WO2003024481A2 - Packaging of immunostimulatory substances into virus-like particles: method of preparation and use - Google Patents

Packaging of immunostimulatory substances into virus-like particles: method of preparation and use Download PDF

Info

Publication number
WO2003024481A2
WO2003024481A2 PCT/IB2002/004132 IB0204132W WO03024481A2 WO 2003024481 A2 WO2003024481 A2 WO 2003024481A2 IB 0204132 W IB0204132 W IB 0204132W WO 03024481 A2 WO03024481 A2 WO 03024481A2
Authority
WO
WIPO (PCT)
Prior art keywords
virus
composition
particle
antigen
unmethylated cpg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2002/004132
Other languages
French (fr)
Other versions
WO2003024481A3 (en
Inventor
Martin F. Bachmann
Tazio Storni
Patrick Maurer
Alain Tissot
Katrin Schwarz
Edwin Meijerink
Gerad Lipowsky
Paul Pumpens
Indulis Cielens
Regina Renhofa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cytos Biotechnology AG
Original Assignee
Cytos Biotechnology AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2003528575A priority Critical patent/JP4516748B2/en
Priority to AU2002339224A priority patent/AU2002339224B2/en
Priority to AT02777600T priority patent/ATE447967T1/en
Priority to HK04110189.6A priority patent/HK1067058B/en
Priority to CA2492826A priority patent/CA2492826C/en
Priority to CN028179358A priority patent/CN1599623B/en
Priority to DK02777600.4T priority patent/DK1450856T3/en
Priority to EP02777600A priority patent/EP1450856B1/en
Application filed by Cytos Biotechnology AG filed Critical Cytos Biotechnology AG
Priority to DE60234375T priority patent/DE60234375D1/en
Publication of WO2003024481A2 publication Critical patent/WO2003024481A2/en
Anticipated expiration legal-status Critical
Publication of WO2003024481A3 publication Critical patent/WO2003024481A3/en
Priority to AU2009200115A priority patent/AU2009200115B2/en
Ceased legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001103—Receptors for growth factors
    • A61K39/001104—Epidermal growth factor receptors [EGFR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001103—Receptors for growth factors
    • A61K39/001106—Her-2/neu/ErbB2, Her-3/ErbB3 or Her 4/ErbB4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001102—Receptors, cell surface antigens or cell surface determinants
    • A61K39/001129—Molecules with a "CD" designation not provided for elsewhere
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001148—Regulators of development
    • A61K39/00115—Apoptosis related proteins, e.g. survivin or livin
    • A61K39/001151—Apoptosis related proteins, e.g. survivin or livin p53
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001154—Enzymes
    • A61K39/001156—Tyrosinase and tyrosinase related proteinases [TRP-1 or TRP-2]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001169—Tumor associated carbohydrates
    • A61K39/001171—Gangliosides, e.g. GM2, GD2 or GD3
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/00118—Cancer antigens from embryonic or fetal origin
    • A61K39/001182—Carcinoembryonic antigen [CEA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/001184—Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K39/001186—MAGE
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/00119—Melanoma antigens
    • A61K39/001191—Melan-A/MART
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A61K39/00119—Melanoma antigens
    • A61K39/001192—Glycoprotein 100 [Gp100]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A61P31/06—Antibacterial agents for tuberculosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/04—Amoebicides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5258—Virus-like particles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6075—Viral proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
    • C12N2710/22022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/22011—Polyomaviridae, e.g. polyoma, SV40, JC
    • C12N2710/22023—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00—Reverse transcribing DNA viruses
    • C12N2730/00011—Details
    • C12N2730/10011—Hepadnaviridae
    • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10123—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/00034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/18011—Details ssRNA Bacteriophages positive-sense
    • C12N2795/18111—Leviviridae
    • C12N2795/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention is related to the fields of vaccinology, immunology and medicine.
  • the invention provides compositions and methods for enhancing immunological responses against virus-like particles (VLPs) or against antigens coupled, fused or attached otherwise to VLPs by packaging immunostimulatory substances, in particular immunostimulatory nucleic acids, and even more particular oligonucleotides containing at least one non-methylated CpG sequence, into the VLPs.
  • the invention can be used to induce strong and sustained T cell responses particularly useful for the treatment of tumors and chronic viral diseases as well as allergies and other chronic diseases.
  • lymphocytes are the key players of the adaptive immune system. Each lymphocyte expresses antigen-receptors of unique specificity. Upon recognizing an antigen via the receptor, lymphocytes proliferate and develop effector function. Few lymphocytes exhibit specificity for a given antigen or pathogen, and massive proliferation is usually required before an effector response can be measured - hence, the slow kinetics of the adaptive immune system. Since a significant proportion of the expanded lymphocytes survive and may maintain some effector function following elimination of the antigen, the adaptive immune system reacts faster when encountering the antigen a second time. This is the basis of its ability to remember.
  • LPS lipopolysaccharides
  • CpG non-methylated CG-rich DNA
  • RNA double stranded RNA
  • CTL cytotoxic T lymphocyte
  • Th cells T helper cells
  • CD40L CD40- ligand
  • B cells B cells
  • macrophages CD40- ligand
  • DCs dendritic cells
  • Triggering of CD40 on B cells is essential for isotype switching and the generation of B cell memory (Foy, T. M., et al, Ann. Rev. Immunol. 14:591 (1996)).
  • stimulation of CD40 on macrophages and DCs leads to their activation and maturation (Cella, M., et al, Curr. Opin. Immunol.
  • Th cells have to recognize their ligands on the same APC as the CTLs, indicating that a cognate interaction is required (Bennett, S. R. M., et al, J. Exp. Med. 186:65 (1997)).
  • CD40L- mediated stimulation by Th cells leads to the activation of DCs, which subsequently are able to prime CTL-responses.
  • type I interferons in particular interferon ⁇ and ⁇ may be equally important as IL-12.
  • viruses are often able to induce protective CTL-responses in the absence of T help (for review, see (Bachmann, M. F., et al, J.
  • lymphocytic choriomeningitis virus (LCMV) (Leist, T. P., et al, J. Immunol 138:2278 (1987); Ahmed, R., et al, J. Virol. 62:2102 (1988); Battegay, M., et al, Cell Immunol. 167:115 (1996); Borrow, P., et al, J. Exp. Med. 183:2129 (1996); hifrnire, J. K., et al, J. Virol. 70:8375 (1996)), vesicular stomatitis virus (VSV) (K ⁇ ndig, T.
  • VSV vesicular stomatitis virus
  • DCs have recently been shown to present influenza derived antigens by cross-priming (Albert, M. L., et al, J. Exp. Med. 188:1359 (1998); Albert, M. L., et al, Nature 392:86 (1998)). It is therefore possible that, similarly as shown for minor histocompatibility antigens and tumor antigens (Ridge, J. P., et al, Nature 393:474 (1998); Bennett, S. R.
  • Th cells may assist induction of CTLs via CD40 triggering on DCs.
  • stimulation of CD40 using CD40L or anti-CD40 antibodies may enhance CTL induction after stimulation with viruses or tumor cells.
  • CD40L is an important activator of DCs, there seem to be additional molecules that can stimulate maturation and activation of DCs during immune responses.
  • CD40 is not measurably involved in the induction of CTLs specific for LCMV or VSV (Ruedl, C, et al, J. Exp. Med. 189:1875 (1999)).
  • VSV-specific CTL responses are partly dependent upon the presence of CD4 + T cells (Kundig, T. M., et al, Immunity 5:41 (1996)), this helper effect is not mediated by CD40L.
  • Candidates for effector molecules triggering maturation of DCs during immune responses include Trance and TNF ⁇ (Bachmann, M. F., et al, J. Exp. Med. 189:1025 (1999); Sallusto, F., and A. Lanzavecchia, J Exp Med 179:1109 (1994)).
  • viruses induce prompt and efficient immune responses in the absence of any adjuvants both with and without T-cell help (Bachmann & Zinkernagel, Ann. Rev. Immunol 75:235-270 (1997)). Although viruses often consist of few proteins, they are able to trigger much stronger immune responses than their isolated components. For B cell responses, it is known that one crucial factor for the immunogenicity of viruses is the repetitiveness and order of surface epitopes.
  • Viral structure is even linked to the generation of anti-antibodies in autoimmune disease and as a part of the natural response to pathogens (see Fehr, T., et al, J. Exp. Med. 185:1785-1792 (1997)).
  • antigens on viral particles that are organized in an ordered and repetitive array are highly immunogenic since they can directly activate B cells.
  • cytotoxic T cell response In addition to strong B cell responses, viral particles are also able to induce the generation of a cytotoxic T cell response, another crucial arm of the immune system. These cytotoxic T cells are particularly important for the elimination of non-cytopathic viruses such as HIV or Hepatitis B virus and for the eradication of tumors. Cytotoxic T cells do not recognize native antigens but rather recognize their degradation products in association with MHC class I molecules (Townsend & Bodmer, Ann. Rev. Immunol. 7:601-624 (1989)).
  • Macrophages and dendritic cells are able to take up and process exogenous viral particles (but not their soluble, isolated components) and present the generated degradation product to cytotoxic T cells, leading to their activation and proliferation (Kovacsovics-Bankowski et al, Proc. Natl. Acad. Sci. USA 90:4942-4946 (1993); Bachmann et al, Eur. J. Immunol. 26:2595-2600 (1996)).
  • Viral particles as antigens exhibit two advantages over their isolated components: (1) due to their highly repetitive surface structure, they are able to directly activate B cells, leading to high antibody titers and long-lasting B cell memory; and (2) viral particles, but not soluble proteins, have the potential to induce a cytotoxic T cell response, even if the viruses are non- infectious and adjuvants are absent.
  • 5,871,747 which discloses synthetic polymer particles carrying on the surface one or more proteins covalently bonded thereto; and a core particle with a non-covalently bound coating, which at least partially covers the surface of said core particle, and at least one biologically active agent in contact with said coated core particle (see, e.g., WO 94/15585).
  • VLPs virus-like particles
  • a virus-like particle is being exploited in the area of vaccine production because of both their structural properties and their non-infectious nature.
  • VLPs are supermolecular structures built in a symmetric manner from many protein molecules of one or more types. They lack the viral genome and, therefore, are noninfectious. VLPs can often be produced in large quantities by heterologous expression and can be easily be purified.
  • CpG non-methylated CG motifs
  • DNA oligomers rich in CpG motifs can exhibit immunostimulatory capacity, their efficiency is often limited, since they are unstable in vitro and in vivo. Thus, they exhibit unfavorable pharmacokinetics. In order to render CpG-oligonucleotides more potent, it is therefore usually necessary to stabilize them by introducing phosphorothioate modifications of the phosphate backbone.
  • CpG-oligonucleotides to stimulate immune responses are their lack of specificity, since all APCs and B cells in contact with CpG-oligonucleotides become stimulated.
  • the efficiency and specificity of CpG-oligonucleotides may be improved by stabilizing them or packaging them in a way that restricts cellular activation to those cells that also present the relevant antigen.
  • immunostimulatory CpG-oligodeoxynucleotides induce strong side effects by causing extramedullary hemopoiesis accomponied by splenomegaly and lymphadenopathy in mice (Sparigan et al., J. Immunol. (1999), 162:2368-74 and Example 18).
  • VLPs have been shown to be efficiently presented on MHC class I molecules as they, presumably after uptake by macropinocytosis, are efficiently processed and crossprimed onto MHC class I.
  • the mechanism of crosspriming is not clear to date, but TAP-dependent and TAP-independent pathways have been proposed.
  • This invention is based on the surprising finding that immunostimulatory substances such as DNA oligonucleotides can be packaged into VLPs which renders them more immunogenic.
  • the nucleic acids and oligonucleotides, respectively, present in VLPs can be replaced specifically by the immunostimulatory substances and DNA- oligonucleotides containing CpG motifs, respectively.
  • these packaged immunostimulatory substances in particular immunostimulatory nucleic acids such as unmethylated CpG-containing oligonucleotides retained their immunostimulatory capacity without widespread activation of the innate immune system.
  • compositions comprising VLP's and the immunostimulatory substances in accordance with the present invention, and in particular the CpG- VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses.
  • the immune response against antigens optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself.
  • the T cell responses against both the VLPs and antigens are especially directed to the Thl type.
  • Antigens attached to CpG- loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.
  • the invention provides a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance, preferably an immunostimulatory nucleic acid, an even more preferably an unmethylated CpG-containing oligonucleotide, where the substance, nucleic acid or oligonucleotide is coupled, fused, or otherwise attached to or enclosed by, i.e., bound, to the virus-like particle.
  • the composition further comprises an antigen bound to the virus-like particle.
  • the immunostimulatory nucleic acids in particular the unmethylated CpG-containing oligonucleotides are stabilized by phosphorothioate modifications of the phosphate backbone.
  • the immunostimulatory nucleic acids, in particular the unmethylated CpG-containing oligonucleotides are packaged into the VLPs by digestion of RNA within the VLPs and simultaneous addition of the DNA oligonucleotides containing CpGs of choice.
  • the VLPs can be disassembled before they are reassembled in the presence of CpGs.
  • the immunostimulatory nucleic acids do not contain CpG motifs but nevertheless exhibit immunostimulatory activities.
  • Such nucleic acids are described in WO 01/22972. All sequences described therein are hereby incorporated by way of reference.
  • the virus-like particle is a recombinant virus-like particle.
  • the virus-like particle is free of a lipoprotein envelope.
  • the recombinant virus-like particle comprises, or alternatively consists of, recombinant proteins of Hepatitis B virus, BK virus or other human Polyoma virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth-Disease virus, Retrovirus, Norwalk virus or human Papilloma virus, RNA-phages, Q ⁇ -phage, GA-phage, fr-phage and Ty.
  • the virus-like particle comprises, or alternatively consists of, one or more different Hepatitis B virus core (capsid) proteins (HBcAgs).
  • the virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.
  • Preferred RNA- phages are Q ⁇ -phage, AP 205-phage, GA-phage, fr-phage
  • the antigen is a recombinant antigen.
  • the antigen can be selected from the group consisting of: (1) a polypeptide suited to induce an immune response against cancer cells; (2) a polypeptide suited to induce an immune response against infectious diseases; (3) a polypeptide suited to induce an immune response against allergens; (4) a polypeptide suited to induce an improved response against self-antigens; and (5) a polypeptide suited to induce an immune response in farm animals or pets.
  • the antigen can be selected from the group consisting of: (1) an organic molecule suited to induce an immune response against cancer cells; (2) an organic molecule suited to induce an immune response against infectious diseases; (3) an organic molecule suited to induce an immune response against allergens; (4) an organic molecule suited to induce an improved response against self-antigens; (5) an organic molecule suited to induce an immune response in farm animals or pets; and (6) an organic molecule suited to induce a response against a drug, a hormone or a toxic compound.
  • the antigen comprises, or alternatively consists of, a cytotoxic T cell epitope.
  • the virus-like particle comprises the Hepatitis B virus core protein and the cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein, h one embodiment, they are fused by a leucine linking sequence.
  • a method of enhancing an immune response in a human or other animal species comprising introducing into the animal a composition comprising a virus-like particle and immunostimulatory substance, preferably an immunostimulatory nucleic acid, an even more preferably an unmethylated CpG-containing oligonucleotide where the substance, preferably the nucleic acid, and even more preferally the oligonucleotide is bound (i.e. coupled, attached or enclosed) to the virus-like particle.
  • the composition further comprises an antigen bound to the virus-like particle.
  • the composition is introduced into an animal subcutaneously, intramuscularly, intranasally, intradermally, intravenously or directly into a lymph node.
  • the immune enhancing composition is applied locally, near a tumor or local viral reservoir against which one would like to vaccinate.
  • the immune response is a T cell response, and the T cell response against the antigen is enhanced.
  • the T cell response is a cytotoxic T cell response, and the cytotoxic T cell response against the antigen is enhanced.
  • the present invention also relates to a vaccine comprising an immunologically effective amount of the immune enhancing composition of the present invention together with a pharmaceutically acceptable diluent, carrier or excipient.
  • the vaccine further comprises at least one adjuvant, such as incomplete Freund's adjuvant.
  • the invention also provides a method of immunizing and/or treating an animal comprising administering to the animal an immunologically effective amount of the disclosed vaccine.
  • the immunostimulatory substance-containing VLPs preferably the immunostimulatory nucleic acid- containing VLP's, an even more preferably the unmethylated CpG-containing oligonucleotide VLPs are used for vaccination of animals or humans against the VLP itself or against antigens coupled, fused or attached otherwise to the VLP.
  • the modified VLPs can be used to vaccinate against tumors, viral diseases, self-molecules and self antigens, respectively, or non-peptidic small molecules, for example.
  • the vaccination can be for prophylactic or therapeutic purposes, or both.
  • the modified VLPs can be used to vaccinate against allergies in order to induce immune-deviation.
  • the desired immune response will be directed against antigens coupled, fused or attached otherwise to the immunostimulatory substance-containing VLPs, preferably the immunostimulatory nucleic acid-containing VLP's, an even more preferably the unmethylated CpG-containing oligonucleotide VLPs.
  • the antigens can be peptides, proteins, domains, carbohydrates or small molecules such as, for example, steroid hormones or drugs, such as nicotine.
  • the desired immune response can be directed against the VLP itself. This latter application will be used in cases where the VLP originates from a virus against which one would like to vaccinate.
  • the route of injection is preferably subcutaneous or intramuscular, but it would also be possible to apply the CpG-containing VLPs intradermally, intranasally, intravenously or directly into the lymph node.
  • the CpG-containing antigen-coupled or free VLPs are applied locally, near a tumor or local viral reservoir against which one would like to vaccinate.
  • Figure 1 shows the DNA sequence of the CpG-oligonucleotide (A) and the DNA sequence of the peptide p33-containing VLP derived from hepatitis B core (B).
  • the nonameric p33 epitope is genetically fused to the C-terminus of the hepatitis B core protein at position 185 via a three leucine linking sequence.
  • Figure 2 shows the structure of the p33-VLPs as assessed by electron microscopy (A) and SDS PAGE (B).
  • Recombinantly produced wild-type VLPs (composed of HBcAg [aa 1-185] monomers) and p33-VLPs were loaded onto a Sephacryl S-400 gel filtration column (Amersham Pharmacia Biotechnology AG) for purification. Pooled fractions were loaded onto a Hydroxyapatite column. Flow through (which contains purified HBc capsids) was collected and loaded onto a reducing SDS-PAGE gel for monomer molecular weight analysis (B).
  • Figure 3 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after control incubation or after digestion with RNase A upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA or protein.
  • Recombinantly produced p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lane 2) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C.
  • the samples were subsequently complemented with 6-fold concentrated DNA-loading buffer (MBS Fermentas GmbH, Heidelberg, Germany) and run for 30 min at 100 volts in a 1% native agarose gel.
  • the Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA packaged in p33-VLPs (A) or p33-VLP capsids themselves (B). Identical results were obtained in 3 independent experiments.
  • Figure 4 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after control incubation or after digestion with RNase A in the presence of buffer only or CpG-containing DNA-oligomers upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA/DNA or protein.
  • Recombinant p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lane 2 and 3) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C.
  • Figure 5 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) before and after digestion with RNase A in the presence of CpG- containing DNA-oligomers and subsequent dialysis (for the elimination of VLP-unbound CpG DNA) upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of DNA or protein.
  • A ethidium bromide
  • B Coomassie blue
  • Recombinant p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in absence (lane 1) or in presence (lanes 2 to 5) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C. 50 nmol CpG-oligonucleotides (containing phosphorothioate modification of the phosphate backbone: lanes 2 and 3, containing phosphodiester bonds: lanes 4 and 5) were added to VLPs before RNase A digestion.
  • Treated samples were extensively dialysed for 24 hours against PBS (4500-fold dilution) with a 300 kDa MWCO dialysis membrane (Spectrum Medical Industries Inc., Houston, USA) to eliminate the in excess DNA (lanes 3 and 5).
  • the Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA or CpG- oligonucleotides in p33-VLPs (A) or p33-VLP capsids themselves (B).
  • Figure 6 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after control incubation or after digestion with RNase A where CpG- containing oligonucleotides were added only after completing the RNA digestion upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA/DNA or protein.
  • Recombinant p33- VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lane 2 and 3) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C.
  • Figure 7 shows that p33-VLPs packaged with CpG-oligonucleotides (containing phosphorothioate modification of the phosphate backbone), are effective at inducing viral protection.
  • Mice were subcutaneously primed with 100 ⁇ g p33-VLP alone, mixed with 20 nmol CpG-oligonucleotide (p33- VLP+CpG) or p33-VLP packaged with CpG-oligonucleotide after dialysis of free CpG-oligonucleotide (p33-VLP/CpG). Untreated naive mice served as negative control.
  • mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immunology Methods Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, NY (1997) p. 1921.
  • Figure 8 shows that p33-VLPs packaged with CpG-oligonucleotide (containing phosphodiester bonds) are effective at inducing viral protection.
  • Mice were subcutaneously primed with 100 ⁇ g p33-VLP alone, mixed with 20 nmol CpG-oligonucleotides (p33-VLP+CpG) or p33-VLPs packaged with CpG-oligonucleotides after dialysis of free CpG-oligonucleotides) (p33- VLP/CpG). Untreated na ⁇ ve mice served as negative control.
  • mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immunology Methods Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, NY (1997) p. 1921.
  • FIG. 9 shows that mice treated with CpG-oligonucleotides alone are not protected from viral infection.
  • Mice were subcutaneously primed with 20 nmol CpG-oligonucleotides (CpG), or left untreated as negative control (naive). Twenty-one days later, mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immunology Methods Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, NY (1997) p. 1921.
  • Figure 10 shows the amino acid sequence of the BKV (AS) VP1 protein (GL332779). This sequence was expressed in yeast to produce BKV capsids (Sasnauskas K. et al, J. Biol Chem 380(3):381 (1999); K. et al, Generation of recombinant virus-like particles of different polyomaviruses in yeast. 3 rd International Workshop "Virus-like particles as vaccines” Berlin, (2001)).
  • Figure 11 shows the DNA sequence of the 246 bp double stranded DNA fragment used for packaging and stabilization of BKV VLPs.
  • Figure 12 shows BKV VLPs (15 ⁇ g) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with fluorescent phosphorothioate (pt) CpG- oligonucleotides.
  • UV excitation leads to detection of DNA in an ethidium bromide stained gel (A) and to fluorescence of CpG-FAM oligomers in the absence of ethidium bromide (B).
  • Lane 1 BKV VLPs untreated; lane 2: BKV VLPs RNase A treated; lane 3: BKV VLPs RNase A treated with CpG(pt)- FAM; lane 4: BKV VLPs RNase A treated with CpG(pt)-FAM plus DNasel treatment; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany). Arrows are indicating the presence of RNA or CpG- FAM oligomers in BKV VLPs.
  • FIG. 13 shows BKV VLPs (15 ⁇ g) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with double stranded (ds) DNA (246 bp) upon staining with ethidium bromide (A) or Coomassie Blue (B).
  • Lane 1 BKV VLPs untreated;
  • lane 2 BKV VLPs RNase A treated;
  • lane 3 BKV VLPs treated with RNase A and incubated with ds DNA;
  • lane M Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany). Arrows indicate the presence of RNA or ds DNA in BKV VLPs.
  • Figure 14 shows BKV VLPs (15 ⁇ g) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with CpG-oligonucleotides (with phosphate- or with phosphorothioate (pt) backbone) upon staining with ethidium bromide (A) or Coomassie Blue (B).
  • Lane 1 BKV VLPs stock (PBS/50% glycerol); lane 2: BKV VLPs untreated (PBS buffer); lane 3: BKV VLPs RNase A treated; lane 4: BKV VLPs RNase A treated post- dialysis; lane 5: BKV VLPs RNase A treated with CpG-oligonucleotides; lane 6: BKV VLPs RNase A treated with CpG(pt)-oligomers; lane 7: BKV VLPs RNase A treated with CpG(pt)- oligomers post-dialysis; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany). Arrows indicate the presence of RNA or CpG-oligonucleotides in BKV VLPs.
  • Figure 15 shows mouse IgGl and IgG2a OD50% antibody titers to BKV VLPs on day 14 after immunization with BKV VLPs and phosphorothioate (pt) CpG-oligonucleotides.
  • Lane 1 RNase treated BKV VLPs
  • lane 2 RNase treated BKV VLPs in combination with 0.3 nmol CpG(pt)-oligomer
  • lane 3 RNase treated BKV VLPs in combination with 20 nmol CpG(pt)-oligomer
  • lane 4 RNase treated BKV VLPs containing 0.3 nmol CpG(pt)-oligomer.
  • Figure 16 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after confrol incubation or after digestion with RNase A where linear double-stranded DNA (350 base pairs long) was added only after completing the RNA digestion upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA DNA or protein.
  • Recombinant p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lanes 2, 3 and 4) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C.
  • Linear double-stranded DNA of 350 bp in length was added to sample 3 and 4 only after the RNase A digestion to a final concentration of 100 ng/ml and incubated for 3 hours at 37 °C.
  • Sample 4 was further digested with DNase I (50 IU/ml)(Sigma, Division of Fluka AG, Switzerland) for additional 3 hours at 37 °C.
  • the Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA/dsDNA free or enclosed in p33-VLPs (A) and p33-VLPs (B).
  • Figure 17 shows packaging of B-CpG into HBc33 VLPs.
  • Figure 18 shows packaging of NKCpG into HBc33 VLPs.
  • Figure 19 shows packaging of glOgacga-PO into HBc33 VLPs.
  • Figure 20 shows packaging of CyCpG-150 into HBc33 VLPs.
  • Figure 21 shows packaging of NKCpGpt into HBcPl A VLPs.
  • Figure 22 shows coupling of p33 to HBcAg VLPs.
  • Figure 23 shows packaging of B-CpGpt into HBx33 VLPs.
  • Figure 24 shows coupling of p33 to Q ⁇ VLPs.
  • Figure 25 shows ionic strength and low protein concentration allow RNA hydrolysis by RNase A in Q ⁇ VLPs.
  • Figure 26 shows ionic strength increases immunostimulatory nucleic acid packaging into Q ⁇ VLPs.
  • Figure 27 shows packaging of B-CpGpt, glOgacga-PO and dsCyCpG into Qbx33 VLPs.
  • Figure 28 shows SDS-PAGE analysis of the fractions from the sucrose gradient centrifugation after Q ⁇ VLP disassembly and reassembly in the presence of immunostimulatory nucleic acids.
  • Figure 29 shows electron micrographs of Q ⁇ VLP after disassembly and reassembly in the presence of oligonucleotide (CpG) 20 OpA.
  • Figure 30 shows ouchterlony analysis (immunodiffusion) of the diassembled and reassembled Q ⁇ VLP.
  • Figure 31 shows gelelectrophoretic analysis of dissassembled and reassembled Q ⁇ VLP.
  • Figure 32 shows electron micrographs of the dissassembled and reassembled Q ⁇ VLP with the oligonucleotide CyOpA.
  • Figure 33' shows electron micrographs of the purified dissassembled and reassembled Q ⁇ VLP with the different immunostimulatory nucleic acids.
  • Figure 34 shows SDS-PAGE analysis of the coupling of Q/3 VLP reassembled with the oligodeoxynucleotide CyOpA to the p33GGC peptide.
  • Figure 35 shows packaged oligodeoxynucleotides after disassembly and reassembly of Q ⁇ VLPs and subsequent coupling to p33 GGC peptide.
  • Figure 36 shows purification of disassembled Q ⁇ coat protein by size exclusion chromatography.
  • Figure 37 shows purification of reassembled Q ⁇ VLPs by size exclusion chromatography.
  • Figure 38 shows electron micrographs of Q ⁇ VLPs that were reassembled in the presence of different oligodeoxynucleotides.
  • Figure 39 shows analysis of the disulfide-bond pattern in reassembled and purified Q ⁇ capsids.
  • Figure 40 shows analysis of nucleic acid content of the reassembled Q ⁇ VLPs by nuclease treatment and agarose gelelectrophoresis.
  • Figure 41 shows analysis of nucleic acid content of the reassembled Q ⁇ VLPs by proteinase K treatment and polyacrylamide TBE Urea gelelectrophoresis .
  • Figure 42 shows electron micrographs AP205 VLP disassembled and subsequently reassembled in the presence of CyCpG.
  • Figure 43 shows agarose gel-electrophoresis analysis of AP205 VLPs diassembled and reassembled in the presence of CyCpG.
  • Figure 44 shows electron micrograph of disassembled and reassembled AP205.
  • Figure 45 shows Agarose gel-electrophoresis analysis of AP205 VLPs diassembled and reassembled in the presence of CyCpG.
  • Figure 46 shows SDS-PAGE analysis of disassembled and reassembled AP205 VLPs.
  • Figure 47 shows SDS-PAGE analysis of the peptide coupling to disassembled and reassembled AP205 VLPs.
  • Figure 48 shows free immunostimulatory nucleic acids but not immunostimulatory nucleic acids packaged in VLPs induce splenomegaly.
  • Figure 49 shows different immunostimulatory nucleic acids packaged in VLP fused to antigen result in a potent antigen-specific CTL response and virus protection.
  • Figure 50 shows the immunostimulatory nucleic acid glOgacga-PS packaged in VLP fused to antigen result in a potent antigen-specific CTL response and virus protection.
  • Figure 51 shows immunostimulatory nucleic acids packaged in HBcAg and Q ⁇ VLPs result in a potent antigen-specific CTL response and virus protection.
  • Figure 52 shows immunostimulatory nucleic acids packaged in VLPs are even more efficient in inducing CTL responses than VLPs mixed with immunostimulatory nucleic acids.
  • Figure 53 shows analysis of non-enzymatic RNA hydrolysis of the RNA in Q ⁇ VLPs.
  • Figure 54 shows packaging of oligodeoxynucleotides into Q ⁇ VLPs after non-enzymatic RNA hydrolysis.
  • Figure 55 shows analysis of packaging of oligodeoxynucleotides into Q ⁇ VLPs after non-enzymatic RNA hydrolysis.
  • Amino acid linker An "amino acid linker”, or also just termed “linker” within this specification, as used herein, either associates the antigen or antigenic determinant with the second attachment site, or more preferably, already comprises or contains the second attachment site, typically - but not necessarily - as one amino acid residue, preferably as a cysteine residue.
  • amino acid linker does not intend to imply that such an amino acid linker consists exclusively of amino acid residues, even if an amino acid linker consisting of amino acid residues is a preferred embodiment of the present invention.
  • amino acid residues of the amino acid linker are, preferably, composed of naturally occuring amino acids or unnatural amino acids known in the art, all-L or all-D or mixtures thereof.
  • an amino acid linker comprising a molecule with a sulfhydryl group or cysteine residue is also encompassed within the invention.
  • Such a molecule comprise preferably a C1-C6 alkyl-, cycloalkyl (C5,C6), aryl or heteroaryl moiety.
  • a linker comprising preferably a C1-C6 alkyl-, cycloalkyl- (C5,C6), aryl- or heteroaryl- moiety and devoid of any amino acid(s) shall also be encompassed within the scope of the invention.
  • Association between the antigen or antigenic determinant or optionally the second attachment site and the amino acid linker is preferably by way of at least one covalent bond, more preferably by way of at least one peptide bond.
  • animal As used herein, the term “animal” is meant to include, for example, humans, sheep, horses, cattle, pigs, dogs, cats, rats, mice, mammals, birds, reptiles, fish, insects and arachnids.
  • Antibody refers to molecules which are capable of binding an epitope or antigenic determinant.
  • the term is meant to include whole antibodies and antigen-binding fragments thereof, including single-chain antibodies.
  • the antibodies are human antigen binding antibody fragments and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a V or V H domain.
  • the antibodies can be from any animal origin including birds and mammals.
  • the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse or chicken.
  • human antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described, for example, in U.S. Patent No. 5,939,598 by Kucherlapati et al.
  • Antigen refers to a molecule capable of being bound by an antibody or a T cell receptor (TCR) if presented by MHC molecules.
  • TCR T cell receptor
  • An antigen is additionally capable of being recognized by the immune system and/or being capable of inducing a humoral immune response and/or cellular immune response leading to the activation of B- and/or T- lymphocytes. This may, however, require that, at least in certain cases, the antigen contains or is linked to a Th cell epitope and is given in adjuvant.
  • An antigen can have one or more epitopes (B- and T- epitopes). The specific reaction referred to above is meant to indicate that the antigen will preferably react, typically in a highly selective manner, with its corresponding antibody or TCR and not with the multitude of other antibodies or TCRs which may be evoked by other antigens.
  • a "microbial antigen” as used herein is an antigen of a microorganism and includes, but is not limited to, infectious virus, infectious bacteria, parasites and infectious fungi. Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic or recombinant compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism. A compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen. Such antigens are used routinely in the art and are well known to the skilled artisan.
  • Retro viridae e.g. human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-HI/LAV, or H ⁇ V-II ⁇ ); and other isolates, such as HIV-LP
  • Picornaviridae e.g. polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses
  • Calciviridae e.g. strains that cause gastroenteritis
  • Togaviridae e.g. equine encephalitis viruses, rubella viruses
  • Flaviridae e.g.
  • Coronoviridae e.g. coronaviruses
  • Rhabdoviradae e.g. vesicular stomatitis viruses, rabies viruses
  • Filoviridae e.g. ebola viruses
  • Paramyxoviridae e.g. parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus
  • Orthomyxoviridae e.g. influenza viruses
  • Bungaviridae e.g. Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses
  • Arena viridae hemorrhagic fever viruses
  • Reoviridae e.g.
  • reoviruses reoviruses, orbiviurses and rotaviruses
  • Birnaviridae Hepadnaviridae (Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (he ⁇ es simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), he ⁇ es virus); Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. African swine fever virus); and unclassified viruses (e.g.
  • Both gram negative and gram positive bacteria serve as antigens in vertebrate animals.
  • Such gram positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species and Streptococcus species.
  • Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species.
  • infectious bacteria include but are not limited to: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps. (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M.
  • infectious fungi examples include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis and Candida albicans.
  • Other infectious organisms i.e., protists
  • Plasmodium such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, Plasmodium vivax, Toxoplasma gondii and Shistosoma.
  • compositions and methods of the invention are also useful for treating cancer by stimulating an antigen-specific immune response against a cancer antigen.
  • a "tumor antigen” as used herein is a compound, such as a peptide, associated with a tumor or cancer and which is capable of provoking an immune response.
  • the compound is capable of provoking an immune response when presented in the context of an MHC molecule.
  • Tumor antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen, et al, Cancer Research, 54:1055 (1994), by partially purifying the antigens, by recombinant technology or by de novo synthesis of known antigens.
  • Tumor antigens include antigens that are antigenic portions of or are a whole tumor or cancer polypeptide. Such antigens can be isolated or prepared recombinantly or by any other means known in the art. Cancers or tumors include, but are not limited to, biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g.
  • melanoma neuroblastomas
  • oral cancer ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas.
  • Antigenic determinant As used herein, the term “antigenic determinant” is meant to refer to that portion of an antigen that is specifically recognized by either B- or T-lymphocytes. B-lymphocytes respond to foreign antigenic determinants via antibody production, whereas T-lymphocytes are the mediator of cellular immunity. Thus, antigenic determinants or epitopes are those parts of an antigen that are recognized by antibodies, or in the context of an MHC, by T-cell receptors.
  • Antigen presenting cell is meant to refer to a heterogenous population of leucocytes or bone marrow derived cells which possess an immunostimulatory capacity. For example, these cells are capable of generating peptides bound to MHC molecules that can be recognized by T cells.
  • the term is synonymous with the term “accessory cell” and includes, for example, Langerhans' cells, interdigitating cells, B cells, macrophages and dendritic cells. Under some conditions, epithetral cells, endothelial cells and other, non-bone marrow derived cells may also serve as antigen presenting cells.
  • association refers to the binding of the first and second attachment sites that is preferably by way of at least one non-peptide bond.
  • the nature of the association may be covalent, ionic, hydrophobic, polar or any combination thereof, preferably the nature of the association is covalent.
  • first attachment site refers to an element of non-natural or natural origin, to which the second attachment site located on the antigen or antigenic determinant may associate.
  • the first attachment site may be a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a combination thereof, or a chemically reactive group thereof.
  • the first attachment site is located, typically and preferably on the surface, of the virus-like particle. Multiple first attachment sites are present on the surface of virus-like particle typically in a repetitive configuration.
  • the phrase "second attachment site” refers to an element associated with the antigen or antigenic determinant to which the first attachment site located on the surface of the virus-like particle may associate.
  • the second attachment site of the antigen or antigenic determinant may be a protein, a polypeptide, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a combination thereof, or a chemically reactive group thereof.
  • At least one second attachment site is present on the antigen or antigenic determinant.
  • antigen or antigenic determinant with at least one second attachment site refers, therefore, to an antigen or antigenic construct comprising at least the antigen or antigenic determinant and the second attachment site.
  • these antigen or antigenic constructs comprise an "amino acid linker".
  • bound refers to binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc.
  • Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon- sulfur bonds, carbon-phosphorus bonds, and the like.
  • the term also includes the enclosement, or partial enclosement, of a substance.
  • bound is broader than and includes terms such as “coupled,” “fused,” “enclosed”, “packaged” and “attached.”
  • immunostimulatory substance such as the unmethylated CpG-containing oligonucleotide can be enclosed by the VLP without the existence of an actual binding, neither covalently nor non-covalently.
  • Coat protein(s) refers to the protein(s) of a bacteriophage or a RNA-phage capable of being inco ⁇ orated within the capsid assembly of the bacteriophage or the RNA-phage.
  • the term "CP” is used.
  • the specific gene product of the coat protein gene of RNA-phage Q ⁇ is referred to as "Q ⁇ CP”
  • the "coat proteins” of bacteriophage Q ⁇ comprise the "Q ⁇ CP” as well as the Al protein.
  • the capsid of Bacteriophage Q ⁇ is composed mainly of the Q ⁇ CP, with a minor content of the Al protein.
  • the VLP Q ⁇ coat protein contains mainly Q ⁇ CP, with a minor content of Al protein.
  • Coupled As used herein, the term “coupled” refers to attachment by covalent bonds or by strong non-covalent interactions. Any method normally used by those skilled in the art for the coupling of biologically active materials can be used in the present invention.
  • Fusion refers to the combination of amino acid sequences of different origin in one polypeptide chain by in-frame combination of their coding nucleotide sequences.
  • the term “fusion” explicitly encompasses internal fusions, i.e., insertion of sequences of different origin within a polypeptide chain, in addition to fusion to one of its termini.
  • CpG refers to an oligonucleotide which contains an unmethylated cytosine, guanine dinucleotide sequence (e.g. "CpG DNA” or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates/activates, e.g. has a mitogenic effect on, or induces or increases cytokine expression by, a vertebrate cell.
  • CpGs can be useful in activating B cells, NK cells and antigen-presenting cells, such as monocytes, dendritic cells and macrophages, and T cells.
  • the CpGs can include nucleotide analogs such as analogs containing phosphorothioester bonds and can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single- stranded molecules have increased immune activity.
  • Epitope refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably in a human.
  • An "immunogenic epitope,” as used herein, is defined as a portion of a polypeptide that elicits an antibody response or induces a T-cell response in an animal, as determined by any method known in the art. (See, for example, Geysen et al, Proc. Natl. Acad. Sci. USA ⁇ 7:3998-4002 (1983)).
  • antigenic epitope is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art. Immunospecific binding excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic. Antigenic epitopes can also be T-cell epitopes, in which case they can be bound immunospecifically by a T-cell receptor within the context of an MHC molecule.
  • An epitope can comprise 3 amino acids in a spatial conformation which is unique to the epitope. Generally, an epitope consists of at least about 5 such amino acids, and more usually, consists of at least about 8-10 such amino acids. If the epitope is an organic molecule, it may be as small as Nitrophenyl.
  • Immune response refers to a humoral immune response and/or cellular immune response leading to the activation or proliferation of B- and/or T-lymphocytes. In some instances, however, the immune responses may be of low intensity and become detectable only when using at least one substance in accordance with the invention.
  • Immunogenic refers to an agent used to stimulate the immune system of a living organism, so that one or more functions of the immune system are increased and directed towards the immunogenic agent.
  • An "immunogenic polypeptide” is a polypeptide that elicits a cellular and/or humoral immune response, whether alone or linked to a carrier in the presence or absence of an adjuvant.
  • Immunization refers to conferring the ability to mount a substantial immune response (comprising antibodies or cellular immunity such as effector CTL) against a target antigen or epitope. These terms do not require that complete immunity be created, but rather that an immune response be produced which is substantially greater than baseline. For example, a mammal may be considered to be immunized against a target antigen if the cellular and/or humoral immune response to the target antigen occurs following the application of methods of the invention.
  • Immunostimulatory nucleic acid refers to a nucleic acid capable of inducing and/or enhancing an immune response.
  • Immunostimulatory nucleic acids comprise ribonucleic acids and in particular deoxyribonucleic acids.
  • immunostimulatory nucleic acids contain at least one CpG motif e.g. a CG dinucleotide in which the C is unmethylated.
  • the CG dinucleotide can be part of a palindromic sequence or can be encompassed within a non-palindromic sequence.
  • Immunostimulatory nucleic acids not containing CpG motifs as described above encompass, by way of example, nucleic acids lacking CpG dinucleotides, as well as nucleic acids containing CG motifs with a methylated CG dinucleotide.
  • immunostaimulatory nucleic acid should also refer to nucleic acids that contain modified bases such as 4-bromo-cytosine.
  • Immunostimulatory substance refers to a substance capable of inducing and/or enhancing an immune response.
  • Immunostimulatory substances include, but are not limited to, toll-like receptor activing substances and substances inducing cytokine secretion.
  • Toll-like receptor activating substances include, but are not limited to, immunostimulatory nucleic acids, peptideoglycans, lipopolysaccharides, lipoteichonic acids, imidazoquinoline compounds, flagellins, lipoproteins, and immunostimulatory organic substances such as taxol.
  • Natural origin As used herein, the term “natural origin” means that the whole or parts thereof are not synthetic and exist or are produced in nature.
  • Non-natural As used herein, the term generally means not from nature, more specifically, the term means from the hand of man.
  • Non-natural origin As used herein, the term “non-natural origin” generally means synthetic or not from nature; more specifically, the term means from the hand of man.
  • Ordered and repetitive antigen or antigenic determinant array generally refers to a repeating pattern of antigen or antigenic determinant, characterized by a typically and preferably uniform spacial arrangement of the antigens or antigenic determinants with respect to the core particle and virus-like particle, respectively.
  • the repeating pattern may be a geometric pattern.
  • suitable ordered and repetitive antigen or antigenic determinant arrays are those which possess strictly repetitive paracrystalline orders of antigens or antigenic determinants, preferably with spacings of 0.5 to 30 nanometers, more preferably 5 to 15 nanometers.
  • Oligonucleotide refers to a nucleic acid sequence comprising 2 or more nucleotides, generally at least about 6 nucleotides to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, and more preferably about 6 to about 300 nucleotides, even more preferably about 20 to about 300 nucleotides, and even more preferably about 20 to about 100 nucleotides.
  • oligonucleotide or “oligomer” also refer to a nucleic acid sequence comprising more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
  • Oligonucleotide also generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • Oligonucleotide includes, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-sfranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • oligonucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • an oligonucleotide can be synthetic, genomic or recombinant, e.g., ⁇ -DNA, cosmid DNA, artificial bacterial chromosome, yeast artificial chromosome and filamentous phage such as M13.
  • oligonucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • suitable nucleotide modifications/analogs include peptide nucleic acid, inosin, tritylated bases, phosphorothioates, alkylphosphorothioates, 5-nitroindole deoxyribofuranosyl, 5-methyldeoxycytosine and 5,6-dihydro-5,6-dihydroxydeoxythymidine.
  • oligonucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. Other nucleotide analogs/modifications will be evident to those skilled in the art.
  • the term "packaged” as used herein refers to the state of an immunostimulatory substance, in particular an immunostimulatory nucleic acid in relation to the VLP.
  • the term “packaged” as used herein includes binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds, carbon-phosphorus bonds, and the like.
  • the term also includes the enclosement, or partial enclosement, of a substance.
  • the term “packaged” includes terms such as “coupled, "enclosed” and “attached.”
  • the immunostimulatory substance such as the unmethylated CpG-containing oligonucleotide can be enclosed by the VLP without the existence of an actual binding, neither covalently nor non- covalently.
  • the term “packaged” indicates that the nucleic acid in a packaged state is not accessible to DNAse or RNAse hydrolysis.
  • the immunostimulatory nucleic acid is packaged inside the VLP capsids, most preferably in a noncovalent manner.
  • compositions of the invention can be combined, optionally, with a pharmaceutically-acceptable carrier.
  • pharmaceutically-acceptable carrier means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human or other animal.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • organic molecule refers to any chemical entity of natural or synthetic origin.
  • organic molecule as used herein encompasses, for example, any molecule being a member of the group of nucleotides, lipids, carbohydrates, polysaccharides, lipopolysaccharides, steroids, alkaloids, te ⁇ enes and fatty acids, being either of natural or synthetic origin.
  • organic molecule encompasses molecules such as nicotine, cocaine, heroin or other pharmacologically active molecules contained in drugs of abuse.
  • an organic molecule contains or is modified to contain a chemical functionality allowing its coupling, binding or other method of attachment to the virus-like particle in accordance with the invention.
  • Polypeptide refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). It indicates a molecular chain of amino acids and does not refer to a specific length of the product. Thus, peptides, oligopeptides and proteins are included within the definition of polypeptide. This term is also intended to refer to post-expression modifications of the polypeptide, for example, glycosolations, acetylations, phosphorylations, and the like. A recombinant or derived polypeptide is not necessarily translated from a designated nucleic acid sequence. It may also be generated in any manner, including chemical synthesis.
  • a substance which "enhances" an immune response refers to a substance in which an immune response is observed that is greater or intensified or deviated in any way with the addition of the substance when compared to the same immune response measured without the addition of the substance.
  • the lytic activity of cytotoxic T cells can be measured, e.g. using a 51 Cr release assay, with and without the substance.
  • the amount of the substance at which the CTL lytic activity is enhanced as compared to the CTL lytic activity without the substance is said to be an amount sufficient to enhance the immune response of the animal to the antigen, hi a preferred embodiment, the immune response in enhanced by a factor of at least about 2, more preferably by a factor of about 3 or more.
  • the amount of cytokines secreted may also be altered.
  • Effective Amount refers to an amount necessary or sufficient to realize a desired biologic effect.
  • An effective amount of the composition would be the amount that achieves this selected result, and such an amount could be determined as a matter of routine by a person skilled in the art.
  • an effective amount for treating an immune system deficiency could be that amount necessary to cause activation of the immune system, resulting in the development of an antigen specific immune response upon exposure to antigen.
  • the term is also synonymous with "sufficient amount.”
  • the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, and/or the severity of the disease or condition.
  • One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the present invention without necessitating undue experimentation.
  • Self antigen refers to proteins encoded by the host's DNA and products generated by proteins or RNA encoded by the hos s DNA are defined as self.
  • proteins that result from a combination of two or several self-molecules or that represent a fraction of a self-molecule and proteins that have a high homology two self- molecules as defined above (>95%, preferably >97%, more preferably >99%) may also be considered self.
  • the antigen is a self antigen. Very preferred embodiments of self- antigens useful for the present invention are described WO 02/056905, the disclosures of which are herewith inco ⁇ orated by reference in its entirety.
  • treatment refers to prophylaxis and/or therapy.
  • the term refers to a prophylactic treatment which increases the resistance of a subject to infection with a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen or will show signs of illness attributable to the infection, as well as a treatment after the subject has become infected in order to fight the infection, e.g., reduce or eliminate the infection or prevent it from becoming worse.
  • the term "vaccine” refers to a formulation which contains the composition of the present invention and which is in a form that is capable of being administered to an animal.
  • the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition of the present invention is suspended or dissolved.
  • the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat a condition.
  • the vaccine Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies, cytokines and/or other cellular responses.
  • the vaccine of the present invention additionally includes an adjuvant which can be present in either a minor or major proportion relative to the compound of the present invention.
  • adjuvant refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine of the present invention provide for an even more enhanced immune response.
  • adjuvants can be used. Examples include incomplete Freund's adjuvant, aluminum hydroxide and modified muramyldipeptide.
  • adjuvant as used herein also refers to typically specific stimulators of the immune response which when combined with the vaccine of the present invention provide for an even more enhanced and typically specific immune response. Examples include, but limited to, GM-CSF, IL-2, IL-12, IFN ⁇ . Further examples are within the knowledge of the person skilled in the art.
  • virus-like particle refers to a structure resembling a virus particle but which has not been demonstrated to be pathogenic.
  • a virus-like particle in accordance with the invention does not carry genetic information encoding for the proteins of the virus-like particle.
  • virus-like particles lack the viral genome and, therefore, are noninfectious.
  • virus-like particles can often be produced in large quantities by heterologous expression and can be easily purified.
  • Some virus-like particles may contain nucleic acid distinct from their genome.
  • a virus-like particle in accordance with the invention is non replicative and noninfectious since it lacks all or part of the viral genome, in particular the replicative and infectious components of the viral genome.
  • a virus-like particle in accordance with the invention may contain nucleic acid distinct from their genome.
  • a typical and preferred embodiment of a virus-like particle in accordance with the present invention is a viral capsid such as the viral capsid of the corresponding virus, bacteriophage, or RNA-phage.
  • the terms "viral capsid” or “capsid”, as interchangeably used herein, refer to a macromolecular assembly composed of viral protein subunits. Typically and preferably, the viral protein subunits assemble into a viral capsid and capsid, respectively, having a structure with an inherent repetitive organization, wherein said structure is, typically, spherical or tubular.
  • capsids of RNA-phages or HBcAg's have a spherical form of icosahedral symmetry.
  • capsid-like structure refers to a macromolecular assembly composed of viral protein subunits reproducing the capsid mo ⁇ hology in the above defined sense but deviating from the typical symmetrical assembly while maintaining a sufficient degree of order and repetitiveness.
  • virus-like particle of a bacteriophage refers to a virus-like particle resembling the structure of a bacteriophage, being non replicative and noninfectious, and lacking at least the gene or genes encoding for the replication machinery of the bacteriophage, and typically also lacking the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host.
  • This definition should, however, also encompass virus-like particles of bacteriophages, in which the aforementioned gene or genes are still present but inactive, and, therefore, also leading to non-replicative and noninfectious virus-like particles of a bacteriophage.
  • VLP of RNA phage coat protein The capsid structure formed from the self-assembly of 180 subunits of RNA phage coat protein and optionally containing host RNA is referred to as a "VLP of RNA phage coat protein".
  • VLP of Q ⁇ coat protein A specific example is the VLP of Q ⁇ coat protein, hi this particular case, the VLP of Q ⁇ coat protein may either be assembled exclusively from Q ⁇ CP subunits (generated by expression of a Q ⁇ CP gene containing, for example, a TAA stop codon precluding any expression of the longer Al protein through suppression, see Kozlovska, T.M., et al, Intervirology 39: 9-15 (1996)), or additionally contain Al protein subunits in the capsid assembly.
  • the term "virus particle” as used herein refers to the mo ⁇ hological form of a virus. In some virus types it comprises a genome surrounded by a protein capsid; others have additional structures (e.g., envelopes, tails,
  • Non-enveloped viral particles are made up of a proteinaceous capsid that surrounds and protects the viral genome. Enveloped viruses also have a capsid structure surrounding the genetic material of the virus but, in addition, have a lipid bilayer envelope that surrounds the capsid. h a preferred embodiment of the invention, the VLP's are free of a lipoprotein envelope or a lipoprotein-containing envelope. In a further preferred embodiment, the VLP's are free of an envelope altogether.
  • certain embodiments of the invention involve the use of recombinant nucleic acid technologies such as cloning, polymerase chain reaction, the purification of DNA and RNA, the expression of recombinant proteins in prokaryotic and eukaryotic cells, etc.
  • recombinant nucleic acid technologies such as cloning, polymerase chain reaction, the purification of DNA and RNA, the expression of recombinant proteins in prokaryotic and eukaryotic cells, etc.
  • Such methodologies are well known to those skilled in the art and can be conveniently found in published laboratory methods manuals (e.g., Sambrook, J. et al, eds., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd. edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel, F.
  • compositions of the invention comprise, or alternatively consist of, a viruslike particle and an immunostimulatory substance, preferably an immunostimulatory nucleic acid, and even more preferably an unmethylated CpG-containing oligonucleotide where the an immunostimulatory substance, the immunostimulatory nucleic acid or the oligonucleotide is bound to the virus-like particle.
  • an immunostimulatory substance preferably an immunostimulatory nucleic acid, and even more preferably an unmethylated CpG-containing oligonucleotide where the an immunostimulatory substance, the immunostimulatory nucleic acid or the oligonucleotide is bound to the virus-like particle.
  • the invention conveniently enables the practitioner to construct such a composition for various treatment and/or prophylactic prevention pu ⁇ oses, which include the prevention and/or treatment of infectious diseases, as well as chronic infectious diseases, and the prevention and/or treatment of cancers, for example.
  • virus-like particles in the context of the present application refer to structures resembling a virus particle but which are not pathogenic. In general, virus-like particles lack the viral genome and, therefore, are noninfectious. Also, virus-like particles can be produced in large quantities by heterologous expression and can be easily purified.
  • the virus-like particle is a recombinant virus-like particle.
  • the skilled artisan can produce VLPs using recombinant DNA technology and virus coding sequences which are readily available to the public.
  • the coding sequence of a virus envelope or core protein can be engineered for expression in a baculovirus expression vector using a commercially available baculovirus vector, under the regulatory control of a virus promoter, with appropriate modifications of the sequence to allow functional linkage of the coding sequence to the regulatory sequence.
  • the coding sequence of a virus envelope or core protein can also be engineered for expression in a bacterial expression vector, for example.
  • VLPs include, but are not limited to, the capsid proteins of Hepatitis B virus (Ulrich, et al, Virus Res. 50:141-182 (1998)), measles virus (Warnes, et al, Gene 160:173-178 (1995)), Sindbis virus, rotavirus (U.S. Patent Nos. 5,071,651 and 5,374,426), foot-and-mouth-disease virus (Twomey, et al, Vaccine 73:1603-1610, (1995)), Norwalk virus (Jiang, X., et al, Science 250:1580-1583 (1990); Matsui, S.M., et al, J. Clin. Invest.
  • the retroviral GAG protein PCT Patent Appl. No. WO 96/30523
  • the retrotransposon Ty protein pi the surface protein of Hepatitis B virus (WO 92/11291)
  • human papilloma virus WO 98/15631
  • human polyoma virus Sasnauskas K., et al, Biol. Chem. 350(3):381-386 (1999); Sasnauskas K., et al, Generation of recombinant virus-like particles of different polyomaviruses in yeast.
  • RNA phages Ty, fr- phage, GA-phage, AP 205-phage and, in particular, Q ⁇ -phage.
  • the VLP of the invention is not limited to any specific form.
  • the particle can be synthesized chemically or through a biological process, which can be natural or non- natural.
  • this type of embodiment includes a virus-like particle or a recombinant form thereof.
  • the VLP can comprise, or alternatively consist of, recombinant polypeptides of Rotavirus; recombinant polypeptides of Norwalk virus; recombinant polypeptides of Alphavirus; recombinant proteins which form bacterial pili or pilus-like structures; recombinant polypeptides of Foot and Mouth Disease virus; recombinant polypeptides of measles virus, recombinant polypeptides of Sindbis virus, recombinant polypeptides of Retrovirus; recombinant polypeptides of Hepatitis B virus (e.g., a HBcAg); recombinant polypeptides of Tobacco mosaic virus; recombinant polypeptides of Flock House Virus; recombinant polypeptides of human Papillomavirus; recombinant polypeptides of Polyoma virus and, in particular, recombinant polypeptides of human Polyom
  • the virus-like particle can further comprise, or alternatively consist of, one or more fragments of such polypeptides, as well as variants of such polypeptides.
  • Variants of polypeptides can share, for example, at least 80%, 85%, 90%, 95%, 97%, or 99% identity at the amino acid level with their wild-type counte ⁇ arts.
  • the virus-like particle comprises, consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of a RNA-phage.
  • the RNA-phage is selected from the group consisting of a) bacteriophage Q ⁇ ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage Mil; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; and 1) bacteriophage PP7.
  • the viruslike particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the RNA- bacteriophage Q ⁇ or of the RNA-bacteriophage fr.
  • the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of coat proteins of RNA phages.
  • RNA-phage coat proteins forming capsids or VLPs, or fragments of the bacteriophage coat proteins compatible with self-assembly into a capsid or a VLP are, therefore, further preferred embodiments of the present invention.
  • Bacteriophage Q ⁇ coat proteins for example, can be expressed recombinantly in E. coli. Further, upon such expression these proteins spontaneously form capsids. Additionally, these capsids form a structure with an inherent repetitive organization.
  • bacteriophage coat proteins which can be used to prepare compositions of the invention include the coat proteins of RNA bacteriophages such as bacteriophage Q ⁇ (S ⁇ Q ID NO: 10; PIR Database, Accession No. VCBPQ ⁇ referring to Q ⁇ CP and S ⁇ Q ID NO: 11; Accession No. AAA16663 referring to Q ⁇ Al protein), bacteriophage R17 (SEQ ID NO: 12; PIR Accession No. VCBPR7), bacteriophage fir (SEQ ID NO:13; PIR Accession No. VCBPFR), bacteriophage GA (SEQ ID NO:14 GenBank Accession No.
  • bacteriophage Q ⁇ S ⁇ Q ID NO: 10; PIR Database, Accession No. VCBPQ ⁇ referring to Q ⁇ CP and S ⁇ Q ID NO: 11; Accession No. AAA16663 referring to Q ⁇ Al protein
  • bacteriophage R17 SEQ ID NO: 12; PIR Accession No. VCBPR7
  • bacteriophage SP SEQ ID NO: 15 GenBank Accession No. CAA30374 referring to SP CP and SEQ ID NO: 16 Accession No. referring to SP Al protein
  • bacteriophage MS2 SEQ ID NO: 17; PER. Accession No. VCBPM2
  • bacteriophage Mil SEQ ID NO: 18 GenBank Accession No. AAC06250
  • bacteriophage MX1 SEQ ID NO: 19 GenBank Accession No. AAC14699
  • bacteriophage NL95 SEQ ID NO:20 GenBank Accession No. AAC14704
  • bacteriophage £ SEQ ID NO: 21 GenBank Accession No.
  • bacteriophage PP7 SEQ ID NO: 22
  • Al protein of bacteriophage Q ⁇ or C-terminal truncated forms missing as much as 100, 150 or 180 amino acids from its C-terminus may be inco ⁇ orated in a capsid assembly of Q ⁇ coat proteins.
  • the percentage of Q ⁇ Al protein relative to Q ⁇ CP in the capsid assembly will be limited, in order to ensure capsid formation.
  • Q ⁇ coat protem has also been found to self-assemble into capsids when expressed in E. coli (Kozlovska TM. et al, GENE 137: 133-137 (1993)).
  • the crystal structure of phage Q ⁇ has been solved.
  • the capsid contains 180 copies of the coat protein, which are linked in covalent pentamers and hexamers by disulfide bridges (Golmohammadi, R. et al, Structure 4: 543- 5554 (1996)) leading to a remarkable stability of the capsid of Q ⁇ coat protein.
  • Capsids or VLPs made from recombinant Q ⁇ coat protein may contain, however, subunits not linked via disulfide links to other subunits within the capsid, or incompletely linked.
  • bands corresponding to monomeric Q ⁇ coat protein as well as bands corresponding to the hexamer or pentamer of Q ⁇ coat protein are visible. Incompletely disulfide-linked subunits could appear as dimer, trimer or even teframer bands in non-reducing SDS-PAGE.
  • Q ⁇ capsid protein also shows unusual resistance to organic solvents and denaturing agents.
  • VLP composed from Q ⁇ coat proteins where the N-terminal methionine has not been removed, or VLPs comprising a mixture of Q ⁇ coat proteins where the N-terminal methionine is either cleaved or present are also within the scope of the present invention.
  • RNA phage coat proteins have also been shown to self- assemble upon expression in a bacterial host (Kastelein, RA. et al, Gene 23: 245-254 (1983), Kozlovskaya, TM. et al, Dokl Akad. Nauk SSSR 287: 452- 455 (1986), Adhin, MR. et al, Virology 170: 238-242 (1989), Ni, CZ., et al, Protein Sci. 5: 2485-2493 (1996), Priano, C. et al., J. Mol. Biol. 249: 283-297 (1995)).
  • the Q ⁇ phage capsid contains, in addition to the coat protein, the so called read-through protein Al and the maturation protein A2. Al is generated by suppression at the UGA stop codon and has a length of 329 aa.
  • the capsid of phage Q ⁇ recombinant coat protein used in the invention is devoid of the A2 lysis protein, and contains RNA from the host.
  • the coat protein of RNA phages is an RNA binding protein, and interacts with the stem loop of the ribosomal binding site of the replicase gene acting as a translational repressor during the life cycle of the virus. The sequence and structural elements of the interaction are known (Witherell, GW. & Uhlenbeck, OC.
  • the viruslike particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of a RNA-phage, wherein the recombinant proteins comprise, consist essentially of or alternatively consist of mutant coat proteins of a RNA phage, preferably of mutant coat proteins of the RNA phages mentioned above.
  • mutant coat proteins of the RNA phage have been modified by removal of at least one lysine residue by way of substitution, or by addition of at least one lysine residue by way of substitution; alternatively, the mutant coat proteins of the RNA phage have been modified by deletion of at least one lysine residue, or by addition of at least one lysine residue by way of insertion.
  • the virus-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the RNA-bacteriophage Q ⁇ , wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of coat proteins having an amino acid sequence of SEQ ID NO: 10, or a mixture of coat proteins having amino acid sequences of SEQ ID NO: 10 and of SEQ ID NO: 11 or mutants of SEQ ID NO: 11 and wherein the N-terminal methionine is preferably cleaved.
  • the viruslike particle comprises, consists essentially of or alternatively consists of recombinant proteins of Q ⁇ , or fragments thereof, wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of mutant Q ⁇ coat proteins.
  • these mutant coat proteins have been modified by removal of at least one lysine residue by way of substitution, or by addition of at least one lysine residue by way of substitution.
  • these mutant coat proteins have been modified by deletion of at least one lysine residue, or by addition of at least one lysine residue by way of insertion.
  • Q ⁇ mutants for which exposed lysine residues are replaced by arginines can also be used for the present invention.
  • the following Q ⁇ coat protein mutants and mutant Q ⁇ VLPs can, thus, be used in the practice of the invention: "Q ⁇ -240" (Lysl3-Arg; SEQ ID NO:23), "Q ⁇ -243" (Asn 10-Lys; SEQ ID NO:24), "Q ⁇ -250" (Lys 2-Arg, Lysl3-Arg; SEQ ID NO:25), “Q ⁇ - 251” (SEQ ID NO:26) and "Q ⁇ -259” (Lys 2-Arg, Lysl6-Arg; SEQ ID NO:27).
  • the virus-like particle comprises, consists essentially of or alternatively consists of recombinant proteins of mutant Q ⁇ coat proteins, which comprise proteins having an amino acid sequence selected from the group of a) the amino acid sequence of SEQ ID NO: 23; b) the amino acid sequence of SEQ ID NO:24; c) the amino acid sequence of SEQ ED NO: 25; d) the amino acid sequence of SEQ ID NO:26; and e) the amino acid sequence of SEQ ID NO: 27.
  • mutant Q ⁇ coat protein VLPs and capsids are disclosed in pending U.S. Application No. 10/050,902 filed on January 18, 2002. In particular is hereby referred to Example 18 of above mentioned application.
  • the viruslike particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins of Q ⁇ , or fragments thereof, wherein the recombinant proteins comprise, consist essentially of or alternatively consist of a mixture of either one of the foregoing Q ⁇ mutants and the corresponding Al protein.
  • the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant proteins, or fragments thereof, of RNA-phage AP205.
  • the AP205 genome consists of a maturation protein, a coat protein, a replicase and two open reading frames not present in related phages; a lysis gene and an open reading frame playing a role in the translation of the maturation gene (Klovins ., et al, J. Gen. Virol. 83: 1523-33 (2002)).
  • AP205 coat protein can be expressed from plasmid pAP283-58 (SEQ ED NO: 79), which is a derivative of pQblO (Kozlovska, T. M. et al, Gene 137:133-37 (1993)), and which contains an AP205 ribosomal binding site.
  • pQblO Kozlovska, T. M. et al, Gene 137:133-37 (1993)
  • AP205 coat protein may be cloned into pQbl85, downstream of the ribosomal binding site present in the vector. Both approaches lead to expression of the protein and formation of capsids as described in the co-pending US provisional patent application with the title "Molecular Antigen Arrays" (Application No.
  • Vectors pQblO and pQbl85 are vectors derived from pGEM vector, and expression of the cloned genes in these vectors is controlled by the trp promoter (Kozlovska, T. M. et al., Gene 137:133-37 (1993)).
  • Plasmid pAP283-58 (SEQ ID NO:79) comprises a putative AP205 ribosomal binding site in the following sequence, which is downstream of the Xbal site, and immediately upstream of the ATG start codon of the AP205 coat protein: tct ⁇ g ⁇ ATTTTCTGCGCACCCAT CCCGGGTGGCGCCCAAAGTGAGGAAAATCAC ⁇ tg.
  • the vector pQbl85 comprises a Shine Delagarno sequence downstream from the Xbal site and upstream of the start codon (tct ⁇ g ⁇ TTAACCCAACGCGTAGGAG TCAGGCC ⁇ tg-, Shine Delagarno sequence underlined).
  • the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant coat proteins, or fragments thereof, of the RNA-phage AP205.
  • This prefened embodiment of the present invention thus, comprises AP205 coat proteins that form capsids.
  • Such proteins are recombinantly expressed, or prepared from natural sources.
  • AP205 coat proteins produced in bacteria spontaneously form capsids, as evidenced by Electron Microscopy (EM) and immunodiffusion.
  • the structural properties of the capsid formed by the AP205 coat protein (SEQ ED NO: 80) and those formed by the coat protein of the AP205 RNA phage are nearly indistinguishable when seen in EM.
  • AP205 VLPs are highly immunogenic, and can be linked with antigens and/or antigenic determinants to generate vaccine constructs displaying the antigens and/or antigenic determinants oriented in a repetitive manner. High titers are elicited against the so displayed antigens showing that bound antigens and or antigenic determinants are accessible for interacting with antibody molecules and are immunogenic.
  • the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant mutant coat proteins, or fragments thereof, of the RNA-phage AP205.
  • Assembly-competent mutant forms of AP205 VLPs including AP205 coat protein with the subsitution of proline at amino acid 5 to threonine (SEQ ED NO: 81), may also be used in the practice of the invention and leads to a further prefened embodiment of the invention.
  • AP205 P5-T mutant coat protein can be expressed from plasmid ⁇ AP281-32 (SEQ ID No. 82), which is derived directly from ⁇ Qbl85, and which contains the mutant AP205 coat protein gene instead of the Q ⁇ coat protein gene.
  • Vectors for expression of the AP205 coat protein are transfected into E. coli for expression of the AP205 coat protein.
  • E. coli sfrains include, but are not limited to, E. coli K802, JM 109, RR1.
  • Suitable vectors and strains and combinations thereof can be identified by testing expression of the coat protein and mutant coat protem, respectively, by SDS-PAGE and capsid formation and assembly by optionally first purifying the capsids by gel filtration and subsequently testing them in an immunodiffusion assay (Ouchterlony test) or Electron Microscopy (Kozlovska, T. M. et al, Gene 137:133-37 (1993)).
  • AP205 coat proteins expressed from the vectors pAP283-58 and pAP281-32 may be devoid of the initial Methionine amino-acid, due to processing in the cytoplasm of E. coli. Cleaved, uncleaved forms of AP205 VLP, or mixtures thereof are further prefened embodiments of the invention.
  • the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of a mixture of recombinant coat proteins, or fragments thereof, of the RNA-phage AP205 and of recombinant mutant coat proteins, or fragments thereof, of the RNA-phage AP205.
  • the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of fragments of recombinant coat proteins or recombinant mutant coat proteins of the RNA-phage AP205.
  • Recombinant AP205 coat protein fragments capable of assembling into a VLP and a capsid, respectively are also useful in the practice of the invention. These fragments may be generated by deletion, either internally or at the termini of the coat protein and mutant coat protein, respectively. Insertions in the coat protein and mutant coat protein sequence or fusions of antigen sequences to the coat protein and mutant coat protein sequence, and compatible with assembly into a VLP, are further embodiments of the invention and lead to chimeric AP205 coat proteins, and particles, respectively. The outcome of insertions, deletions and fusions to the coat protein sequence and whether it is compatible with assembly into a VLP can be determined by electron microscopy.
  • the particles formed by the AP205 coat protein, coat protein fragments and chimeric coat proteins described above, can be isolated in pure form by a combination of fractionation steps by precipitation and of purification steps by gel filtration using e.g. Sepharose CL-4B, Sepharose CL-2B, Sepharose CL- 6B columns and combinations thereof as described in the co-pending US provisional patent application with the title "Molecular Antigen Arrays" (Application No. 60/396,126) and having been filed on July 17, 2002, which is inco ⁇ orated by reference in its entirety.
  • Other methods of isolating virus-like particles are known in the art, and may be used to isolate the virus-like particles (VLPs) of bacteriophage AP205.
  • VLPs virus-like particles
  • the use of ultracentrifugation to isolate VLPs of the yeast retrotransposon Ty is described in U.S. Patent No. 4,918,166, which is inco ⁇ orated by reference herein in its entirety.
  • RNA- phage coat proteins can be modified such that one or more reactive amino acid residues can be inserted by way of insertion or substitution.
  • those modified fonns of bacteriophage coat proteins can also be used for the present invention.
  • variants of proteins which form capsids or capsid-like structures e.g., coat proteins of bacteriophage Q ⁇ , bacteriophage R17, bacteriophage fr, bacteriophage GA, bacteriophage SP, and bacteriophage MS2, bacteriophage AP 205) can also be used to prepare compositions of the present invention.
  • the invention further includes compositions and vaccine compositions, respectively, which further includes variants of proteins which form capsids or capsid-like structures, as well as methods for preparing such compositions and vaccine compositions, respectively, individual protein subunits used to prepare such compositions, and nucleic acid molecules which encode these protein subunits.
  • variant forms of wild-type proteins which form capsids or capsid-like structures and retain the ability to associate and form capsids or capsid-like structures.
  • compositions and vaccine compositions comprising proteins, which comprise, or alternatively consist essentially of, or alternatively consist of amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99% identical to wild-type proteins which form ordered arrays and have an inherent repetitive structure, respectively.
  • nucleic acid molecules which encode proteins used to prepare compositions of the present invention.
  • the invention further includes compositions comprising proteins, which comprise, or alternatively consist essentially of, or alternatively consist of amino acid sequences which are at least 80%, 85%, 90%, 95%o, 97%, or 99% identical to any of the amino acid sequences shown in SEQ ID NOs: 10-27.
  • Proteins suitable for use in the present invention also include C-terminal truncation mutants of proteins which form capsids or capsid-like structures, or VLPs.
  • Specific examples of such truncation mutants include proteins having an amino acid sequence shown in any of SEQ ED NOs: 10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the C-terminus.
  • theses C-terminal truncation mutants will retain the ability to form capsids or capsid-like structures.
  • proteins suitable for use in the present invention also include N-terminal truncation mutants of proteins which form capsids or capsid-like structures.
  • Specific examples of such truncation mutants include proteins having an amino acid sequence shown in any of SEQ YD NOs: 10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus.
  • these N-terminal truncation mutants will retain the ability to form capsids or capsid-like structures.
  • Additional proteins suitable for use in the present invention include N- and C-terminal truncation mutants which form capsids or capsid-like structures.
  • Suitable truncation mutants include proteins having an amino acid sequence shown in any of SEQ ED NOs:10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus and 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the C-terminus.
  • these N-terminal and C-terminal truncation mutants will retain the ability to form capsids or capsid-like structures.
  • compositions comprising proteins which comprise, or alternatively consist essentially of, or alternatively consist of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99%» identical to the above described truncation mutants.
  • the invention thus includes compositions and vaccine compositions prepared from proteins which form capsids or VLPs, methods for preparing these compositions from individual protein subunits and VLPs or capsids, methods for preparing these individual protein subunits, nucleic acid molecules which encode these subunits, and methods for vaccinating and/or eliciting immunological responses in individuals using these compositions of the present invention.
  • Fragments of VLPs which retain the ability to induce an immune response can comprise, or alternatively consist of, polypeptides which are about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450 or 500 amino acids in length, but will obviously depend on the length of the sequence of the subunit composing the VLP. Examples of such fragments include fragments of proteins discussed herein which are suitable for the preparation of the immune response enhancing composition.
  • the VLP's are free of a lipoprotein envelope or a lipoprotein-containing envelope, h a further prefened embodiment, the VLP's are free of an envelope altogether.
  • the lack of a lipoprotein envelope or lipoprotein-containing envelope and, in particular, the complete lack of an envelope leads to a more defined virus-like particle in its structure and composition. Such more defined viruslike particles, therefore, may minimize side-effects.
  • the lack of a lipoprotein-containing envelope or, in particular, the complete lack of an envelope avoids or minimizes inco ⁇ oration of potentially toxic molecules and pyrogens within the virus-like particle.
  • the invention includes virus-like particles or recombinant forms thereof. Skilled artisans have the knowledge to produce such particles and attach antigens thereto. By way of providing other examples, the invention provides herein for the production of Hepatitis B virus-like particles as virus-like particles (Example 1).
  • the particles used in compositions of the invention are composed of a Hepatitis B capsid (core) protein (HBcAg) or a fragment of a HBcAg which has been modified to either eliminate or reduce the number of free cysteine residues.
  • HBcAg Hepatitis B capsid
  • Zhou et al. J. Virol. (5(5:5393-5398 (1992)) demonstrated that HBcAgs which have been modified to remove the naturally resident cysteine residues retain the ability to associate and form multimeric structures.
  • core particles suitable for use in compositions of the invention include those comprising modified HBcAgs, or fragments thereof, in which one or more of the naturally resident cysteine residues have been either deleted or substituted with another amino acid residue (e.g., a serine residue).
  • the HBcAg is a protein generated by the processing of a Hepatitis B core antigen precursor protein.
  • a number of isotypes of the HBcAg have been identified and their amino acids sequences are readily available to those skilled in the art.
  • the HBcAg protein having the amino acid sequence shown in Figure 1 is 185 amino acids in length and is generated by the processing of a 212 amino acid Hepatitis B core antigen precursor protein. This processing results in the removal of 29 amino acids from the N-terminus of the Hepatitis B core antigen precursor protein.
  • the HBcAg protein that is 185 amino acids in length is generated by the processing of a 214 amino acid Hepatitis B core antigen precursor protein.
  • vaccine compositions of the invention will be prepared using the processed form of a HBcAg (i.e., a HBcAg from which the N-terminal leader sequence of the Hepatitis B core antigen precursor protein have been removed).
  • the HBcAgs when HBcAgs are produced under conditions where processing will not occur, the HBcAgs will generally be expressed in "processed" form.
  • bacterial systems such as E. coli, generally do not remove the leader sequences, also refened to as "signal peptides," of proteins which are normally expressed in eukaryotic cells.
  • signal peptides proteins which are normally expressed in eukaryotic cells.
  • these proteins will generally be expressed such that the N-terminal leader sequence of the Hepatitis B core antigen precursor protein is not present.
  • Hepatitis B virus-like particles which can be used for the present invention, is disclosed, for example, in WO 00/32227, and hereby in particular in Examples 17 to 19 and 21 to 24, as well as in WO 01/85208, and hereby in particular in Examples 17 to 19, 21 to 24, 31 and 41, and in pending U.S. Application No. 10/050,902 filed on January 18, 2002. For the latter application, it is in particular refened to Example 23, 24, 31 and 51. All three documents are explicitly inco ⁇ orated herein by reference.
  • the present invention also includes HBcAg variants which have been modified to delete or substitute one or more additional cysteine residues.
  • the vaccine compositions of the invention include compositions comprising HBcAgs in which cysteine residues not present in the amino acid sequence shown in Figure 1 have been deleted.
  • HBcAg variants suitable for use in the practice of the present invention have been identified. Yuan et al, (J. Virol 73:10122-10128 (1999)), for example, describe variants in which the isoleucine residue at position corresponding to position 97 in SEQ ED NO:28 is replaced with either a leucine residue or a phenylalanine residue.
  • HBcAg variants differ in amino acid sequence at a number of positions, including amino acid residues which corresponds to the amino acid residues located at positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO:77.
  • Further HBcAg variants suitable for use in the compositions of the invention, and which may be further modified according to the disclosure of this specification are described in WO 00/198333, WO 00/177158 and WO 00/214478.
  • HBcAgs suitable for use in the present invention can be derived from any organism so long as they are able to enclose or to be coupled or otherwise attached to, in particular as long as they are capable of packaging, an unmethylated CpG-containing oligonucleotide and induce an immune response.
  • HBcAgs As noted above, generally processed HBcAgs (i.e., those which lack leader sequences) will be used in the vaccine compositions of the invention.
  • the present invention includes vaccine compositions, as well as methods for using these compositions, which employ the above described variant HBcAgs.
  • HBcAg variants which are capable of associating to form dimeric or multimeric structures.
  • the invention further includes vaccine compositions comprising HBcAg polypeptides comprising, or alternatively consisting of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97% or 99% identical to any of the wild-type amino acid sequences, and forms of these proteins which have been processed, where appropriate, to remove the N-terminal leader sequence.
  • the amino acid sequence of a polypeptide has an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97% or 99% identical to one of the wild-type amino acid sequences, or a subportion thereof, can be determined conventionally using known computer programs such the Bestfit program.
  • Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference amino acid sequence, the parameters are set such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • the HBcAg variants and precursors having the amino acid sequences set out in SEQ ID NOs: 29-72 and 73-76 are relatively similar to each other.
  • reference to an amino acid residue of a HBcAg variant located at a position which conesponds to a particular position in SEQ ID NO:77 refers to the amino acid residue which is present at that position in the amino acid sequence shown in SEQ ID NO:77.
  • the homology between these HBcAg variants is for the most part high enough among Hepatitis B viruses that infect mammals so that one skilled in the art would have little difficulty reviewing both the amino acid sequence shown in SEQ ID NO:77 and in Figure 1, respectively, and that of a particular HBcAg variant and identifying "corresponding" amino acid residues.
  • the HBcAg amino acid sequence shown in SEQ ED NO:73 which shows the amino acid sequence of a HBcAg derived from a virus which infect woodchucks, has enough homology to the HBcAg having the amino acid sequence shown in SEQ ID NO: 77 that it is readily apparent that a three amino acid residue insert is present in SEQ ED NO:73 between amino acid residues 155 and 156 of SEQ ED NO:77.
  • the invention also includes vaccine compositions which comprise HBcAg variants of Hepatitis B viruses which infect birds, as wells as vaccine compositions which comprise fragments of these HBcAg variants.
  • vaccine compositions which comprise HBcAg variants of Hepatitis B viruses which infect birds, as wells as vaccine compositions which comprise fragments of these HBcAg variants.
  • cysteine residues naturally present in these polypeptides could be either substituted with another amino acid residue or deleted prior to their inclusion in vaccine compositions of the invention.
  • cysteine residues of the Hepatitis B virus capsid protein have been either deleted or substituted with another amino acid residue.
  • compositions and vaccine compositions, respectively, of the invention will contain HBcAgs from which the C-terminal region (e.g., amino acid residues 145-185 or 150-185 of SEQ ED NO: 77) has been removed.
  • additional modified HBcAgs suitable for use in the practice of the present invention include C-terminal truncation mutants. Suitable truncation mutants include HBcAgs where 1, 5, 10, 15, 20, 25, 30, 34, 35, amino acids have been removed from the C-terminus.
  • HBcAgs suitable for use in the practice of the present invention also include N-terminal truncation mutants.
  • Suitable truncation mutants include modified HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus.
  • HBcAgs suitable for use in the practice of the present invention include N- and C-terminal truncation mutants.
  • Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35 amino acids have been removed from the C-terminus.
  • compositions and vaccine compositions comprising HBcAg polypeptides comprising, or alternatively essentially consisting of, or alternatively consisting of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99% identical to the above described truncation mutants.
  • compositions of the invention are prepared using a HBcAg comprising, or alternatively consisting of, amino acids 1-144, or 1-149, 1-185 of SEQ TD NO:77, which is modified so that the amino acids conesponding to positions 79 and 80 are replaced with a peptide having the amino acid sequence of Gly-Gly-Lys-Gly- Gly (SEQ TD NO:78).
  • compositions are particularly useful in those embodiments where an antigenic determinant is coupled to a VLP of HBcAg.
  • cysteine residues at positions 48 and 107 of SEQ ED NO: 77 are mutated to serine.
  • the invention further includes compositions comprising the corresponding polypeptides having amino acid sequences shown in any of SEQ ED NOs:29-74 which also have above noted amino acid alterations.
  • additional HBcAg variants which are capable of associating to form a capsid or VLP and have the above noted amino acid alterations.
  • compositions and vaccine compositions comprising HBcAg polypeptides which comprise, or alternatively consist of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97% or 99% identical to any of the wild-type amino acid sequences, and forms of these proteins which have been processed, where appropriate, to remove the N-terminal leader sequence and modified with above noted alterations.
  • compositions or vaccine compositions of the invention may comprise mixtures of different HBcAgs.
  • these vaccine compositions may be composed of HBcAgs which differ in amino acid sequence.
  • vaccine compositions could be prepared comprising a "wild-type" HBcAg and a modified HBcAg in which one or more amino acid residues have been altered (e.g., deleted, inserted or substituted).
  • prefened vaccine compositions of the invention are those which present highly ordered and repetitive antigen arrays.
  • the invention is based on the su ⁇ rising finding that immunostimulatory substances, preferably immunostimulatory nucleic acids and even more preferably DNA oligonucleotides can be packaged into VLPs.
  • immunostimulatory substances preferably immunostimulatory nucleic acids and even more preferably DNA oligonucleotides can be packaged into VLPs.
  • the nucleic acids present in VLPs can be replaced specifically by the immunostimulatory substances, preferably by the immunostimulatory nucleic acids and even more preferably by the DNA- oligonucleotides containing CpG motifs.
  • the CpG- VLPs are dramatically more immunogenic and elicit more specific effects than their CpG-free counte ⁇ arts and induce enhanced B and T cell responses.
  • the immune response against antigens coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself, h addition, the T cell responses against both the VLPs and antigens are especially directed to the Thl type. Furthermore, the packaged nucleic acids and CpGs, respectively, are protected from degradation, i.e., they are more stable. Moreover, non-specific activation of cells from the innate immune system is dramatically reduced.
  • the innate immune system has the capacity to recognize invariant molecular pattern shared by microbial pathogens. Recent studies have revealed that this recognition is a crucial step in inducing effective immune responses.
  • the main mechanism by which microbial products augment immune responses is to stimulate APC, expecially dendritic cells to produce proinflammatory cytokines and to expres high levels costimulatory molecules for T cells. These activated dendritic cells subsequently initiate primary T cell responses and dictate the type of T cell-mediated effector function.
  • nucleic acids Two classes of nucleic acids, namely 1) bacterial DNA that contains immunostimulatory sequences, in particular unmethylated CpG dinucleotides within specific flanking bases (refened to as CpG motifs) and 2) double- sfranded RNA synthesized by various types of viruses represent important members of the microbial components that enhance immune responses.
  • Synthetic double stranded (ds) RNA such as polyinosinic-polycytidylic acid (poly I:C) are capable of inducing dendritic cells to produce proinflammatory cytokines and to express high levels of costimulatory molecules.
  • Prefened ribonucleic acid encompass polyinosinic-polycytidylic acid double-stranded RNA (poly I:C).
  • Ribonucleic acids and modifications thereof as well as methods for their production have been described by Levy, H.B (Methods Enzymol. 1981, 78:242-251), DeClercq, E (Methods Enzymol. 1981,78:227-236) and Torrence, P.F. (Methods Enzymol 1981;78:326-331) and references therein. Ribonucleic acids can be isolated from organisms.
  • Ribonucleic acids also encompass further synthetic ribonucleic acids, in particular synthetic poly (I:C) oligonucleotides that have been rendered nuclease resistant by modification of the phosphodiester backbone, in particular by phosphorothioate modifications.
  • the ribose backbone of poly (EC) is replaced by a deoxyribose.
  • TLR active toll-like receptors
  • TLR2 is activated by peptidoglycans, lipoproteins, lipoteichonic acid and Zymosan;
  • TLR3 is activated by double-sfranded RNA such as poly (I:C);
  • TLR4 is activated by lipopolysaccharide, lipoteichoic acids and taxol;
  • TLR5 is activated by bacterial flagella, especially the flagellin protein;
  • TLR6 is activated by peptidoglycans, TLR7 is activated by imiquimoid and imidazoquinoline compounds, such as R418 and TLR9 is activated by bacterial DNA, in particular CpG DNA.
  • Ligands for TLR1, TLR8 and TLR10 are not known so far. However, recent reports indicate that same receptors can react with different ligands and that further receptors are present. The above list of ligands is not exhaustive and further ligands are within the knowledge of the person skilled in the art.
  • the unmethylated CpG-containing oligonucleotide comprises the sequence: wherein X ls X 2 , X 3 and X 4 are any nucleotide.
  • the oligonucleotide can comprise about 6 to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, more preferably about 20 to about 2000 nucleotides, and even more preferably comprises about 20 to about 300 nucleotides.
  • the oligonucleotide can comprise more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
  • the CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone.
  • a CpG-containing oligonucleotide having one or more phosphate backbone modifications or having all of the phosphate backbone modified and a CpG-containing oligonucleotide wherein one, some or all of the nucleotide phosphate backbone modifications are phosphorothioate modifications are included within the scope of the present invention.
  • the CpG-containing oligonucleotide can also be recombinant, genomic, synthetic, cDNA, plasmid-derived and single or double stranded.
  • the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., 7et. Let. 22:1859 (1981); nucleoside H-phosphonate method (Garegg et al, Tet. Let. 27:4051-4054 (1986); Froehler et al, Nucl. Acid. Res.
  • oligonucleotide synthesizers available in the market.
  • CpGs can be produced on a large scale in plasmids, (see Sambrook, T., et al, "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor laboratory Press, New York, 1989) which after being administered to a subject are degraded into oligonucleotides.
  • Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
  • the immunostimulatory substances, the immunostimulatory nucleic acids as well as the unmethylated CpG-containing oligonucleotide can be bound to the VLP by any way known is the art provided the composition enhances an immune response in an animal.
  • the oligonucleotide can be bound either covalently or non-covalently.
  • the VLP can enclose, fully or partially, the immunostimulatory substances, the immunostimulatory nucleic acids as well as the unmethylated CpG-containing oligonucleotide.
  • the immunostimulatory nucleic acid as well as the unmethylated CpG-containing oligonucleotide can be bound to a VLP site such as an oligonucleotide binding site (either naturally or non-naturally occurring), a DNA binding site or a RNA binding site.
  • the VLP site comprises an arginine-rich repeat.
  • compositions of the invention are to activate dendritic cells for the pu ⁇ ose of enhancing a specific immune response against antigens.
  • the immune response can be enhanced using ex vivo or in vivo techniques.
  • the ex vivo procedure can be used on autologous or heterologous cells, but is preferably used on autologous cells.
  • the dendritic cells are isolated from peripheral blood or bone marrow, but can be isolated from any source of dendritic cells. Ex vivo manipulation of dendritic cells for the pu ⁇ oses of cancer immunotherapy have been described in several references in the art, including Engleman, E.
  • the dendritic cells can also be contacted with the inventive compositions using in vivo methods.
  • the CpGs are administered in combination with the VLP optionally coupled, fused or otherwise attached to an antigen directly to a subject in need of immunotherapy.
  • the VLPs/CpGs be administered in the local region of the tumor, which can be accomplished in any way known in the art, e.g., direct injection into the tumor.
  • the inventive composition can further comprise an antigen or antigenic determinant bound to the virus-like particle.
  • the invention provides for compositions that vary according to the antigen or antigenic determinant selected in consideration of the desired therapeutic effect.
  • Very prefened antigens or antigenic determinants suitable for use in the present invention are disclosed in WO 00/32227, in WO 01/85208 and in WO 02/056905, the disclosures of which are herewith inco ⁇ orated by reference in their entireties.
  • the antigen can be any antigen of known or yet unknown provenance. It can be isolated from bacteria, viruses or other pathogens or can be a recombinant antigen obtained from expression of suitable nucleic acid coding therefor. It can also be isolated from prions, tumors, self-molecules, non- peptidic hapten molecules, allergens and hormones. In a prefened embodiment, the antigen is a recombinant antigen. The selection of the antigen is, of course, dependent upon the immunological response desired and the host.
  • the immune response is induced against the VLP itself.
  • a virus-like particle is coupled, fused or otherwise attached to an antigen immunogen against which an enhanced immune response is desired.
  • the at least one antigen or antigenic determinant is fused to the virus-like particle.
  • a VLP is typically composed of at least one subunit assembling into a VLP.
  • the antigen or antigenic determinant is fused to at least one subunit of the viruslike particle or of a protein capable of being inco ⁇ orated into a VLP generating a chimeric VLP-subunit-antigen fusion.
  • Fusion of the antigen or antigenic determinant can be effected by insertion into the VLP subunit sequence, or by fusion to either the N- or C- terminus of the VLP-subunit or protein capable of being inco ⁇ orated into a VLP.
  • fusion proteins of a peptide to a VLP subunit the fusion to either ends of the subunit sequence or internal insertion of the peptide within the subunit sequence are encompassed.
  • Fusion may also be effected by inserting antigen or antigenic determinant sequences into a variant of a VLP subunit where part of the subunit sequence has been deleted, that are further refened to as truncation mutants.
  • Truncation mutants may have N- or C-terminal, or internal deletions of part of the sequence of the VLP subunit.
  • the specific VLP HBcAg with, for example, deletion of amino acid residues 79 to 81 is a truncation mutant with an internal deletion. Fusion of antigens or antigenic determinants to either the N- or C-terminus of the truncation mutants VLP- subunits also lead to embodiments of the invention.
  • fusion of an epitope into the sequence of the VLP subunit may also be effected by substitution, where for example for the specific VLP HBcAg, amino acids 79- 81 are replaced with a foreign epitope.
  • fusion as referred to hereinafter, may be effected by insertion of the antigen or antigenic determinant sequence in the sequence of a VLP subunit, by substitution of part of the sequence of the VLP subunit with the antigen or antigenic determinant, or by a combination of deletion, substitution or insertions.
  • the chimeric antigen or antigenic determinant -VLP subunit will be in general capable of self-assembly into a VLP.
  • VLP displaying epitopes fused to their subunits are also herein referred to as chimeric VLPs.
  • the virus-like particle comprises or alternatively is composed of at least one VLP subunit.
  • the virus-like particle comprises or alternatively is composed of a mixture of chimeric VLP subunits and non-chimeric VLP subunits, i.e. VLP subunits not having an antigen fused thereto, leading to so called mosaic particles. This may be advantageous to ensure formation of, and assembly to a VLP.
  • the proportion of chimeric VLP-subunits may be 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or higher.
  • Flanking amino acid residues may be added to either end of the sequence of the peptide or epitope to be fused to either end of the sequence of the subunit of a VLP, or for internal insertion of such peptidic sequence into the sequence of the subunit of a VLP.
  • Glycine and serine residues are particularly favored amino acids to be used in the flanking sequences added to the peptide to be fused. Glycine residues confer additional flexibility, which may diminish the potentially destabilizing effect of fusing a foreign sequence into the sequence of a VLP subunit.
  • the VLP is a Hepatitis B core antigen VLP.
  • Fusion proteins of the antigen or antigenic determinant to either the N-terminus of a HBcAg (Neyrinck, S. et al, Nature Med. 5:1157- 1163 (1999)) or insertions in the so called major immunodominant region (MER.) have been described (Pumpens, P. and Grens, E., Intervirology 44:98- 114 (2001)), WO 01/98333), and are preferred embodiments of the invention.
  • Naturally occurring variants of HBcAg with deletions in the MER. have also been described (Pumpens, P.
  • HBcAg contains a long arginine tail (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001))which is dispensable for capsid assembly and capable of binding nucleic acids (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001)).
  • HBcAg either comprising or lacking this arginine tail are both embodiments of the invention.
  • the VLP is a VLP of a RNA phage.
  • the major coat proteins of RNA phages spontaneously assemble into VLPs upon expression in bacteria, and in particular in E. coli.
  • Specific examples of bacteriophage coat proteins which can be used to prepare compositions of the invention include the coat proteins of RNA bacteriophages such as bacteriophage Q ⁇ (SEQ ID NO: 10; PER. Database, Accession No. VCBPQ ⁇ referring to Q ⁇ CP and SEQ ID NO: 11; Accession No. AAA16663 referring to Q ⁇ Al protein) and bacteriophage fr (SEQ ED NO: 13; PIR Accession No. VCBPFR).
  • the at least one antigen or antigenic determinant is fused to a Q ⁇ coat protein.
  • Fusion protein constructs wherein epitopes have been fused to the C-terminus of a truncated form of the Al protein of Q ⁇ , or inserted within the Al protein have been described (Kozlovska, T. M., et al, Intervirology, 39:9-15 (1996)).
  • the Al protein is generated by suppression at the UGA stop codon and has a length of 329 aa, or 328 aa, if the cleavage of the N-terminal methionine is taken into account.
  • mosaic particles may be effected in a number of ways. Kozlovska et al, Intervirology, 39:9-15 (1996), describe three methods, which all can be used in the practice of the invention.
  • efficient display of the fused epitope on the VLPs is mediated by the expression of the plasmid encoding the Q ⁇ Al protein fusion having a UGA stop codong between CP and CP extension in a ⁇ .
  • coli strain harboring a plasmid encoding a cloned UGA suppressor tRNA which leads to franslation of the UGA codon into T ⁇ ( ⁇ ISM3001 plasmid (Smiley B.K., et al, Gene 134:33-40 (1993))).
  • the CP gene stop codon is modified into UAA, and a second plasmid expressing the Al protein-antigen fusion is cotransformed.
  • the second plasmid encodes a different antibiotic resistance and the origin of replication is compatible with the first plasmid (Kozlovska, T. M., et al, Intervirology 39:9-15 (1996)).
  • CP and the Al protein-antigen fusion are encoded in a bicisfronic manner, operatively linked to a promoter such as the T ⁇ promoter, as described in Figure 1 of Kozlovska et al, Intervirology, 39:9-15 (1996).
  • the antigen or antigenic determinant is inserted between amino acid 2 and 3 (numbering of the cleaved CP, that is wherein the N-terminal methionine is cleaved) of the fr CP, thus leading to an antigen or antigenic determinant -fr CP fusion protein.
  • Vectors and expression systems for construction and expression of fr CP fusion proteins self- assembling to VLP and useful in the practice of the invention have been described (Pushko P. et al, Prot. Eng. 5:883-891 (1993)).
  • the antigen or antigenic determinant sequence is inserted into a deletion variant of the fr CP after amino acid 2, wherein residues 3 and 4 of the fr CP have been deleted (Pushko P. et al, Prot. Eng. 6:883-891 (1993)).
  • the antigen or antigenic determinant is fused to a capsid protein of papillomavirus.
  • the antigen or antigenic determinant is fused to the major capsid protein LI of bovine papillomavirus type 1 (BPV-1).
  • BPV-1 bovine papillomavirus type 1
  • BPV-1 LI -antigen fusion protein which is a preferred embodiment of the invention.
  • Cloning in a baculovirus vector and expression in baculovirus infected Sf9 cells has been described, and can be used in the practice of the invention (Chackerian, B. et al, Proc. Natl Acad. Sci. USA 96:2373-2378 (1999), WO 00/23955).
  • Purification of the assembled particles displaying the fused antigen or antigenic determinant can be performed in a number of ways, such as for example gel filtration or sucrose gradient ultracentrifugation (Chackerian, B. et al, Proc. Natl. Acad. Sci.USA 96:2373- 2378 (1999), WO 00/23955).
  • the antigen or antigenic determinant is fused to a Ty protein capable of being inco ⁇ orated into a Ty VLP.
  • the antigen or antigenic determinant is fused to the pi or capsid protein encoded by the TYA gene (Roth, J.F., Yeast 76:785-795 (2000)).
  • the yeast refrotransposons Tyl, 2, 3 and 4 have been isolated from Saccharomyces Serevisiae, while the retrotransposon Tfl has been isolated from Schizosaccharomyces Pombae (Boeke, J.D.
  • the refrotransposons Tyl and 2 are related to the copia class of plant and animal elements, while Ty3 belongs to the gypsy family of refrotransposons, which is related to plants and animal retroviruses.
  • the pi protein also referred to as Gag or capsid protem, has a length of 440 amino acids.
  • PI is cleaved during maturation of the VLP at position 408, leading to the p2 protein, the essential component of the VLP.
  • an antigen or antigenic determinant may be fused to pl by inserting a sequence coding for the antigen or antigenic determinant into the BamHI site of the pMA5620 plasmid (Adams, S.E., et al, Nature 329:68- 70 (1987)).
  • fusion proteins comprising amino acids 1-381 of pi of Tyl -15, fused C-terminally to the N-terminus of the foreign epitope.
  • N-terminal fusion of an antigen or antigenic determinant, or internal insertion into the pi sequence, or substitution of part of the pi sequence are also meant to fall within the scope of the invention.
  • insertion of an antigen or antigenic determinant into the Ty sequence between amino acids 30-31, 67-68, 113-114 and 132-133 of the Ty protein pi leads to prefened embodiments of the invention.
  • VLPs suitable for fusion of antigens or antigenic determinants are, for example, Retro virus-like-particles (WO9630523), HEV2 Gag (Kang, Y.C., et al, Biol Chem. 380:353-364 (1999)), Cowpea Mosaic Virus (Taylor, K.M.et al, Biol. Chem. 380:387-392 (1999)), parvovirus VP2 VLP (Rueda, P. et al, Virology 263:89-99 (1999)), HBsAg (US 4,722,840, EP0020416B1).
  • VLPs suitable for the practice of the invention are also those described in Intervirology 39:1 (1996). Further examples of VLPs contemplated for use in the invention are: HPV-1, HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, HPV-45, CRPV, COPV, HIV GAG, Tobacco Mosaic Virus. Virus-like particles of SV-40, Polyomavirus, Adenovirus, He ⁇ es Simplex Virus, Rotavirus and Norwalk virus have also been made, and chimeric VLPs of those VLPs comprising an antigen or antigenic determinant are also within the scope of the present invention.
  • antigens fused to the virus-like particle by insertion within the sequence of the virus-like particle building monomer are also within the scope of the present invention.
  • antigens can be inserted in a form of the virus-like particle building monomer containing deletions.
  • the virus-like particle building monomer may not be able to form virus-like structures in the absence of the inserted antigen.
  • recombinant DNA technology can be utilized to fuse a heterologous protein to a VLP protein (Kratz, P.A., et al, Proc. Natl. Acad. Sci. USA 96:1915 (1999)).
  • the present invention encompasses VLPs recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to an antigen (or portion thereof, preferably at least 10, 20 or 50 amino acids) of the present invention to generate fusion proteins or conjugates.
  • the fusion does not necessarily need to be direct, but can occur through linker sequences.
  • linker sequences are typically added at one or both ends of the epitopes.
  • linker sequences preferably comprise sequences recognized by the proteasome, proteases of the endosomes or other vesicular compartment of the cell.
  • a peptide bond in which the conjugate can be a contiguous polypeptide, i.e. a fusion protein.
  • a fusion protein according to the present invention, different peptides or polypeptides are linked in frame to each other to form a contiguous polypeptide.
  • a first portion of the fusion protein comprises an antigen or immunogen and a second portion of the fusion protein, either N-terminal or C-terminal to the first portion, comprises a VLP.
  • internal insertion into the VLP with optional linking sequences on both ends of the antigen, can also be used in accordance with the present invention.
  • HBcAg When HBcAg is used as the VLP, it is preferred that the antigen is linked to the C-terminal end of the HBcAg particle.
  • LCMV lymphocytic choriomeningitis virus
  • the 185 amino acids long wild type HBc protein assembles into highly structured particles composed of 180 subunits assuming icosahedral geometry.
  • a flexible linker sequence e.g. a polyglycme/polyserine-containing sequence such as [Gly 4 Ser] 2 (Huston et al, Meth. Enzymol 203:46-88 (1991)) can be inserted into the fusion protein between the antigen and ligand.
  • the fusion protein can be constructed to contain an "epitope tag", which allows the fusion protein to bind an antibody (e.g. monoclonal antibody) for example for labeling or purification pu ⁇ oses.
  • An example of an epitope tag is a Glu- Glu-Phe tripeptide which is recognized by the monoclonal antibody YL1/2.
  • the invention also relates to the chimeric DNA which contains a sequence coding for the VLP and a sequence coding for the antigen/immunogen.
  • the DNA can be expressed, for example, in insect cells transfonned with Baculoviruses, in yeast or in bacteria.
  • Baculoviruses Baculoviruses
  • yeast or in bacteria There are no restrictions regarding the expression system, of which a large selection is available for routine use.
  • a system is used which allows expression of the proteins in large amounts, h general, bacterial expression systems are prefened on account of their efficiency.
  • a bacterial expression system suitable for use within the scope of the present invention is the one described by Clarke et al, J. Gen. Virol. 71: 1109-1117 (1990); Borisova et al, J. Virol.
  • yeast expression system An example of a suitable yeast expression system is the one described by Emr, Methods Enzymol. 185:231-3 (1990); Baculovirus systems, which have previously been used for preparing capsid proteins, are also suitable. Constitutive or inducible expression systems can be used. By the choice and possible modification of available expression systems it is possible to control the form in which the proteins are obtained.
  • the antigen to which an enhanced immune response is desired is coupled, fused or otherwise attached in frame to the Hepatitis B virus capsid (core) protein (HBcAg).
  • core protein HBV capsid
  • the at least one antigen or antigenic determinant is bound to the virus-like particle by at least one covalent bond.
  • the least one antigen or antigenic determinant is bound to the virus-like particle by at least one covalent bond, said covalent bond being a non-peptide bond leading to an antigen or antigenic determinant anay and antigen or antigenic determinant -VLP conjugate, respectively.
  • This antigen or antigenic determinant array and conjugate, respectively has typically and preferably a repetitive and ordered structure since the at least one antigen or antigenic determinant is bound to the VLP in an oriented mamier.
  • the formation of a repetitive and ordered antigen or antigenic determinant -VLP array and conjugate, respectively, is ensured by an oriented and directed as well as defined binding and attachment, respectively, of the at least one antigen or antigenic determinant to the VLP as will become apparent in the following.
  • the typical inherent highly repetitive and organized structure of the VLPs advantageously contributes to the display of the antigen or antigenic determinant in a highly ordered and repetitive fashion leading to a highly organized and repetitive antigen or antigenic determinant -VLP array and conjugate, respectively.
  • the prefened inventive conjugates and arrays differ from prior art conjugates in their highly organized structure, dimensions, and in the repetitiveness of the antigen on the surface of the array.
  • the preferred embodiment of this invention furthermore, allows expression of the particle in an expression host guaranteeing proper folding and assembly of the VLP, to which the antigen is then further coupled
  • the present invention discloses methods of binding of antigen or antigenic determinant to VLPs.
  • the at least one antigen or antigenic determinant is bound to the VLP by way of chemical cross-linking, typically and preferably by using a heterobifunctional cross-linker.
  • a heterobifunctional cross-linker typically and preferably by using a heterobifunctional cross-linker.
  • the hetero-bifunctional cross- linker contains a functional group which can react with prefened first attachment sites, i.e. with the side-chain amino group of lysine residues of the VLP or at least one VLP subunit, and a further functional group which can react with a prefened second attachment site, i.e.
  • the first step of the procedure is the reaction of the VLP with the cross-linker.
  • the product of this reaction is an activated VLP, also called activated carrier.
  • unreacted cross-linker is removed using usual methods such as gel filtration or dialysis.
  • the antigen or antigenic determinant is reacted with the activated VLP, and this step is typically called the coupling step.
  • Unreacted antigen or antigenic determinant may be optionally removed in a fourth step, for example by dialysis.
  • Several hetero-bifunctional cross- linkers are known to the art.
  • cross-linkers include the prefened cross-linkers SMPH (Pierce), Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB, Sulfo-SMCC, SVSB, SEA and other cross-linkers available for example from the Pierce Chemical Company (Rockford, IL, USA) , and having one functional group reactive towards amino groups and one functional group reactive towards cysteine residues.
  • the above mentioned cross-linkers all lead to formation of a thioether linkage.
  • Another class of cross-linkers suitable in the practice of the invention is characterized by the introduction of a disulfide linkage between the antigen or antigenic determinant and the VLP upon coupling.
  • Prefened cross-linkers belonging to this class include for example SPDP and Sulfo-LC-SPDP (Pierce).
  • the extent of derivatization of the VLP with cross-linker can be influenced by varying experimental conditions such as the concenfration of each of the reaction partners, the excess of one reagent over the other, the pH, the temperature and the ionic strength.
  • the degree of coupling, i.e. the amount of antigens or antigenic determinants per subunits of the VLP can be adjusted by varying the experimental conditions described above to match the requirements of the vaccine.
  • a particularly favored method of binding of antigens or antigenic determinants to the VLP is the linking of a lysine residue on the surface of the VLP with a cysteine residue on the antigen or antigenic determinant.
  • fusion of an amino acid linker containing a cysteine residue, as a second attachment site or as a part thereof, to the antigen or antigenic determinant for coupling to the VLP may be required.
  • amino acid linkers are favored.
  • amino acid linkers are the hinge region of Immunoglobulins, glycine serine linkers (GGGGS) n , and glycine linkers (G) n all further containing a cysteine residue as second attachment site and optionally further glycine residues.
  • said amino acid linkers are N-terminal gammal: CGDKTHTSPP; C-terminal gamma 1: DKTHTSPPCG; N-terminal gamma 3: CGGPKPSTPPGSSGGAP; C-terminal gamma 3: PKPSTPPGSSGGAPGGCG; N-terminal glycine linker: GCGGGG and C-terminal glycine linker: GGGGCG.
  • amino acid linkers particularly suitable in the practice of the invention when a hydrophobic antigen or antigenic determinant is bound to a VLP, are CGKKGG, or CGDEGG for N-terminal linkers, or GGKKGC and GGEDGC, for the C-terminal linkers.
  • the terminal cysteine is optionally C-terminally amidated.
  • GGCG, GGC or GGC-NH2 (“NH2" stands for amidation) linkers at the C-terminus of the peptide or CGG at its N-terminus are prefened as amino acid linkers.
  • amino acid linker GGC-NH2 is fused to the C-terminus of the antigen or antigenic determinant.
  • the cysteine residue present on the antigen or antigenic determinant has to be in its reduced state to react with the hetero-bifunctional cross-linker on the activated VLP, that is a free cysteine or a cysteine residue with a free sulfhydryl group has to be available.
  • the cysteine residue to function as binding site is in an oxidized form, for example if it is forming a disulfide bridge, reduction of this disulfide bridge with e.g. DTT, TCEP or ⁇ - mercaptoethanol is required.
  • Other methods of binding the antigen or antigenic determinant to the VLP include methods wherein the antigen or antigenic determinant is cross-linked to the VLP using the carbodiimide EDC, and NHS.
  • the antigen or antigenic determinant is attached to the VLP using a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO] 4 , BS 3 , (Pierce Chemical Company, Rockford, IL, USA) or other known homo-bifunctional cross-linkers whith functional groups reactive towards amine groups or carboxyl groups of the VLP.
  • a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO] 4 , BS 3 , (Pierce Chemical Company, Rockford, IL, USA) or other known homo-bifunctional cross-linkers whith functional groups reactive towards amine groups or carboxyl groups of the VLP.
  • VLP binding methods include methods where the VLP is biotinylated, and the antigen or antigenic determinant expressed as a streptavidin-fusion protein, or methods wherein both the antigen or antigenic determinant and the VLP are biotinylated, for example as described in WO 00/23955.
  • the antigen or antigenic determinant may be first bound to streptavidin or avidin by adjusting the ratio of antigen or antigenic determinant to streptavidin such that free binding sites are still available for binding of the VLP, which is added in the next step.
  • all components may be mixed in a "one pot" reaction.
  • ligand-receptor pairs where a soluble form of the receptor and of the ligand is available, and are capable of being cross-linked to the VLP or the antigen or antigenic determinant, may be used as binding agents for binding antigen or antigenic determinant to the VLP.
  • either the ligand or the receptor may be fused to the antigen or antigenic determinant, and so mediate binding to the VLP chemically bound or fused either to the receptor, or the ligand respectively. Fusion may also be effected by insertion or substitution.
  • the VLP is the VLP of a RNA phage, and in a more prefened embodiment, the VLP is the VLP of RNA phage Q ⁇ coat protein.
  • One or several antigen molecules i.e. one or several antigens or antigenic determinants, can be attached to one subunit of the capsid or VLP of RNA phages coat proteins, preferably through the exposed lysine residues of the VLP of RNA phages, if sterically allowable.
  • a specific feature of the VLP of the coat protein of RNA phages and in particular of the Q ⁇ coat protein VLP is thus the possibility to couple several antigens per subunit. This allows for the generation of a dense antigen array.
  • the binding and attachment, respectively, of the at least one antigen or antigenic determinant to the virus-like particle is by way of interaction and association, respectively, between at least one first attachment site of the virus-like particle and at least one second attachment of the antigen or antigenic determinant.
  • VLPs or capsids of Q ⁇ coat protein display a defined number of lysine residues on their surface, with a defined topology with three lysine residues pointing towards the interior of the capsid and interacting with the RNA, and four other lysine residues exposed to the exterior of the capsid. These defined properties favor the attachment of antigens to the exterior of the particle, rather than to the interior of the particle where the lysine residues interact with RNA.
  • VLPs of other RNA phage coat proteins also have a defined number of lysine residues on their surface and a defined topology of these lysine residues.
  • the first attachment site is a lysine residue and/or the second attachment comprises sulfhydryl group or a cysteine residue, h a very prefened embodiment of the present invention, the first attachment site is a lysine residue and the second attachment is a cysteine residue.
  • the antigen or antigenic determinant is bound via a cysteine residue, to lysine residues of the VLP of RNA phage coat protein, and in particular to the VLP of Q ⁇ coat protein.
  • VLPs derived from RNA phages are their high expression yield in bacteria that allows production of large quantities of material at affordable cost.
  • the inventive conjugates and anays differ from prior art conjugates in their highly organized structure, dimensions, and in the repetitiveness of the antigen on the surface of the array.
  • the use of the VLPs as carriers allow the formation of robust antigen anays and conjugates, respectively, with variable antigen density.
  • the use of VLPs of RNA phages, and hereby in particular the use of the VLP of RNA phage Q ⁇ coat protein allows to achieve very high epitope density. In particular, a density of more than 1.5 epitopes per subunit could be reached by coupling the human A ⁇ l-6 peptide to the VLP of Q ⁇ coat protein.
  • compositions of VLPs of RNA phage coat proteins with a high epitope density can be effected using the teaching of this application, h prefered embodiment of the invention, when an antigen or antigenic determinant is coupled to the VLP of Q ⁇ coat protein, an average number of antigen or antigenic determinant per subunit of 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6 , 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4 2.5, 2.6, 2.7, 2.8, 2.9, or higher is preferred.
  • the second attachment site may be either naturally or non-naturally present with the antigen or the antigenic determinant. In the case of the absence of a suitable natural occurring second attachment site on the antigen or antigenic determinant, such a, then non-natural second attachment has to be engineered to the antigen.
  • lysine residues are exposed on the surface of the VLP of Q ⁇ coat protein. Typically these residues are derivatized upon reaction with a cross-linker molecule. In the instance where not all of the exposed lysine residues can be coupled to an antigen, the lysine residues which have reacted with the cross-linker are left with a cross-linker molecule attached to the ⁇ -amino group after the derivatization step. This leads to disappearance of one or several positive charges, which may be detrimental to the solubility and stability of the VLP.
  • Q ⁇ -240 (Lysl3-Arg; SEQ ID NO:23), Q ⁇ -250 (Lys 2-Arg, Lysl3-Arg; SEQ ID NO: 25) and Q ⁇ -259 (Lys 2-Arg, Lysl6-Arg; SEQ ED NO:27).
  • the constructs were cloned, the proteins expressed, the VLPs purified and used for coupling to peptide and protein antigens.
  • Q ⁇ -251 (SEQ ID NO: 26) was also constructed, and guidance on how to express, purify and couple the VLP of Q ⁇ -251 coat protein can be found throughout the application.
  • a Q ⁇ mutant coat protein with one additional lysine residue suitable for obtaining even higher density anays of antigens.
  • This mutant Q ⁇ coat protein, Q ⁇ -243 (Asn 10-Lys; SEQ ED NO: 24) was cloned, the protein expressed, and the capsid or VLP isolated and purified, showing that introduction of the additional lysine residue is compatible with self-assembly of the subunits to a capsid or VLP.
  • antigen or antigenic determinant anays and conjugates, respectively may be prepared using VLP of Q ⁇ coat protein mutants.
  • a particularly favored method of attachment of antigens to VLPs, and in particular to VLPs of RNA phage coat proteins is the linking of a lysine residue present on the surface of the VLP of RNA phage coat proteins with a cysteine residue added to the antigen.
  • a cysteine residue In order for a cysteine residue to be effective as second attachment site, a sulfhydryl group must be available for coupling. Thus, a cysteine residue has to be in its reduced state, that is, a free cysteine or a cysteine residue with a free sulfhydryl group has to be available.
  • cysteine residue to function as second attachment site is in an oxidized form, for example if it is forming a disulfide bridge
  • reduction of this disulfide bridge with e.g. DTT, TCEP or ⁇ -mercaptoethanol is required.
  • concentration of reductand, and the molar excess of reductand over antigen has to be adjusted for each antigen.
  • a tifration range, starting from concentrations as low as 10 ⁇ M or lower, up to 10 to 20 mM or higher reductand if required is tested, and coupling of the antigen to the carrier assessed.
  • the pH of the dialysis or equilibration buffer is lower than 7, preferably 6. The compatibility of the low pH buffer with antigen activity or stability has to be tested.
  • Epitope density on the VLP of RNA phage coat proteins can be modulated by the choice of cross-linker and other reaction conditions.
  • the cross-linkers Sulfo-GMBS and SMPH typically allow reaching high epitope density.
  • Derivatization is positively influenced by high concentration of reactands, and manipulation of the reaction conditions can be used to control the number of antigens coupled to VLPs of RNA phage coat proteins, and in particular to VLPs of Q ⁇ coat protein.
  • the position at which it should be fused, inserted or generally engineered has to be chosen.
  • the selection of the position of the second attachment site may, by way of example, be based on a crystal structure of the antigen.
  • Such a crystal structure of the antigen may provide information on the availability of the C- or N- termini of the molecule (determined for example from their accessibility to solvent), or on the exposure to solvent of residues suitable for use as second attachment sites, such as cysteine residues.
  • Exposed disulfide bridges as is the case for Fab fragments, may also be a source of a second attachment site, since they can be generally converted to single cysteine residues through mild reduction, with e.g.
  • the second attachment site will be added such that it allows generation of antibodies against the site of interaction with the natural ligands.
  • the location of the second attachment site will be selected such that steric hindrance from the second attachment site or any amino acid linker containing the same is avoided.
  • an antibody response directed at a site distinct from the interaction site of the self-antigen with its natural ligand is desired.
  • the second attachment site may be selected such that it prevents generation of antibodies against the interaction site of the self-antigen with its natural ligands.
  • Other criteria in selecting the position of the second attachment site include the oligomerization state of the antigen, the site of oligomerization, the presence of a cofactor, and the availability of experimental evidence disclosing sites in the antigen structure and sequence where modification of the antigen is compatible with the function of the self-antigen, or with the generation of antibodies recognizing the self-antigen.
  • the antigen or antigenic determinant comprises a single second attachment site or a single reactive attachment site capable of association with the first attachment sites on the core particle and the VLPs or VLP subunits, respectively.
  • This further ensures a defined and uniform binding and association, respectively, of the at least one, but typically more than one, preferably more than 10, 20, 40, 80, 120 antigens to the core particle and VLP, respectively.
  • the provision of a single second attachment site or a single reactive attachment site on the antigen thus, ensures a single and unifonn type of binding and association, respectively leading to a very highly ordered and repetitive anay.
  • the binding and association, respectively is effected by way of a lysine- (as the first attachment site) and cysteine- (as a second attachment site) interaction, it is ensured, in accordance with this prefened embodiment of the invention, that only one cysteine residue per antigen, independent whether this cysteine residue is naturally or non-naturally present on the antigen, is capable of binding and associating, respectively, with the VLP and the first attachment site of the core particle, respectively.
  • an amino acid linker is bound to the antigen or the antigenic determinant by way of at least one covalent bond.
  • the amino acid linker comprises, or alternatively consists of, the second attachment site.
  • the amino acid linker comprises a sulfhydryl group or a cysteine residue.
  • the amino acid linker is cysteine.
  • the attachment site is selected to be a lysine or cysteine residue that is fused in frame to the HBcAg.
  • the antigen is fused to the C-terminus of HBcAg via a three leucine linker.
  • an antigen or antigenic determinant is linked to the VLP through a lysine residue, it may be advantageous to either substitute or delete one or more of the naturally resident lysine residues, as well as other lysine residues present in HBcAg variants.
  • lysine residues when the naturally resident lysine residues are eliminated, another lysine will be infroduced into the HBcAg as an attachment site for an antigen or antigenic determinant. Methods for inserting such a lysine residue are known in the art. Lysine residues may also be added without removing existing lysine residues.
  • the C-terminus of the HBcAg has been shown to direct nuclear localization of this protein. (Eckhardt et al, J. Virol. 65:575-582 (1991)). Further, this region of the protein is also believed to confer upon the HBcAg the ability to bind nucleic acids.
  • HBcAgs suitable for use in the practice of the present invention also include N-terminal truncation mutants.
  • Suitable truncation mutants include modified HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus.
  • variants of virus-like particles containing internal deletions within the sequence of the subunit composing the virus-like particle are also suitable in accordance with the present invention, provided their compatibility with the ordered or particulate structure of the virus-like particle.
  • internal deletions within the sequence of the HBcAg are suitable (Preikschat, P., et al, J. Gen. Virol. 80:1777-1788 (1999)).
  • HBcAgs suitable for use in the practice of the present invention include N- and C-terminal truncation mutants.
  • Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35, 36, 37, 38, 39 40, 41, 42 or 48 amino acids have been removed from the C-terminus.
  • Vaccine compositions of the invention can comprise mixtures of different HBcAgs.
  • these vaccine compositions can be composed of HBcAgs which differ in amino acid sequence.
  • vaccine compositions could be prepared comprising a "wild-type" HBcAg and a modified HBcAg in which one or more amino acid residues have been altered (e.g., deleted, inserted or substituted). In most applications, however, only one type of a HBcAg will be used.
  • the present invention is applicable to a wide variety of antigens.
  • the antigen is a protein, polypeptide or peptide.
  • the antigen is DNA.
  • the antigen can also be a lipid, a carbohydrate, or an organic molecule, in particular a small organic molecule such as nicotine.
  • Antigens of the invention can be selected from the group consisting of the following: (a) polypeptides suited to induce an immune response against cancer cells; (b) polypeptides suited to induce an immune response against infectious diseases; (c) polypeptides suited to induce an immune response against allergens; (d) polypeptides suited to induce an immune response in farm animals or pets; and (e) fragments (e.g., a domain) of any of the polypeptides set out in (a)-(d).
  • Preferred antigens include those from a pathogen (e.g. virus, bacterium, parasite, fungus) and tumors (especially tumor-associated antigens or "tumor markers"). Other prefened antigens are autoantigens.
  • pathogen e.g. virus, bacterium, parasite, fungus
  • tumors especially tumor-associated antigens or "tumor markers”
  • Other prefened antigens are autoantigens.
  • the antigen is the peptide p33 derived from lymphocytic choriomeningitis virus (LCMV).
  • LCMV lymphocytic choriomeningitis virus
  • the p33 peptide represents one of the best studied CTL epitopes (Pircher et al, "Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen," Nature 342:559 (1989); Tissot et al, “Characterizing the functionality of recombinant T-cell receptors in vitro: a pMHC tetramer based approach," J Immunol Methods 236:147 (2000); Bachmann et al., “Four types of Ca2+-signals after stimulation of naive T cells with T cell agonists, partial agonists and antagonists,"- Eur.
  • p33-specific T cells have been shown to induce lethal diabetic disease in transgenic mice (Ohashi et al, "Ablation of 'tolerance' and induction of diabetes by virus infection in viral antigen transgenic mice," Cell 65:305 (1991)) as well as to be able to prevent growth of tumor cells expressing p33 (Kiindig et al, "Fibroblasts act as efficient antigen-presenting cells in lymphoid organs," Science 268:1343 (1995); arriver et al., "CTL tumor therapy specific for an endogenous antigen does not cause autoimmune disease," J. Exp. Med. 186:645 (1997)).
  • This specific epitope therefore, is particularly well suited to study autoimmunity, tumor immunology as well as viral diseases.
  • the antigen or antigenic determinant is one that is useful for the prevention of infectious disease.
  • Such treatment will be useful to treat a wide variety of infectious diseases affecting a wide range of hosts, e.g., human, cow, sheep, pig, dog, cat, other mammalian species and non-mammalian species as well.
  • Treatable infectious diseases are well known to those skilled in the art, and examples include infections of viral etiology such as H ⁇ V, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, Papilloma virus etc.; or infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc.
  • viral etiology such as H ⁇ V, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, Papilloma virus etc.
  • infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.
  • infections of parasitic etiology such as malaria
  • antigens or antigenic determinants selected for the compositions of the invention will be well known to those in the medical art; examples of antigens or antigenic determinants include the following: the HFV antigens gpl40 and gpl60; the influenza antigens hemagglutinin, M2 protein and neuraminidase, Hepatitis B surface antigen or core and circumsporozoite protein of malaria or fragments thereof.
  • antigens include infectious microbes such as viruses, bacteria and fungi and fragments thereof, derived from natural sources or synthetically.
  • Infectious viruses of both human and non-human vertebrates include retroviruses, RNA viruses and DNA viruses.
  • the group of retroviruses includes both simple retroviruses and complex retroviruses.
  • the simple retroviruses include the subgroups of B-type retroviruses, C-type retroviruses and D-type retroviruses.
  • An example of a B-type retrovirus is mouse mammary tumor virus (MMTV).
  • the C-type retroviruses include subgroups C-type group A (including Rous sarcoma virus (RSV), avian leukemia virus (ALV), and avian myeloblastosis virus (AMV)) and C-type group B (including murine leukemia virus (MLV), feline leukemia virus (FeLV), murine sarcoma virus (MSV), gibbon ape leukemia virus (GALV), spleen necrosis virus (SNV), reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)).
  • the D-type retroviruses include Mason-Pfizer monkey virus (MPMV) and simian retrovirus type 1 (SRV-1).
  • the complex retroviruses include the subgroups of lentiviruses, T-cell leukemia viruses and the foamy viruses.
  • Lentiviruses include HEV-1, but also include HEV-2, SEV, Visna virus, feline immunodeficiency virus (FEV), and equine infectious anemia virus (EIAV).
  • the T-cell leukemia viruses include HTLV-1, HTLV- II, simian T-cell leukemia virus (STLV), and bovine leukemia virus (BLV).
  • the foamy viruses include human foamy virus (HFV), simian foamy virus (SFV) and bovine foamy virus (BFV).
  • RNA viruses that are antigens in vertebrate animals include, but are not limited to, the following: members of the family Reoviridae, including the genus Orthoreovirus (multiple serotypes of both mammalian and avian retroviruses), the genus Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus, African horse sickness virus, and Colorado Tick Fever virus), the genus Rotavirus (human rotavirus, Kansas calf diarrhea virus, murine rotavirus, simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the family Picomaviridae, including the genus Enterovirus (poliovirus, Coxsackie virus A and B, enteric cytopathic human o ⁇ han (ECHO) viruses, hepatitis A, C, D, E and G viruses, Simian enteroviruses, Murine encephalomyelitis (ME) viruses, Poliovirus murine
  • the family Bunyaviridae including the genus Bunyvirus (Bunyamwera and related viruses, California encephalitis group viruses), the genus Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever virus), the genus Nairovirus (Crimean-Congo hemonhagic fever virus, Kenya sheep disease virus), and the genus Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus Influenza virus (Influenza virus type A, many human
  • the family Bunyaviridae including the genus Bunyvirus (Bunyamwera and related viruses, California encephalitis group viruses), the genus Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever virus), the genus Nairovirus (Crimean- Congo hemonhagic fever virus, Kenya sheep disease virus), and the genus Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus Influenza virus (Influenza virus type A, many human subtype
  • Illustrative DNA viruses that are antigens in vertebrate animals include, but are not limited to: the family Poxviridae, including the genus Orthopoxvirus (Variola major, Variola minor, Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ecfromelia), the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus (Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox, goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus (contagious postular dermatitis virus, pseudocowpox, bovine papular stomatitis virus); the family Iridoviridae (African swine fever virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the family He ⁇ esviridae
  • the antigen comprises one or more cytotoxic T cell epitopes, Th cell epitopes, or a combination of the two epitopes.
  • the methods of the preferred embodiments are particularly well suited for treatment of other mammals or other animals, e.g., birds such as hens, chickens, turkeys, ducks, geese, quail and pheasant. Birds are prime targets for many types of infections.
  • CIAV chicken infectious anemia virus
  • Vaccination of birds, like other vertebrate animals can be performed at any age. Normally, vaccinations are performed at up to 12 weeks of age for a live microorganism and between 14-18 weeks for an inactivated microorganism or other type of vaccine. For in ovo vaccination, vaccination can be performed in the last quarter of embryo development.
  • the vaccine can be administered subcutaneously, by spray, orally, intraocularly, intrafracheally, nasally, in ovo or by other methods described herein.
  • Cattle and livestock are also susceptible to infection. Disease which affect these animals can produce severe economic losses, especially amongst cattle.
  • the methods of the invention can be used to protect against infection in livestock, such as cows, horses, pigs, sheep and goats.
  • Bovine viral diarrhea virus (BVDV) is a small enveloped positive-stranded RNA virus and is classified, along with hog cholera virus (HOCV) and sheep border disease virus (BDV), in the pestivirus genus.
  • HOCV hog cholera virus
  • BDV sheep border disease virus
  • Pestiviruses were previously classified in the Togaviridae family, some studies have suggested their reclassification within the Flaviviridae family along with the flavivirus and hepatitis C virus (HCV) groups.
  • Equine he ⁇ esviruses comprise a group of antigenically distinct biological agents which cause a variety of infections in horses ranging from subclinical to fatal disease. These include Equine he ⁇ esvirus-1 (EHV-1), a ubiquitous pathogen in horses. EHV-1 is associated with epidemics of abortion, respiratory tract disease, and cenfral nervous system disorders. Other EHV's include EHV-2, or equine cytomegalo virus, EHV-3, equine coital exanthema virus, and EHV-4, previously classified as EHV-1 subtype 2.
  • Sheep and goats can be infected by a variety of dangerous microorganisms including visna-maedi.
  • Cats both domestic and wild, are susceptible to infection with a variety of microorganisms.
  • feline infectious peritonitis is a disease which occurs in both domestic and wild cats, such as lions, leopards, cheetahs, and jaguars.
  • the methods of the invention can be used to vaccinate cats to prevent them against infection.
  • feline leukemia virus FeLV
  • feline sarcoma virus FeSV
  • endogenous type C oncomavirus RD-114
  • feline syncytia- forming virus FeSFV
  • feline T-lymphofropic lenti virus also refened to as feline immiinodeficiency
  • Feline infectious peritonitis FEP is a sporadic disease occurring unpredictably in domestic and wild Felidae.
  • FEP is primarily a disease of domestic cats, it has been diagnosed in lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller wild cats that have been afflicted with FEP include the lynx and caracal, sand cat and pallas cat.
  • the fish immune system has many features similar to the mammalian immune system, such as the presence of B cells, T cells, lymphokines, complement, and immunoglobulins. Fish have lymphocyte subclasses with roles that appear similar in many respects to those of the B and T cells of mammals. Vaccines can be administered orally or by immersion or injection.
  • Aquaculture species include but are not limited to fin-fish, shellfish, and other aquatic animals.
  • Fin-fish include all vertebrate fish, which may be bony or cartilaginous fish, such as, for example, salmonids, ca ⁇ , catfish, yellowtail, seabream and seabass.
  • Salmonids are a family of fin-fish which include trout (including rainbow trout), salmon and Arctic char.
  • shellfish include, but are not limited to, clams, lobster, shrimp, crab and oysters.
  • Other cultured aquatic animals include, but are not limited to, eels, squid and octopi.
  • Polypeptides of viral aquaculture pathogens include but are not limited to glycoprotein or nucleoprotein of viral hemonhagic septicemia virus (VHSV); G or N proteins of infectious hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural proteins of infectious pancreatic necrosis virus (JPNV); G protein of spring viremia of ca ⁇ (SVC); and a membrane- associated protein, tegumin or capsid protein or glycoprotein of channel catfish virus (CCV).
  • VHSV viral hemonhagic septicemia virus
  • IHNV infectious hematopoietic necrosis virus
  • JPNV infectious pancreatic necrosis virus
  • SVC G protein of spring viremia of ca ⁇
  • CMV channel catfish virus
  • Polypeptides of bacterial pathogens include but are not limited to an iron-regulated outer membrane protein, (IROMP), an outer membrane protein (OMP), and an A-protein of Aeromonis salmonicida which causes furunculosis, p57 protein of Renibacterium salmoninarum which causes bacterial kidney disease (BKD), major surface associated antigen (msa), a surface expressed cytotoxin (mpr), a surface expressed hemolysin (ish), and a flagellar antigen of Yersiniosis; an extracellular protein (ECP), an iron- regulated outer membrane protein (IROMP), and a structural protein of Pasteurellosis; an OMP and a flagellar protein of Vibrosis anguillarum and V.
  • IROMP iron-regulated outer membrane protein
  • OMP outer membrane protein
  • Vibrosis anguillarum and V.
  • ordalii a flagellar protein, an OMP protein, aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and surface antigen of Ichthyophthirius; and a structural and regulatory protein of Cytophaga columnari; and a structural and regulatory protein of Rickettsia.
  • Polypeptides of a parasitic pathogen include but are not limited to the surface antigens of Ichthyophthirius.
  • vaccine compositions suitable for use in methods for preventing and/or attenuating diseases or conditions which are caused or exacerbated by "self gene products (e.g., tumor necrosis factors).
  • vaccine compositions of the invention include compositions which lead to the production of antibodies that prevent and/or attenuate diseases or conditions caused or exacerbated by "self gene products.
  • diseases or conditions include graft versus host disease, IgE-mediated allergic reactions, anaphylaxis, adult respiratory distress syndrome, Crohn's disease, allergic asthma, acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma (NHL), Graves' disease, systemic lupus erythematosus (SLE), inflammatory autoimmune diseases, myasthenia gravis, immunoproliferative disease lymphadenopathy (EPL), angioimmunoproliferative lymphadenopathy (AIL), immunoblastive lymphadenopathy (EBL), rheumatoid arthritis, diabetes, prion diseases, multiple sclerosis, Alzheimer disease and osteoporosis.
  • compositions of the invention are an immunotherapeutic that can be used for the freatment and/or prevention of allergies, cancer or drug addiction.
  • antigens or antigenic determinants for the preparation of compositions and for use in methods of treatment for allergies would be known to those skilled in the medical arts treating such disorders.
  • Representative examples of such antigens or antigenic determinants include the following: bee venom phospholipase A 2 , Bet v I (birch pollen allergen), 5 Dol m V (white-faced hornet venom allergen), and Der p I (House dust mite allergen), as well as fragments of each which can be used to elicit immunological responses.
  • antigens or antigenic determinants for compositions and methods of treatment for cancer would be known to those skilled in the medical arts treating such disorders (see Renkvist et al, Cancer. Immunol. Immunother. 50:3-15 (2001) which is inco ⁇ orated by reference), and such antigens or antigenic determinants are included within the scope of the present invention.
  • antigens or antigenic determinants include the following: Her2 (breast cancer); GD2 (neuroblastoma); EGF-R (malignant ghoblastoma); CEA (medullary thyroid cancer); CD52 (leukemia); human melanoma protein gplOO; human melanoma protein gplOO epitopes such as amino acids 154-162 (sequence: KTWGQYWQV), 209-217 (ITDQVPFSV), 280-288 (YLEPGPVTA), 457- 466 (LLDGTATLRL) and 476-485 (VLYRYGSFSV); human melanoma protein melan-A/MART-1; human melanoma protein melan- A/MART- 1 epitopes such as amino acids 27-35 (AAGIGILTV) and 32- 40 (ILTVILGVL); tyrosinase and tyrosinase related proteins (e.
  • CEA epitopes such as amino acids 571-579 (YLSGANLNL); p53 protein; p53 protein epitopes such as amino acids 65-73 (RMPEAAPPV), 149-157 (STPPPGTRV) and 264-272 (LLGRNSFEV); Her2/neu epitopes such as amino acids 369-377 (KIFGSLAFL) and 654-662 (IISAVVGIL); NY-ESO-1 peptides 157-165 and 157-167, 159-167; HPV16 E7 protein; HPV16 E7 protein epitopes such as amino acids 86-93 (TLGEVCPE); as well as fragments of each which can be used to elicit immunological responses.
  • YLSGANLNL p53 protein
  • p53 protein epitopes such as amino acids 65-73 (RMPEAAPPV), 149-157 (STPPPGTRV) and 264-272 (LLGRNSFEV)
  • Her2/neu epitopes such as amino acids 369-377
  • antigens or antigenic determinants for compositions and methods of treatment for drug addiction, in particular recreational drug addiction, would be known to those skilled in the medical arts treating such disorders.
  • antigens or antigenic determinants include, for example, opioids and mo ⁇ hine derivatives such as codeine, fentanyl, heroin, mo ⁇ hium and opium; stimulants such as amphetamine, cocaine, MDMA (methylenedioxymethamphetamine), methamphetamine, methylphenidate and nicotine; hallucinogens such as LSD, mescaline and psilocybin; as well as cannabinoids such as hashish and marijuana.
  • opioids and mo ⁇ hine derivatives such as codeine, fentanyl, heroin, mo ⁇ hium and opium
  • stimulants such as amphetamine, cocaine, MDMA (methylenedioxymethamphetamine), methamphetamine, methylphenidate and nicotine
  • hallucinogens such as LSD, mesca
  • antigens or antigenic determinants for compositions and methods of treatment for other diseases or conditions associated with self antigens would be also known to those skilled in the medical arts treating such disorders.
  • Representative examples of such antigens or antigenic determinants are, for example, lymphotoxins (e.g.
  • Lymphotoxin (LT ⁇ ), Lymphotoxin ⁇ (LT ⁇ )), and lymphotoxin receptors, Receptor activator of nuclear factor kappaB ligand (RANKL), vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGF-R), Interleukin 17 and amyloid beta peptide (A ⁇ 1-42 ), TNF ⁇ , MB?, MCP-1, SDF-1, Rank-L, M-CSF, Angiotensin II, Endoglin, Eotaxin, Grehlin, BLC, CCL21, IL-13, IL-17, IL-5, IL-8, IL-15, Bradykinin, Resistin, LHRH, GHRH, GEH, CRH, TRH and Gastrin, as well as fragments of each which can be used to elicit immunological responses.
  • RNKL nuclear factor kappaB ligand
  • VEGF vascular endotheli
  • the antigen or antigenic determinant is selected from the group consisting of: (a) a recombinant polypeptide of HEV; (b) a recombinant polypeptide of Influenza virus (e.g., an Influenza virus M2 polypeptide or a fragment thereof); (c) a recombinant polypeptide of Hepatitis C virus; (d) a recombinant polypeptide of Hepatitis B virus (e) a recombinant polypeptide of Toxoplasma; (f) a recombinant polypeptide of Plasmodium falciparum; (g) a recombinant polypeptide of Plasmodium vivax; (h) a recombinant polypeptide of Plasmodium ovale; (i) a recombinant polypeptide of Plasmodium malariae; j) a recombinant polypeptide of breast cancer cells; (k) a recombinant polypeptide of
  • the antigen being coupled, fused or otherwise attached to the virus-like particle, is a T cell epitope, either a cytotoxic or a Th cell epitope.
  • the antigen is a combination of at least two, preferably different, epitopes, wherein the at least two epitopes are linked directly or by way of a linking sequence. These epitopes are preferably selected from the group consisting of cytotoxic and Th cell epitopes.
  • a mosaic virus-like particle e.g. a virus-like particle composed of subunits attached to different antigens and epitopes, respectively
  • a composition of the present invention can be, for example, obtained by transforming E.coli with two compatible plasmids encoding the subunits composing the virus-like particle fused to different antigens and epitopes, respectively.
  • the mosaic virus-like particle is assembled either directly in the cell or after cell lysis.
  • such an inventive composition can also be obtained by attaching a mixture of different antigens and epitopes, respectively, to the isolated virus-like particle.
  • the antigen of the present invention can be synthesized or recombinantly expressed and coupled to the virus-like particle, or fused to the virus-like particle using recombinant DNA techniques.
  • Exemplary procedures describing the attachment of antigens to virus-like particles are disclosed in WO 00/32227, in WO 01/85208 and in WO 02/056905, the disclosures of which are herewith inco ⁇ orated by reference in its entirety
  • the invention also provides a method of producing a composition for enhancing an immune response in an animal comprising a VLP and an immunostimulatory substance, preferably an unmethylated CpG-containing oligonucleotide bound to the VLP which comprises incubating the VLP with the immunostimulatory substance and oligonucleotide, respectively, adding RNase and purifying said composition, hi an equally prefened embodiment, the method comprises incubating the VLP with RNase, adding the immunostimulatory substance and oligonucleotide, respectively, and purifying the composition.
  • the VLP is produced in a bacterial expression system.
  • the RNase is RNase A.
  • the invention further provides a method of producing a composition for enhancing an immune response in an animal comprising a VLP bound to an immunostimulatory substance, preferably to an unmethylated CpG- containing oligonucleotide which comprises disassembling the VLP, adding the immunostimulatory substance and oligonucleotide, respectively, and reassembling the VLP.
  • the method can further comprise removing nucleic acids of the disassembled VLP and/or purifying the composition after reassembly.
  • the invention also provides vaccine compositions which can be used for preventing and/or attenuating diseases or conditions.
  • Vaccine compositions of the invention comprise, or alternatively consist of, an immunologically effective amount of the inventive immune enhancing composition together with a pharmaceutically acceptable diluent, carrier or excipient.
  • the vaccine can also optionally comprise an adjuvant.
  • the invention further provides vaccination methods for preventing and/or attenuating diseases or conditions in animals, h one embodiment, the invention provides vaccines for the prevention of infectious diseases in a wide range of animal species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc.
  • Vaccines can be designed to treat infections of viral etiology such as HFV, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, etc.; or infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc.
  • viral etiology such as HFV, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, etc.
  • infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.
  • infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis,
  • the invention provides vaccines for the prevention of cancer in a wide range of species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc.
  • Vaccines can be designed to treat all types of cancer including, but not limited to, lymphomas, carcinomas, sarcomas and melanomas.
  • compositions of the invention when administered to an animal, they can be in a composition which contains salts, buffers, adjuvants or other substances which are desirable for improving the efficacy of the composition.
  • materials suitable for use in preparing pharmaceutical compositions are provided in numerous sources including REMINGTON'S PHARMACEUTICAL SCIENCES (Osol, A, ed., Mack Publishing Co., (1990)).
  • adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Cahnette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.
  • compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology.
  • the adjuvants can also comprise a mixture of these substances.
  • compositions of the invention are said to be “pharmacologically acceptable” if their administration can be tolerated by a recipient individual. Further, the compositions of the invention will be administered in a "therapeutically effective amount” (i.e., an amount that produces a desired physiological effect).
  • compositions of the present invention can be administered by various methods known in the art.
  • the particular mode selected will depend of course, upon the particular composition selected, the severity of the condition being freated and the dosage required for therapeutic efficacy.
  • the methods of the invention generally speaking, can be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
  • modes of administration include oral, rectal, parenteral, intracistemal, intravaginal, intraperitoneal, topical (as by powders, ointments, drops or transdermal patch), bucal, or as an oral or nasal spray.
  • parenteral refers to modes of administration which include infravenous, intramuscular, infraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the composition of the invention can also be injected directly in a lymph node.
  • compositions for administration include sterile aqueous (e.g., physiological saline) or non-aqueous solutions and suspensions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen abso ⁇ tion.
  • Combinations can be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concunently; or sequentially.
  • Administration "in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.
  • Dosage levels depend on the mode of administration, the nature of the subject, and the quality of the carrier/adjuvant formulation. Typical amounts are in the range of about 0.1 ⁇ g to about 20 mg per subject. Preferred amounts are at least about 1 ⁇ g to about 100 ⁇ g per subject. Multiple administration to immunize the subject is prefened, and protocols are those standard in the art adapted to the subject in question.
  • compositions can conveniently be presented in unit dosage form and can be prepared by any of the methods well-known in the art of pharmacy. Methods include the step of bringing the compositions of the invention into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compositions of the invention into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • Compositions suitable for oral administration can be presented as discrete units, such as capsules, tablets or lozenges, each containing a predetermined amoxmt of the compositions of the invention. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, an elixir or an emulsion.
  • Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions of the invention described above, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art.
  • compositions of the invention include processes for the production of the compositions of the invention and methods of medical treatment for cancer and allergies using said compositions.
  • HBcAg containing peptide p33 from LCMV is given in Figure IB.
  • the p33-HBcAg VLPs (p33-VLPs) were generated as follows: Hepatitis B clone pEco63 containing the complete viral genome of Hepatitis B virus was purchased from ATCC. The gene encoding HBcAg was introduced into the EcoRI/Hindlll restriction sites of expression vector pkk223.3 (Pharmacia) under the control of a strong tac promoter.
  • the p33 peptide (KAVYNFATM) derived from lymphocytic choriomeningitis virus (LCMV) was fused to the C-terminus of HBcAg (1-185) via a three leucine- lifrker by standard PCR methods.
  • a clone of E. coli K802 selected for good expression was transfected with the plasmid, and cells were grown and resuspended in 5 ml lysis buffer (10 mM Na 2 HPO 4 , 30 mM NaCl, 10 mM EDTA, 0.25 % Tween-20, pH 7.0). 200 ⁇ l of lysozyme solution (20 mg/ml) was added.
  • CpG-containing oligonucleotides can be packaged into HBcAg VLPs.
  • RNA/DNA or protein Recombinant p33-VLPs were run on a native agarose (1%) gel electrophoresis and stained with ethidium bromide or Coomassie blue for the detection of RNA/DNA or protein (Figure 3).
  • Bacterial produced VLPs contain high levels of single stranded RNA, which is presumably binding to the arginine repeats appearing near the C-terminus of the HBcAg protein and being geographically located inside the VLPs as shown by X-ray crystallography.
  • the contaminating RNA can be easily digested and so eliminated by incubating the VLPs with RNase A.
  • the highly active RNase A enzyme has a molecular weight of about 14 kDa and is presumably small enough to enter the VLPs to eliminate the undesired ribonucleic acids.
  • the recombinant p33-VLPs were supplemented with CpG- oligonucleotides (Figure 1A) before digestion with RNase A. As shown in Figure 4 the presence of CpG-oligonucleotides preserved the capsid structure as shown by similar migration compared to untreated p33-VLPs.
  • the CpG- oligonucleotide-containing VLPs were purified from unbound oligonucleotides via dialysis (4500-fold dilution in PBS for 24 hours using a 300 kDa MWCO dialysis membrane) ( Figure 5).
  • CpG-oligonucleotides can be packaged into VLPs by removal of the RNA with RNAse and subsequent packaging of oligonucleotides into VLPs.
  • the p33-VLPs (containing bacterial single-stranded RNA) were first incubated with RNase A to remove the RNA and in a second step the immunostimulating CpG-oligonucleotides (with normal phosphodiester bonds but also with phosphorothioate modification of the phosphate backbone) was supplemented to the samples (Figure 6). This experiment clearly shows that the CpG-oligonucleotides are not absolutely required simultaneously during the RNA degradation reaction but can be added at a later time.
  • VLPs containing CpG-oligonucleotides induce enhanced anti-viral protection.
  • mice were subcutaneously primed with 100 ⁇ g CpG-oligonucleotide containing p33-VLPs. Before immunization, p33-VLP preparations were extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). As controls mice were subcutaneously primed with 100 ⁇ g p33-VLP alone, mixed with 20 nmol CpG-oligonucleotide, with 20 nmol CpG-oligonucleotide alone or left untreated. Twenty-one days later, mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M.
  • LCMV 200 pfu, intravenously
  • BK virus is a non-enveloped double stranded DNA virus belonging to the polyoma virus subfamily of the papovaviridae.
  • VPl is the major capsid protem.
  • VPl has 362 amino acids ( Figure 10) and is 42 kDa in size.
  • the capsid is organized in 72 VPl pentamers forming an icosahedral structure.
  • the capsids have a diameter of approximately 45 nm.
  • VLPs produced in yeast contain small amounts of RNA which can be easily digested and so eliminated by incubating the VLPs with RNase A.
  • the highly active RNase A enzyme has a molecular weight of about 14 kDa and is small enough to enter the VLPs to eliminate the undesired ribonucleic acids.
  • Recombinantly produced BKV VLPs were concentrated to 1 mg/ml in PBS buffer pH7.2 and incubated in the absence or presence of RNase A (200 ⁇ g/ml, Roche Diagnostics Ltd, Switzerland) for 3 h at 37°C.
  • BKV VLPs were supplemented with 75 nmol/ml fluorescein labeled phosphorothioate CpG-FAM oligonucleotide and incubated for 3 h at 37°C. Subsequently BKV VLPs were subjected to DNasel digestion for 3 h at 37°C (40 u/ml AMPD1, Sigma, Division of Fluka AG, Switzerland) or loaded without DNasel digestion. The samples were complemented with 6-fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8% native tris-acetate pH 7.5 agarose gel.
  • Figure 12 shows BKV VLPs in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with fluorescent CpG-FAM oligonucleotides (oligonucleotide from Figure 1A with a 5'-fluorescein-label) upon staining with ethidium bromide or without ethidium bromide staining.
  • fluorescent CpG-FAM oligonucleotides oligonucleotide from Figure 1A with a 5'-fluorescein-label
  • the RNase A treated recombinant BKV VLPs (Example 6) were supplemented with 50 ⁇ g/ml (ds) DNA fragments (246 bp in length, Figure 11) and incubated for 3 h at 37°C.
  • the samples were complemented with 6-fold concentrated DNA- loading buffer (10 mM Tris pH8.0, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8% native tris-acetate pH8.0 agarose gel.
  • Figure 13 shows BKV VLPs (15 ⁇ g) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with (ds) DNA upon staining with ethidium bromide or Coomassie Blue in order to assess the presence of RNA DNA or protem.
  • Packaged DNA molecules are visible in the presence of ethidium bromide as a band with the same migration as the VLP band visualized with Coomassie Blue.
  • CpG-containing oligonucleotides can be packaged into BKV VLPs.
  • the RNase A treated recombinant BKV VLPs (Example 6) were supplemented with 150 nmol/ml CpG-oligonucleotides with phosphodiester backbone or with phosphorothioate backbone and incubated for 3 h at 37°C.
  • VLP preparations for mouse immunization were extensively dialysed (10,000-fold diluted) for 24 h against PBS pH7.2 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNase A and the excess of CpG-oligonucleotides.
  • the samples were complemented with 6- fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8% native tris-acetate pH7.5 agarose gel.
  • Figure 14 shows BKV VLPs (15 ⁇ g) in a native 0.8% agarose gel electrophoresis after confrol incubation or after digestion with RNase A and subsequent incubation with CpG-oligonucleotides (with phosphodiester- or with phosphorothioate backbone) upon staining with ethidium bromide (A) or Coomassie Blue (B) in order to assess the presence of RNA/DNA or protein and the reduction of unbound CpG-oligonucleotides after dialysis. Unbound CpG-oligonucleotides are visible as a low molecular weight ethidium bromide stained band.
  • VLPs containing CpG-oligonucleotides induce enhanced Thl directed immune response.
  • mice Female BALB/c mice (three mice per group) were subcutaneously injected with 10 ⁇ g BKV VLPs containing phosphorothioate CpG- oligonucleotide ( Figure 1A). As controls mice were subcutaneously injected with either 10 ⁇ g of RNase treated BKV VLPs alone or BKV VLPs mixed with 0.3 nmol or 20 nmol phosphorothioate CpG-oligonucleotides in 200 ⁇ l PBS pH7.2 or were left untreated. BKV VLPs were prepared as described in Example 8 and before immunization extensively purified from unbound CpG- oligonucleotide by dialysis. On day 14 after immunization blood was taken and IgGl and IgG2a antibody response to BKV VLPs was determined.
  • FIG. 15 shows IgGl and IgG2a antibody response to BKV VLPs on day 14 after immxmization.
  • Immunization with RNase A treated BKV VLPs containing phosphorothioate CpG-oligonucleotides results in a decreased IgGl and an increased anti-BKV VLP IgG2a titer as compared to immunization with the same amount (0.3 nmol) of CpG-oligonucleotides mixed with BKV VLPs or BKV VLPs alone.
  • mice immunized with BKV VLPs mixed with 20 nmol phosphorothioate CpG-oligonucleotides show very low IgGl and high IgG2a titers.
  • the decrease in IgGl titer and the increase in IgG2a titer as compared to controls demonstrates a Thl cell directed irnmiine response induced by phosphorothioate CpG-oligonucleotides packaged in BKV VLPs.
  • Figure 15 clearly demonsfrates the higher potency of BKV VLPs containing CpG-oligonucleotides packaged within the particles as compared to BKV VLPs simply mixed with CpG-oligonucleotides.
  • dsDNA Linear double-stranded DNA
  • VLPs Linear double-stranded DNA
  • the p33-VLPs preparations (containing bacterial RNA) (EXAMPLE 1) were first incubated with RNaseA to remove the RNA and in a second step the linear dsDNA (350 bp long) was supplemented to the samples ( Figure 16).
  • the migration of the p33-VLPs packaged with the dsDNA was similar to the one of p33 -VLP containing RNA. This experiment shows that linear dsDNA of at least 350 base pairs in length can be packaged into the virus-like particles.
  • Immunostimulatory nucleic acids can be packaged into HBcAg VLPs comprising fusion proteins with antigens.
  • HBcAg VLPs when produced in E. coli by expressing the Hepatitis B core antigen fusion protein HBc33 (Example 1) or the fusion protein to the peptide PI A (HBcPlA), contain RNA which can be digested and so eliminated by incubating the VLPs with RNase A.
  • the gene PI A codes for a protein that is expressed by the mastocytoma tumor cell line P815.
  • the dominant CTL epitope termed P1A peptide
  • P1A peptide binds to MHC class I (Ld) and the complex is recognized by specific CTL clones (Brandle et al., 1998, Eur. J. Immunol. 28: 4010-4019).
  • Fusion of peptide P1A-1 (LPYLGWLVF) to the C-tenninus of HBcAg (aa 185, see Example 1) was performed by PCR using appropriate primers using standard molecular biology techniques.
  • a three leucine linker was cloned between the HBcAg and the peptide sequence. Expression was performed as described in Example 1.
  • the fusion protein of HBcAg with PI A termed HBcPlA, formed capsids when expressed in E. coli which could be purified similar to the procedure described in Example 1.
  • HBcAg-p33 Recombinantly produced HBcAg-p33 (HBc33) and HBcAg-Pl A (HBcPlA) VLPs at a concentration of 1.0 mg/ml in 1 x PBS buffer (KC1 0.2g/L, KH2PO4 0.2g/L, NaCl 8 g/L, Na2HPO4 1.15 g/L) pH 7.4, were incubated in the presence of 300 ⁇ g/ml RNase A (Qiagen AG, Switzerland) for 3 h at 37°C in a thermomixer at 650 ⁇ m.
  • RNase A Qiagen AG, Switzerland
  • RNAse A HBcAg-p33 VLPs were supplemented with 130 nmol/ml CpG- oligonucleotides B-CpG, NKCpG, G10-PO (Table I).
  • the 150mer single-stranded Cyl50-1 and 253mer double stranded dsCyCpG-253, both containing multiple copies of CpG motifs were added at 130 nmol/ml or 1.2 nmol/ml, respectively, and incubated in a thermomixer for 3 h at 37°C.
  • Double stranded CyCpG-253 DNA was produced by cloning a double stranded multimer of CyCpG into the EcoRV site of pBluescript KS-.
  • the resulting plasmid produced in E. coli XLl-blue and isolated using the Qiagen Endofree plasmid Giga Kit, was digested with restriction endonucleases Xhol and Xbal and resulting restriction products were separated by agarose electrophoresis.
  • the 253 bp insert was isolated by electro-elution and ethanol precipitation. Sequence was verified by sequencing of both strands.
  • Table I Sequences of immunostimulatory nucleic acids used in the Examples.
  • DNAse I treatment Packaged HBcAg-p33 VLPs were subsequently subjected to DNasel digestion (5 U/ml) for 3 h at 37°C (DNasel, RNase free Fluka AG, Switzerland) and were extensively dialysed (2 x against 200-fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNAse A and the excess of CpG-oligonucleotides.
  • Benzonase treatment Since some single stranded oligodeoxynucleotides were partially resistant to DNasel treatment, Benzonase treatment was used to eliminate free oligonucleotides from the preparation. 100-120 U/ml Benzonase (Merck KGaA, Darmstadt, Germany) and 5 mM MgCl 2 were added and incubated for 3 h at 37°C before dialysis.
  • VLP preparations packaged with immunostimulatroy nucleic acids used in mouse immunization experiments were extensively dialysed (2x against 200fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical Industries, Houston, US) to eliminate added enzymes and free nucleic acids.
  • capsid 2-30 ⁇ g of capsid were mixed with 1 volume of 2x loading buffer (IxTBE, 42% w/v urea, 12% w/v Ficoll, 0.01 % Bromphenolblue), heated for 3 min at 95°C and loaded on a 10% (for oligonucleotides of about 20 nt length) or 15% (for > than 40 mer nucleic acids) TBE/urea polyacrylamid gel (Invitrogen). Alternatively samples were loaded on a 1 % agarose gel with 6x loading dye (10 mM Tris pH 7.5, 50 mM EDTA, 10% v/v glycerol, 0.4 % orange G). TBE/urea gels were stained with CYBRGold and agarose gels with stained with ethidium bromide.
  • 2x loading buffer IxTBE, 42% w/v urea, 12% w/v Ficoll, 0.01 % Bromphenolblue
  • Figures 17, 18 and 19 show the packaging of B-CpG, NKCpG and G10-PO oligonucleotides into HBc33.
  • RNA content in the VLPs was strongly reduced after RNaseA treatment ( Figure 17A, 18 A, 19A) while most of the capsid migrated as a a slow migrating smear presumably due to the removal of the negatively charged RNA ( Figure 17B, 18B, 19B).
  • Figures 17B, 18B, 19B After incubation with an excess of oligonucleotid the capsids contained a higher amount of nucleic acid than the RNAseA treated capsids and therefore migrated at similar velocity as the untreated capsids.
  • Figure 20 shows packaging of a large single-stranded oligonucleotide Cyl50-1 into HBc33.
  • Cyl50-1 contains 7.5 repeats of CyCpG and was synthesized according standard oligonucleotide synthesis methods (EBA, G ⁇ ttingen, Germany).
  • RNA content in the capsid was strongly reduced after RNaseA treatment while most of the capsid migrated as a slow migrating smear ( Figure 20A, B).
  • Capsid were diluted with 4 volumes of water and concentrated to 1 mg/ml. After incubation with an excess of Cyl50-1 the capsid contained a bigger amount of nucleic acid and thus migrated at similar velocity as the untreated capsids.
  • Figure 21 shows packaging of oligonucleotide NKCpGpt in HBcPlA. Treatment with RNAse reduced nucleic acid content and slowed migration of the capsids. Addition of NKCpGpt restored nucleic acid content in capsids and fast migration.
  • Figure 17 depicts the analysis of B-CpG packaging into HBc33 VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 50 ⁇ g of the following samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A; 3. HBc33 VLP treated with RNase A and packaged with B-CpG; 4. HBc33 VLP treated with RNase A, packaged with B-CpG and treated with DNasel; 5. HBc33 VLP treated with RNase A, packaged with B-CpG, treated with DNasel and dialysed; 6. 1 kb MBI Fermentas DNA ladder.
  • (C) depicts the analysis of the amount of packaged oligo extracted from the VLP on a 1.5% agarose gel stained with ethidium bromide: Loaded on gel are the following samples: 1. 0.5 nmol B- CpG control; 2. 0.5 nmol B-CpG control; 3. B-CpG oligo content HBc33 after phenol / chloroform extraction; 4. B-CpG oligo content HBc33 after phenol / chloroform extraction and RNase A treatment; 5. B-CpG oligo content HBc33 after phenol/ chloroform extraction and DNasel freatment; 6. empty; 7. MBI Fermentas 100 bp DNA ladder
  • Figure 18 depicts the analysis of NKCpG packaging into HBc33 VLPs on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 ⁇ g of the following samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A; 3. HBc33 VLP treated with RNase A and packaged with NKCpG; 4. HBc33 VLP treated with RNase A, packaged with NKCpG, treated with DNasel and dialysed; 5. 1 kb MBI Fermentas DNA ladder.
  • C depicts the analysis of the amount of packaged oligo exfracted from the VLP on a 15% TBE/urea gel stained with CYBR Gold.
  • NKCpG oligo content HBc33 after proteinase K digestion and RNase A treatment 2. 20 pmol NKCpG control; 3. 10 pmol NKCpG control; 4. 40 pmol NKCpG control
  • Figure 19 depicts the analysis of glOgacga-PO packaging into HBc33 VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 ⁇ g of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP untreated; 3. HBc33 VLP freated with RNase A; 4. HBc33 VLP treated with RNase A and packaged with glOgacga- PO; 5. HBc33 VLP treated with RNase A, packaged with glOgacga-PO, treated with Benzonase and dialysed.
  • Figure 20 depicts the analysis of CyCpG-150 packaging into HBc33 VLPs on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 ⁇ g of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP untreated; 3. HBc33 VLP treated with RNase A; 4. HBc33 VLP treated with RNase A and packaged with CyCpG- 150; 5. HBc33 VLP treated with RNase A, packaged with CyCpG-150, treated with DNasel and dialysed; 6. HBc33 VLP treated with RNase A, packaged with CyCpG-150, treated with DNasel and dialysed.
  • (C) depicts the analysis of the amount of packaged oligo extracted from the VLP on a 10 % TBE/urea gel stained with CYBR Gold. Loaded on gel are the following samples: 1. 20 pmol CyCpG-150 control; 2. 10 pmol CyCpG-150 control; 3. 4 pmol CyCpG- 150 control; 4. CyCpG-150 oligo content of 4 ⁇ g HBc33 after 3 min at 95°C with 1 volume TBE/urea sample buffer.
  • Figure 21 depicts the analysis of NKCpGpt packaging into HBcPlA VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 ⁇ g of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBcPlA VLP untreated; 3. HBcPlA VLP treated with RNase A; 4. HBcPlA VLP treated with RNase A and packaged with NKCpGpt.
  • Immunostimulatory nucleic acids can be packaged in HBcAg-wt coupled with antigens.
  • HBcAg-wt VLPs were packaged after coupling with peptide p33 (CGG-KAVYNFATM), derived from lymphocytic choriomeningitis virus (LCMV).
  • CGG-KAVYNFATM lymphocytic choriomeningitis virus
  • LCMV lymphocytic choriomeningitis virus
  • VLPs were dialyzed to Mes buffer (2-(N- mo ⁇ holino) ethanesulphonic acid) pH 7.4 for 2 x 2 h using MWCO 10.000 kD dialysis membranes at 4°C.
  • VLPs (50 ⁇ M) were subsequently coupled to the N-terminal cysteine of the p33 peptide (250 ⁇ M) during a 2 h incubation in a thermomixer at 25°C.
  • Samples were dialyzed (MWCO 300.000) extensively to lx PBS pH 7.4 to eliminate undesired free peptide.
  • Figure 22 shows SDS-PAGE analysis of HBcAg wt VLPs derivatization with SMPH and coupling to p33 peptide.
  • Samples were analysed by 16% SDS PAGE and stained with Coomassie Blue.
  • HBcAg- wt was visible as a 21 kD protein band. Due to the low molecular weigth of SMPH is the derivatised product only slightly larger and can not be distinguished by SDS-PAGE.
  • Peptide alone was visible as a 3 kD band and coupled product, termed HBx33, showed a strong secondary band at approximately 24 kD accounting for more than 50% of total HBcAg- wt.
  • Enzymatic RNA hydrolysis HBx33 VLPs (0.5-1.0 mg/ml, lxPBS buffer pH7.4) in the presence of RNase A (300 ⁇ g/ml, Qiagen AG, Switzerland) were diluted with 4 volumes H 2 O to decrease salt concentration to a final 0.2xPBS concentration and incubated for 3 h at 37°C in a thermomixer at 650 ⁇ m.
  • VLP preparations for mouse immunization were extensively dialysed (2x against 200-fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNase A and the excess of CpG-oligonucleotides.
  • Figure 23 shows that RNAse treatment reduced the nucleic acid content of the capsids and slowed their migration. Addition of B-CpGpt restored nucleic acid content and fast migration of capsids. DNAse I only digested the free oligonucleotides while the packaged oligonucleotides remained in the VLP also after dialysis ( Figure 23).
  • Figure 22 depicts the SDS-PAGE analysis of the p33 coupling to HBc VLPs after Coomassie Blue staining. Loaded on the gel are the following samples: l .NEB Prestained Protein Marker, Broad Range (# 7708S), 10 ⁇ l; 2. CGG-p33 peptide; 3. HBc VLP derivatized with SMPH, before dialysis; 4. HBc VLP derivatized with SMPH, after dialysis; 5. HBc VLP coupled with CGG-p33, supernatant; 6. HBc VLP coupled with CGG-p33, pellet.
  • Figure 23 depicts the analysis of B-CpGpt packaging into HBx33 VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 50 ⁇ g of the following samples: 1. HBx33 VLP untreated; 2. HBx33 VLP treated with RNase A; 3. HBx33 VLP treated with RNase A and packaged with B-CpGpt; 4. HBx33 VLP freated with RNase A, packaged with B-CpGpt and treated with DNasel; 5. HBx33 VLP treated with RNase A, packaged with B-CpGpt, treated with DNasel and dialysed; 6. 1 kb MBI Fermentas DNA ladder Example 13
  • Immunostimulatory nucleic acids can be packaged into Q ⁇ VLPs coupled with antigens.
  • Recombinantly produced Q ⁇ VLPs were used after coupling to p33 peptides containing an N-terminal CGG or and C-terminal GGC extension (CGG-KAVYNFATM and KAVYNFATM-GGC).
  • Recombinantly produced Q ⁇ VLPs were derivatized with a 10 molar excess of SMPH (Pierce) for 0.5 h at 25°C, followed by dialysis against 20 mM HEPES, 150 mM NaCl, pH 7.2 at 4°C to remove unreacted SMPH.
  • Peptides were added in a 5 fold molar excess and allowed to react for 2 h in a thermomixer at 25°C in the presence of 30% acetonitrile.
  • Figure 24 shows the SDS-PAGE analysis demonstrating multiple coupling bands consisting of one, two or three peptides coupled to the Q ⁇ monomer (Arrows, Figure 24).
  • Q ⁇ VLPs when produced in E. coli by expressing the bacteriophage Q ⁇ capsid protein, contain RNA which can be digested and so eliminated by incubating the VLPs with RNase A.
  • Q ⁇ VLPs at a concentration of 1.0 mg/ml in 20mM Hepes/150mM NaCl buffer (HBS) pH 7.4 were either digested directly by addition of RNase A (300 ⁇ g/ml, Qiagen AG, Switzerland) or were diluted with 4 volumes H 2 O to a final 0.2 x HBS concentration and then incubated with RNase A (60 ⁇ g/ml, Qiagen AG, Switzerland). Incubation was allowed for 3 h at 37°C in a thermomixer at 650 ⁇ m.
  • Figure 25 demonstrates that in IxHBS only a very weak reduction of RNA content was observed, while in 0.2x HBS most of the RNA were hydrolysed. In agreement, capsid migration was unchanged after addition of RNAse A in lx HBS, while migration was slower after addition of RNAse in 0.2xHBS ( Figure 25 B,D).
  • Q ⁇ VLPs were concentrated to 1 mg/ml using Millipore Microcon or Centriplus concentrators and aliquots were dialysed against lx HBS or 0.2 x HBS.
  • Q ⁇ VLPs were supplemented with 130 nmol/ml CpG-oligonucleotide B-CpG and incubated in a thermomixer for 3 h at 37°C.
  • Q ⁇ VLPs were subjected to Benzonase digestion (100 U/ml) for 3 h at 37°C. Samples were analysed on 1% agarose gels after staining with ethidium bromide or Coomassie Blue.
  • Figure 26 shows that in lx HBS only a very low amount of oligonucleotides could be packaged, while in 0.2 x HBS a strong ethidium bromide stained band was detectable, which colocalized with the Coomassie blue stain of the capsids.
  • the Q ⁇ VLPs were concentrated to 1 mg/ml using Millipore Microcon or Centriplus concentrators and supplemented with 130 nmol ml CpG-oligonucleotides B-CpGpt, glOgacga and the 253 mer dsCyCpG-253 (Table I) and incubated in a thermomixer for 3 h at 37°C. Subsequently Q ⁇ VLPs were subjected to DNAse I digestion (5 U/ml) or Benzonase digestion (100 U/ml) for 3 h at 37°C.
  • Figure 27 shows that the different nucleic acids B-CpGpt, glOgacga and the 253mer dsDNA could be packaged into Qbx33. Packaged nucleic acids were resistant to DNAse I digestion and remained packaged during dialysis ( Figure 27). Packaging of B-CpGpt was confirmed by release of the nucleic acid by proteinase K digestion followed by agarose electrophoresis and ethidium bromide staining ( Figure 27C).
  • Figure 24 depicts the SDS-PAGE analysis of the p33 coupling to Q ⁇ VLPs after Coomassie Blue staining. Loaded are the following samples: (A) 1. NEB Prestained Protein Marker, Broad Range (# 7708S), 10 ⁇ l; 2. Q ⁇ VLP, 14 ⁇ g; 3. Q ⁇ VLP derivatized with SMPH, after dialysis; 4. Q ⁇ VLP coupled with CGG-p33, supernatant. (B) 1. NEB Prestained Protein Marker, Broad Range (# 7708S), 10 ⁇ l; 2. Q ⁇ VLP, 10 ⁇ g; 3. Q ⁇ VLP coupled with GGC- p33, supernatant.
  • Figure25 depicts the analysis of RNA hydrolysis from Q ⁇ VLPs by RNase A under low and high ionic strength on a 1% agarose gel stained with ethidium bromide (A, C) and Coomassie Blue (B, D). Loaded on the gel are the following samples: (A, B) 1. MBI Fermentas lkb DNA ladder; 2. Q ⁇ VLP untreated; 3. Q ⁇ VLP treated with RNase A inlx HBS buffer pH7.2. (C, D) 1. MBI Fermentas lkb DNA ladder; 2. Q ⁇ VLP untreated; 3. Q ⁇ VLP treated with RNase A in 0.2 x HBS buffer pH7.2.
  • Figure26 depicts the analysis of B-CpG packaging into Q ⁇ VLPs under low and high ionic strength on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are the following samples: 1. Q ⁇ VLP untreated; 2. Q ⁇ VLP treated with RNase A; 3. Q ⁇ VLP freated with RNase A and packaged with B-CpG in 0.2x HBS buffer pH7.2 and treated with Benzonase; 4. HBx33 VLP freated with RNase A, packaged with B-CpG in lx HBS buffer pH7.2 and treated with Benzonase.
  • Figure 27 depicts the analysis of B-CpGpt packaging into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 50 ⁇ g of the following samples: 1. Qbx33 VLP untreated; 2. Qbx33 VLP treated with RNase A; 3. Qbx33 VLP treated with RNase A and packaged with B-CpGpt; 4. Qbx33 VLP treated with RNase A, packaged with B-CpGpt, treated with DNasel and dialysed; 5. 1 kb MBI Fermentas DNA ladder.
  • (C) depicts the analysis of the amount of packaged oligo extracted from the VLP on a 15% TBE/urea stained with CYBR Gold. Loaded on gel are the following samples: 1. BCpGpt oligo content of 2 ⁇ g Qbx33 VLP after proteinase K digestion and RNase A treatment; 2. 20 pmol BCpGpt control; 3. 10 pmol BCpGpt confrol; 4. 5 pmol BCpGpt confrol
  • Figure 27 D and E depict the analysis of glOgacga-PO packaging into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide (D) and Coomassie Blue (E). Loaded on the gel are 15 ⁇ g of the following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP freated with RNase A and packaged with glOgacga-PO; 5. Qbx33 VLP treated with RNase A, packaged with glOgacga-PO, treated with Benzonase and dialysed.
  • FIGS. 1 and F depict the analysis of dsCyCpG-253 packaging into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide (E) and Coomassie Blue (F). Loaded on the gel are 15 ⁇ g of the following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253 and treated with DNasel; 5. Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253, treated with DNasel and dialysed.
  • Disassembly 70 mg of pure lyophilized Q ⁇ VLP gave a protein content of about 35 mg, according to spectrophotometric determination using the average result obtained with the following three formulae: 1. (183 * OD 230 nm - 75.8 * OD 260 nm ) * volume (ml) - 2. ((OD 235 nm - OD 280 nm )/2.51) x volume - 3. ((OD 228 5 nm - OD 2345 nm ) * 0.37) x volume.
  • the pure lyophilized Q ⁇ VLP was solubilized in 7 ml of 6 M GuHCl and incubated overnight at 4°C.
  • the solution was clarified for 15 minutes, at 6000 ⁇ m (Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the following steps). A negligible sediment was discarded, and the supernatant was dialysed 5 X against 200-300 ml NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) over 3 days. Alternatively, the supernatant was dialyzed in a continuous mode against 1.5 1 NET buffer over 3-4 days. The resulting suspension was centrifuged at 12000 ⁇ m for 20 minutes.
  • the pellet was resolubilized in 2-3 ml 8 M urea, while the supernatant was precipitated with solid ammonium sulphate at 60% saturation.
  • a saturated ammonium sulphate solution was added to the pellet previously resolubilized in urea to 60% saturation, and the solution was left to precipitate 4 days at 4°C, with subsequent centrifugation at 12000 ⁇ m for 20 minutes.
  • This pellet, and the pellet of the initial supernatant were resolubilized and joined in a total volume of 3 ml of 7 M urea, 10 mM DTT.
  • This material was loaded on a Sephadex G75 column, eluted at 2 ml/h with 7 M urea, 10 mM DTT.
  • Reassembly ⁇ -mercaptoethanol was added to the 10 ml dimer fraction to a final concentration of 10%, and 300 ⁇ l of a solution of (CpG) 20 OpA oligodeoxynucleotide, containing 12.3 nmol of oligonucleotide, were added.
  • the reassembly mixture was first dialyzed against 30 ml NET buffer containing 10% beta-mercaptoethanol for 2 hours at 4°C, and then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 4 days at 4°C.
  • the reassembly mixture was then desalted against water by dialysis, with 6 buffer exchanges (4 X 100 ml, 2 X 1 liter).
  • the ratio of absorbance at 280 nm vs. 260 nm was of 0.167/0.24.
  • the protein was dried by lyophilization. The dried protein was resolubilized in water and purified by ultracentrifugation on a sucrose gradient in a Beckman L 8-80 centrifuge, with the SW 50.1 rotor at 22 000 ⁇ m, for 17h at +4°C.
  • the sucrose gradient purification was performed as follows. 5 layers of 1 ml of the following sucrose concentrations (w/v) were dispensed into a centrifuge tube: 50%, 43%, 36%, 29%o and 22%. The so formed succession of layers was left standing overnight at 4°C.
  • the reassembled Q ⁇ had the same apparent density as wt Q ⁇ within experimental enor.
  • the fractions 6-9 of the sucrose gradient were pooled, dialyzed against water and lyophilized. This material was then resolubilized for electron microscopy (EM) analysis ( Figure 29) and Ouchterlony assay ( Figure 30 A and B).
  • EM electron microscopy
  • Figure 29 A suspension of the proteins was absorbed on carbon-formvar coated grids and stained with 2% phosphotungstic acid (pH 6,8).
  • the grids were examined with a JEM 100C (JEOL,Japan) electron microscope at an accelerating voltage of 80 kV.
  • Photographic records were performed on Kodak electron image film and electron micrographs were obtained by printing of negatives on Kodak Polymax paper. Both methods indicate that the reassembled VLPs have the same macromolecular properties as intact Q ⁇ VLP.
  • the pattern of disulfide bonds displayed by the purified reassembled Q ⁇ VLP is indistinguishable from the disulfide bond pattern displayed by the untreated Q ⁇ VLP, with the typical pattern of pentamers and hexamers ( Figure 31 A).
  • Reassembled Q ⁇ VLP was digested with pancreatic DNAse I as follows. To 200 ⁇ l of a 0.5 mg/ml solution of Q ⁇ VLP reassembled with (CpG) 20 OpA oligodeoxynucleotide were added 20 ⁇ l of a 1 U/ ⁇ l DNAse I (Fluka) solution, and 22 ⁇ l of DNAse I buffer (20 mM MgCl , 200 mM Tris, pH 8.3). The reaction mixture was incubated for 2h30 min. at 37°C.
  • the nucleic acid content of the sample was subsequently isolated by phenol/chloroform extraction, and loaded on a 2 % agarose gel stained with ethidium bromide (Figure 3 IB).
  • Figure 3 IB A band of the size of the packaged oligodeoxynucleotide was detected on the gel.
  • a band migrating at a higher apparent molecular weight was also visible.
  • the gel thus shows that DNAse I protected oligodeoxynucleotides of the right size were present in the reassembled Q ⁇ VLP, since the oligodeoxynuleotides could subsequently be digested by DNAse I, but not by RNAse A. Oligodeoxynucleotides could thus be successfully packaged in Q ⁇ VLP after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLP in the presence of oligodeoxynucleotide.
  • Figure 28 shows the SDS-PAGE analysis of the fractions from the sucrose gradient centrifugation. Loaded on the gels were the following samples. Lane 1 - 10: fractions 6-15 of the sucrose gradient ultracentrifugation .
  • Figure 29 shows the EM pictures of (A) intact Q ⁇ VLP and (B) Q ⁇ VLP after disassembly and reassembly in the presence of oligonucleotide (CpG) 0 OpA, and subsequent purification by sucrose gradient ulfra- centrifugation. A dense overlay of capsids is observed, and those capsids display the same structural features and properties as the intact Q ⁇ VLPs.
  • CpG oligonucleotide
  • Figure 30 shows the Ouchterlony analysis (immunodiffusion) of the reconstructed Q ⁇ VLP.
  • Q ⁇ VLP reassembled with oligonucleotide (CpG)20OpA was loaded next to intact Q ⁇ VLP.
  • the two characteristic precipitation bands are indicated by black anows.
  • the two precipitation bands are concunent, indicating that the reassembled Q ⁇ VLP diffuse as the intact Q ⁇ VLP.
  • sample 1 is Q ⁇ VLP reassembled in the presence of ribosomal RNA
  • sample 2 is intact Q ⁇ VLP
  • sample 3 is Q ⁇ VLP reassembled with oligonucleotide (CpG)20OpA.
  • the precipitation bands are indicated by white anows.
  • Figure 31 A shows the analysis of the untreated and reassembled Q ⁇ VLP by non-reducing SDS-PAGE.
  • the pentamers and hexamers of Q ⁇ VLP are indicated by arrows.
  • Figure 31 B shows the agarose gel electrophoresis analysis of the nucleotide content extracted after DNAse I digestion of Q ⁇ VLP reassembled with oligonucleotide (CpG)20OpA.
  • the nucleic acid content was either untreated (lane 1), or subsequently digested with DNAse I (lane2) or RNAse A (lane 3); 33 ⁇ g of reassembled Q ⁇ VLP were loaded on each lane. 300 ng of a 50 bp oligonucleotide were loaded on lane 4, while 10 ⁇ l of the GeneRuler 100 bp DNA ladder + marker (MBI Fermentas) was loaded on lane 5.
  • MBI Fermentas bp DNA ladder + marker
  • the disassembly of Q ⁇ VLP was performed essentially as described in Example 1 , but for the use of 8 M urea instead of 7 M urea to resuspend the ammonium sulphate pellets.
  • the reassembly of Q ⁇ VLP with the oligos CyOpA, CyCyCy, (CpG)20-OpA and CyCpG was performed essentially as described in Example 1, but for the following variations.
  • a dialysis step against 10 % ⁇ - mercaptoethanol in NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) for 1 hour at 4 °C was added to the procedure before addition of the oligodeoxynucleotide solution to the dimer solution in the dialysis bag.
  • the oligodeoxynucleotides were then added to the dimer solutions, resulting approx.
  • oligonucleotide to capsid 180 subunits
  • the reassembly mixture was first dialyzed against 30 ml NET buffer containing 10% -mercaptoethanol for 1 hours at 4°C, and then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 4 days at 4°C.
  • a sample of the reassembly reaction of Q ⁇ VLP with oligodeoxynucleotide CyOpA was taken for EM analysis ( Figure 32) at the end of the reassembly reaction. The EM procedure using phosphotungstic acid and described above was used.
  • the reassembly mixtures were then desalted against water by dialysis and dried.
  • the dried protein was resolubilized in water and purified by ultracentrifugation on a sucrose gradient.
  • the purified reassembled Q ⁇ VLPs were also analyzed by EM ( Figure 33 A-D).
  • the electron micrographs indicate that the reassembled VLPs have the same macromolecular properties as intact Q ⁇ VLP. Purification notably enriches the preparations for reassembled particles.
  • Q ⁇ VLP was successfully reassembled with oligodeoxynucleotides of various lengths and sequences.
  • Q ⁇ VLP reassembled with the oligodeoxynucleotide CyOpA was reacted at a concenfration of 1.5 mg/ml, with the cross-linker SMPH diluted from a stock solution in DMSO at a final concentration of cross-linker of 536 ⁇ M for 35 minutes at 26°C in 20 mM Hepes pH 7.4.
  • the derivatized Q ⁇ VLP was dialyzed 2 X 2 hours against a thousand volumes of 20 mM Hepes, 150 mM NaCl, pH 7.4.
  • the dialysed derivatized Q ⁇ VLP at a concentration of 1.4 mg/ml was subsequently reacted with the p33GGC peptide (sequence: KAVYNFATMGGC) at a final concentration of peptide of 250 ⁇ M for 2 hours at 15°C in 20 mM Hepes, 150 mM NaCl, pH 7.4.
  • the gel of Figure 34 indicates successful coupling of the p33 peptide to Q ⁇ VLP. Coupling bands conesponding to one, respectively two peptides coupled per subunit are indicated by an anow in the Figure.
  • nucleic acid content of reassembled and coupled Q ⁇ VLP was analysed by proteinase K digestion, phenol cloroform extraction and subsequent loading of the extracted oligonucleotide on a TBE/Urea PAGE gel.
  • the analysis procedure was as follows. 25 ⁇ l reassembled Q ⁇ VLP (0.5-1 mg/ml) were supplemented with 0.5 ⁇ l proteinase K, 1.5 ⁇ l 10% SDS and 3 ⁇ l lOx proteinase buffer (0.5 M NaCl, 50 mM EDTA, 0.1 M Tris pH7.4).
  • RNAseA Qiagen, 100 ⁇ g/ml, diluted 250x.
  • the packaged nucleic acid was the oligonucleotide used for reassembly. Quantification of the packaged oligodeoxynucleotide was performed by comparison of the band intensity of the extracted oligonucleotide with the band intensity of a reference amount of the same oligonucleotide loaded on the same gel. A figure of 1.75 nmol CyOpA/ 100 ⁇ g Q ⁇ VLP was obtained, giving a ratio of 44 oligonucleotides per VLP on average.
  • Figure 32 depicts the electron micrographs of the reassembly reaction of Q ⁇ VLP with the oligonucleotide CyOpA before purification. The magnification was 200 000 fold.
  • Figure 33 A-D show the electron micrographs of the purified reassembly reactions of Q ⁇ VLP with the oligodeoxynucleotides Cy(CpG)20 (A), CyCyCy (B), CyCpG (C) and CyOpA (D).
  • the magnification was 200 000 fold.
  • Figure 34 depicts the SDS-PAGE analysis of the coupling of Q ⁇ VLP reassembled with the oligodeoxynucleotide CyOpA to the p33GGC peptide.
  • Loaded on the gel were the following samples: 1. Prestained Protein Marker, Broad Range (# 7708S) 10 ⁇ l; 2. Q ⁇ VLP reassembled with CyOpA [1.5 mg/ml] 10 ⁇ l; 3. Q ⁇ VLP reassembled with CyOpA [1.5 mg/ml] and derivatized with SMPH 10 ⁇ l; 4. Q ⁇ VLP reassembled with CyOpA [1.5 mg/ml], derivatized with SMPH and coupled with p33-peptide 10 ⁇ l; 5. Q ⁇ VLP reassembled with CyOpA [1.5 mg/ml], derivatized with SMPH and coupled with p33-peptide, l/5 th vol of the pellet.
  • Figure 35 depicts the analysis of the extracted packaged oligodeoxynucleotides by Urea Polyacrylamide gel electrophoresis, stained with CYBR Gold. The following samples were loaded on the gel: 1. Q ⁇ VLP reassembled with oligonucleotide CyOpA and coupled to p33 GGC peptide, 2 ⁇ g protein loaded on the gel. 2. Q ⁇ VLP reassembled with oligonucleotide CyOpA and coupled to p33GGC peptide, frozen and thawed before loading on the gel, 2 ⁇ g protein. 3.
  • Protein concentration was determined by Bradford analysis and 5mg total protein was applied onto a HiLoadTM SuperdexTM 75 prep grade column (26/60, Amersham Biosciences) equilibrated with 7 M urea, 100 mM TrisHCl and 10 mM DTT. Size exclusion chromatography was performed with the equilibration buffer (7 M urea, 100 mM TrisHCl pH 8.0, 10 mM DTT) at 12°C with a flow-rate of 0.5 ml/min. During the elution absorbance at 254 nm and 280 nm was monitored. Two peaks were isolated. A high molecular weight peak preceded a peak of lower apparent molecular weight. Peaks were collected in fractions of 1.5 ml and aliquots were analysed by SDS-PAGE followed by Coomassie staining as well as SYBR ® Gold staining ( Figure 36).
  • Protein concentration was determined by Bradford analysis and 10 mg total protein was diluted to a final volume of 10 ml with buffer A (see below) and applied with a flowrate of 1 ml/min to a 1 ml HiTrapTM SP HP column (Amersham Biosciences, Cat. No. 17-1151-01 ) equilibrated with buffer A: 7 M urea, 20 mM MES, 10 mM DTT, pH 6.0. The flowthrough which contained the RNA was collected as one fraction.
  • this solution (volume up to 5 ml) was first dialysed for 2 h against 500 ml NET buffer containing 10% 3-mercaptoethanol at 4°C, then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 72 h at 4°C, and finally for another 72 h with the same continous mode with a buffer composed of 20 mM TrisHCl pH 8.0, 150 mM NaCl. The resulting suspension was centrifuged at 14 000 ⁇ m for 10 minutes at 4°C.
  • nucleic acid content in the intact Q ⁇ VLPs which had been purified from E.coli was degraded upon addition of RNase A, indicating that the nucleic acid content in this VLPs consists of RNA.
  • both the ethidium bromide stain and the Coomasie blue stain of the agarose gel shows that the nucleic acid containing Q ⁇ VLPs (reassembled and purified from E.coli, respectively) are migrating at about the same size, which indicates that the reassembly reaction led to Q ⁇ VLPs of comparable size to intact Q ⁇ VLPs which had been purified from E.coli.
  • the gel thus shows that DNAse I protected oligodeoxynucleotides were present in the reassembled Q ⁇ VLP. Furthermore, after the packaged oligodeoxynuleotides had been extracted by phenol/chloroform they were digestable by DNAse I, but not by RNAse A. Oligodeoxynucleotides could thus be successfully packaged into Q ⁇ VLPs after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLPs in the presence of oligodeoxynucleotides.
  • Intact Q ⁇ VLPs which had been purified from E.coli served as control and were incubated with proteinase K under the same conditions as described for the capsids which had been reassembled in the presence of oligodeoxynucleotides.
  • the reactions were then mixed with a TBE- Urea sample buffer and loaded on a 15% polyacrylamide TBE-Urea gel (Novex ® , Invitrogen Cat. No. EC6885).
  • 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembling reaction were loaded onto the same gel.
  • This gel was fixed with 10% acetic acid, 20% methanol, equilibrated to neutral pH and stained with SYBR ® -Gold (Molecular Probes Cat. No. S-11494).
  • SYBR ® -Gold stain showed ( Figure 41), that the reassembled Q ⁇ capsids contained nucleic acid comigrating with the oligodeoxynucleotides which were used in the reassembly reaction. Note that intact Q ⁇ VLPs (which had been purified from E.coli) did not contain a nucleic acid of similar size.
  • FIG. 36 shows the purification of disassembled Q ⁇ coat protein by size exclusion chromatography. 5 ⁇ l of the indicated fractions (#) were mixed with sample buffer and loaded onto 16% Tris-Glycine gels (Novex ® by Invitrogen, Cat. No. EC64952).
  • the gels were stained first with Coomassie blue (A) and after documentation the same gels were stained with SYBR ® -Gold (B).
  • A Coomassie blue
  • B SYBR ® -Gold
  • Figure 37 shows the purification of reassembled Q ⁇ VLPs by size exclusion chromatography.
  • Figure 38 shows electron micrographs of Q ⁇ VLPs that were reassembled in the presence of different oligodeoxynucleotides.
  • the VLPs had been reassembled in the presence of the indicated oligodeoxynucleotides or in the presence of tRNA but had not been purified to a homogenous suspension by size exclusion chromatography.
  • positive confrol served preparation of "intact" Q ⁇ VLPs which had been purified from E.coli.
  • VLPs of the conect size and conformation could be formed, when compared to the "positive" control.
  • Figure 39 shows the analysis of the disulfide-bond pattern in reassembled and purified Q ⁇ capsids. 5 ⁇ g of the indicated capsids were mixed with sample buffer that either contained a reducing agent or not and loaded onto a 16% Tris-Glycine gel. After the run was completed the gel was stained with Coomassie blue. When compared to "intact" capsids purified from E.coli, the reassembled Q ⁇ VLPs displayed the same disulfide bond pattern.
  • Figure 40 shows the analysis of nucleic acid content of the reassembled Q ⁇ VLPs by nuclease treatment and agarose gelelectrophoresis: 5 ⁇ g of reassembled and purified Q ⁇ VLPs and 5 ⁇ g of Q ⁇ VLPs which had been purified from E.coli, respectively, were treated as indicated. After this treatment, samples were mixed with loading dye and loaded onto a 0.8% agarose gel. After the run the gel was stained first with ethidum bromide (A) and after documentation the same gel was stained with Coomassie blue (B).
  • A ethidum bromide
  • B Coomassie blue
  • nucleic acid content of the reassembled and purified Q ⁇ VLPs were resistant towards RNase A digestion while the nucleic acid content of Q ⁇ VLPs purified from E.coli was digested upon incubation with RNase A.
  • nucleic acid content of the reassembled Q ⁇ capsids consists out of deoxynucleotides which of course are protected from RNase A digestion.
  • oligodeoxynucleotides were packaged into Q ⁇ VLPs during the reassembly reaction.
  • Figure 41 shows the analysis of nucleic acid content of the reassembled Q ⁇ VLPs by proteinase K treatment and polyacrylamide TBE/Urea gelelectrophoresis:
  • the equivalent of 1 ug Q ⁇ VLPs which had been digested by proteinase K-treatment was mixed with a TBE-Urea sample buffer and loaded on a 15% polyacrylamide TBE-Urea gel (Novex ® , Invitrogen Cat. No. EC6885).
  • 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembly reaction was loaded onto the same gel.
  • Disassembly 40 mg of lyophilized purified AP205 VLP were resolubilized in 4 ml 6 M GuHCl, and incubated overnight at 4°C. The disassembly mixture was centrifuged at 8000 ⁇ m (Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the following steps). The pellet was resolubilized in 7 M urea, while the supernatant was dialyzed 3 days against NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) with 3 changes of buffer. Alternatively, dialysis was conducted in continuous mode over 4 days.
  • NET buffer 20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl
  • the dialyzed solution was centrifuged at 8000 ⁇ m for 20 minutes, and the pellet was resolubilized in 7 M urea, while the supernatant was pelletted with ammonium sulphate (60% saturation), and resolubilized in a 7 M urea buffer containing 10 mM DTT.
  • the previous pellets all resolubilized in 7 M urea were joined, and precipitated with ammonium sulphate (60% saturation), and resolubilized in a 7 M urea buffer containing 10 mM DTT.
  • Reassembly 1.1 ml beta-mercaptoethanol was added to the sample, and the following reassembly reactions were set up:
  • the EM analysis of AP205 reassembled with CyCpG is shown on Figure 42B.
  • the EM procedure was as follows: A suspension of the proteins was absorbed on carbon-formvar coated grids and stained with 2% phosphotungstic acid (pH 6,8). The grids were examined with a JEM 100C (JEOL, Japan) electron microscope at an accelerating voltage of 80 kV. Photographic records (negatives) were performed on Kodak electron image film and electron micrographs were obtained by printing of negatives on Kodak Polymax paper.
  • the VLP reassembled in the presence of the CyCpG was purified over a Sepharose 4B column (1 X 50 cm), eluted with NET buffer (1 ml/h).
  • a band migrating at the same height than intact AP205 VLP and staining both for ethidium-bromide and Coomassie blue staining could be obtained, showing that AP205 VLP containing oligodeoxynucleotide had been reassembled.
  • the extensive dialysis steps following the reassembly procedure are likely to have led to diffusion of the oligodeoxynucleotide outside of the VLPs.
  • the AP205 VLPs could also be reassembled in the absence of detectable oligodeoxynucleotide, as measured by agarose gel electrophoresis using ethidium bromide staining.
  • Oligodeoxynucleotides could thus be successfully bound to AP205 VLP after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLP in the presence of oligodeoxynucleotide.
  • Figure 42 shows electron micrographs of either intact recombinant AP205 VLP used for the disassembly step (A), or AP205 VLP disassembled, and subsequently reassembled in the presence of CyCpG (B).
  • Figure 43 shows the agarose gel-electrophoresis analysis of the AP205 VLP sample reassembled in the presence of CyCpG, and taken directly after the reassembly step before dialysis.
  • the gel on Figure 43A was stained with ethidium-bromide.
  • AP205 VLP reassembled with CyCpG was loaded on lanel, while untreated pure AP205 VLP was loaded on lane 2.
  • the arrow indicates the band of the reassembled AP205 VLP.
  • the gel on Figure 43 B was stained with Coomassie-brillant blue. Untreated AP205 VLP was loaded on lane 1, while AP205 VLP reassembled with CyCpG was loaded on on lane 2.
  • B Reassembly of AP205 VLP using disassembled material which does not reassemble in the absence of added oligonucleotide
  • Disassembly 100 mg of purified and dried recombinant AP205 VLP (Cytos patent) were used for disassembly as described above. All steps were performed essentially as described under disassembly in part A, but for the use of 8 M urea to solublize the pellets of the ammonium sulphate precipitation steps and the omission of the gel filtration step using a CL-4B column prior to reassembly .
  • the pooled fractions of the Sephadex G-75 column contained 21 mg of protein as determined by spectroscopy using the formula described in part A. The ratio of absorbance at 280 nm to the absorbance at 260 nm of the sample was of 0.16 to 0.125. The sample was diluted 50 times for the measurement.
  • Reassembly The protein preparation resulting from the Sephadex G-75 gel filtration purification step was precipitated with ammonium sulphate at 60%) saturation, and the resulting pellet solubilized in 2 ml 7 M urea, 10 mM DTT. The sample was diluted with 8 ml of 10% 2-mercaptoethanol in NET buffer, and dialyzed for 1 hour against 40 ml of 10%> 2-mercaptoethanol in NET buffer. Reassembly was initiated by adding 0.4 ml of a CyCpG solution (109 nmol/ml) to the protein sample in the dialysis bag. Dialysis in continous mode was set up, and NET buffer used as eluting buffer.
  • Dialysis was pursued for two days and a sample was taken for EM analysis after completion of this dialysis step ( Figure 44 B).
  • the dialyzed reassembly solution was subsequently dialyzed against 50% v/v Glycerol in NET buffer, to achieve concentration.
  • One change of buffer was effected after one day of dialysis.
  • the dialysis was pursued over a total of three days.
  • the dialyzed and concentrated reassembly solution was purified by gel filtration over a Sepharose 4-B column (1X60 cm) at a flow rate of 1 ml/hour, in NET buffer. Fractions were tested in an Ouchterlony assay, and fractions containing capsids were dried, resuspended in water, and rechromatographed on the 4-B column equilibrated in 20 mM Hepes pH 7.6. Using each of the following three formula:
  • the reassembled AP205 VLPs were analyzed by EM as described above, agarose gel electrophoresis and SDS-PAGE under non-reducing conditions.
  • Figure 44 A Depicted on Figure 44 A is an electron micrograph of the disassembled AP205 VLP protein, while Figure 44 B shows the reassembled particles before purification.
  • Figure 3 C shows an electron micrograph of the purified reassembled AP205 VLPs. The magnigication of Figure 3 A-C is 200 000 X.
  • Figure 45 A and B show the reassembled AP205 VLPs analyzed by agarose gel electrophoresis.
  • the samples loaded on the gel from both figures were, from left to right: untreated AP205 VLP, 3 samples with differing amount of AP205 VLP reassembled with CyCpG and purified, and untreated Q ⁇ VLP.
  • the gel on Figure 45A was stained with ethidium bromide, while the same gel was stained with Coomassie blue in Figure 45 B.
  • Figure 46 depicts an SDS-PAGE analysis of reassembled AP205 VLP, loaded under non-reducing conditions. 5 samples were loaded on the gel. The samples loaded on the gel are, from left to right: Protein Marker, untreated wt Q ⁇ , reassembled wt Q ⁇ , untreated AP205 VLP, reassembled AP205 VLP.
  • the Molecular Weight of the AP205 VLP subunit is 14.0 kDa, while the molecular weight of the Q ⁇ subunit is 14.3 kDa (both molecular weights calculated with the N-terminal methionine).
  • the disulfide linked multimers are each indicated by an anow on the figure.
  • Reassembled AP205 VLP obtained as described in part B, and in 20 mM Hepes, 150 mM NaCl, pH 7.4 was reacted at a concentration of 1.4 mg/ml with a 5-fold excess of the crosslinker SMPH diluted from a 50 mM stock in DMSO for 30 minutes at 15 °C.
  • the obtained so-called derivatized AP205 VLP was dialyzed 2 X 2 hours against at least a 1000-fold volume of 20 mM Hepes, 150 mM NaCl, pH 7.4 buffer.
  • the derivatized AP205 was reacted at a concentration of 1 mg/ml with either a 2.5-fold, or with a 5-fold excess of peptide, diluted from a 20 mM stock in DMSO, for 2 hours at 15 °C. The sample was subsequently flash frozen in liquid nitrogen for storage.
  • FIG. 47 Depicted on Figure 47 is the SDS-PAGE analysis of the coupling reaction.
  • the following samples (from left to right) were loaded on the gel: protein marker; derivatized AP205 VLP (d); AP205 VLP coupled with a 2.5- fold excess of peptide, supernatant (s); AP205 VLP coupled with a 2.5-fold excess of peptide, pellet (p); AP205 VLP coupled with a 5-fold excess of peptide, supernatant (s); AP205 VLP coupled with a 5-fold excess of peptide, pellet (p).
  • mice Groups of three female C57B1/6 mice were immunized s.c. with 100 ⁇ g VLP coupled or fused to p33 alone, mixed with 20 nmol immunostimulatory nucleic acid or packaged with immunostimulatory nucleic acid.
  • mice were infected 7- 9 days later, i.p., with 1.5xl0 6 pfu recombinant vaccinia virus expressing the LCMV- glycoprotein (inclusive of the p33 peptide). Five days later the ovaries were collected and viral titers determined.
  • ovaries were ground with a homogenizer in Minimum Essential Medium (Gibco) containing 5 % fetal bovine serum and supplemented with glutamine, Earls 's salts and antibiotics (penicillin/streptomycin amphotericin).
  • the suspension was titrated in tenfold dilution steps onto BSC40 cells. After overnight incubation at 37°C, the adherent cell layer was stained with a solution consisting of 50%> ethanol, 2% crystal violet and 150mM NaCl for visualization of viral plaques.
  • Non-immunized naive mice were used as control.
  • mice Groups of three female C57B1/6 mice were immunized s.c. with 100 ⁇ g VLP coupled or fused to p33 alone or mixed with adjuvant / 20 nmol CpG oligonucleotide.
  • mice were infected i.p. 11-13 days later with 200 pfu LCMV- WE. Four days later spleens were isolated and viral titers determined. The spleens were ground with a homogenizer in Minimum Essential Medium (Gibco) containing 2 % fetal bovine serum and supplemented with glutamine, earls 's salts and antibiotics (penicillin/streptomycin/amphotericin).
  • Minimum Essential Medium Gibco
  • the suspension was titrated in tenfold dilution steps onto MC57 cells. After incubation for one hour the cells were overlayed with DMEM containing 5% Fetal bovine serum, 1 % methyl cellulose, and antibiotics (penicillin /streptomycin /amphotericin). Following incubation for 2 days at 37°C the cells were assessed for LCMV infection by the intracellular staining procedure (which stains the viral nucleoprotein): Cells were fixed with 4 % Formaldehyde for 30 min followed by a 20 min lysing step with 1% Triton X-100. Incubation for 1 hour with 10 % fetal bovine serum blocked unspecific binding.
  • HBc33 The fusion protein of HBcAg with the peptide p33 (HBc33) was produced as described in EXAMPLE 1 and packaged with different CpG nucleic acids as described in EXAMPLE 11.
  • Double stranded CyCpGpt (dsCyCpGpt) was produced by annealing 0.5 mM of DNA oligonucleotides CyCpGpt and CyCpG-rev-pt (Table I) in 15 mM Tris pH7.5 by a 10 min heating step at 80°C and subsequent cooling to RT . Oligonucleotide hybridization was checked on a 20% TBE polyacrylamid gel (Novex).
  • HBc33 capsids containing CyCpG, NKCpG, B-CpG and glOgacga-PS did induce CTL responses capable of completely inhibition viral infection (Figure 49, Figure 50). Protection was observed with nucleic acids contained phosphodiester or phosphothioate bonds (pt or PS). Even a double stranded oligonucleotide dsCyCpGpt was inducing protection against vaccinia challenge ( Figure 49).
  • Immunostimulatory nucleic acids packaged in HBcAg and Q ⁇ VLPs result in a potent antigen-specific CTL response and virus protection.
  • the fusion protein of HBcAg with the peptide p33 was produced as described in EXAMPLE 1 and packaged with oligonucleotide B- CpGpt as described in EXAMPLE 11.
  • Peptide p33 was coupled to the RNA phage Q ⁇ and oligonucleotide B-CpGpt were packaged as described in EXAMPLE 13.
  • 100 ⁇ g, 30 ⁇ g, 10 ⁇ g or 3 ⁇ g of each vaccine was injected into mice and vaccina titers in the ovaries after recombinant vaccinia challenge were detected as described in EXAMPLE 19.
  • 100 ⁇ g and 30 ⁇ g HBc33 and Qbx33 with packaged B-CpG did induce full protection against viral challenge while at lower concentrations partial or no protection was observed (Figure 51).
  • Immunostimulatory nucleic acids packaged in VLPs which are coupled to selfantigens can overcome tolerance to self-antigens.
  • mice expressing LCMV glycoprotein in pancreatic ⁇ islet cells were immunized with 200 pfu LCMV, 100 ⁇ g HBc33 mixed with 20 nmol CyCpGpt, 100 ⁇ g HBc33 packaged with CyCpGpt or 100 ⁇ g p33 peptide mixed with 20 nmol CyCpGpt as control.
  • Blood glucose levels were measured every four days with the Glucofrend Plus Glucose test kit (Roche). Mice with blood glucose levels larger 12 mM were considered diabetic. Immunization with LCMV induced diabetes in 4/4 animals at day 12.
  • CyCpGpt mixed with HBc33 only caused diabetes in 1/3 mice.
  • Two of three mice immunized with HBc33 in which CyCpGpt was packaged develop diabetes at day 12, the third mouse at day 16.
  • Immunization with peptide p33 mixed with CyCpGpt did not induce diabetes in three mice. This clearly shows that immunostimulatory nucleic acid packaged into VLP to which antigens are fused are much more efficient in enhancing a strong CTL response than a mixture of nucleic acid and antigen. They even induced a stronger response than antigen fused to VLP and mixed with the immunostimulatory nucleic acid.
  • Immunostimulatory nucleic acids packaged in VLPs-coupled to antigens are even more efficient in inducing antigen-specific CD8 + T cells than VLPs mixed with immunostimulatory nucleic acids.
  • mice were subcutaneously immunized with 100 ⁇ g HBc33 alone, mixed with CyCpGpt or, alternatively, packaged with CyCpGpt. Untreated mice served as controls.
  • Table II Induction of p33-specific CD8+ T cells after vaccination with p33-VLP mixed or packaged with CpGs. Numbers conespond to means of frequencies (in percent) and standard deviations.
  • HBc33 with packaged CyCpGpt induced a higher frequence of p33- specific CD8 + T cells than HBc33 mixed with CyCpGpt (Table II).
  • amount of packaged oligonucleotide is much lower (about 1/20) of the amount of oligonucleotide used in the mixed setting this clearly demonstrates that VLPs with packaged immunostimulatory nucleic acids are even more efficient in inducing high numbers of antigen-specific CD8 + T cells.
  • Immunostimulatory nucleic acids packaged in VLPs are even more efficient in inducing CTL responses than VLPs mixed with immunostimulatory nucleic acids.
  • mice Groups of C57BL/6 mice were subcutaneously primed with 100 ⁇ g p33-VLP given alone, mixed with 20 nmol CyCpGpt, or, alternatively, packaged with CyCpGpt.
  • effector cell suspensions were prepared from spleens of vaccinated mice 9 days after priming.
  • EL-4 cells were pulsed with p33 peptide (IO "6 M, 2 h at 37 °C in 2% FCS MEM medium) and used in a 5 h 51 Cr release assay.
  • Fig 52 shows the primary ex vivo cytotoxicity of groups of C57BL/6 mice that were subcutaneously primed with 100 ⁇ g p33-VLP given alone (A), mixed with 20 nmol CyCpGpt (B), or, alternatively, packaged with CyCpGpt (C).
  • A 100 ⁇ g p33-VLP given alone
  • B 20 nmol CyCpGpt
  • C CyCpGpt
  • Radioactivity in cell culture supernatants was measured in a Cobra II Counter (Canbena Packard, Downers Growe, IL). Spontaneous release was always ⁇ 10 %. Two dilution series of effector cells per mouse were performed. In (A) two mice per group were used, whereas in (B) and (C) data from four mice per group are shown.
  • Figure 52 clearly demonstrates that 100 ⁇ g HBc33 alone did not induce primary in vivo CTL response while the same amount HBc33 mixed with 20 nmol CyCpGpt did induce a significant cytotoxicity.
  • the amount of packaged oligonucleotide was much lower (about 1/20) of the amount of oligonucleotide used in the mixed setting cytotoxicity was enhanced when 100 ⁇ g HBc33 with packaged CyCpGpt were used for immunization (Figure 52).
  • Non-enzymatic hydrolysis of the RNA content of VLPs and packaging of immunostimulatory nucleic acids are included in the RNA content of VLPs and packaging of immunostimulatory nucleic acids.
  • the dialysed solution was clarified for 10 minutes at 14 000 ⁇ m (Eppendorf 5417 R, in fixed angle rotor F45-30-11, used in all the following steps) and proteinconcentration was again determined by Bradford analysis.
  • Q ⁇ VLPs in 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl 2 were diluted with the conesponding buffer to a final protein concentration of 1 mg/ml whereas Q ⁇ VLPs in 4 mM HEPES pH 7.4, 30 mM NaCl were diluted with the conesponding buffer to a final protein concentration of 0.5 mg/ml.
  • ZnSO 4 -treated and dialysed Q ⁇ capsids with a protein concentration (as determined by Bradford analysis) beween 0.4 mg/ml and 0.9 mg/ml (which conesponds to a concentration of capsids of 159 nM and 357.5 nM, respectively) were used for the packaging of the oligodeoxynucleotides.
  • the oligodeoxynucleotides were added at a 300-fold molar excess to the of Q ⁇ - VLP capsids and incubated for 3 h at 37°C in an Eppendorf Thermomixer comfort at 550 ⁇ m . After 3 h the reactions were centrifuged for 10 minutes at 14 000 ⁇ m and 4°C.
  • the supernatants were dialysed in Spectra/Por ® CE DispoDialyzer with a MWCO 300 * 000 (Spectrum, Cat. No. 135 526) against 5000 ml of 20 mM HEPES pH 7.4, 150 mM NaCl for 8 h at 4°C. 5000 ml buffer was exchanged once and dialysis continued over night at 4°C. The protein concentration of the dialysed samples were determined by Bradford analysis. Q ⁇ capsids and their nucleic acid contents were analyzed as described in Examples 11 and 13.
  • Figure 53 shows the analysis of ZnSO 4 -treated Q ⁇ VLPs by agarose gelelectrophoresis: Q ⁇ VLPs which had been purified from E.coli and dialysed either against buffer 1 (50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl 2 ) or buffer 2 (4 mM HEPES, pH 7.4, 30 mM NaCl) were incubated either without or in the presence of 2.5 mM zinc sulfate (ZnSO 4 ) for 24 hrs at 60°C. After this treatment equal amounts of the indicated samples (5 ⁇ g protein) were mixed with loading dye and loaded onto a 0.8%> agarose gel. After the run the gel was stained with ethidium bromide. Note that treatment of VLPs with ZnSO 4 causes degradation of the nucleic acid content, while the mock-treated controls were unaffected.
  • buffer 1 50 mM TrisHCl pH 8.0, 50 mM NaC
  • Figure 54 shows the packaging of oligodeoxynucleotides into ZnSO 4 - treated VLPs and analysis of them by agarose gelelectrophoresis.
  • Q ⁇ VLPs which had been treated with 2.5 mM zinc sulfate ( + ZnSO 4 ) were dialysed against 4 mM HEPES, pH 7.4, 30 mM NaCl and incubated for 3 hrs at 37°C with an excess of oligodeoxynucleotides (due to the dialysis the concentration of ZnSO 4 was decreased by an order of IO 6 , therefore its indicated only in parenthesis) After this incubation in presence of oligodeoxynucleotides, equal amounts of the indicated samples (5 ⁇ g protein) were mixed with loading dye and loaded onto a 0.8% agarose gel.
  • Figure 55 shows the analysis of nucleic acid content of ZnSO 4 - and oligodeoxynucleotide treated Q ⁇ VLPs by Benzonase and proteinase K digestion and polyacrylamide TBE/Urea gelelectrophoresis: Oligodeoxynucleotides were packaged into ZnSO 4 -treated Q ⁇ VLPs as described above.
  • VLPs 25 ⁇ g of these VLPs were digested with 25 ⁇ l Benzonase (Merck, Cat. No. 1.01694.0001) according to the manufactures instructions. After heat-inactivation of the nuclease (30 minutes at 80°C) the VLPs were treated with Proteinase K (final enzyme concentration was 0.5 mg/ml) according to the manufactures instructions. After 3 hrs the equivalent of 2 ug Q ⁇ VLPs which had been digested by Benzonase and proteinase K were mixed with TBE-Urea sample buffer and loaded on a 15% polyacrylamide TBE-Urea gel (Novex ® , Invitrogen Cat. No. EC6885).
  • the capsids loaded in lane 2 were treated with 2.5 mM ZnSO 4 in presence of buffer 1 (see above), while the capsids loaded in lane 3 were treated with 2.5 mM ZnSO 4 in presence of buffer 2 (see above).
  • 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembly reaction was loaded onto the same gel (lanes 4 - 6).
  • Q ⁇ capsids which had been purified from E.coli were treated exactly the same and analyzed on the same polyacrylamide TBE-Urea gel (lane 1) .
  • VLPs containing containing immunostimulatory nucleic acids induce T cell responses that can be boosted by viral vectors: LCMV.
  • mice were subcutaneously primed with 20 ⁇ g p33-VLPs containing immunostimulatory nucleic acids. Before immunization, p33-VLP preparations were extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). 12 days later, blood was taken and frequencies of p33-specific T cells were determined by tetramer staining. The mice were boosted with 200 pfu of live LCMV strain WE and frequencies of specific T cells were determined 5 days later. Frequencies before boost were 3.5% +/- 1.8% and after boost 15.5% +/- 1.9%.
  • VLPs containing immunostimulatory nucleic acids induce T cell responses that can be boosted by viral vectors: recombinant vaccinia virus
  • mice are subcutaneously primed with 20 ⁇ g p33-VLPs containing immunostimulatory nucleic acids.
  • p33-VLP preparations are extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). 12 days later, blood is taken and frequencies of p33 -specific T cells are determined by tetramer staining. The mice are boosted with IO 6 pfu of recombinant vaccina virus expressing LCMV-GP and frequencies of specific T cells are determined 5 days later.
  • VLPs containing immunostimulatory nucleic acids induce T cell responses that can be boosted by viral vectors: recombinant canary pox virus.
  • mice are subcutaneously primed with 20 ⁇ g p33-VLPs containing immunostimulatory nucleic acids. Before immunization, p33-VLP preparations are extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). 12 days later, blood is taken and frequencies of p33-specific T cells are determined by tetramer staining. The mice are boosted with IO 7 pfu of recombinant canary pox virus expressing LCMV-GP and frequencies of specific T cells are determined 5 days later.
  • VLPs containing containing immunostimulatory nucleic acids can boost T cell responses.
  • mice are infected intravenously with recombinant vacccina virus expressing LCMV-GP. 20 days later, blood is taken and frequencies of p33- specific T cells are determined by tetramer staining. The mice are boosted the same day with p33-VLP preparations containing immunostimulatory nucleic acids (see Example 2 and Figure 5) and frequencies of specific T cells are determined 5 days later.
  • Immunostimulatory ribonucleic acids such as poly (EC) (Sigma) or synthetic double-stranded 30 mer of polyinosinic acid and polycytidylic acid either with phosphodiester or phosphorothiate backbone are dissolved in water.
  • polydeoxyinosinic acid and polydeoxyinosinic acid are used to prepare a double stranded poly(LC) analogon.
  • HBc33 VLPs and Q ⁇ VLPs are freated with RNAse as described in Examples 11, 13 or 25 and nucleic acids are added at 1, 10 and 100 nmol/ml in 0.2x HBS and incubated for 3 h at 37°C in a thermomixer .
  • nucleic acids are removed by enzymatic hydrolysis or dialysis and analysed as described in Example 11, 13 and 25.
  • immunostimulatory ribonucleic acids and their analoga are packaged during reassembly of Q ⁇ coat proteins as described in Examples 14, 15, 16.
  • Reassembly is performed by adding ⁇ -mercaptoethanol to the 10 ml dimer fraction to a final concentration of 10%, and 300 ⁇ l of a solution of nucleic acid, resulting in a 1, 10 and 100 molar excess over capsid concentration, are added.
  • the reassembly mixtures are first dialyzed against 30 ml NET buffer containing 10% beta-mercaptoethanol for 2 hours at 4°C, and then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 4 days at 4°C.
  • the reassembly mixtures are then desalted against water by dialysis, with 6 buffer exchanges (4 X 100 ml, 2 X 1 liter).
  • Reassembled Q ⁇ VLPs are then isolated by sucrose gradient centrifugation as described in Example 14 or by gelfiltration as described in Example 16.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Pulmonology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Reproductive Health (AREA)
  • Pregnancy & Childbirth (AREA)
  • Gynecology & Obstetrics (AREA)
  • Dermatology (AREA)
  • General Engineering & Computer Science (AREA)

Abstract

The invention relates to the finding that virus like particles (VLPs) can be loaded with immunostimulatory substances, in particular with DNA oligonucleotides containing non-methylated C and G (CpGs). Such CpG- VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses. The immune response against antigens optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself. In addition, the T cell responses against both the VLPs and antigens are especially directed to the Thl type. Antigens attached to CpG-loaded VLPs may therefore be ...∩ ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.

Description

Packaging of Immunostimulatory Substances Into Virus-Like Particles: Method of Preparation and Use
Background of the Invention
Field of the Invention
The present invention is related to the fields of vaccinology, immunology and medicine. The invention provides compositions and methods for enhancing immunological responses against virus-like particles (VLPs) or against antigens coupled, fused or attached otherwise to VLPs by packaging immunostimulatory substances, in particular immunostimulatory nucleic acids, and even more particular oligonucleotides containing at least one non-methylated CpG sequence, into the VLPs. The invention can be used to induce strong and sustained T cell responses particularly useful for the treatment of tumors and chronic viral diseases as well as allergies and other chronic diseases.
Related Art
The essence of the immune system is built on two separate foundation pillars: one is specific or adaptive immunity which is characterized by relatively slow response-kinetics and the ability to remember; the other is nonspecific or innate immunity exhibiting rapid response-kinetics but lacking memory. Lymphocytes are the key players of the adaptive immune system. Each lymphocyte expresses antigen-receptors of unique specificity. Upon recognizing an antigen via the receptor, lymphocytes proliferate and develop effector function. Few lymphocytes exhibit specificity for a given antigen or pathogen, and massive proliferation is usually required before an effector response can be measured - hence, the slow kinetics of the adaptive immune system. Since a significant proportion of the expanded lymphocytes survive and may maintain some effector function following elimination of the antigen, the adaptive immune system reacts faster when encountering the antigen a second time. This is the basis of its ability to remember.
In contrast to the situation with lymphocytes, where specificity for a pathogen is confined to few cells that must expand to gain function, the cells and molecules of the innate immune system are usually present in massive numbers and recognize a limited number of invariant features associated with pathogens (Medzhitov, R. and Janeway, C.A., Jr., Cell 91:295-29 (1997)). Examples of such patterns include lipopolysaccharides (LPS), non-methylated CG-rich DNA (CpG) or double stranded RNA, which are specific for bacterial and viral infections, respectively.
Most research in immunology has focused on the adaptive immune system and only recently has the innate immune system entered the focus of interest. Historically, the adaptive and innate immune system were treated and analyzed as two separate entities that had little in common. Such was the disparity that few researchers wondered why antigens were much more immunogenic for the specific immune system when applied with adjuvants that stimulated innate immunity (Sotomayor, E. M., et al., Nat. Med. 5:780 (1999); Diehl, L., et al, Nat. Med. 5:774 (1999); Weigle, W. O., Adv. Immunol. 30:159 (1980)). However, the answer posed by this question is critical to the understanding of the immune system and for comprehending the balance between protective immunity and autoimmunity.
Rationalized manipulation of the innate immune system and in particular activation of APCs involved in T cell priming to deliberately induce a self-specific T cell response provides a means for T cell-based tumor- therapy. Accordingly, the focus of most current therapies is on the use of activated dendritic cells (DCs) as antigen-carriers for the induction of sustained T cell responses (Nestle et al, Nat. Med. 4:328 (1998)). Similarly, in vivo activators of the innate immune system, such as CpGs or anti-CD40 antibodies, are applied together with tumor cells in order to enhance their immunogenicity (Sotomayor, E. M., et al, Nat. Med. 5:780 (1999); Diehl, L., et al, Nat. Med. 5:774 (1999)). Generalized activation of APCs by factors that stimulate innate immumty may often be the cause for triggering self-specific lymphocytes and autoimmunity. Activation may result in enhanced expression of costimulatory molecules or cytokines such as IL-12 or IFNα. This view is compatible with the observation that administration of LPS together with thyroid extracts is able to overcome tolerance and trigger autoimmune thyroiditis (Weigle, W. O., Adv. Immunol 30:159 (1980)). Moreover, in a transgenic mouse model, it was recently shown that administration of self-peptide alone failed to cause auto-immunity unless APCs were activated by a separate pathway (Garza, K. M., et al, J. Exp. Med. 191:2021 (2000)). The link between innate immunity and autoimmune disease is further underscored by the observation that LPS, viral infections or generalized activation of APCs delays or prevents the establishment of peripheral tolerance (Vella, A. T., et al, Immunity 2:261 (1995); Ehl, S., et al, J. Exp. Med. 187:763 (1998); Maxwell, J. R., et al, J. Immunol. 162:2024 (1999)). In this way, innate immunity not only enhances the activation of self-specific lymphocytes but also inhibits their subsequent elimination. These findings may extend to tumor biology and the confrol of chronic viral diseases.
Induction of cytotoxic T lymphocyte (CTL) responses after immunization with minor histocompatibility antigens, such as the HY-antigen, requires the presence of T helper cells (Th cells) (Husmann, L. A., and M. J. Bevan, Ann. NY. Acad. Sci. 532:158 (1988); Guerder, S., and P. Matzinger, J. Exp. Med. 176:553 (1992)). CTL-responses induced by cross-priming, i.e. by priming with exogenous antigens that reached the class I pathway, have also been shown to require the presence of Th cells (Bennett, S. R. M., et al, J. Exp. Med. 186:65 (1997)). These observations have important consequences for tumor therapy where T help may be critical for the induction of protective CTL responses by tumor cells (Ossendorp, F., et al, J. Exp. Med. 187:693 (1998)).
An important effector molecule on activated Th cells is the CD40- ligand (CD40L) interacting with CD40 on B cells, macrophages and dendritic cells (DCs) (Foy, T.M., et al, Annu. Rev. Immunol. 14:591 (1996)). Triggering of CD40 on B cells is essential for isotype switching and the generation of B cell memory (Foy, T. M., et al, Ann. Rev. Immunol. 14:591 (1996)). More recently, it was shown that stimulation of CD40 on macrophages and DCs leads to their activation and maturation (Cella, M., et al, Curr. Opin. Immunol. 9:10 (1997); Banchereau, J., and R. M. Steinman Nature 392:245 (1998)). Specifically, DCs upregulate costimulatory molecules and produce cytokines such as IL-12 upon activation. Interestingly, this CD40L-mediated maturation of DCs seems to be responsible for the helper effect on CTL responses. In fact, it has recently been shown that CD40-triggering by Th cells renders DCs able to initiate a CTL-response (Ridge, J. P., et al, Nature 393:474 (1998); Bennett, S. R. M., et al, Nature 393:478 (1998); Schoenenberger, S. P., et al, Nature 393:480 (1998)). This is consistent with the earlier observation that Th cells have to recognize their ligands on the same APC as the CTLs, indicating that a cognate interaction is required (Bennett, S. R. M., et al, J. Exp. Med. 186:65 (1997)). Thus CD40L- mediated stimulation by Th cells leads to the activation of DCs, which subsequently are able to prime CTL-responses. In the human, type I interferons, in particular interferon α and β may be equally important as IL-12. In contrast to these Th-dependent CTL responses, viruses are often able to induce protective CTL-responses in the absence of T help (for review, see (Bachmann, M. F., et al, J. Immunol. 161:5791 (1998)). Specifically, lymphocytic choriomeningitis virus (LCMV) (Leist, T. P., et al, J. Immunol 138:2278 (1987); Ahmed, R., et al, J. Virol. 62:2102 (1988); Battegay, M., et al, Cell Immunol. 167:115 (1996); Borrow, P., et al, J. Exp. Med. 183:2129 (1996); hifrnire, J. K., et al, J. Virol. 70:8375 (1996)), vesicular stomatitis virus (VSV) (Kϋndig, T. M., et al, Immunity 5:41 (1996)), influenza virus (Tripp, R. A., et al, J. Immunol. 155:2955 (1995)), vaccinia virus (Leist, T. P., et al, Scand. J. Immunol 30:679 (1989)) and ecfromelia virus (Buller, R., et al, Nature 328:77 (1987)) were able to prime CTL-responses in mice depleted of CD4+ T cells or deficient for the expression of class II or CD40. The mechanism for this Th cell independent CTL-priming by viruses is presently not understood. Moreover, most viruses do not stimulate completely Th cell independent CTL-responses, but virus-specific CTL-activity is reduced in Th- cell deficient mice. Thus, Th cells may enhance anti-viral CTL-responses but the mechanism of this help is not fully understood yet. DCs have recently been shown to present influenza derived antigens by cross-priming (Albert, M. L., et al, J. Exp. Med. 188:1359 (1998); Albert, M. L., et al, Nature 392:86 (1998)). It is therefore possible that, similarly as shown for minor histocompatibility antigens and tumor antigens (Ridge, J. P., et al, Nature 393:474 (1998); Bennett, S. R. M., et al, Nature 393:478 (1998); Schoenenberger, S. P., et al, Nature 5 3:480 (1998)), Th cells may assist induction of CTLs via CD40 triggering on DCs. Thus, stimulation of CD40 using CD40L or anti-CD40 antibodies may enhance CTL induction after stimulation with viruses or tumor cells.
However, although CD40L is an important activator of DCs, there seem to be additional molecules that can stimulate maturation and activation of DCs during immune responses. In fact, CD40 is not measurably involved in the induction of CTLs specific for LCMV or VSV (Ruedl, C, et al, J. Exp. Med. 189:1875 (1999)). Thus, although VSV-specific CTL responses are partly dependent upon the presence of CD4+T cells (Kundig, T. M., et al, Immunity 5:41 (1996)), this helper effect is not mediated by CD40L. Candidates for effector molecules triggering maturation of DCs during immune responses include Trance and TNFα (Bachmann, M. F., et al, J. Exp. Med. 189:1025 (1999); Sallusto, F., and A. Lanzavecchia, J Exp Med 179:1109 (1994)).
It is well established that the administration of purified proteins alone is usually not sufficient to elicit a strong immune response; isolated antigen generally must be given together with helper substances called adjuvants. Within these adjuvants, the administered antigen is protected against rapid degradation, and the adjuvant provides an extended release of a low level of antigen. Unlike isolated proteins, viruses induce prompt and efficient immune responses in the absence of any adjuvants both with and without T-cell help (Bachmann & Zinkernagel, Ann. Rev. Immunol 75:235-270 (1997)). Although viruses often consist of few proteins, they are able to trigger much stronger immune responses than their isolated components. For B cell responses, it is known that one crucial factor for the immunogenicity of viruses is the repetitiveness and order of surface epitopes. Many viruses exhibit a quasi-crystalline surface that displays a regular array of epitopes which efficiently crosslinks epitope-specific immunoglobulins on B cells (Bachmann & Zinkernagel, Immunol. Today 77:553-558 (1996)). This crosslinking of surface immunoglobulins on B cells is a strong activation signal that directly induces cell-cycle progression and the production of IgM antibodies. Further, such triggered B cells are able to activate T helper cells, which in turn induce a switch from IgM to IgG antibody production in B cells and the generation of long-lived B cell memory - the goal of any vaccination (Bachmann & Zinkernagel, Ann. Rev. Immunol. 75:235-270 (1997)). Viral structure is even linked to the generation of anti-antibodies in autoimmune disease and as a part of the natural response to pathogens (see Fehr, T., et al, J. Exp. Med. 185:1785-1792 (1997)). Thus, antigens on viral particles that are organized in an ordered and repetitive array are highly immunogenic since they can directly activate B cells.
In addition to strong B cell responses, viral particles are also able to induce the generation of a cytotoxic T cell response, another crucial arm of the immune system. These cytotoxic T cells are particularly important for the elimination of non-cytopathic viruses such as HIV or Hepatitis B virus and for the eradication of tumors. Cytotoxic T cells do not recognize native antigens but rather recognize their degradation products in association with MHC class I molecules (Townsend & Bodmer, Ann. Rev. Immunol. 7:601-624 (1989)). Macrophages and dendritic cells are able to take up and process exogenous viral particles (but not their soluble, isolated components) and present the generated degradation product to cytotoxic T cells, leading to their activation and proliferation (Kovacsovics-Bankowski et al, Proc. Natl. Acad. Sci. USA 90:4942-4946 (1993); Bachmann et al, Eur. J. Immunol. 26:2595-2600 (1996)).
Viral particles as antigens exhibit two advantages over their isolated components: (1) due to their highly repetitive surface structure, they are able to directly activate B cells, leading to high antibody titers and long-lasting B cell memory; and (2) viral particles, but not soluble proteins, have the potential to induce a cytotoxic T cell response, even if the viruses are non- infectious and adjuvants are absent.
Several new vaccine strategies exploit the inherent immunogenicity of viruses. Some of these approaches focus on the particulate nature of the virus particle; for example see Harding, CN. and Song, R., (J. Immunology 153:4925 (1994)), which discloses a vaccine consisting of latex beads and antigen; Kovacsovics-Bankowski, M., et al. (Proc. Natl. Acad. Sci. USA 90:4942-4946 (1993)), which discloses a vaccine consisting of iron oxide beads and antigen; U.S. Patent No. 5,334,394 to Kossovsky, N., et al, which discloses core particles coated with antigen; U.S. Patent No. 5,871,747, which discloses synthetic polymer particles carrying on the surface one or more proteins covalently bonded thereto; and a core particle with a non-covalently bound coating, which at least partially covers the surface of said core particle, and at least one biologically active agent in contact with said coated core particle (see, e.g., WO 94/15585).
In a further development, virus-like particles (VLPs) are being exploited in the area of vaccine production because of both their structural properties and their non-infectious nature. VLPs are supermolecular structures built in a symmetric manner from many protein molecules of one or more types. They lack the viral genome and, therefore, are noninfectious. VLPs can often be produced in large quantities by heterologous expression and can be easily be purified.
In addition, DNA rich in non-methylated CG motifs (CpG), as present in bacteria and most non-vertebrates, exhibits a potent stimulatory activity on B cells, dendritic cells and other APCs in vitro as well as in vivo. Although bacterial DNA is immunostimulatory across many vertebrate species, the individual CpG motifs may differ. In fact, CpG motifs that stimulate mouse immune cells may not necessarily stimulate human immune cells and vice versa.
Although DNA oligomers rich in CpG motifs can exhibit immunostimulatory capacity, their efficiency is often limited, since they are unstable in vitro and in vivo. Thus, they exhibit unfavorable pharmacokinetics. In order to render CpG-oligonucleotides more potent, it is therefore usually necessary to stabilize them by introducing phosphorothioate modifications of the phosphate backbone.
A second limitation for the use of CpG-oligonucleotides to stimulate immune responses is their lack of specificity, since all APCs and B cells in contact with CpG-oligonucleotides become stimulated. Thus, the efficiency and specificity of CpG-oligonucleotides may be improved by stabilizing them or packaging them in a way that restricts cellular activation to those cells that also present the relevant antigen. h addition, immunostimulatory CpG-oligodeoxynucleotides induce strong side effects by causing extramedullary hemopoiesis accomponied by splenomegaly and lymphadenopathy in mice (Sparwasser et al., J. Immunol. (1999), 162:2368-74 and Example 18).
VLPs have been shown to be efficiently presented on MHC class I molecules as they, presumably after uptake by macropinocytosis, are efficiently processed and crossprimed onto MHC class I. The mechanism of crosspriming is not clear to date, but TAP-dependent and TAP-independent pathways have been proposed.
There have been remarkable advances made in vaccination strategies recently, yet there remains a need for improvement on existing strategies, hi particular, there remains a need in the art for the development of new and improved vaccines that promote a strong CTL immune response and anti- pathogenic protection as efficiently as natural pathogens in the absence of generalized activation of APCs and other cells.
Summary of the Invention
This invention is based on the surprising finding that immunostimulatory substances such as DNA oligonucleotides can be packaged into VLPs which renders them more immunogenic. Unexpectedly, the nucleic acids and oligonucleotides, respectively, present in VLPs can be replaced specifically by the immunostimulatory substances and DNA- oligonucleotides containing CpG motifs, respectively. Surprisingly, these packaged immunostimulatory substances, in particular immunostimulatory nucleic acids such as unmethylated CpG-containing oligonucleotides retained their immunostimulatory capacity without widespread activation of the innate immune system. The compositions comprising VLP's and the immunostimulatory substances in accordance with the present invention, and in particular the CpG- VLPs are dramatically more immunogenic than their CpG-free counterparts and induce enhanced B and T cell responses. The immune response against antigens optionally coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself. In addition, the T cell responses against both the VLPs and antigens are especially directed to the Thl type. Antigens attached to CpG- loaded VLPs may therefore be ideal vaccines for prophylactic or therapeutic vaccination against allergies, tumors and other self-molecules and chronic viral diseases.
In a first embodiment, the invention provides a composition for enhancing an immune response in an animal comprising a virus-like particle and an immunostimulatory substance, preferably an immunostimulatory nucleic acid, an even more preferably an unmethylated CpG-containing oligonucleotide, where the substance, nucleic acid or oligonucleotide is coupled, fused, or otherwise attached to or enclosed by, i.e., bound, to the virus-like particle. In another embodiment, the composition further comprises an antigen bound to the virus-like particle.
In a preferred embodiment of the invention, the immunostimulatory nucleic acids, in particular the unmethylated CpG-containing oligonucleotides are stabilized by phosphorothioate modifications of the phosphate backbone. In another preferred embodiment, the immunostimulatory nucleic acids, in particular the unmethylated CpG-containing oligonucleotides are packaged into the VLPs by digestion of RNA within the VLPs and simultaneous addition of the DNA oligonucleotides containing CpGs of choice. In an equally preferred embodiment, the VLPs can be disassembled before they are reassembled in the presence of CpGs.
In a further preferred embodiment, the immunostimulatory nucleic acids do not contain CpG motifs but nevertheless exhibit immunostimulatory activities. Such nucleic acids are described in WO 01/22972. All sequences described therein are hereby incorporated by way of reference.
In a further preferred embodiment, the virus-like particle is a recombinant virus-like particle. Also preferred, the virus-like particle is free of a lipoprotein envelope. Preferably, the recombinant virus-like particle comprises, or alternatively consists of, recombinant proteins of Hepatitis B virus, BK virus or other human Polyoma virus, measles virus, Sindbis virus, Rotavirus, Foot-and-Mouth-Disease virus, Retrovirus, Norwalk virus or human Papilloma virus, RNA-phages, Qβ-phage, GA-phage, fr-phage and Ty. In a specific embodiment, the virus-like particle comprises, or alternatively consists of, one or more different Hepatitis B virus core (capsid) proteins (HBcAgs).
In a further preferred embodiment, the virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage. Preferred RNA- phages are Qβ-phage, AP 205-phage, GA-phage, fr-phage
In another embodiment, the antigen is a recombinant antigen. In yet another embodiment, the antigen can be selected from the group consisting of: (1) a polypeptide suited to induce an immune response against cancer cells; (2) a polypeptide suited to induce an immune response against infectious diseases; (3) a polypeptide suited to induce an immune response against allergens; (4) a polypeptide suited to induce an improved response against self-antigens; and (5) a polypeptide suited to induce an immune response in farm animals or pets.
In yet another embodiment, the antigen can be selected from the group consisting of: (1) an organic molecule suited to induce an immune response against cancer cells; (2) an organic molecule suited to induce an immune response against infectious diseases; (3) an organic molecule suited to induce an immune response against allergens; (4) an organic molecule suited to induce an improved response against self-antigens; (5) an organic molecule suited to induce an immune response in farm animals or pets; and (6) an organic molecule suited to induce a response against a drug, a hormone or a toxic compound.
In a particular embodiment, the antigen comprises, or alternatively consists of, a cytotoxic T cell epitope. In a related embodiment, the virus-like particle comprises the Hepatitis B virus core protein and the cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein, h one embodiment, they are fused by a leucine linking sequence.
In another aspect of the invention, there is provided a method of enhancing an immune response in a human or other animal species comprising introducing into the animal a composition comprising a virus-like particle and immunostimulatory substance, preferably an immunostimulatory nucleic acid, an even more preferably an unmethylated CpG-containing oligonucleotide where the substance, preferably the nucleic acid, and even more preferally the oligonucleotide is bound (i.e. coupled, attached or enclosed) to the virus-like particle. In a further embodiment, the composition further comprises an antigen bound to the virus-like particle.
In yet another embodiment of the invention, the composition is introduced into an animal subcutaneously, intramuscularly, intranasally, intradermally, intravenously or directly into a lymph node. In an equally preferred embodiment, the immune enhancing composition is applied locally, near a tumor or local viral reservoir against which one would like to vaccinate.
In a preferred aspect of the invention, the immune response is a T cell response, and the T cell response against the antigen is enhanced. In a specific embodiment, the T cell response is a cytotoxic T cell response, and the cytotoxic T cell response against the antigen is enhanced.
The present invention also relates to a vaccine comprising an immunologically effective amount of the immune enhancing composition of the present invention together with a pharmaceutically acceptable diluent, carrier or excipient. In a preferred embodiment, the vaccine further comprises at least one adjuvant, such as incomplete Freund's adjuvant. The invention also provides a method of immunizing and/or treating an animal comprising administering to the animal an immunologically effective amount of the disclosed vaccine.
In a preferred embodiment of the invention, the immunostimulatory substance-containing VLPs, preferably the immunostimulatory nucleic acid- containing VLP's, an even more preferably the unmethylated CpG-containing oligonucleotide VLPs are used for vaccination of animals or humans against the VLP itself or against antigens coupled, fused or attached otherwise to the VLP. The modified VLPs can be used to vaccinate against tumors, viral diseases, self-molecules and self antigens, respectively, or non-peptidic small molecules, for example. The vaccination can be for prophylactic or therapeutic purposes, or both. Also, the modified VLPs can be used to vaccinate against allergies in order to induce immune-deviation.
In the majority of cases, the desired immune response will be directed against antigens coupled, fused or attached otherwise to the immunostimulatory substance-containing VLPs, preferably the immunostimulatory nucleic acid-containing VLP's, an even more preferably the unmethylated CpG-containing oligonucleotide VLPs. The antigens can be peptides, proteins, domains, carbohydrates or small molecules such as, for example, steroid hormones or drugs, such as nicotine. Under some conditions, the desired immune response can be directed against the VLP itself. This latter application will be used in cases where the VLP originates from a virus against which one would like to vaccinate.
The route of injection is preferably subcutaneous or intramuscular, but it would also be possible to apply the CpG-containing VLPs intradermally, intranasally, intravenously or directly into the lymph node. In an equally preferred embodiment, the CpG-containing antigen-coupled or free VLPs are applied locally, near a tumor or local viral reservoir against which one would like to vaccinate.
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are intended to provide further explanation of the invention as claimed.
Brief Description Of The Drawings/Figures
Figure 1 shows the DNA sequence of the CpG-oligonucleotide (A) and the DNA sequence of the peptide p33-containing VLP derived from hepatitis B core (B). The nonameric p33 epitope is genetically fused to the C-terminus of the hepatitis B core protein at position 185 via a three leucine linking sequence.
Figure 2 shows the structure of the p33-VLPs as assessed by electron microscopy (A) and SDS PAGE (B). Recombinantly produced wild-type VLPs (composed of HBcAg [aa 1-185] monomers) and p33-VLPs were loaded onto a Sephacryl S-400 gel filtration column (Amersham Pharmacia Biotechnology AG) for purification. Pooled fractions were loaded onto a Hydroxyapatite column. Flow through (which contains purified HBc capsids) was collected and loaded onto a reducing SDS-PAGE gel for monomer molecular weight analysis (B).
Figure 3 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after control incubation or after digestion with RNase A upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA or protein. Recombinantly produced p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lane 2) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C. The samples were subsequently complemented with 6-fold concentrated DNA-loading buffer (MBS Fermentas GmbH, Heidelberg, Germany) and run for 30 min at 100 volts in a 1% native agarose gel. The Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA packaged in p33-VLPs (A) or p33-VLP capsids themselves (B). Identical results were obtained in 3 independent experiments.
Figure 4 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after control incubation or after digestion with RNase A in the presence of buffer only or CpG-containing DNA-oligomers upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA/DNA or protein. Recombinant p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lane 2 and 3) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C. 5 nmol CpG- oligonucleotides (containing phosphorothioate modification of the backbone) were added to sample 3 before RNase A digestion. The Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA or CpG-oligonucleotides in p33-VLPs (A) or p33-VLPs capsids themselves (B). Identical results were obtained when CpG oligonucleotides with phosphodiester bonds were used for co-incubation of VLPs with RNase A.
Figure 5 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) before and after digestion with RNase A in the presence of CpG- containing DNA-oligomers and subsequent dialysis (for the elimination of VLP-unbound CpG DNA) upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of DNA or protein. Recombinant p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in absence (lane 1) or in presence (lanes 2 to 5) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C. 50 nmol CpG-oligonucleotides (containing phosphorothioate modification of the phosphate backbone: lanes 2 and 3, containing phosphodiester bonds: lanes 4 and 5) were added to VLPs before RNase A digestion. Treated samples were extensively dialysed for 24 hours against PBS (4500-fold dilution) with a 300 kDa MWCO dialysis membrane (Spectrum Medical Industries Inc., Houston, USA) to eliminate the in excess DNA (lanes 3 and 5). The Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA or CpG- oligonucleotides in p33-VLPs (A) or p33-VLP capsids themselves (B).
Figure 6 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after control incubation or after digestion with RNase A where CpG- containing oligonucleotides were added only after completing the RNA digestion upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA/DNA or protein. Recombinant p33- VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lane 2 and 3) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C. 5 nmol CpG-oligonucleotides (containing phosphorothioate modification of the phosphate backbone) were added to sample 3 only after the RNase A digestion. The Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA or CpG-oligonucleotides in p33- VLPs (A) or p33-VLP capsids themselves (B). Identical results were obtained when CpG oligonucleotides with phosphodiester bonds were used for reassembly of VLPs. Figure 7 shows that p33-VLPs packaged with CpG-oligonucleotides (containing phosphorothioate modification of the phosphate backbone), are effective at inducing viral protection. Mice were subcutaneously primed with 100 μg p33-VLP alone, mixed with 20 nmol CpG-oligonucleotide (p33- VLP+CpG) or p33-VLP packaged with CpG-oligonucleotide after dialysis of free CpG-oligonucleotide (p33-VLP/CpG). Untreated naive mice served as negative control. Twenty-one days later, mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immunology Methods Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, NY (1997) p. 1921.
Figure 8 shows that p33-VLPs packaged with CpG-oligonucleotide (containing phosphodiester bonds) are effective at inducing viral protection. Mice were subcutaneously primed with 100 μg p33-VLP alone, mixed with 20 nmol CpG-oligonucleotides (p33-VLP+CpG) or p33-VLPs packaged with CpG-oligonucleotides after dialysis of free CpG-oligonucleotides) (p33- VLP/CpG). Untreated naϊve mice served as negative control. Twenty-one days later, mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immunology Methods Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, NY (1997) p. 1921.
Figure 9 shows that mice treated with CpG-oligonucleotides alone are not protected from viral infection. Mice were subcutaneously primed with 20 nmol CpG-oligonucleotides (CpG), or left untreated as negative control (naive). Twenty-one days later, mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immunology Methods Manual, Lefkowitz, I., ed., Academic Press Ltd., New York, NY (1997) p. 1921. Figure 10 shows the amino acid sequence of the BKV (AS) VP1 protein (GL332779). This sequence was expressed in yeast to produce BKV capsids (Sasnauskas K. et al, J. Biol Chem 380(3):381 (1999); K. et al, Generation of recombinant virus-like particles of different polyomaviruses in yeast. 3rd International Workshop "Virus-like particles as vaccines" Berlin, (2001)).
Figure 11 shows the DNA sequence of the 246 bp double stranded DNA fragment used for packaging and stabilization of BKV VLPs.
Figure 12 shows BKV VLPs (15 μg) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with fluorescent phosphorothioate (pt) CpG- oligonucleotides. UV excitation leads to detection of DNA in an ethidium bromide stained gel (A) and to fluorescence of CpG-FAM oligomers in the absence of ethidium bromide (B). Lane 1: BKV VLPs untreated; lane 2: BKV VLPs RNase A treated; lane 3: BKV VLPs RNase A treated with CpG(pt)- FAM; lane 4: BKV VLPs RNase A treated with CpG(pt)-FAM plus DNasel treatment; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany). Arrows are indicating the presence of RNA or CpG- FAM oligomers in BKV VLPs.
Figure 13 shows BKV VLPs (15 μg) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with double stranded (ds) DNA (246 bp) upon staining with ethidium bromide (A) or Coomassie Blue (B). Lane 1: BKV VLPs untreated; lane 2: BKV VLPs RNase A treated; lane 3: BKV VLPs treated with RNase A and incubated with ds DNA; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany). Arrows indicate the presence of RNA or ds DNA in BKV VLPs.
Figure 14 shows BKV VLPs (15 μg) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with CpG-oligonucleotides (with phosphate- or with phosphorothioate (pt) backbone) upon staining with ethidium bromide (A) or Coomassie Blue (B). Lane 1: BKV VLPs stock (PBS/50% glycerol); lane 2: BKV VLPs untreated (PBS buffer); lane 3: BKV VLPs RNase A treated; lane 4: BKV VLPs RNase A treated post- dialysis; lane 5: BKV VLPs RNase A treated with CpG-oligonucleotides; lane 6: BKV VLPs RNase A treated with CpG(pt)-oligomers; lane 7: BKV VLPs RNase A treated with CpG(pt)- oligomers post-dialysis; lane M: Gene Ruler 1 kb DNA ladder (MBI Fermentas GmbH, Heidelberg, Germany). Arrows indicate the presence of RNA or CpG-oligonucleotides in BKV VLPs.
Figure 15 shows mouse IgGl and IgG2a OD50% antibody titers to BKV VLPs on day 14 after immunization with BKV VLPs and phosphorothioate (pt) CpG-oligonucleotides. Lane 1: RNase treated BKV VLPs; lane 2: RNase treated BKV VLPs in combination with 0.3 nmol CpG(pt)-oligomer; lane 3: RNase treated BKV VLPs in combination with 20 nmol CpG(pt)-oligomer; lane 4: RNase treated BKV VLPs containing 0.3 nmol CpG(pt)-oligomer.
Figure 16 shows p33-VLPs in a native agarose gel electrophoresis (1% agarose) after confrol incubation or after digestion with RNase A where linear double-stranded DNA (350 base pairs long) was added only after completing the RNA digestion upon staining with ethidium bromide (A) or Coomassie blue (B) in order to assess for the presence of RNA DNA or protein. Recombinant p33-VLPs were diluted at a final concentration of 0.5 ug/ul protein in PBS buffer and incubated in the absence (lane 1) or presence (lanes 2, 3 and 4) of RNase A (100 ug/ml) (Sigma, Division of Fluka AG, Switzerland) for 2 h at 37°C. Linear double-stranded DNA of 350 bp in length was added to sample 3 and 4 only after the RNase A digestion to a final concentration of 100 ng/ml and incubated for 3 hours at 37 °C. Sample 4 was further digested with DNase I (50 IU/ml)(Sigma, Division of Fluka AG, Switzerland) for additional 3 hours at 37 °C. The Gene Ruler marker (MBS Fermentas GmbH, Heidelberg, Germany) was used as reference for p33-VLPs migration velocity (lane M). Arrows are indicating the presence of RNA/dsDNA free or enclosed in p33-VLPs (A) and p33-VLPs (B). Figure 17 shows packaging of B-CpG into HBc33 VLPs.
Figure 18 shows packaging of NKCpG into HBc33 VLPs.
Figure 19 shows packaging of glOgacga-PO into HBc33 VLPs.
Figure 20 shows packaging of CyCpG-150 into HBc33 VLPs.
Figure 21 shows packaging of NKCpGpt into HBcPl A VLPs.
Figure 22 shows coupling of p33 to HBcAg VLPs.
Figure 23 shows packaging of B-CpGpt into HBx33 VLPs.
Figure 24 shows coupling of p33 to Qβ VLPs.
Figure 25 shows ionic strength and low protein concentration allow RNA hydrolysis by RNase A in Qβ VLPs.
Figure 26 shows ionic strength increases immunostimulatory nucleic acid packaging into Qβ VLPs.
Figure 27 shows packaging of B-CpGpt, glOgacga-PO and dsCyCpG into Qbx33 VLPs.
Figure 28 shows SDS-PAGE analysis of the fractions from the sucrose gradient centrifugation after Qβ VLP disassembly and reassembly in the presence of immunostimulatory nucleic acids.
Figure 29 shows electron micrographs of Qβ VLP after disassembly and reassembly in the presence of oligonucleotide (CpG)20OpA.
Figure 30 shows ouchterlony analysis (immunodiffusion) of the diassembled and reassembled Qβ VLP.
Figure 31 shows gelelectrophoretic analysis of dissassembled and reassembled Qβ VLP.
Figure 32. shows electron micrographs of the dissassembled and reassembled Qβ VLP with the oligonucleotide CyOpA.
Figure 33' shows electron micrographs of the purified dissassembled and reassembled Qβ VLP with the different immunostimulatory nucleic acids.
Figure 34 shows SDS-PAGE analysis of the coupling of Q/3 VLP reassembled with the oligodeoxynucleotide CyOpA to the p33GGC peptide.
Figure 35 shows packaged oligodeoxynucleotides after disassembly and reassembly of Qβ VLPs and subsequent coupling to p33 GGC peptide. Figure 36 shows purification of disassembled Qβ coat protein by size exclusion chromatography.
Figure 37 shows purification of reassembled Qβ VLPs by size exclusion chromatography.
Figure 38 shows electron micrographs of Qβ VLPs that were reassembled in the presence of different oligodeoxynucleotides.
Figure 39 shows analysis of the disulfide-bond pattern in reassembled and purified Qβ capsids.
Figure 40 shows analysis of nucleic acid content of the reassembled Qβ VLPs by nuclease treatment and agarose gelelectrophoresis.
Figure 41 shows analysis of nucleic acid content of the reassembled Qβ VLPs by proteinase K treatment and polyacrylamide TBE Urea gelelectrophoresis .
Figure 42 shows electron micrographs AP205 VLP disassembled and subsequently reassembled in the presence of CyCpG.
Figure 43 shows agarose gel-electrophoresis analysis of AP205 VLPs diassembled and reassembled in the presence of CyCpG.
Figure 44 shows electron micrograph of disassembled and reassembled AP205.
Figure 45 shows Agarose gel-electrophoresis analysis of AP205 VLPs diassembled and reassembled in the presence of CyCpG.
Figure 46 shows SDS-PAGE analysis of disassembled and reassembled AP205 VLPs.
Figure 47 shows SDS-PAGE analysis of the peptide coupling to disassembled and reassembled AP205 VLPs.
Figure 48 shows free immunostimulatory nucleic acids but not immunostimulatory nucleic acids packaged in VLPs induce splenomegaly.
Figure 49 shows different immunostimulatory nucleic acids packaged in VLP fused to antigen result in a potent antigen-specific CTL response and virus protection. Figure 50 shows the immunostimulatory nucleic acid glOgacga-PS packaged in VLP fused to antigen result in a potent antigen-specific CTL response and virus protection.
Figure 51 shows immunostimulatory nucleic acids packaged in HBcAg and Qβ VLPs result in a potent antigen-specific CTL response and virus protection.
Figure 52 shows immunostimulatory nucleic acids packaged in VLPs are even more efficient in inducing CTL responses than VLPs mixed with immunostimulatory nucleic acids.
Figure 53 shows analysis of non-enzymatic RNA hydrolysis of the RNA in Qβ VLPs.
Figure 54 shows packaging of oligodeoxynucleotides into Qβ VLPs after non-enzymatic RNA hydrolysis.
Figure 55 shows analysis of packaging of oligodeoxynucleotides into Qβ VLPs after non-enzymatic RNA hydrolysis.
Detailed Description Of The Invention
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are hereinafter described.
1. Definitions
Amino acid linker: An "amino acid linker", or also just termed "linker" within this specification, as used herein, either associates the antigen or antigenic determinant with the second attachment site, or more preferably, already comprises or contains the second attachment site, typically - but not necessarily - as one amino acid residue, preferably as a cysteine residue. The term "amino acid linker" as used herein, however, does not intend to imply that such an amino acid linker consists exclusively of amino acid residues, even if an amino acid linker consisting of amino acid residues is a preferred embodiment of the present invention. The amino acid residues of the amino acid linker are, preferably, composed of naturally occuring amino acids or unnatural amino acids known in the art, all-L or all-D or mixtures thereof. However, an amino acid linker comprising a molecule with a sulfhydryl group or cysteine residue is also encompassed within the invention. Such a molecule comprise preferably a C1-C6 alkyl-, cycloalkyl (C5,C6), aryl or heteroaryl moiety. However, in addition to an amino acid linker, a linker comprising preferably a C1-C6 alkyl-, cycloalkyl- (C5,C6), aryl- or heteroaryl- moiety and devoid of any amino acid(s) shall also be encompassed within the scope of the invention. Association between the antigen or antigenic determinant or optionally the second attachment site and the amino acid linker is preferably by way of at least one covalent bond, more preferably by way of at least one peptide bond.
Animal: As used herein, the term "animal" is meant to include, for example, humans, sheep, horses, cattle, pigs, dogs, cats, rats, mice, mammals, birds, reptiles, fish, insects and arachnids.
Antibody: As used herein, the term "antibody" refers to molecules which are capable of binding an epitope or antigenic determinant. The term is meant to include whole antibodies and antigen-binding fragments thereof, including single-chain antibodies. Most preferably the antibodies are human antigen binding antibody fragments and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a V or VH domain. The antibodies can be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse or chicken. As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described, for example, in U.S. Patent No. 5,939,598 by Kucherlapati et al.
Antigen: As used herein, the term "antigen" refers to a molecule capable of being bound by an antibody or a T cell receptor (TCR) if presented by MHC molecules. The term "antigen", as used herein, also encompasses T- cell epitopes. An antigen is additionally capable of being recognized by the immune system and/or being capable of inducing a humoral immune response and/or cellular immune response leading to the activation of B- and/or T- lymphocytes. This may, however, require that, at least in certain cases, the antigen contains or is linked to a Th cell epitope and is given in adjuvant. An antigen can have one or more epitopes (B- and T- epitopes). The specific reaction referred to above is meant to indicate that the antigen will preferably react, typically in a highly selective manner, with its corresponding antibody or TCR and not with the multitude of other antibodies or TCRs which may be evoked by other antigens.
A "microbial antigen" as used herein is an antigen of a microorganism and includes, but is not limited to, infectious virus, infectious bacteria, parasites and infectious fungi. Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic or recombinant compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism. A compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen. Such antigens are used routinely in the art and are well known to the skilled artisan.
Examples of infectious viruses that have been found in humans include but are not limited to: Retro viridae (e.g. human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-HI/LAV, or HΓV-IIΪ); and other isolates, such as HIV-LP); Picornaviridae (e.g. polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae (e.g. equine encephalitis viruses, rubella viruses); Flaviridae (e.g. dengue viruses, encephalitis viruses, yellow fever viruses); Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae (e.g. parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g. influenza viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g. reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (heφes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), heφes virus); Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. African swine fever virus); and unclassified viruses (e.g. the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class l=internally transmitted; class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and related viruses, and astroviruses).
Both gram negative and gram positive bacteria serve as antigens in vertebrate animals. Such gram positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species and Streptococcus species. Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include but are not limited to: Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps. (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus antracis, Corynebacterium diphtheriae, Corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia, Actinomyces israelli and Chlamydia.
Examples of infectious fungi include: Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis and Candida albicans. Other infectious organisms (i.e., protists) include: Plasmodium such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, Plasmodium vivax, Toxoplasma gondii and Shistosoma.
Other medically relevant microorganisms have been descried extensively in the literature, e.g., see C. G. A. Thomas, "Medical Microbiology", Bailliere Tindall, Great Britain 1983, the entire contents of which is hereby incoφorated by reference.
The compositions and methods of the invention are also useful for treating cancer by stimulating an antigen-specific immune response against a cancer antigen. A "tumor antigen" as used herein is a compound, such as a peptide, associated with a tumor or cancer and which is capable of provoking an immune response. In particular, the compound is capable of provoking an immune response when presented in the context of an MHC molecule. Tumor antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen, et al, Cancer Research, 54:1055 (1994), by partially purifying the antigens, by recombinant technology or by de novo synthesis of known antigens. Tumor antigens include antigens that are antigenic portions of or are a whole tumor or cancer polypeptide. Such antigens can be isolated or prepared recombinantly or by any other means known in the art. Cancers or tumors include, but are not limited to, biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g. small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas.
Antigenic determinant: As used herein, the term "antigenic determinant" is meant to refer to that portion of an antigen that is specifically recognized by either B- or T-lymphocytes. B-lymphocytes respond to foreign antigenic determinants via antibody production, whereas T-lymphocytes are the mediator of cellular immunity. Thus, antigenic determinants or epitopes are those parts of an antigen that are recognized by antibodies, or in the context of an MHC, by T-cell receptors.
Antigen presenting cell: As used herein, the term "antigen presenting cell" is meant to refer to a heterogenous population of leucocytes or bone marrow derived cells which possess an immunostimulatory capacity. For example, these cells are capable of generating peptides bound to MHC molecules that can be recognized by T cells. The term is synonymous with the term "accessory cell" and includes, for example, Langerhans' cells, interdigitating cells, B cells, macrophages and dendritic cells. Under some conditions, epithetral cells, endothelial cells and other, non-bone marrow derived cells may also serve as antigen presenting cells.
Association: As used herein, the term "association" as it applies to the first and second attachment sites, refers to the binding of the first and second attachment sites that is preferably by way of at least one non-peptide bond. The nature of the association may be covalent, ionic, hydrophobic, polar or any combination thereof, preferably the nature of the association is covalent.
Attachment Site, First: As used herein, the phrase "first attachment site" refers to an element of non-natural or natural origin, to which the second attachment site located on the antigen or antigenic determinant may associate. The first attachment site may be a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a combination thereof, or a chemically reactive group thereof. The first attachment site is located, typically and preferably on the surface, of the virus-like particle. Multiple first attachment sites are present on the surface of virus-like particle typically in a repetitive configuration.
Attachment Site, Second: As used herein, the phrase "second attachment site" refers to an element associated with the antigen or antigenic determinant to which the first attachment site located on the surface of the virus-like particle may associate. The second attachment site of the antigen or antigenic determinant may be a protein, a polypeptide, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a combination thereof, or a chemically reactive group thereof. At least one second attachment site is present on the antigen or antigenic determinant. The term "antigen or antigenic determinant with at least one second attachment site" refers, therefore, to an antigen or antigenic construct comprising at least the antigen or antigenic determinant and the second attachment site. However, in particular for a second attachment site, which is of non-natural origin, i.e. not naturally occurring within the antigen or antigenic determinant, these antigen or antigenic constructs comprise an "amino acid linker".
Bound: As used herein, the term "bound" refers to binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon- sulfur bonds, carbon-phosphorus bonds, and the like. The term also includes the enclosement, or partial enclosement, of a substance. The term "bound" is broader than and includes terms such as "coupled," "fused," "enclosed", "packaged" and "attached." For example, the immunostimulatory substance such as the unmethylated CpG-containing oligonucleotide can be enclosed by the VLP without the existence of an actual binding, neither covalently nor non-covalently.
Coat protein(s): As used herein, the term "coat protein(s)" refers to the protein(s) of a bacteriophage or a RNA-phage capable of being incoφorated within the capsid assembly of the bacteriophage or the RNA-phage. However, when referring to the specific gene product of the coat protein gene of RNA- phages the term "CP" is used. For example, the specific gene product of the coat protein gene of RNA-phage Qβ is referred to as "Qβ CP", whereas the "coat proteins" of bacteriophage Qβ comprise the "Qβ CP" as well as the Al protein. The capsid of Bacteriophage Qβ is composed mainly of the Qβ CP, with a minor content of the Al protein. Likewise, the VLP Qβ coat protein contains mainly Qβ CP, with a minor content of Al protein.
Coupled: As used herein, the term "coupled" refers to attachment by covalent bonds or by strong non-covalent interactions. Any method normally used by those skilled in the art for the coupling of biologically active materials can be used in the present invention.
Fusion: As used herein, the term "fusion" refers to the combination of amino acid sequences of different origin in one polypeptide chain by in-frame combination of their coding nucleotide sequences. The term "fusion" explicitly encompasses internal fusions, i.e., insertion of sequences of different origin within a polypeptide chain, in addition to fusion to one of its termini.
CpG: As used herein, the term "CpG" refers to an oligonucleotide which contains an unmethylated cytosine, guanine dinucleotide sequence (e.g. "CpG DNA" or DNA containing a cytosine followed by guanosine and linked by a phosphate bond) and stimulates/activates, e.g. has a mitogenic effect on, or induces or increases cytokine expression by, a vertebrate cell. For example, CpGs can be useful in activating B cells, NK cells and antigen-presenting cells, such as monocytes, dendritic cells and macrophages, and T cells. The CpGs can include nucleotide analogs such as analogs containing phosphorothioester bonds and can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single- stranded molecules have increased immune activity.
Epitope: As used herein, the term "epitope" refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably in a human. An "immunogenic epitope," as used herein, is defined as a portion of a polypeptide that elicits an antibody response or induces a T-cell response in an animal, as determined by any method known in the art. (See, for example, Geysen et al, Proc. Natl. Acad. Sci. USA §7:3998-4002 (1983)). The term "antigenic epitope," as used herein, is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art. Immunospecific binding excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic. Antigenic epitopes can also be T-cell epitopes, in which case they can be bound immunospecifically by a T-cell receptor within the context of an MHC molecule.
An epitope can comprise 3 amino acids in a spatial conformation which is unique to the epitope. Generally, an epitope consists of at least about 5 such amino acids, and more usually, consists of at least about 8-10 such amino acids. If the epitope is an organic molecule, it may be as small as Nitrophenyl.
Immune response: As used herein, the term "immune response" refers to a humoral immune response and/or cellular immune response leading to the activation or proliferation of B- and/or T-lymphocytes. In some instances, however, the immune responses may be of low intensity and become detectable only when using at least one substance in accordance with the invention. "Immunogenic" refers to an agent used to stimulate the immune system of a living organism, so that one or more functions of the immune system are increased and directed towards the immunogenic agent. An "immunogenic polypeptide" is a polypeptide that elicits a cellular and/or humoral immune response, whether alone or linked to a carrier in the presence or absence of an adjuvant.
Immunization: As used herein, the terms "immunize" or "immunization" or related terms refer to conferring the ability to mount a substantial immune response (comprising antibodies or cellular immunity such as effector CTL) against a target antigen or epitope. These terms do not require that complete immunity be created, but rather that an immune response be produced which is substantially greater than baseline. For example, a mammal may be considered to be immunized against a target antigen if the cellular and/or humoral immune response to the target antigen occurs following the application of methods of the invention.
Immunostimulatory nucleic acid: As used herein, the term immunostimulatory nucleic acid refers to a nucleic acid capable of inducing and/or enhancing an immune response. Immunostimulatory nucleic acids, as used herein, comprise ribonucleic acids and in particular deoxyribonucleic acids. Preferably, immunostimulatory nucleic acids contain at least one CpG motif e.g. a CG dinucleotide in which the C is unmethylated. The CG dinucleotide can be part of a palindromic sequence or can be encompassed within a non-palindromic sequence. Immunostimulatory nucleic acids not containing CpG motifs as described above encompass, by way of example, nucleic acids lacking CpG dinucleotides, as well as nucleic acids containing CG motifs with a methylated CG dinucleotide. The term "immunostimulatory nucleic acid" as used herein should also refer to nucleic acids that contain modified bases such as 4-bromo-cytosine.
Immunostimulatory substance: As used herein, the term "immunostimulatory substance" refers to a substance capable of inducing and/or enhancing an immune response. Immunostimulatory substances, as used herein, include, but are not limited to, toll-like receptor activing substances and substances inducing cytokine secretion. Toll-like receptor activating substances include, but are not limited to, immunostimulatory nucleic acids, peptideoglycans, lipopolysaccharides, lipoteichonic acids, imidazoquinoline compounds, flagellins, lipoproteins, and immunostimulatory organic substances such as taxol.
Natural origin: As used herein, the term "natural origin" means that the whole or parts thereof are not synthetic and exist or are produced in nature.
Non-natural: As used herein, the term generally means not from nature, more specifically, the term means from the hand of man.
Non-natural origin: As used herein, the term "non-natural origin" generally means synthetic or not from nature; more specifically, the term means from the hand of man.
Ordered and repetitive antigen or antigenic determinant array: As used herein, the term "ordered and repetitive antigen or antigenic determinant array" generally refers to a repeating pattern of antigen or antigenic determinant, characterized by a typically and preferably uniform spacial arrangement of the antigens or antigenic determinants with respect to the core particle and virus-like particle, respectively. In one embodiment of the invention, the repeating pattern may be a geometric pattern. Typical and preferred examples of suitable ordered and repetitive antigen or antigenic determinant arrays are those which possess strictly repetitive paracrystalline orders of antigens or antigenic determinants, preferably with spacings of 0.5 to 30 nanometers, more preferably 5 to 15 nanometers.
Oligonucleotide: As used herein, the terms "oligonucleotide" or "oligomer" refer to a nucleic acid sequence comprising 2 or more nucleotides, generally at least about 6 nucleotides to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, and more preferably about 6 to about 300 nucleotides, even more preferably about 20 to about 300 nucleotides, and even more preferably about 20 to about 100 nucleotides. The terms "oligonucleotide" or "oligomer" also refer to a nucleic acid sequence comprising more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides. "Oligonucleotide" also generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Oligonucleotide" includes, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-sfranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "oligonucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. Further, an oligonucleotide can be synthetic, genomic or recombinant, e.g., λ-DNA, cosmid DNA, artificial bacterial chromosome, yeast artificial chromosome and filamentous phage such as M13.
The term "oligonucleotide" also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. For example, suitable nucleotide modifications/analogs include peptide nucleic acid, inosin, tritylated bases, phosphorothioates, alkylphosphorothioates, 5-nitroindole deoxyribofuranosyl, 5-methyldeoxycytosine and 5,6-dihydro-5,6-dihydroxydeoxythymidine. A variety of modifications have been made to DNA and RNA; thus, "oligonucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. Other nucleotide analogs/modifications will be evident to those skilled in the art.
Packaged: The term "packaged" as used herein refers to the state of an immunostimulatory substance, in particular an immunostimulatory nucleic acid in relation to the VLP. The term "packaged" as used herein includes binding that may be covalent, e.g., by chemically coupling, or non-covalent, e.g., ionic interactions, hydrophobic interactions, hydrogen bonds, etc. Covalent bonds can be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds, carbon-phosphorus bonds, and the like. The term also includes the enclosement, or partial enclosement, of a substance. The term "packaged" includes terms such as "coupled, "enclosed" and "attached." For example, the immunostimulatory substance such as the unmethylated CpG-containing oligonucleotide can be enclosed by the VLP without the existence of an actual binding, neither covalently nor non- covalently. In preferred embodiments, in particular, if immunostimulatory nucleic acids are the immunostimulatory substances, the term "packaged" indicates that the nucleic acid in a packaged state is not accessible to DNAse or RNAse hydrolysis. In preferred embodiments, the immunostimulatory nucleic acid is packaged inside the VLP capsids, most preferably in a noncovalent manner.
The compositions of the invention can be combined, optionally, with a pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human or other animal. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
Organic molecule: As used herein, the term "organic molecule" refers to any chemical entity of natural or synthetic origin. In particular the term "organic molecule" as used herein encompasses, for example, any molecule being a member of the group of nucleotides, lipids, carbohydrates, polysaccharides, lipopolysaccharides, steroids, alkaloids, teφenes and fatty acids, being either of natural or synthetic origin. In particular, the term "organic molecule" encompasses molecules such as nicotine, cocaine, heroin or other pharmacologically active molecules contained in drugs of abuse. In general an organic molecule contains or is modified to contain a chemical functionality allowing its coupling, binding or other method of attachment to the virus-like particle in accordance with the invention.
Polypeptide: As used herein, the term "polypeptide" refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). It indicates a molecular chain of amino acids and does not refer to a specific length of the product. Thus, peptides, oligopeptides and proteins are included within the definition of polypeptide. This term is also intended to refer to post-expression modifications of the polypeptide, for example, glycosolations, acetylations, phosphorylations, and the like. A recombinant or derived polypeptide is not necessarily translated from a designated nucleic acid sequence. It may also be generated in any manner, including chemical synthesis.
A substance which "enhances" an immune response refers to a substance in which an immune response is observed that is greater or intensified or deviated in any way with the addition of the substance when compared to the same immune response measured without the addition of the substance. For example, the lytic activity of cytotoxic T cells can be measured, e.g. using a 51Cr release assay, with and without the substance. The amount of the substance at which the CTL lytic activity is enhanced as compared to the CTL lytic activity without the substance is said to be an amount sufficient to enhance the immune response of the animal to the antigen, hi a preferred embodiment, the immune response in enhanced by a factor of at least about 2, more preferably by a factor of about 3 or more. The amount of cytokines secreted may also be altered.
Effective Amount: As used herein, the term "effective amount" refers to an amount necessary or sufficient to realize a desired biologic effect. An effective amount of the composition would be the amount that achieves this selected result, and such an amount could be determined as a matter of routine by a person skilled in the art. For example, an effective amount for treating an immune system deficiency could be that amount necessary to cause activation of the immune system, resulting in the development of an antigen specific immune response upon exposure to antigen. The term is also synonymous with "sufficient amount."
The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, and/or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular composition of the present invention without necessitating undue experimentation.
Self antigen: As used herein, the tern "self antigen" refers to proteins encoded by the host's DNA and products generated by proteins or RNA encoded by the hos s DNA are defined as self. In addition, proteins that result from a combination of two or several self-molecules or that represent a fraction of a self-molecule and proteins that have a high homology two self- molecules as defined above (>95%, preferably >97%, more preferably >99%) may also be considered self. In a further preferred embodiment of the present invention, the antigen is a self antigen. Very preferred embodiments of self- antigens useful for the present invention are described WO 02/056905, the disclosures of which are herewith incoφorated by reference in its entirety.
Treatment: As used herein, the terms "treatment", "treat", "treated" or "treating" refer to prophylaxis and/or therapy. When used with respect to an infectious disease, for example, the term refers to a prophylactic treatment which increases the resistance of a subject to infection with a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen or will show signs of illness attributable to the infection, as well as a treatment after the subject has become infected in order to fight the infection, e.g., reduce or eliminate the infection or prevent it from becoming worse.
Vaccine: As used herein, the term "vaccine" refers to a formulation which contains the composition of the present invention and which is in a form that is capable of being administered to an animal. Typically, the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition of the present invention is suspended or dissolved. In this form, the composition of the present invention can be used conveniently to prevent, ameliorate, or otherwise treat a condition. Upon introduction into a host, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies, cytokines and/or other cellular responses.
Optionally, the vaccine of the present invention additionally includes an adjuvant which can be present in either a minor or major proportion relative to the compound of the present invention. The term "adjuvant" as used herein refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine of the present invention provide for an even more enhanced immune response. A variety of adjuvants can be used. Examples include incomplete Freund's adjuvant, aluminum hydroxide and modified muramyldipeptide. The term "adjuvant" as used herein also refers to typically specific stimulators of the immune response which when combined with the vaccine of the present invention provide for an even more enhanced and typically specific immune response. Examples include, but limited to, GM-CSF, IL-2, IL-12, IFNα. Further examples are within the knowledge of the person skilled in the art.
Virus-like particle: As used herein, the term "virus-like particle" refers to a structure resembling a virus particle but which has not been demonstrated to be pathogenic. Typically, a virus-like particle in accordance with the invention does not carry genetic information encoding for the proteins of the virus-like particle. In general, virus-like particles lack the viral genome and, therefore, are noninfectious. Also, virus-like particles can often be produced in large quantities by heterologous expression and can be easily purified. Some virus-like particles may contain nucleic acid distinct from their genome. As indicated, a virus-like particle in accordance with the invention is non replicative and noninfectious since it lacks all or part of the viral genome, in particular the replicative and infectious components of the viral genome. A virus-like particle in accordance with the invention may contain nucleic acid distinct from their genome. A typical and preferred embodiment of a virus-like particle in accordance with the present invention is a viral capsid such as the viral capsid of the corresponding virus, bacteriophage, or RNA-phage. The terms "viral capsid" or "capsid", as interchangeably used herein, refer to a macromolecular assembly composed of viral protein subunits. Typically and preferably, the viral protein subunits assemble into a viral capsid and capsid, respectively, having a structure with an inherent repetitive organization, wherein said structure is, typically, spherical or tubular. For example, the capsids of RNA-phages or HBcAg's have a spherical form of icosahedral symmetry. The term "capsid-like structure" as used herein, refers to a macromolecular assembly composed of viral protein subunits ressembling the capsid moφhology in the above defined sense but deviating from the typical symmetrical assembly while maintaining a sufficient degree of order and repetitiveness.
Virus-like particle of a bacteriophage: As used herein, the term "viruslike particle of a bacteriophage" refers to a virus-like particle resembling the structure of a bacteriophage, being non replicative and noninfectious, and lacking at least the gene or genes encoding for the replication machinery of the bacteriophage, and typically also lacking the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host. This definition should, however, also encompass virus-like particles of bacteriophages, in which the aforementioned gene or genes are still present but inactive, and, therefore, also leading to non-replicative and noninfectious virus-like particles of a bacteriophage.
VLP of RNA phage coat protein: The capsid structure formed from the self-assembly of 180 subunits of RNA phage coat protein and optionally containing host RNA is referred to as a "VLP of RNA phage coat protein". A specific example is the VLP of Qβ coat protein, hi this particular case, the VLP of Qβ coat protein may either be assembled exclusively from Qβ CP subunits (generated by expression of a Qβ CP gene containing, for example, a TAA stop codon precluding any expression of the longer Al protein through suppression, see Kozlovska, T.M., et al, Intervirology 39: 9-15 (1996)), or additionally contain Al protein subunits in the capsid assembly. The term "virus particle" as used herein refers to the moφhological form of a virus. In some virus types it comprises a genome surrounded by a protein capsid; others have additional structures (e.g., envelopes, tails, etc.).
Non-enveloped viral particles are made up of a proteinaceous capsid that surrounds and protects the viral genome. Enveloped viruses also have a capsid structure surrounding the genetic material of the virus but, in addition, have a lipid bilayer envelope that surrounds the capsid. h a preferred embodiment of the invention, the VLP's are free of a lipoprotein envelope or a lipoprotein-containing envelope. In a further preferred embodiment, the VLP's are free of an envelope altogether.
One, a, or an: When the terms "one," "a," or "an" are used in this disclosure, they mean "at least one" or "one or more," unless otherwise indicated.
As will be clear to those skilled in the art, certain embodiments of the invention involve the use of recombinant nucleic acid technologies such as cloning, polymerase chain reaction, the purification of DNA and RNA, the expression of recombinant proteins in prokaryotic and eukaryotic cells, etc. Such methodologies are well known to those skilled in the art and can be conveniently found in published laboratory methods manuals (e.g., Sambrook, J. et al, eds., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd. edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel, F. et al, eds., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John H. Wiley & Sons, Inc. (1997)). Fundamental laboratory techniques for working with tissue culture cell lines (Celis, J., ed., CELL BIOLOGY, Academic Press, 2nd edition, (1998)) and antibody-based technologies (Harlow, E. and Lane, D., "Antibodies: A Laboratory Manual," Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1988); Deutscher, M.P., "Guide to Protein Purification," Meth. Enzymol. 128, Academic Press San Diego (1990); Scopes, R.K., "Protein Purification Principles and Practice," 3rd ed., Springer- Verlag, New York (1994)) are also adequately described in the literature, all of which are incoφorated herein by reference. 2. Compositions and Methods for Enhancing an Immune Response
The disclosed invention provides compositions and methods for enhancing an immune response against one or more antigens in an animal. Compositions of the invention comprise, or alternatively consist of, a viruslike particle and an immunostimulatory substance, preferably an immunostimulatory nucleic acid, and even more preferably an unmethylated CpG-containing oligonucleotide where the an immunostimulatory substance, the immunostimulatory nucleic acid or the oligonucleotide is bound to the virus-like particle. Furthermore, the invention conveniently enables the practitioner to construct such a composition for various treatment and/or prophylactic prevention puφoses, which include the prevention and/or treatment of infectious diseases, as well as chronic infectious diseases, and the prevention and/or treatment of cancers, for example.
Virus-like particles in the context of the present application refer to structures resembling a virus particle but which are not pathogenic. In general, virus-like particles lack the viral genome and, therefore, are noninfectious. Also, virus-like particles can be produced in large quantities by heterologous expression and can be easily purified.
In a preferred embodiment, the virus-like particle is a recombinant virus-like particle. The skilled artisan can produce VLPs using recombinant DNA technology and virus coding sequences which are readily available to the public. For example, the coding sequence of a virus envelope or core protein can be engineered for expression in a baculovirus expression vector using a commercially available baculovirus vector, under the regulatory control of a virus promoter, with appropriate modifications of the sequence to allow functional linkage of the coding sequence to the regulatory sequence. The coding sequence of a virus envelope or core protein can also be engineered for expression in a bacterial expression vector, for example.
Examples of VLPs include, but are not limited to, the capsid proteins of Hepatitis B virus (Ulrich, et al, Virus Res. 50:141-182 (1998)), measles virus (Warnes, et al, Gene 160:173-178 (1995)), Sindbis virus, rotavirus (U.S. Patent Nos. 5,071,651 and 5,374,426), foot-and-mouth-disease virus (Twomey, et al, Vaccine 73:1603-1610, (1995)), Norwalk virus (Jiang, X., et al, Science 250:1580-1583 (1990); Matsui, S.M., et al, J. Clin. Invest. 57:1456-1461 (1991)), the retroviral GAG protein (PCT Patent Appl. No. WO 96/30523), the retrotransposon Ty protein pi, the surface protein of Hepatitis B virus (WO 92/11291), human papilloma virus (WO 98/15631), human polyoma virus (Sasnauskas K., et al, Biol. Chem. 350(3):381-386 (1999); Sasnauskas K., et al, Generation of recombinant virus-like particles of different polyomaviruses in yeast. 3r friterational Workshop "Virus-like particles as vaccines." Berlin, September 26-29 (2001)), RNA phages, Ty, fr- phage, GA-phage, AP 205-phage and, in particular, Qβ-phage.
As will be readily apparent to those skilled in the art, the VLP of the invention is not limited to any specific form. The particle can be synthesized chemically or through a biological process, which can be natural or non- natural. By way of example, this type of embodiment includes a virus-like particle or a recombinant form thereof. In a more specific embodiment, the VLP can comprise, or alternatively consist of, recombinant polypeptides of Rotavirus; recombinant polypeptides of Norwalk virus; recombinant polypeptides of Alphavirus; recombinant proteins which form bacterial pili or pilus-like structures; recombinant polypeptides of Foot and Mouth Disease virus; recombinant polypeptides of measles virus, recombinant polypeptides of Sindbis virus, recombinant polypeptides of Retrovirus; recombinant polypeptides of Hepatitis B virus (e.g., a HBcAg); recombinant polypeptides of Tobacco mosaic virus; recombinant polypeptides of Flock House Virus; recombinant polypeptides of human Papillomavirus; recombinant polypeptides of Polyoma virus and, in particular, recombinant polypeptides of human Polyoma virus, and in particular recombinant polypeptides of BK virus; recombinant polypeptides of bacteriophages, recombinant polypeptides of RNA phages; recombinant polypeptides of Ty; recombinant polypeptides of fr-phage, recombinant polypeptides of GA-phage, recombinant polypeptides of AP 205-phage and, in particular, recombinant polypeptides of Qβ-phage. The virus-like particle can further comprise, or alternatively consist of, one or more fragments of such polypeptides, as well as variants of such polypeptides. Variants of polypeptides can share, for example, at least 80%, 85%, 90%, 95%, 97%, or 99% identity at the amino acid level with their wild-type counteφarts.
In a preferred embodiment, the virus-like particle comprises, consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of a RNA-phage. Preferably, the RNA-phage is selected from the group consisting of a) bacteriophage Qβ; b) bacteriophage R17; c) bacteriophage fr; d) bacteriophage GA; e) bacteriophage SP; f) bacteriophage MS2; g) bacteriophage Mil; h) bacteriophage MX1; i) bacteriophage NL95; k) bacteriophage f2; and 1) bacteriophage PP7.
In another preferred embodiment of the present invention, the viruslike particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the RNA- bacteriophage Qβ or of the RNA-bacteriophage fr.
In a further preferred embodiment of the present invention, the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of coat proteins of RNA phages.
RNA-phage coat proteins forming capsids or VLPs, or fragments of the bacteriophage coat proteins compatible with self-assembly into a capsid or a VLP, are, therefore, further preferred embodiments of the present invention. Bacteriophage Qβ coat proteins, for example, can be expressed recombinantly in E. coli. Further, upon such expression these proteins spontaneously form capsids. Additionally, these capsids form a structure with an inherent repetitive organization.
Specific preferred examples of bacteriophage coat proteins which can be used to prepare compositions of the invention include the coat proteins of RNA bacteriophages such as bacteriophage Qβ (SΕQ ID NO: 10; PIR Database, Accession No. VCBPQβ referring to Qβ CP and SΕQ ID NO: 11; Accession No. AAA16663 referring to Qβ Al protein), bacteriophage R17 (SEQ ID NO: 12; PIR Accession No. VCBPR7), bacteriophage fir (SEQ ID NO:13; PIR Accession No. VCBPFR), bacteriophage GA (SEQ ID NO:14 GenBank Accession No. NP-040754), bacteriophage SP (SEQ ID NO: 15 GenBank Accession No. CAA30374 referring to SP CP and SEQ ID NO: 16 Accession No. referring to SP Al protein), bacteriophage MS2 (SEQ ID NO: 17; PER. Accession No. VCBPM2), bacteriophage Mil (SEQ ID NO: 18 GenBank Accession No. AAC06250), bacteriophage MX1 (SEQ ID NO: 19 GenBank Accession No. AAC14699), bacteriophage NL95 (SEQ ID NO:20 GenBank Accession No. AAC14704), bacteriophage £2 (SEQ ID NO: 21 GenBank Accession No. P03611), bacteriophage PP7 (SEQ ID NO: 22). Furthermore, the Al protein of bacteriophage Qβ or C-terminal truncated forms missing as much as 100, 150 or 180 amino acids from its C-terminus may be incoφorated in a capsid assembly of Qβ coat proteins. Generally, the percentage of Qβ Al protein relative to Qβ CP in the capsid assembly will be limited, in order to ensure capsid formation.
Qβ coat protem has also been found to self-assemble into capsids when expressed in E. coli (Kozlovska TM. et al, GENE 137: 133-137 (1993)). The obtained capsids or virus-like particles showed an icosahedral phage-like capsid structure with a diameter of 25 nm and T=3 quasi symmetry. Further, the crystal structure of phage Qβ has been solved. The capsid contains 180 copies of the coat protein, which are linked in covalent pentamers and hexamers by disulfide bridges (Golmohammadi, R. et al, Structure 4: 543- 5554 (1996)) leading to a remarkable stability of the capsid of Qβ coat protein. Capsids or VLPs made from recombinant Qβ coat protein may contain, however, subunits not linked via disulfide links to other subunits within the capsid, or incompletely linked. Thus, upon loading recombinant Qβ capsid on non-reducing SDS-PAGΕ, bands corresponding to monomeric Qβ coat protein as well as bands corresponding to the hexamer or pentamer of Qβ coat protein are visible. Incompletely disulfide-linked subunits could appear as dimer, trimer or even teframer bands in non-reducing SDS-PAGE. Qβ capsid protein also shows unusual resistance to organic solvents and denaturing agents. Suφrisingly, we have observed that DMSO and acetonitrile concentrations as high as 30%), and Guanidinium concentrations as high as 1 M do not affect the stability of the capsid. The high stability of the capsid of Qβ coat protein is an advantageous feature, in particular, for its use in immunization and vaccination of mammals and humans in accordance of the present invention.
Upon expression in E. coli, the N-terminal methionine of Qβ coat protein is usually removed, as we observed by N-terminal Edman sequencing as described in Stall, E. et al. J. Biol. Chem. 252:990-993 (1977). VLP composed from Qβ coat proteins where the N-terminal methionine has not been removed, or VLPs comprising a mixture of Qβ coat proteins where the N-terminal methionine is either cleaved or present are also within the scope of the present invention.
Further RNA phage coat proteins have also been shown to self- assemble upon expression in a bacterial host (Kastelein, RA. et al, Gene 23: 245-254 (1983), Kozlovskaya, TM. et al, Dokl Akad. Nauk SSSR 287: 452- 455 (1986), Adhin, MR. et al, Virology 170: 238-242 (1989), Ni, CZ., et al, Protein Sci. 5: 2485-2493 (1996), Priano, C. et al., J. Mol. Biol. 249: 283-297 (1995)). The Qβ phage capsid contains, in addition to the coat protein, the so called read-through protein Al and the maturation protein A2. Al is generated by suppression at the UGA stop codon and has a length of 329 aa. The capsid of phage Qβ recombinant coat protein used in the invention is devoid of the A2 lysis protein, and contains RNA from the host. The coat protein of RNA phages is an RNA binding protein, and interacts with the stem loop of the ribosomal binding site of the replicase gene acting as a translational repressor during the life cycle of the virus. The sequence and structural elements of the interaction are known (Witherell, GW. & Uhlenbeck, OC. Biochemistry 28: 71-76 (1989); Lim F. et al., J. Biol. Chem. 271: 31839-31845 (1996)). The stem loop and RNA in general are known to be involved in the virus assembly (Golmohammadi, R. et al, Structure 4: 543-5554 (1996)).
In a further preferred embodiment of the present invention, the viruslike particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of a RNA-phage, wherein the recombinant proteins comprise, consist essentially of or alternatively consist of mutant coat proteins of a RNA phage, preferably of mutant coat proteins of the RNA phages mentioned above. In another preferred embodiment, the mutant coat proteins of the RNA phage have been modified by removal of at least one lysine residue by way of substitution, or by addition of at least one lysine residue by way of substitution; alternatively, the mutant coat proteins of the RNA phage have been modified by deletion of at least one lysine residue, or by addition of at least one lysine residue by way of insertion.
In another preferred embodiment, the virus-like particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins, or fragments thereof, of the RNA-bacteriophage Qβ, wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of coat proteins having an amino acid sequence of SEQ ID NO: 10, or a mixture of coat proteins having amino acid sequences of SEQ ID NO: 10 and of SEQ ID NO: 11 or mutants of SEQ ID NO: 11 and wherein the N-terminal methionine is preferably cleaved.
In a further preferred embodiment of the present invention, the viruslike particle comprises, consists essentially of or alternatively consists of recombinant proteins of Qβ, or fragments thereof, wherein the recombinant proteins comprise, or alternatively consist essentially of, or alternatively consist of mutant Qβ coat proteins. In another preferred embodiment, these mutant coat proteins have been modified by removal of at least one lysine residue by way of substitution, or by addition of at least one lysine residue by way of substitution. Alternatively, these mutant coat proteins have been modified by deletion of at least one lysine residue, or by addition of at least one lysine residue by way of insertion.
Four lysine residues are exposed on the surface of the capsid of Qβ coat protein. Qβ mutants, for which exposed lysine residues are replaced by arginines can also be used for the present invention. The following Qβ coat protein mutants and mutant Qβ VLPs can, thus, be used in the practice of the invention: "Qβ-240" (Lysl3-Arg; SEQ ID NO:23), "Qβ-243" (Asn 10-Lys; SEQ ID NO:24), "Qβ-250" (Lys 2-Arg, Lysl3-Arg; SEQ ID NO:25), "Qβ- 251" (SEQ ID NO:26) and "Qβ-259" (Lys 2-Arg, Lysl6-Arg; SEQ ID NO:27). Thus, in further preferred embodiment of the present invention, the virus-like particle comprises, consists essentially of or alternatively consists of recombinant proteins of mutant Qβ coat proteins, which comprise proteins having an amino acid sequence selected from the group of a) the amino acid sequence of SEQ ID NO: 23; b) the amino acid sequence of SEQ ID NO:24; c) the amino acid sequence of SEQ ED NO: 25; d) the amino acid sequence of SEQ ID NO:26; and e) the amino acid sequence of SEQ ID NO: 27. The construction, expression and purification of the above indicated Qβ coat proteins, mutant Qβ coat protein VLPs and capsids, respectively, are disclosed in pending U.S. Application No. 10/050,902 filed on January 18, 2002. In particular is hereby referred to Example 18 of above mentioned application.
In a further preferred embodiment of the present invention, the viruslike particle comprises, or alternatively consists essentially of, or alternatively consists of recombinant proteins of Qβ, or fragments thereof, wherein the recombinant proteins comprise, consist essentially of or alternatively consist of a mixture of either one of the foregoing Qβ mutants and the corresponding Al protein.
In a further prefened embodiment of the present invention, the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant proteins, or fragments thereof, of RNA-phage AP205. The AP205 genome consists of a maturation protein, a coat protein, a replicase and two open reading frames not present in related phages; a lysis gene and an open reading frame playing a role in the translation of the maturation gene (Klovins ., et al, J. Gen. Virol. 83: 1523-33 (2002)). AP205 coat protein can be expressed from plasmid pAP283-58 (SEQ ED NO: 79), which is a derivative of pQblO (Kozlovska, T. M. et al, Gene 137:133-37 (1993)), and which contains an AP205 ribosomal binding site. Alternatively, AP205 coat protein may be cloned into pQbl85, downstream of the ribosomal binding site present in the vector. Both approaches lead to expression of the protein and formation of capsids as described in the co-pending US provisional patent application with the title "Molecular Antigen Arrays" (Application No. 60/396,126) and having been filed on July 17, 2002, which is incoφorated by reference in its entirety. Vectors pQblO and pQbl85 are vectors derived from pGEM vector, and expression of the cloned genes in these vectors is controlled by the trp promoter (Kozlovska, T. M. et al., Gene 137:133-37 (1993)). Plasmid pAP283-58 (SEQ ID NO:79) comprises a putative AP205 ribosomal binding site in the following sequence, which is downstream of the Xbal site, and immediately upstream of the ATG start codon of the AP205 coat protein: tctαgαATTTTCTGCGCACCCAT CCCGGGTGGCGCCCAAAGTGAGGAAAATCACαtg. The vector pQbl85 comprises a Shine Delagarno sequence downstream from the Xbal site and upstream of the start codon (tctαgαTTAACCCAACGCGTAGGAG TCAGGCCαtg-, Shine Delagarno sequence underlined).
In a further preferred embodiment of the present invention, the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant coat proteins, or fragments thereof, of the RNA-phage AP205.
This prefened embodiment of the present invention, thus, comprises AP205 coat proteins that form capsids. Such proteins are recombinantly expressed, or prepared from natural sources. AP205 coat proteins produced in bacteria spontaneously form capsids, as evidenced by Electron Microscopy (EM) and immunodiffusion. The structural properties of the capsid formed by the AP205 coat protein (SEQ ED NO: 80) and those formed by the coat protein of the AP205 RNA phage are nearly indistinguishable when seen in EM. AP205 VLPs are highly immunogenic, and can be linked with antigens and/or antigenic determinants to generate vaccine constructs displaying the antigens and/or antigenic determinants oriented in a repetitive manner. High titers are elicited against the so displayed antigens showing that bound antigens and or antigenic determinants are accessible for interacting with antibody molecules and are immunogenic.
In a further prefened embodiment of the present invention, the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of recombinant mutant coat proteins, or fragments thereof, of the RNA-phage AP205.
Assembly-competent mutant forms of AP205 VLPs, including AP205 coat protein with the subsitution of proline at amino acid 5 to threonine (SEQ ED NO: 81), may also be used in the practice of the invention and leads to a further prefened embodiment of the invention. These VLPs, AP205 VLPs derived from natural sources, or AP205 viral particles, may be bound to antigens to produce ordered repetitive arrays of the antigens in accordance with the present invention.
AP205 P5-T mutant coat protein can be expressed from plasmid ρAP281-32 (SEQ ID No. 82), which is derived directly from ρQbl85, and which contains the mutant AP205 coat protein gene instead of the Qβ coat protein gene. Vectors for expression of the AP205 coat protein are transfected into E. coli for expression of the AP205 coat protein.
Methods for expression of the coat protein and the mutant coat protein, respectively, leading to self-assembly into VLPs are described in co-pending US provisional patent application with the title "Molecular Antigen Arrays" (Application No. 60/396,126) and having been filed on July 17, 2002, which is incoφorated by reference in its entirety. Suitable E. coli sfrains include, but are not limited to, E. coli K802, JM 109, RR1. Suitable vectors and strains and combinations thereof can be identified by testing expression of the coat protein and mutant coat protem, respectively, by SDS-PAGE and capsid formation and assembly by optionally first purifying the capsids by gel filtration and subsequently testing them in an immunodiffusion assay (Ouchterlony test) or Electron Microscopy (Kozlovska, T. M. et al, Gene 137:133-37 (1993)).
AP205 coat proteins expressed from the vectors pAP283-58 and pAP281-32 may be devoid of the initial Methionine amino-acid, due to processing in the cytoplasm of E. coli. Cleaved, uncleaved forms of AP205 VLP, or mixtures thereof are further prefened embodiments of the invention.
In a further prefened embodiment of the present invention, the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of a mixture of recombinant coat proteins, or fragments thereof, of the RNA-phage AP205 and of recombinant mutant coat proteins, or fragments thereof, of the RNA-phage AP205.
In a further prefened embodiment of the present invention, the viruslike particle comprises, or alternatively essentially consists of, or alternatively consists of fragments of recombinant coat proteins or recombinant mutant coat proteins of the RNA-phage AP205.
Recombinant AP205 coat protein fragments capable of assembling into a VLP and a capsid, respectively are also useful in the practice of the invention. These fragments may be generated by deletion, either internally or at the termini of the coat protein and mutant coat protein, respectively. Insertions in the coat protein and mutant coat protein sequence or fusions of antigen sequences to the coat protein and mutant coat protein sequence, and compatible with assembly into a VLP, are further embodiments of the invention and lead to chimeric AP205 coat proteins, and particles, respectively. The outcome of insertions, deletions and fusions to the coat protein sequence and whether it is compatible with assembly into a VLP can be determined by electron microscopy. The particles formed by the AP205 coat protein, coat protein fragments and chimeric coat proteins described above, can be isolated in pure form by a combination of fractionation steps by precipitation and of purification steps by gel filtration using e.g. Sepharose CL-4B, Sepharose CL-2B, Sepharose CL- 6B columns and combinations thereof as described in the co-pending US provisional patent application with the title "Molecular Antigen Arrays" (Application No. 60/396,126) and having been filed on July 17, 2002, which is incoφorated by reference in its entirety. Other methods of isolating virus-like particles are known in the art, and may be used to isolate the virus-like particles (VLPs) of bacteriophage AP205. For example, the use of ultracentrifugation to isolate VLPs of the yeast retrotransposon Ty is described in U.S. Patent No. 4,918,166, which is incoφorated by reference herein in its entirety.
The crystal structure of several RNA bacteriophages has been detennined (Golmohammadi, R. et al, Structure 4:543-554 (1996)). Using such information, surface exposed residues can be identified and, thus, RNA- phage coat proteins can be modified such that one or more reactive amino acid residues can be inserted by way of insertion or substitution. As a consequence, those modified fonns of bacteriophage coat proteins can also be used for the present invention. Thus, variants of proteins which form capsids or capsid-like structures (e.g., coat proteins of bacteriophage Qβ, bacteriophage R17, bacteriophage fr, bacteriophage GA, bacteriophage SP, and bacteriophage MS2, bacteriophage AP 205) can also be used to prepare compositions of the present invention.
Although the sequence of the variants proteins discussed above will differ from their wild-type counteφarts, these variant proteins will generally retain the ability to form capsids or capsid-like structures. Thus, the invention further includes compositions and vaccine compositions, respectively, which further includes variants of proteins which form capsids or capsid-like structures, as well as methods for preparing such compositions and vaccine compositions, respectively, individual protein subunits used to prepare such compositions, and nucleic acid molecules which encode these protein subunits. Thus, included within the scope of the invention are variant forms of wild-type proteins which form capsids or capsid-like structures and retain the ability to associate and form capsids or capsid-like structures.
As a result, the invention further includes compositions and vaccine compositions, respectively, comprising proteins, which comprise, or alternatively consist essentially of, or alternatively consist of amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99% identical to wild-type proteins which form ordered arrays and have an inherent repetitive structure, respectively.
Further included within the scope of the invention are nucleic acid molecules which encode proteins used to prepare compositions of the present invention.
In other embodiments, the invention further includes compositions comprising proteins, which comprise, or alternatively consist essentially of, or alternatively consist of amino acid sequences which are at least 80%, 85%, 90%, 95%o, 97%, or 99% identical to any of the amino acid sequences shown in SEQ ID NOs: 10-27.
Proteins suitable for use in the present invention also include C-terminal truncation mutants of proteins which form capsids or capsid-like structures, or VLPs. Specific examples of such truncation mutants include proteins having an amino acid sequence shown in any of SEQ ED NOs: 10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the C-terminus. Typically, theses C-terminal truncation mutants will retain the ability to form capsids or capsid-like structures.
Further proteins suitable for use in the present invention also include N-terminal truncation mutants of proteins which form capsids or capsid-like structures. Specific examples of such truncation mutants include proteins having an amino acid sequence shown in any of SEQ YD NOs: 10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus. Typically, these N-terminal truncation mutants will retain the ability to form capsids or capsid-like structures.
Additional proteins suitable for use in the present invention include N- and C-terminal truncation mutants which form capsids or capsid-like structures. Suitable truncation mutants include proteins having an amino acid sequence shown in any of SEQ ED NOs:10-27 where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus and 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the C-terminus. Typically, these N-terminal and C-terminal truncation mutants will retain the ability to form capsids or capsid-like structures.
The invention further includes compositions comprising proteins which comprise, or alternatively consist essentially of, or alternatively consist of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99%» identical to the above described truncation mutants.
The invention thus includes compositions and vaccine compositions prepared from proteins which form capsids or VLPs, methods for preparing these compositions from individual protein subunits and VLPs or capsids, methods for preparing these individual protein subunits, nucleic acid molecules which encode these subunits, and methods for vaccinating and/or eliciting immunological responses in individuals using these compositions of the present invention.
Fragments of VLPs which retain the ability to induce an immune response can comprise, or alternatively consist of, polypeptides which are about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450 or 500 amino acids in length, but will obviously depend on the length of the sequence of the subunit composing the VLP. Examples of such fragments include fragments of proteins discussed herein which are suitable for the preparation of the immune response enhancing composition. In another preferred embodiment of the invention, the VLP's are free of a lipoprotein envelope or a lipoprotein-containing envelope, h a further prefened embodiment, the VLP's are free of an envelope altogether.
The lack of a lipoprotein envelope or lipoprotein-containing envelope and, in particular, the complete lack of an envelope leads to a more defined virus-like particle in its structure and composition. Such more defined viruslike particles, therefore, may minimize side-effects. Moreover, the lack of a lipoprotein-containing envelope or, in particular, the complete lack of an envelope avoids or minimizes incoφoration of potentially toxic molecules and pyrogens within the virus-like particle.
As previously stated, the invention includes virus-like particles or recombinant forms thereof. Skilled artisans have the knowledge to produce such particles and attach antigens thereto. By way of providing other examples, the invention provides herein for the production of Hepatitis B virus-like particles as virus-like particles (Example 1).
In one embodiment, the particles used in compositions of the invention are composed of a Hepatitis B capsid (core) protein (HBcAg) or a fragment of a HBcAg which has been modified to either eliminate or reduce the number of free cysteine residues. Zhou et al. (J. Virol. (5(5:5393-5398 (1992)) demonstrated that HBcAgs which have been modified to remove the naturally resident cysteine residues retain the ability to associate and form multimeric structures. Thus, core particles suitable for use in compositions of the invention include those comprising modified HBcAgs, or fragments thereof, in which one or more of the naturally resident cysteine residues have been either deleted or substituted with another amino acid residue (e.g., a serine residue).
The HBcAg is a protein generated by the processing of a Hepatitis B core antigen precursor protein. A number of isotypes of the HBcAg have been identified and their amino acids sequences are readily available to those skilled in the art. For example, the HBcAg protein having the amino acid sequence shown in Figure 1 is 185 amino acids in length and is generated by the processing of a 212 amino acid Hepatitis B core antigen precursor protein. This processing results in the removal of 29 amino acids from the N-terminus of the Hepatitis B core antigen precursor protein. Similarly, the HBcAg protein that is 185 amino acids in length is generated by the processing of a 214 amino acid Hepatitis B core antigen precursor protein. h prefened embodiments, vaccine compositions of the invention will be prepared using the processed form of a HBcAg (i.e., a HBcAg from which the N-terminal leader sequence of the Hepatitis B core antigen precursor protein have been removed).
Further, when HBcAgs are produced under conditions where processing will not occur, the HBcAgs will generally be expressed in "processed" form. For example, bacterial systems, such as E. coli, generally do not remove the leader sequences, also refened to as "signal peptides," of proteins which are normally expressed in eukaryotic cells. Thus, when an E. coli expression system directing expression of the protein to the cytoplasm is used to produce HBcAgs of the invention, these proteins will generally be expressed such that the N-terminal leader sequence of the Hepatitis B core antigen precursor protein is not present.
The preparation of Hepatitis B virus-like particles, which can be used for the present invention, is disclosed, for example, in WO 00/32227, and hereby in particular in Examples 17 to 19 and 21 to 24, as well as in WO 01/85208, and hereby in particular in Examples 17 to 19, 21 to 24, 31 and 41, and in pending U.S. Application No. 10/050,902 filed on January 18, 2002. For the latter application, it is in particular refened to Example 23, 24, 31 and 51. All three documents are explicitly incoφorated herein by reference.
The present invention also includes HBcAg variants which have been modified to delete or substitute one or more additional cysteine residues. Thus, the vaccine compositions of the invention include compositions comprising HBcAgs in which cysteine residues not present in the amino acid sequence shown in Figure 1 have been deleted.
It is well known in the art that free cysteine residues can be involved in a number of chemical side reactions. These side reactions include disulfide exchanges, reaction with chemical substances or metabolites that are, for example, injected or formed in a combination therapy with other substances, or direct oxidation and reaction with nucleotides upon exposure to UV light. Toxic adducts could thus be generated, especially considering the fact that HBcAgs have a strong tendency to bind nucleic acids. The toxic adducts would thus be distributed between a multiplicity of species, which individually may each be present at low concentration, but reach toxic levels when together. hi view of the above, one advantage to the use of HBcAgs in vaccine compositions which have been modified to remove naturally resident cysteine residues is that sites to which toxic species can bind when antigens or antigenic determinants are attached would be reduced in number or eliminated altogether.
A number of naturally occurring HBcAg variants suitable for use in the practice of the present invention have been identified. Yuan et al, (J. Virol 73:10122-10128 (1999)), for example, describe variants in which the isoleucine residue at position corresponding to position 97 in SEQ ED NO:28 is replaced with either a leucine residue or a phenylalanine residue. The amino acid sequences of a number of HBcAg variants, as well as several Hepatitis B core antigen precursor variants, are disclosed in GenBank reports AAF121240 (SEQ ID NO:29), AF121239 (SEQ ID NO:30), X85297 (SEQ ID NO:31), X02496 (SEQ ID NO:32), X85305 (SEQ ID NO:33), X85303 (SEQ ID NO:34), AF151735 (SEQ ID NO:35), X85259 (SEQ ID NO:36), X85286 (SEQ ID NO:37), X85260 (SEQ ID NO:38), X85317 (SEQ ED NO:39), X85298 (SEQ ED NO:40), AF043593 (SEQ ID NO:41), M20706 (SEQ ID NO:42), X85295 (SEQ ID NO:43), X80925 (SEQ ED NO:44), X85284 (SEQ ID NO:45), X85275 (SEQ ED NO:46), X72702 (SEQ ID NO:47), X85291 (SEQ ED NO:48), X65258 (SEQ ED NO:49), X85302 (SEQ ID NO:50), M32138 (SEQ ID NO:51), X85293 (SEQ ID NO:52), X85315 (SEQ ID NO:53), U95551 (SEQ ID NO:54), X85256 (SEQ ID NO:55), X85316 (SEQ ED NO:56), X85296 (SEQ ID NO:57), AB033559 (SEQ ID NO:58), X59795 (SEQ ID NO:59), X85299 (SEQ ID NO:60), X85307 (SEQ ID NO:61), X65257 (SEQ ID NO:62), X85311 (SEQ ED NO:63), X85301 (SEQ ID NO:64), X85314 (SEQ ID NO:65), X85287 (SEQ ID NO:66), X85272 (SEQ ID NO:67), X85319 (SEQ ID NO:68), AB010289 (SEQ ID NO:69), X85285 (SEQ ID NO:70), AB010289 (SEQ ID NO:71), AF121242 (SEQ ID NO:72), M90520 (SEQ ID NO:73), P03153 (SEQ ID NO:74), AF110999 (SEQ ID NO:75), and M95589 (SEQ ID NO:76), the disclosures of each of which are incoφorated herein by reference. These HBcAg variants differ in amino acid sequence at a number of positions, including amino acid residues which corresponds to the amino acid residues located at positions 12, 13, 21, 22, 24, 29, 32, 33, 35, 38, 40, 42, 44, 45, 49, 51, 57, 58, 59, 64, 66, 67, 69, 74, 77, 80, 81, 87, 92, 93, 97, 98, 100, 103, 105, 106, 109, 113, 116, 121, 126, 130, 133, 135, 141, 147, 149, 157, 176, 178, 182 and 183 in SEQ ID NO:77. Further HBcAg variants suitable for use in the compositions of the invention, and which may be further modified according to the disclosure of this specification are described in WO 00/198333, WO 00/177158 and WO 00/214478.
HBcAgs suitable for use in the present invention can be derived from any organism so long as they are able to enclose or to be coupled or otherwise attached to, in particular as long as they are capable of packaging, an unmethylated CpG-containing oligonucleotide and induce an immune response.
As noted above, generally processed HBcAgs (i.e., those which lack leader sequences) will be used in the vaccine compositions of the invention. The present invention includes vaccine compositions, as well as methods for using these compositions, which employ the above described variant HBcAgs.
Further included within the scope of the invention are additional HBcAg variants which are capable of associating to form dimeric or multimeric structures. Thus, the invention further includes vaccine compositions comprising HBcAg polypeptides comprising, or alternatively consisting of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97% or 99% identical to any of the wild-type amino acid sequences, and forms of these proteins which have been processed, where appropriate, to remove the N-terminal leader sequence.
Whether the amino acid sequence of a polypeptide has an amino acid sequence that is at least 80%, 85%, 90%, 95%, 97% or 99% identical to one of the wild-type amino acid sequences, or a subportion thereof, can be determined conventionally using known computer programs such the Bestfit program. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference amino acid sequence, the parameters are set such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
The HBcAg variants and precursors having the amino acid sequences set out in SEQ ID NOs: 29-72 and 73-76 are relatively similar to each other. Thus, reference to an amino acid residue of a HBcAg variant located at a position which conesponds to a particular position in SEQ ID NO:77, refers to the amino acid residue which is present at that position in the amino acid sequence shown in SEQ ID NO:77. The homology between these HBcAg variants is for the most part high enough among Hepatitis B viruses that infect mammals so that one skilled in the art would have little difficulty reviewing both the amino acid sequence shown in SEQ ID NO:77 and in Figure 1, respectively, and that of a particular HBcAg variant and identifying "corresponding" amino acid residues. Furthermore, the HBcAg amino acid sequence shown in SEQ ED NO:73, which shows the amino acid sequence of a HBcAg derived from a virus which infect woodchucks, has enough homology to the HBcAg having the amino acid sequence shown in SEQ ID NO: 77 that it is readily apparent that a three amino acid residue insert is present in SEQ ED NO:73 between amino acid residues 155 and 156 of SEQ ED NO:77.
The invention also includes vaccine compositions which comprise HBcAg variants of Hepatitis B viruses which infect birds, as wells as vaccine compositions which comprise fragments of these HBcAg variants. As one skilled in the art would recognize, one, two, three or more of the cysteine residues naturally present in these polypeptides could be either substituted with another amino acid residue or deleted prior to their inclusion in vaccine compositions of the invention.
As discussed above, the elimination of free cysteine residues reduces the number of sites where toxic components can bind to the HBcAg, and also eliminates sites where cross-linking of lysine and cysteine residues of the same or of neighboring HBcAg molecules can occur. Therefore, in another embodiment of the present invention, one or more cysteine residues of the Hepatitis B virus capsid protein have been either deleted or substituted with another amino acid residue.
In other embodiments, compositions and vaccine compositions, respectively, of the invention will contain HBcAgs from which the C-terminal region (e.g., amino acid residues 145-185 or 150-185 of SEQ ED NO: 77) has been removed. Thus, additional modified HBcAgs suitable for use in the practice of the present invention include C-terminal truncation mutants. Suitable truncation mutants include HBcAgs where 1, 5, 10, 15, 20, 25, 30, 34, 35, amino acids have been removed from the C-terminus.
HBcAgs suitable for use in the practice of the present invention also include N-terminal truncation mutants. Suitable truncation mutants include modified HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus.
Further HBcAgs suitable for use in the practice of the present invention include N- and C-terminal truncation mutants. Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35 amino acids have been removed from the C-terminus.
The invention further includes compositions and vaccine compositions, respectively, comprising HBcAg polypeptides comprising, or alternatively essentially consisting of, or alternatively consisting of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97%, or 99% identical to the above described truncation mutants.
In certain embodiments of the invention, a lysine residue is introduced into a HBcAg polypeptide, to mediate the binding of the antigen or antigenic determinant to the VLP of HBcAg. In preferred embodiments, compositions of the invention are prepared using a HBcAg comprising, or alternatively consisting of, amino acids 1-144, or 1-149, 1-185 of SEQ TD NO:77, which is modified so that the amino acids conesponding to positions 79 and 80 are replaced with a peptide having the amino acid sequence of Gly-Gly-Lys-Gly- Gly (SEQ TD NO:78). These compositions are particularly useful in those embodiments where an antigenic determinant is coupled to a VLP of HBcAg. In further prefened embodiments, the cysteine residues at positions 48 and 107 of SEQ ED NO: 77 are mutated to serine. The invention further includes compositions comprising the corresponding polypeptides having amino acid sequences shown in any of SEQ ED NOs:29-74 which also have above noted amino acid alterations. Further included within the scope of the invention are additional HBcAg variants which are capable of associating to form a capsid or VLP and have the above noted amino acid alterations. Thus, the invention further includes compositions and vaccine compositions, respectively, comprising HBcAg polypeptides which comprise, or alternatively consist of, amino acid sequences which are at least 80%, 85%, 90%, 95%, 97% or 99% identical to any of the wild-type amino acid sequences, and forms of these proteins which have been processed, where appropriate, to remove the N-terminal leader sequence and modified with above noted alterations.
Compositions or vaccine compositions of the invention may comprise mixtures of different HBcAgs. Thus, these vaccine compositions may be composed of HBcAgs which differ in amino acid sequence. For example, vaccine compositions could be prepared comprising a "wild-type" HBcAg and a modified HBcAg in which one or more amino acid residues have been altered (e.g., deleted, inserted or substituted). Further, prefened vaccine compositions of the invention are those which present highly ordered and repetitive antigen arrays.
As previously disclosed, the invention is based on the suφrising finding that immunostimulatory substances, preferably immunostimulatory nucleic acids and even more preferably DNA oligonucleotides can be packaged into VLPs. Unexpectedly, the nucleic acids present in VLPs can be replaced specifically by the immunostimulatory substances, preferably by the immunostimulatory nucleic acids and even more preferably by the DNA- oligonucleotides containing CpG motifs. As an example, the CpG- VLPs are dramatically more immunogenic and elicit more specific effects than their CpG-free counteφarts and induce enhanced B and T cell responses. The immune response against antigens coupled, fused or attached otherwise to the VLPs is similarly enhanced as the immune response against the VLP itself, h addition, the T cell responses against both the VLPs and antigens are especially directed to the Thl type. Furthermore, the packaged nucleic acids and CpGs, respectively, are protected from degradation, i.e., they are more stable. Moreover, non-specific activation of cells from the innate immune system is dramatically reduced.
The innate immune system has the capacity to recognize invariant molecular pattern shared by microbial pathogens. Recent studies have revealed that this recognition is a crucial step in inducing effective immune responses. The main mechanism by which microbial products augment immune responses is to stimulate APC, expecially dendritic cells to produce proinflammatory cytokines and to expres high levels costimulatory molecules for T cells. These activated dendritic cells subsequently initiate primary T cell responses and dictate the type of T cell-mediated effector function.
Two classes of nucleic acids, namely 1) bacterial DNA that contains immunostimulatory sequences, in particular unmethylated CpG dinucleotides within specific flanking bases (refened to as CpG motifs) and 2) double- sfranded RNA synthesized by various types of viruses represent important members of the microbial components that enhance immune responses. Synthetic double stranded (ds) RNA such as polyinosinic-polycytidylic acid (poly I:C) are capable of inducing dendritic cells to produce proinflammatory cytokines and to express high levels of costimulatory molecules.
A series of studies by Tokunaga and Yamamoto et al. has shown that bacterial DNA or synthetic oligodeoxynucleotides induce human PBMC and mouse spleen cells to produce type I interferon (EFN) (reviewed in Yamamoto et al., Springer Semin hnmunopathol. 22:11-19). Poly (I:C) was originally synthesized as a potent inducer of type I EFN but also induces other cytokines such as IL-12.
Prefened ribonucleic acid encompass polyinosinic-polycytidylic acid double-stranded RNA (poly I:C). Ribonucleic acids and modifications thereof as well as methods for their production have been described by Levy, H.B (Methods Enzymol. 1981, 78:242-251), DeClercq, E (Methods Enzymol. 1981,78:227-236) and Torrence, P.F. (Methods Enzymol 1981;78:326-331) and references therein. Ribonucleic acids can be isolated from organisms. Ribonucleic acids also encompass further synthetic ribonucleic acids, in particular synthetic poly (I:C) oligonucleotides that have been rendered nuclease resistant by modification of the phosphodiester backbone, in particular by phosphorothioate modifications. In a further embodiment the ribose backbone of poly (EC) is replaced by a deoxyribose. Those skilled in the art know procedures how to synthesize synthetic oligonucleotides. hi another prefened embodiment of the invention molecules that active toll-like receptors (TLR) are enclosed. Ten human toll-like receptors are known uptodate. They are activated by a variety of ligands. TLR2 is activated by peptidoglycans, lipoproteins, lipoteichonic acid and Zymosan; TLR3 is activated by double-sfranded RNA such as poly (I:C); TLR4 is activated by lipopolysaccharide, lipoteichoic acids and taxol; TLR5 is activated by bacterial flagella, especially the flagellin protein; TLR6 is activated by peptidoglycans, TLR7 is activated by imiquimoid and imidazoquinoline compounds, such as R418 and TLR9 is activated by bacterial DNA, in particular CpG DNA. Ligands for TLR1, TLR8 and TLR10 are not known so far. However, recent reports indicate that same receptors can react with different ligands and that further receptors are present. The above list of ligands is not exhaustive and further ligands are within the knowledge of the person skilled in the art.
Preferably, the unmethylated CpG-containing oligonucleotide comprises the sequence:
Figure imgf000062_0001
wherein Xls X2, X3 and X4 are any nucleotide. hi addition, the oligonucleotide can comprise about 6 to about 100,000 nucleotides, preferably about 6 to about 2000 nucleotides, more preferably about 20 to about 2000 nucleotides, and even more preferably comprises about 20 to about 300 nucleotides. hi addition, the oligonucleotide can comprise more than 100 to about 2000 nucleotides, preferably more than 100 to about 1000 nucleotides, and more preferably more than 100 to about 500 nucleotides.
In a prefened embodiment, the CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone. For example, a CpG-containing oligonucleotide having one or more phosphate backbone modifications or having all of the phosphate backbone modified and a CpG-containing oligonucleotide wherein one, some or all of the nucleotide phosphate backbone modifications are phosphorothioate modifications are included within the scope of the present invention.
The CpG-containing oligonucleotide can also be recombinant, genomic, synthetic, cDNA, plasmid-derived and single or double stranded. For use in the instant invention, the nucleic acids can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., 7et. Let. 22:1859 (1981); nucleoside H-phosphonate method (Garegg et al, Tet. Let. 27:4051-4054 (1986); Froehler et al, Nucl. Acid. Res. 74:5399-5407 (1986); Garegg et al, Tet. Let. 27:4055-4058 (1986), Gaffhey et al, Tet. Let. 29:2619-2622 (1988)). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market. Alternatively, CpGs can be produced on a large scale in plasmids, (see Sambrook, T., et al, "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor laboratory Press, New York, 1989) which after being administered to a subject are degraded into oligonucleotides. Oligonucleotides can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
The immunostimulatory substances, the immunostimulatory nucleic acids as well as the unmethylated CpG-containing oligonucleotide can be bound to the VLP by any way known is the art provided the composition enhances an immune response in an animal. For example, the oligonucleotide can be bound either covalently or non-covalently. In addition, the VLP can enclose, fully or partially, the immunostimulatory substances, the immunostimulatory nucleic acids as well as the unmethylated CpG-containing oligonucleotide. Preferably, the immunostimulatory nucleic acid as well as the unmethylated CpG-containing oligonucleotide can be bound to a VLP site such as an oligonucleotide binding site (either naturally or non-naturally occurring), a DNA binding site or a RNA binding site. In another embodiment, the VLP site comprises an arginine-rich repeat.
One specific use for the compositions of the invention is to activate dendritic cells for the puφose of enhancing a specific immune response against antigens. The immune response can be enhanced using ex vivo or in vivo techniques. The ex vivo procedure can be used on autologous or heterologous cells, but is preferably used on autologous cells. In preferred embodiments, the dendritic cells are isolated from peripheral blood or bone marrow, but can be isolated from any source of dendritic cells. Ex vivo manipulation of dendritic cells for the puφoses of cancer immunotherapy have been described in several references in the art, including Engleman, E. G., Cytotechnology 25:1 (1997); Van Schooten, W., et al, Molecular Medicine Today, June, 255 (1997); Steinman, R. M., Experimental Hematology 24:849 (1996); and Gluckman, J. C, Cytokines, Cellular and Molecular Therapy 3:187 (1997).
The dendritic cells can also be contacted with the inventive compositions using in vivo methods. In order to accomplish this, the CpGs are administered in combination with the VLP optionally coupled, fused or otherwise attached to an antigen directly to a subject in need of immunotherapy. h some embodiments, it is prefened that the VLPs/CpGs be administered in the local region of the tumor, which can be accomplished in any way known in the art, e.g., direct injection into the tumor.
The inventive composition can further comprise an antigen or antigenic determinant bound to the virus-like particle. The invention provides for compositions that vary according to the antigen or antigenic determinant selected in consideration of the desired therapeutic effect. Very prefened antigens or antigenic determinants suitable for use in the present invention are disclosed in WO 00/32227, in WO 01/85208 and in WO 02/056905, the disclosures of which are herewith incoφorated by reference in their entireties.
The antigen can be any antigen of known or yet unknown provenance. It can be isolated from bacteria, viruses or other pathogens or can be a recombinant antigen obtained from expression of suitable nucleic acid coding therefor. It can also be isolated from prions, tumors, self-molecules, non- peptidic hapten molecules, allergens and hormones. In a prefened embodiment, the antigen is a recombinant antigen. The selection of the antigen is, of course, dependent upon the immunological response desired and the host.
In one embodiment of the immune enhancing composition of the present invention, the immune response is induced against the VLP itself. In another embodiment of the invention a virus-like particle is coupled, fused or otherwise attached to an antigen immunogen against which an enhanced immune response is desired.
In a further prefened embodiment of the invention, the at least one antigen or antigenic determinant is fused to the virus-like particle. As outlined above, a VLP is typically composed of at least one subunit assembling into a VLP. Thus, in again a further preferred embodiment of the invention, the antigen or antigenic determinant is fused to at least one subunit of the viruslike particle or of a protein capable of being incoφorated into a VLP generating a chimeric VLP-subunit-antigen fusion.
Fusion of the antigen or antigenic determinant can be effected by insertion into the VLP subunit sequence, or by fusion to either the N- or C- terminus of the VLP-subunit or protein capable of being incoφorated into a VLP. Hereinafter, when referring to fusion proteins of a peptide to a VLP subunit, the fusion to either ends of the subunit sequence or internal insertion of the peptide within the subunit sequence are encompassed.
Fusion may also be effected by inserting antigen or antigenic determinant sequences into a variant of a VLP subunit where part of the subunit sequence has been deleted, that are further refened to as truncation mutants. Truncation mutants may have N- or C-terminal, or internal deletions of part of the sequence of the VLP subunit. For example, the specific VLP HBcAg with, for example, deletion of amino acid residues 79 to 81 is a truncation mutant with an internal deletion. Fusion of antigens or antigenic determinants to either the N- or C-terminus of the truncation mutants VLP- subunits also lead to embodiments of the invention. Likewise, fusion of an epitope into the sequence of the VLP subunit may also be effected by substitution, where for example for the specific VLP HBcAg, amino acids 79- 81 are replaced with a foreign epitope. Thus, fusion, as referred to hereinafter, may be effected by insertion of the antigen or antigenic determinant sequence in the sequence of a VLP subunit, by substitution of part of the sequence of the VLP subunit with the antigen or antigenic determinant, or by a combination of deletion, substitution or insertions.
The chimeric antigen or antigenic determinant -VLP subunit will be in general capable of self-assembly into a VLP. VLP displaying epitopes fused to their subunits are also herein referred to as chimeric VLPs. As indicated, the virus-like particle comprises or alternatively is composed of at least one VLP subunit. In a further embodiment of the invention, the virus-like particle comprises or alternatively is composed of a mixture of chimeric VLP subunits and non-chimeric VLP subunits, i.e. VLP subunits not having an antigen fused thereto, leading to so called mosaic particles. This may be advantageous to ensure formation of, and assembly to a VLP. In those embodiments, the proportion of chimeric VLP-subunits may be 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% or higher.
Flanking amino acid residues may be added to either end of the sequence of the peptide or epitope to be fused to either end of the sequence of the subunit of a VLP, or for internal insertion of such peptidic sequence into the sequence of the subunit of a VLP. Glycine and serine residues are particularly favored amino acids to be used in the flanking sequences added to the peptide to be fused. Glycine residues confer additional flexibility, which may diminish the potentially destabilizing effect of fusing a foreign sequence into the sequence of a VLP subunit.
In a specific embodiment of the invention, the VLP is a Hepatitis B core antigen VLP. Fusion proteins of the antigen or antigenic determinant to either the N-terminus of a HBcAg (Neyrinck, S. et al, Nature Med. 5:1157- 1163 (1999)) or insertions in the so called major immunodominant region (MER.) have been described (Pumpens, P. and Grens, E., Intervirology 44:98- 114 (2001)), WO 01/98333), and are preferred embodiments of the invention. Naturally occurring variants of HBcAg with deletions in the MER. have also been described (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001), which is expressly incoφorated by reference in its entirety), and fusions to the N- or C-terminus, as well as insertions at the position of the MIR corresponding to the site of deletion as compared to a wt HBcAg are further embodiments of the invention. Fusions to the C-terminus have also been described (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001)). One skilled in the art will easily find guidance on how to construct fusion proteins using classical molecular biology techniques (Sambrook, J. et al, eds., Molecular Cloning, A Laboratory Manual, 2nd. edition, Cold Spring Habor Laboratory Press, Cold Spring Harbor, N.Y. (1989), Ho et al, Gene 77:51 (1989)). Vectors and plasmids encoding HBcAg and HBcAg fusion proteins and useful for the expression of a HBcAg and HBcAg fusion proteins have been described (Pumpens, P. & Grens, E. Intervirology 44: 98-114 (2001), Neyrinck, S. et al, Nature Med. 5:1157-1163 (1999)) and can be used in the practice of the invention. An important factor for the optimization of the efficiency of self-assembly and of the display of the epitope to be inserted in the MIR of HBcAg is the choice of the insertion site, as well as the number of amino acids to be deleted from the HBcAg sequence within the MER. (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001); EP 0 421 635; U.S. Patent No. 6,231,864) upon insertion, or in other words, which amino acids form HBcAg are to be substituted with the new epitope. For example, substitution of HBcAg amino acids 76-80, 79-81, 79-80, 75-85 or 80-81 with foreign epitopes has been described (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001); EP0421635; US 6,231,864). HBcAg contains a long arginine tail (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001))which is dispensable for capsid assembly and capable of binding nucleic acids (Pumpens, P. and Grens, E., Intervirology 44:98-114 (2001)). HBcAg either comprising or lacking this arginine tail are both embodiments of the invention.
In a further prefened embodiment of the invention, the VLP is a VLP of a RNA phage. The major coat proteins of RNA phages spontaneously assemble into VLPs upon expression in bacteria, and in particular in E. coli. Specific examples of bacteriophage coat proteins which can be used to prepare compositions of the invention include the coat proteins of RNA bacteriophages such as bacteriophage Qβ (SEQ ID NO: 10; PER. Database, Accession No. VCBPQβ referring to Qβ CP and SEQ ID NO: 11; Accession No. AAA16663 referring to Qβ Al protein) and bacteriophage fr (SEQ ED NO: 13; PIR Accession No. VCBPFR).
In a more prefened embodiment, the at least one antigen or antigenic determinant is fused to a Qβ coat protein. Fusion protein constructs wherein epitopes have been fused to the C-terminus of a truncated form of the Al protein of Qβ, or inserted within the Al protein have been described (Kozlovska, T. M., et al, Intervirology, 39:9-15 (1996)). The Al protein is generated by suppression at the UGA stop codon and has a length of 329 aa, or 328 aa, if the cleavage of the N-terminal methionine is taken into account. Cleavage of the N-terminal methionine before an alanine (the second amino acid encoded by the Qβ CP gene) usually takes place in E. coli, and such is the case for N-termini of the Qβ coat proteins. The part of the Al gene, 3' of the UGA amber codon encodes the CP extension, which has a length of 195 amino acids. Insertion of the at least one antigen or antigenic determinant between position 72 and 73 of the CP extension leads to further embodiments of the invention (Kozlovska, T. M., et al, Intervirology 39:9-15 (1996)). Fusion of an antigen or antigenic determinant at the C-terminus of a C- terminally truncated Qβ Al protein leads to further prefened embodiments of the invention. For example, Kozlovska et al., (Intervirology, 39: 9-15 (1996)) describe Qβ Al protein fusions where the epitope is fused at the C-terminus of the Qβ CP extension truncated at position 19.
As described by Kozlovska et al. (Intervirology, 39: 9-15 (1996)), assembly of the particles displaying the fused epitopes typically requires the presence of both the Al protein-antigen fusion and the wt CP to form a mosaic particle. However, embodiments comprising virus-like particles, and hereby in particular the VLPs of the RNA phage Qβ coat protein, which are exclusively composed of VLP subunits having at least one antigen or antigenic determinant fused thereto, are also within the scope of the present invention.
The production of mosaic particles may be effected in a number of ways. Kozlovska et al, Intervirology, 39:9-15 (1996), describe three methods, which all can be used in the practice of the invention. In the first approach, efficient display of the fused epitope on the VLPs is mediated by the expression of the plasmid encoding the Qβ Al protein fusion having a UGA stop codong between CP and CP extension in a Ε. coli strain harboring a plasmid encoding a cloned UGA suppressor tRNA which leads to franslation of the UGA codon into Tφ (ρISM3001 plasmid (Smiley B.K., et al, Gene 134:33-40 (1993))). In another approach, the CP gene stop codon is modified into UAA, and a second plasmid expressing the Al protein-antigen fusion is cotransformed. The second plasmid encodes a different antibiotic resistance and the origin of replication is compatible with the first plasmid (Kozlovska, T. M., et al, Intervirology 39:9-15 (1996)). In a third approach, CP and the Al protein-antigen fusion are encoded in a bicisfronic manner, operatively linked to a promoter such as the Tφ promoter, as described in Figure 1 of Kozlovska et al, Intervirology, 39:9-15 (1996).
In a further embodiment, the antigen or antigenic determinant is inserted between amino acid 2 and 3 (numbering of the cleaved CP, that is wherein the N-terminal methionine is cleaved) of the fr CP, thus leading to an antigen or antigenic determinant -fr CP fusion protein. Vectors and expression systems for construction and expression of fr CP fusion proteins self- assembling to VLP and useful in the practice of the invention have been described (Pushko P. et al, Prot. Eng. 5:883-891 (1993)). In a specific embodiment, the antigen or antigenic determinant sequence is inserted into a deletion variant of the fr CP after amino acid 2, wherein residues 3 and 4 of the fr CP have been deleted (Pushko P. et al, Prot. Eng. 6:883-891 (1993)).
Fusion of epitopes in the N-terminal protuberant β-hafrpin of the coat protein of RNA phage MS-2 and subsequent presentation of the fused epitope on the self-assembled VLP of RNA phage MS-2 has also been described (WO 92/13081), and fusion of an antigen or antigenic determinant by insertion or substitution into the coat protein of MS-2 RNA phage is also falling under the scope of the invention.
In another embodiment of the invention, the antigen or antigenic determinant is fused to a capsid protein of papillomavirus. In a more specific embodiment, the antigen or antigenic determinant is fused to the major capsid protein LI of bovine papillomavirus type 1 (BPV-1). Vectors and expression systems for construction and expression of BPV-1 fusion proteins in a baculovirus/insect cells systems have been described (Chackerian, B. et al, Proc. Natl. Acad. Sci. USA 96:2373-2378 (1999), WO 00/23955). Substitution of amino acids 130-136 of BPV-1 LI with an antigen or antigenic determinant leads to a BPV-1 LI -antigen fusion protein, which is a preferred embodiment of the invention. Cloning in a baculovirus vector and expression in baculovirus infected Sf9 cells has been described, and can be used in the practice of the invention (Chackerian, B. et al, Proc. Natl Acad. Sci. USA 96:2373-2378 (1999), WO 00/23955). Purification of the assembled particles displaying the fused antigen or antigenic determinant can be performed in a number of ways, such as for example gel filtration or sucrose gradient ultracentrifugation (Chackerian, B. et al, Proc. Natl. Acad. Sci.USA 96:2373- 2378 (1999), WO 00/23955).
In a further embodiment of the invention, the antigen or antigenic determinant is fused to a Ty protein capable of being incoφorated into a Ty VLP. In a more specific embodiment, the antigen or antigenic determinant is fused to the pi or capsid protein encoded by the TYA gene (Roth, J.F., Yeast 76:785-795 (2000)). The yeast refrotransposons Tyl, 2, 3 and 4 have been isolated from Saccharomyces Serevisiae, while the retrotransposon Tfl has been isolated from Schizosaccharomyces Pombae (Boeke, J.D. and Sandmeyer, S.B., "Yeast Transposable elements," in The molecular and Cellular Biology of the Yeast Saccharomyces: Genome dynamics, Protem Synthesis, and Energetics, p. 193, Cold Spring Harbor Laboratory Press (1991)). The refrotransposons Tyl and 2 are related to the copia class of plant and animal elements, while Ty3 belongs to the gypsy family of refrotransposons, which is related to plants and animal retroviruses. In the Tyl retrotransposon, the pi protein, also referred to as Gag or capsid protem, has a length of 440 amino acids. PI is cleaved during maturation of the VLP at position 408, leading to the p2 protein, the essential component of the VLP.
Fusion proteins to pi and vectors for the expression of said fusion proteins in Yeast have been described (Adams, S.E., et al, Nature 329:68-70 (1987)). So, for example, an antigen or antigenic determinant may be fused to pl by inserting a sequence coding for the antigen or antigenic determinant into the BamHI site of the pMA5620 plasmid (Adams, S.E., et al, Nature 329:68- 70 (1987)). The cloning of sequences coding for foreign epitopes into the pMA5620 vector leads to expression of fusion proteins comprising amino acids 1-381 of pi of Tyl -15, fused C-terminally to the N-terminus of the foreign epitope. Likewise, N-terminal fusion of an antigen or antigenic determinant, or internal insertion into the pi sequence, or substitution of part of the pi sequence are also meant to fall within the scope of the invention. In particular, insertion of an antigen or antigenic determinant into the Ty sequence between amino acids 30-31, 67-68, 113-114 and 132-133 of the Ty protein pi (EP0677111) leads to prefened embodiments of the invention.
Further VLPs suitable for fusion of antigens or antigenic determinants are, for example, Retro virus-like-particles (WO9630523), HEV2 Gag (Kang, Y.C., et al, Biol Chem. 380:353-364 (1999)), Cowpea Mosaic Virus (Taylor, K.M.et al, Biol. Chem. 380:387-392 (1999)), parvovirus VP2 VLP (Rueda, P. et al, Virology 263:89-99 (1999)), HBsAg (US 4,722,840, EP0020416B1).
Examples of chimeric VLPs suitable for the practice of the invention are also those described in Intervirology 39:1 (1996). Further examples of VLPs contemplated for use in the invention are: HPV-1, HPV-6, HPV-11, HPV-16, HPV-18, HPV-33, HPV-45, CRPV, COPV, HIV GAG, Tobacco Mosaic Virus. Virus-like particles of SV-40, Polyomavirus, Adenovirus, Heφes Simplex Virus, Rotavirus and Norwalk virus have also been made, and chimeric VLPs of those VLPs comprising an antigen or antigenic determinant are also within the scope of the present invention.
As indicated, embodiments comprising antigens fused to the virus-like particle by insertion within the sequence of the virus-like particle building monomer are also within the scope of the present invention. In some cases, antigens can be inserted in a form of the virus-like particle building monomer containing deletions. In these cases, the virus-like particle building monomer may not be able to form virus-like structures in the absence of the inserted antigen. In some instances, recombinant DNA technology can be utilized to fuse a heterologous protein to a VLP protein (Kratz, P.A., et al, Proc. Natl. Acad. Sci. USA 96:1915 (1999)). For example, the present invention encompasses VLPs recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to an antigen (or portion thereof, preferably at least 10, 20 or 50 amino acids) of the present invention to generate fusion proteins or conjugates. The fusion does not necessarily need to be direct, but can occur through linker sequences. More generally, in the case that epitopes, either fused, conjugated or otherwise attached to the viruslike particle, are used as antigens in accordance with the invention, spacer or linker sequences are typically added at one or both ends of the epitopes. Such linker sequences preferably comprise sequences recognized by the proteasome, proteases of the endosomes or other vesicular compartment of the cell.
One way of coupling is by a peptide bond, in which the conjugate can be a contiguous polypeptide, i.e. a fusion protein. In a fusion protein according to the present invention, different peptides or polypeptides are linked in frame to each other to form a contiguous polypeptide. Thus a first portion of the fusion protein comprises an antigen or immunogen and a second portion of the fusion protein, either N-terminal or C-terminal to the first portion, comprises a VLP. Alternatively, internal insertion into the VLP, with optional linking sequences on both ends of the antigen, can also be used in accordance with the present invention.
When HBcAg is used as the VLP, it is preferred that the antigen is linked to the C-terminal end of the HBcAg particle. The hepatitis B core antigen (HBcAg) exhibiting a C-terminal fusion of the MHC class I restricted peptide p33 derived from lymphocytic choriomeningitis virus (LCMV) glycoprotein was used as a model antigen (HBcAg-p33). The 185 amino acids long wild type HBc protein assembles into highly structured particles composed of 180 subunits assuming icosahedral geometry. The flexibility of the HBcAg and other VLPs in accepting relatively large insertions of foreign sequences at different positions while retaining the capacity to form structured capsids is well documented in the literature. This makes the HBc VLPs attractive candidates for the design of non-replicating vaccines.
A flexible linker sequence (e.g. a polyglycme/polyserine-containing sequence such as [Gly4 Ser]2 (Huston et al, Meth. Enzymol 203:46-88 (1991)) can be inserted into the fusion protein between the antigen and ligand. Also, the fusion protein can be constructed to contain an "epitope tag", which allows the fusion protein to bind an antibody (e.g. monoclonal antibody) for example for labeling or purification puφoses. An example of an epitope tag is a Glu- Glu-Phe tripeptide which is recognized by the monoclonal antibody YL1/2.
The invention also relates to the chimeric DNA which contains a sequence coding for the VLP and a sequence coding for the antigen/immunogen. The DNA can be expressed, for example, in insect cells transfonned with Baculoviruses, in yeast or in bacteria. There are no restrictions regarding the expression system, of which a large selection is available for routine use. Preferably, a system is used which allows expression of the proteins in large amounts, h general, bacterial expression systems are prefened on account of their efficiency. One example of a bacterial expression system suitable for use within the scope of the present invention is the one described by Clarke et al, J. Gen. Virol. 71: 1109-1117 (1990); Borisova et al, J. Virol. 67: 3696-3701 (1993); and Studier et al, Methods Enzymol. 185:60-89 (1990). An example of a suitable yeast expression system is the one described by Emr, Methods Enzymol. 185:231-3 (1990); Baculovirus systems, which have previously been used for preparing capsid proteins, are also suitable. Constitutive or inducible expression systems can be used. By the choice and possible modification of available expression systems it is possible to control the form in which the proteins are obtained.
In a specific embodiment of the invention, the antigen to which an enhanced immune response is desired is coupled, fused or otherwise attached in frame to the Hepatitis B virus capsid (core) protein (HBcAg). However, it will be clear to all individuals in the art that other virus-like particles can be utilized in the fusion protein construct of the invention.
In a further preferred embodiment of the present invention, the at least one antigen or antigenic determinant is bound to the virus-like particle by at least one covalent bond. Preferably, the least one antigen or antigenic determinant is bound to the virus-like particle by at least one covalent bond, said covalent bond being a non-peptide bond leading to an antigen or antigenic determinant anay and antigen or antigenic determinant -VLP conjugate, respectively. This antigen or antigenic determinant array and conjugate, respectively, has typically and preferably a repetitive and ordered structure since the at least one antigen or antigenic determinant is bound to the VLP in an oriented mamier. The formation of a repetitive and ordered antigen or antigenic determinant -VLP array and conjugate, respectively, is ensured by an oriented and directed as well as defined binding and attachment, respectively, of the at least one antigen or antigenic determinant to the VLP as will become apparent in the following. Furthermore, the typical inherent highly repetitive and organized structure of the VLPs advantageously contributes to the display of the antigen or antigenic determinant in a highly ordered and repetitive fashion leading to a highly organized and repetitive antigen or antigenic determinant -VLP array and conjugate, respectively.
Therefore, the prefened inventive conjugates and arrays, respectively, differ from prior art conjugates in their highly organized structure, dimensions, and in the repetitiveness of the antigen on the surface of the array. The preferred embodiment of this invention, furthermore, allows expression of the particle in an expression host guaranteeing proper folding and assembly of the VLP, to which the antigen is then further coupled
The present invention discloses methods of binding of antigen or antigenic determinant to VLPs. As indicated, in one aspect of the invention, the at least one antigen or antigenic determinant is bound to the VLP by way of chemical cross-linking, typically and preferably by using a heterobifunctional cross-linker. Several hetero-bifunctional cross-linkers are known to the art. In preferred embodiments, the hetero-bifunctional cross- linker contains a functional group which can react with prefened first attachment sites, i.e. with the side-chain amino group of lysine residues of the VLP or at least one VLP subunit, and a further functional group which can react with a prefened second attachment site, i.e. a cysteine residue fused to the antigen or antigenic determinant and optionally also made available for reaction by reduction. The first step of the procedure, typically called the derivatization, is the reaction of the VLP with the cross-linker. The product of this reaction is an activated VLP, also called activated carrier. In the second step, unreacted cross-linker is removed using usual methods such as gel filtration or dialysis. In the third step, the antigen or antigenic determinant is reacted with the activated VLP, and this step is typically called the coupling step. Unreacted antigen or antigenic determinant may be optionally removed in a fourth step, for example by dialysis. Several hetero-bifunctional cross- linkers are known to the art. These include the prefened cross-linkers SMPH (Pierce), Sulfo-MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB, Sulfo-SMCC, SVSB, SEA and other cross-linkers available for example from the Pierce Chemical Company (Rockford, IL, USA) , and having one functional group reactive towards amino groups and one functional group reactive towards cysteine residues. The above mentioned cross-linkers all lead to formation of a thioether linkage. Another class of cross-linkers suitable in the practice of the invention is characterized by the introduction of a disulfide linkage between the antigen or antigenic determinant and the VLP upon coupling. Prefened cross-linkers belonging to this class include for example SPDP and Sulfo-LC-SPDP (Pierce). The extent of derivatization of the VLP with cross-linker can be influenced by varying experimental conditions such as the concenfration of each of the reaction partners, the excess of one reagent over the other, the pH, the temperature and the ionic strength. The degree of coupling, i.e. the amount of antigens or antigenic determinants per subunits of the VLP can be adjusted by varying the experimental conditions described above to match the requirements of the vaccine. A particularly favored method of binding of antigens or antigenic determinants to the VLP, is the linking of a lysine residue on the surface of the VLP with a cysteine residue on the antigen or antigenic determinant. In some embodiments, fusion of an amino acid linker containing a cysteine residue, as a second attachment site or as a part thereof, to the antigen or antigenic determinant for coupling to the VLP may be required.
In general, flexible amino acid linkers are favored. Examples of the amino acid linker are selected from the group consisting of: (a) CGG; (b) N- terminal gamma 1 -linker; (c) N-terminal gamma 3 -linker; (d) Ig hinge regions; (e) N-terminal glycine linkers; (f) (G)kC(G)n with n=0-12 and k=0-5; (g) N- terminal glycine-serine linkers; (h) (G)kC(G)m(S)ι(GGGGS)n with n=0-3, k=0- 5, m=0-10, 1=0-2; (i) GGC; (k) GGC-NH2; (1) C-terminal gamma 1 -linker; (m) C-terminal gamma 3-linker; (n) C-terminal glycine linkers; (o) (G)nC(G)k with n=0-12 and k=0-5; (p) C-terminal glycine-serine linkers; (q) (G)m(S)1(GGGGS)n(G)0C(G)k with n=0-3, k=0-5, m=0-10, 1=0-2, and o=0-8.
Further examples of amino acid linkers are the hinge region of Immunoglobulins, glycine serine linkers (GGGGS)n, and glycine linkers (G)n all further containing a cysteine residue as second attachment site and optionally further glycine residues. Typically preferred examples of said amino acid linkers are N-terminal gammal: CGDKTHTSPP; C-terminal gamma 1: DKTHTSPPCG; N-terminal gamma 3: CGGPKPSTPPGSSGGAP; C-terminal gamma 3: PKPSTPPGSSGGAPGGCG; N-terminal glycine linker: GCGGGG and C-terminal glycine linker: GGGGCG.
Other amino acid linkers particularly suitable in the practice of the invention, when a hydrophobic antigen or antigenic determinant is bound to a VLP, are CGKKGG, or CGDEGG for N-terminal linkers, or GGKKGC and GGEDGC, for the C-terminal linkers. For the C-terminal linkers, the terminal cysteine is optionally C-terminally amidated. h preferred embodiments of the present invention, GGCG, GGC or GGC-NH2 ("NH2" stands for amidation) linkers at the C-terminus of the peptide or CGG at its N-terminus are prefened as amino acid linkers. In general, glycine residues will be inserted between bulky amino acids and the cysteine to be used as second attachment site, to avoid potential steric hindrance of the bulkier amino acid in the coupling reaction, h the most prefened embodiment of the invention, the amino acid linker GGC-NH2 is fused to the C-terminus of the antigen or antigenic determinant.
The cysteine residue present on the antigen or antigenic determinant has to be in its reduced state to react with the hetero-bifunctional cross-linker on the activated VLP, that is a free cysteine or a cysteine residue with a free sulfhydryl group has to be available. In the instance where the cysteine residue to function as binding site is in an oxidized form, for example if it is forming a disulfide bridge, reduction of this disulfide bridge with e.g. DTT, TCEP or β- mercaptoethanol is required. Low concentrations of reducing agent are compatible with coupling as described in WO 02/05690, higher concentrations inhibit the coupling reaction, as a skilled artisan would know, in which case the reductand has to be removed or its concentration decreased prior to coupling, e.g. by dialysis, gel filtration or reverse phase HPLC.
Binding of the antigen or antigenic determinant to the VLP by using a hetero-bifunctional cross-linker according to the prefened methods described above, allows coupling of the antigen or antigenic determinant to the VLP in an oriented fashion. Other methods of binding the antigen or antigenic determinant to the VLP include methods wherein the antigen or antigenic determinant is cross-linked to the VLP using the carbodiimide EDC, and NHS. In further methods, the antigen or antigenic determinant is attached to the VLP using a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce Chemical Company, Rockford, IL, USA) or other known homo-bifunctional cross-linkers whith functional groups reactive towards amine groups or carboxyl groups of the VLP.
Other methods of binding the VLP to an antigen or antigenic determinant include methods where the VLP is biotinylated, and the antigen or antigenic determinant expressed as a streptavidin-fusion protein, or methods wherein both the antigen or antigenic determinant and the VLP are biotinylated, for example as described in WO 00/23955. In this case, the antigen or antigenic determinant may be first bound to streptavidin or avidin by adjusting the ratio of antigen or antigenic determinant to streptavidin such that free binding sites are still available for binding of the VLP, which is added in the next step. Alternatively, all components may be mixed in a "one pot" reaction. Other ligand-receptor pairs, where a soluble form of the receptor and of the ligand is available, and are capable of being cross-linked to the VLP or the antigen or antigenic determinant, may be used as binding agents for binding antigen or antigenic determinant to the VLP. Alternatively, either the ligand or the receptor may be fused to the antigen or antigenic determinant, and so mediate binding to the VLP chemically bound or fused either to the receptor, or the ligand respectively. Fusion may also be effected by insertion or substitution.
As already indicated, in a favored embodiment of the present invention, the VLP is the VLP of a RNA phage, and in a more prefened embodiment, the VLP is the VLP of RNA phage Qβ coat protein.
One or several antigen molecules, i.e. one or several antigens or antigenic determinants, can be attached to one subunit of the capsid or VLP of RNA phages coat proteins, preferably through the exposed lysine residues of the VLP of RNA phages, if sterically allowable. A specific feature of the VLP of the coat protein of RNA phages and in particular of the Qβ coat protein VLP is thus the possibility to couple several antigens per subunit. This allows for the generation of a dense antigen array. h a preferred embodiment of the invention, the binding and attachment, respectively, of the at least one antigen or antigenic determinant to the virus-like particle is by way of interaction and association, respectively, between at least one first attachment site of the virus-like particle and at least one second attachment of the antigen or antigenic determinant.
VLPs or capsids of Qβ coat protein display a defined number of lysine residues on their surface, with a defined topology with three lysine residues pointing towards the interior of the capsid and interacting with the RNA, and four other lysine residues exposed to the exterior of the capsid. These defined properties favor the attachment of antigens to the exterior of the particle, rather than to the interior of the particle where the lysine residues interact with RNA. VLPs of other RNA phage coat proteins also have a defined number of lysine residues on their surface and a defined topology of these lysine residues.
In further prefened embodiments of the present invention, the first attachment site is a lysine residue and/or the second attachment comprises sulfhydryl group or a cysteine residue, h a very prefened embodiment of the present invention, the first attachment site is a lysine residue and the second attachment is a cysteine residue.
In very preferred embodiments of the invention, the antigen or antigenic determinant is bound via a cysteine residue, to lysine residues of the VLP of RNA phage coat protein, and in particular to the VLP of Qβ coat protein.
Another advantage of the VLPs derived from RNA phages is their high expression yield in bacteria that allows production of large quantities of material at affordable cost.
As indicated, the inventive conjugates and anays, respectively, differ from prior art conjugates in their highly organized structure, dimensions, and in the repetitiveness of the antigen on the surface of the array. Moreover, the use of the VLPs as carriers allow the formation of robust antigen anays and conjugates, respectively, with variable antigen density. In particular, the use of VLPs of RNA phages, and hereby in particular the use of the VLP of RNA phage Qβ coat protein allows to achieve very high epitope density. In particular, a density of more than 1.5 epitopes per subunit could be reached by coupling the human Aβl-6 peptide to the VLP of Qβ coat protein. The preparation of compositions of VLPs of RNA phage coat proteins with a high epitope density can be effected using the teaching of this application, h prefered embodiment of the invention, when an antigen or antigenic determinant is coupled to the VLP of Qβ coat protein, an average number of antigen or antigenic determinant per subunit of 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6 , 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4 2.5, 2.6, 2.7, 2.8, 2.9, or higher is preferred.
The second attachment site, as defined herein, may be either naturally or non-naturally present with the antigen or the antigenic determinant. In the case of the absence of a suitable natural occurring second attachment site on the antigen or antigenic determinant, such a, then non-natural second attachment has to be engineered to the antigen.
As described above, four lysine residues are exposed on the surface of the VLP of Qβ coat protein. Typically these residues are derivatized upon reaction with a cross-linker molecule. In the instance where not all of the exposed lysine residues can be coupled to an antigen, the lysine residues which have reacted with the cross-linker are left with a cross-linker molecule attached to the ε-amino group after the derivatization step. This leads to disappearance of one or several positive charges, which may be detrimental to the solubility and stability of the VLP. By replacing some of the lysine residues with arginines, as in the disclosed Qβ coat protein mutants described below, we prevent the excessive disappearance of positive charges since the arginine residues do not react with the cross-linker. Moreover, replacement of lysine residues by arginines may lead to more defined antigen arrays, as fewer sites are available for reaction to the antigen.
Accordingly, exposed lysine residues were replaced by arginines in the following Qβ coat protein mutants and mutant Qβ VLPs disclosed in this application: Qβ-240 (Lysl3-Arg; SEQ ID NO:23), Qβ-250 (Lys 2-Arg, Lysl3-Arg; SEQ ID NO: 25) and Qβ-259 (Lys 2-Arg, Lysl6-Arg; SEQ ED NO:27). The constructs were cloned, the proteins expressed, the VLPs purified and used for coupling to peptide and protein antigens. Qβ-251 ; (SEQ ID NO: 26) was also constructed, and guidance on how to express, purify and couple the VLP of Qβ-251 coat protein can be found throughout the application. In a further embodiment, we disclose a Qβ mutant coat protein with one additional lysine residue, suitable for obtaining even higher density anays of antigens. This mutant Qβ coat protein, Qβ-243 (Asn 10-Lys; SEQ ED NO: 24), was cloned, the protein expressed, and the capsid or VLP isolated and purified, showing that introduction of the additional lysine residue is compatible with self-assembly of the subunits to a capsid or VLP. Thus, antigen or antigenic determinant anays and conjugates, respectively, may be prepared using VLP of Qβ coat protein mutants. A particularly favored method of attachment of antigens to VLPs, and in particular to VLPs of RNA phage coat proteins is the linking of a lysine residue present on the surface of the VLP of RNA phage coat proteins with a cysteine residue added to the antigen. In order for a cysteine residue to be effective as second attachment site, a sulfhydryl group must be available for coupling. Thus, a cysteine residue has to be in its reduced state, that is, a free cysteine or a cysteine residue with a free sulfhydryl group has to be available. In the instant where the cysteine residue to function as second attachment site is in an oxidized form, for example if it is forming a disulfide bridge, reduction of this disulfide bridge with e.g. DTT, TCEP or β-mercaptoethanol is required. The concentration of reductand, and the molar excess of reductand over antigen has to be adjusted for each antigen. A tifration range, starting from concentrations as low as 10 μM or lower, up to 10 to 20 mM or higher reductand if required is tested, and coupling of the antigen to the carrier assessed. Although low concentrations of reductand are compatible with the coupling reaction as described in WO 02/056905, higher concentrations inhibit the coupling reaction, as a skilled artisan would know, in which case the reductand has to be removed or its concenfration decreased, e.g. by dialysis, gel filtration or reverse phase HPLC . Advantageously, the pH of the dialysis or equilibration buffer is lower than 7, preferably 6. The compatibility of the low pH buffer with antigen activity or stability has to be tested.
Epitope density on the VLP of RNA phage coat proteins can be modulated by the choice of cross-linker and other reaction conditions. For example, the cross-linkers Sulfo-GMBS and SMPH typically allow reaching high epitope density. Derivatization is positively influenced by high concentration of reactands, and manipulation of the reaction conditions can be used to control the number of antigens coupled to VLPs of RNA phage coat proteins, and in particular to VLPs of Qβ coat protein.
Prior to the design of a non-natural second attachment site the position at which it should be fused, inserted or generally engineered has to be chosen. The selection of the position of the second attachment site may, by way of example, be based on a crystal structure of the antigen. Such a crystal structure of the antigen may provide information on the availability of the C- or N- termini of the molecule (determined for example from their accessibility to solvent), or on the exposure to solvent of residues suitable for use as second attachment sites, such as cysteine residues. Exposed disulfide bridges, as is the case for Fab fragments, may also be a source of a second attachment site, since they can be generally converted to single cysteine residues through mild reduction, with e.g. 2-mercaptoethylamine, TCEP, /3-mercaptoethanol or DTT. Mild reduction conditions not affecting the immunogenicity of the antigen will be chosen. In general, in the case where immunization with a self-antigen is aiming at inhibiting the interaction of this self-antigen with its natural ligands, the second attachment site will be added such that it allows generation of antibodies against the site of interaction with the natural ligands. Thus, the location of the second attachment site will be selected such that steric hindrance from the second attachment site or any amino acid linker containing the same is avoided. In further embodiments, an antibody response directed at a site distinct from the interaction site of the self-antigen with its natural ligand is desired. In such embodiments, the second attachment site may be selected such that it prevents generation of antibodies against the interaction site of the self-antigen with its natural ligands.
Other criteria in selecting the position of the second attachment site include the oligomerization state of the antigen, the site of oligomerization, the presence of a cofactor, and the availability of experimental evidence disclosing sites in the antigen structure and sequence where modification of the antigen is compatible with the function of the self-antigen, or with the generation of antibodies recognizing the self-antigen.
In very prefened embodiments, the antigen or antigenic determinant comprises a single second attachment site or a single reactive attachment site capable of association with the first attachment sites on the core particle and the VLPs or VLP subunits, respectively. This further ensures a defined and uniform binding and association, respectively, of the at least one, but typically more than one, preferably more than 10, 20, 40, 80, 120 antigens to the core particle and VLP, respectively. The provision of a single second attachment site or a single reactive attachment site on the antigen, thus, ensures a single and unifonn type of binding and association, respectively leading to a very highly ordered and repetitive anay. For example, if the binding and association, respectively, is effected by way of a lysine- (as the first attachment site) and cysteine- (as a second attachment site) interaction, it is ensured, in accordance with this prefened embodiment of the invention, that only one cysteine residue per antigen, independent whether this cysteine residue is naturally or non-naturally present on the antigen, is capable of binding and associating, respectively, with the VLP and the first attachment site of the core particle, respectively. .
In some embodiments, engineering of a second attachment site onto the antigen require the fusion of an amino acid linker containing an amino acid suitable as second attachment site according to the disclosures of this invention. Therefore, in a preferred embodiment of the present invention, an amino acid linker is bound to the antigen or the antigenic determinant by way of at least one covalent bond. Preferably, the amino acid linker comprises, or alternatively consists of, the second attachment site. In a further prefened embodiment, the amino acid linker comprises a sulfhydryl group or a cysteine residue. En another prefened embodiment, the amino acid linker is cysteine. Some criteria of selection of the amino acid linker as well as further prefened embodiments of the amino acid linker according to the invention have already been mentioned above.
In another specific embodiment of the invention, the attachment site is selected to be a lysine or cysteine residue that is fused in frame to the HBcAg. In a preferred embodiment, the antigen is fused to the C-terminus of HBcAg via a three leucine linker.
When an antigen or antigenic determinant is linked to the VLP through a lysine residue, it may be advantageous to either substitute or delete one or more of the naturally resident lysine residues, as well as other lysine residues present in HBcAg variants.
In many instances, when the naturally resident lysine residues are eliminated, another lysine will be infroduced into the HBcAg as an attachment site for an antigen or antigenic determinant. Methods for inserting such a lysine residue are known in the art. Lysine residues may also be added without removing existing lysine residues.
The C-terminus of the HBcAg has been shown to direct nuclear localization of this protein. (Eckhardt et al, J. Virol. 65:575-582 (1991)). Further, this region of the protein is also believed to confer upon the HBcAg the ability to bind nucleic acids.
As indicated, HBcAgs suitable for use in the practice of the present invention also include N-terminal truncation mutants. Suitable truncation mutants include modified HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, or 17 amino acids have been removed from the N-terminus. However, variants of virus-like particles containing internal deletions within the sequence of the subunit composing the virus-like particle are also suitable in accordance with the present invention, provided their compatibility with the ordered or particulate structure of the virus-like particle. For example, internal deletions within the sequence of the HBcAg are suitable (Preikschat, P., et al, J. Gen. Virol. 80:1777-1788 (1999)).
Further HBcAgs suitable for use in the practice of the present invention include N- and C-terminal truncation mutants. Suitable truncation mutants include HBcAgs where 1, 2, 5, 7, 9, 10, 12, 14, 15, and 17 amino acids have been removed from the N-terminus and 1, 5, 10, 15, 20, 25, 30, 34, 35, 36, 37, 38, 39 40, 41, 42 or 48 amino acids have been removed from the C-terminus.
Vaccine compositions of the invention can comprise mixtures of different HBcAgs. Thus, these vaccine compositions can be composed of HBcAgs which differ in amino acid sequence. For example, vaccine compositions could be prepared comprising a "wild-type" HBcAg and a modified HBcAg in which one or more amino acid residues have been altered (e.g., deleted, inserted or substituted). In most applications, however, only one type of a HBcAg will be used.
The present invention is applicable to a wide variety of antigens. In a preferred embodiment, the antigen is a protein, polypeptide or peptide. In another embodiment the antigen is DNA. The antigen can also be a lipid, a carbohydrate, or an organic molecule, in particular a small organic molecule such as nicotine.
Antigens of the invention can be selected from the group consisting of the following: (a) polypeptides suited to induce an immune response against cancer cells; (b) polypeptides suited to induce an immune response against infectious diseases; (c) polypeptides suited to induce an immune response against allergens; (d) polypeptides suited to induce an immune response in farm animals or pets; and (e) fragments (e.g., a domain) of any of the polypeptides set out in (a)-(d).
Preferred antigens include those from a pathogen (e.g. virus, bacterium, parasite, fungus) and tumors (especially tumor-associated antigens or "tumor markers"). Other prefened antigens are autoantigens.
In the specific embodiments described in the Examples, the antigen is the peptide p33 derived from lymphocytic choriomeningitis virus (LCMV). The p33 peptide represents one of the best studied CTL epitopes (Pircher et al, "Tolerance induction in double specific T-cell receptor transgenic mice varies with antigen," Nature 342:559 (1989); Tissot et al, "Characterizing the functionality of recombinant T-cell receptors in vitro: a pMHC tetramer based approach," J Immunol Methods 236:147 (2000); Bachmann et al., "Four types of Ca2+-signals after stimulation of naive T cells with T cell agonists, partial agonists and antagonists,"- Eur. J.- Immunol. 27:3414 (1997); Bachmann et al, "Functional maturation of an anti-viral cytotoxic T cell response," J. Virol. 71:5764 (1997); Bachmann et al, "Peptide induced TCR-down regulation on naive T cell predicts agonist/partial agonist properties and strictly conelates with T cell activation," Eur. J. Immunol. 27:2195 (1997); Bachmann et al, "Distinct roles for LFA-1 and CD28 during activation of naive T cells: adhesion versus costimulation," Immunity 7:549 (1997)). p33-specific T cells have been shown to induce lethal diabetic disease in transgenic mice (Ohashi et al, "Ablation of 'tolerance' and induction of diabetes by virus infection in viral antigen transgenic mice," Cell 65:305 (1991)) as well as to be able to prevent growth of tumor cells expressing p33 (Kiindig et al, "Fibroblasts act as efficient antigen-presenting cells in lymphoid organs," Science 268:1343 (1995); Speiser et al., "CTL tumor therapy specific for an endogenous antigen does not cause autoimmune disease," J. Exp. Med. 186:645 (1997)). This specific epitope, therefore, is particularly well suited to study autoimmunity, tumor immunology as well as viral diseases.
In one specific embodiment of the invention, the antigen or antigenic determinant is one that is useful for the prevention of infectious disease. Such treatment will be useful to treat a wide variety of infectious diseases affecting a wide range of hosts, e.g., human, cow, sheep, pig, dog, cat, other mammalian species and non-mammalian species as well. Treatable infectious diseases are well known to those skilled in the art, and examples include infections of viral etiology such as HΕV, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, Papilloma virus etc.; or infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc. Thus, antigens or antigenic determinants selected for the compositions of the invention will be well known to those in the medical art; examples of antigens or antigenic determinants include the following: the HFV antigens gpl40 and gpl60; the influenza antigens hemagglutinin, M2 protein and neuraminidase, Hepatitis B surface antigen or core and circumsporozoite protein of malaria or fragments thereof.
As discussed above, antigens include infectious microbes such as viruses, bacteria and fungi and fragments thereof, derived from natural sources or synthetically. Infectious viruses of both human and non-human vertebrates include retroviruses, RNA viruses and DNA viruses. The group of retroviruses includes both simple retroviruses and complex retroviruses. The simple retroviruses include the subgroups of B-type retroviruses, C-type retroviruses and D-type retroviruses. An example of a B-type retrovirus is mouse mammary tumor virus (MMTV). The C-type retroviruses include subgroups C-type group A (including Rous sarcoma virus (RSV), avian leukemia virus (ALV), and avian myeloblastosis virus (AMV)) and C-type group B (including murine leukemia virus (MLV), feline leukemia virus (FeLV), murine sarcoma virus (MSV), gibbon ape leukemia virus (GALV), spleen necrosis virus (SNV), reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)). The D-type retroviruses include Mason-Pfizer monkey virus (MPMV) and simian retrovirus type 1 (SRV-1). The complex retroviruses include the subgroups of lentiviruses, T-cell leukemia viruses and the foamy viruses. Lentiviruses include HEV-1, but also include HEV-2, SEV, Visna virus, feline immunodeficiency virus (FEV), and equine infectious anemia virus (EIAV). The T-cell leukemia viruses include HTLV-1, HTLV- II, simian T-cell leukemia virus (STLV), and bovine leukemia virus (BLV). The foamy viruses include human foamy virus (HFV), simian foamy virus (SFV) and bovine foamy virus (BFV).
Examples of RNA viruses that are antigens in vertebrate animals include, but are not limited to, the following: members of the family Reoviridae, including the genus Orthoreovirus (multiple serotypes of both mammalian and avian retroviruses), the genus Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus, African horse sickness virus, and Colorado Tick Fever virus), the genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus, murine rotavirus, simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the family Picomaviridae, including the genus Enterovirus (poliovirus, Coxsackie virus A and B, enteric cytopathic human oφhan (ECHO) viruses, hepatitis A, C, D, E and G viruses, Simian enteroviruses, Murine encephalomyelitis (ME) viruses, Poliovirus muris, Bovine enteroviruses, Porcine enteroviruses, the genus Cardiovirus (Encephalomyocarditis virus (EMC), Mengovirus), the genus Rhinovirus (Human rhinoviruses including at least 113 subtypes; other rhinoviruses), the genus Apthovirus (Foot and Mouth disease (FMDV); the family Calciviridae, including Vesicular exanthema of swine virus, San Miguel sea lion virus, Feline picornavirus and Norwalk virus; the family Togaviridae, including the genus Alphavirus (Eastern equine encephalitis virus, Semliki forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross river virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus), the genus Flavirius (Mosquito borne yellow fever virus, Dengue virus, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunjin virus, Cenfral European tick borne virus, Far Eastern tick borne virus, Kyasanur forest virus, Louping III virus, Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus (Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog cholera virus, Border disease virus); the family Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related viruses, California encephalitis group viruses), the genus Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever virus), the genus Nairovirus (Crimean-Congo hemonhagic fever virus, Nairobi sheep disease virus), and the genus Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus Influenza virus (Influenza virus type A, many human subtypes); Swine influenza virus, and Avian and Equine Influenza viruses; influenza type B (many human subtypes), and influenza type C (possible separate genus); the family paramyxoviridae, including the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus, Hemadsoφtion virus, Parainfluenza viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the genus Morbilhvirus (Measles virus, subacute sclerosing panencephalitis virus, distemper virus, Rindeφest virus), the genus Pneumovirus (respiratory syncytial virus (RSV), Bovine respiratory syncytial virus and Pneumoma virus of mice); forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross river virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus), the genus Flavirius (Mosquito borne yellow fever virus, Dengue virus, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunjin virus, Cenfral European tick borne virus, Far Eastern tick borne virus, Kyasanur forest virus, Louping III virus, Powassan virus, Omsk hemonhagic fever virus), the genus Rubivirus (Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog cholera virus, Border disease virus); the family Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related viruses, California encephalitis group viruses), the genus Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever virus), the genus Nairovirus (Crimean- Congo hemonhagic fever virus, Nairobi sheep disease virus), and the genus Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus Influenza virus (Influenza virus type A, many human subtypes); Swine influenza virus, and Avian and Equine Influenza viruses; influenza type B (many human subtypes), and influenza type C (possible separate genus); the family paramyxoviridae, including the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus, Hemadsoφtion virus, Parainfluenza viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the genus Morbilhvirus (Measles virus, subacute sclerosing panencephalitis virus, distemper virus, Rindeφest virus), the genus Pneumovirus (respiratory syncytial virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus of mice); the family Rhabdoviridae, including the genus Vesiculovirus (VSV), Chandipura virus, Flanders-Hart Park virus), the genus Lyssavirus (Rabies virus), fish Rhabdoviruses and filoviruses (Marburg virus and Ebola virus); the family Arenaviridae, including Lymphocytic choriomeningitis virus (LCM), Tacaribe virus complex, and Lassa virus; the family Coronoaviridae, including Infectious Bronchitis Virus (EBV), Mouse Hepatitis virus, Human enteric corona virus, and Feline infectious peritonitis (Feline coronavirus).
Illustrative DNA viruses that are antigens in vertebrate animals include, but are not limited to: the family Poxviridae, including the genus Orthopoxvirus (Variola major, Variola minor, Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ecfromelia), the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus (Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox, goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus (contagious postular dermatitis virus, pseudocowpox, bovine papular stomatitis virus); the family Iridoviridae (African swine fever virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the family Heφesviridae, including the alpha-Heφesviruses (Heφes Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus, Equine heφes virus 2 and 3, pseudorabies virus, infectious bovine keratoconjunctivitis virus, infectious bovine rhinofracheitis virus, feline rhinotracheitis virus, infectious laryngotracheitis virus) the Beta-heφesviruses (Human cytomegalo irus and cytomegalo viruses of swine, monkeys and rodents); the gamma-heφesviruses (Epstein-Ban virus (EBV), Marek's disease virus, Heφes saimiri, Heφesvirus ateles, Heφesvirus sylvilagus, guinea pig heφes virus, Lucke tumor virus); the family Adenoviridae, including the genus Mastadenovirus (Human subgroups A, B, C, D and E and ungrouped; simian adenoviruses (at least 23 serotypes), infectious canine hepatitis, and adenoviruses of cattle, pigs, sheep, frogs and many other species, the genus Aviadenovirus (Avian adenoviruses); and non-cultivatable adenoviruses; the family Papoviridae, including the genus Papillomavirus (Human papilloma viruses, bovine papilloma viruses, Shope rabbit papilloma virus, and various pathogenic papilloma viruses of other species), the genus Polyomavirus (polyomavirus, Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K virus, BK virus, JC virus, and other primate polyoma viruses such as Lymphotrophic papilloma virus); the family Parvoviridae including the genus Adeno-associated viruses, the genus Parvovirus (Feline panleukopenia virus, bovine parvovirus, canine parvovirus, Aleutian mink disease virus, etc.). Finally, DNA viruses may include viruses which do not fit into the above families such as Kuru and Creutzfeldt- Jacob disease viruses and chronic infectious neuropathic agents (CHINA virus).
Each of the foregoing lists is illustrative, and is not intended to be limiting.
In a specific embodiment of the invention, the antigen comprises one or more cytotoxic T cell epitopes, Th cell epitopes, or a combination of the two epitopes.
In addition to enhancing an antigen specific immune response in humans, the methods of the preferred embodiments are particularly well suited for treatment of other mammals or other animals, e.g., birds such as hens, chickens, turkeys, ducks, geese, quail and pheasant. Birds are prime targets for many types of infections.
An example of a common infection in chickens is chicken infectious anemia virus (CIAV). CIAV was first isolated in Japan in 1979 during an investigation of a Marek's disease vaccination break (Yuasa et al, Avian Dis. 23:366-385 (1979)). Since that time, CIAV has been detected in commercial poultry in all major poultry producing countries (van Bulow et al, pp. 690- 699 in "Diseases of Poultry", 9th edition, Iowa State University Press 1991).
Vaccination of birds, like other vertebrate animals can be performed at any age. Normally, vaccinations are performed at up to 12 weeks of age for a live microorganism and between 14-18 weeks for an inactivated microorganism or other type of vaccine. For in ovo vaccination, vaccination can be performed in the last quarter of embryo development. The vaccine can be administered subcutaneously, by spray, orally, intraocularly, intrafracheally, nasally, in ovo or by other methods described herein.
Cattle and livestock are also susceptible to infection. Disease which affect these animals can produce severe economic losses, especially amongst cattle. The methods of the invention can be used to protect against infection in livestock, such as cows, horses, pigs, sheep and goats.
Cows can be infected by bovine viruses. Bovine viral diarrhea virus (BVDV) is a small enveloped positive-stranded RNA virus and is classified, along with hog cholera virus (HOCV) and sheep border disease virus (BDV), in the pestivirus genus. Although Pestiviruses were previously classified in the Togaviridae family, some studies have suggested their reclassification within the Flaviviridae family along with the flavivirus and hepatitis C virus (HCV) groups.
Equine heφesviruses (EHV) comprise a group of antigenically distinct biological agents which cause a variety of infections in horses ranging from subclinical to fatal disease. These include Equine heφesvirus-1 (EHV-1), a ubiquitous pathogen in horses. EHV-1 is associated with epidemics of abortion, respiratory tract disease, and cenfral nervous system disorders. Other EHV's include EHV-2, or equine cytomegalo virus, EHV-3, equine coital exanthema virus, and EHV-4, previously classified as EHV-1 subtype 2.
Sheep and goats can be infected by a variety of dangerous microorganisms including visna-maedi.
Primates such as monkeys, apes and macaques can be infected by simian immunodeficiency virus. Inactivated cell-virus and cell-free whole simian immunodeficiency vaccines have been reported to afford protection in macaques (Stott et al, Lancet 36:1538-1541 (1990); Desrosiers et al, PNAS USA 56:6353-6357 (1989); Muφhey-Corb et al, Science 246:1293-1297 (1989); and Carlson et al, AIDS Res. Human Retroviruses 6:1239-1246 (1990)). A recombinant HJV gpl20 vaccine has been reported to afford protection in chimpanzees (Berman et al, Nature 345:622-625 (1990)).
Cats, both domestic and wild, are susceptible to infection with a variety of microorganisms. For instance, feline infectious peritonitis is a disease which occurs in both domestic and wild cats, such as lions, leopards, cheetahs, and jaguars. When it is desirable to prevent infection with this and other types of pathogenic organisms in cats, the methods of the invention can be used to vaccinate cats to prevent them against infection.
Domestic cats may become infected with several retroviruses, including but not limited to feline leukemia virus (FeLV), feline sarcoma virus (FeSV), endogenous type C oncomavirus (RD-114), and feline syncytia- forming virus (FeSFV). The discovery of feline T-lymphofropic lenti virus (also refened to as feline immiinodeficiency) was first reported in Pedersen et al, Science 235:790-793 (1987). Feline infectious peritonitis (FEP) is a sporadic disease occurring unpredictably in domestic and wild Felidae. While FEP is primarily a disease of domestic cats, it has been diagnosed in lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller wild cats that have been afflicted with FEP include the lynx and caracal, sand cat and pallas cat.
Viral and bacterial diseases in fin-fish, shellfish or other aquatic life forms pose a serious problem for the aquaculture industry. Owing to the high density of animals in the hatchery tanks or enclosed marine fanning areas, infectious diseases may eradicate a large proportion of the stock in, for example, a fin-fish, shellfish, or other aquatic life forms facility. Prevention of disease is a more desired remedy to these threats to fish than intervention once the disease is in progress. Vaccination of fish is the only preventative method which may offer long-term protection through immunity. Nucleic acid based vaccinations offish are described, for example, in U.S. Patent No. 5,780,448.
The fish immune system has many features similar to the mammalian immune system, such as the presence of B cells, T cells, lymphokines, complement, and immunoglobulins. Fish have lymphocyte subclasses with roles that appear similar in many respects to those of the B and T cells of mammals. Vaccines can be administered orally or by immersion or injection.
Aquaculture species include but are not limited to fin-fish, shellfish, and other aquatic animals. Fin-fish include all vertebrate fish, which may be bony or cartilaginous fish, such as, for example, salmonids, caφ, catfish, yellowtail, seabream and seabass. Salmonids are a family of fin-fish which include trout (including rainbow trout), salmon and Arctic char. Examples of shellfish include, but are not limited to, clams, lobster, shrimp, crab and oysters. Other cultured aquatic animals include, but are not limited to, eels, squid and octopi.
Polypeptides of viral aquaculture pathogens include but are not limited to glycoprotein or nucleoprotein of viral hemonhagic septicemia virus (VHSV); G or N proteins of infectious hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural proteins of infectious pancreatic necrosis virus (JPNV); G protein of spring viremia of caφ (SVC); and a membrane- associated protein, tegumin or capsid protein or glycoprotein of channel catfish virus (CCV).
Polypeptides of bacterial pathogens include but are not limited to an iron-regulated outer membrane protein, (IROMP), an outer membrane protein (OMP), and an A-protein of Aeromonis salmonicida which causes furunculosis, p57 protein of Renibacterium salmoninarum which causes bacterial kidney disease (BKD), major surface associated antigen (msa), a surface expressed cytotoxin (mpr), a surface expressed hemolysin (ish), and a flagellar antigen of Yersiniosis; an extracellular protein (ECP), an iron- regulated outer membrane protein (IROMP), and a structural protein of Pasteurellosis; an OMP and a flagellar protein of Vibrosis anguillarum and V. ordalii; a flagellar protein, an OMP protein, aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and surface antigen of Ichthyophthirius; and a structural and regulatory protein of Cytophaga columnari; and a structural and regulatory protein of Rickettsia.
Polypeptides of a parasitic pathogen include but are not limited to the surface antigens of Ichthyophthirius.
In another aspect of the invention, there is provided vaccine compositions suitable for use in methods for preventing and/or attenuating diseases or conditions which are caused or exacerbated by "self gene products (e.g., tumor necrosis factors). Thus, vaccine compositions of the invention include compositions which lead to the production of antibodies that prevent and/or attenuate diseases or conditions caused or exacerbated by "self gene products. Examples of such diseases or conditions include graft versus host disease, IgE-mediated allergic reactions, anaphylaxis, adult respiratory distress syndrome, Crohn's disease, allergic asthma, acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma (NHL), Graves' disease, systemic lupus erythematosus (SLE), inflammatory autoimmune diseases, myasthenia gravis, immunoproliferative disease lymphadenopathy (EPL), angioimmunoproliferative lymphadenopathy (AIL), immunoblastive lymphadenopathy (EBL), rheumatoid arthritis, diabetes, prion diseases, multiple sclerosis, Alzheimer disease and osteoporosis.
In related specific embodiments, compositions of the invention are an immunotherapeutic that can be used for the freatment and/or prevention of allergies, cancer or drug addiction.
The selection of antigens or antigenic determinants for the preparation of compositions and for use in methods of treatment for allergies would be known to those skilled in the medical arts treating such disorders. Representative examples of such antigens or antigenic determinants include the following: bee venom phospholipase A2, Bet v I (birch pollen allergen), 5 Dol m V (white-faced hornet venom allergen), and Der p I (House dust mite allergen), as well as fragments of each which can be used to elicit immunological responses.
The selection of antigens or antigenic determinants for compositions and methods of treatment for cancer would be known to those skilled in the medical arts treating such disorders (see Renkvist et al, Cancer. Immunol. Immunother. 50:3-15 (2001) which is incoφorated by reference), and such antigens or antigenic determinants are included within the scope of the present invention. Representative examples of such types of antigens or antigenic determinants include the following: Her2 (breast cancer); GD2 (neuroblastoma); EGF-R (malignant ghoblastoma); CEA (medullary thyroid cancer); CD52 (leukemia); human melanoma protein gplOO; human melanoma protein gplOO epitopes such as amino acids 154-162 (sequence: KTWGQYWQV), 209-217 (ITDQVPFSV), 280-288 (YLEPGPVTA), 457- 466 (LLDGTATLRL) and 476-485 (VLYRYGSFSV); human melanoma protein melan-A/MART-1; human melanoma protein melan- A/MART- 1 epitopes such as amino acids 27-35 (AAGIGILTV) and 32- 40 (ILTVILGVL); tyrosinase and tyrosinase related proteins (e.g., TRP-1 and TRP-2); tyrosinase epitopes such as amino acids 1-9 (MLLAVLYCL) and 369-377 (YMDGTMSQV); NA17-A nt protein; NA17-A nt protein epitopes such as amino acids 38-64 (VLPDVFERC); MAGE-3 protein; MAGE-3 protein epitopes such as amino acids 271-279 (FLWGPRALV); other human tumors antigens, e.g. CEA epitopes such as amino acids 571-579 (YLSGANLNL); p53 protein; p53 protein epitopes such as amino acids 65-73 (RMPEAAPPV), 149-157 (STPPPGTRV) and 264-272 (LLGRNSFEV); Her2/neu epitopes such as amino acids 369-377 (KIFGSLAFL) and 654-662 (IISAVVGIL); NY-ESO-1 peptides 157-165 and 157-167, 159-167; HPV16 E7 protein; HPV16 E7 protein epitopes such as amino acids 86-93 (TLGEVCPE); as well as fragments of each which can be used to elicit immunological responses.
The selection of antigens or antigenic determinants for compositions and methods of treatment for drug addiction, in particular recreational drug addiction, would be known to those skilled in the medical arts treating such disorders. Representative examples of such antigens or antigenic determinants include, for example, opioids and moφhine derivatives such as codeine, fentanyl, heroin, moφhium and opium; stimulants such as amphetamine, cocaine, MDMA (methylenedioxymethamphetamine), methamphetamine, methylphenidate and nicotine; hallucinogens such as LSD, mescaline and psilocybin; as well as cannabinoids such as hashish and marijuana.
The selection of antigens or antigenic determinants for compositions and methods of treatment for other diseases or conditions associated with self antigens would be also known to those skilled in the medical arts treating such disorders. Representative examples of such antigens or antigenic determinants are, for example, lymphotoxins (e.g. Lymphotoxin (LT α), Lymphotoxin β (LT β)), and lymphotoxin receptors, Receptor activator of nuclear factor kappaB ligand (RANKL), vascular endothelial growth factor (VEGF) and vascular endothelial growth factor receptor (VEGF-R), Interleukin 17 and amyloid beta peptide (Aβ1-42), TNFα, MB?, MCP-1, SDF-1, Rank-L, M-CSF, Angiotensin II, Endoglin, Eotaxin, Grehlin, BLC, CCL21, IL-13, IL-17, IL-5, IL-8, IL-15, Bradykinin, Resistin, LHRH, GHRH, GEH, CRH, TRH and Gastrin, as well as fragments of each which can be used to elicit immunological responses.
In a particular embodiment of the invention, the antigen or antigenic determinant is selected from the group consisting of: (a) a recombinant polypeptide of HEV; (b) a recombinant polypeptide of Influenza virus (e.g., an Influenza virus M2 polypeptide or a fragment thereof); (c) a recombinant polypeptide of Hepatitis C virus; (d) a recombinant polypeptide of Hepatitis B virus (e) a recombinant polypeptide of Toxoplasma; (f) a recombinant polypeptide of Plasmodium falciparum; (g) a recombinant polypeptide of Plasmodium vivax; (h) a recombinant polypeptide of Plasmodium ovale; (i) a recombinant polypeptide of Plasmodium malariae; j) a recombinant polypeptide of breast cancer cells; (k) a recombinant polypeptide of kidney cancer cells; (1) a recombinant polypeptide of prostate cancer cells; (m) a recombinant polypeptide of skin cancer cells; (n) a recombinant polypeptide of brain cancer cells; (o) a recombinant polypeptide of leukemia cells; (p) a recombinant profiling; (q) a recombinant polypeptide of bee sting allergy; (r) a recombinant polypeptide of nut allergy; (s) a recombinant polypeptide of pollen; (t) a recombinant polypeptide of house-dust; (u) a recombinant polypeptide of cat or cat hair allergy; (v) a recombinant protein of food allergies; (w) a recombinant protein of asthma; (x) a recombinant protein of Chlamydia; and (y) a fragment of any of the proteins set out in (a)-(x). hi another embodiment of the present invention, the antigen, being coupled, fused or otherwise attached to the virus-like particle, is a T cell epitope, either a cytotoxic or a Th cell epitope. In a further prefened embodiment, the antigen is a combination of at least two, preferably different, epitopes, wherein the at least two epitopes are linked directly or by way of a linking sequence. These epitopes are preferably selected from the group consisting of cytotoxic and Th cell epitopes.
It should also be understood that a mosaic virus-like particle, e.g. a virus-like particle composed of subunits attached to different antigens and epitopes, respectively, is within the scope of the present invention. Such a composition of the present invention can be, for example, obtained by transforming E.coli with two compatible plasmids encoding the subunits composing the virus-like particle fused to different antigens and epitopes, respectively. In this instance, the mosaic virus-like particle is assembled either directly in the cell or after cell lysis. Moreover, such an inventive composition can also be obtained by attaching a mixture of different antigens and epitopes, respectively, to the isolated virus-like particle.
The antigen of the present invention, and in particular the indicated epitope or epitopes, can be synthesized or recombinantly expressed and coupled to the virus-like particle, or fused to the virus-like particle using recombinant DNA techniques. Exemplary procedures describing the attachment of antigens to virus-like particles are disclosed in WO 00/32227, in WO 01/85208 and in WO 02/056905, the disclosures of which are herewith incoφorated by reference in its entirety
The invention also provides a method of producing a composition for enhancing an immune response in an animal comprising a VLP and an immunostimulatory substance, preferably an unmethylated CpG-containing oligonucleotide bound to the VLP which comprises incubating the VLP with the immunostimulatory substance and oligonucleotide, respectively, adding RNase and purifying said composition, hi an equally prefened embodiment, the method comprises incubating the VLP with RNase, adding the immunostimulatory substance and oligonucleotide, respectively, and purifying the composition. In one embodiment, the VLP is produced in a bacterial expression system. In another embodiment, the RNase is RNase A.
The invention further provides a method of producing a composition for enhancing an immune response in an animal comprising a VLP bound to an immunostimulatory substance, preferably to an unmethylated CpG- containing oligonucleotide which comprises disassembling the VLP, adding the immunostimulatory substance and oligonucleotide, respectively, and reassembling the VLP. The method can further comprise removing nucleic acids of the disassembled VLP and/or purifying the composition after reassembly.
The invention also provides vaccine compositions which can be used for preventing and/or attenuating diseases or conditions. Vaccine compositions of the invention comprise, or alternatively consist of, an immunologically effective amount of the inventive immune enhancing composition together with a pharmaceutically acceptable diluent, carrier or excipient. The vaccine can also optionally comprise an adjuvant.
The invention further provides vaccination methods for preventing and/or attenuating diseases or conditions in animals, h one embodiment, the invention provides vaccines for the prevention of infectious diseases in a wide range of animal species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc. Vaccines can be designed to treat infections of viral etiology such as HFV, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, etc.; or infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc.
In another embodiment, the invention provides vaccines for the prevention of cancer in a wide range of species, particularly mammalian species such as human, monkey, cow, dog, cat, horse, pig, etc. Vaccines can be designed to treat all types of cancer including, but not limited to, lymphomas, carcinomas, sarcomas and melanomas.
As would be understood by one of ordinary skill in the art, when compositions of the invention are administered to an animal, they can be in a composition which contains salts, buffers, adjuvants or other substances which are desirable for improving the efficacy of the composition. Examples of materials suitable for use in preparing pharmaceutical compositions are provided in numerous sources including REMINGTON'S PHARMACEUTICAL SCIENCES (Osol, A, ed., Mack Publishing Co., (1990)).
Various adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Cahnette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art. Further adjuvants that can be administered with the compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology. The adjuvants can also comprise a mixture of these substances.
Compositions of the invention are said to be "pharmacologically acceptable" if their administration can be tolerated by a recipient individual. Further, the compositions of the invention will be administered in a "therapeutically effective amount" (i.e., an amount that produces a desired physiological effect).
The compositions of the present invention can be administered by various methods known in the art. The particular mode selected will depend of course, upon the particular composition selected, the severity of the condition being freated and the dosage required for therapeutic efficacy. The methods of the invention, generally speaking, can be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Such modes of administration include oral, rectal, parenteral, intracistemal, intravaginal, intraperitoneal, topical (as by powders, ointments, drops or transdermal patch), bucal, or as an oral or nasal spray. The term "parenteral" as used herein refers to modes of administration which include infravenous, intramuscular, infraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion. The composition of the invention can also be injected directly in a lymph node.
Components of compositions for administration include sterile aqueous (e.g., physiological saline) or non-aqueous solutions and suspensions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absoφtion.
Combinations can be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concunently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second.
Dosage levels depend on the mode of administration, the nature of the subject, and the quality of the carrier/adjuvant formulation. Typical amounts are in the range of about 0.1 μg to about 20 mg per subject. Preferred amounts are at least about 1 μg to about 100 μg per subject. Multiple administration to immunize the subject is prefened, and protocols are those standard in the art adapted to the subject in question.
The compositions can conveniently be presented in unit dosage form and can be prepared by any of the methods well-known in the art of pharmacy. Methods include the step of bringing the compositions of the invention into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compositions of the invention into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Compositions suitable for oral administration can be presented as discrete units, such as capsules, tablets or lozenges, each containing a predetermined amoxmt of the compositions of the invention. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as a syrup, an elixir or an emulsion.
Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions of the invention described above, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art.
Other embodiments of the invention include processes for the production of the compositions of the invention and methods of medical treatment for cancer and allergies using said compositions.
Further aspects and embodiments of the present invention will become apparent in the following examples and the appended claims.
The following examples are illustrative only and are not intended to limit the scope of the invention as defined by the appended claims. It will be apparent to those skilled in the art that various modifications and variations can be made in the methods of the present invention without departing from the spirit and scope of the invention. Thus, it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.
All patents and publications refened to herein are expressly incoφorated by reference in their entirety.
Example 1
Generation ofp33-HBcAg VLPs.
The DNA sequence of HBcAg containing peptide p33 from LCMV is given in Figure IB. The p33-HBcAg VLPs (p33-VLPs) were generated as follows: Hepatitis B clone pEco63 containing the complete viral genome of Hepatitis B virus was purchased from ATCC. The gene encoding HBcAg was introduced into the EcoRI/Hindlll restriction sites of expression vector pkk223.3 (Pharmacia) under the control of a strong tac promoter. The p33 peptide (KAVYNFATM) derived from lymphocytic choriomeningitis virus (LCMV) was fused to the C-terminus of HBcAg (1-185) via a three leucine- lifrker by standard PCR methods. A clone of E. coli K802 selected for good expression was transfected with the plasmid, and cells were grown and resuspended in 5 ml lysis buffer (10 mM Na2HPO4, 30 mM NaCl, 10 mM EDTA, 0.25 % Tween-20, pH 7.0). 200 μl of lysozyme solution (20 mg/ml) was added. After sonication, 4 μl Benzonase and 10 mM MgCl2 was added and the suspension was incubation for 30 minutes at RT, centrifuged for 15 minutes at 15,000 φm at 4°C and the supernatant was retained.
Next, 20 % (w/v) (0.2 g/ml lysate) ammonium sulfate was added to the supernatant. After incubation for 30 minutes on ice and centrifugation for 15 minutes at 20,000 φm at 4°C the supernatant was discarded and the pellet resuspended in 2-3 ml PBS. 20 ml of the PBS-solution was loaded onto a Sephacryl S-400 gel filtration column (Amersham Pharmacia Biotechnology AG), fractions were loaded onto a SDS-Page gel and fractions with purified p33-VLP capsids were pooled. Pooled fractions were loaded onto a Hydroxyappatite column. Flow through (which contains purified p33-VLP capsids) was collected (Figure 2B). Electron microscopy was performed according to standard protocols. A representative example is shown in Figure 2A.
Example 2
CpG-containing oligonucleotides can be packaged into HBcAg VLPs.
Recombinant p33-VLPs were run on a native agarose (1%) gel electrophoresis and stained with ethidium bromide or Coomassie blue for the detection of RNA/DNA or protein (Figure 3). Bacterial produced VLPs contain high levels of single stranded RNA, which is presumably binding to the arginine repeats appearing near the C-terminus of the HBcAg protein and being geographically located inside the VLPs as shown by X-ray crystallography. The contaminating RNA can be easily digested and so eliminated by incubating the VLPs with RNase A. The highly active RNase A enzyme has a molecular weight of about 14 kDa and is presumably small enough to enter the VLPs to eliminate the undesired ribonucleic acids.
The recombinant p33-VLPs were supplemented with CpG- oligonucleotides (Figure 1A) before digestion with RNase A. As shown in Figure 4 the presence of CpG-oligonucleotides preserved the capsid structure as shown by similar migration compared to untreated p33-VLPs. The CpG- oligonucleotide-containing VLPs were purified from unbound oligonucleotides via dialysis (4500-fold dilution in PBS for 24 hours using a 300 kDa MWCO dialysis membrane) (Figure 5).
Example 3
CpG-oligonucleotides can be packaged into VLPs by removal of the RNA with RNAse and subsequent packaging of oligonucleotides into VLPs.
The p33-VLPs (containing bacterial single-stranded RNA) were first incubated with RNase A to remove the RNA and in a second step the immunostimulating CpG-oligonucleotides (with normal phosphodiester bonds but also with phosphorothioate modification of the phosphate backbone) was supplemented to the samples (Figure 6). This experiment clearly shows that the CpG-oligonucleotides are not absolutely required simultaneously during the RNA degradation reaction but can be added at a later time. Example 4
VLPs containing CpG-oligonucleotides (with phosphorothioate modification of the phosphate backbone or normal phosphodiester bonds) induce enhanced anti-viral protection.
Mice were subcutaneously primed with 100 μg CpG-oligonucleotide containing p33-VLPs. Before immunization, p33-VLP preparations were extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). As controls mice were subcutaneously primed with 100 μg p33-VLP alone, mixed with 20 nmol CpG-oligonucleotide, with 20 nmol CpG-oligonucleotide alone or left untreated. Twenty-one days later, mice were challenged with LCMV (200 pfu, intravenously) and viral titers were assessed in the spleens 5 days later as described in Bachmann, M. F., "Evaluation of lymphocytic choriomeningitis virus-specific cytotoxic T cell responses," in Immxmology Methods Manual, Lefkowitz, L, ed., Academic Press Ltd., New York, NY (1997) p. 1921. The results are shown in Figures 7, 8 and 9.
Example 5
Generation of BKV polyoma capsids.
BK virus (BKV) is a non-enveloped double stranded DNA virus belonging to the polyoma virus subfamily of the papovaviridae. VPl is the major capsid protem. VPl has 362 amino acids (Figure 10) and is 42 kDa in size. When produced in E. coli, insect cells or yeast VPl spontaneously forms capsid structures (Salunke D.M., et al, Cell 46(6):895-904 (1986); Sasnauskas, K., et ah, Biol. Chem. 380(3):381-6 (1999); Sasnauskas, K, et al, 3r International Workshop "Virus-like particles as vaccines" Berlin, September 26-29 (2001); Touze, A., et al, J Gen Virol. 82(Pt 12):3005-9 (2001). The capsid is organized in 72 VPl pentamers forming an icosahedral structure. The capsids have a diameter of approximately 45 nm. Example 6
Fluorescein labeled CpG-containing oligonucleotides can be packaged into
BKV VLPs.
VLPs produced in yeast contain small amounts of RNA which can be easily digested and so eliminated by incubating the VLPs with RNase A. The highly active RNase A enzyme has a molecular weight of about 14 kDa and is small enough to enter the VLPs to eliminate the undesired ribonucleic acids. Recombinantly produced BKV VLPs were concentrated to 1 mg/ml in PBS buffer pH7.2 and incubated in the absence or presence of RNase A (200μg/ml, Roche Diagnostics Ltd, Switzerland) for 3 h at 37°C. After RNase A digestion BKV VLPs were supplemented with 75 nmol/ml fluorescein labeled phosphorothioate CpG-FAM oligonucleotide and incubated for 3 h at 37°C. Subsequently BKV VLPs were subjected to DNasel digestion for 3 h at 37°C (40 u/ml AMPD1, Sigma, Division of Fluka AG, Switzerland) or loaded without DNasel digestion. The samples were complemented with 6-fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8% native tris-acetate pH 7.5 agarose gel.
Figure 12 shows BKV VLPs in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with fluorescent CpG-FAM oligonucleotides (oligonucleotide from Figure 1A with a 5'-fluorescein-label) upon staining with ethidium bromide or without ethidium bromide staining. In the presence of ethidium bromide nucleic acids are detected, while in its absence UV excitation leads to fluorescence of the fluorescein-label in the CpG-FAM.
The RNase A digestion leads to a change in migration of the VLP, visible on Coomassie stained agarose gel, presumably due to the lack of negative charges from the RNA (Figures 13 and 14). Addition of CpG- oligonucleotide restores the migration of BKV VLPs and results in a fluorescent band with the same migration as the RNA band present in untreated VLPs. This clearly shows that CpG-FAM oligonucleotides have been packaged into VLPs.
Example 7
Large double stranded oligonucleotides can be packaged into BKV VLPs.
To introduce double stranded (ds) nucleotide sequences, the RNase A treated recombinant BKV VLPs (Example 6) were supplemented with 50μg/ml (ds) DNA fragments (246 bp in length, Figure 11) and incubated for 3 h at 37°C. The samples were complemented with 6-fold concentrated DNA- loading buffer (10 mM Tris pH8.0, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8% native tris-acetate pH8.0 agarose gel.
Figure 13 shows BKV VLPs (15 μg) in a native 0.8% agarose gel electrophoresis after control incubation or after digestion with RNase A and subsequent incubation with (ds) DNA upon staining with ethidium bromide or Coomassie Blue in order to assess the presence of RNA DNA or protem. Packaged DNA molecules are visible in the presence of ethidium bromide as a band with the same migration as the VLP band visualized with Coomassie Blue.
Addition of (ds) DNA restores the migration of BKV VLPs and results in a DNA band with the same migration as the Coomassie Blue stained VLPs. This clearly shows that (ds) DNA has been packaged into BKV VLPs.
Example 8
CpG-containing oligonucleotides can be packaged into BKV VLPs.
To introduce immunostimulatory CpG-oligonucleotides, the RNase A treated recombinant BKV VLPs (Example 6) were supplemented with 150 nmol/ml CpG-oligonucleotides with phosphodiester backbone or with phosphorothioate backbone and incubated for 3 h at 37°C. VLP preparations for mouse immunization were extensively dialysed (10,000-fold diluted) for 24 h against PBS pH7.2 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNase A and the excess of CpG-oligonucleotides. The samples were complemented with 6- fold concentrated DNA-loading buffer (10 mM Tris pH7.5, 10% v/v glycerol, 0.4% orange G) and run for 1 h at 65 volts in a 0.8% native tris-acetate pH7.5 agarose gel.
Figure 14 shows BKV VLPs (15 μg) in a native 0.8% agarose gel electrophoresis after confrol incubation or after digestion with RNase A and subsequent incubation with CpG-oligonucleotides (with phosphodiester- or with phosphorothioate backbone) upon staining with ethidium bromide (A) or Coomassie Blue (B) in order to assess the presence of RNA/DNA or protein and the reduction of unbound CpG-oligonucleotides after dialysis. Unbound CpG-oligonucleotides are visible as a low molecular weight ethidium bromide stained band.
Addition of CpG-oligonucleotides restores the migration of BKV VLPs and results in a DNA band with the same migration as the Coomassie Blue stained VLPs. This clearly shows that CpG-oligonucleotides are packaged into BKV VLPs.
Example 9
VLPs containing CpG-oligonucleotides (with phosphorothioate modification of the phosphate backbone) induce enhanced Thl directed immune response.
Female BALB/c mice (three mice per group) were subcutaneously injected with 10 μg BKV VLPs containing phosphorothioate CpG- oligonucleotide (Figure 1A). As controls mice were subcutaneously injected with either 10 μg of RNase treated BKV VLPs alone or BKV VLPs mixed with 0.3 nmol or 20 nmol phosphorothioate CpG-oligonucleotides in 200 μl PBS pH7.2 or were left untreated. BKV VLPs were prepared as described in Example 8 and before immunization extensively purified from unbound CpG- oligonucleotide by dialysis. On day 14 after immunization blood was taken and IgGl and IgG2a antibody response to BKV VLPs was determined.
Figure 15 shows IgGl and IgG2a antibody response to BKV VLPs on day 14 after immxmization. Immunization with RNase A treated BKV VLPs containing phosphorothioate CpG-oligonucleotides results in a decreased IgGl and an increased anti-BKV VLP IgG2a titer as compared to immunization with the same amount (0.3 nmol) of CpG-oligonucleotides mixed with BKV VLPs or BKV VLPs alone. Mice immunized with BKV VLPs mixed with 20 nmol phosphorothioate CpG-oligonucleotides show very low IgGl and high IgG2a titers. The decrease in IgGl titer and the increase in IgG2a titer as compared to controls demonstrates a Thl cell directed irnmiine response induced by phosphorothioate CpG-oligonucleotides packaged in BKV VLPs. Figure 15 clearly demonsfrates the higher potency of BKV VLPs containing CpG-oligonucleotides packaged within the particles as compared to BKV VLPs simply mixed with CpG-oligonucleotides.
Example 10
Linear double-stranded DNA (dsDNA) can be packaged into VLPs by first RNAse digestion and subsequently addition ofdsDNA.
The p33-VLPs preparations (containing bacterial RNA) (EXAMPLE 1) were first incubated with RNaseA to remove the RNA and in a second step the linear dsDNA (350 bp long) was supplemented to the samples (Figure 16). The migration of the p33-VLPs packaged with the dsDNA was similar to the one of p33 -VLP containing RNA. This experiment shows that linear dsDNA of at least 350 base pairs in length can be packaged into the virus-like particles. Example 11
Immunostimulatory nucleic acids can be packaged into HBcAg VLPs comprising fusion proteins with antigens.
HBcAg VLPs, when produced in E. coli by expressing the Hepatitis B core antigen fusion protein HBc33 (Example 1) or the fusion protein to the peptide PI A (HBcPlA), contain RNA which can be digested and so eliminated by incubating the VLPs with RNase A.
The gene PI A codes for a protein that is expressed by the mastocytoma tumor cell line P815. The dominant CTL epitope, termed P1A peptide, binds to MHC class I (Ld) and the complex is recognized by specific CTL clones (Brandle et al., 1998, Eur. J. Immunol. 28: 4010-4019). Fusion of peptide P1A-1 (LPYLGWLVF) to the C-tenninus of HBcAg (aa 185, see Example 1) was performed by PCR using appropriate primers using standard molecular biology techniques. A three leucine linker was cloned between the HBcAg and the peptide sequence. Expression was performed as described in Example 1. The fusion protein of HBcAg with PI A, termed HBcPlA, formed capsids when expressed in E. coli which could be purified similar to the procedure described in Example 1.
Enzymatic RNA hydrolysis: Recombinantly produced HBcAg-p33 (HBc33) and HBcAg-Pl A (HBcPlA) VLPs at a concentration of 1.0 mg/ml in 1 x PBS buffer (KC1 0.2g/L, KH2PO4 0.2g/L, NaCl 8 g/L, Na2HPO4 1.15 g/L) pH 7.4, were incubated in the presence of 300 μg/ml RNase A (Qiagen AG, Switzerland) for 3 h at 37°C in a thermomixer at 650 φm.
Packaging of immunostimulatory nucleic acids: After RNA digestion with RNAse A HBcAg-p33 VLPs were supplemented with 130 nmol/ml CpG- oligonucleotides B-CpG, NKCpG, G10-PO (Table I). Similarly, the 150mer single-stranded Cyl50-1 and 253mer double stranded dsCyCpG-253, both containing multiple copies of CpG motifs, were added at 130 nmol/ml or 1.2 nmol/ml, respectively, and incubated in a thermomixer for 3 h at 37°C. Double stranded CyCpG-253 DNA was produced by cloning a double stranded multimer of CyCpG into the EcoRV site of pBluescript KS-. The resulting plasmid, produced in E. coli XLl-blue and isolated using the Qiagen Endofree plasmid Giga Kit, was digested with restriction endonucleases Xhol and Xbal and resulting restriction products were separated by agarose electrophoresis. The 253 bp insert was isolated by electro-elution and ethanol precipitation. Sequence was verified by sequencing of both strands.
Table I: Sequences of immunostimulatory nucleic acids used in the Examples.
Small letters indicate deoxynucleotides connected via phosphorothioate bonds while larger letters indicate deoxynucleotides connected via phosphodiester bonds
Figure imgf000111_0001
Figure imgf000112_0001
DNAse I treatment: Packaged HBcAg-p33 VLPs were subsequently subjected to DNasel digestion (5 U/ml) for 3 h at 37°C (DNasel, RNase free Fluka AG, Switzerland) and were extensively dialysed (2 x against 200-fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNAse A and the excess of CpG-oligonucleotides.
Benzonase treatment: Since some single stranded oligodeoxynucleotides were partially resistant to DNasel treatment, Benzonase treatment was used to eliminate free oligonucleotides from the preparation. 100-120 U/ml Benzonase (Merck KGaA, Darmstadt, Germany) and 5 mM MgCl2 were added and incubated for 3 h at 37°C before dialysis.
Dialysis: VLP preparations packaged with immunostimulatroy nucleic acids used in mouse immunization experiments were extensively dialysed (2x against 200fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical Industries, Houston, US) to eliminate added enzymes and free nucleic acids.
Analytics of packaging: release of packaged immunostimulatory nucleic acids: To 50 μl capsid solution 1 μl of proteinase K (600 U/ml, Roche, Mannheim, Germany), 3 μl 10% SDS-solution and 6 μl lOfold proteinase buffer (0.5 M NaCl, 50 mM EDTA, 0.1 M Tris pH 7.4) were added and subsequently incubated overnight at 37°C. VLPs are completed hydrolysed under these conditions. Proteinase K was inactivated by heating for 20 min at 65°C. 1 μl RNAse A (Qiagen, 100 μg/ml, diluted 250 fold) was added to 25 μl of capsid. 2-30 μg of capsid were mixed with 1 volume of 2x loading buffer (IxTBE, 42% w/v urea, 12% w/v Ficoll, 0.01 % Bromphenolblue), heated for 3 min at 95°C and loaded on a 10% (for oligonucleotides of about 20 nt length) or 15% (for > than 40 mer nucleic acids) TBE/urea polyacrylamid gel (Invitrogen). Alternatively samples were loaded on a 1 % agarose gel with 6x loading dye (10 mM Tris pH 7.5, 50 mM EDTA, 10% v/v glycerol, 0.4 % orange G). TBE/urea gels were stained with CYBRGold and agarose gels with stained with ethidium bromide.
Figures 17, 18 and 19 show the packaging of B-CpG, NKCpG and G10-PO oligonucleotides into HBc33. RNA content in the VLPs was strongly reduced after RNaseA treatment (Figure 17A, 18 A, 19A) while most of the capsid migrated as a a slow migrating smear presumably due to the removal of the negatively charged RNA (Figure 17B, 18B, 19B). After incubation with an excess of oligonucleotid the capsids contained a higher amount of nucleic acid than the RNAseA treated capsids and therefore migrated at similar velocity as the untreated capsids. Additional treatment with DNAse I or Benzonase degraded the free oligonucleotides while oligonucleotides packaged in the capsids did not degrade, clearly showing packaging of oligonucleotides. In some cases packaging of oligonucleotides was confirmed by proteinase K digestion (as described in Examples 15 and 16) after DNAsel/Benzonase treatment and dialysis. The finding that oligonucleotides released from the capsid with the procedure described above were of the same size than the oligonucleotide used for packaging clearly demonsfrated packaging of oligonucleotides (Figure 17C, 18C).
Figure 20 shows packaging of a large single-stranded oligonucleotide Cyl50-1 into HBc33. Cyl50-1 contains 7.5 repeats of CyCpG and was synthesized according standard oligonucleotide synthesis methods (EBA, Gόttingen, Germany). RNA content in the capsid was strongly reduced after RNaseA treatment while most of the capsid migrated as a slow migrating smear (Figure 20A, B). Capsid were diluted with 4 volumes of water and concentrated to 1 mg/ml. After incubation with an excess of Cyl50-1 the capsid contained a bigger amount of nucleic acid and thus migrated at similar velocity as the untreated capsids. Additional freatment with DNAsel degraded the free, not packaged oligonucleotides while oligonucleotides in capsids were not degraded (Figure 20A). Release of the DNAsel-resistant nucleic acid from the packaged VLPs by heating for 3 min at 95°C in TBE/urea loading buffer revealed the presence of the 150 mer (Figure 20 C).
Figure 21 shows packaging of oligonucleotide NKCpGpt in HBcPlA. Treatment with RNAse reduced nucleic acid content and slowed migration of the capsids. Addition of NKCpGpt restored nucleic acid content in capsids and fast migration.
Figure 17 depicts the analysis of B-CpG packaging into HBc33 VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 50 μg of the following samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A; 3. HBc33 VLP treated with RNase A and packaged with B-CpG; 4. HBc33 VLP treated with RNase A, packaged with B-CpG and treated with DNasel; 5. HBc33 VLP treated with RNase A, packaged with B-CpG, treated with DNasel and dialysed; 6. 1 kb MBI Fermentas DNA ladder. (C) depicts the analysis of the amount of packaged oligo extracted from the VLP on a 1.5% agarose gel stained with ethidium bromide: Loaded on gel are the following samples: 1. 0.5 nmol B- CpG control; 2. 0.5 nmol B-CpG control; 3. B-CpG oligo content HBc33 after phenol / chloroform extraction; 4. B-CpG oligo content HBc33 after phenol / chloroform extraction and RNase A treatment; 5. B-CpG oligo content HBc33 after phenol/ chloroform extraction and DNasel freatment; 6. empty; 7. MBI Fermentas 100 bp DNA ladder
Figure 18 depicts the analysis of NKCpG packaging into HBc33 VLPs on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 μg of the following samples: 1. HBc33 VLP untreated; 2. HBc33 VLP treated with RNase A; 3. HBc33 VLP treated with RNase A and packaged with NKCpG; 4. HBc33 VLP treated with RNase A, packaged with NKCpG, treated with DNasel and dialysed; 5. 1 kb MBI Fermentas DNA ladder. (C) depicts the analysis of the amount of packaged oligo exfracted from the VLP on a 15% TBE/urea gel stained with CYBR Gold. Loaded on gel are the following samples: 1. NKCpG oligo content HBc33 after proteinase K digestion and RNase A treatment; 2. 20 pmol NKCpG control; 3. 10 pmol NKCpG control; 4. 40 pmol NKCpG control
Figure 19 depicts the analysis of glOgacga-PO packaging into HBc33 VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 μg of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP untreated; 3. HBc33 VLP freated with RNase A; 4. HBc33 VLP treated with RNase A and packaged with glOgacga- PO; 5. HBc33 VLP treated with RNase A, packaged with glOgacga-PO, treated with Benzonase and dialysed.
Figure 20 depicts the analysis of CyCpG-150 packaging into HBc33 VLPs on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 μg of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBc33 VLP untreated; 3. HBc33 VLP treated with RNase A; 4. HBc33 VLP treated with RNase A and packaged with CyCpG- 150; 5. HBc33 VLP treated with RNase A, packaged with CyCpG-150, treated with DNasel and dialysed; 6. HBc33 VLP treated with RNase A, packaged with CyCpG-150, treated with DNasel and dialysed. (C) depicts the analysis of the amount of packaged oligo extracted from the VLP on a 10 % TBE/urea gel stained with CYBR Gold. Loaded on gel are the following samples: 1. 20 pmol CyCpG-150 control; 2. 10 pmol CyCpG-150 control; 3. 4 pmol CyCpG- 150 control; 4. CyCpG-150 oligo content of 4 μg HBc33 after 3 min at 95°C with 1 volume TBE/urea sample buffer.
Figure 21 depicts the analysis of NKCpGpt packaging into HBcPlA VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 15 μg of the following samples: 1. 1 kb MBI Fermentas DNA ladder; 2. HBcPlA VLP untreated; 3. HBcPlA VLP treated with RNase A; 4. HBcPlA VLP treated with RNase A and packaged with NKCpGpt.
Example 12
Immunostimulatory nucleic acids can be packaged in HBcAg-wt coupled with antigens.
Recombinantly produced HBcAg-wt VLPs were packaged after coupling with peptide p33 (CGG-KAVYNFATM), derived from lymphocytic choriomeningitis virus (LCMV). For coupling HBcAg-wt VLPs (2 mg/ml) were derivatized with 25x molar excess of SMPH (Succinimidyl-6-[(β- maleimido-propionamido)hexanoate], Pierce) for 1 h at 25°C in a thermomixer. The derivatized VLPs were dialyzed to Mes buffer (2-(N- moφholino) ethanesulphonic acid) pH 7.4 for 2 x 2 h using MWCO 10.000 kD dialysis membranes at 4°C. VLPs (50μM) were subsequently coupled to the N-terminal cysteine of the p33 peptide (250μM) during a 2 h incubation in a thermomixer at 25°C. Samples were dialyzed (MWCO 300.000) extensively to lx PBS pH 7.4 to eliminate undesired free peptide.
Figure 22 shows SDS-PAGE analysis of HBcAg wt VLPs derivatization with SMPH and coupling to p33 peptide. Samples were analysed by 16% SDS PAGE and stained with Coomassie Blue. HBcAg- wt was visible as a 21 kD protein band. Due to the low molecular weigth of SMPH is the derivatised product only slightly larger and can not be distinguished by SDS-PAGE. Peptide alone was visible as a 3 kD band and coupled product, termed HBx33, showed a strong secondary band at approximately 24 kD accounting for more than 50% of total HBcAg- wt.
Enzymatic RNA hydrolysis: HBx33 VLPs (0.5-1.0 mg/ml, lxPBS buffer pH7.4) in the presence of RNase A (300 μg/ml, Qiagen AG, Switzerland) were diluted with 4 volumes H2O to decrease salt concentration to a final 0.2xPBS concentration and incubated for 3 h at 37°C in a thermomixer at 650 φm. Packaging of immunostimulatory nucleic acids: After RNase A digestion HBx33 VLPs were concentrated using Millipore Microcon or Centriplus concentrators, then supplemented with 130 nmol/ml CpG- oligonucleotide B-CpGpt and incubated in a thermomixer for 3 h at 37°C in 0.2xPBS pH 7.4. Subsequently, reaction mixtures were subjected to DNasel digestion (5 U/ml) for 3 h at 37°C (DNasel, RNase free Fluka AG, Switzerland). VLP preparations for mouse immunization were extensively dialysed (2x against 200-fold volume) for 24 h against PBS pH 7.4 with a 300 kDa MWCO dialysis membrane (Spectrum Medical industries Inc., Houston, USA) to eliminate RNase A and the excess of CpG-oligonucleotides. Figure 23 shows that RNAse treatment reduced the nucleic acid content of the capsids and slowed their migration. Addition of B-CpGpt restored nucleic acid content and fast migration of capsids. DNAse I only digested the free oligonucleotides while the packaged oligonucleotides remained in the VLP also after dialysis (Figure 23).
Figure 22 depicts the SDS-PAGE analysis of the p33 coupling to HBc VLPs after Coomassie Blue staining. Loaded on the gel are the following samples: l .NEB Prestained Protein Marker, Broad Range (# 7708S), 10 μl; 2. CGG-p33 peptide; 3. HBc VLP derivatized with SMPH, before dialysis; 4. HBc VLP derivatized with SMPH, after dialysis; 5. HBc VLP coupled with CGG-p33, supernatant; 6. HBc VLP coupled with CGG-p33, pellet.
Figure 23 depicts the analysis of B-CpGpt packaging into HBx33 VLPs on a 1 % agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 50 μg of the following samples: 1. HBx33 VLP untreated; 2. HBx33 VLP treated with RNase A; 3. HBx33 VLP treated with RNase A and packaged with B-CpGpt; 4. HBx33 VLP freated with RNase A, packaged with B-CpGpt and treated with DNasel; 5. HBx33 VLP treated with RNase A, packaged with B-CpGpt, treated with DNasel and dialysed; 6. 1 kb MBI Fermentas DNA ladder Example 13
Immunostimulatory nucleic acids can be packaged into Qβ VLPs coupled with antigens.
Coupling of p33 peptides to Qβ VLPs:
Recombinantly produced Qβ VLPs were used after coupling to p33 peptides containing an N-terminal CGG or and C-terminal GGC extension (CGG-KAVYNFATM and KAVYNFATM-GGC). Recombinantly produced Qβ VLPs were derivatized with a 10 molar excess of SMPH (Pierce) for 0.5 h at 25°C, followed by dialysis against 20 mM HEPES, 150 mM NaCl, pH 7.2 at 4°C to remove unreacted SMPH. Peptides were added in a 5 fold molar excess and allowed to react for 2 h in a thermomixer at 25°C in the presence of 30% acetonitrile. Figure 24 shows the SDS-PAGE analysis demonstrating multiple coupling bands consisting of one, two or three peptides coupled to the Qβ monomer (Arrows, Figure 24).
Qβ VLPs, when produced in E. coli by expressing the bacteriophage Qβ capsid protein, contain RNA which can be digested and so eliminated by incubating the VLPs with RNase A.
Low ionic strength and low Qβ concentration allow RNA hydrolysis of Qβ VLPs by RNAse A:
Qβ VLPs at a concentration of 1.0 mg/ml in 20mM Hepes/150mM NaCl buffer (HBS) pH 7.4 were either digested directly by addition of RNase A (300 μg/ml, Qiagen AG, Switzerland) or were diluted with 4 volumes H2O to a final 0.2 x HBS concentration and then incubated with RNase A (60 μg/ml, Qiagen AG, Switzerland). Incubation was allowed for 3 h at 37°C in a thermomixer at 650 φm. Figure 25 demonstrates that in IxHBS only a very weak reduction of RNA content was observed, while in 0.2x HBS most of the RNA were hydrolysed. In agreement, capsid migration was unchanged after addition of RNAse A in lx HBS, while migration was slower after addition of RNAse in 0.2xHBS (Figure 25 B,D).
Low ionic strength increases nucleic acid packaging in Qβ VLPs:
After RNase A digestion in 0.2 x HBS the Qβ VLPs were concentrated to 1 mg/ml using Millipore Microcon or Centriplus concentrators and aliquots were dialysed against lx HBS or 0.2 x HBS. Qβ VLPs were supplemented with 130 nmol/ml CpG-oligonucleotide B-CpG and incubated in a thermomixer for 3 h at 37°C. Subsequently Qβ VLPs were subjected to Benzonase digestion (100 U/ml) for 3 h at 37°C. Samples were analysed on 1% agarose gels after staining with ethidium bromide or Coomassie Blue. Figure 26 shows that in lx HBS only a very low amount of oligonucleotides could be packaged, while in 0.2 x HBS a strong ethidium bromide stained band was detectable, which colocalized with the Coomassie blue stain of the capsids.
Different immunostimulatory nucleic acids can be packaged in Qβ VLPs:
After RNase A digestion in 0.2 x HBS the Qβ VLPs were concentrated to 1 mg/ml using Millipore Microcon or Centriplus concentrators and supplemented with 130 nmol ml CpG-oligonucleotides B-CpGpt, glOgacga and the 253 mer dsCyCpG-253 (Table I) and incubated in a thermomixer for 3 h at 37°C. Subsequently Qβ VLPs were subjected to DNAse I digestion (5 U/ml) or Benzonase digestion (100 U/ml) for 3 h at 37°C. Samples were analysed on 1% agarose gels after staining with ethidium bromide or Coomassie Blue. Figure 27 shows that the different nucleic acids B-CpGpt, glOgacga and the 253mer dsDNA could be packaged into Qbx33. Packaged nucleic acids were resistant to DNAse I digestion and remained packaged during dialysis (Figure 27). Packaging of B-CpGpt was confirmed by release of the nucleic acid by proteinase K digestion followed by agarose electrophoresis and ethidium bromide staining (Figure 27C).
Figure 24 depicts the SDS-PAGE analysis of the p33 coupling to Qβ VLPs after Coomassie Blue staining. Loaded are the following samples: (A) 1. NEB Prestained Protein Marker, Broad Range (# 7708S), 10 μl; 2. Qβ VLP, 14 μg; 3. Qβ VLP derivatized with SMPH, after dialysis; 4. Qβ VLP coupled with CGG-p33, supernatant. (B) 1. NEB Prestained Protein Marker, Broad Range (# 7708S), 10 μl; 2. Qβ VLP, 10 μg; 3. Qβ VLP coupled with GGC- p33, supernatant.
Figure25 depicts the analysis of RNA hydrolysis from Qβ VLPs by RNase A under low and high ionic strength on a 1% agarose gel stained with ethidium bromide (A, C) and Coomassie Blue (B, D). Loaded on the gel are the following samples: (A, B) 1. MBI Fermentas lkb DNA ladder; 2. Qβ VLP untreated; 3. Qβ VLP treated with RNase A inlx HBS buffer pH7.2. (C, D) 1. MBI Fermentas lkb DNA ladder; 2. Qβ VLP untreated; 3. Qβ VLP treated with RNase A in 0.2 x HBS buffer pH7.2.
Figure26 depicts the analysis of B-CpG packaging into Qβ VLPs under low and high ionic strength on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are the following samples: 1. Qβ VLP untreated; 2. Qβ VLP treated with RNase A; 3. Qβ VLP freated with RNase A and packaged with B-CpG in 0.2x HBS buffer pH7.2 and treated with Benzonase; 4. HBx33 VLP freated with RNase A, packaged with B-CpG in lx HBS buffer pH7.2 and treated with Benzonase.
Figure 27 depicts the analysis of B-CpGpt packaging into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide (A) and Coomassie Blue (B). Loaded on the gel are 50 μg of the following samples: 1. Qbx33 VLP untreated; 2. Qbx33 VLP treated with RNase A; 3. Qbx33 VLP treated with RNase A and packaged with B-CpGpt; 4. Qbx33 VLP treated with RNase A, packaged with B-CpGpt, treated with DNasel and dialysed; 5. 1 kb MBI Fermentas DNA ladder. (C) depicts the analysis of the amount of packaged oligo extracted from the VLP on a 15% TBE/urea stained with CYBR Gold. Loaded on gel are the following samples: 1. BCpGpt oligo content of 2 μg Qbx33 VLP after proteinase K digestion and RNase A treatment; 2. 20 pmol BCpGpt control; 3. 10 pmol BCpGpt confrol; 4. 5 pmol BCpGpt confrol
Figure 27 D and E depict the analysis of glOgacga-PO packaging into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide (D) and Coomassie Blue (E). Loaded on the gel are 15 μg of the following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP freated with RNase A and packaged with glOgacga-PO; 5. Qbx33 VLP treated with RNase A, packaged with glOgacga-PO, treated with Benzonase and dialysed.
Figure27 E and F depict the analysis of dsCyCpG-253 packaging into Qbx33 VLPs on a 1% agarose gel stained with ethidium bromide (E) and Coomassie Blue (F). Loaded on the gel are 15 μg of the following samples: 1. MBI Fermentas 1 kb DNA ladder; 2. Qbx33 VLP untreated; 3. Qbx33 VLP treated with RNase A; 4. Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253 and treated with DNasel; 5. Qbx33 VLP treated with RNase A, packaged with dsCyCpG-253, treated with DNasel and dialysed.
Example 14
Qβ Disassembly Reassembly and Packaging of Immunostimulatory Nucleic
Acids.
Disassembly and Reassembly ofQβ VLP
Disassembly: 70 mg of pure lyophilized Qβ VLP gave a protein content of about 35 mg, according to spectrophotometric determination using the average result obtained with the following three formulae: 1. (183 * OD230 nm - 75.8 * OD260 nm) * volume (ml) - 2. ((OD235 nm - OD280 nm)/2.51) x volume - 3. ((OD228 5 nm - OD2345 nm) * 0.37) x volume. The pure lyophilized Qβ VLP was solubilized in 7 ml of 6 M GuHCl and incubated overnight at 4°C. The solution was clarified for 15 minutes, at 6000 φm (Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the following steps). A negligible sediment was discarded, and the supernatant was dialysed 5 X against 200-300 ml NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) over 3 days. Alternatively, the supernatant was dialyzed in a continuous mode against 1.5 1 NET buffer over 3-4 days. The resulting suspension was centrifuged at 12000 φm for 20 minutes. The pellet was resolubilized in 2-3 ml 8 M urea, while the supernatant was precipitated with solid ammonium sulphate at 60% saturation. A saturated ammonium sulphate solution was added to the pellet previously resolubilized in urea to 60% saturation, and the solution was left to precipitate 4 days at 4°C, with subsequent centrifugation at 12000 φm for 20 minutes. This pellet, and the pellet of the initial supernatant were resolubilized and joined in a total volume of 3 ml of 7 M urea, 10 mM DTT. This material was loaded on a Sephadex G75 column, eluted at 2 ml/h with 7 M urea, 10 mM DTT. Two peaks were isolated. A high molecular weight peak preceded a peak of lower apparent molecular weight. Calibration of the column with chymotrypsin in the same elution buffer revealed that the apparent molecular weight of the second peak is consistent with Qβ coat protein being in a dimeric form. Fractions containing this dimer material were pooled and precipitated with ammonium sulphate (2 days, at 4°C). The pellet was washed with a few droplets of water, centrifuged again, and solubilized in 2 ml of 7 M urea, 10 mM DTT. This material was then purified on a short (1.5 X 27 cm) Sepharose 4B column. One peak eluted from the column and the fractions were pooled, leading to a protein preparation with a volume of 10 ml, and a ratio of absorbance at 280 nm vs. 260 nm of 0.68/0.5, yielding about 450 nmol of Qβ coat protein (giving a maximum of 2.5 nmol VLP after reassembly, considering that there are 180 subunits in the VLP) and a protein concentration of 630 μg/ml (calculated using the spectrophotometric methods described above). Reassembly: β-mercaptoethanol was added to the 10 ml dimer fraction to a final concentration of 10%, and 300 μl of a solution of (CpG)20OpA oligodeoxynucleotide, containing 12.3 nmol of oligonucleotide, were added. The reassembly mixture was first dialyzed against 30 ml NET buffer containing 10% beta-mercaptoethanol for 2 hours at 4°C, and then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 4 days at 4°C. The reassembly mixture was then desalted against water by dialysis, with 6 buffer exchanges (4 X 100 ml, 2 X 1 liter).
The ratio of absorbance at 280 nm vs. 260 nm was of 0.167/0.24. The protein was dried by lyophilization. The dried protein was resolubilized in water and purified by ultracentrifugation on a sucrose gradient in a Beckman L 8-80 centrifuge, with the SW 50.1 rotor at 22 000 φm, for 17h at +4°C. The sucrose gradient purification was performed as follows. 5 layers of 1 ml of the following sucrose concentrations (w/v) were dispensed into a centrifuge tube: 50%, 43%, 36%, 29%o and 22%. The so formed succession of layers was left standing overnight at 4°C. 0.5 ml of the protein sample was layered on the gradient, and centrifuged for 17 h as indicated above. The gradient was eluted from the bottom of the centrifuge tube, and the 5 ml of the gradient were divided in 16 fractions of approximatively 300 μl. The fractions in the gradient were analyzed by SDS-PAGE (Figure 28) and Ouchterlony assay. Fractions 6- 9 contained Qβ coat protein and gave the precipitation band typical of Qβ VLP in an Ouchterlony assay. Fractions 11-15, with a lower apparent density and containing Qβ protein gave no capsid band in the Ouchterlony assay. The reassembled Qβ had the same apparent density as wt Qβ within experimental enor. The fractions 6-9 of the sucrose gradient were pooled, dialyzed against water and lyophilized. This material was then resolubilized for electron microscopy (EM) analysis (Figure 29) and Ouchterlony assay (Figure 30 A and B). The EM procedure was as follows: A suspension of the proteins was absorbed on carbon-formvar coated grids and stained with 2% phosphotungstic acid (pH 6,8). The grids were examined with a JEM 100C (JEOL,Japan) electron microscope at an accelerating voltage of 80 kV. Photographic records (negatives) were performed on Kodak electron image film and electron micrographs were obtained by printing of negatives on Kodak Polymax paper. Both methods indicate that the reassembled VLPs have the same macromolecular properties as intact Qβ VLP. In addition, the pattern of disulfide bonds displayed by the purified reassembled Qβ VLP is indistinguishable from the disulfide bond pattern displayed by the untreated Qβ VLP, with the typical pattern of pentamers and hexamers (Figure 31 A).
Analysis of nucleic acid content: Reassembled Qβ VLP was digested with pancreatic DNAse I as follows. To 200 μl of a 0.5 mg/ml solution of Qβ VLP reassembled with (CpG)20OpA oligodeoxynucleotide were added 20 μl of a 1 U/μl DNAse I (Fluka) solution, and 22 μl of DNAse I buffer (20 mM MgCl , 200 mM Tris, pH 8.3). The reaction mixture was incubated for 2h30 min. at 37°C. The nucleic acid content of the sample was subsequently isolated by phenol/chloroform extraction, and loaded on a 2 % agarose gel stained with ethidium bromide (Figure 3 IB). A band of the size of the packaged oligodeoxynucleotide was detected on the gel. A band migrating at a higher apparent molecular weight was also visible. We cannot exclude the presence of multimers of the (CpG) 0OpA oligodeoxynucleotide which would lead to a band at this height. The gel thus shows that DNAse I protected oligodeoxynucleotides of the right size were present in the reassembled Qβ VLP, since the oligodeoxynuleotides could subsequently be digested by DNAse I, but not by RNAse A. Oligodeoxynucleotides could thus be successfully packaged in Qβ VLP after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLP in the presence of oligodeoxynucleotide.
Figure 28 shows the SDS-PAGE analysis of the fractions from the sucrose gradient centrifugation. Loaded on the gels were the following samples. Lane 1 - 10: fractions 6-15 of the sucrose gradient ultracentrifugation . Figure 29 shows the EM pictures of (A) intact Qβ VLP and (B) Qβ VLP after disassembly and reassembly in the presence of oligonucleotide (CpG) 0OpA, and subsequent purification by sucrose gradient ulfra- centrifugation. A dense overlay of capsids is observed, and those capsids display the same structural features and properties as the intact Qβ VLPs.
Figure 30 shows the Ouchterlony analysis (immunodiffusion) of the reconstructed Qβ VLP. In Figure 30 A, Qβ VLP reassembled with oligonucleotide (CpG)20OpA was loaded next to intact Qβ VLP. The two characteristic precipitation bands are indicated by black anows. The two precipitation bands are concunent, indicating that the reassembled Qβ VLP diffuse as the intact Qβ VLP. In Figure 30 B, sample 1 is Qβ VLP reassembled in the presence of ribosomal RNA, while sample 2 is intact Qβ VLP and sample 3 is Qβ VLP reassembled with oligonucleotide (CpG)20OpA. The precipitation bands are indicated by white anows.
Figure 31 A shows the analysis of the untreated and reassembled Qβ VLP by non-reducing SDS-PAGE. The pentamers and hexamers of Qβ VLP are indicated by arrows.
Figure 31 B shows the agarose gel electrophoresis analysis of the nucleotide content extracted after DNAse I digestion of Qβ VLP reassembled with oligonucleotide (CpG)20OpA. The nucleic acid content was either untreated (lane 1), or subsequently digested with DNAse I (lane2) or RNAse A (lane 3); 33 μg of reassembled Qβ VLP were loaded on each lane. 300 ng of a 50 bp oligonucleotide were loaded on lane 4, while 10 μl of the GeneRuler 100 bp DNA ladder + marker (MBI Fermentas) was loaded on lane 5. Example 15
Qβ Disassembly Reassembly with different immunostimulatory nucleic acids.
Disassembly and Reassembly of Qβ VLP with oligodeoxynucleotides of various sequences
The disassembly of Qβ VLP was performed essentially as described in Example 1 , but for the use of 8 M urea instead of 7 M urea to resuspend the ammonium sulphate pellets.
The reassembly of Qβ VLP with the oligos CyOpA, CyCyCy, (CpG)20-OpA and CyCpG was performed essentially as described in Example 1, but for the following variations. A dialysis step against 10 % β- mercaptoethanol in NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) for 1 hour at 4 °C was added to the procedure before addition of the oligodeoxynucleotide solution to the dimer solution in the dialysis bag. The oligodeoxynucleotides were then added to the dimer solutions, resulting approx. in a ten-fold molar excess of oligonucleotide to capsid (180 subunits) as described previously. The reassembly mixture was first dialyzed against 30 ml NET buffer containing 10% -mercaptoethanol for 1 hours at 4°C, and then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 4 days at 4°C. A sample of the reassembly reaction of Qβ VLP with oligodeoxynucleotide CyOpA was taken for EM analysis (Figure 32) at the end of the reassembly reaction. The EM procedure using phosphotungstic acid and described above was used. The reassembly mixtures were then desalted against water by dialysis and dried.
The dried protein was resolubilized in water and purified by ultracentrifugation on a sucrose gradient. The purified reassembled Qβ VLPs were also analyzed by EM (Figure 33 A-D). The electron micrographs indicate that the reassembled VLPs have the same macromolecular properties as intact Qβ VLP. Purification notably enriches the preparations for reassembled particles. Thus, Qβ VLP was successfully reassembled with oligodeoxynucleotides of various lengths and sequences.
Coupling of the p33 peptide to reassembled Qβ VLP: Qβ VLP reassembled with the oligodeoxynucleotide CyOpA was reacted at a concenfration of 1.5 mg/ml, with the cross-linker SMPH diluted from a stock solution in DMSO at a final concentration of cross-linker of 536 μM for 35 minutes at 26°C in 20 mM Hepes pH 7.4. The derivatized Qβ VLP was dialyzed 2 X 2 hours against a thousand volumes of 20 mM Hepes, 150 mM NaCl, pH 7.4. The dialysed derivatized Qβ VLP at a concentration of 1.4 mg/ml was subsequently reacted with the p33GGC peptide (sequence: KAVYNFATMGGC) at a final concentration of peptide of 250 μM for 2 hours at 15°C in 20 mM Hepes, 150 mM NaCl, pH 7.4. The gel of Figure 34 indicates successful coupling of the p33 peptide to Qβ VLP. Coupling bands conesponding to one, respectively two peptides coupled per subunit are indicated by an anow in the Figure.
Analysis of nucleic acid content: The nucleic acid content of reassembled and coupled Qβ VLP was analysed by proteinase K digestion, phenol cloroform extraction and subsequent loading of the extracted oligonucleotide on a TBE/Urea PAGE gel. The analysis procedure was as follows. 25 μl reassembled Qβ VLP (0.5-1 mg/ml) were supplemented with 0.5 μl proteinase K, 1.5 μl 10% SDS and 3 μl lOx proteinase buffer (0.5 M NaCl, 50 mM EDTA, 0.1 M Tris pH7.4). After incubation overnight at 37°C, proteinase K was inactivated by heating 20 min at 65 °C and the nucleic acid content was exfracted from the samples by lx phenol and lx chloroform extraction. Subsequently the samples were incubated 2 h at 37°C with 1 μl RNAseA (Qiagen, 100 μg/ml, diluted 250x). The equivalent of 2 μg starting protein was heated 3 min at 95 °C with 1 volume of 2x loading buffer (1ml lOxTBE, 4.2 g Urea, 1.2 g Ficoll, 1 ml 0.1%Bromophenolblue, H2O up to 10 ml) and loaded on a 15% TBE/Urea polyacrylamide gel (Invitrogen). The gel was run for 1.5 h at 180 V, and fixed in 10% acetic acid/20% ethanol and stained with CYBR Gold (Molecular Probes, Eugene ,OR, USA). For quantification, 10 and 20 pmol of the oligonucleotide used for the reassembly were applied on the gel as a reference. Resistance of the nucleic acid content to RNAse and its size proved that the packaged nucleic acid was the oligonucleotide used for reassembly. Quantification of the packaged oligodeoxynucleotide was performed by comparison of the band intensity of the extracted oligonucleotide with the band intensity of a reference amount of the same oligonucleotide loaded on the same gel. A figure of 1.75 nmol CyOpA/ 100 μg Qβ VLP was obtained, giving a ratio of 44 oligonucleotides per VLP on average.
Figure 32 depicts the electron micrographs of the reassembly reaction of Qβ VLP with the oligonucleotide CyOpA before purification. The magnification was 200 000 fold.
Figure 33 A-D show the electron micrographs of the purified reassembly reactions of Qβ VLP with the oligodeoxynucleotides Cy(CpG)20 (A), CyCyCy (B), CyCpG (C) and CyOpA (D). The magnification was 200 000 fold.
Figure 34 depicts the SDS-PAGE analysis of the coupling of Qβ VLP reassembled with the oligodeoxynucleotide CyOpA to the p33GGC peptide. Loaded on the gel were the following samples: 1. Prestained Protein Marker, Broad Range (# 7708S) 10 μl; 2. Qβ VLP reassembled with CyOpA [1.5 mg/ml] 10 μl; 3. Qβ VLP reassembled with CyOpA [1.5 mg/ml] and derivatized with SMPH 10 μl; 4. Qβ VLP reassembled with CyOpA [1.5 mg/ml], derivatized with SMPH and coupled with p33-peptide 10 μl; 5. Qβ VLP reassembled with CyOpA [1.5 mg/ml], derivatized with SMPH and coupled with p33-peptide, l/5th vol of the pellet.
Figure 35 depicts the analysis of the extracted packaged oligodeoxynucleotides by Urea Polyacrylamide gel electrophoresis, stained with CYBR Gold. The following samples were loaded on the gel: 1. Qβ VLP reassembled with oligonucleotide CyOpA and coupled to p33 GGC peptide, 2 μg protein loaded on the gel. 2. Qβ VLP reassembled with oligonucleotide CyOpA and coupled to p33GGC peptide, frozen and thawed before loading on the gel, 2 μg protein. 3. Qβ VLP reassembled with oligonucleotide Cy(CpG) 0 and coupled to p33GGC peptide, frozen and thawed before loading on the gel;2 μg protein. 4. CyOpA oligonucleotide, 20 pmol. 5. CyOpA oligonucleotide, 10 pmol.
Example 16
Qβ Disassembly Reassembly and Packaging.
Disassembly and Reassembly ofQβ VLP
Disassembly: 10 mg Qβ VLP (as determined by Bradford analysis) in 20 mM HEPES, pH 7.4, 150 mM NaCl was precipitated with solid ammonium sulfate at a final saturation of 60%. Precipitation was performed over night at 4°C and precipitated VLPs were sedimented by centrifugation for 60 minutes at 4°C (SS-34 rotor). Pellets were resuspended in 1 ml of 6 M Guanidine hydrochloride (GuHCl) containing 100 mM DTT (final concentration) and incubated for 8 h at 4°C.
Purification ofQβ coat protein by size exclusion chromatography: The solution was clarified for 10 minutes at 14000 φm (Eppendorf 5417 R, in fixed angle rotor F45-30-11, used in all the following steps) and dialysed against a buffer containing 7 M urea, 100 mM TrisHCl, pH 8.0, 10 mM DTT (2000 ml) over night. Dialysis buffer was exchanged once and dialysis continued for another 2 h. The resulting suspension was centrifuged at 14 000 φm for 10 minutes at 4°C. A negligible sediment was discarded, and the supernatant was kept as "load fraction" containing dissasembled coat protein and RNA. Protein concentration was determined by Bradford analysis and 5mg total protein was applied onto a HiLoad™ Superdex™ 75 prep grade column (26/60, Amersham Biosciences) equilibrated with 7 M urea, 100 mM TrisHCl and 10 mM DTT. Size exclusion chromatography was performed with the equilibration buffer (7 M urea, 100 mM TrisHCl pH 8.0, 10 mM DTT) at 12°C with a flow-rate of 0.5 ml/min. During the elution absorbance at 254 nm and 280 nm was monitored. Two peaks were isolated. A high molecular weight peak preceded a peak of lower apparent molecular weight. Peaks were collected in fractions of 1.5 ml and aliquots were analysed by SDS-PAGE followed by Coomassie staining as well as SYBR®Gold staining (Figure 36).
Purification of Qβ coat protein by ion exchange chromatography: Alternatively, the clearified supernatant was dialysed against a buffer containing 7 M urea, 20 mM MES, 10 mM DTT, pH 6.0 (2000 ml) over night. Dialysis buffer was exchanged once and dialysis continued for another 2 h. The resulting suspension was centrifuged at 14 000 φm for 10 minutes at 4°C. A negligible sediment was discarded, and the supernatant was kept as "load fraction" containing disassembled coat protein and RNA. Protein concentration was determined by Bradford analysis and 10 mg total protein was diluted to a final volume of 10 ml with buffer A (see below) and applied with a flowrate of 1 ml/min to a 1 ml HiTrap™ SP HP column (Amersham Biosciences, Cat. No. 17-1151-01 ) equilibrated with buffer A: 7 M urea, 20 mM MES, 10 mM DTT, pH 6.0. The flowthrough which contained the RNA was collected as one fraction. After the column was extensively washed with buffer A (30 CV) the bound Qβ coat protein was eluted in a linear gradient from 0% - 100% buffer B (gradient length was 5 CV; buffer A: see above, buffer B: 7 M urea, 20 mM MES, 10 mM DTT, 2 M NaCl, pH 6.0). During the loading, wash and elution the absorbance at 254 nm and 280 nm was monitored. Peak fractions of 1 ml were collected and analysed by SDS-PAGE followed by Coomassie staining as well as SYBR®Gold staining. Fractions containing the Qβ coat protein but not the RNA were identified and the pH was adjusted by addition of 100 μl 1 M TrisHCl, pH 8.0.
Samples containing the Qβ coat protein but no RNA were pooled and dialysed against 0.87 M urea, 100 mM TrisHCl, 10 mM DTT (2000 ml) over night and buffer was exchanged once and dialysis continued for another 2 h. The resulting suspension was centrifuged at 14 000 φm for 10 minutes at 4°C. A negligible sediment was discarded, and the supernatant was kept as "disassembled coat protein". Protein concentration was determined by Bradford analysis.
Reassembly: Purified Qβ coat protein with a concentration of 0.5 mg/ml was used for the reassembly of VLPs in the presence of an oligodeoxynucleotide. For the reassembly reaction the oligodeoxynucleotide was used in a tenfold excess over the calculated theoretical amount of Q -VLP capsids (monomer concentration divided by 180). After the Qβ coat protein was mixed with the oligodeoxynucleotide to be packaged during the reassembly reaction, this solution (volume up to 5 ml) was first dialysed for 2 h against 500 ml NET buffer containing 10% 3-mercaptoethanol at 4°C, then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 72 h at 4°C, and finally for another 72 h with the same continous mode with a buffer composed of 20 mM TrisHCl pH 8.0, 150 mM NaCl. The resulting suspension was centrifuged at 14 000 φm for 10 minutes at 4°C. A negligible sediment was discarded, and the supernatant contained the reassembled and packaged VLPs. Protein concentration was determined by Bradford analysis and if needed reassembled and packaged VLPs were concentrated with centrifugal filter devices (Millipore, UFV4BCC25, 5K NMWL) to a final proteinconcentration of 3 mg/ml.
Purification of reassembled and packaged VLPs: Up to 10 mg total protein was loaded onto a Sepharose™ CL-4B column (16/70, Amersham Biosciences) equilibrated with 20 mM HEPES pH 7.4, 150 mM NaCl. Size exclusion chromatography was performed with the equilibration buffer (20 mM HEPES pH 7.4, 150 mM NaCl) at room temperature with a flow-rate of 0.4 ml/min. During the elution absorbance at 254 nm and 280 nm was monitored. Two peaks were isolated. A high molecular weight peak preceded a peak of lower apparent molecular weight. Fractions of 0.5 ml were collected and analysed by SDS-PAGE followed by Coomassie blue staining (Figure 37). Calibration of the column with intact and highly purified Qβ capsids from E.coli revealed that the apparent molecular weight of the major first peak was consistent with Qβ capsids. Analysis of Qβ VLPs which had been reassembled in the presence of oligodeoxynucleotides:
A) Overall structure of the capsids: Qβ VLPs that were reassembled either in the presence of one of the following oligodeoxynucleotides (CyOpA, Cy(CpG)20OpA, Cy(CpG)20, CyCyCy, (CpG)20OpA), or in the presence of tRNA from E.coli (Roche Molecular Biochemicals, Cat. No. 109541) were analyzed by electron microscopy (negative staining with uranylacetate pH 4.5) and compared to intact Qβ VLPs purified from E.coli. As a negative control served a reassembly reaction where nucleic acid was omitted. Reassembled capsids display the same structural features and properties as the intact Qβ VLPs (Figure 38).
B) Hydrodynamic size of reassembled capsids: Qβ capsids which had been reassembled in the presence of oligodeoxynucleotides were analyzed by dynamic light scattering (DLS) and compared to intact Qβ VLPs which had been purified from E.co/t.Reassembled capsids showed the same hydrodynamic size (which depends both on mass and conformation) as the intact Qβ VLPs.
C) Disulfide-bond formation in reassembled capsids: Reassembled Qβ VLPs were analyzed by native polyacrylamid gelelectrophoresis and compared to intact Qβ VLPs which had been purified from E.coli. Reassembled capsids displayed the same disulfide-bond pattern as the intact Qβ VLPs (Figure 39).
D) Analysis of nucleic acid content of the Qβ VLPs which had been reassembled in the presence of oligodeoxynucleotides by agarose gelelectrophoresis: 5 μg reassembled Qβ VLPs were incubated in total reaction volume of 25 μl either with 0.35 units RNase A (Qiagen, Cat. No. 19101), 15 units DNAse I (Fluka, Cat. No. 31136), or without any further addition of enzymes for 3 h at 37°C. Intact Qβ VLPs which had been purified from E.coli served as control and were incubated under the same conditions as described for the capsids which had been reassembled in the presence of oligodeoxynucleotides. The reactions were then loaded on a 0.8% agarose gel that was first stained with ethidumbromide (Figure 40A) and subsequently with Coomassie blue (Figure 40B). The ethidium bromide stain shows, that none of the added enzymes could digest the nucleic acid content in the reassembled Qβ capsids showing that the nucleic acid content (i.e. the oligodeoxynucleotides) is protected. This result indicates that the added oligodeoxynucleotides were packaged into the newly formed capsids during the reassembly reaction. In contrast, the nucleic acid content in the intact Qβ VLPs which had been purified from E.coli was degraded upon addition of RNase A, indicating that the nucleic acid content in this VLPs consists of RNA. In addition, both the ethidium bromide stain and the Coomasie blue stain of the agarose gel shows that the nucleic acid containing Qβ VLPs (reassembled and purified from E.coli, respectively) are migrating at about the same size, which indicates that the reassembly reaction led to Qβ VLPs of comparable size to intact Qβ VLPs which had been purified from E.coli.
The gel thus shows that DNAse I protected oligodeoxynucleotides were present in the reassembled Qβ VLP. Furthermore, after the packaged oligodeoxynuleotides had been extracted by phenol/chloroform they were digestable by DNAse I, but not by RNAse A. Oligodeoxynucleotides could thus be successfully packaged into Qβ VLPs after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLPs in the presence of oligodeoxynucleotides. Analysis of nucleic acid content of the Qβ VLPs which had been reassembled in the presence of oligodeoxynucleotides by denaturing polyacrylamide TBE-Urea gelelectrophoresis: 40 μg reassembled Qβ VLPs (0.8 mg/ml) were incubated in a total reaction volume of 60 μl with 0.5 mg/ml proteinase K (PCR-grade, Roche Molecular Biochemicals, Cat. No. 1964364) and a reaction buffer according to the manufacturers instructions for 3 h at 37°C. Intact Qβ VLPs which had been purified from E.coli served as control and were incubated with proteinase K under the same conditions as described for the capsids which had been reassembled in the presence of oligodeoxynucleotides. The reactions were then mixed with a TBE- Urea sample buffer and loaded on a 15% polyacrylamide TBE-Urea gel (Novex®, Invitrogen Cat. No. EC6885). As a qualitative as well as quantitative standard, 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembling reaction, were loaded onto the same gel. This gel was fixed with 10% acetic acid, 20% methanol, equilibrated to neutral pH and stained with SYBR®-Gold (Molecular Probes Cat. No. S-11494). The SYBR®-Gold stain showed (Figure 41), that the reassembled Qβ capsids contained nucleic acid comigrating with the oligodeoxynucleotides which were used in the reassembly reaction. Note that intact Qβ VLPs (which had been purified from E.coli) did not contain a nucleic acid of similar size. Taken together, analysis of the nucleic acid content of the Qβ VLPs which had been reassembled in the presence of oligodeoxynucleotides showed that oligodeoxynucleotides were protected from DNase I digestion, meaning that they were packaged) and that the added oligodeoxynucleotides could be reisolated by proper means (e.g. proteinase K digestion of the Qβ VLP). Figure 36 shows the purification of disassembled Qβ coat protein by size exclusion chromatography. 5 μl of the indicated fractions (#) were mixed with sample buffer and loaded onto 16% Tris-Glycine gels (Novex® by Invitrogen, Cat. No. EC64952). After the run was completed the gels were stained first with Coomassie blue (A) and after documentation the same gels were stained with SYBR®-Gold (B). Note that the first high molecular weight peak (fractions #15 - #20) contained no protein but nucleic acids. On the other hand, the second peak of lower apparent molecular weight contained disassembled coat protein which was thereby separated from the nucleic acids.
Figure 37 shows the purification of reassembled Qβ VLPs by size exclusion chromatography.
10 μl of the indicated fractions (#) were mixed with sample buffer and loaded onto a 16% Tris-Glycine gel (Novex® by Invitrogen, Cat. No. EC64952). After the run was completed the gel was stained with Coomassie blue. Due to the reducing conditions, disulfide bonds were reduced and the proteinaceous monomer of the reassembled VLPs is visible as 14 kDa coat protein.
Figure 38 shows electron micrographs of Qβ VLPs that were reassembled in the presence of different oligodeoxynucleotides. The VLPs had been reassembled in the presence of the indicated oligodeoxynucleotides or in the presence of tRNA but had not been purified to a homogenous suspension by size exclusion chromatography. As positive confrol served preparation of "intact" Qβ VLPs which had been purified from E.coli. Importantly, by adding any of the indicated nucleic acids during the reassembly reaction, VLPs of the conect size and conformation could be formed, when compared to the "positive" control. This implicates that the reassembly process in general is independent of the nucleotide sequence and the length of the used oligodeoxynucleotides. Note that adding of nucleic acids during the reassembly reaction is required for the formation of Qβ VLPs, since no particles had been formed if nucleic acids were omitted from the reassembly reaction.
Figure 39 shows the analysis of the disulfide-bond pattern in reassembled and purified Qβ capsids. 5 μg of the indicated capsids were mixed with sample buffer that either contained a reducing agent or not and loaded onto a 16% Tris-Glycine gel. After the run was completed the gel was stained with Coomassie blue. When compared to "intact" capsids purified from E.coli, the reassembled Qβ VLPs displayed the same disulfide bond pattern.
Figure 40 shows the analysis of nucleic acid content of the reassembled Qβ VLPs by nuclease treatment and agarose gelelectrophoresis: 5 μg of reassembled and purified Qβ VLPs and 5 μg of Qβ VLPs which had been purified from E.coli, respectively, were treated as indicated. After this treatment, samples were mixed with loading dye and loaded onto a 0.8% agarose gel. After the run the gel was stained first with ethidum bromide (A) and after documentation the same gel was stained with Coomassie blue (B). Note that the nucleic acid content of the reassembled and purified Qβ VLPs were resistant towards RNase A digestion while the nucleic acid content of Qβ VLPs purified from E.coli was digested upon incubation with RNase A. This indicates that the nucleic acid content of the reassembled Qβ capsids consists out of deoxynucleotides which of course are protected from RNase A digestion. Hence, oligodeoxynucleotides were packaged into Qβ VLPs during the reassembly reaction.
Figure 41 shows the analysis of nucleic acid content of the reassembled Qβ VLPs by proteinase K treatment and polyacrylamide TBE/Urea gelelectrophoresis: The equivalent of 1 ug Qβ VLPs which had been digested by proteinase K-treatment was mixed with a TBE-Urea sample buffer and loaded on a 15% polyacrylamide TBE-Urea gel (Novex®, Invitrogen Cat. No. EC6885). As qualitative as well as quantitative standard, 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembly reaction, was loaded onto the same gel. After the run was completed, the gel was fixed, equilibrated to neutral pH and stained with SYBR®-Gold (Molecular Probes Cat. No. S-l 1494). Note that intact Qβ VLPs (which had been purified from E.coli) did not contain nucleic acids of similar size than those which had been extracted from reassembled Qβ capsids. In addition, nucleic acids isolated from reassembled VLPs were comigrating with the oligodeoxynucleotides which had been used in the reassembly reaction. This results confirmed that the used oligodeoxynucleotides were packaged into reassembled Qβ capsids. Example 17
AP205 Disassembly-Purification-Reassembly and Packaging of immunostimulatory nucleic acids.
A. Disassembly and Reassembly ofAP205 VLP from material able to reassemble without addition of oligonucleotide
Disassembly: 40 mg of lyophilized purified AP205 VLP were resolubilized in 4 ml 6 M GuHCl, and incubated overnight at 4°C. The disassembly mixture was centrifuged at 8000 φm (Eppendorf 5810 R, in fixed angle rotor F34-6-38, used in all the following steps). The pellet was resolubilized in 7 M urea, while the supernatant was dialyzed 3 days against NET buffer (20 mM Tris-HCl, pH 7.8 with 5mM EDTA and 150 mM NaCl) with 3 changes of buffer. Alternatively, dialysis was conducted in continuous mode over 4 days. The dialyzed solution was centrifuged at 8000 φm for 20 minutes, and the pellet was resolubilized in 7 M urea, while the supernatant was pelletted with ammonium sulphate (60% saturation), and resolubilized in a 7 M urea buffer containing 10 mM DTT. The previous pellets all resolubilized in 7 M urea were joined, and precipitated with ammonium sulphate (60% saturation), and resolubilized in a 7 M urea buffer containing 10 mM DTT. The materials resolubilized in the 7 M urea buffer containing 10 mM DTT were joined and loaded on a Sephadex G75 column equilibrated and eluted with the 7 M urea buffer containing 10 mM DTT at 2ml/h. One peak eluted from the column. Fractions of 3 ml were collected. The peak fractions containing AP205 coat protein were pooled and precipitated with ammonium sulphate (60% saturation). The pellet was isolated by centrifugation at 8000 φm, for 20 minutes. It was resolubilized in 7 M urea, 10 mM DTT, and loaded on a short Sepharose 4B column (1.5 X 27 cm Sepharose 4B, 2 ml/h, 7 M urea, 10 mM DTT as elution buffer). Mainly one peak, with a small shoulder eluted from the column. The fractions containing the AP205 coat protein were identified by SDS-PAGE, and pooled, excluding the shoulder. This yielded a sample of 10.3 ml. The protein concentration was estimated spectrophotometrically by measuring an aliquot of protein diluted 25-fold for the measurement, using the following formula: (1.55 x OD280 - 0.76 x OD260) x volume. The average concentration was of 1 nmol ml of VLP (2.6 mg/ml). The ratio of absorbance at 280 nm vs. 260 nm was of 0.12/0.105.
Reassembly: 1.1 ml beta-mercaptoethanol was added to the sample, and the following reassembly reactions were set up:
1. 1 ml of AP205 coat protein, no nucleic acids
2. 1 ml of AP205 coat protein, rRNA (approx. 200 OD260 units, 10 nmol)
3. 9 ml of AP205 coat protein, CyCpG (370 ul of 225 pmol/μl solution, i.e. 83 nmol).
These mixtures were dialyzed 1 hour against 30 ml of NET buffer containing 10% beta-mercaptoethanol. The mixture containing no nucleic acids was dialyzed separately. The dialysis was then pursued in a continuous mode, and 1 1 of NET buffer was exchanged over 3 days. The reaction mixtures were subsequently extensively dialyzed against water (5 changes of buffer), and lyophilized. They were resolubilized in water, and analyzed by EM. All mixtures contained capsids, showing that AP205 VLP reassembly is independent of the presence of detectable nucleic acids, as measured by agarose gel electrophoresis using ethidium bromide staining. The EM analysis of AP205 reassembled with CyCpG is shown on Figure 42B. The EM procedure was as follows: A suspension of the proteins was absorbed on carbon-formvar coated grids and stained with 2% phosphotungstic acid (pH 6,8). The grids were examined with a JEM 100C (JEOL, Japan) electron microscope at an accelerating voltage of 80 kV. Photographic records (negatives) were performed on Kodak electron image film and electron micrographs were obtained by printing of negatives on Kodak Polymax paper.The VLP reassembled in the presence of the CyCpG was purified over a Sepharose 4B column (1 X 50 cm), eluted with NET buffer (1 ml/h). The fractions were analyzed by Ouchterlony assay, and the fractions containing VLP were pooled. This resulted in a sample of 8 ml, which was desalted against water by dialysis, and dried. The yield of capsid was of 10 mg. Analysis of resolubilized material in a 0.6% agarose gel stained with ethidium- bromide showed that the capsids were empty of nucleic acids. Samples of the reassembly reaction containing CyCpG taken after the reassembly step and before extensive dialysis were analysed on a 0.6% agarose gel and are shown in Figure 43 A and B. A band migrating at the same height than intact AP205 VLP and staining both for ethidium-bromide and Coomassie blue staining could be obtained, showing that AP205 VLP containing oligodeoxynucleotide had been reassembled. The extensive dialysis steps following the reassembly procedure are likely to have led to diffusion of the oligodeoxynucleotide outside of the VLPs. Significantly, the AP205 VLPs could also be reassembled in the absence of detectable oligodeoxynucleotide, as measured by agarose gel electrophoresis using ethidium bromide staining. Oligodeoxynucleotides could thus be successfully bound to AP205 VLP after initial disassembly of the VLP, purification of the disassembled coat protein from nucleic acids and subsequent reassembly of the VLP in the presence of oligodeoxynucleotide.
Figure 42 shows electron micrographs of either intact recombinant AP205 VLP used for the disassembly step (A), or AP205 VLP disassembled, and subsequently reassembled in the presence of CyCpG (B).
Figure 43 shows the agarose gel-electrophoresis analysis of the AP205 VLP sample reassembled in the presence of CyCpG, and taken directly after the reassembly step before dialysis. The gel on Figure 43A was stained with ethidium-bromide. AP205 VLP reassembled with CyCpG was loaded on lanel, while untreated pure AP205 VLP was loaded on lane 2. The arrow indicates the band of the reassembled AP205 VLP. The gel on Figure 43 B was stained with Coomassie-brillant blue. Untreated AP205 VLP was loaded on lane 1, while AP205 VLP reassembled with CyCpG was loaded on on lane 2. B. Reassembly of AP205 VLP using disassembled material which does not reassemble in the absence of added oligonucleotide
Disassembly: 100 mg of purified and dried recombinant AP205 VLP (Cytos patent) were used for disassembly as described above. All steps were performed essentially as described under disassembly in part A, but for the use of 8 M urea to solublize the pellets of the ammonium sulphate precipitation steps and the omission of the gel filtration step using a CL-4B column prior to reassembly . The pooled fractions of the Sephadex G-75 column contained 21 mg of protein as determined by spectroscopy using the formula described in part A. The ratio of absorbance at 280 nm to the absorbance at 260 nm of the sample was of 0.16 to 0.125. The sample was diluted 50 times for the measurement.
Reassembly: The protein preparation resulting from the Sephadex G-75 gel filtration purification step was precipitated with ammonium sulphate at 60%) saturation, and the resulting pellet solubilized in 2 ml 7 M urea, 10 mM DTT. The sample was diluted with 8 ml of 10% 2-mercaptoethanol in NET buffer, and dialyzed for 1 hour against 40 ml of 10%> 2-mercaptoethanol in NET buffer. Reassembly was initiated by adding 0.4 ml of a CyCpG solution (109 nmol/ml) to the protein sample in the dialysis bag. Dialysis in continous mode was set up, and NET buffer used as eluting buffer. Dialysis was pursued for two days and a sample was taken for EM analysis after completion of this dialysis step (Figure 44 B). The dialyzed reassembly solution was subsequently dialyzed against 50% v/v Glycerol in NET buffer, to achieve concentration. One change of buffer was effected after one day of dialysis. The dialysis was pursued over a total of three days.
The dialyzed and concentrated reassembly solution was purified by gel filtration over a Sepharose 4-B column (1X60 cm) at a flow rate of 1 ml/hour, in NET buffer. Fractions were tested in an Ouchterlony assay, and fractions containing capsids were dried, resuspended in water, and rechromatographed on the 4-B column equilibrated in 20 mM Hepes pH 7.6. Using each of the following three formula:
1. (183 * OD230 nm - 75.8 * OD260 nm) * volume (ml) - 2. ((OD235 nm - OD280 nm)/2.51) x volume - 3. ((OD228 5 nm - OD234 5 nm) * 0.37) x volume protein amounts of 6 - 26 mg of reassembled VLP were determined.
The reassembled AP205 VLPs were analyzed by EM as described above, agarose gel electrophoresis and SDS-PAGE under non-reducing conditions.
The EM analysis of disassembled material shows that the treatment of AP205 VLP with guanidinium-chloride essentially disrupts the capsid assembly of the VLP. Reassembly of this disassembled material with an oligonucleotide yielded capsids (Figure 44B), which were purified and further enriched by gel filtration (Figure 44 C). Two sizes of particles were obtained; particles of about 25 nm diameter and smaller particles are visible in the electron micrograph of Figure 44C. No reassembly was obtained in the absence of oligonucleotides. Loading of the reassembled particles on agarose electrophoresis showed that the reassembled particles contained nucleic acids. Extraction of the nucleic acid content by phenol extraction and subsequent loading on an agarose gel stained with ethidium bromide revealed that the particles contained the oligonucleotide used for reassembly (Figure 45A). Identity of the packaged oligonucleotide was controlled by loading a sample of this oligonucleotide side to side to the nucleic acid material extracted from the particles. The agarose gel where the reassembled AP205 VLP had been loaded and previously stained with ethidium bromide was subsequently stained with Coomassie blue, revealing comigration of the oligonucleotide content with the protein content of the particles (Figure 45B), showing that the oligonucleotide had been packaged in the particles.
Loading of the reassembled AP205 VLP on an SDS-PAGE gel, run in the absence of reducing agent (Figure 46) demonstrated that the reassembled particles have formed disulfide bridges, as is the case for the untreated AP205 VLP. Moreover, the disulfide bridge pattern is identical to the untreated particles.
Depicted on Figure 44 A is an electron micrograph of the disassembled AP205 VLP protein, while Figure 44 B shows the reassembled particles before purification. Figure 3 C shows an electron micrograph of the purified reassembled AP205 VLPs. The magnigication of Figure 3 A-C is 200 000 X.
Figure 45 A and B show the reassembled AP205 VLPs analyzed by agarose gel electrophoresis. The samples loaded on the gel from both figures were, from left to right: untreated AP205 VLP, 3 samples with differing amount of AP205 VLP reassembled with CyCpG and purified, and untreated Qβ VLP. The gel on Figure 45A was stained with ethidium bromide, while the same gel was stained with Coomassie blue in Figure 45 B.
Figure 46 depicts an SDS-PAGE analysis of reassembled AP205 VLP, loaded under non-reducing conditions. 5 samples were loaded on the gel. The samples loaded on the gel are, from left to right: Protein Marker, untreated wt Qβ, reassembled wt Qβ, untreated AP205 VLP, reassembled AP205 VLP. The Molecular Weight of the AP205 VLP subunit is 14.0 kDa, while the molecular weight of the Qβ subunit is 14.3 kDa (both molecular weights calculated with the N-terminal methionine). The disulfide linked multimers are each indicated by an anow on the figure.
C. Coupling of p33 epitope (sequence: H2N-KAVYNFATMGGC-
COOH, with free N- and C- termini ) to AP205 VLPs reassembled with CyCpG
Reassembled AP205 VLP obtained as described in part B, and in 20 mM Hepes, 150 mM NaCl, pH 7.4 was reacted at a concentration of 1.4 mg/ml with a 5-fold excess of the crosslinker SMPH diluted from a 50 mM stock in DMSO for 30 minutes at 15 °C. The obtained so-called derivatized AP205 VLP was dialyzed 2 X 2 hours against at least a 1000-fold volume of 20 mM Hepes, 150 mM NaCl, pH 7.4 buffer. The derivatized AP205 was reacted at a concentration of 1 mg/ml with either a 2.5-fold, or with a 5-fold excess of peptide, diluted from a 20 mM stock in DMSO, for 2 hours at 15 °C. The sample was subsequently flash frozen in liquid nitrogen for storage.
The result of the coupling reaction is shown in Figure 6. A higher degree of coupling could be achieved by using a 5-fold excess of peptide rather than with a 2.5 fold excess of peptide in the coupling reaction.
Depicted on Figure 47 is the SDS-PAGE analysis of the coupling reaction. The following samples (from left to right) were loaded on the gel: protein marker; derivatized AP205 VLP (d); AP205 VLP coupled with a 2.5- fold excess of peptide, supernatant (s); AP205 VLP coupled with a 2.5-fold excess of peptide, pellet (p); AP205 VLP coupled with a 5-fold excess of peptide, supernatant (s); AP205 VLP coupled with a 5-fold excess of peptide, pellet (p).
Example 18
Free immunostimulatory nucleic acids but not immunostimulatory nucleic acids packaged in VLPs induce splenomegaly.
Mice were left untreated or immunized s.c. with 100 μg HBc33 alone, 20 nmol CyCpGpt, 100 μg HBc33 mixed with 20 nmol CyCpGpt, or 100 μg HBc33 packaged with CyCpGpt. Twelve days later, spleens were isolated and spleen weigths and splenic cellularity were assessed. CyCpGpt induced a massive increase in spleen weight and number of cells when given alone (Figure 48). No such effect was seen with CyCpGpt packaged in HBc33 although this composition was able to induce protection against viral challenge (see EXAMPLE 4). EXAMPLE 19
In-vivo virus protection assays.
Vaccinia protection assay
Groups of three female C57B1/6 mice were immunized s.c. with 100 μg VLP coupled or fused to p33 alone, mixed with 20 nmol immunostimulatory nucleic acid or packaged with immunostimulatory nucleic acid. To assess antiviral immunity in peripheral tissues, mice were infected 7- 9 days later, i.p., with 1.5xl06 pfu recombinant vaccinia virus expressing the LCMV- glycoprotein (inclusive of the p33 peptide). Five days later the ovaries were collected and viral titers determined. Therefore, ovaries were ground with a homogenizer in Minimum Essential Medium (Gibco) containing 5 % fetal bovine serum and supplemented with glutamine, Earls 's salts and antibiotics (penicillin/streptomycin amphotericin). The suspension was titrated in tenfold dilution steps onto BSC40 cells. After overnight incubation at 37°C, the adherent cell layer was stained with a solution consisting of 50%> ethanol, 2% crystal violet and 150mM NaCl for visualization of viral plaques. Non-immunized naive mice were used as control.
LCMV protection assay
Groups of three female C57B1/6 mice were immunized s.c. with 100 μg VLP coupled or fused to p33 alone or mixed with adjuvant / 20 nmol CpG oligonucleotide. To examine systemic antiviral immunity mice were infected i.p. 11-13 days later with 200 pfu LCMV- WE. Four days later spleens were isolated and viral titers determined. The spleens were ground with a homogenizer in Minimum Essential Medium (Gibco) containing 2 % fetal bovine serum and supplemented with glutamine, earls 's salts and antibiotics (penicillin/streptomycin/amphotericin). The suspension was titrated in tenfold dilution steps onto MC57 cells. After incubation for one hour the cells were overlayed with DMEM containing 5% Fetal bovine serum, 1 % methyl cellulose, and antibiotics (penicillin /streptomycin /amphotericin). Following incubation for 2 days at 37°C the cells were assessed for LCMV infection by the intracellular staining procedure (which stains the viral nucleoprotein): Cells were fixed with 4 % Formaldehyde for 30 min followed by a 20 min lysing step with 1% Triton X-100. Incubation for 1 hour with 10 % fetal bovine serum blocked unspecific binding. Cells were stained with a rat anti- LCMV-antibody (VL-4) for 1 hour. A peroxidase-conjugated goat anti-rat-IgG (Jackson ImmunoResearch Laboratories, Inc) was used as secondary antibody followed by a colour reaction with ODP substrate according to standard procedures.
Example 20
Different immunostimulatory nucleic acids packaged in VLP fused to antigen result in a potent antigen-specific CTL response and virus protection.
The fusion protein of HBcAg with the peptide p33 (HBc33) was produced as described in EXAMPLE 1 and packaged with different CpG nucleic acids as described in EXAMPLE 11.
100 μg of vaccines were injected into mice and vaccina titers in the ovaries after recombinant vaccinia challenge were detected as described in EXAMPLE 19. Double stranded CyCpGpt (dsCyCpGpt) was produced by annealing 0.5 mM of DNA oligonucleotides CyCpGpt and CyCpG-rev-pt (Table I) in 15 mM Tris pH7.5 by a 10 min heating step at 80°C and subsequent cooling to RT . Oligonucleotide hybridization was checked on a 20% TBE polyacrylamid gel (Novex).
HBc33 capsids containing CyCpG, NKCpG, B-CpG and glOgacga-PS did induce CTL responses capable of completely inhibition viral infection (Figure 49, Figure 50). Protection was observed with nucleic acids contained phosphodiester or phosphothioate bonds (pt or PS). Even a double stranded oligonucleotide dsCyCpGpt was inducing protection against vaccinia challenge (Figure 49).
Example 21
Immunostimulatory nucleic acids packaged in HBcAg and Qβ VLPs result in a potent antigen-specific CTL response and virus protection.
The fusion protein of HBcAg with the peptide p33 (HBc33) was produced as described in EXAMPLE 1 and packaged with oligonucleotide B- CpGpt as described in EXAMPLE 11. Peptide p33 was coupled to the RNA phage Qβ and oligonucleotide B-CpGpt were packaged as described in EXAMPLE 13. 100 μg, 30 μg, 10 μg or 3 μg of each vaccine was injected into mice and vaccina titers in the ovaries after recombinant vaccinia challenge were detected as described in EXAMPLE 19. 100 μg and 30 μg HBc33 and Qbx33 with packaged B-CpG did induce full protection against viral challenge while at lower concentrations partial or no protection was observed (Figure 51).
Example 22
Immunostimulatory nucleic acids packaged in VLPs which are coupled to selfantigens can overcome tolerance to self-antigens.
Transgenic mice expressing LCMV glycoprotein in pancreatic β islet cells (Ohasi et al., Cell 65, 305-317 (1991)) were immunized with 200 pfu LCMV, 100 μg HBc33 mixed with 20 nmol CyCpGpt, 100 μg HBc33 packaged with CyCpGpt or 100 μg p33 peptide mixed with 20 nmol CyCpGpt as control. Blood glucose levels were measured every four days with the Glucofrend Plus Glucose test kit (Roche). Mice with blood glucose levels larger 12 mM were considered diabetic. Immunization with LCMV induced diabetes in 4/4 animals at day 12. CyCpGpt mixed with HBc33 only caused diabetes in 1/3 mice. Two of three mice immunized with HBc33 in which CyCpGpt was packaged develop diabetes at day 12, the third mouse at day 16. Immunization with peptide p33 mixed with CyCpGpt did not induce diabetes in three mice. This clearly shows that immunostimulatory nucleic acid packaged into VLP to which antigens are fused are much more efficient in enhancing a strong CTL response than a mixture of nucleic acid and antigen. They even induced a stronger response than antigen fused to VLP and mixed with the immunostimulatory nucleic acid.
Example 23
Immunostimulatory nucleic acids packaged in VLPs-coupled to antigens are even more efficient in inducing antigen-specific CD8+ T cells than VLPs mixed with immunostimulatory nucleic acids.
C57BL/6 mice were subcutaneously immunized with 100 μg HBc33 alone, mixed with CyCpGpt or, alternatively, packaged with CyCpGpt. Untreated mice served as controls.
8 days after immunization blood lymphocytes were double-stained with PE-labeled p33-tetramers and FITC-coupled monoclonal anti-CD8 antibodies for p33-specific CD8+ T cell detection and percentage of p33- specific cells on the total CD8+ T cell population were determined by FACS analysis.
Table II. Induction of p33-specific CD8+ T cells after vaccination with p33-VLP mixed or packaged with CpGs. Numbers conespond to means of frequencies (in percent) and standard deviations.
HBc33 with packaged CyCpGpt induced a higher frequence of p33- specific CD8+ T cells than HBc33 mixed with CyCpGpt (Table II). As the amount of packaged oligonucleotide is much lower (about 1/20) of the amount of oligonucleotide used in the mixed setting this clearly demonstrates that VLPs with packaged immunostimulatory nucleic acids are even more efficient in inducing high numbers of antigen-specific CD8+ T cells.
Example 24
Immunostimulatory nucleic acids packaged in VLPs are even more efficient in inducing CTL responses than VLPs mixed with immunostimulatory nucleic acids.
Groups of C57BL/6 mice were subcutaneously primed with 100 μg p33-VLP given alone, mixed with 20 nmol CyCpGpt, or, alternatively, packaged with CyCpGpt. For detection of primary ex vivo cytotoxicity, effector cell suspensions were prepared from spleens of vaccinated mice 9 days after priming. EL-4 cells were pulsed with p33 peptide (IO"6 M, 2 h at 37 °C in 2% FCS MEM medium) and used in a 5 h 51Cr release assay.
Immunization Frequencies of p33- Mice per specific CD8+ T group cells
Untreated 0.2 2
HBc33 0.3 ± 0.1 4
HBc33 + CyCpGpt (mixed) 2.1 ± 0.9 5
HBc33/CyCpGpt (packaged) 4.3 ± 1.1 5 Fig 52 shows the primary ex vivo cytotoxicity of groups of C57BL/6 mice that were subcutaneously primed with 100 μg p33-VLP given alone (A), mixed with 20 nmol CyCpGpt (B), or, alternatively, packaged with CyCpGpt (C). Nine days later spleen cells were tested for direct ex vivo CTL activity in a 5-h 51Cr-release assay on p33-pulsed (filled symbols) or on unpulsed (open symbols) EL-4 target cells at the indicated effector to target cell ratios. Radioactivity in cell culture supernatants was measured in a Cobra II Counter (Canbena Packard, Downers Growe, IL). Spontaneous release was always < 10 %. Two dilution series of effector cells per mouse were performed. In (A) two mice per group were used, whereas in (B) and (C) data from four mice per group are shown.
Figure 52 clearly demonstrates that 100 μg HBc33 alone did not induce primary in vivo CTL response while the same amount HBc33 mixed with 20 nmol CyCpGpt did induce a significant cytotoxicity. However, although the amount of packaged oligonucleotide was much lower (about 1/20) of the amount of oligonucleotide used in the mixed setting cytotoxicity was enhanced when 100 μg HBc33 with packaged CyCpGpt were used for immunization (Figure 52).
Example 25
Non-enzymatic hydrolysis of the RNA content of VLPs and packaging of immunostimulatory nucleic acids.
ZnSC>4 dependent degradation of the nucleic acid content of a VLP:
5 mg Qβ VLP (as determined by Bradford analysis) in 20 mM HEPES, pH 7.4, 150 mM NaCl was dialysed either against 2000 ml of 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl2 or 2000 ml of 4 mM HEPES, pH 7.4, 30 mM NaCl for 2 h at 4°C in SnakeSkin™ pleated dialysis tubing (Pierce, Cat. No. 68035). Each of the dialysis buffers was exchanged once and dialysis was allowed to continue for another 16 h at 4°C. The dialysed solution was clarified for 10 minutes at 14 000 φm (Eppendorf 5417 R, in fixed angle rotor F45-30-11, used in all the following steps) and proteinconcentration was again determined by Bradford analysis. Qβ VLPs in 50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl2 were diluted with the conesponding buffer to a final protein concentration of 1 mg/ml whereas Qβ VLPs in 4 mM HEPES pH 7.4, 30 mM NaCl were diluted with the conesponding buffer to a final protein concentration of 0.5 mg/ml. This capsid-containing solutions were centrifuged again for 10 minutes at 14 000 φm at 4°C. The supernatants were than incubated with ZnSO4 which was added to a final concentration of 2.5 mM for 24 h at 60°C in an Eppendorf Thermomixer comfort at 550 φm. After 24 h the solutions were clarified for 10 minutes at 14000 φm and the sediment was discarded. The efficiency of the ZnSO4-dependent degradation of nucleic acids was confirmed by agarose gelelectrophoresis (Figure 53). The supernatants were dialysed against 5000 ml of 4 mM HEPES pH 7.4, 30 mM NaCl for 2h at 4°C. 5000 ml buffer was exchanged once and dialysis continued over night at 4°C. The dialysed solution was clarified for 10 minutes at 14 000 φm and 4°C, a negligible sediment was discarded and the protein concentration of the supernatants were determined by Bradford analysis.
Similar results were obtained with copper chloride / phenanthroline / hydrogen peroxide treatment of capsids. Those skilled in the art know alternative non-enzymatic procedures for hydrolysis or RNA.
Packaging of oligodeoxynucleotides into ZnS04-treated VLPs:
ZnSO4-treated and dialysed Qβ capsids with a protein concentration (as determined by Bradford analysis) beween 0.4 mg/ml and 0.9 mg/ml (which conesponds to a concentration of capsids of 159 nM and 357.5 nM, respectively) were used for the packaging of the oligodeoxynucleotides. The oligodeoxynucleotides were added at a 300-fold molar excess to the of Qβ- VLP capsids and incubated for 3 h at 37°C in an Eppendorf Thermomixer comfort at 550 φm . After 3 h the reactions were centrifuged for 10 minutes at 14 000 φm and 4°C. The supernatants were dialysed in Spectra/Por®CE DispoDialyzer with a MWCO 300*000 (Spectrum, Cat. No. 135 526) against 5000 ml of 20 mM HEPES pH 7.4, 150 mM NaCl for 8 h at 4°C. 5000 ml buffer was exchanged once and dialysis continued over night at 4°C. The protein concentration of the dialysed samples were determined by Bradford analysis. Qβ capsids and their nucleic acid contents were analyzed as described in Examples 11 and 13.
Figure 53 shows the analysis of ZnSO4-treated Qβ VLPs by agarose gelelectrophoresis: Qβ VLPs which had been purified from E.coli and dialysed either against buffer 1 (50 mM TrisHCl pH 8.0, 50 mM NaCl, 5% glycerol, 10 mM MgCl2) or buffer 2 (4 mM HEPES, pH 7.4, 30 mM NaCl) were incubated either without or in the presence of 2.5 mM zinc sulfate (ZnSO4) for 24 hrs at 60°C. After this treatment equal amounts of the indicated samples (5 μg protein) were mixed with loading dye and loaded onto a 0.8%> agarose gel. After the run the gel was stained with ethidium bromide. Note that treatment of VLPs with ZnSO4 causes degradation of the nucleic acid content, while the mock-treated controls were unaffected.
Figure 54 shows the packaging of oligodeoxynucleotides into ZnSO4- treated VLPs and analysis of them by agarose gelelectrophoresis. Qβ VLPs which had been treated with 2.5 mM zinc sulfate ( + ZnSO4) were dialysed against 4 mM HEPES, pH 7.4, 30 mM NaCl and incubated for 3 hrs at 37°C with an excess of oligodeoxynucleotides (due to the dialysis the concentration of ZnSO4 was decreased by an order of IO6, therefore its indicated only in parenthesis) After this incubation in presence of oligodeoxynucleotides, equal amounts of the indicated samples (5 μg protein) were mixed with loading dye and loaded onto a 0.8% agarose gel. After the run the gel was stained with ethidium bromide. Note that adding of oligodeoxynucleotides to ZnSO4- treated Qβ VLPs could restore the electrophoretical behaviour of the so freated capsids when compared to untreated Qβ capsids which had been purified from E.coli. Figure 55 shows the analysis of nucleic acid content of ZnSO4- and oligodeoxynucleotide treated Qβ VLPs by Benzonase and proteinase K digestion and polyacrylamide TBE/Urea gelelectrophoresis: Oligodeoxynucleotides were packaged into ZnSO4-treated Qβ VLPs as described above. 25 μg of these VLPs were digested with 25 μl Benzonase (Merck, Cat. No. 1.01694.0001) according to the manufactures instructions. After heat-inactivation of the nuclease (30 minutes at 80°C) the VLPs were treated with Proteinase K (final enzyme concentration was 0.5 mg/ml) according to the manufactures instructions. After 3 hrs the equivalent of 2 ug Qβ VLPs which had been digested by Benzonase and proteinase K were mixed with TBE-Urea sample buffer and loaded on a 15% polyacrylamide TBE-Urea gel (Novex®, Invitrogen Cat. No. EC6885). The capsids loaded in lane 2 were treated with 2.5 mM ZnSO4 in presence of buffer 1 (see above), while the capsids loaded in lane 3 were treated with 2.5 mM ZnSO4 in presence of buffer 2 (see above). As qualitative as well as quantitative standard, 1 pmol, 5 pmol and 10 pmol of the oligodeoxynucleotide which was used for the reassembly reaction, was loaded onto the same gel (lanes 4 - 6). As control, Qβ capsids which had been purified from E.coli were treated exactly the same and analyzed on the same polyacrylamide TBE-Urea gel (lane 1) . After the run was completed, the gel was fixed, equilibrated to neutral pH and stained with SYBR-Gold (Molecular Probes Cat. No. S- 11494). Note that intact Qβ VLPs (which had been purified from E.coli) did not contain nucleic acids of similar size than those which had been extracted from ZnSO4- and oligodeoxynucleotide treated Qβ capsids. In addition, nucleic acids isolated from the latter VLPs were comigrating with the oligodeoxynucleotides which had been used in the reassembly reaction. This results confirmed that the used oligodeoxynucleotides were packaged into ZnSO4-treated Qβ capsids. Example 26
VLPs containing containing immunostimulatory nucleic acids induce T cell responses that can be boosted by viral vectors: LCMV.
Mice were subcutaneously primed with 20 μg p33-VLPs containing immunostimulatory nucleic acids. Before immunization, p33-VLP preparations were extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). 12 days later, blood was taken and frequencies of p33-specific T cells were determined by tetramer staining. The mice were boosted with 200 pfu of live LCMV strain WE and frequencies of specific T cells were determined 5 days later. Frequencies before boost were 3.5% +/- 1.8% and after boost 15.5% +/- 1.9%.
Example 27
VLPs containing immunostimulatory nucleic acids induce T cell responses that can be boosted by viral vectors: recombinant vaccinia virus
Mice are subcutaneously primed with 20 μg p33-VLPs containing immunostimulatory nucleic acids. Before immunization, p33-VLP preparations are extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). 12 days later, blood is taken and frequencies of p33 -specific T cells are determined by tetramer staining. The mice are boosted with IO6 pfu of recombinant vaccina virus expressing LCMV-GP and frequencies of specific T cells are determined 5 days later.
Example 28
VLPs containing immunostimulatory nucleic acids induce T cell responses that can be boosted by viral vectors: recombinant canary pox virus.
Mice are subcutaneously primed with 20 μg p33-VLPs containing immunostimulatory nucleic acids. Before immunization, p33-VLP preparations are extensively purified from unbound CpG-oligonucleotides via dialysis (see Example 2 and Figure 5). 12 days later, blood is taken and frequencies of p33-specific T cells are determined by tetramer staining. The mice are boosted with IO7 pfu of recombinant canary pox virus expressing LCMV-GP and frequencies of specific T cells are determined 5 days later.
Example 29
VLPs containing containing immunostimulatory nucleic acids can boost T cell responses.
Mice are infected intravenously with recombinant vacccina virus expressing LCMV-GP. 20 days later, blood is taken and frequencies of p33- specific T cells are determined by tetramer staining. The mice are boosted the same day with p33-VLP preparations containing immunostimulatory nucleic acids (see Example 2 and Figure 5) and frequencies of specific T cells are determined 5 days later.
Example 30
Packaging of immunostimulatory ribonucleic acids into VLPs.
Immunostimulatory ribonucleic acids such as poly (EC) (Sigma) or synthetic double-stranded 30 mer of polyinosinic acid and polycytidylic acid either with phosphodiester or phosphorothiate backbone are dissolved in water. Alternatively, polydeoxyinosinic acid and polydeoxyinosinic acid are used to prepare a double stranded poly(LC) analogon. HBc33 VLPs and Qβ VLPs are freated with RNAse as described in Examples 11, 13 or 25 and nucleic acids are added at 1, 10 and 100 nmol/ml in 0.2x HBS and incubated for 3 h at 37°C in a thermomixer . Excess nucleic acids are removed by enzymatic hydrolysis or dialysis and analysed as described in Example 11, 13 and 25. Alternatively, immunostimulatory ribonucleic acids and their analoga are packaged during reassembly of Qβ coat proteins as described in Examples 14, 15, 16. Reassembly is performed by adding β-mercaptoethanol to the 10 ml dimer fraction to a final concentration of 10%, and 300 μl of a solution of nucleic acid, resulting in a 1, 10 and 100 molar excess over capsid concentration, are added. The reassembly mixtures are first dialyzed against 30 ml NET buffer containing 10% beta-mercaptoethanol for 2 hours at 4°C, and then dialyzed in a continuous mode, with a flow of NET buffer of 8 ml/h over 4 days at 4°C. The reassembly mixtures are then desalted against water by dialysis, with 6 buffer exchanges (4 X 100 ml, 2 X 1 liter). Reassembled Qβ VLPs are then isolated by sucrose gradient centrifugation as described in Example 14 or by gelfiltration as described in Example 16.

Claims

Whatls Claimed Is:
1. A composition for enhancing an immune response in an animal comprising:
(a) a virus-like particle; and
(b) an immunostimulatory substance; wherein said immunostimulatory substance is bound to said virus-like particle.
2. The composition of claim 1 further comprising at least one antigen, wherein said antigen is bound to said virus-like particle.
3. The composition of claim 1, wherein said immunostimulatory substance is a toll-like receptor activating substance.
4. The composition of claim 1, wherein said immunostimulatory substance is a cytokine secretion inducing substance.
5. The composition of claim 3, wherein said toll-like receptor activating substance is selected from the group consisting of, or alternatively consists essentially of:
(a) immunostimulatory nucleic acids;
(b) peptidoglycans;
(c) lipopolysaccharides;
(d) lipoteichonic acids;
(e) imidazoquinoline compounds;
(f) flagellines;
(g) lipoproteins;
(h) immunostimulatory organic molecules; (i) unmethylated CpG-containing oligonucleotides; and (j) any mixtures of at least one substance of (a), (b), (c), (d), (e), (f), (g), (h) and/or (i).
6. The composition of claim 5, wherein said immunostimulatory nucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids;
(b) deoxyribonucleic acids;
(c) chimeric nucleic acids; and
(d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
7. The composition of claim 6, wherein said ribonucleic acid is poly-(LC) or a derivative thereof.
8. The composition of claim 6, wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and
(b) oligonucleotides free of unmethylated CpG motifs.
9. The composition of claim 1, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
10. The composition of claim 1, wherein said virus-like particle lacks a lipoprotein-containing envelope.
11. The composition of claim 1, wherein said virus-like particle is a recombinant virus-like particle.
12. The composition of claim 11, wherein said virus-like particle is selected from the group consisting of:
(a) recombinant proteins of Hepatitis B virus; (b) recombinant proteins of measles virus;
(c) recombinant proteins of Sinbis virus;
(d) recombinant proteins of Rotavirus;
(e) recombinant proteins of Foot-and-Mouth-Disease virus;
(f) recombinant proteins of Retrovirus;
(g) recombinant proteins of Norwalk virus;
(h) recombinant proteins of human Papilloma virus;
(i) recombinant proteins of BK virus;
(j) recombinant proteins of bacteriophages;
(k) recombinant proteins of RNA-phages;
(1) recombinant proteins of Q/3-phage;
(m) recombinant proteins of GA-phage
(n) recombinant proteins of fr-phage;
(o) recombinant proteins of AP 205-phage;
(p) recombinant proteins of Ty; and
(q) fragments of any of the recombinant proteins from (a) to (p).
13. The composition of claim 12, wherein said virus-like particle is the Hepatitis B virus core protein. ,
14. The composition of claim 12, wherein said virus-like particle is the BK virus VPl protein.
15. The composition of claim 1, wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.
16. The composition of claim 15, wherein said RNA-phage is selected from the group consisting of:
(a) bacteriophage Qβ;
(b) bacteriophage R 17 ; (c) bacteriophage fr;
(d) bacteriophage GA;
(e) bacteriophage SP;
(f) bacteriophage MS2;
(g) bacteriophage Mi l; (h) bacteriophage MX 1 ; (i) bacteriophage NL95; (k) bacteriophage f2;
(1) bacteriophage PP7; and (m) bacteriophage AP205.
17. The composition of claim 1, wherein said virus-like particle comprises recombinant proteins,or fragments thereof, of RNA-phage Qβ.
18. The composition of claim 1, wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage AP 205.
19. The composition of claim 9, wherein said unmethylated CpG- containing oligonucleotide comprises the sequence:
5' X]X2CGX X 3' wherein X , X2, X3, and X4 are any nucleotide.
20. The composition of claim 19, wherein at least one of said nucleotide Xls X2, X3, and X4 has a phosphate backbone modification.
21. The composition of claim 9, wherein said unmethylated CpG- containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence selected from the group consisting of:
(a) TCCATGACGTTCCTGAATAAT;
(b) TCCATGACGTTCCTGACGTT;
(c) GGGGTCAACGTTGAGGGGG; (d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and
(e) "dsCyCpG-253" as described in Table 1.
22. The composition of claim 21, wherein said unmethylated CpG- containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
23. The composition of claim 9, wherein said unmethylated CpG- containing oligonucleotide is palindromic.
24. The composition of claim 23, wherein said palindromic unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence GGGGTCAACGTTGAGGGGG.
25. The composition of claim 24, wherein said palindromic unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
26. The composition of claim 1, wherein said immunostimulatory substance is non-covalently bound to said virus-like particle.
27. The composition of claim 9, wherein said unmethylated CpG- containing oligonucleotide is non-covalently bound to said virus-like particle.
28. The composition of claim 5, wherein said immunostimulatory nucleic acid is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.
29. The composition of claim 9, wherein said unmethylated CpG- containing oligonucleotide is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.
30. The composition of claim 29, wherein said oligonucleotide binding site is a non-naturally occurring oligonucleotide binding site.
31. The composition of claim 29, wherein said virus-like particle site comprises an arginine-rich repeat.
32. The composition of claim 5, wherein said immunostimulatory nucleic acid contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
33. The composition of claim 9, wherein said unmethylated CpG- containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
34. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 100,000 nucleotides.
35. The composition of claim 34, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 2000 nucleotides.
36. The composition of claim 35, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 2000 nucleotides.
37. The composition of claim 36, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 300 nucleotides.
38. The composition of claim 37, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises 20 to 100 nucleotides.
39. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 2000 nucleotides.
40. The composition of claim 39, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 1000 nucleotides.
41. The composition of claim 40, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 500 nucleotides.
42. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a recombinant oligonucleotide.
43. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a genomic oligonucleotide.
44. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a synthetic oligonucleotide.
45. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a plasmid-derived oligonucleotide.
46. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a single-stranded oligonucleotide.
47. The composition of claim 5, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a double-stranded oligonucleotide.
48. The composition of claim 2, wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond.
49. The composition of claim 2, wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond, and wherein said covalent bond is a non-peptide bond.
50. The composition of claim 2, wherein said at least one antigen or antigenic determinant is fused to said virus-like particle.
51. The composition of claim 2, wherein said antigen or antigenic determinant further comprises at least one second attachment site being selected from the group consisting of:
(a) an attachment site not naturally occurring with said antigen or antigenic determinant; and
(b) an attachment site naturally occurring with said antigen or antigenic determinant.
52. The composition of claim 2 further comprising an amino acid linker, wherein said amino acid linker comprises, or alternatively consists of, said second attachment site.
53. The composition of claim 2, wherein said antigen is selected from the group consisting of:
(a) polypeptides;
(b) carbohydrates;
(c) steroid hormones; and
(d) organic molecules.
54. The composition of claim 53, wherein said antigen is an organic molecule.
55. The composition of claim 54, wherein said organic molecule is selected from the group consisting of:
(a) codeine;
(b) fentanyl;
(c) heroin;
(d) moφhium;
(e) amphetamine;
(f) cocaine; (g) methylenedioxymethamphetamine;
(h) methamphetamine;
(i) methylphenidate;
0') nicotine;
(k) LSD;
(1) mescaline;
(m) psilocybin; and
(n) tetrahydrocannabinol .
56. The composition of claim 2, wherein said antigen is a recombinant antigen.
57. The composition of claim 2, wherein said antigen is derived from the group consisting of:
(a) viruses;
(b) bacteria;
(c) parasites;
(d) prions;
(e) tumors;
(f) self-molecules;
(g) non-peptidic hapten molecules (h) allergens; and
(i) hormones.
58. The composition of claim 57, wherein said antigen is a tumor antigen.
59. The composition of claim 58, wherein said tumor antigen is selected from the group consisting of:
(a) Her2;
(b) GD2; (c) EGF-R;
(d) CEA;
(e) CD52;
(f) CD21;
(g) human melanoma protein gp 100 ;
(h) human melanoma protein melan- A MART- 1 ;
(i) tyrosinase;
(j) NA17-A nt protein;
(k) MAGE-3 protein;
(1) p53 protein;
(m) HPV 16 E7 protein; and
(n) antigenic fragments of any of the tumor antigens from (a) to (m).
60. The composition of claim 2, wherein said antigen is bound to said virus-like particle by way of a linking sequence.
61. The composition of claim 60, wherein said virus-like particle is the Hepatitis B virus core protein.
62. The composition of claim 60, wherein said virus-like particle is the BK virus core protein.
63. The composition of claim 2, wherein said antigen is a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are bound directly or by way of a linking sequence.
64. The composition of claim 63, wherein said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.
65. The composition of claim 63, wherein said antigen is bound to said virus-like particle by way of a linking sequence.
66. The composition of claim 63, wherein said virus-like particle is the Hepatitis B virus core protein.
67. The composition of claim 66, wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein.
68. The composition of claim 67, wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B virus core protein by way of a linking sequence.
69. The composition of claim 63, wherein said virus-like particle is the BK virus VPl protein.
70. The composition of claim 69, wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VPl protein.
71. The composition of claim 70, wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK virus VPl protein by way of a linking sequence.
72. A method for enhancing an immune response in an animal comprising introducing into said animal a composition comprising:
(a) a virus-like particle; and
(b) an immunostimulatory substance; wherein said immunostimulatory substance is bound to said virus-like particle.
73. The method of claim 72, wherein said composition further comprises an antigen, wherein said antigen is bound to said virus-like particle.
74. The method of claim 72, wherein said immunostimulatory substance is a toll-like receptor activating substance.
75. The method of claim 72, wherein said immunostimulatory substance is a cytokine secretion inducing substance.
76. The method of claim 74, wherein said toll-like receptor activating substance is selected from the group consisting of, or alternatively consists essentially of:
(a) immunostimulatory nucleic acids;
(b) peptidoglycans;
(c) lipopolysaccharides;
(d) lipoteichonic acids;
(e) imidazoquinoline compounds;
(f) flagellines;
(g) lipoproteins;
(h) immunostimulatory organic molecules; (i) unmethylated CpG-containing oligonucleotides; and (j) any mixtures of at least one substance of (a), (b), (c), (d), (e), (f), (g), (h) and/or (i).
77. The method of claim 76, wherein said immunostimulatory nucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids;
(b) deoxyribonucleic acids;
(c) chimeric nucleic acids; and
(d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
78. The method of claim 77, wherein said ribonucleic acid is poly- (I:C) or a derivative thereof.
79. The method of claim 77, wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and
(b) oligonucleotides free of unmethylated CpG motifs.
80. The method of claim 72, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
81. The method of claim 72, wherein said virus-like particle lacks a lipoprotein-containing envelope.
82. The method of claim 72, wherein said virus-like particle is a recombinant virus-like particle.
83. The method of claim 82, wherein said virus-like particle is selected from the group consisting of:
(a) recombinant proteins of Hepatitis B virus;
(b) recombinant proteins of measles virus;
(c) recombinant proteins of Sinbis virus;
(d) recombinant proteins of Rotavirus;
(e) recombinant proteins of Foot-and-Mouth-Disease virus;
(f) recombinant proteins of Retrovirus;
(g) recombinant proteins of Norwalk virus;
(h) recombinant proteins of human Papilloma virus;
(i) recombinant proteins of BK virus;
(j) recombinant proteins of bacteriophages:
(k) recombinant proteins of RNA-phages;
(1) recombinant proteins of Q3-phage; (m) recombinant proteins of GA-phage;
(n) recombinant proteins of fr-phage;
(0) recombinant proteins of AP 205-phage; (p) recombinant proteins of Ty; and
(q) fragments of any of the recombinant proteins from (a) to (p).
84. The method of claim 83, wherein said virus-like particle is the Hepatitis B virus core protein.
85. The method of claim 83, wherein said virus-like particle is the BK virus VPl protein.
86. The method of claim 72, wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of a RNA-phage.
87. The method of claim 86, wherein said RNA-phage is selected from the group consisting of:
(a) bacteriophage Qβ;
(b) bacteriophage Rl 7;
(c) bacteriophage fr;
(d) bacteriophage GA;
(e) bacteriophage SP;
(f) bacteriophage MS2;
(g) bacteriophage Mi l; (h) bacteriophage MX 1 ; (i) bacteriophage NL95; (k) bacteriophage f2;
(1) bacteriophage PP7; and (m) bacteriophage AP205.
88. The method of claim 72, wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage Qβ.
89. The method of claim 72, wherein said virus-like particle comprises recombinant proteins, or fragments thereof, of RNA-phage AP 205.
90. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide comprises the sequence:
5' X|X CGX3X4 3' wherein X1 } X2, X , and X4 are any nucleotide.
91. The method of claim 90, wherein at least one of said nucleotide Xi, X2, X3, and X4 has a phosphate backbone modification.
92. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence selected from the group consisting of:
(a) TCCATGACGTTCCTGAATAAT;
(b) TCCATGACGTTCCTGACGTT;
(c) GGGGTCAACGTTGAGGGGG;
(d) GGGGGGGGGGGACGATCGTCGGGGGGGGGG; and
(e) "dsCyCpG-253" as described in Table 1.
93. The method of claim 92, wherein said unmethylated CpG- containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
94. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide is palindromic.
95. The method of claim 94, wherein said palindromic unmethylated CpG-containing oligonucleotide comprises, or alternatively consists essentially of, or alternatively consists of the sequence GGGGTCAACGTTGAGGGGG.
96. The method of claim 95, wherein said palindromic unmethylated CpG-containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
97. The method of claim 72, wherein said immunostimulatory substance is non-covalently bound to said virus-like particle.
98. The method of claim 72, wherein said virus-like particle is produced in a bacterial expression system.
99. The method of claim 72, wherein said virus-like particle is produced in a yeast expression system.
100. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide is non-covalently bound to said virus-like particle.
101. The method of claim 72, wherein said immunostimulatory substance is packaged, preferably enclosed by said virus-like particle.
102. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide is packaged, preferably enclosed by said virus-like particle.
103. The method of claim 76, wherein said immunostimulatory nucleic acid is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site
104. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide is bound to a virus-like particle site selected from the group consisting of an oligonucleotide binding site, a DNA binding site and a RNA binding site.
105. The method of claim 104, wherein said oligonucleotide binding site is a non-naturally occurring oligonucleotide binding site.
106. The method of claim 104, wherein said virus-like particle site comprises an arginine-rich repeat.
107. The method of claim 76, wherein said immunostimulatory nucleic acid contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
108. The method of claim 80, wherein said unmethylated CpG- containing oligonucleotide contains one or more phosphorothioate modifications of the phosphate backbone or wherein each phosphate moiety of said phosphate backbone of said oligonucleotide is a phosphorothioate modification.
109. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 100,000 nucleotides.
110. The method of claim 109, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 6 to about 2000 nucleotides.
111. The method of claim 110, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 2000 nucleotides.
112. The method of claim 111, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises about 20 to about 300 nucleotides.
113. The method of claim 112, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises 20 to 100 nucleotides.
114. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 2000 nucleotides.
115. The method of claim 114, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 1000 nucleotides.
116. The method of claim 115, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide comprises more than 100 to about 500 nucleotides.
117. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a recombinant oligonucleotide.
118. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a genomic oligonucleotide.
119. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a synthetic oligonucleotide.
120. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a plasmid-derived oligonucleotide.
121. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a single-stranded oligonucleotide.
122. The method of claim 76, wherein said immunostimulatory nucleic acid, and preferably said unmethylated CpG-containing oligonucleotide is a double-stranded oligonucleotide.
123. The method of claim 73, wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond.
124. The method of claim 73, wherein said at least one antigen or antigenic determinant is bound to said virus-like particle by at least one covalent bond, and wherein said covalent bond is a non-peptide bond.
125. The method of claim 73, wherein said at least one antigen or antigenic determinant is fused to said virus-like particle.
126. The method of claim 73, wherein said antigen or antigenic determinant further comprises at least one second attachment site selected from the group consisting of:
(a) an attachment site not naturally occu ing with said antigen or antigenic determinant; and
(b) an attachment site naturally occurring with said antigen or antigenic determinant.
127. The method of claim 73, further comprising an amino acid linker, wherein said amino acid linker comprises, or alternatively consists of, said second attachment site.
128. The method of claim 73, wherein said antigen is selected from the group consisting of:
(a) polypeptides;
(b) carbohydrates;
(c) steroid hormones; and
(d) organic molecules.
129. The method of claim 128, wherein said antigen is an organic molecule.
130. The method of claim 129, wherein said organic molecule is selected from the group consisting of: (a) codeine;
(b) fentanyl;
(c) heroin;
(d) moφhium;
(e) amphetamine;
CD cocaine;
(g) methylenedioxymethamphetamme;
(h) methamphetamine;
(i) methylphenidate ;
0) nicotine;
(k) LSD;
(1) mescaline;
(m) psilocybin; and
(n) tetrahydrocannabinol.
131. The method of claim 73, wherein said antigen is a recombinant antigen.
132. The method of claim 73, wherein said antigen is derived from the group consisting of:
(a) viruses;
(b) bacteria;
(c) parasites;
(d) prions;
(e) tumors;
(f) self-molecules;
(g) non-peptidic hapten molecules (h) allergens; and
(i) hormones.
133. The method of claim 132, wherein said antigen is a tumor antigen.
134. The method of claim 133, wherein said tumor antigen is selected from the group consisting of:
(a) Her2;
(b) GD2;
(c) EGF-R;
(d) CEA;
(e) CD52;
(f) CD21;
(g) human melanoma protein gp 100;
(h) human melanoma protein melan-A/M ART- 1 ;
(i) tyrosinase;
(j) NA17-A nt protein;
(k) MAGE-3 protein;
(1) p53 protein;
(m) HPV 16 E7 protein; and
(m) antigenic fragments of any of the tumor antigens from (a) to (m).
135. The method of claim 73, wherein said antigen is bound to said vims-like particle by way of a linking sequence.
136. The method of claim 135, wherein said vims-like particle is the Hepatitis B vims core protein.
137. The method of claim 135, wherein said vims-like particle is the BK vims VPl protein.
138. The method of claim 73, wherein said antigen is a cytotoxic T cell epitope, a Th cell epitope or a combination of at least two of said epitopes, wherein said at least two epitopes are linked directly or by way of a linking sequence.
139. The method of claim 138, wherein said cytotoxic T cell epitope is a viral or a tumor cytotoxic T cell epitope.
140. The method of claim 138, wherein said antigen is bound to said vims-like particle by way of a linking sequence.
141. The method of claim 138, wherein said vims-like particle is the Hepatitis B vims core protein.
142. The method of claim 141, wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B vims core protein.
143. The method of claim 142, wherein said cytotoxic T cell epitope is fused to the C-terminus of said Hepatitis B vims core protein by way of a linking sequence.
144. The method of claim 138, wherein said vims-like particle is a BK vims VPl protein.
145. The method of claim 144, wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK vims VPl protein.
146. The method of claim 145, wherein said cytotoxic T cell epitope is fused to the C-terminus of said BK vims VPl protein by way of a linking sequence.
147. The method of claim 72, wherein said immune response is an enhanced B cell response.
148. The method of claim 72, wherein said immune response is an enhanced T cell response.
149. The method of claim 148, wherein said T cell response is a CTL response.
150. The method of claim 148, wherein said T cell response is a Th cell response.
151. The method of claim 150, wherein said Th cell response is a Thl cell response.
152. The method of claim 72, wherein said animal is a mammal.
153. The method of claim 152, wherein said mammal is a human.
154. The method of claim 72, wherein said composition is infroduced into said animal subcutaneously, intramuscularly, intravenously, intranasally or directly into the lymph node.
155. A method of producing a composition for enhancing an immune response in an animal comprising a vims-like particle and an immunostimulatory substance bound to said vims-like particle which comprises:
(a) incubating said vims-like particle with said immunostimulatory substance;
(b) adding RNase; and
(c) purifying said composition.
156. The method of claim 155, wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids;
(b) deoxyribonucleic acids;
(c) chimeric nucleic acids; and
(d) any mixtures of at least one nucleic acid of (a), (b) and or (c).
157. The method of claim 156, wherein said ribonucleic acid is poly-(LC) or a derivative thereof.
158. The method of claim 156, wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and
(b) oligonucleotides free of unmethylated CpG motifs.
159. The method of claim 155, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
160. The method of claim 155, wherein said vims-like particle is produced in a bacterial expression system.
161. The method of claim 155, wherein said RNase is RNase A.
162. A method of producing a composition for enhancing an immune response in an animal comprising a vims-like particle and an immunostimulatory substance bound to said vims-like particle which comprises:
(a) incubating said vims-like particle with RNase; (b) adding said immunostimulatory substance; and
(c) purifying said composition.
163. The method of claim 162, wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids;
(b) deoxyribonucleic acids;
(c) chimeric nucleic acids; and
(d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
164. The method of claim 163, wherein said ribonucleic acid is poly-(LC) or a derivative thereof.
165. The method of claim 163, wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and
(b) oligonucleotides free of unmethylated CpG motifs.
166. The method of claim 162, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
167. The method of claim 162, wherein said vims-like particle is produced in a bacterial expression system.
168. The method of claim 162, wherein said RNase is RNase A.
169. A method of producing a composition for enhancing an immune response in an animal comprising a vims-like particle and an immunostimulatory substance bound to said vims-like particle which comprises:
(a) disassembling said vims-like particle;
(b) adding said immunostimulatory substance; and
(c) reassembling said vims-like particle.
170. The method of claim 169, wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids;
(b) deoxyribonucleic acids;
(c) chimeric nucleic acids; and
(d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
171. The method of claim 170, wherein said ribonucleic acid is poly-(LC) or a derivative thereof.
172. The method of claim 170, wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and
(b) oligonucleotides free of unmethylated CpG motifs.
173. The method of claim 169, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
174. The method of claim 169 further comprising removing nucleic acids of said disassembled vims-like particle.
175. The method of claim 169 further comprising purifying said composition after reassembly (c).
176. A method of producing a composition for enhancing an immune response in an animal comprising a vims-like particle and an immunostimulatory substance bound to said vims-like particle which comprises:
(a) incubating said vims-like particle with solutions comprising metal ions capable of hydrolizing the nucleic acids of said vims-like particle;
(b) adding said immunostimulatory substance; and
(c) purifying said composition.
177. The method of claim 176, wherein said immunostimulatory substance is an immunostimulatory nucleic acid selected from the group consisting of, or alternatively consists essentially of:
(a) ribonucleic acids;
(b) deoxyribonucleic acids;
(c) chimeric nucleic acids; and
(d) any mixtures of at least one nucleic acid of (a), (b) and/or (c).
178. The method of claim 177, wherein said ribonucleic acid is poly-(EC) or a derivative thereof.
179. The method of claim 177, wherein said deoxyribonucleic acid is selected from the group consisting of, or alternatively consists essentially of:
(a) unmethylated CpG-containing oligonucleotides; and
(b) oligonucleotides free of unmethylated CpG motifs.
180. The method of claim 176, wherein said immunostimulatory substance is an unmethylated CpG-containing oligonucleotide.
181. The method of claim 176, wherein said metal ions are selected from the group consisting of:
(a) zinc (Zn) ions;
(b) copper (Cu) ions;
(c) iron (Fe) ions; and
(d) any mixtures of at least one ion of (a), (b) and/or (c).
182. A vaccine comprising an immunologically effective amount of the composition of claim 1 together with a pharmaceutically acceptable diluent, carrier or excipient.
183. The vaccine of claim 182 further comprising an adjuvant.
184. A method of immunizing or treating an animal comprising administering to said animal an immunologically effective amount of the vaccine of claim 182.
185. The method of claim 184, wherein said animal is a mammal.
186. The method of claim 185, wherein said mammal is a human.
187. A vaccine comprising an immunologically effective amount of the composition of claim 2 together with a pharmaceutically acceptable diluent, carrier or excipient.
188. The vaccine of claim 187 further comprising an adjuvant.
189. A method of immunizing or treating an animal comprising administering to said animal an immunologically effective amount of the vaccine of claim 187.
190. The method of claim 189, wherein said animal is a mammal.
191. The method of claim 190, wherein said mammal is a human.
192. A method of immunizing or treating an animal comprising priming a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 182.
193. The method of claim 192, further comprising the step of boosting the immune response in said animal.
194. The method of claim 193, wherein said boosting is effected by administering an immunologically effective amount of a vaccine of claim 182 or an immunologically effective amount of a heterologous vaccine.
195. The method of claim 194, wherein said heterologous vaccine is a DNA vaccine.
196. A method of immunizing or treating an animal comprising boosting a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 182.
197. The method of claim 196, further comprising the step of priming a T cell response in said animal.
198. The method of claim 197, wherein said primimg is effected by administering an immunologically effective amount of a vaccine of claim 182 or an immunologically effective amount of a heterologous vaccine.
199. The method of claim 198, wherein said heterologous vaccine is a DNA vaccine.
200. A method of immunizing or treating an animal comprising priming a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 187.
201. The method of claim 200 further comprising the step of boosting the immune response in said animal.
202. The method of claim 201, wherein said boosting is effected by administering an immunologically effective amount of a vaccine of claim 187 or an immunologically effective amount of a heterologous vaccine.
203. The method of claim 202, wherein said heterologous vaccine is a DNA vaccine or a viral vaccine or a canery pox vaccine.
204. A method of immunizing or treating an animal comprising boosting a T cell response in said animal by administering an immunologically effective amount of the vaccine of claim 187.
205. The method of claim 204, further comprising the step of priming a T cell response in said animal.
206. The method of claim 205, wherein said primimg is effected by administering an immunologically effective amount of a vaccine of claim 187 or an immunologically effective amount of a heterologous vaccine.
207. The method of claim 206, wherein said heterologous vaccine is a DNA vaccine or a viral vaccine or a canery pox vaccine.
PCT/IB2002/004132 2001-09-14 2002-09-16 Packaging of immunostimulatory substances into virus-like particles: method of preparation and use Ceased WO2003024481A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
DK02777600.4T DK1450856T3 (en) 2001-09-14 2002-09-16 Packaging of Immunostimulatory CpG in Virus-Like Particles, Method and Use
AT02777600T ATE447967T1 (en) 2001-09-14 2002-09-16 PACKAGING OF IMMUNO-STIMULATIVE CPG IN VIRUS-LIKE PARTICLES: PRODUCTION METHOD AND USE
HK04110189.6A HK1067058B (en) 2001-09-14 2002-09-16 Packaging of immunostimulatory cpg into virus-like particles: method of preparation and use
CA2492826A CA2492826C (en) 2001-09-14 2002-09-16 Encapsulation of unmethylated cpg-containing oligonucleotides into virus-like particles: method of preparation and use
CN028179358A CN1599623B (en) 2001-09-14 2002-09-16 Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
JP2003528575A JP4516748B2 (en) 2001-09-14 2002-09-16 Packaging immunostimulatory substances in virus-like particles: preparation and use
AU2002339224A AU2002339224B2 (en) 2001-09-14 2002-09-16 Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
EP02777600A EP1450856B1 (en) 2001-09-14 2002-09-16 Packaging of immunostimulatory cpg into virus-like particles: method of preparation and use
DE60234375T DE60234375D1 (en) 2001-09-14 2002-09-16 PACKAGING IMMUNSTIMULATING CpG IN VIRUS LIKE PARTICLES: PREPARATION METHOD AND USE
AU2009200115A AU2009200115B2 (en) 2001-09-14 2009-01-09 Packaging of immunostimulatory substances into virus-like particles: method of preparation and use

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US31899401P 2001-09-14 2001-09-14
US60/318,994 2001-09-14
US37414502P 2002-04-22 2002-04-22
US60/374,145 2002-04-22

Publications (2)

Publication Number Publication Date
WO2003024481A2 true WO2003024481A2 (en) 2003-03-27
WO2003024481A3 WO2003024481A3 (en) 2004-06-03

Family

ID=26981773

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2002/004132 Ceased WO2003024481A2 (en) 2001-09-14 2002-09-16 Packaging of immunostimulatory substances into virus-like particles: method of preparation and use

Country Status (12)

Country Link
US (3) US20030099668A1 (en)
EP (2) EP1450856B1 (en)
JP (2) JP4516748B2 (en)
CN (1) CN1599623B (en)
AT (1) ATE447967T1 (en)
AU (2) AU2002339224B2 (en)
CA (1) CA2492826C (en)
CY (1) CY1110585T1 (en)
DE (1) DE60234375D1 (en)
DK (1) DK1450856T3 (en)
ES (1) ES2335979T3 (en)
WO (1) WO2003024481A2 (en)

Cited By (137)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003089642A1 (en) * 2002-04-22 2003-10-30 Bioniche Life Sciences Inc. Oligonucleotide compositions and their use for the modulation of immune responses
WO2004000351A1 (en) * 2002-06-20 2003-12-31 Cytos Biotechnology Ag Packaged virus-like particles for use as adjuvants: method of preparation and use
WO2004009124A3 (en) * 2002-07-19 2004-04-08 Cytos Biotechnology Ag Ghrelin-carrier conjugates
WO2005004907A1 (en) 2003-07-10 2005-01-20 Cytos Biotechnology Ag Packaged virus-like particles
WO2004102198A3 (en) * 2003-05-15 2005-01-27 Cytos Biotechnology Ag Selection of b cells with specificity of interest: method of preparation and use
WO2005014110A1 (en) * 2003-07-22 2005-02-17 Cytos Biotechnology Ag Cpg-packaged liposomes
WO2004084939A3 (en) * 2003-03-26 2005-03-31 Cytos Biotechnology Ag Hiv-peptide-carrier-conjugates
WO2005068639A3 (en) * 2004-01-20 2006-02-02 Cytos Biotechnology Ag Particle-induced ghrelin immune response
WO2006027300A3 (en) * 2004-08-04 2006-08-10 Cytos Biotechnology Ag Carrier conjugates of gnrh-peptides
US7138252B2 (en) 2002-07-17 2006-11-21 Cytos Biotechnology Ag Molecular antigen arrays
WO2006136566A1 (en) 2005-06-21 2006-12-28 Cytos Biotechnology Ag Process for the preparative purification of virus-like particles (vlps)
WO2006083706A3 (en) * 2005-01-31 2007-04-26 Vaxinnate Corp Method to identify polypeptide toll-like receptor (tlr) ligands
WO2007068747A1 (en) * 2005-12-14 2007-06-21 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
JP2008515851A (en) * 2004-10-05 2008-05-15 サイトス バイオテクノロジー アーゲー VLP-antigen conjugates and their use as vaccines
WO2008071774A1 (en) * 2006-12-14 2008-06-19 Cytos Biotechnology Ag Purification process for coat protein of rna bacteriophages
US7476387B2 (en) 2005-07-15 2009-01-13 Chimera Pharma S.L.U. Chimeric empty viral-like particles derived from the infectious bursal disease virus (IBDV), process for their production and applications
WO2009034473A2 (en) 2007-09-12 2009-03-19 Novartis Ag Gas57 mutant antigens and gas57 antibodies
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
EP2108374A1 (en) 2004-04-30 2009-10-14 Novartis Vaccines and Diagnostics S.r.l. Combined meningococcal conjugates with common carrier protein
WO2009138752A3 (en) * 2008-05-15 2010-03-18 Big Dna Ltd Fish vaccine
US7718623B2 (en) 2004-02-27 2010-05-18 Emori & Co., Ltd. Immunostimulatory oligonucleotide that induces interferon alpha
EP2193810A1 (en) 2005-01-14 2010-06-09 Novartis Vaccines and Diagnostics S.r.l. Meningococcal conjugate vaccination
WO2010067286A2 (en) 2008-12-09 2010-06-17 Pfizer Vaccines Llc IgE CH3 PEPTIDE VACCINE
WO2010079464A1 (en) 2009-01-12 2010-07-15 Novartis Ag Cna_b domain antigens in vaccines against gram positive bacteria
US7767212B2 (en) 2005-03-18 2010-08-03 Cytos Biotechnology Ag CAT allergen conjugates and uses thereof
US7790189B2 (en) * 2003-05-15 2010-09-07 Mitsui Sugar Co., Ltd. Immunostimulating agents
WO2010100632A2 (en) 2009-03-06 2010-09-10 Novartis Ag Chlamydia antigens
WO2010122164A1 (en) 2009-04-23 2010-10-28 Cytos Biotechnology Ag VIRUS-LIKE PARTICLES OF BACTERIOPHAGE φCB5
WO2010125202A1 (en) * 2009-04-30 2010-11-04 Cytos Biotechnology Ag Influenza hemagglutinin compositions and uses thereof
EP2267036A1 (en) 2003-10-02 2010-12-29 Novartis Vaccines and Diagnostics S.r.l. Hypo- and Hyper-Acetylated Meningococcal Capsular Saccharides
EP2272531A2 (en) 2004-04-30 2011-01-12 Novartis Vaccines and Diagnostics S.r.l. Integration of meningococcal conjugate vaccination
WO2011004263A2 (en) 2009-07-07 2011-01-13 Novartis Ag Conserved escherichia coli immunogens
WO2011007257A1 (en) 2009-07-16 2011-01-20 Novartis Ag Detoxified escherichia coli immunogens
EP2277538A1 (en) 2003-10-02 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Combined meningitis vaccines
EP2279747A1 (en) 2004-10-29 2011-02-02 Novartis Vaccines and Diagnostics S.r.l. Immunogenic bacterial vesicles with outer membrane proteins
WO2011013034A1 (en) 2009-07-30 2011-02-03 Pfizer Vaccines Llc Antigenic tau peptides and uses thereof
EP2289546A2 (en) 2003-01-30 2011-03-02 Novartis Vaccines and Diagnostics S.r.l. Injectable vaccines against multiple meningococcal serogroups
WO2011024072A2 (en) 2009-08-27 2011-03-03 Novartis Ag Hybrid polypeptides including meningococcal fhbp sequences
WO2011027257A2 (en) 2009-09-03 2011-03-10 Pfizer Vaccines Llc Pcsk9 vaccine
EP2298795A1 (en) 2005-02-18 2011-03-23 Novartis Vaccines and Diagnostics, Inc. Immunogens from uropathogenic escherichia coli
EP2301573A1 (en) 2002-10-01 2011-03-30 Novartis Vaccines and Diagnostics, Inc. Anti-cancer and anti-infectious disease compositions and methods for using same
WO2011048561A1 (en) 2009-10-20 2011-04-28 Novartis Ag Diagnostic and therapeutic methods for rheumatic heart disease based upon group a streptococcus markers
WO2011051893A1 (en) 2009-10-27 2011-05-05 Novartis Ag Modified meningococcal fhbp polypeptides
WO2011058302A1 (en) 2009-11-10 2011-05-19 Guy's And St Thomas's Nhs Foundation Trust Bacteremia-associated antigen from staphylococcus aureus
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US7959928B2 (en) 2004-10-05 2011-06-14 Cytos Biotechnology Ag VLP-antigen conjugates and their uses as vaccines
EP2341069A1 (en) 2004-05-14 2011-07-06 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
WO2011080595A2 (en) 2009-12-30 2011-07-07 Novartis Ag Polysaccharide immunogens conjugated to e. coli carrier proteins
EP2351772A1 (en) 2005-02-18 2011-08-03 Novartis Vaccines and Diagnostics, Inc. Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
EP2351579A1 (en) 2002-10-11 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptide vaccines for broad protection against hypervirulent meningococcal lineages
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
EP2357184A1 (en) 2006-03-23 2011-08-17 Novartis AG Imidazoquinoxaline compounds as immunomodulators
EP2357000A1 (en) 2005-10-18 2011-08-17 Novartis Vaccines and Diagnostics, Inc. Mucosal and systemic immunizations with alphavirus replicon particles
EP2360175A2 (en) 2005-11-22 2011-08-24 Novartis Vaccines and Diagnostics, Inc. Norovirus and Sapovirus virus-like particles (VLPs)
WO2011104632A1 (en) 2010-02-26 2011-09-01 Novartis Ag Immunogenic proteins and compositions
WO2011121576A2 (en) 2010-04-01 2011-10-06 Novartis Ag Immunogenic proteins and compositions
WO2011130379A1 (en) 2010-04-13 2011-10-20 Novartis Ag Benzonapthyridine compositions and uses thereof
EP2385126A1 (en) 2005-11-25 2011-11-09 Novartis Vaccines and Diagnostics S.r.l. Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870
WO2011138636A1 (en) 2009-09-30 2011-11-10 Novartis Ag Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides
WO2011149564A1 (en) 2010-05-28 2011-12-01 Tetris Online, Inc. Interactive hybrid asynchronous computer game infrastructure
WO2011154878A1 (en) 2010-06-07 2011-12-15 Pfizer Vaccines Llc Ige ch3 peptide vaccine
WO2011161551A2 (en) 2010-06-11 2011-12-29 Novartis Ag Omv vaccines
WO2012006359A1 (en) 2010-07-06 2012-01-12 Novartis Ag Delivery of self-replicating rna using biodegradable polymer particles
EP2431468A1 (en) 2005-09-28 2012-03-21 Cytos Biotechnology AG Interleukin-1 conjugates and uses thereof
WO2012035519A1 (en) 2010-09-16 2012-03-22 Novartis Ag Immunogenic compositions
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
WO2012085668A2 (en) 2010-12-24 2012-06-28 Novartis Ag Compounds
WO2012131504A1 (en) 2011-03-02 2012-10-04 Pfizer Inc. Pcsk9 vaccine
EP2510947A1 (en) 2009-04-14 2012-10-17 Novartis AG Compositions for immunising against Staphylococcus aureus
EP2530086A1 (en) 2006-06-12 2012-12-05 Cytos Biotechnology AG Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US20120315335A1 (en) * 2004-05-25 2012-12-13 De Los Rios Miguel A Self-assembling nanoparticle drug delivery system
EP2537857A2 (en) 2007-12-21 2012-12-26 Novartis AG Mutant forms of streptolysin O
WO2013006838A1 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic combination compositions and uses thereof
WO2013006842A2 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic compositions and uses thereof
WO2013030783A1 (en) 2011-08-30 2013-03-07 Novartis Ag Immunogenic proteins and compositions
WO2013038385A2 (en) 2011-09-14 2013-03-21 Novartis Ag Escherichia coli vaccine combination
EP2572726A1 (en) 2007-08-01 2013-03-27 Novartis AG Compositions comprising pneumococcal antigens
EP2586790A2 (en) 2006-08-16 2013-05-01 Novartis AG Immunogens from uropathogenic Escherichia coli
WO2013084071A2 (en) 2011-12-08 2013-06-13 Novartis Ag Clostridium difficile toxin-based vaccine
WO2013092720A1 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Full length antibody display system for eukaryotic cells and its use
EP2612679A1 (en) 2004-07-29 2013-07-10 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
WO2013108272A2 (en) 2012-01-20 2013-07-25 International Centre For Genetic Engineering And Biotechnology Blood stage malaria vaccine
WO2013124473A1 (en) 2012-02-24 2013-08-29 Novartis Ag Pilus proteins and compositions
WO2013160335A2 (en) 2012-04-26 2013-10-31 Novartis Ag Antigens and antigen combinations
EP2659912A2 (en) 2007-07-17 2013-11-06 Novartis AG Conjugate purification
DE202005022108U1 (en) 2004-03-09 2013-11-12 Novartis Vaccines And Diagnostics, Inc. Influenza virus vaccines
US8586728B2 (en) 2006-12-12 2013-11-19 Cytos Biotechnology Ag Oligonucleotides containing high concentrations of guanine monomers
WO2013174832A1 (en) 2012-05-22 2013-11-28 Novartis Ag Meningococcus serogroup x conjugate
WO2014005958A1 (en) 2012-07-06 2014-01-09 Novartis Ag Immunogenic compositions and uses thereof
US8691209B2 (en) 2001-09-14 2014-04-08 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
WO2014053612A1 (en) 2012-10-03 2014-04-10 Novartis Ag Immunogenic composition
WO2014053521A2 (en) 2012-10-02 2014-04-10 Novartis Ag Nonlinear saccharide conjugates
WO2014144211A2 (en) 2013-03-15 2014-09-18 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Compositions and methods for treating fungal and bacterial pathogens
EP2811027A1 (en) 2004-05-21 2014-12-10 Novartis Vaccines and Diagnostics, Inc. Alphavirus vectors for RSV and PIV vaccines
WO2015024992A3 (en) * 2013-08-22 2015-04-30 Cytos Biotechnology Ag Treatment of asthma
EP2886551A2 (en) 2008-02-21 2015-06-24 Novartis AG Meningococcal fhbp polypeptides
EP2891498A1 (en) 2007-12-20 2015-07-08 Novartis AG Fermentation processes for cultivating streptococci and purification processes for obtaining CPS therefrom
WO2015123291A1 (en) 2014-02-11 2015-08-20 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Pcsk9 vaccine and methods of using the same
WO2016109310A1 (en) 2014-12-31 2016-07-07 Checkmate Pharmaceuticals, Llc Combination tumor immunotherapy
AU2013204383B2 (en) * 2006-06-12 2016-09-22 Kuros Us Llc Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US9549901B2 (en) 2010-09-03 2017-01-24 The Brigham And Women's Hospital, Inc. Lipid-polymer hybrid particles
WO2017173334A1 (en) 2016-04-01 2017-10-05 Checkmate Pharmaceuticals, Inc. Fc receptor-mediated drug delivery
WO2017186813A1 (en) 2016-04-27 2017-11-02 Benchmark Animal Health Ltd. Treatment of canine atopic dermatitis
WO2017186808A1 (en) 2016-04-27 2017-11-02 Allergy Therapeutics (Uk) Limited Treatment of peanut allergy
WO2018104889A1 (en) 2016-12-06 2018-06-14 Glaxosmithkline Biologicals Sa Purification process for capsular polysaccharide
US10040830B2 (en) 2008-10-03 2018-08-07 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services Methods and compositions for protein delivery
US10086056B2 (en) 2015-01-15 2018-10-02 University Of Copenhagen Virus-like particle with efficient epitope display
US10279026B2 (en) 2012-04-26 2019-05-07 Glaxosmithkline Biologicals Sa Antigens and antigen combinations
EP3498302A1 (en) 2005-02-01 2019-06-19 Novartis Vaccines and Diagnostics S.r.l. Conjugation of streptococcal capsular saccharides to carrier proteins
WO2019197965A1 (en) 2018-04-09 2019-10-17 Checkmate Pharmaceuticals Packaging oligonucleotides into virus-like particles
US10519175B2 (en) 2017-10-09 2019-12-31 Compass Pathways Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US10526387B2 (en) * 2010-03-16 2020-01-07 Biontech Protein Therapeutics Gmbh Tumor vaccination involving a humoral immune response against self-proteins
US10538743B2 (en) 2012-03-26 2020-01-21 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Delivery of packaged RNA to mammalian cells
WO2020128037A1 (en) 2018-12-20 2020-06-25 Saiba Gmbh Virus-like particles of cmv modified by fusion
WO2021016509A1 (en) * 2019-07-24 2021-01-28 Unm Rainforest Innovations Malaria immunogen and methods for using same
WO2021081353A1 (en) 2019-10-23 2021-04-29 Checkmate Pharmaceuticals, Inc. Synthetic rig-i-like receptor agonists
US11129882B2 (en) 2015-10-30 2021-09-28 University Of Copenhagen Virus like particle with efficient epitope display
WO2021250628A1 (en) 2020-06-12 2021-12-16 Glaxosmithkline Biologicals Sa Bacterial immunization using nanoparticle vaccine
WO2021252450A1 (en) * 2020-06-08 2021-12-16 Adaptive Phage Therapeutics, Inc. Phage display vaccine for covid-19 using a novel peptide sequence
WO2021260131A1 (en) 2020-06-25 2021-12-30 Saiba AG Virus-like particles of cmv modified by fusion
EP3835414A4 (en) * 2018-08-07 2022-05-25 Institute Of Biophysics, Chinese Academy Of Sciences CD4+ T LYMPHOCYTE ACTIVATION METHOD
US11564935B2 (en) 2019-04-17 2023-01-31 Compass Pathfinder Limited Method for treating anxiety disorders, headache disorders, and eating disorders with psilocybin
US20230102159A1 (en) * 2021-09-28 2023-03-30 Unm Rainforest Innovations Malaria immunogen and methods for using same
US11633471B2 (en) 2018-03-06 2023-04-25 Unm Rainforest Innovations Compositions and methods for reducing serum triglycerides
WO2023111826A1 (en) 2021-12-14 2023-06-22 Glaxosmithkline Biologicals Sa Bacterial immunization using qbeta hairpin nanoparticle constructs
US11718861B2 (en) 2013-12-16 2023-08-08 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Cancer immunotherapy by delivering class II MHC antigens using a VLP-replicon
EP4272750A2 (en) 2013-02-07 2023-11-08 Children's Medical Center, Corp. Protein antigens that provide protection against pneumococcal colonization and/or disease
WO2024047091A2 (en) 2022-08-30 2024-03-07 Saiba Animal Health Ag Veterinary compositions of modified virus-like particles of cmv and ngf antigens
WO2024091589A1 (en) * 2022-10-28 2024-05-02 Unm Rainforest Innovations Malaria immunogen and methods for using same
US12060328B2 (en) 2022-03-04 2024-08-13 Reset Pharmaceuticals, Inc. Co-crystals or salts of psilocybin and methods of treatment therewith
US12123003B2 (en) 2018-04-19 2024-10-22 Checkmate Pharmaceuticals, Inc. Synthetic RIG-I-like receptor agonists
US12162916B2 (en) 2022-08-31 2024-12-10 Unm Rainforest Innovations Compositions targeting apoptosis-associated speck-like protein with caspase activation and recruitment domain (ASC) and methods of use
US12246031B2 (en) 2018-02-13 2025-03-11 Checkmate Pharmaceuticals, Inc. Compositions and methods for tumor immunotherapy
WO2025186317A1 (en) 2024-03-06 2025-09-12 Elanco Us Inc. Veterinary compositions of modified virus-like particles of cmv and canine il-1beta mutein antigens
WO2025186188A1 (en) 2024-03-04 2025-09-12 Boehringer Ingelheim Vetmedica Gmbh Active vaccination for the treatment of ngf-related disorders
US12459965B2 (en) 2017-10-09 2025-11-04 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
WO2025242657A1 (en) 2024-05-21 2025-11-27 Shape Biopharmaceuticals Ag Lipopeptide building blocks and aggregates

Families Citing this family (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6572862B1 (en) * 1989-11-08 2003-06-03 Baylor College Of Medicine Methods and reagents to detect and characterize Norwalk and related viruses
US20030232055A1 (en) * 2000-07-31 2003-12-18 Ruslan Medzhitov Innate immune system-directed vaccines
US20030175287A1 (en) * 2001-01-03 2003-09-18 Yale University Innate immune system-directed vaccines
US7320793B2 (en) * 2001-01-19 2008-01-22 Cytos Biotechnology Ag Molecular antigen array
CA2492823A1 (en) * 2001-09-14 2003-03-27 Cytos Biotechnology Ag In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
US7682618B2 (en) * 2001-11-07 2010-03-23 The United States Of America As Represented By The Secretary Of The Army Generation of virus-like particles and use as panfilovirus vaccine
CA2466982A1 (en) * 2001-11-19 2003-05-30 Becton, Dickinson And Company Pharmaceutical compositions in particulate form
CA2486118A1 (en) * 2002-06-07 2003-12-18 Large Scale Biology Corporation Flexible vaccine assembly and vaccine delivery platform
WO2004003143A2 (en) * 2002-06-26 2004-01-08 Advanced Bionutrition Corporation Viruses and virus-like particles for multiple antigen and target display
DE60336902D1 (en) * 2002-07-19 2011-06-09 Cytos Biotechnology Ag VACCINE COMPOSITIONS CONTAINING AMYLOID BETA 1-6 ANTIGENARRAYS
AU2003296902A1 (en) * 2002-09-03 2004-05-04 Kentucky Bioprocessing, Llc Production of peptides in plants as viral coat protein fusions
US20060210588A1 (en) * 2003-03-26 2006-09-21 Cytos Biotechnology Ag Hiv-peptide-carrier-conjugates
US7320795B2 (en) * 2003-07-30 2008-01-22 Vaccine Research Institute Of San Diego Rodent hepatitis B virus core proteins as vaccine platforms and methods of use thereof
US7144712B2 (en) * 2003-07-30 2006-12-05 Vaccine Research Institute Of San Diego Human hepatitis B virus core proteins as vaccine platforms and methods of use thereof
CA2534060C (en) 2003-07-30 2012-06-12 Vaccine Research Institute Of San Diego Hepatitis virus core proteins as vaccine platforms and methods of use thereof
EP1758925A4 (en) * 2003-12-01 2009-04-08 Dow Global Technologies Inc Recombinant icosahedral virus like particle production in pseudomonads
EP1789566A1 (en) * 2004-09-03 2007-05-30 Consejo Superior De Investigaciones Cientificas Nucleic acid sequences encoding proteins capable of associating into a virus-like particle
MX2007003171A (en) * 2004-09-21 2007-05-23 Cytos Biotechnology Ag Virus-like particles comprising a fusion protein of the coat protein of ap205 and an antigenic polypeptide.
US9492400B2 (en) 2004-11-04 2016-11-15 Massachusetts Institute Of Technology Coated controlled release polymer particles as efficient oral delivery vehicles for biopharmaceuticals
RU2007126553A (en) * 2004-12-13 2009-01-20 Цитос Биотехнологи Аг (Ch) ORDERED SERIES OF IL-15 ANTIGENES AND THEIR APPLICATION
LT5414B (en) * 2005-04-13 2007-04-25 Biotechnologijos Institutas Process for preparing monoclonal antibodies; hybridoma cell lines generated by this process and recombinant chimeric virus-like particles with inserted foreign protein fragments as immunogenes to generate hybridomas by this process
JP2008539252A (en) * 2005-04-25 2008-11-13 スリーエム イノベイティブ プロパティズ カンパニー Immune activation composition
WO2007070682A2 (en) * 2005-12-15 2007-06-21 Massachusetts Institute Of Technology System for screening particles
ES2555544T3 (en) 2006-03-07 2016-01-04 Vaxinnate Corporation Compositions that include hemagglutinin, preparation methods and methods of use thereof
CA2648099C (en) * 2006-03-31 2012-05-29 The Brigham And Women's Hospital, Inc System for targeted delivery of therapeutic agents
EP2019691B1 (en) 2006-05-15 2020-08-12 Massachusetts Institute of Technology Polymers for functional particles
WO2007137117A2 (en) * 2006-05-17 2007-11-29 Massachusetts Institute Of Technology Aptamer-directed drug delivery
US9381477B2 (en) * 2006-06-23 2016-07-05 Massachusetts Institute Of Technology Microfluidic synthesis of organic nanoparticles
EP2134830A2 (en) * 2007-02-09 2009-12-23 Massachusetts Institute of Technology Oscillating cell culture bioreactor
WO2008124632A1 (en) * 2007-04-04 2008-10-16 Massachusetts Institute Of Technology Amphiphilic compound assisted nanoparticles for targeted delivery
CA2685308A1 (en) * 2007-04-27 2009-01-29 Dow Global Technologies Inc. Improved production and in vivo assembly of soluble recombinant icosahedral virus-like particles
CA2917512C (en) 2007-10-12 2025-08-05 President And Fellows Of Harvard College Vaccine nanotechnology
US20110014231A1 (en) * 2007-11-05 2011-01-20 Mor Research Applications Ltd Anti-measles cancer immunotherapy
AU2009236585B2 (en) 2008-04-18 2013-03-07 Vaxinnate Corporation Deletion mutants of flagellin and methods of use
CN101559224B (en) * 2008-04-18 2012-07-11 北京生物制品研究所 Poliomyelitis vaccine
NO339169B1 (en) * 2008-04-24 2016-11-14 Chemoforma Ltd Functional fish feed comprising peptidoglycan and nucleotides
WO2009156960A2 (en) 2008-06-27 2009-12-30 Pfizer Inc. Novel adjuvant compositions
US8591905B2 (en) 2008-10-12 2013-11-26 The Brigham And Women's Hospital, Inc. Nicotine immunonanotherapeutics
US8277812B2 (en) 2008-10-12 2012-10-02 Massachusetts Institute Of Technology Immunonanotherapeutics that provide IgG humoral response without T-cell antigen
US8343498B2 (en) 2008-10-12 2013-01-01 Massachusetts Institute Of Technology Adjuvant incorporation in immunonanotherapeutics
US8343497B2 (en) 2008-10-12 2013-01-01 The Brigham And Women's Hospital, Inc. Targeting of antigen presenting cells with immunonanotherapeutics
WO2010067262A1 (en) * 2008-12-09 2010-06-17 Pfizer Inc. Immunostimulatory oligonucleotides
TWI378144B (en) * 2010-02-09 2012-12-01 Univ Nat Pingtung Sci & Tech Recombinant plasmic containing multicopy cpg motifs and transformant thereof for applying on dna adjuvant in avian vaccines
EP2471926A3 (en) 2010-12-30 2012-07-11 Intervet International BV Immunostimulatory oligodeoxynucleotides
US9238679B2 (en) 2011-02-11 2016-01-19 The Trustees Of The University Of Pennslyvania Nucleic acid molecule encoding hepatitis B virus core protein and surface antigen protein and vaccine comprising the same
EA037377B1 (en) * 2011-02-11 2021-03-22 Дзе Трастиз Оф Дзе Юниверсити Оф Пенсильвания Vaccine for inducing an immune response against hbv
KR20140056184A (en) 2011-05-13 2014-05-09 고쿠리츠다이가쿠호진 토쿄고교 다이가꾸 Cytotoxic t cell inducer
EP2714907B1 (en) * 2011-05-26 2016-06-15 Intervet International B.V. Immunostimulatory oligodeoxynucleotides
CA2834440A1 (en) * 2011-05-26 2012-11-29 Intervet International B.V. Immunostimulatory oligodeoxynucleotides
PT2734544T (en) * 2011-07-18 2021-03-16 Us Health Methods and compositions for inhibiting polyomavirus-associated pathology
CA2860310C (en) 2011-12-21 2023-03-21 Apse, Llc Processes using vlps with capsids resistant to hydrolases
US8932598B2 (en) 2012-08-28 2015-01-13 Vaxinnate Corporation Fusion proteins and methods of use
JP2016507520A (en) 2013-01-23 2016-03-10 ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー Stabilized hepatitis B core polypeptide
EP2968517A4 (en) * 2013-03-15 2017-02-22 Bullet Biotechnology, Inc. Specific multivalent virus-like particle vaccines and uses thereof
BR112015029559A2 (en) 2013-06-19 2017-12-12 Apse Llc virus-like particle, nucleic acid, and methods for producing double-stranded rna and sirna, shrna, sshrna, 1shrna, and mirna
KR20160042917A (en) 2013-07-25 2016-04-20 엑시큐어, 인크. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
UA121200C2 (en) 2013-09-19 2020-04-27 Зоетіс Сервісіз Ллс OIL-BASED ADJUSTANT
EP3164113B1 (en) 2014-06-04 2019-03-27 Exicure, Inc. Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
US11213593B2 (en) 2014-11-21 2022-01-04 Northwestern University Sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
EP4248992A3 (en) 2015-01-16 2023-12-27 Zoetis Services LLC Foot-and-mouth disease vaccine
WO2017184655A1 (en) * 2016-04-18 2017-10-26 University Of Florida Research Foundaiton, Inc. Stable poliovirus variants and uses thereof
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
US10434171B2 (en) 2016-12-23 2019-10-08 United States of America as Represented by Secretary of Agriculture Microfluidized Mycobacterium avium fragments as an adjuvant and carrier for mucosal vaccine delivery
US10566881B2 (en) 2017-01-27 2020-02-18 Franklin Electric Co., Inc. Motor drive system including removable bypass circuit and/or cooling features
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
CN111166727A (en) * 2019-11-15 2020-05-19 河南省生物工程技术研究中心 Tumor immunotherapy compound and preparation method and application thereof
CN110862435B (en) * 2019-12-05 2021-09-24 中国农业大学 African swine fever CTL epitope polypeptide and its application
CN111214663B (en) * 2020-03-06 2022-03-15 中国人民解放军军事科学院军事医学研究院 TMED2 as a therapeutic target for Ebola virus disease
CN111253494B (en) * 2020-03-10 2022-04-26 天康制药(苏州)有限公司 Fusion protein of pig foot-and-mouth disease virus and pig rotavirus, viroid particle, vaccine and preparation method
CN111281973A (en) * 2020-03-31 2020-06-16 清华大学 Vaccine adjuvant containing TRPV2 agonist and use thereof
CU20200028A7 (en) * 2020-04-20 2021-11-04 Ct Ingenieria Genetica Biotecnologia VIRAL NUCLEOPROTEIN AND FORMULATIONS CONTAINING IT
CN113136372B (en) * 2021-05-28 2023-08-01 广西大学 Construction method of recombinant phage
EP4601684A2 (en) * 2022-10-14 2025-08-20 Longhorn Vaccines and Diagnostics, LLC Vaccines and antibodies for the treatment and prevention of microbial infections
WO2024164006A2 (en) * 2023-02-03 2024-08-08 The Regents Of The University Of California Self-amplifying rna form of a constitutively-active sting protein for enhancing t-cell response to antigenpresenting cells

Family Cites Families (131)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE2034118A1 (en) 1970-07-09 1972-01-13 Seinfeld, Hugo, Brendel, Walter, Prof Dr . 8000 München Xenogenic nucleic acids for enhancing antigenicity - of peptides and proteins
US4722840A (en) 1984-09-12 1988-02-02 Chiron Corporation Hybrid particle immunogens
FR2581394B1 (en) 1985-05-02 1988-08-05 Grp Genie Genetique PARTICLES HAVING IMMUNOGENIC PROPERTIES OF THE HBS ANTIGEN AND CARRYING A FOREIGN ANTIGENIC SITE TO THE EPITOPES CARRIED BY THE HBS ANTIGEN, ANIMAL VECTORS AND CELLS FOR THE PRODUCTION OF SUCH PARTICLES AND COMPOSITIONS CONTAINING SUCH PARTICLES FOR THE PRODUCTION
US5374426A (en) 1986-09-03 1994-12-20 University Of Saskatchewan Rotavirus nucleocapsid protein VP6 in vaccine compositions
US4918166A (en) 1987-04-10 1990-04-17 Oxford Gene Systems Limited Particulate hybrid HIV antigens
US5057540A (en) * 1987-05-29 1991-10-15 Cambridge Biotech Corporation Saponin adjuvant
GB8913737D0 (en) 1989-06-15 1989-08-02 Univ Birmingham A novel anti-allergy treatment
NZ235315A (en) 1989-09-19 1991-09-25 Wellcome Found Chimaeric hepadnavirus core antigen proteins and their construction
ES2284161T3 (en) 1990-01-12 2007-11-01 Amgen Fremont Inc. GENERATION OF XENOGENIC ANTIBODIES.
US5334394A (en) 1990-06-22 1994-08-02 The Regents Of The University Of California Human immunodeficiency virus decoy
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
WO1992011291A1 (en) 1990-12-20 1992-07-09 Smithkline Beecham Biologicals (S.A.) Vaccines based on hepatitis b surface antigen
GB9101550D0 (en) 1991-01-24 1991-03-06 Mastico Robert A Antigen-presenting chimaeric protein
GB9114003D0 (en) 1991-06-28 1991-08-14 Mastico Robert A Chimaeric protein
GB9213601D0 (en) * 1992-06-26 1992-08-12 Mastico Robert A Protein based delivery system
AU678769B2 (en) 1992-07-27 1997-06-12 Hybridon, Inc. Oligonucleotide alkylphosphonothioates
FR2695563B1 (en) 1992-09-11 1994-12-02 Pasteur Institut Microparticles carrying antigens and their use for the induction of humoral or cellular responses.
DK0732936T3 (en) 1993-12-09 2000-09-04 Heinrich Exner Adjuvant to antigens, method of preparation and use
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1995026204A1 (en) 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
FR2722506B1 (en) 1994-07-13 1996-08-14 Rhone Poulenc Rorer Sa COMPOSITION CONTAINING NUCLEIC ACIDS, PREPARATION AND USES
US6239116B1 (en) * 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20030026782A1 (en) 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030050263A1 (en) 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
WO1996002555A1 (en) 1994-07-15 1996-02-01 The University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US5935821A (en) * 1995-01-17 1999-08-10 Board Of Trustees Of The University Of Kentucky Polynucleotides related to monoclonal antibody 1A7 and use for the treatment of melanoma and small cell carcinoma
WO1996030523A2 (en) 1995-03-31 1996-10-03 Hans Wolf Antigen presentation system based on retrovirus-like particles
US5994315A (en) 1995-06-07 1999-11-30 East Carolina University Low adenosine agent, composition, kit and method for treatment of airway disease
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
ZA9756B (en) 1996-01-16 1997-07-17 Warner Lambert Co Process for preparing 4,6-disubstituted pyrido[3,4-d]-pyrimidines
PT879056E (en) 1996-01-23 2002-10-31 Ribapharm Inc MODIFICATION OF TH1 / TH2 CYTOKINES EXPRESSION THROUGH RIBAVIRIN IN T ACTIVATED LYMPHOCYTES
CA2244946C (en) 1996-01-30 2010-04-13 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
GB9621091D0 (en) 1996-10-09 1996-11-27 Fondation Pour Le Perfectionem Attenuated microorganisms strains and their uses
JP4111403B2 (en) 1996-10-11 2008-07-02 ザ リージェンツ オブ ザ ユニバーシティー オブ カリフォルニア Immunostimulatory polynucleotide / immunomodulatory molecule complex
EP0855184A1 (en) 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
GB9702021D0 (en) 1997-01-31 1997-03-19 Imperial College Medicaments
WO1998037919A1 (en) 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS
AU753688B2 (en) 1997-03-10 2002-10-24 Ottawa Civic Loeb Research Institute Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6406705B1 (en) * 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
WO1998049195A1 (en) 1997-04-29 1998-11-05 Universiteit Utrecht Corona virus-like particles as tools for vaccination and therapy
WO1998050071A1 (en) * 1997-05-01 1998-11-12 Chiron Corporation Use of virus-like particles as adjuvants
AU7690898A (en) 1997-05-20 1998-12-11 Ottawa Civic Hospital Loeb Research Institute Vectors and methods for immunization or therapeutic protocols
WO1998055495A2 (en) 1997-06-06 1998-12-10 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
NZ501752A (en) * 1997-06-23 2000-12-22 Ludwig Inst Cancer Res Isolated nona- and decapeptides which bind to HLA molecules, and the use thereof
WO1999007839A2 (en) 1997-08-05 1999-02-18 Vlaams Interuniversitair Instituut Voor Biotechnologie Immunoprotective influenza antigen and its use in vaccination
US6169175B1 (en) 1997-08-06 2001-01-02 Centers For Disease Control And Prevention Preparation and use of recombinant influenza A virus M2 construct vaccines
DK1009413T3 (en) 1997-09-05 2007-06-11 Univ California Use of immunostimulatory oligonucleotides for the prevention or treatment of asthma
US5989868A (en) 1997-09-12 1999-11-23 The Board Of Regents Of The University Of Oklahoma Fusion protein systems designed to increase soluble cytoplasmic expression of heterologous proteins in esherichia coli
US6171591B1 (en) * 1997-12-08 2001-01-09 Pentamer Pharmaceuticals, Inc. Recombinant nodavirus compositions and methods
ATE249240T1 (en) 1998-02-12 2003-09-15 Immune Complex Corp STRATEGICALLY MODIFIED HEPATITIS B CORE PROTEINS AND THEIR DERIVATIVES
US6218371B1 (en) 1998-04-03 2001-04-17 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6541438B1 (en) * 1998-05-01 2003-04-01 The Procter & Gamble Company Laundry detergent and/or fabric care compositions comprising a modified cellulase
US5990085A (en) 1998-05-04 1999-11-23 Michigan State University Inhibin-HBc fusion protein
WO1999058118A2 (en) * 1998-05-14 1999-11-18 Cpg Immunopharmaceuticals Gmbh METHODS FOR REGULATING HEMATOPOIESIS USING CpG-OLIGONUCLEOTIDES
US7157092B1 (en) 1998-06-30 2007-01-02 Om Pharma Acyl pseudodipeptides, preparation method and pharmaceutical compositions containing same
WO2000006588A1 (en) 1998-07-27 2000-02-10 University Of Iowa Research Foundation STEREOISOMERS OF CpG OLIGONUCLEOTIDES AND RELATED METHODS
AU5254799A (en) 1998-08-04 2000-02-28 Dryken Technologies, Inc. Method and system for dynamic data-mining and on-line communication of customized information
EP1104306B1 (en) 1998-08-10 2006-01-11 Antigenics Inc. Compositions of cpg and saponin adjuvants and methods of use thereof
US5962636A (en) * 1998-08-12 1999-10-05 Amgen Canada Inc. Peptides capable of modulating inflammatory heart disease
US6927278B1 (en) * 1998-09-01 2005-08-09 Trustees Of The University Of Pennsylvania Peptide scaffolds for transfer of molecules into eukaryotic cells
EP1108017A2 (en) 1998-09-03 2001-06-20 Coley Pharmaceutical GmbH G-motif oligonucleotides and uses thereof
ATE314095T1 (en) * 1998-10-21 2006-01-15 Us Health VIRUS-LIKE PARTICLES FOR INDUCING AUTOANTIBODIES
PL192016B1 (en) * 1998-11-30 2006-08-31 Cytos Biotechnology Ag Ordered molecular presentation of antigens, method of preparation and use
MXPA01006491A (en) 1998-12-23 2003-06-06 Thompson Boyce Plant Res Expression of immunogenic hepatitis b surface antigens in transgenic plants.
WO2000039304A2 (en) 1998-12-31 2000-07-06 Chiron Corporation Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
WO2000046365A1 (en) * 1999-02-02 2000-08-10 Biocache Pharmaceuticals, Inc. Advanced antigen presentation platform
WO2000046385A1 (en) 1999-02-03 2000-08-10 The Children's Medical Center Corporation Gene repair involving in vivo excision of targeting dna
WO2000050461A1 (en) 1999-02-25 2000-08-31 Smithkline Beecham Biologicals S.A. Epitopes or mimotopes derived from the c-epsilon-3 or c-epsilon-4 domains of ige, antagonists thereof, and their therapeutic uses
EP2286792A1 (en) * 1999-02-26 2011-02-23 Novartis Vaccines and Diagnostics, Inc. Microemulsions with an adsorbent surface, comprising a microdroplet emulsion
WO2000054803A2 (en) 1999-03-16 2000-09-21 Panacea Pharmaceuticals, Llc Immunostimulatory nucleic acids and antigens
US6977245B2 (en) * 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
CN1227030C (en) 1999-04-19 2005-11-16 史密丝克莱恩比彻姆生物有限公司 Adjuvant compositions comprising saponins and immunostimulatory oligonucleotides
WO2001000232A2 (en) 1999-06-29 2001-01-04 Smithkline Beecham Biologicals S.A. Use of cpg as an adjuvant for hiv vaccine
US7479285B1 (en) 1999-08-19 2009-01-20 Dynavax Technologies Corporation Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
AU6801800A (en) 1999-08-30 2001-03-26 Ludwig Institute For Cancer Research Isolated nona and decapeptides which bind to hla molecules, and the use thereof
JP2001151698A (en) * 1999-09-10 2001-06-05 Nichiko Pharmaceutical Co Ltd Influenza vaccine
IL148843A0 (en) * 1999-09-25 2002-09-12 Univ Iowa Res Found Immunostimulatory nucleic acids
US6949520B1 (en) * 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
NZ517928A (en) 1999-09-27 2004-09-24 Coley Pharm Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
EP1221968B1 (en) * 1999-10-13 2010-01-13 Novartis Vaccines and Diagnostics, Inc. Method of obtaining cellular immune responses from proteins
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
DE60018601D1 (en) * 1999-11-24 2005-04-14 Chiron Corp HBV / HCV virus-like particle
WO2001051083A2 (en) 2000-01-13 2001-07-19 Antigenics Inc. Innate immunity-stimulating compositions of cpg and saponin and methods thereof
US6261326B1 (en) 2000-01-13 2001-07-17 North Carolina State University Method for introducing dyes and other chemicals into a textile treatment system
US20010044416A1 (en) * 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
AT409085B (en) * 2000-01-28 2002-05-27 Cistem Biotechnologies Gmbh PHARMACEUTICAL COMPOSITION FOR IMMUNULATING AND PRODUCING VACCINES
AU2001236621B2 (en) 2000-02-01 2006-06-15 Mycenax Biotech Inc. Cd40-binding apc-activating molecules
US7585847B2 (en) * 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US6756044B1 (en) 2000-02-09 2004-06-29 Genvec, Inc. Antigenic complexes and methods
AU2001239873A1 (en) * 2000-02-24 2001-09-03 The Board Of Trustees Of The Leland Stanford Junior University Adjuvant treatment by in vivo activation of dendritic cells
WO2001077158A1 (en) 2000-04-07 2001-10-18 University Of Leeds Innovations Limited Hepatitis b core antigen fusion proteins
WO2001085208A2 (en) 2000-05-05 2001-11-15 Cytos Biotechnology Ag Molecular antigen arrays and vaccines
EP1294893B1 (en) 2000-06-22 2006-03-15 UCB Pharma Limited Modification of hepatitis b core antigen
AUPQ912000A0 (en) 2000-07-31 2000-08-24 Crown In The Right Of The Queensland Department Of Health, The Improved virus like particles
US20030138769A1 (en) 2000-08-16 2003-07-24 Birkett Ashley J. Immunogenic HBc chimer particles having enhanced stability
MXPA03002640A (en) 2000-09-28 2003-06-19 Chiron Corp Microparticles for delivery of the heterologous nucleic acids.
HU229642B1 (en) 2000-10-18 2014-03-28 Glaxosmithkline Beecham Biolog S A Vaccines against cancers
WO2002053141A2 (en) 2000-12-14 2002-07-11 Coley Pharmaceutical Group, Inc. Inhibition of angiogenesis by nucleic acids
US7320793B2 (en) 2001-01-19 2008-01-22 Cytos Biotechnology Ag Molecular antigen array
US7128911B2 (en) * 2001-01-19 2006-10-31 Cytos Biotechnology Ag Antigen arrays for treatment of bone disease
US7094409B2 (en) * 2001-01-19 2006-08-22 Cytos Biotechnology Ag Antigen arrays for treatment of allergic eosinophilic diseases
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
WO2003040308A2 (en) 2001-07-27 2003-05-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver cpg oligonucleotides in vivo
DE60236806D1 (en) 2001-08-13 2010-08-05 Univ Rochester TRANSCUTANEOUS IMMUNIZATION AGAINST PAPILLOMA VIRUSES WITH VIRUSUAL PAPILLOMA VIRUS PARTICLES
EP1450856B1 (en) 2001-09-14 2009-11-11 Cytos Biotechnology AG Packaging of immunostimulatory cpg into virus-like particles: method of preparation and use
CA2492823A1 (en) * 2001-09-14 2003-03-27 Cytos Biotechnology Ag In vivo activation of antigen presenting cells for enhancement of immune responses induced by virus like particles
US7115266B2 (en) * 2001-10-05 2006-10-03 Cytos Biotechnology Ag Angiotensin peptide-carrier conjugates and uses thereof
ES2321491T3 (en) 2001-10-05 2009-06-08 Cytos Biotechnology Ag CONJUGATES THAT CARRY ANGIOTENSIN PEPTIDE AND USE OF THE SAME.
AU2002346960A1 (en) 2001-10-06 2003-04-22 Merial Limited Methods and compositions for promoting growth and innate immunity in young animals
ES2320638T3 (en) 2001-11-07 2009-05-27 Cytos Biotechnology Ag ORDERED PROVISION OF ANTIGENS IL-5, IL-13 OR EOTASINE, FOR THE TREATMENT OF ALLERGIC DISEASES WITH AN EOSYPHILIC COMPONENT.
BR0213941A (en) 2001-11-07 2004-08-31 Cytos Biotechnology Ag Antigen Arrangements for the Treatment of Bone Disease
TW200303759A (en) 2001-11-27 2003-09-16 Schering Corp Methods for treating cancer
JP3881985B2 (en) 2001-12-04 2007-02-14 株式会社アトック Quartz glass fluid single-hole nozzle and quartz glass fluid multi-hole burner head
WO2003059386A2 (en) 2002-01-18 2003-07-24 Cytos Biotechnology Ag Prion protein carrier-conjugates
US20030219459A1 (en) * 2002-01-18 2003-11-27 Cytos Biotechnology Ag Prion protein carrier-conjugates
BR0311995A (en) 2002-06-20 2005-04-05 Cytos Biotechnology Ag Virus-like particles packaged for use as adjuvants: Method of preparation and use
JP4726483B2 (en) 2002-07-17 2011-07-20 サイトス バイオテクノロジー アーゲー Molecular antigen array
DE60336902D1 (en) 2002-07-19 2011-06-09 Cytos Biotechnology Ag VACCINE COMPOSITIONS CONTAINING AMYLOID BETA 1-6 ANTIGENARRAYS
RU2351362C2 (en) * 2003-03-26 2009-04-10 Цитос Байотекнолоджи Аг CONJUGATES OF PEPTIDE Melan-A, VIRUS-LIKE PARTICLE ANALOGUE
US20060210588A1 (en) * 2003-03-26 2006-09-21 Cytos Biotechnology Ag Hiv-peptide-carrier-conjugates
US7537767B2 (en) * 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
EP1644034B1 (en) * 2003-07-10 2011-01-12 Cytos Biotechnology AG Composition for enhancing an immune response comprising packaged virus-like particles
MX2007003171A (en) * 2004-09-21 2007-05-23 Cytos Biotechnology Ag Virus-like particles comprising a fusion protein of the coat protein of ap205 and an antigenic polypeptide.
CN101052411B (en) 2004-10-05 2011-04-06 赛托斯生物技术公司 VLP-antigen conjugates and their uses as vaccines
PL1868642T3 (en) 2005-03-18 2013-10-31 Cytos Biotechnology Ag Cat allergen fusion proteins and uses thereof
US20110027220A1 (en) 2005-09-28 2011-02-03 Cytos Biotechnology Ag Interleukin-1 Conjugates and Uses Thereof
WO2007068747A1 (en) * 2005-12-14 2007-06-21 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
EP2231179A2 (en) 2007-12-20 2010-09-29 Cytos Biotechnology AG Ngf conjugates and uses thereof
CA2721657A1 (en) 2008-04-22 2009-10-29 Cytos Biotechnology Ag Vaccine compositions for the treatment of dengue fever and uses thereof

Cited By (223)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8691209B2 (en) 2001-09-14 2014-04-08 Cytos Biotechnology Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US9950055B2 (en) 2001-09-14 2018-04-24 Kuros Biosciences Ag Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US7371734B2 (en) 2002-04-22 2008-05-13 Bioniche Life Sciences Inc. Oligonucleotide compositions and their use for the modulation of immune responses
WO2003089642A1 (en) * 2002-04-22 2003-10-30 Bioniche Life Sciences Inc. Oligonucleotide compositions and their use for the modulation of immune responses
WO2004000351A1 (en) * 2002-06-20 2003-12-31 Cytos Biotechnology Ag Packaged virus-like particles for use as adjuvants: method of preparation and use
US7138252B2 (en) 2002-07-17 2006-11-21 Cytos Biotechnology Ag Molecular antigen arrays
US7494656B2 (en) 2002-07-17 2009-02-24 Cytos Biotechnology Ag Molecular antigen arrays
WO2004009124A3 (en) * 2002-07-19 2004-04-08 Cytos Biotechnology Ag Ghrelin-carrier conjugates
EP2301573A1 (en) 2002-10-01 2011-03-30 Novartis Vaccines and Diagnostics, Inc. Anti-cancer and anti-infectious disease compositions and methods for using same
EP2353608A1 (en) 2002-10-11 2011-08-10 Novartis Vaccines and Diagnostics S.r.l. Polypeptide-vaccines for broad protection against hypervirulent meningococcal lineages
EP2351579A1 (en) 2002-10-11 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptide vaccines for broad protection against hypervirulent meningococcal lineages
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
EP2289546A2 (en) 2003-01-30 2011-03-02 Novartis Vaccines and Diagnostics S.r.l. Injectable vaccines against multiple meningococcal serogroups
WO2004084939A3 (en) * 2003-03-26 2005-03-31 Cytos Biotechnology Ag Hiv-peptide-carrier-conjugates
US7537767B2 (en) 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
US7517520B2 (en) 2003-03-26 2009-04-14 Cytos Biotechnology Ag Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
US7790189B2 (en) * 2003-05-15 2010-09-07 Mitsui Sugar Co., Ltd. Immunostimulating agents
WO2004102198A3 (en) * 2003-05-15 2005-01-27 Cytos Biotechnology Ag Selection of b cells with specificity of interest: method of preparation and use
AU2004255470B2 (en) * 2003-07-10 2010-08-19 Cytos Biotechnology Ag Packaged virus-like particles
CN100404070C (en) * 2003-07-10 2008-07-23 赛托斯生物技术公司 packaged virus-like particle
WO2005004907A1 (en) 2003-07-10 2005-01-20 Cytos Biotechnology Ag Packaged virus-like particles
WO2005014110A1 (en) * 2003-07-22 2005-02-17 Cytos Biotechnology Ag Cpg-packaged liposomes
EP2277538A1 (en) 2003-10-02 2011-01-26 Novartis Vaccines and Diagnostics S.r.l. Combined meningitis vaccines
EP2267036A1 (en) 2003-10-02 2010-12-29 Novartis Vaccines and Diagnostics S.r.l. Hypo- and Hyper-Acetylated Meningococcal Capsular Saccharides
WO2005068639A3 (en) * 2004-01-20 2006-02-02 Cytos Biotechnology Ag Particle-induced ghrelin immune response
US7718623B2 (en) 2004-02-27 2010-05-18 Emori & Co., Ltd. Immunostimulatory oligonucleotide that induces interferon alpha
DE202005022108U1 (en) 2004-03-09 2013-11-12 Novartis Vaccines And Diagnostics, Inc. Influenza virus vaccines
EP2108374A1 (en) 2004-04-30 2009-10-14 Novartis Vaccines and Diagnostics S.r.l. Combined meningococcal conjugates with common carrier protein
EP2272531A2 (en) 2004-04-30 2011-01-12 Novartis Vaccines and Diagnostics S.r.l. Integration of meningococcal conjugate vaccination
EP2341069A1 (en) 2004-05-14 2011-07-06 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2343313A1 (en) 2004-05-14 2011-07-13 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2351773A1 (en) 2004-05-14 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2351774A1 (en) 2004-05-14 2011-08-03 Novartis Vaccines and Diagnostics S.r.l. Polypeptides from non-typeable haemophilus influenzae
EP2848692A1 (en) 2004-05-21 2015-03-18 Novartis Vaccines and Diagnostics, Inc. Alphavirus vectors for influenza virus vaccines
EP2811027A1 (en) 2004-05-21 2014-12-10 Novartis Vaccines and Diagnostics, Inc. Alphavirus vectors for RSV and PIV vaccines
US20120315335A1 (en) * 2004-05-25 2012-12-13 De Los Rios Miguel A Self-assembling nanoparticle drug delivery system
EP2612679A1 (en) 2004-07-29 2013-07-10 Novartis Vaccines and Diagnostics, Inc. Immunogenic compositions for gram positive bacteria such as streptococcus agalactiae
WO2006027300A3 (en) * 2004-08-04 2006-08-10 Cytos Biotechnology Ag Carrier conjugates of gnrh-peptides
US7959928B2 (en) 2004-10-05 2011-06-14 Cytos Biotechnology Ag VLP-antigen conjugates and their uses as vaccines
JP2008515851A (en) * 2004-10-05 2008-05-15 サイトス バイオテクノロジー アーゲー VLP-antigen conjugates and their use as vaccines
EP2279747A1 (en) 2004-10-29 2011-02-02 Novartis Vaccines and Diagnostics S.r.l. Immunogenic bacterial vesicles with outer membrane proteins
EP2193810A1 (en) 2005-01-14 2010-06-09 Novartis Vaccines and Diagnostics S.r.l. Meningococcal conjugate vaccination
WO2006083706A3 (en) * 2005-01-31 2007-04-26 Vaxinnate Corp Method to identify polypeptide toll-like receptor (tlr) ligands
EP3498302A1 (en) 2005-02-01 2019-06-19 Novartis Vaccines and Diagnostics S.r.l. Conjugation of streptococcal capsular saccharides to carrier proteins
EP2351772A1 (en) 2005-02-18 2011-08-03 Novartis Vaccines and Diagnostics, Inc. Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
EP2298795A1 (en) 2005-02-18 2011-03-23 Novartis Vaccines and Diagnostics, Inc. Immunogens from uropathogenic escherichia coli
US7767212B2 (en) 2005-03-18 2010-08-03 Cytos Biotechnology Ag CAT allergen conjugates and uses thereof
WO2006136566A1 (en) 2005-06-21 2006-12-28 Cytos Biotechnology Ag Process for the preparative purification of virus-like particles (vlps)
US7476387B2 (en) 2005-07-15 2009-01-13 Chimera Pharma S.L.U. Chimeric empty viral-like particles derived from the infectious bursal disease virus (IBDV), process for their production and applications
EP2431468A1 (en) 2005-09-28 2012-03-21 Cytos Biotechnology AG Interleukin-1 conjugates and uses thereof
EP2357000A1 (en) 2005-10-18 2011-08-17 Novartis Vaccines and Diagnostics, Inc. Mucosal and systemic immunizations with alphavirus replicon particles
EP2360175A2 (en) 2005-11-22 2011-08-24 Novartis Vaccines and Diagnostics, Inc. Norovirus and Sapovirus virus-like particles (VLPs)
EP2385126A1 (en) 2005-11-25 2011-11-09 Novartis Vaccines and Diagnostics S.r.l. Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870
EP2385127A1 (en) 2005-11-25 2011-11-09 Novartis Vaccines and Diagnostics S.r.l. Chimeric, hybrid and tandem polypeptides of meningococcal NMB1870
EP3346009A1 (en) 2005-11-25 2018-07-11 GlaxoSmithKline Biologicals S.A. Chimeric, hybrid and tandem polypeptides of meningococcal nmb1870
WO2007068747A1 (en) * 2005-12-14 2007-06-21 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
AU2006325225B2 (en) * 2005-12-14 2013-07-04 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
US8574564B2 (en) 2005-12-14 2013-11-05 Cytos Biotechnology Ag Immunostimulatory nucleic acid packaged particles for the treatment of hypersensitivity
EP2357184A1 (en) 2006-03-23 2011-08-17 Novartis AG Imidazoquinoxaline compounds as immunomodulators
US8541559B2 (en) 2006-06-12 2013-09-24 Cytos Biotechnology Ag Process for producing aggregated oligonucleotides
EP2530086A1 (en) 2006-06-12 2012-12-05 Cytos Biotechnology AG Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
AU2013204383B2 (en) * 2006-06-12 2016-09-22 Kuros Us Llc Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US9902972B2 (en) * 2006-06-12 2018-02-27 Kuros Biosciences Ag Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
US10358656B2 (en) 2006-06-12 2019-07-23 Kuros Biosciences Ag Oligonucleotides packaged into virus-like particles of RNA bacteriophages
US20150004688A1 (en) * 2006-06-12 2015-01-01 Cytos Biotechnology Ag Processes for Packaging Oligonucleotides Into Virus-Like Particles of RNA Bacteriophages
AU2007260236B2 (en) * 2006-06-12 2013-05-16 Kuros Us Llc Processes for packaging oligonucleotides into virus-like particles of RNA bacteriophages
EP2586790A2 (en) 2006-08-16 2013-05-01 Novartis AG Immunogens from uropathogenic Escherichia coli
US9914746B2 (en) 2006-12-12 2018-03-13 Kuros Biosciences Ag Oligonucleotides containing high concentrations of guanine monomers
US8586728B2 (en) 2006-12-12 2013-11-19 Cytos Biotechnology Ag Oligonucleotides containing high concentrations of guanine monomers
WO2008071774A1 (en) * 2006-12-14 2008-06-19 Cytos Biotechnology Ag Purification process for coat protein of rna bacteriophages
EP2659912A2 (en) 2007-07-17 2013-11-06 Novartis AG Conjugate purification
US9463250B2 (en) 2007-07-17 2016-10-11 Glaxosmithkline Biologicals Sa Conjugate purification
EP2572726A1 (en) 2007-08-01 2013-03-27 Novartis AG Compositions comprising pneumococcal antigens
WO2009034473A2 (en) 2007-09-12 2009-03-19 Novartis Ag Gas57 mutant antigens and gas57 antibodies
EP2891498A1 (en) 2007-12-20 2015-07-08 Novartis AG Fermentation processes for cultivating streptococci and purification processes for obtaining CPS therefrom
EP2537857A2 (en) 2007-12-21 2012-12-26 Novartis AG Mutant forms of streptolysin O
EP3263591A1 (en) 2008-02-21 2018-01-03 GlaxoSmithKline Biologicals S.A. Meningococcal fhbp polypeptides
EP2886551A2 (en) 2008-02-21 2015-06-24 Novartis AG Meningococcal fhbp polypeptides
WO2009138752A3 (en) * 2008-05-15 2010-03-18 Big Dna Ltd Fish vaccine
US10577397B2 (en) 2008-10-03 2020-03-03 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Methods and compositions for protein delivery
US10040830B2 (en) 2008-10-03 2018-08-07 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services Methods and compositions for protein delivery
US8475801B2 (en) 2008-12-09 2013-07-02 Pfizer Vaccines, LCC IgE CH3 peptide vaccine
US8298547B2 (en) 2008-12-09 2012-10-30 Pfizer Vaccines, LLC IgE CH3 peptide vaccine
US9216229B2 (en) 2008-12-09 2015-12-22 Pfizer Vaccines Llc IgE CH3 peptide vaccine
WO2010067286A2 (en) 2008-12-09 2010-06-17 Pfizer Vaccines Llc IgE CH3 PEPTIDE VACCINE
EP2865389A1 (en) 2008-12-09 2015-04-29 Pfizer Vaccines LLC IgE CH3 peptide vaccine
WO2010079464A1 (en) 2009-01-12 2010-07-15 Novartis Ag Cna_b domain antigens in vaccines against gram positive bacteria
EP3549602A1 (en) 2009-03-06 2019-10-09 GlaxoSmithKline Biologicals S.A. Chlamydia antigens
WO2010100632A2 (en) 2009-03-06 2010-09-10 Novartis Ag Chlamydia antigens
EP2510947A1 (en) 2009-04-14 2012-10-17 Novartis AG Compositions for immunising against Staphylococcus aureus
EP3263128A2 (en) 2009-04-14 2018-01-03 GlaxoSmithKline Biologicals S.A. Compositions for immunising against staphylococcus aureus
WO2010122164A1 (en) 2009-04-23 2010-10-28 Cytos Biotechnology Ag VIRUS-LIKE PARTICLES OF BACTERIOPHAGE φCB5
WO2010125202A1 (en) * 2009-04-30 2010-11-04 Cytos Biotechnology Ag Influenza hemagglutinin compositions and uses thereof
WO2011004263A2 (en) 2009-07-07 2011-01-13 Novartis Ag Conserved escherichia coli immunogens
WO2011007257A1 (en) 2009-07-16 2011-01-20 Novartis Ag Detoxified escherichia coli immunogens
EP2837386A1 (en) 2009-07-16 2015-02-18 Novartis AG Detoxified Escherichia coli immunogens
WO2011013034A1 (en) 2009-07-30 2011-02-03 Pfizer Vaccines Llc Antigenic tau peptides and uses thereof
EP3017828A1 (en) 2009-08-27 2016-05-11 GlaxoSmithKline Biologicals SA Hybrid polypeptides including meningococcal fhbp sequences
WO2011024072A2 (en) 2009-08-27 2011-03-03 Novartis Ag Hybrid polypeptides including meningococcal fhbp sequences
WO2011027257A2 (en) 2009-09-03 2011-03-10 Pfizer Vaccines Llc Pcsk9 vaccine
US9987341B2 (en) 2009-09-03 2018-06-05 Pfizer Vaccines Llc PCSK9 vaccine
WO2011027257A3 (en) * 2009-09-03 2011-06-30 Pfizer Vaccines Llc Pcsk9 vaccine
US9481875B2 (en) 2009-09-03 2016-11-01 Pfizer Vaccines Llc PCSK9 vaccine
EP3358008A1 (en) 2009-09-03 2018-08-08 Pfizer Vaccines LLC Pcsk9 vaccine
CN104587462A (en) * 2009-09-03 2015-05-06 辉瑞疫苗有限责任公司 Pcsk9 vaccine
EP2865752A1 (en) 2009-09-03 2015-04-29 Pfizer Vaccines LLC PCSK9 vaccine
US8889144B2 (en) 2009-09-03 2014-11-18 Pfizer Vaccines Llc PCSK9 vaccine
WO2011138636A1 (en) 2009-09-30 2011-11-10 Novartis Ag Conjugation of staphylococcus aureus type 5 and type 8 capsular polysaccharides
WO2011048561A1 (en) 2009-10-20 2011-04-28 Novartis Ag Diagnostic and therapeutic methods for rheumatic heart disease based upon group a streptococcus markers
WO2011051893A1 (en) 2009-10-27 2011-05-05 Novartis Ag Modified meningococcal fhbp polypeptides
WO2011058302A1 (en) 2009-11-10 2011-05-19 Guy's And St Thomas's Nhs Foundation Trust Bacteremia-associated antigen from staphylococcus aureus
WO2011080595A2 (en) 2009-12-30 2011-07-07 Novartis Ag Polysaccharide immunogens conjugated to e. coli carrier proteins
WO2011104632A1 (en) 2010-02-26 2011-09-01 Novartis Ag Immunogenic proteins and compositions
US10526387B2 (en) * 2010-03-16 2020-01-07 Biontech Protein Therapeutics Gmbh Tumor vaccination involving a humoral immune response against self-proteins
WO2011121576A2 (en) 2010-04-01 2011-10-06 Novartis Ag Immunogenic proteins and compositions
WO2011130379A1 (en) 2010-04-13 2011-10-20 Novartis Ag Benzonapthyridine compositions and uses thereof
WO2011149564A1 (en) 2010-05-28 2011-12-01 Tetris Online, Inc. Interactive hybrid asynchronous computer game infrastructure
EP2942061A2 (en) 2010-06-07 2015-11-11 Pfizer Vaccines LLC Ige ch3 peptide vaccine
WO2011154878A1 (en) 2010-06-07 2011-12-15 Pfizer Vaccines Llc Ige ch3 peptide vaccine
US8722053B2 (en) 2010-06-07 2014-05-13 Pfizer Vaccines Llc IgE CH3 peptide vaccine
US9249233B2 (en) 2010-06-07 2016-02-02 Pfizer Vaccines Llc IgE CH3 peptide vaccine
WO2011161551A2 (en) 2010-06-11 2011-12-29 Novartis Ag Omv vaccines
EP3399021A1 (en) 2010-06-11 2018-11-07 GlaxoSmithKline Biologicals S.A. Omv vaccines
EP3611269A1 (en) 2010-07-06 2020-02-19 GlaxoSmithKline Biologicals SA Delivery of self-replicating rna using biodegradable polymer particles
WO2012006359A1 (en) 2010-07-06 2012-01-12 Novartis Ag Delivery of self-replicating rna using biodegradable polymer particles
US9549901B2 (en) 2010-09-03 2017-01-24 The Brigham And Women's Hospital, Inc. Lipid-polymer hybrid particles
WO2012035519A1 (en) 2010-09-16 2012-03-22 Novartis Ag Immunogenic compositions
WO2012072769A1 (en) 2010-12-01 2012-06-07 Novartis Ag Pneumococcal rrgb epitopes and clade combinations
WO2012085668A2 (en) 2010-12-24 2012-06-28 Novartis Ag Compounds
WO2012131504A1 (en) 2011-03-02 2012-10-04 Pfizer Inc. Pcsk9 vaccine
EP3332802A1 (en) 2011-07-06 2018-06-13 GlaxoSmithKline Biologicals SA Immunogenic combination compositions and uses thereof
EP3854413A1 (en) 2011-07-06 2021-07-28 GlaxoSmithKline Biologicals SA Immunogenic combination compositions and uses thereof
WO2013006838A1 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic combination compositions and uses thereof
WO2013006842A2 (en) 2011-07-06 2013-01-10 Novartis Ag Immunogenic compositions and uses thereof
WO2013030783A1 (en) 2011-08-30 2013-03-07 Novartis Ag Immunogenic proteins and compositions
US10105429B2 (en) 2011-09-14 2018-10-23 Glaxosmithkline Biologicals Sa Escherichia coli vaccine combination
US9511130B2 (en) 2011-09-14 2016-12-06 Glaxosmithkline Biologicals Sa Escherichia coli vaccine combination
WO2013038385A2 (en) 2011-09-14 2013-03-21 Novartis Ag Escherichia coli vaccine combination
WO2013084071A2 (en) 2011-12-08 2013-06-13 Novartis Ag Clostridium difficile toxin-based vaccine
WO2013092720A1 (en) 2011-12-22 2013-06-27 F. Hoffmann-La Roche Ag Full length antibody display system for eukaryotic cells and its use
WO2013108272A2 (en) 2012-01-20 2013-07-25 International Centre For Genetic Engineering And Biotechnology Blood stage malaria vaccine
WO2013124473A1 (en) 2012-02-24 2013-08-29 Novartis Ag Pilus proteins and compositions
US10538743B2 (en) 2012-03-26 2020-01-21 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Delivery of packaged RNA to mammalian cells
EP3804749A2 (en) 2012-04-26 2021-04-14 GlaxoSmithKline Biologicals S.A. Antigens and antigen combinations
WO2013160335A2 (en) 2012-04-26 2013-10-31 Novartis Ag Antigens and antigen combinations
US10279026B2 (en) 2012-04-26 2019-05-07 Glaxosmithkline Biologicals Sa Antigens and antigen combinations
US10124051B2 (en) 2012-05-22 2018-11-13 Glaxosmithkline Biologicals Sa Meningococcus serogroup X conjugate
WO2013174832A1 (en) 2012-05-22 2013-11-28 Novartis Ag Meningococcus serogroup x conjugate
WO2014005958A1 (en) 2012-07-06 2014-01-09 Novartis Ag Immunogenic compositions and uses thereof
WO2014053521A2 (en) 2012-10-02 2014-04-10 Novartis Ag Nonlinear saccharide conjugates
WO2014053612A1 (en) 2012-10-03 2014-04-10 Novartis Ag Immunogenic composition
EP3482770A1 (en) 2012-10-03 2019-05-15 GlaxoSmithKline Biologicals S.A. Immunogenic compositions
WO2014053607A1 (en) 2012-10-03 2014-04-10 Novartis Ag Immunogenic compositions
EP4272750A2 (en) 2013-02-07 2023-11-08 Children's Medical Center, Corp. Protein antigens that provide protection against pneumococcal colonization and/or disease
WO2014144211A2 (en) 2013-03-15 2014-09-18 Los Angeles Biomedical Research Institute At Harbor-Ucla Medical Center Compositions and methods for treating fungal and bacterial pathogens
WO2015024992A3 (en) * 2013-08-22 2015-04-30 Cytos Biotechnology Ag Treatment of asthma
US12049639B2 (en) 2013-12-16 2024-07-30 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Cancer immunotherapy by delivering class II MHC antigens using a VLP-replicon
US11718861B2 (en) 2013-12-16 2023-08-08 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Cancer immunotherapy by delivering class II MHC antigens using a VLP-replicon
US10925938B2 (en) 2014-02-11 2021-02-23 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Composition comprising PCSK9 peptide conjugated to a Qbeta carrier and methods of using the same
WO2015123291A1 (en) 2014-02-11 2015-08-20 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Pcsk9 vaccine and methods of using the same
US10279019B2 (en) 2014-02-11 2019-05-07 Stc.Unm PCSK9 peptide vaccine conjugated to a Qbeta carrier and methods of using the same
US11696941B2 (en) 2014-02-11 2023-07-11 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services Compositions comprising a PCSK9 peptide conjugated to a qbeta carrier and methods of using the same
WO2016109310A1 (en) 2014-12-31 2016-07-07 Checkmate Pharmaceuticals, Llc Combination tumor immunotherapy
US10682365B2 (en) 2014-12-31 2020-06-16 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
AU2015374385B2 (en) * 2014-12-31 2020-08-06 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
AU2020223671C1 (en) * 2014-12-31 2024-04-18 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
AU2020223671B2 (en) * 2014-12-31 2023-08-03 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
EP3240801A4 (en) * 2014-12-31 2018-07-25 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
EP3835312A1 (en) 2014-12-31 2021-06-16 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
US10526376B2 (en) 2015-01-15 2020-01-07 University Of Copenhagen Virus-like particle with efficient epitope display
US10086056B2 (en) 2015-01-15 2018-10-02 University Of Copenhagen Virus-like particle with efficient epitope display
US11497800B2 (en) 2015-01-15 2022-11-15 University Of Copenhagen Virus-like particle with efficient epitope display
US11129882B2 (en) 2015-10-30 2021-09-28 University Of Copenhagen Virus like particle with efficient epitope display
WO2017173334A1 (en) 2016-04-01 2017-10-05 Checkmate Pharmaceuticals, Inc. Fc receptor-mediated drug delivery
WO2017186808A1 (en) 2016-04-27 2017-11-02 Allergy Therapeutics (Uk) Limited Treatment of peanut allergy
WO2017186813A1 (en) 2016-04-27 2017-11-02 Benchmark Animal Health Ltd. Treatment of canine atopic dermatitis
WO2018104889A1 (en) 2016-12-06 2018-06-14 Glaxosmithkline Biologicals Sa Purification process for capsular polysaccharide
US10954259B1 (en) 2017-10-09 2021-03-23 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US10947257B2 (en) 2017-10-09 2021-03-16 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US12459965B2 (en) 2017-10-09 2025-11-04 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US12312375B2 (en) 2017-10-09 2025-05-27 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US10519175B2 (en) 2017-10-09 2019-12-31 Compass Pathways Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11447510B2 (en) 2017-10-09 2022-09-20 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11149044B2 (en) 2017-10-09 2021-10-19 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11505564B2 (en) 2017-10-09 2022-11-22 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11939346B2 (en) 2017-10-09 2024-03-26 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11851451B2 (en) 2017-10-09 2023-12-26 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11629159B2 (en) 2017-10-09 2023-04-18 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US11180517B2 (en) 2017-10-09 2021-11-23 Compass Pathfinder Limited Preparation of psilocybin, different polymorphic forms, intermediates, formulations and their use
US12246031B2 (en) 2018-02-13 2025-03-11 Checkmate Pharmaceuticals, Inc. Compositions and methods for tumor immunotherapy
US11633471B2 (en) 2018-03-06 2023-04-25 Unm Rainforest Innovations Compositions and methods for reducing serum triglycerides
US12084655B2 (en) 2018-04-09 2024-09-10 Checkmate Pharmaceuticals Packaging oligonucleotides into virus-like particles
WO2019197965A1 (en) 2018-04-09 2019-10-17 Checkmate Pharmaceuticals Packaging oligonucleotides into virus-like particles
US12123003B2 (en) 2018-04-19 2024-10-22 Checkmate Pharmaceuticals, Inc. Synthetic RIG-I-like receptor agonists
EP3835414A4 (en) * 2018-08-07 2022-05-25 Institute Of Biophysics, Chinese Academy Of Sciences CD4+ T LYMPHOCYTE ACTIVATION METHOD
WO2020128037A1 (en) 2018-12-20 2020-06-25 Saiba Gmbh Virus-like particles of cmv modified by fusion
US11564935B2 (en) 2019-04-17 2023-01-31 Compass Pathfinder Limited Method for treating anxiety disorders, headache disorders, and eating disorders with psilocybin
US12611418B2 (en) 2019-04-17 2026-04-28 Compass Pathfinder Limited Methods for treating anxiety disorders, headache disorders, and eating disorders with psilocybin
US12377112B2 (en) 2019-04-17 2025-08-05 Compass Pathfinder Limited Methods of treating neurocognitive disorders, chronic pain and reducing inflammation
US11738035B2 (en) 2019-04-17 2023-08-29 Compass Pathfinder Limited Method for treating anxiety disorders, headache disorders, and eating disorders with psilocybin
US12447164B2 (en) 2019-04-17 2025-10-21 Compass Pathfinder Limited Method for treating anxiety disorders, headache disorders, and eating disorders with psilocybin
US12433904B2 (en) 2019-04-17 2025-10-07 Compass Pathfinder Limited Methods for treating anxiety disorders, headache disorders, and eating disorders with psilocybin
US12161710B2 (en) 2019-07-24 2024-12-10 Unm Rainforest Innovations Malaria immunogen and methods for using same
WO2021016509A1 (en) * 2019-07-24 2021-01-28 Unm Rainforest Innovations Malaria immunogen and methods for using same
WO2021081353A1 (en) 2019-10-23 2021-04-29 Checkmate Pharmaceuticals, Inc. Synthetic rig-i-like receptor agonists
WO2021252450A1 (en) * 2020-06-08 2021-12-16 Adaptive Phage Therapeutics, Inc. Phage display vaccine for covid-19 using a novel peptide sequence
WO2021250628A1 (en) 2020-06-12 2021-12-16 Glaxosmithkline Biologicals Sa Bacterial immunization using nanoparticle vaccine
WO2021260131A1 (en) 2020-06-25 2021-12-30 Saiba AG Virus-like particles of cmv modified by fusion
US12121574B2 (en) * 2021-09-28 2024-10-22 Unm Rainforest Innovations Malaria immunogen and methods for using same
US20230102159A1 (en) * 2021-09-28 2023-03-30 Unm Rainforest Innovations Malaria immunogen and methods for using same
WO2023111826A1 (en) 2021-12-14 2023-06-22 Glaxosmithkline Biologicals Sa Bacterial immunization using qbeta hairpin nanoparticle constructs
US12060328B2 (en) 2022-03-04 2024-08-13 Reset Pharmaceuticals, Inc. Co-crystals or salts of psilocybin and methods of treatment therewith
US12559458B2 (en) 2022-03-04 2026-02-24 Reset Pharmaceuticals, Inc. Co-crystals or salts of psilocin and methods of treatment therewith
WO2024047090A2 (en) 2022-08-30 2024-03-07 Saiba Animal Health Ag Modified virus-like particles of cmv
WO2024047091A2 (en) 2022-08-30 2024-03-07 Saiba Animal Health Ag Veterinary compositions of modified virus-like particles of cmv and ngf antigens
US12162916B2 (en) 2022-08-31 2024-12-10 Unm Rainforest Innovations Compositions targeting apoptosis-associated speck-like protein with caspase activation and recruitment domain (ASC) and methods of use
WO2024091589A1 (en) * 2022-10-28 2024-05-02 Unm Rainforest Innovations Malaria immunogen and methods for using same
WO2025186188A1 (en) 2024-03-04 2025-09-12 Boehringer Ingelheim Vetmedica Gmbh Active vaccination for the treatment of ngf-related disorders
WO2025186316A1 (en) 2024-03-06 2025-09-12 Elanco Us Inc. Veterinary compositions of modified virus-like particles of cmv and il-1beta mutein antigens
WO2025186318A2 (en) 2024-03-06 2025-09-12 Elanco Us Inc. Veterinary compositions of modified virus-like particles of cmv and feline il-1beta mutein antigens
WO2025186317A1 (en) 2024-03-06 2025-09-12 Elanco Us Inc. Veterinary compositions of modified virus-like particles of cmv and canine il-1beta mutein antigens
WO2025242657A1 (en) 2024-05-21 2025-11-27 Shape Biopharmaceuticals Ag Lipopeptide building blocks and aggregates

Also Published As

Publication number Publication date
CN1599623A (en) 2005-03-23
ATE447967T1 (en) 2009-11-15
CN1599623B (en) 2011-05-11
EP2196217A1 (en) 2010-06-16
JP2009197001A (en) 2009-09-03
JP4516748B2 (en) 2010-08-04
US9950055B2 (en) 2018-04-24
AU2002339224B2 (en) 2008-10-09
EP1450856A2 (en) 2004-09-01
US20030099668A1 (en) 2003-05-29
AU2009200115B2 (en) 2012-05-03
CA2492826A1 (en) 2003-03-27
DK1450856T3 (en) 2010-05-31
JP2005517632A (en) 2005-06-16
EP1450856B1 (en) 2009-11-11
AU2009200115A1 (en) 2009-02-05
CA2492826C (en) 2016-12-13
US20150030620A1 (en) 2015-01-29
WO2003024481A3 (en) 2004-06-03
DE60234375D1 (en) 2009-12-24
US8691209B2 (en) 2014-04-08
CY1110585T1 (en) 2015-04-29
US20120301499A1 (en) 2012-11-29
JP4749475B2 (en) 2011-08-17
ES2335979T3 (en) 2010-04-07
HK1067058A1 (en) 2005-04-01

Similar Documents

Publication Publication Date Title
AU2009200115B2 (en) Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US7517520B2 (en) Packaging of immunostimulatory oligonucleotides into virus-like particles: method of preparation and use
US20180015160A1 (en) In Vivo Activation of Antigen Presenting Cells for Enhancement of Immune Responses Induced by Virus-Like Particles
AU2002339224A1 (en) Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US20110097417A1 (en) Melan-a-carrier conjugates
WO2004000351A1 (en) Packaged virus-like particles for use as adjuvants: method of preparation and use
HK1067058B (en) Packaging of immunostimulatory cpg into virus-like particles: method of preparation and use

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2002777600

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2492826

Country of ref document: CA

Ref document number: 20028179358

Country of ref document: CN

Ref document number: 2002339224

Country of ref document: AU

Ref document number: 551/CHENP/2004

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2003528575

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2002777600

Country of ref document: EP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)