WO2003023006A2 - Hemocyanin nucleic acids and polypeptides and related vectors, fusion proteins, conjugates, cells and methods of use - Google Patents
Hemocyanin nucleic acids and polypeptides and related vectors, fusion proteins, conjugates, cells and methods of use Download PDFInfo
- Publication number
- WO2003023006A2 WO2003023006A2 PCT/US2002/028581 US0228581W WO03023006A2 WO 2003023006 A2 WO2003023006 A2 WO 2003023006A2 US 0228581 W US0228581 W US 0228581W WO 03023006 A2 WO03023006 A2 WO 03023006A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- klh
- isolated
- nucleic acid
- seq
- acid molecule
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
Definitions
- the present invention relates to an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence encoding keyhole limpet hemocyanin (KLH) and related nucleic acid molecules, vectors, cells, polypeptides, conjugates, fusion proteins and compositions; methods of treating cancer, pathogenic infection, and high blood pressure; methods of stimulating an immune response; and an isolated or purified nucleic acid molecule consisting essentially of the KLH leader sequence, optionally fused to an isolated or purified nucleic acid molecule encoding a polypeptide or protein, and related vectors and cells.
- KLH keyhole limpet hemocyanin
- KLH Megathura crenulata.
- KLH-1 and KLH-2 are two isoforms of KLH, namely KLH-1 and KLH-2.
- KLH is clinically used as an immunotherapeutic agent, specifically in the treatment of bladder cancer (Jurincic et al., J. Urol. 139: 723-726 (1988); and Swerdlow et al., J. Urol. 151: 1718-1722 (1994)).
- KLH is believed to be potentially useful in the treatment of other carcinomas, such as the epithelial-derived adenocarcinomas, when used as a carrier for mucin-like epitopes and carcinoma ganglioside (Harris et al., Micron 30: 597- 623 (1999)).
- KLH is also widely used as a hapten carrier and as a generalized vaccine component, such as in a vaccine for AIDS (Naylor et al., Int. J. Immunopharmacol. 13 Suppl. 1:117-127 (1991)) and for the prophylaxis of cocaine abuse (Bagasra et al., Immunopharmacology 23(3): 173- 179 ( 1992)). It is also used in the diagnosis of Schistosomiasis (Grzych et al., J. Exp. Med. 165: 865-878 (1987); Markl et al., Naturwissenschaften 78: 30-31 (1991); and Wishahi et al., J. Urol.
- KLH is currently isolated from Megathura crenu ata maintained under mariculture conditions, or from naturally occurring organisms in the ocean. Maintaining and or obtaining M. crenuiata under such conditions is difficult, costly and/or unreliable.
- Markl et al. WO 00/55192 and WO 01/14536
- the present invention provides an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence encoding KLH-2 or a fragment thereof comprising at least 1,080 contiguous nucleotides.
- an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence that is complementary to a nucleotide sequence encoding KLH-2 or a fragment thereof comprising at least 1,080 contiguous nucleotides.
- the present invention provides an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence encoding KLH-1 or a fragment thereof comprising at least 2,300 contiguous nucleotides.
- nucleic acid molecule consisting essentially of a nucleotide sequence that is complementary to a nucleotide sequence encoding KLH-1 or a fragment thereof comprising at least 2,300 contiguous nucleotides.
- the present invention further provides a vector comprising such an isolated or purified nucleic acid.
- the isolated or purified nucleic acid molecule consists essentially of a nucleotide sequence encoding KLH or a fragment thereof, the nucleotide sequence is optionally part of an encoded fusion protein.
- the present invention provides a cell comprising and expressing an above-described isolated or purified nucleic acid molecule.
- the isolated or purified nucleic acid molecule is optionally in the form of a vector.
- an isolated or purified polypeptide molecule consisting essentially of an amino acid sequence encoding KLH-2 or at least 360 contiguous amino acids of KLH-2, either one of which is optionally glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated or converted into an acid addition salt and/or dimerized or polymerized.
- the isolated or purified polypeptide molecule is essentially free from KLH-1.
- an isolated or purified polypeptide molecule consisting essentially of an amino acid sequence encoding KLH-1 or at least 770 contiguous amino acids of KLH-1, either one of which is optionally glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated or converted into an acid addition salt and/or dimerized or polymerized.
- the isolated or purified polypeptide molecule is essentially free from KLH-2.
- the present invention provides a composition comprising the isolated or purified polypeptide molecule, optionally in the form of a conjugate or a fusion protein comprising a therapeutically or prophylactically active agent, and an excipient or adjuvant.
- Still further provided by the present invention is a method of treating cancer prophylactically or therapeutically in a mammal.
- the method comprises administering to the mammal an effective amount of: (a) an isolated or purified nucleic acid molecule encoding a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) an antigen of the cancer, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector, (b) a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) an antigen of the cancer,
- a conjugate comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the cancer or an anti-cancer agent, or
- composition comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the cancer and/or an anti-cancer agent, whereupon the mammal is treated for the cancer prophylactically or therapeutically.
- Yet still further provided by the present invention is a method of treating a mammal prophylactically or therapeutically for a pathogenic infection.
- the method comprises admimstering to the mammal an effective amount of:
- an isolated or purified nucleic acid molecule encoding a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) an antigen of the pathogen, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector, (b) a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) an antigen of the pathogen,
- a conjugate comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the pathogen or an anti-pathogen agent, or (d) a composition comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the pathogen and/or an anti-pathogen agent, wherein the
- Methods of stimulating an immune response in a mammal are also provided by the present invention.
- the method comprises administering to the mammal an effective amount of:
- an isolated or purified polypeptide molecule consisting essentially of an amino acid sequence encoding KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, whereupon an immune response in the mammal is stimulated.
- the method comprises stimulating an immune response to an antigen in a mammal by administering to the mammal an effective amount of dendritic cells which have been previously isolated from the mammal and treated in vitro with: (a) a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) an antigen, (b) a conjugate comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen, or
- composition comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen, whereupon an immune response to the antigen is induced in the mammal.
- a method of treating high blood pressure in a mammal comprises administering to the mammal an effective amount of: (a) an isolated or purified nucleic acid molecule encoding a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) hemocyanin ⁇ - adrenergic receptor peptide, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector,
- a fusion protein comprising (i) KLH or an irnmunogenic fragment thereof, and (ii) hemocyanin ⁇ -adrenergic receptor peptide,
- composition comprising (i) (a) KLH-2 or an irnmunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH- 2 is essentially free from KLH-1, or (b) KLH-1 or an irnmunogenic fragment thereof comprising at least 770 amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) hemocyanin ⁇ -adrenergic receptor peptide, whereupon the mammal is treated for high blood pressure prophylactically or therapeutically.
- a method of identifying an irnmunogenic portion of KLH comprises: (i) contacting antigen-presenting cells with KLH or a portion thereof,
- An isolated or purified nucleic acid molecule consisting essentially of the nucleotide sequence encoding the leader sequence of KLH is also provided.
- An isolated or purified nucleic acid molecule consisting essentially of the aforementioned isolated or purified nucleic acid molecule coupled 5' to an isolated or purified nucleic acid molecule encoding a polypeptide or protein, optionally in the form of a vector is also provided.
- secretion of the encoded polypeptide or protein by the eukaryotic cell results.
- a eukaryotic cell comprising and expressing such an isolated or purified nucleic acid molecule is also provided.
- FIG. 1 represents the nucleotide (SEQ ID NO: 1 (coding); SEQ ID NO: 2 (complementary)) and deduced amino acid (SEQ ID NO: 3) sequences of KLH-2.
- Fig. 2 represents the nucleotide (SEQ ID NO: 4 (coding); SEQ ID NO: 5
- Fig. 7 represents the nucleotide (SEQ ID NO: 28 (coding); SEQ ID NO: 29 (complementary)) and deduced amino acid (SEQ ID NO: 30) sequences of KLH-1 with the leader sequence.
- Fig. 8 represents the nucleotide (SEQ ID NO: 31 (coding); SEQ ID NO: 32 (complementary)) and deduced amino acid (SEQ ID NO: 33) sequences of the 5' untranslated region, the coding region, and the 3' untranslated region of KLH-1.
- nucleic acid molecule is intended to encompass a polymer of DNA or RNA, i.e., a polynucleotide, which can be single-stranded or double-stranded and which can contain non-natural or altered nucleotides. Desirably, the isolated or purified nucleic acid molecule does not contain any introns or portions thereof.
- the fragment can be substantially smaller than 1,080 contiguous nucleotides (e.g., a fragment encoding a single epitope, such as an immunogenic epitope (e.g., an epitope that induces an immune response in a mammal)), and all fragments, irrespective of length (e.g., 1,050, 1,025, 1,000, 900, 800, 700, 600, 500, 475, 450, 425, 400, 375, 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 50, 25, 20, and 12- 15) and unique to nucleotides 1-1,530 or nucleotides 9,012-10,206 of SEQ ID NO: 1 or nucleotides
- fragment that is unique to SEQ ID NO: 1 is that which spans nucleotides 7,472-7,495 of SEQ ID NO: 1, and all fragments, irrespective of length and unique to nucleotides 7,472-7,495 of SEQ ID NO: 1, are also contemplated.
- fragments unique to KLH-2 can overlap the aforementioned regions in whole or in part and extend into adjoining regions of SEQ ID NO: 1.
- fragments unique to KLH-1 can overlap the aforementioned regions in whole or in part and extend into adjoining regions of SEQ ID NO: 22.
- the isolated or purified nucleic acid molecule that consists essentially of a nucleotide sequence encoding KLH-1 or a fragment thereof (i) encodes the amino acid sequence of SEQ ID NO: 24 or at least 770 (or at least 800, 825, 850, 875 or 900 or more) contiguous amino acids of SEQ ID NO: 24, (ii) consists essentially of the nucleotide sequence of SEQ ID NO: 22 or a fragment thereof comprising at least 2,300 contiguous nucleotides, (iii) hybridizes under moderately stringent conditions to an isolated or purified nucleic acid molecule consisting essentially of the nucleotide sequence that is complementary to SEQ ID NO: 22 or a fragment thereof comprising at least 2,300 (or at least 2,325, 2,350, 2,375, 2,400 or more) contiguous nucleotides, or (iv) shares 65% (or 70%, 75, 80%, 85%, 90% or 95%) or more identity with SEQ ID NO: 24 or
- Functional unit A of KLH-1 comprises amino acids 1-420 (SEQ ID NO: 24), nucleotides 1-1,260 (SEQ ID NO: 22), whereas functional unit A of KLH-2 comprises amino acids 1-422 (SEQ ID NO: 3), nucleotides 1-1,266 (SEQ ID NO: 1).
- Functional unit H of KLH-1 comprises amino acids 2,899-3,398 (SEQ ID NO: 24), nucleotides 8,695-10,197 (SEQ ID NO: 22), whereas functional unit H of KLH-2 comprises amino acids 2,905-3,401 (SEQ ID NO: 3), nucleotides 8,713-10,206 (SEQ ID NO: 1).
- Functional unit B of KLH-1 comprises amino acids 421-509 (SEQ ID NO: 24), nucleotides 1 ,261 - 1 ,527 (SEQ ID NO: 22), whereas functional unit B of KLH-2 comprises amino acids 423-510 (SEQ ID NO: 3), nucleotides 1,267-1,530 (SEQ ID NO: 1).
- Functional unit G of KLH-1 comprises amino acids 2,659-2,898 (SEQ ID NO: 24), nucleotides 7,975-8,694 (SEQ ID NO: 22).
- An isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence encoding a variant KLH-2, or a fragment thereof comprising at least 1,080 (or at least 1,100, 1,125, 1,150, 1,175, or 1,200 or more) contiguous nucleotides, comprises one or more insertions, deletions, substitutions and/or inversions.
- the variant KLH-2 does not differ functionally from the corresponding unmodified KLH-2, such as that comprising SEQ ID NO: 3.
- the variant KLH-2 functions as an immunogen at least about 50%, more preferably at least about 75%, most preferably at least about 90% as well as the unmodified KLH-2 comprising SEQ ID NO: 3 as determined by an in vitro immunogenic assay.
- the manner in which the assay is carried out is not critical and can be conducted in accordance with methods known in the art.
- the one or more substitution(s) results in the substitution of an amino acid of the encoded KLH-2 with another amino acid of approximately equivalent mass, structure and/or charge.
- a preferred variant KLH-2 comprises a deletion of all or part of the leader sequence, i.e., SEQ ID NO: 4, such that the encoded variant KLH-2 cannot be secreted by a cell.
- An isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence encoding a variant KLH-1, or a fragment thereof comprising at least 2,300 (or at least 2,325, 2,350, 2,375, 2,400 or more) contiguous nucleotides, comprises one or more insertions, deletions, substitutions and/or inversions.
- the variant KLH-1 does not differ functionally from the corresponding unmodified KLH-1, such as that comprising SEQ ID NO: 24.
- the variant KLH-1 functions as an immunogen at least about 50%, more preferably at least about 75%, most preferably at least about 90% as well as the unmodified KLH-1 comprising SEQ ID NO: 24 as determined by an in vitro immunogenic assay.
- the manner in which the assay is carried out is not critical and can be conducted in accordance with methods known in the art.
- the one or more substitution(s) results in the substitution of an amino acid of the encoded KLH-1 with another amino acid of approximately equivalent mass, structure and/or charge.
- a preferred variant KLH-1 comprises a deletion of all or part of the leader sequence, i.e., SEQ ID NO: 25, such that the encoded variant KLH-2 cannot be secreted by a cell.
- the present invention also provides an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence that is complementary to a nucleotide sequence encoding KLH-2 or a fragment thereof comprising at least 1,080 (or at least 1,100, 1,125, 1,150, 1,175, or 1,200 or more) contiguous nucleotides.
- Such an isolated or purified nucleic acid molecule preferably (i) is complementary to a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 3 or at least 360 (or at least 375, 400, 425 or 450 or more) contiguous amino acids of SEQ ID NO: 3, (ii) is complementary to the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof comprising at least 1,080 contiguous nucleotides, (iii) hybridizes under moderately stringent conditions to an isolated or purified nucleic acid molecule consisting essentially of SEQ ID NO: 1 or a fragment thereof comprising at least 1,080 contiguous nucleotides and is characterized by no more than 40% mismatch, or (iv) shares 60% (or 65%, 70%, 75, 80%, 85%, 90% or 95%) or more identity with the nucleotide sequence that is complementary to SEQ ID NO : 1.
- the present invention provides an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence that is complementary to a nucleotide sequence encoding KLH-1 or a fragment thereof comprising at least 2,300 (or at least 2,325, 2,350, 2,375, 2,400 or more) contiguous nucleotides.
- Such an isolated or purified nucleic acid molecule preferably (i) is complementary to a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 24 or at least 770 (or at least 800, 825, 850, 875, 900 or more) contiguous amino acids of SEQ ID NO: 24, (ii) is complementary to the nucleotide sequence of SEQ ID NO: 22 or a fragment thereof comprising at least 2,300 contiguous nucleotides, (iii) hybridizes under moderately stringent conditions to an isolated or purified nucleic acid molecule consisting essentially of SEQ ID NO: 22 or a fragment thereof comprising at least 2,300 contiguous nucleotides and is characterized by no more than 35% mismatch, or (iv) shares 65 % (or 70%, 75, 80%, 85%, 90% or 95%) or more identity with the nucleotide sequence that is complementary to SEQ ID NO: 22.
- An isolated or purified nucleic acid molecule can consist essentially of a nucleotide sequence that is complementary to either of a nucleotide sequence encoding a variant KLH-2 or at least 360 (or at least 375, 400, 425 or 450 or more) contiguous amino acids of a variant KLH-2 as described above.
- an isolated or purified nucleic acid molecule can consist essentially of a nucleotide sequence that is complementary to either of a nucleotide sequence encoding a variant KLH-1 or at least 770 (or at least 800, 825, 850, 875 or 900 or more) contiguous amino acids of a variant KLH-1 as described above.
- any such insertions, deletions, substitutions and/or inversions are introduced into the nucleotide sequence encoding the regions between the copper-binding domains of KLH or a variant thereof. It is also preferred that the one or more substitution(s) result(s) in the substitution of an amino acid with another amino acid of approximately equivalent size, shape and charge.
- Insertions, deletions, substitutions and/or inversions also can be introduced into one or more of the copper-binding domains. If such mutations are introduced into the nucleotide sequences encoding one or more of the copper-binding domains, desirably not all such domains are mutated and those copper-binding domains that are mutated are located at the N-terminal or C-terminal ends of KLH.
- variant KLH has activity characteristic of the unmodified KLH. In other words, it can induce an immune response in a mammal, resulting in the production of a specific antibody that can be measured by standard immunoassay techniques known in the art.
- the variant KLH can be more or less active than the unmodified KLH as desired in accordance with the present invention.
- An indication that polynucleotide sequences are substantially identical is if two molecules selectively hybridize to each other under stringent conditions.
- hybridizes to refers to the selective binding of a single-stranded nucleic acid probe to a single-stranded target DNA or RNA sequence of complementary sequence when the target sequence is present in a preparation of heterogeneous DNA and/or RNA.
- Stringent conditions are sequence-dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 20°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
- hybridization is preferably carried out using a standard hybridization buffer at a temperature ranging from about 50°C to about 75°C, from about 60°C to about 70°C, or from about 65°C to about 68°C.
- formamide can be included in the hybridization reaction, and the temperature of hybridization can be reduced to from about 35°C to about 45°C, from about 40°C to about 45°C, or to about 42°C.
- formamide is included in the hybridization reaction at a concentration of from about 30% to about 50%, preferably from about 35% to about 45%, and optimally at about 40%.
- hybridization conditions :
- washing conditions 100 ⁇ g/ml salmon sperm DNA 10 ⁇ g/ml salmon sperm DNA hybridization at 65-68 °C hybridization at 58-64 °C Highly stringent Moderately stringent washing conditions: washing conditions:
- highly stringent conditions allow for up to about 20% mismatch, preferably up to about 15% mismatch, more preferably up to about 10% mismatch, and most preferably less than about 5% mismatch, such as 4%, 3%, 2% or 1% mismatch.
- At least moderately stringent conditions preferably allow for up to about 40% mismatch, more preferably up to about 30% mismatch, and most preferably up to about 20% mismatch.
- Low stringency conditions preferably allow for up to about 60% mismatch, more preferably up to about 50% mismatch, and most preferably up to about 40% mismatch. With respect to the preceding ranges of mismatch, 1% mismatch corresponds to one degree decrease in the melting temperature.
- nucleic acid molecules also can be characterized in terms of "percentage of sequence identity.”
- a given nucleic acid molecule as described above can be compared to a nucleic acid molecule encoding a corresponding gene (i.e., the reference sequence) by optimally aligning the nucleic acid sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence, which does not comprise additions or deletions, for optimal alignment of the two sequences.
- the percentage of sequence identity is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences, i.e., the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
- Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI, or BlastN and BlastX available from the National Center for Biotechnology Information, Bethesda, MD), or by inspection. Sequences are typically compared using BESTFIT or BlastN with default parameters.
- Substantial sequence identity means that at least 75%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% (such as 96%, 97%, 98% or 99%) of the sequence of a given nucleic acid molecule is identical to a given reference sequence.
- two polypeptides are considered to be substantially similar if at least 40%, preferably at least 60%, more preferably at least 90%, and most preferably at least 95% (such as 96%, 97%, 98% or 99%) of the amino acids of which the polypeptides are comprised are identical to or represent conservative substitutions of the amino acids of a given reference sequence.
- polynucleotide sequences can be substantially different at the nucleic acid level, yet encode substantially similar, if not identical, amino acid sequences, due to the degeneracy of the genetic code.
- the present invention is intended to encompass such polynucleotide sequences.
- nucleic acid molecules can be isolated or purified, alternatively they can be synthesized. Methods of nucleic acid synthesis are known in the art. See, e.g., the references cited herein under "Example.”
- nucleic acid molecules can be used, in whole or in part (i.e., as fragments or primers), to identify and isolate corresponding genes from other organisms for use in the context of the present inventive methods using conventional means known in the art. See, for example, the references cited herein under "Examples.” Evolutionarily conserved portions of the sequence given in SEQ ID NO:l or SEQ ID NO: 22, for example, can be used to identify highly related hemocyanin nucleic acids, such as in Rapana thomasiana and Megathura crenuiata, among others. In addition, the above-described nucleic acid molecules (or fragments thereof) can be used as probes to identify limpet cells that produce KLH.
- the vector comprises regulatory sequences, such as transcription and translation initiation and termination codons, which are specific to the type of host (e.g., bacterium, fungus, plant or animal) into which the vector is to be introduced, as appropriate and taking into consideration whether the vector is DNA or RNA.
- the vector comprises regulatory sequences that are specific to the genus of the host.
- the vector comprises regulatory sequences that are specific to the species of the host.
- Constructs of vectors which are circular or linear, can be prepared to contain an entire nucleic acid sequence as described above or a portion thereof ligated to a replication system functional in a prokaryotic or eukaryotic host cell.
- Replication systems can be derived from ColEl, 2 m ⁇ plasmid, ⁇ , SV40, bovine papilloma virus, and the like.
- Suitable vectors include those designed for propagation and expansion or for expression or both.
- a preferred cloning vector is selected from the group consisting of the pUC series the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
- Bacteriophage vectors such as ⁇ GTIO, ⁇ GTl 1, ⁇ ZapII (Stratagene), ⁇ EMBL4, and ⁇ NM1149, also can be used.
- Examples of plant expression vectors include pBHOl, pBI101.2, ⁇ BI101.3, ⁇ BI121 and ⁇ BIN19 (Clontech).
- Examples of animal expression vectors include pEUK-Cl, pMAM and pMAMneo (Clontech).
- An expression vector can comprise a native or normative promoter operably linked to an isolated or purified nucleic acid molecule as described above. The selection of promoters, e.g., strong, weak, inducible, tissue-specific and developmental-specific, is within the skill in the art. Similarly, the combining of a nucleic acid molecule as described above with a promoter is also within the skill in the art.
- the isolated or purified nucleic acid molecule can be part of an encoded fusion protein.
- the generation of fusion proteins is within the ordinary skill in the art (see, e.g., references cited under "Example") and can involve the use of restriction enzyme or recombinational cloning techniques (see, e.g., Gateway TM (Invitrogen, Carlsbad, CA). See, also, U.S. Patent No. 5,314,995.
- the present invention provides a host cell comprising and expressing an isolated or purified nucleic acid molecule, optionally in the form of a vector, as described above.
- host cells include, but are not limited to, a human cell, a human cell line, E. coli (e.g., E. coli TB-1, TG-2, DH5 ⁇ , XL-Blue MRF' (Stratagene), SA2821 and Y 1090), B. subtilis, P. aerugenosa, S. cerevisiae, N. crassa, insect cells (e.g., Sf9, Ea4) and others set forth herein below.
- E. coli e.g., E. coli TB-1, TG-2, DH5 ⁇ , XL-Blue MRF' (Stratagene), SA2821 and Y 1090
- B. subtilis B. subtilis
- P. aerugenosa S. cerevisiae
- N. crassa insect cells
- the present invention further provides an isolated or purified polypeptide molecule consisting essentially of an amino acid sequence encoding KLH-2 or at least 360 (or at least 375, 400, 425 or 450 or more) contiguous amino acids of KLH-2, which is optionally glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated or converted into an acid addition salt and/or dimerized or polymerized, wherein the isolated or purified polypeptide molecule is essentially free from KLH-1.
- polypeptide molecule consisting essentially of an amino acid sequence encoding KLH-1 or at least 770 (or at least 800, 825, 850, 875 or 900 or more) contiguous amino acids of KLH-1, which is optionally glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated or converted into an acid addition salt and/or dimerized or polymerized, wherein the isolated or purified polypeptide molecule is essentially free from KLH-2.
- polymerized is meant at least trimerized.
- Especially preferred polymers include decamers and didecamers.
- the fragment can be substantially smaller than 360 contiguous amino acids (e.g., a fragment comprising a single epitope, such as an immunogenic epitope (e.g., an epitope that induces an immune response in a mammal)), and all fragments, irrespective of length (e.g., 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 50, 25, 20, 15, 10, and 4-5) and unique to amino acids 1-510 or amino acids 3,004-3,401 of SEQ ID NO: 3, are contemplated by the present invention.
- a fragment comprising a single epitope such as an immunogenic epitope (e.g., an epitope that induces an immune response in a mammal)
- all fragments irrespective of length (e.g., 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 50, 25, 20, 15, 10, and 4-5) and unique to amino acids 1-510 or amino
- fragments that are unique to SEQ ID NO: 3 are those that span amino acids 2,491-2,498 and 2,892-2,907 of SEQ ID NO: 3.
- fragments unique to KLH-2 can overlap the aforementioned regions in whole or in part and extend into adjoining regions of SEQ ID NO: 3.
- the fragment can be substantially smaller than 770 continguous amino acids (e.g., a fragment comprising a single epitope, such as an immunogenic epitope (e.g., an epitope that induces an immune response in a mammal)), and all fragments, irrespective of length (e.g., 750, 725, 700, 675, 650, 625, 600, 575, 550, 525, 500, 475, 450, 425, 400, 375, 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 50, 25, 20, 15, 10, and 4-5) and unique to amino acids 1-509 or amino acids 2,659-3,398 of SEQ ID NO: 24 are contemplated by the present invention.
- fragments unique to KLH-1 can overlap the aforementioned regions in whole or in part and
- one or more fragments of KLH-2 such as from amino acids 1-510 or amino acids 3,004-3,401 of SEQ ID NO: 3
- one or more fragments of KLH-1 such as from amino acids 1- 509 or amino acids 2,659-3,398 of SEQ ID NO: 24.
- Such combinations of fragments can be generated at the nucleic acid or amino acid level in accordance with methods known in the art.
- An isolated or purified polypeptide molecule can consist essentially of an amino acid sequence encoding a variant KLH-2 or at least 360 (or at least 375, 400, 425 or 450 or more) contiguous amino acids of a variant KLH-2, which is optionally glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, converted into an acid addition salt and/or dimerized or polymerized, wherein the isolated or purified polypeptide molecule is essentially free from KLH-1.
- an isolated or purified polypeptide molecule can consist essentially of an amino acid sequence encoding a variant KLH-1 or at least 770 (or at least 800, 825, 850, 875 or 900 or more) contiguous amino acids of a variant KLH-1, which is optionally glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, converted into an acid addition salt and/or dimerized or polymerized, wherein the isolated or purified polypeptide molecule is essentially free from KLH-2.
- the present invention also provides fragments thereof comprising at least one epitope that can bind to a receptor on the surface of a cell that functions in cellular immunity, such as a T cell or a B cell.
- a receptor on the surface of a cell that functions in cellular immunity
- Such fragments can consist essentially of from about 5 to about 8 amino acids, from about 10 to about 16 amino acids, from about 20 to about 30 amino acids, or can comprise substantially more amino acids.
- the fragments can be readily generated by the ordinarily skilled artisan in accordance with methods known in the art. The ability of such fragments to bind to a receptor on the surface of a cell that functions in cellular immunity also can be determined in accordance with methods known in the art.
- the fragments can comprise from about 5 to about 8 amino acids or more in the following regions of SEQ ID NO: 3: amino acids 1-510, 539-543, 823-827, 1,655-1,660, 2,491- 2,498, 2,892-2,907, and 3,004-3,401 or in the following regions of SEQ ID NO: 24: amino acids 1-509 and 2,659-3,398. These regions are exemplary and are not limiting.
- Functional units of KLH can be determined by N-terminal sequence analysis of proteolytic cleavage products. See, e.g., Harris et al., Micron 30: 597-623 (1999).
- contacting antigen-presenting cells with KLH or a portion thereof contacting antigen-presenting cells with KLH or a portion thereof, (ii) harvesting the antigen-presenting cells that have been contacted with KLH or a portion thereof, (iii) purifying complexes of major histocompatibility complex (MHC) and peptidic fragments derived from KLH from the harvested antigen-presenting cells, (iv) isolating the peptidic fragments from the purified complexes, and (v) analyzing the peptidic fragments to determine which fragments were bound to MHC, whereupon an immunogenic portion of KLH is identified.
- MHC major histocompatibility complex
- the method can be conducted in vitro or in vivo. If conducted in vivo, a preferred organism is a mammal.
- the complexes can be purified by any suitable purification method know in the art, such as immuno-affinity purification.
- the peptidic fragments can be isolated from the purified complexes by any suitable means, such as acetic acid elution.
- the KLH is KLH-1 in the absence of KLH-2 or KLH-2 in the absence of KLH-1.
- the peptides can be analyzed in accordance with methods well-known in the art, such as by post-source decay and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (PSD-MALDI-TOF-MS) (see, e.g., J. Immunol. Methods 246: 1-12 (2000)).
- the present invention provides an immunogenic portion of KLH identified in accordance with the method.
- the polypeptide preferably comprises an amino end and a carboxyl end.
- the polypeptide can comprise D-amino acids, L-amino acids or a mixture of D- and L- amino acids.
- the D-form of the amino acids is particularly preferred since a polypeptide comprised of D-amino acids is expected to have a greater retention of its biological activity in vivo, given that the D-amino acids are not recognized by naturally occurring proteases.
- the polypeptide can be prepared by any of a number of conventional techniques.
- the polypeptide can be isolated or purified from a naturally occurring source or from a recombinant source.
- polypeptide can be isolated or purified from a naturally occurring source, such isolation is difficult and costly and does not readily or easily enable the separation of KLH polypeptides of isotypes 1 and 2.
- recombinant production is preferred.
- a DNA fragment encoding a desired peptide can be subcloned into an appropriate vector using well-known molecular genetic techniques (see, e.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory, 1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 nd ed. (Cold Spring Harbor Laboratory, 1989).
- the fragment can be transcribed and the polypeptide subsequently translated in vitro.
- kits can also be employed (e.g., such as manufactured by Clontech, Palo Alto, CA; Amersham Pharmacia Biotech Inc., Piscataway, NJ; InVitrogen, Carlsbad, CA, and the like).
- the polymerase chain reaction optionally can be employed in the manipulation of nucleic acids.
- Alterations of the native amino acid sequence to produce variant polypeptides can be done by a variety of means known to those skilled in the art.
- site -specific mutations can be introduced by ligating into an expression vector a synthesized oligonucleotide comprising the modified site.
- oligonucleotide-directed site- specific mutagenesis procedures can be used such as disclosed in Walder et al., Gene 42: 133 (1986); Bauer et al, Gene 37: 73 (1985); Craik, Biotechniques, 12-19 (January 1995); and U.S. Patent Nos. 4,518,584 and 4,737,462.
- Any appropriate expression vector e.g., as described in Pouwels et al., Cloning Vectors: A Laboratory Manual (Elsevier, NY: 1985)
- suitable host can be employed for production of recombinant polypeptides.
- Expression hosts include, but are not limited to, bacterial species within the genera Escherichia, Bacillus, Pseudomonas, Salmonella, mammalian or insect host cell systems including baculovirus systems (e.g., as described by Luckow et al., Bio/Technology 6: 47 (1988)), and established cell lines such as the COS-7, C127, 3T3, CHO, HeLa, BHK cell line, and the like.
- polypeptides produced in yeast or mammalian cells will differ from that of polypeptides produced in bacterial cells such as Escherichia coli.
- the polypeptide (including the variant polypeptides) can be synthesized using standard peptide synthesizing techniques well-known to those of skill in the art (e.g., as summarized in Bodanszky, Principles of Peptide Synthesis, (Springer- Verlag, Heidelberg: 1984)).
- the polypeptide can be synthesized using the procedure of solid-phase synthesis (see, e.g., Merrifield, J. Am. Chem. Soc. 85: 2149-54 (1963); Barany et al., Int. J. Peptide Protein Res. 30: 705-739 (1987); and U.S. Patent No. 5,424,398). If desired, this can be done using an automated peptide synthesizer.
- t-butyloxycarbonyl (t-BOC) or 9-fluorenylmethyloxycarbonyl (Fmoc) amino acid blocking groups and separation of the polypeptide from the resin can be accomplished by, for example, acid treatment at reduced temperature.
- the polypeptide-containing mixture can then be extracted, for instance, with dimethyl ether, to remove non-peptidic organic compounds, and the synthesized polypeptide can be extracted from the resin powder (e.g., with about 25% w/v acetic acid).
- further purification e.g., using high performance liquid chromatography (HPLC)
- HPLC high performance liquid chromatography
- Amino acid and/or HPLC analysis can be performed on the synthesized polypeptide to validate its identity.
- the polypeptides of the invention can be modified, for instance, by glycosylation, amidation, carboxylation, or phosphorylation, or by the creation of acid addition salts, amides, esters, in particular C -terminal esters, andN- acyl derivatives of the polypeptides of the invention.
- the present invention also provides a fusion protein and a conjugate comprising an above-described isolated or purified polypeptide molecule or fragment thereof and a therapeutically or prophylactically active agent.
- “Prophylactically” as used herein does not necessarily mean prevention, although prevention is encompassed by the term. Prophylactic activity also can include lesser effects, such as inhibition of the spread of cancer or a pathogenic infection; etc.
- the active agent is a hapten, an allergen, a sperm coat protein (e.g., for use as a contraceptive), an immunogen, or hemocyanin ⁇ -adrenergic receptor peptide.
- the immunogen is an antigen of a pathogen, e.g., bacterial, viral or parasitic pathogen, or an antigen of a cancer.
- a pathogen e.g., bacterial, viral or parasitic pathogen
- conjugate kits are commercially available.
- methods of conjugation and conjugates see, e.g., Hermanson, G.T., Bioconjugate Techniques, 1996, Academic Press, San Diego, CA; U.S. Patent Nos. 6,013,779; 6,274,552 and 6,080,725 and Ragupathi et al., Glycoconjugate Journal 15: 217-221 (1998).
- the present invention also provides a composition
- a composition comprising an above- described isolated or purified polypeptide molecule, optionally in the form of a conjugate or a fusion protein comprising a prophylactically or therapeutically active agent, and an excipient or an adjuvant.
- Excipients and adjuvants are well-known in the art, and are readily available. The choice of excipient/adjuvant will be determined in part by the particular route of administration and whether a nucleic acid molecule or a polypeptide molecule (or conjugate or fusion protein thereof) is being administered.
- Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of the compound dissolved in diluent, such as water, saline, or orange juice;, (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as solids or granules; (c) suspensions in an appropriate liquid; and (d) suitable emulsions.
- Tablet forms can include one or more of lactose, mannitol, corn starch, potato starch, microcrystalline cellulose, acacia, gelatin, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible excipients.
- Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth.
- Pastilles can comprise the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such excipients/carriers as are known in the art.
- an inert base such as gelatin and glycerin, or sucrose and acacia, emulsions, gels, and the like containing, in addition to the active ingredient, such excipients/carriers as are known in the art.
- An active agent of the present invention can be made into aerosol formulations to be administered via inhalation.
- aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like. They also can be formulated as pharmaceuticals for non-pressured preparations such as in a nebulizer or an atomizer.
- Formulations suitable for parenteral administration include aqueous and non- aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- the formulations can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
- Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.
- active agents of the present invention can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases.
- bases such as emulsifying bases or water-soluble bases.
- Formulations suitable for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate. Further suitable formulations are found in Remington's Pharmaceutical Sciences, 17th ed., (Mack Publishing Company, Philadelphia, Pa.: 1985), and methods of drug delivery are reviewed in, for example, Langer, Science 249: 1527-1533 (1990).
- the present invention provides a method of treating cancer prophylactically or therapeutically in a mammal.
- the method comprises administering to the mammal an effective amount of:
- nucleic acid molecule encoding a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) an antigen of the cancer, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector,
- a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) an antigen of the cancer
- a conjugate comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-1 or an immunogenic fragment of either of the foregoing comprising at least 770 amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the cancer or an anti-cancer agent, or
- a composition comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-1, or an immunogenic fragment of either of the foregoing comprising at least 770 amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the cancer and/or an anti-cancer agent, whereupon the mammal is treated for the cancer prophylactically or therapeutically.
- Such a method can further comprise the co- administration, whether simultaneously or sequentially, in either order, of an anti-cancer agent by the same or different route.
- the cancer is adenocarcinoma, bladder cancer, colon cancer, breast cancer, lung cancer or skin cancer.
- the skin cancer is preferably melanoma.
- the anti-cancer agent can be a chemotherapeutic agent, e.g., a polyamine or an analogue thereof.
- therapeutic polyamines include those set forth in U.S. Patent Nos. 5,880,161, 5,541,230 and 5,962,533, Saab et al., J. Med. Chem. 36: 2998- 3004 (1993), Bergeron et al., J. Med. Chem. 37(21): 3464-3476 (1994), Casero et al., Cancer Chemother. Pharmacol 36: 69-74 (1995), Bernacki et al., Clin. Cancer Res. 1: 847-857 (1995); Bergeron et al, J. Med. Chem.
- Preferred routes of administration in the first embodiment of the method of treating cancer include intratumoral and peritumoral routes of administration.
- a preferred manner of administering a separate anti-cancer agent is by targeting to a cancer cell.
- cancer-specific, cell-surface molecules include placental alkaline phosphatase (testicular and ovarian cancer), pan carcinoma (small cell lung cancer), polymo ⁇ hic epithelial mucin (ovarian cancer), prostate-specific membrane antigen, ⁇ -fetoprotein, B-lymphocyte surface antigen (B-cell lymphoma), truncated EGFR (gliomas), idiotypes (B-cell lymphoma), gp95/gp97 (melanoma), N- CAM (small cell lung carcinoma), cluster w4 (small cell lung carcinoma), cluster 5A (small cell carcinoma), cluster 6 (small cell lung carcinoma), PLAP (seminomas, ovarian cancer, and non-small cell lung cancer), CA-125 (lung and ovarian cancers),
- cancer-specific, cell-surface receptors include erbB-2, erbB-3, erbB-4, IL-2 (lymphoma and leukemia), IL-4 (lymphoma and leukemia), IL-6 (lymphoma and leukemia), MSH (melanoma), transferrin (gliomas), tumor vasculature integrins, and the like.
- Preferred cancer-specific, cell-surface receptors include erbB-2 and tumor vasculature integrins, such as CDlla, GDI lb, CDl lc, GDI 8, CD29, CD51, CD61, CD66d, CD66e, CD106, and CDwl45.
- the present invention provides a method of treating a mammal prophylactically or therapeutically for a pathogenic infection.
- the method comprises administering to the mammal an effective amount of: (a) an isolated or purified nucleic acid molecule encoding a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) an antigen of the pathogen, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector,
- a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) an antigen of the pathogen,
- a conjugate comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen of the pathogen or an anti-pathogen agent, or (d) a composition comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-1, or an immunogenic fragment of either of the foregoing comprising at least 770 contiguous amino acids,
- the pathogen can be any pathogen, such as a virus, a bacterium or a fungus.
- pathogen such as a virus, a bacterium or a fungus.
- bacterial and viral antigens see, e.g, U.S. Patent No. 6,080,725.
- Fungal antigens are known in the art.
- Anti-pathogen agents i.e., active agents used to treat prophylactically or therapeutically infection of an animal, such as a mammal, in particular a human, with a virus, bacterium or fungus, are known in the art.
- a method of stimulating an immune response i.e., immune reactants, e.g, antibodies or specific effector T-cells, directed at an antigen
- the method comprises administering to the mammal an effective amount of:
- nucleic acid molecule consisting essentially of a nucleotide sequence encoding KLH-2, a variant KLH-2 or an immunogenic fragment of either of the foregoing comprising at least 1,080 contiguous nucleotides, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector,
- an isolated or purified nucleic acid molecule consisting essentially of a nucleotide sequence encoding KLH-1, a variant KLH-1 or an immunogenic fragment of either of the foregoing comprising at least 2,300 contiguous nucleotides, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector, (c) an isolated or purified polypeptide molecule consisting essentially of an amino acid sequence encoding KLH-2, a variant KLH-2 or an immunogenic fragment thereof comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or
- the method comprises stimulating an immune response to an antigen in a mammal by administering to the mammal an effective amount of dendritic cells which have been previously isolated from the mammal and treated in vitro with:
- a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) an antigen
- a conjugate comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-1, or an immunogenic fragment of either of the foregoing comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen, or
- composition comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-1, or an immunogenic fragment of either of the foregoing comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) an antigen, whereupon an immune response to the antigen is induced in the mammal.
- the antigen is an antigen of a pathogen or an antigen of a cancer as herein described.
- the method can further comprise the simultaneous or sequential co- administration of an active agent (e.g, an anti-cancer agent or an anti-pathogen agent) by the same or different route.
- an active agent e.g, an anti-cancer agent or an anti-pathogen agent
- Methods of isolating, treating ex vivo, and administering dendritic cells are known in the art. See, e.g. International Patent Application WO 00/73432.
- the method comprises administering to the mammal an effective amount of: (a) an isolated or purified nucleic acid molecule encoding a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) hemocyanin ⁇ -adrenergic receptor peptide, wherein the isolated or purified nucleic acid molecule is optionally in the form of a vector, (b) a fusion protein comprising (i) KLH, a variant KLH or an immunogenic fragment of either of the foregoing, and (ii) hemocyanin ⁇ -adrenergic receptor peptide,
- a conjugate comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH- 1 , or an immunogenic fragment of either of the foregoing comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) hemocyanin ⁇ -adrenergic receptor peptide, or
- composition comprising (i) (a) KLH-2, a variant KLH-2, or an immunogenic fragment of either of the foregoing comprising at least 360 contiguous amino acids, wherein the KLH-2 is essentially free from KLH-1, or (b) KLH-1, a variant KLH-1, or an immunogenic fragment of either of the foregoing comprising at least 770 contiguous amino acids, wherein the KLH-1 is essentially free from KLH-2, and (ii) hemocyanin ⁇ -adrenergic receptor peptide, whereupon the mammal is treated for high blood pressure prophylactically or therapeutically.
- KLH or a conjugate or fusion protein thereof
- an animal such as a mammal, in particular a human
- KLH be administered in a dose of from about 1 to about 1,000 ⁇ g/kg body weight/treatment when given parenterally.
- this dosage range is merely preferred, and higher or lower doses may be chosen in appropriate circumstances.
- the actual dose and schedule can vary depending on whether the composition is administered in combination with other pharmaceutical compositions, or depending on interindividual differences in pharmacokinetics, drug disposition, and metabolism.
- One skilled in the art easily can make any necessary adjustments in accordance with the necessities of the particular situation.
- lxlO 12 pfu is equivalent to lxlO 14 pu.
- An amount of recombinant virus, recombinant DNA vector or RNA genome sufficient to achieve a tissue concentration of about 10 2 to about 10 12 particles per ml is preferred, especially of about 10 6 to about 10 10 particles per ml.
- multiple daily doses are preferred.
- the number of doses will vary depending on the means of delivery and the particular recombinant virus, recombinant DNA vector or RNA genome administered.
- a targeting moiety also can be used in the contact of a cell with an above- described isolated or purified nucleic acid molecule.
- any molecule that can be linked with the therapeutic nucleic acid directly or indirectly, such as through a suitable delivery vehicle, such that the targeting moiety binds to a cell-surface receptor can be used.
- the targeting moiety can bind to a cell through a receptor, a substrate, an antigenic determinant or another binding site on the surface of the cell.
- a targeting moiety examples include an antibody (i.e., a polyclonal or a monoclonal antibody), an immunologically reactive fragment of an antibody, an engineered immunoprotein and the like, a protein (target is receptor, as substrate, or regulatory site on DNA or RNA), a polypeptide (target is receptor), a peptide (target is receptor), a nucleic acid, which is DNA or RNA (i.e., single-stranded or double-stranded, synthetic or isolated and purified from nature; target is complementary nucleic acid), a steroid (target is steroid receptor), and the like.
- Analogs of targeting moieties that retain the ability to bind to a defined target also can be used.
- synthetic targeting moieties can be designed, such as to fit a particular epitope.
- the therapeutic nucleic acid can be encapsulated in a liposome comprising on its surface the targeting moiety.
- the targeting moiety includes any linking group that can be used to join a targeting moiety to, in the context of the present invention, an above-described nucleic acid molecule. It will be evident to one skilled in the art that a variety of linking groups, including bifunctional reagents, can be used.
- the targeting moiety can be linked to the therapeutic nucleic acid by covalent or non-covalent bonding. If bonding is noncovalent, the conjugation can be through hydrogen bonding, ionic bonding, hydrophobic or van der Waals interactions, or any other appropriate type of binding.
- An isolated or purified nucleic acid molecule consisting essentially of SEQ ID
- nucleic acid molecule consisting essentially of the aforementioned nucleic acid molecule coupled 5' to an isolated or purified nucleic acid molecule encoding a polypeptide or protein, optionally in the form of a vector, which, upon expression in a eukaryotic cell, results in the secretion of the encoded polypeptide or protein by the eukaryotic cell. See, e.g, U.S. Patent No. 6,169,172. Thus, a eukaryotic cell comprising and expressing such a nucleic acid molecule is also provided.
- This example describes the sequencing of the KLH-2 cDNA.
- Fresh limpet tissue associated with the respiratory system and other organ tissues were dissected and immediately frozen on dry ice. The tissue was stored at -70°C.
- Degenerate PCR primers were designed using the amino acid sequence of the KLH functional unit 2c (Sohngen et al, Eur. J. Biochem. 248: 602-614 (1997); and Stoeva et al, Biochim. Biophys. Acta 1435: 94-109 (1999)).
- the design of the degenerate PCR primers took into consideration codon usage frequency.
- the Codon Usage Database is an extended WWW version of CUTG (Codon
- Codon frequency tables were also generated using the Countcodon program (version 4). Octopus dolfleini was used as a model hemocyanin and the codon usage correlated well with other standard codon usage tables. In addition, the degenerate PCR primers were designed to avoid, when possible, amino acids with numerous codons, e.g, leucine, arginine and serine.
- Primer 11 + Primer 30 yielded PCR product of approximately 460 base pairs. Plasmid 6.2
- Primer 11 + Primer 30 yielded PCR product of approximately 460 base pairs. Plasmid 6.1
- Primer 12 + Primer 30 yielded PCR product of approximately 460 base pairs.
- Plasmid 8.1 Primer 12 + Primer 30 yielded PCR product of approximately 460 base pairs.
- PCR products were separated on a 1% agarose gel. Bands of the expected size were excised with a razor blade.
- the amplified DNA was extracted from the agarose using an Ultrafree-DA (Millipore, Bedford, MA) spin column.
- the gel-purified fragments were then cloned into pGEM-T Easy vector (Promega, Madison, WI) according to the manufacturer's recommended directions.
- Cells were transformed with pGEM-T easy vector containing PCR product. Max efficiency DH5 alpha chemically competent cells (Life Technologies) were used according to the manufacturer's recommended directions.
- Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA) according to the manufacturer's directions.
- Plasmids were screened for inserts by digesting with Not I and subsequent gel electrophoresis. Plasmids containing inserts of the expected size were sequenced. Sequence data were translated and clones of the open reading frames were compared with other hemocyanins using the BLAST sequence analysis program. Clones containing homology to hemocyanins found in the database were used to make primers for 5' and 3' RACE reactions.
- 5 'RACE reaction products were separated on a 1% agarose gel.
- the fragments corresponding to the expected size were gel purified using an Ultrafree-DA spin column (Millipore Corporation, Bedford, MA) and TA cloned into TOPOXL (Invitrogen, Carlsbad, CA) and then used to transform TOP 10 (Invitrogen) electrocompetent cells.
- Colonies from the transformation reaction were used to inoculate 2 ml LB broth containing 50 ⁇ g/ml of kanamycin for plasmid minipreps (QIAprep Spin Miniprep Kit, Qiagen). Plasmids were digested with Eco Rl to determine inserts of the expected size.
- RACE primer 1 GAGCGCCCTTCCACATTTTGTTG [SEQ ID NO: 20]
- 3' RACE plasmids 1-3, 1-4, and 2-5 were sequenced.
- the overlapping 5' and 3' RACE clones contained the complete cDNA sequence of KLH isotype 2 and, in addition, part of the 5' untranslated region, including the N-terminal methionine, a leader peptide sequence for secretion of the KLH-2 protein, a 3' untranslated region and the 3' poly A tail.
- This example describes the cloning and sequencing of the KLH-1 cDNA.
- Fresh limpet tissue associated with the respiratory system and other organ tissues were dissected and immediately frozen on dry ice. The tissue was stored at -70 °C.
- RNA was then precipitated with isopropanol. The RNA pellets were washed with 75% ethanol, dried and dissolved in distilled water. The RNA solution was stored at -70 °C.
- Hemocyanin sequences for Megathura crenuiata found on CBI's GenBank database were used to make primers for 5' and 3' RACE reactions (International Patent Application WO 01/14536, SEQ ID NO: 210, 211, and 217).
- 5' and 3' RACE reactions were performed using the SMART TM RACE cDNA Amplification Kit (Catalog K 1811 - 1 , CLONTECH) according to the manufacturer's recommended protocols.
- This example describes the construction of vectors containing full-length KLH1 and KLH2 cDNA.
- RNA extraction was performed as described in Example 1.
- cDNA was prepared using the SMART cDNA Synthesis Kit (Catalog Kl 052-1, CLONTECH) according to the manufacturer's recommended protocols.
- KLH1 Primer 1 (forward): 5' to 3' ATGCTGTCGGTCAGGTTGCTTATAGTCG [SEQ ID NO: 40]
- KLHl and KLH2 PCR reactions yielded products of approximately 10,000 bp.
- PCR products were separated on a 1% agarose gel.
- the fragments were gel-purified using an Ultrafree-DA spin column (Amicon, Millipore, Bedford, MA), TA cloned into pCR-XL-TOPO (Invitrogen) using the TOPOXL PCR Cloning Kit (Catalog K4700-10, Invitrogen), and used to transform TOP 10 (Invitrogen) electrocompetent cells.
- Colonies from the transformation reaction were used to inoculate 2mL LB broth containing 50 ⁇ g/mL of kanamycin for plasmid minipreps (QIAprep Spin Miniprep Kit, QIAGEN).
- KLHl plasmids were digested with Notl restriction enzyme (New England Biolabs).
- KLH2 plasmids were digested with Mlul and Notl restriction enzymes (New England Biolabs). Digests were separated on a 1% agarose gel to determine inserts of the expected size.
- KLH2 plasmid 13 and KLHl plasmid 5-1 were each sequenced. Two-three kilobases of both of the 5' and 3' ends of each insert were sequenced for confirmation. The plasmids were found to contain the coding regions of KLH2 and KLHl, respectively.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Toxicology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2002339902A AU2002339902A1 (en) | 2001-09-06 | 2002-09-06 | Hemocyanin nucleic acids and polypeptides and related vectors, fusion proteins, conjugates, cells and methods of use |
EP02778241A EP1435789A4 (en) | 2001-09-06 | 2002-09-06 | Hemocyanin nucleic acids and polypeptides and related vectors, fusion proteins, conjugates, cells and methods of use |
US10/488,824 US20040241695A1 (en) | 2001-09-06 | 2002-09-06 | Hemocyanin nucleic acids and polypeptides and related vectors fusion protein conjugates cells and methods of use |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US31767801P | 2001-09-06 | 2001-09-06 | |
US60/317,678 | 2001-09-06 | ||
US34541801P | 2001-12-21 | 2001-12-21 | |
US60/345,418 | 2001-12-21 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2003023006A2 true WO2003023006A2 (en) | 2003-03-20 |
WO2003023006A3 WO2003023006A3 (en) | 2003-11-20 |
Family
ID=26981081
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2002/028581 WO2003023006A2 (en) | 2001-09-06 | 2002-09-06 | Hemocyanin nucleic acids and polypeptides and related vectors, fusion proteins, conjugates, cells and methods of use |
Country Status (4)
Country | Link |
---|---|
US (1) | US20040241695A1 (en) |
EP (1) | EP1435789A4 (en) |
AU (1) | AU2002339902A1 (en) |
WO (1) | WO2003023006A2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000055192A2 (en) * | 1999-03-17 | 2000-09-21 | Biosyn Arzneimittel Gmbh | Hemocyanin and nucleic acid sequence coding for the same |
WO2001014536A2 (en) * | 1999-08-20 | 2001-03-01 | Biosyn Arzneimittel Gmbh | Nucleic acid molecule comprising a nucleic acid sequence which codes for a haemocyanin, and comprising at least one intron sequence |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6759515B1 (en) * | 1997-02-25 | 2004-07-06 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
US6551575B1 (en) * | 1999-12-02 | 2003-04-22 | Neurosciences Research Foundation, Inc. | Methods for identifying compounds for motion sickness, vertigo and other disorders related to balance and the perception of gravity |
-
2002
- 2002-09-06 EP EP02778241A patent/EP1435789A4/en not_active Withdrawn
- 2002-09-06 US US10/488,824 patent/US20040241695A1/en not_active Abandoned
- 2002-09-06 AU AU2002339902A patent/AU2002339902A1/en not_active Abandoned
- 2002-09-06 WO PCT/US2002/028581 patent/WO2003023006A2/en not_active Application Discontinuation
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000055192A2 (en) * | 1999-03-17 | 2000-09-21 | Biosyn Arzneimittel Gmbh | Hemocyanin and nucleic acid sequence coding for the same |
WO2001014536A2 (en) * | 1999-08-20 | 2001-03-01 | Biosyn Arzneimittel Gmbh | Nucleic acid molecule comprising a nucleic acid sequence which codes for a haemocyanin, and comprising at least one intron sequence |
Non-Patent Citations (2)
Title |
---|
BATEMAN ET AL.: 'Cancer gene therapy: developments to 2000' EXP. OPIN. INVEST. DRUGS vol. 9, no. 12, 2000, pages 2799 - 2813, XP002961631 * |
See also references of EP1435789A2 * |
Also Published As
Publication number | Publication date |
---|---|
WO2003023006A3 (en) | 2003-11-20 |
EP1435789A2 (en) | 2004-07-14 |
AU2002339902A1 (en) | 2003-03-24 |
US20040241695A1 (en) | 2004-12-02 |
EP1435789A4 (en) | 2005-03-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9452204B2 (en) | Chimeric peptides comprising HER-2 B-cell epitopes and Tcell helper epitopes | |
AU2002361584B2 (en) | Compositions and methods for WT1 specific immunotherapy | |
US7060284B1 (en) | Polypeptides and polynucleotides for enhancing immune reactivity to HER-2 protein | |
KR100380503B1 (en) | Melanoma-related antigenic polypeptides, epitopes and vaccines for melanoma | |
US7915393B2 (en) | Compositions and methods for WT1 specific immunotherapy | |
US7323181B2 (en) | Compositions and methods for WT1 specific immunotherapy | |
AU2002361584A1 (en) | Compositions and methods for WT1 specific immunotherapy | |
US8258261B2 (en) | Induction of tumor immunity by variants of folate binding protein | |
WO2003023006A2 (en) | Hemocyanin nucleic acids and polypeptides and related vectors, fusion proteins, conjugates, cells and methods of use | |
WO2002066506A2 (en) | Use of casb7439 (ash2) in the immunotherapy of breast cancer | |
JP2004518410A5 (en) | ||
EP1064377A1 (en) | Casb414: antigen overexpressed in several tumours | |
JP4727059B2 (en) | Utilization of nucleic acid molecule encoding Babesagibsoni P50 antigen and its expression product | |
WO2002064797A2 (en) | Mitochondrial topoisomerase i | |
WO2007023628A1 (en) | Secretory antigen 1 protein of babesia gibsoni, dna encoding the same and use thereof | |
EP1373505A2 (en) | Tri-hybrid melanoma antigen | |
WO2001007610A1 (en) | Pmf-1 (polyamide-modulated factor 1) | |
AU2002244196A1 (en) | Tri-hybrid melanoma antigen | |
MXPA05006070A (en) | Method for preparing recombinant heterocarpine. | |
EP1562622A2 (en) | Immunogenic epitopes for fibroblast growth factor 5 (fgf-5) presented by hla-a3 and hla-a2 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 10488824 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2002778241 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2002778241 Country of ref document: EP |
|
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2002778241 Country of ref document: EP |