WO2003020890A2 - Genes encoding baeyer-villiger monooxygenases - Google Patents
Genes encoding baeyer-villiger monooxygenases Download PDFInfo
- Publication number
- WO2003020890A2 WO2003020890A2 PCT/US2002/027549 US0227549W WO03020890A2 WO 2003020890 A2 WO2003020890 A2 WO 2003020890A2 US 0227549 W US0227549 W US 0227549W WO 03020890 A2 WO03020890 A2 WO 03020890A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- polypeptide
- seq
- nucleotide sequence
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/08—Oxygen as only ring hetero atoms containing a hetero ring of at least seven ring members, e.g. zearalenone, macrolide aglycons
Definitions
- the invention relates to the field of molecular biology and microbiology. More specifically, genes have been isolated from a variety of bacteria encoding Baeyer-Villiger monooxygenase activity. BACKGROUND OF THE INVENTION In 1899, Baeyer and Villiger reported on a reaction of cyclic ketones with peroxymonosulfuric acid to produce lactones (Chem Ber 32:3625-3633 (1899)). Since then, the Baeyer-Villiger (BV) reaction has been broadly used in organic synthesis.
- BV reactions are one of only a few methods available for cleaving specific carbon-carbon bonds under mild conditions, thereby converting ketones into esters (Walsh and Chen, Angew.Chem.lnt.Ed. Engl 27:333-343 (1988)).
- the importance of minimizing environmental impact in industrial processes has catalyzed a trend whereby alternative methods are replacing established chemical techniques.
- Baeyer-Villiger (BV) oxidations considerable interest has focused on discovery of enantioselective versions of the Baeyer-Villiger oxidation that are not based on peracids. Enzymes, which are often enantioselective, are valued alternatives as renewable, biodegradable resources.
- BVMOs Baeyer-Villiger monooxygenases enzymes
- EC 1.14.13.x monooxygenases
- NADH NADH
- NADPH NADH
- One of the oxygen atoms is incorporated into the lactone product between the carbonyl carbon and the flanking carbon while the other is used to oxidize the reduced NADPH producing H 2 O (Banerjee, A.
- BVMOs have a flavin coenzyme which acts in the oxidation reaction; the predominant coenzyme form is flavin adenine dinucleotide cofactor (FAD).
- FAD flavin adenine dinucleotide cofactor
- BVMOs display remarkably broad substrate acceptance, high enantioselectivies, and great stereosel ctivity and regioselectivity (Mihovilovic et al. J. Org. Chem. 66:733-738 (2001).
- Suitable substrates for the enzymes can be broadly classified as cyclic ketones, ketoterpenes, and steroids. However, few enzymes have been subjected to extensive biochemical characterization. Key studies in relation to each broad ketone substrate class are summarized below.
- Cyclic ketones Activity of cyclohexanone monooxygenase upon cyclic ketone substrates in Acinetobacter sp. NCIB 9871 has been studied extensively (reviewed in Stewart, Curr. Org. Chem. 2:195-216 (1998), Table 2; Walsh and Chen, Angew.Chem.lnt.Ed. Engl 27:333-343 (1988), Tables 4-5) . Specificity has also been biochemically analyzed in Brevibacterium sp. HCU (Brzostowicz et al., J. Bad 182(15):4241 -4248 (2000)). 2.
- Ketoterpenes A monocyclic monoterpene ketone monooxygenase has been characterized from Rhodococcus erythropolis DCL14 (Van der Werf, J. Biochem. 347:693-701 (2000)). In addition to broad substrate specificity against ketoterpenes, the enzyme also has activity against substituted cyclohexanones. , 3. Steroids: The steroid monooxygenase of Rhodococcus rhodochrous (Morii et al. J. Biochem 126:624-631 (1999)) is well characterized, both biochemically and by sequence data.
- genes and gene products listed above are useful for specific Baeyer-Villiger reactions targeted toward cyclic ketone, ketoterpene, or steroid compounds, however the enzymes are limited in their ability to predict other newly discovered proteins which would have similar activity.
- the problem to be solved therefore is to provide a suite of bacterial flavoprotein Baeyer-Villiger monooxygenase enzymes that can efficiently perform oxygenation reactions on cyclic ketones and ketoterpenes compounds. Identity of a suite of enzymes with this broad substrate acceptance would facilitate commercial applications of these enzymes and reduce efforts with respect to optimization of multiple enzymes for multiple reactions. Maximum efficiency is especially relevant today, when many enzymes are genetically engineered such that the enzyme is recombinantly expressed in a desirable host organism. Additionally, a collection of BVMO's with diverse amino acid sequences could be used to create a general predictive model based on amino acid sequence conservation of other BVMO enzymes. Finally, a broad class of BVMO's could also be used as basis for the in vitro evolution of novel enzymes.
- Applicants have solved the stated problem by isolating several novel organisms with BVMO activity, identifying and characterizing BMVO genes, expressing these genes in microbial hosts, and demonstrating activity of the genes against a wide range of ketone substrates, including cyclic ketones and ketoterpenes.
- Several signature sequences have been identified, based on amino acid sequence alignments, which are characteristic of specific BVMO families and have diagnostic utility.
- the invention provides an isolated nucleic acid fragment isolated from Rhodococcus selected from the group consisting of:
- the invention provides an isolated nucleic acid fragment isolated from Arthrobacter selected from the group consisting of: (a) an isolated nucleic acid fragment encoding a Baeyer-Villiger monooxygenase polypeptide having an amino acid sequence as set forth in SEQ ID NO:12;
- the invention provides an isolated nucleic acid fragment isolated from Acidovorax selected from the group consisting of:
- the invention provides polypeptides encoded by the present sequences as well as genetic chimera of the present sequences and transformed hosts expressing the same.
- the invention provides a method for the identification of a polypeptide having monooxygenase activity comprising:
- step (b) aligning the amino acid sequence of step (a) with the amino acid sequence of a Baeyer-Villiger monooxygenase consensus sequence selected from the group consisting of SEQ ID NO:47, SEQ ID NO:48 and
- polypeptide of (a) is identified as having monooxygenase activity.
- step (b) identifying a DNA clone that hybridizes with a nucleic acid fragment of step (a);
- step (c) sequencing the genomic fragment that comprises the clone identified in step (b), wherein the sequenced genomic fragment encodes a Baeyer-
- the invention provides a method for the biotransformation of a ketone substrate to the corresponding ester, comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of ketone substrate whereby the corresponding ester is produced, said transformed host cell comprising a nucleic acid fragment encoding an isolated nucleic acid fragment of any of the present nucleic acid sequences; under the control of suitable regulatory sequences.
- the invention provides a method for the in vitro transformation of a ketone substrate to the corresponding ester, comprising: contacting a ketone substrate under suitable reaction conditions with an effective amount of a Baeyer-Villiger monooxygenase enzyme, the enzyme having an amino acid seqeunce selected from the group consisting of SEQ ID NOs:8, 10, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, and 46.
- the invention provides a mutated microbial gene encoding a protein having an altered biological activity produced by a method comprising the steps of:
- step (iii) incubating the denatured said mixture of restriction fragments of step (ii) with a polymerase; (iv) repeating steps (ii) and (iii) wherein a mutated microbial gene is produced encoding a protein having an altered biological activity.
- the invention provides unique strains of Acidovorax sp. comprising the 16s rDNA sequence as set forth in SEQ ID NO:5,
- Arthrobacter sp. comprising the 16s rDNA sequence as set forth in SEQ ID NO:1
- Rhodococcus sp. comprising the 16s rDNA sequence as set forth in SEQ ID NO:6.
- the invention provides an Acidovorax sp. comprising the 16s rDNA sequence as set forth in SEQ ID NO:5. Additionally the invention provides an Arthrobacter sp. comprising the 16s rDNA sequence as set forth in SEQ ID NO:1. Similarly the invention provides a Rhodococcus sp. comprising the 16s rDNA sequence as set forth in SEQ ID NO:6. Additionally the invention provides an isolated nucleic acid useful for the identification of a BV monooxygenase selected from the group consisting of SEQ ID 70-113.
- FIG. 6 illustrates the signature sequences of the three BVMO groups based on the consensus sequences derived from the alignments of Figure 7, Figure 8 and Figure 9.
- Figure 7 shows a Clustal W alignment of a family of Baeyer-Villiger monoxygenases (Family 1) and the associated signature sequence.
- Figure 8 shows a Clustal W alignment of a family of Baeyer-Villiger monoxygenases (Family 2) and the associated signature sequence.
- Figure 9 shows a Clustal W alignment of a family of BC monoxygenases (Family 3) and the associated signature sequence.
- the invention can be more fully understood from the following detailed description and the accompanying sequence descriptions which form a part of this application.
- SEQ ID Nos:1-49 are full length genes or proteins as identified in Table 1.
- SEQ ID NOs:50-62 are primers used for 16s rDNA sequencing.
- SEQ ID NO:63 describes a primer used for RT-PCR and out-PCR.
- SEQ ID NOs:64 and 65 are primers used for sequencing of inserts within pCR2.1
- SEQ ID NOs:66 and 67 are primers used to amplify monooxygenase genes from Acinetobactersp. SE19.
- SEQ ID NOs:68-107 are primers used for amplification of full length Baeyer-Villiger monooxygenases.
- SEQ ID NOs:108-113 are primers used to screen cosmid libraries.
- the invention provides nucleic acid and amino acid sequences defining a group of Baeyer-Villiger monooxygenase enzymes. These enzymes have been found to have the ability to use a wide variety of ketone substrates that include two general classes of compounds, cyclic ketones and ketoterpenes. These enzymes are characterized by function as well as a series of diagnostic signature sequences. The enzymes may be expressed recombinantly for the conversion of ketone substrates to the corresponding lactones or esters.
- ORF Open reading frame
- PCR Polymerase chain reaction
- BV Bath-Villiger
- Baeyer-Villiger monooxygenase is abbreviated BVMO.
- ketoone substrate includes a substrate for a Baeyer- Villiger monooxygenase that comprises a class of compounds which include cyclic ketones and ketoterpenes.
- Ketone substrates of the invention are defined by the general formula:
- R and R-i are independently selected from substituted or unsubstituted phenyl, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, or substituted or unsubstituted alkylidene.
- alkyl will mean a univalent group derived from alkanes by removal of a hydrogen atom from any carbon atom: C n H 2n+ 'i-
- the groups derived by removal of a hydrogen atom from a terminal carbon atom of unbranched alkanes form a subclass of normal alkyl (/7-alkyl) groups: H[CH 2 ] n -.
- the groups RCH 2 -, R 2 CH- (R not equal to H), and R 3 C- (R not equal to H) are primary, secondary and tertiary alkyl groups respectively.
- alkenyl will mean an acyclic branched or unbranched hydrocarbon having one carbon-carbon double bond and the general formula C n H 2n .
- Acyclic branched or unbranched hydrocarbons having more than one double bond are alkadienes, alkatrienes, etc.
- alkylidene will mean the divalent groups formed from alkanes by removal of two hydrogen atoms from the same carbon atom, the free valiances of which are part of a double bond (e.g. (CH 3 ) C, also known as propan-2-ylidene).
- an "isolated nucleic acid molecule” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases.
- An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
- a nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength.
- Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein (entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the "stringency" of the hybridization.
- Stringency conditions can be adjusted to screen for moderately similar fragments, such as homologous sequences from distantly related organisms, to highly similar fragments, such as genes that duplicate functional enzymes from closely related organisms.
- Typical stringent hybridization conditions are for example, hybridization at 0.1X SSC, 0.1% SDS, 65°C with a wash with 2X SSC, 0.1 % SDS followed by 0.1X SSC, 0.1 % SDS.
- Generally post-hybridization washes determine stringency conditions.
- One set of preferred conditions uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for 15 min, then repeated with 2X SSC, 0.5% SDS at 45°C for 30 min, and then repeated twice with 0.2X SSC, 0.5% SDS at 50°C for 30 min.
- a more preferred set of stringent conditions uses higher temperatures in which the washes are identical to those above except for the temperature of the final two 30 min washes in 0.2X SSC, 0.5% SDS was increased to 60°C.
- Another preferred set of highly stringent conditions uses two final washes in 0.1 X SSC, 0.1% SDS at 65°C.
- Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
- the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of Tm for hybrids of nucleic acids having those sequences.
- the relative stability (corresponding to higher TAT?) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
- the length for a , hybridizable nucleic acid is at least about 10 nucleotides. Preferable a minimum length for a hybridizable nucleic acid is at least about
- the temperature and wash solution salt concentration may be adjusted as necessary according to factors such as length of the probe.
- nucleotide bases that are capable to hybridizing to one another.
- adenosine is complementary to thymine
- cytosine is complementary to guanine.
- the instant invention also includes isolated nucleic acid fragments that are complementary to the complete sequences as reported in the accompanying Sequence Listing as well as those substantially similar nucleic acid sequences.
- identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
- identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
- Identity and similarity can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.
- nucleic acid fragments encode polypeptides that are at least about 70% identical, preferably at least about 80% identical to the amino acid sequences reported herein.
- Preferred nucleic acid fragments encode amino acid sequences that are about 85% identical to the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 90% identical to the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 95% identical to the amino acid sequences reported herein.
- Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.
- Codon degeneracy refers to the nature in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant invention relates to any nucleic acid fragment that encodes all or a substantial portion of the amino acid sequence encoding the instant microbial polypeptides as set forth in SEQ ID NOs:8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, and 46.
- Synthetic genes can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments which are then enzymatically assembled to construct the entire gene. "Chemically synthesized”, as related to a sequence of DNA, means that the component nucleotides were assembled in vitro.
- genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell. The skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.
- Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
- Native gene refers to a gene as found in nature with its own regulatory sequences.
- Chimeric gene refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Endogenous gene refers to a native gene in its natural location in the genome of an organism.
- a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
- a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
- Coding sequence refers to a DNA sequence that codes for a specific amino acid sequence.
- Suitable regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structures.
- Promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
- a coding sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.
- RNA transcript refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence.
- the primary transcript When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from post-transcriptional processing of the primary transcript and is referred to as the mature RNA.
- RNA essential RNA
- cDNA double-stranded DNA that is complementary to and derived from mRNA.
- Sense RNA refers to RNA transcript that includes the mRNA and so can be translated into protein by the cell.
- Antisense RNA refers to a RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene (U.S. Patent No. 5,107,065; WO 9928508).
- the complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, or the coding sequence.
- “Functional RNA” refers to antisense RNA, ribozyme RNA, or other RNA that is not translated yet has an effect on cellular processes.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
- a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
- expression refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
- Transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” or “recombinant” or “transformed” organisms.
- the terms “plasmid”, “vector” and “cassette” refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double- stranded DNA molecules.
- Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3" untranslated sequence into a cell.
- Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell.
- “Expression cassette” refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.
- sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences.
- Sequence analysis software may be commercially available or independently developed. Typical sequence analysis software will include but is not limited to the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wl), BLASTP, BLASTN, BLASTX (Altschul et al., J. Mol. Biol. 215:403-410 (1990), and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, Wl 53715 USA), and the FASTA program incorporating the Smith-Waterman algorithm (W. R. Pearson, Comput.
- Signature sequences of the present invention are specifically described Figure 6 showing the signature sequence comprised of p1-p74 of SEQ ID NO:47, p1-p76 of SEQ ID NO:48 and p1-p41 of SEQ ID NO:49.
- Microorganisms having Baeyer-Villiger monooxygenase activity may be isolated from a variety of sources. Suitable sources include industrial waste streams, soil from contaminated industrial sites and waste stream treatment facilities. The Baeyer-Villiger monooxygenase containing microorganisms of the instant invention were isolated from activated sludge from waste water treatment plants.
- Samples suspected of containing a microorganism having Baeyer- Villiger monooxygenase activity may be enriched by incubation in a suitable growth medium in combination with at least one ketone substrate.
- Suitable ketone substrates for use in the instant invention include cyclic ketones and ketoterpenes having the general formula:
- are independently selected from substituted or unsubstituted phenyl, substituted or unsubstituted alkyl, or substituted or unsubstituted alkenyl or substituted or unsubstituted alkylidene. These compounds may be synthetic or natural secondary metabolites
- Particularly useful ketone substrates include, but are not limited to Norcamphor, Cyclobutanone, Cyclopentanone, 2-methyl-cyclopentanone, Cyclohexanone, 2-methyl-cyclohexanone, Cyclohex-2-ene-1-one, 1 ,2- cyclohexanedione, 1 ,3-cyclohexanedione, 1 ,4-cyclohexanedione, Cycloheptanone, Cyclooctanone, Cyclodecanone, Cycloundecanone, Cyclododecanone, Cyclotridecanone, Cyclopenta-decanone, 2- tridecanone, dihexyl ketone, 2-phenyl-cyclohexanone, Oxindole, Levoglucosenone, dimethyl sulfoxide, dimethy-2-piperidone, Phenylboronic acid, and beta-ionone.Growth medium and techniques needed in the enrichment and
- the sequence of the small subunit ribosomal RNA or DNA (16S rDNA) is frequently used for taxonomic identification of novel bacterial.
- 16S rDNA sequences are now available.
- Highly conserved regions of the 16S rDNA provide priming sites for broad-range polymerase chain reaction (PCR) (or RT-PCR) and obviate the need for specific information about a targeted microorganism before this procedure. This permits identification of a previously uncharacterized bacterium by broad range bacterial 16S rDNA amplification, sequencing, and phylogenetic analysis.
- This invention describes the isolation and identification of 7 different bacteria based on their taxonomic identification following amplification of the 16S rDNA using primers corresponding to conserved regions of the 16S rDNA molecule (Amann, R.I. et al. Microbiol. Rev. 59(1):143-69 (1995); Kane, M.D. et al. Appl. Environ. Microbiol. 59:682- 686 (1993)), followed by sequencing and BLAST analysis (Basic Local Alignment Search Tool; Altschul, S. F., et al., J. Mol. Biol. 215:403-410 (1993); see also www.ncbi.nlm.nih.gov/BLAST/). Bacterial strains were identified as highly homologous to bacteria of the genera Brevibacterium, Arthrobacter, Acinetobacter, Acidovorax, and Rhodococcus.
- BP2 to public databases reveals that the most similar known sequences (99% homologous) are the 16S rRNA gene sequences of bacteria of the genus Arthrobacter.
- Comparison of the 16S rRNA nucleotide base sequence from strain SE19 to public databases reveals that the most similar known sequences (99% homologous) are the 16S rRNA gene sequences of bacteria of the genus Acinetobacter.
- the present invention provides examples of Baeyer-Villiger monooxygenase genes and gene products having the ability to convert suitable ketone substrates comprising cyclic ketones and ketoterpenes to the corresponding lactone or ester.
- genes encoding BVMO's have been isolated from Arthrobacter (SEQ ID NO:11 ), Brevibacterium (SEQ ID NOs:13 and 15), Acidovorax (SEQ ID NO: 17), Acinetobacter (SEQ ID NO:19) , and Rhodococcus (SEQ ID NOs:7, 9, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, and 45).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus sp. phil chnB nucleotide base and deduced amino acid sequences reveals that the most similar known sequences range from a distant as about 55% identical to the amino acid sequence of reported herein over length of 542 amino acids using a Smith-Waterman alignment algorithm (W. R.
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus sp. phi2 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 53% identical to the amino acid sequence of reported herein over length of 541 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN 12 ORF8 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 37% identical to the amino acid sequence of reported herein over length of 439 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF9 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 44% identical to the amino acid sequence of reported herein over length of 518 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF10 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 64% identical to the amino acid sequence of reported herein over length of 541 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF11 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 65% identical to the amino acid sequence of reported herein over length of 462 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF12 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 45% identical to the amino acid sequence of reported herein over length of 523 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF13 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 55% identical to the amino acid sequence of reported herein over length of 493 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF14 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 51% identical to the amino acid sequence of reported herein over length of 539 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF15 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 39% identical to the amino acid sequence of reported herein over length of 649 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF16 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 43% identical to the amino acid sequence of reported herein over length of 494 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis W ORF17 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 53% identical to the amino acid sequence of reported herein over length of 499 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF18 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 44% identical to the amino acid sequence of reported herein over length of 493 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF19 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 54% identical to the amino acid sequence of reported herein over length of 541 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- Rhodococcus erythropolis AN1 ORF20 chnB nucleotide base and deduced amino acid sequences to public databases reveals that the most similar known sequences range from a distant as about 42% identical to the amino acid sequence of reported herein over length of 545 amino acids using a Smith-Waterman alignment algorithm (W. R. Pearson, supra).
- Preferred amino acid fragments are at least about 70% - 80% and more preferred amino acid fragments are at least about 80%-90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein.
- preferred chnB encoding nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences reported herein. More preferred chnB nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are chnB nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- BV Family 1 is comprised of the monooxygenase sequences shown in Figure 7 and generating the consensus sequence as set forth in SEQ ID NO:47.
- SEQ ID NO:47 As will be seen in Figure 7, there are a group of completely conserved amino acids in 74 positions across all of the sequences of Figure 7. These positions are further delineated in Figure 6, and indicated as p1 - p74.
- BV Family 2 is comprised of the monooxygenase sequences shown on Figure 8, and generating the consensus sequence as set forth in SEQ ID NO:48.
- the signature seqeunce of BV Family 2 monooxygenases is shown in Figure 6 having the positions p1-p76.
- BV Family 3 monooxygenases are shown in Figure 9, generating the consensus sequence as set for the in SEQ ID NO:49, having the signature sequence as shown in Figure 6 of positions p1-p41.
- step (b) identifying a DNA clone that hybridizes with a nucleic acid fragment of step (a);
- step (c) sequencing the genomic fragment that comprises the clone identified in step (b), wherein the sequenced genomic fragment encodes a Baeyer- Villiger monooxygenase polypeptide.
- the invention provides the above method wherein where at least 100% of the amino acid residues at positions p1- p74 of SEQ ID NO:47, or at least 100% of the amino acid residues at p1-p76 of SEQ ID NO:48 or at least 100% of the amino acid residues of p1-p41 of SEQ ID NO:49 are completely conserved. It will be appreciated that other Baeyer-Villiger monooxygenase genes having similar substrate specificity may be identified and isolated on the basis of sequence dependent protocols or according to alignment against the signature sequences disclosed herein.
- sequence-dependent protocols include, but are not limited to, methods of nucleic acid hybridization, and methods of DNA and RNA amplification as exemplified by various uses of nucleic acid amplification technologies (e.g polymerase chain reaction (PCR), Mullis et al., U.S. Patent 4,683,202), ligase chain reaction (LCR), Tabor, S. et al., Proc. Acad. Sci. USA 82: 1074, (1985)) or strand displacement amplification (SDA, Walker, et al., Proc. Natl. Acad. Sci. U.S.A., 89: 392, (1992)).
- PCR polymerase chain reaction
- LCR ligase chain reaction
- SDA strand displacement amplification
- Walker et al., Proc. Natl. Acad. Sci. U.S.A., 89: 392, (1992)
- genes encoding similar proteins or polypeptides to the present Baeyer-Villiger monooxygenases could be isolated directly by using all or a portion of the nucleic acid fragments set forth in SEQ ID NOs:7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, and 45 or as DNA hybridization probes to screen libraries from any desired bacteria using methodology well known to those skilled in the art.
- Specific oligonucleotide probes based upon the instant nucleic acid sequences can be designed and synthesized by methods known in the art (Maniatis, supra).
- sequences can be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primers DNA labeling, nick translation, or end-labeling techniques, or RNA probes using available in vitro transcription systems.
- specific primers can be designed and used to amplify a part of or full- length of the instant sequences.
- the resulting amplification products can be labeled directly during amplification reactions or labeled after amplification reactions, and used as probes to isolate full length DNA fragments under conditions of appropriate stringency.
- the primers typically have different sequences and are not complementary to each other. Depending on the desired test conditions, the sequences of the primers should be designed to provide for both efficient and faithful replication of the target nucleic acid.
- Methods of PCR primer design are common and well known in the art. (Thein and Wallace, "The use of oligonucleotide as specific hybridization probes in the Diagnosis of Genetic Disorders", in Human Genetic Diseases: A Practical Approach, K. E. Davis Ed., (1986) pp. 33-50 IRL Press, Herndon, Virginia; Rychlik, W. (1993) In White, B. A. (ed.), Methods in Molecular Biology. Vol.
- PCR primers may be used to amplify longer nucleic acid fragments encoding homologous genes from DNA or RNA.
- the polymerase chain reaction may also be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the instant nucleic acid fragments, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3" end of the mRNA precursor encoding microbial genes.
- the second primer sequence may be based upon sequences derived from the cloning vector.
- the invention provides a method for identifying a nucleic acid molecule encoding a Baeyer-Villiger monooxygenase comprising: (a) synthesizing at least one oligonucleotide primer corresponding to a portion of the sequence selected from the group consisting of SEQ ID NOs:7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41 , 43, and 45 and (b) amplifying an insert present in a cloning vector using the oligonucleotide primer of step (a); wherein the amplified insert encodes a Baeyer-Villiger monooxygenase
- the instant sequences may be employed as hybridization reagents for the identification of homologs.
- the basic components of a nucleic acid hybridization test include a probe, a sample suspected of containing the gene or gene fragment of interest, and a specific hybridization method.
- Probes of the present invention are typically single stranded nucleic acid sequences which are complementary to the nucleic acid sequences to be detected. Probes are "hybridizable" to the nucleic acid sequence to be detected.
- the probe length can vary from 5 bases to tens of thousands of bases, and will depend upon the specific test to be done. Typically a probe length of about 15 bases to about 30 bases is suitable. Only part of the probe molecule need be complementary to the nucleic acid sequence to be detected.
- the complementarity between the probe and the target sequence need not be perfect. Hybridization does occur between imperfectly complementary molecules with the result that a certain fraction of the bases in the hybridized region are not paired with the proper complementary base. Hybridization methods are well defined.
- the probe and sample must be mixed under conditions which will permit nucleic acid hybridization. This involves contacting the probe and sample in the presence of an inorganic or organic salt under the proper concentration and temperature conditions. The probe and sample nucleic acids must be in contact for a long enough time that any possible hybridization between the probe and sample nucleic acid may occur. The concentration of probe or target in the mixture will determine the time necessary for hybridization to occur. The higher the probe or target concentration the shorter the hybridization incubation time needed.
- a chaotropic agent may be added.
- the chaotropic agent stabilizes nucleic acids by inhibiting nuclease activity. Furthermore, the chaotropic agent allows sensitive and stringent hybridization of short oligonucleotide probes at room temperature [Van Ness and Chen (1991) Nucl. Acids Res. 19:5143-5151].
- Suitable chaotropic agents include guanidinium chloride, guanidinium thiocyanate, sodium thiocyanate, lithium tetrachloroacetate, sodium perchlorate, rubidium tetrachloroacetate, potassium iodide, and cesium trifluoroacetate, among others.
- the chaotropic agent will be present at a final concentration of about 3M. If desired, one can add formamide to the hybridization mixture, typically 30-50% (v/v).
- hybridization solutions can be employed. Typically, these comprise from about 20 to 60% volume, preferably 30%, of a polar organic solvent.
- a common hybridization solution employs about 30-50% v/v formamide, about 0.15 to 1M sodium chloride, about 0.05 to 0.1 M buffers, such as sodium citrate, Tris-HCI, PIPES or HEPES (pH range about 6-9), about 0.05 to 0.2% detergent, such as sodium dodecylsulfate, or between 0.5-20 mM EDTA, FICOLL (Pharmacia Inc.) (about
- the invention provides a method for identifying a nucleic acid molecule encoding a Baeyer-Villiger monooxygenase comprising:(a) probing a genomic library with a portion of a nucleic acid molecule selected from the group consisting of SEQ ID NOs:7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39, 41, 43, and 45 ;(b) identifying a DNA clone that hybridizes under conditions of 0.1X SSC, 0.1 % SDS, 65°C and washed with 2X SSC, 0.1% SDS followed by 0.1 X SSC, 0.1% SDS with the nucleic acid molecule of (a); and (c) sequencing the genomic fragment that comprises the clone identified in step (b), wherein the sequenced genomic fragment encodes Baeyer-Villiger monooxygenase.
- the genes and gene products of the present BVMO sequences may be introduced into microbial host cells.
- Preferred host cells for expression of the instant genes and nucleic acid molecules are microbial hosts that can be found broadly within the fungal or bacterial families and which grow over a wide range of temperature, pH values, and solvent tolerances. Because of transcription, translation and the protein biosynthetic apparatus is the same irrespective of the cellular feedstock, functional genes are expressed irrespective of carbon feedstock used to generate cellular biomass. Large scale microbial growth and functional gene expression may utilize a wide range of simple or complex carbohydrates, organic acids and alcohols, saturated hydrocarbons such as methane or carbon dioxide in the case of photosynthetic or chemoautotrophic hosts.
- the functional genes may be regulated, repressed or depressed by specific growth conditions, which may include the form and amount of nitrogen, phosphorous, sulfur, oxygen, carbon or any trace micronutrient including small inorganic ions.
- the regulation of functional genes may be achieved by the presence or absence of specific regulatory molecules that are added to the culture and are not typically considered nutrient or energy sources. Growth rate may also be an important regulatory factor in gene expression. Examples of suitable host strains include but are not limited to fungal or yeast species such as Aspergillus, Trichoderma,
- Saccharomyces, Pichia, Candida, Hansenula, or bacterial species such as member of the proteobacteria and actinomycetes as well as the specific genera Rhodococcus, Acinetobacter, Arthrobacter, Mycobacteria, Nocardia, Brevibacterium, Acidovorax, Bacillus, Streptomyces, Escherichia, Salmonella, Pseudomonas, Aspergillus, Saccharomyces, Pichia, Candida, Cornyebacterium, and Hansenula.
- the Proteobacteria form a physiologically diverse group of microorganisms and represent five subdivisions ( ⁇ , ⁇ , ⁇ , ⁇ , ⁇ ) (Madigan et al., Brock Biology of Microorganisms. 8th edition, Prentice Hall, UpperSaddle River, NJ (1997)). All five subdivisions of the Proteobacteria contain microorganisms that use organic compounds as sources of carbon and energy.
- Proteobacteria suitable in the present invention include, but are not limited to Burkholderia, Alcaligenes, Pseudomonas, Sphingomonas, Pandoraea, Delftia and Comamonas.
- Microbial expression systems and expression vectors containing regulatory sequences that direct high level expression of foreign proteins are well known to those skilled in the art. Any of these could be used to construct chimeric genes for production of the any of the gene products of the instant sequences. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high level expression of the enzymes.
- Vectors or cassettes useful for the transformation of suitable host cells are well known in the art.
- the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration.
- Suitable vectors comprise a region 5" of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.
- Initiation control regions or promoters which are useful to drive expression of the instant ORF's in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes is suitable for the present invention including but not limited to CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, ara, tet, trp, IPj_, IP R , T7, tac, and trc (useful for expression in Escherichia coli) as well as the amy, apr, npr promoters and various phage promoters useful for expression in Bacillus.
- Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary, however, it is most preferred if included.
- sequences encoding the BVMO's of the present invention may be used to create transgenic plants having the ability to express the microbial proteins.
- Preferred plant hosts will be any variety that will support a high production level of the instant proteins.
- Suitable green plants will included but are not limited to of soybean, rapeseed (Brassica napus, B. campestris), sunflower (Helianthus annus), cotton (Gossypium hirsutum), corn, tobacco (Nicotiana tabacum), alfalfa (Medicago sativa), wheat (Triticum sp), barley (Hordeum vulgare), oats (Avena sativa, L), sorghum (Sorghum bicolor), rice (Oryza sativa), Arabidopsis, cruciferous vegetables (broccoli, cauliflower, cabbage, parsnips, etc.), melons, carrots, celery, parsley, tomatoes, potatoes, strawberries, peanuts, grapes, grass seed crops, sugar beets, sugar cane, beans, peas, rye, flax, hardwood trees, softwood trees, and forage grasses.
- Algal species include but not limited to commercially significant hosts such as Spirulina and Dunalliela.
- Overexpression of the proteins of the instant invention may be accomplished by first constructing chimeric genes in which the coding region are operably linked to promoters capable of directing expression of a gene in the desired tissues at the desired stage of development.
- the chimeric genes may comprise promoter sequences and translation leader sequences derived from the same genes. 3' Non-coding sequences encoding transcription termination signals must also be provided.
- the instant chimeric genes may also comprise one or more introns in order to facilitate gene expression.
- any combination of any promoter and any terminator capable of inducing expression of a coding region may be used in the chimeric genetic sequence.
- Some suitable examples of promoters and terminators include those from nopaline synthase (nos), octopine synthase (ocs) and cauliflower mosaic virus (CaMV) genes.
- One type of efficient plant promoter that may be used is a high level plant promoter. Such promoters, in operable linkage with the genetic sequences or the present invention should be capable of promoting expression of the present gene product.
- High level plant promoters that may be used in this invention include the promoter of the small subunit (ss) of the ribulose-1 ,5- bisphosphate carboxylase from example from soybean (Berry-Lowe et al., J. Molecular and App. Gen., 1 :483-498 1982)), and the promoter of the chlorophyll a/b binding protein. These two promoters are known to be light-induced in plant cells (See, for example, Genetic Engineering of Plants, an Agricultural Perspective. A. Cashmore, Plenum, New York (1983), pages 29-38; Coruzzi, G. et al., The Journal of Biological Chemistry, 258:1399 (1983), and Dunsmuir, P. et al., Journal of Molecular and Applied Genetics, 2:285 (1983)).
- Plasmid vectors comprising the instant chimeric genes can then be constructed.
- the choice of plasmid vector depends upon the method that will be used to transform host plants. The skilled artisan is well aware of the genetic elements that must be present on the plasmid vector in order to successfully transform, select and propagate host cells containing the chimeric gene. The skilled artisan will also recognize that different independent transformation events will result in different levels and patterns of expression (Jones et al., EMBO J. 4:2411 -2418 (1985); De Almeida et al., Mol. Gen. Genetics 218:78-86 (1989)), and thus that multiple events must be screened in order to obtain lines displaying the desired expression level and pattern. Such screening may be accomplished by Southern analysis of DNA blots (Southern, J. Mol. Biol. 98:503, (1975)). Northern analysis of mRNA expression (Kroczek, J.
- the chimeric genes described above may be further supplemented by altering the coding sequences to encode enzymes with appropriate intracellular targeting sequences such as transit sequences (Keegstra, K., Cell 56:247-253 (1989)), signal sequences or sequences encoding endoplasmic reticulum localization (Chrispeels, J.J., Ann. Rev. Plant Phys. Plant Mol. Biol. 42:21-53 (1991)), or nuclear localization signals (Raikhel, N. Plant Phys.100: 1627-1632 (1992)) added and/or with targeting sequences that are already present removed. While the references cited give examples of each of these, the list is not exhaustive and more targeting signals of utility may be discovered in the future that are useful in the invention.
- ketone substrate for the production of Lactones and Esters from Ketone Substrates
- the organism may be contacted with a suitable ketone substrate for the production of the corresponding ester.
- the Baeyer-Villiger monooxygenases of the instant invention will act on a variety of ketone substrates comprising cyclic ketones and ketoterpenes to produce the corresponding lactone or ester.
- Suitable ketone substrates for the conversion to esters are defined by the general formula: O
- R and R are independently selected from substituted or unsubstituted phenyl, substituted or unsubstituted alkyl, or substituted or unsubstituted alkenyl or substituted or unsubstituted alkylidene.
- Particularly useful ketone substrates include, but are not limited to Norcamphor, Cyclobutanone, Cyclopentanone, 2-methyl-cyclopentanone, Cyclohexanone, 2-methyl-cyclohexanone, Cyclohex-2-ene-1-one, 1 ,2- cyclohexanedione, 1 ,3-cyclohexanedione, 1 ,4-cyclohexanedione, Cycloheptanone, Cyclooctanone, Cyclodecanone, Cycloundecanone, Cyclododecanone, Cyclotridecanone, Cyclopenta-decanone, 2- tridecanone, dihexyl ketone, 2-phenyl-cyclohexanone, Oxindole, Levoglucosenone, dimethyl sulfoxide, dimethy-2-piperidone, Phenylboronic acid, and beta-ionone.
- the enzymes of the invention may be used in vitro for the transformation of ketone substrates to the corresponding esters.
- the monooxygenase enzymes may be produced recombinantly or isoalted from native sources, purified and reacted with the appropriate substrate under suitalbe conditions of pH and temperature.
- large scale commercial production of lactones or esters is desired, a variety of culture methodologies may be applied.
- large scale production from a recombinant microbial host may be produced by both batch or continuous culture methodologies.
- a classical batch culturing method is a closed system where the composition of the media is set at the beginning of the culture and not subject to artificial alterations during the culturing process.
- the media is inoculated with the desired organism or organisms and growth or metabolic activity is permitted to occur adding nothing to the system.
- a "batch" culture is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration.
- the metabolite and biomass compositions of the system change constantly up to the time the culture is terminated.
- cells moderate through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted.
- Fed-Batch culture processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the culture progresses.
- Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as C0 2 .
- Batch and Fed-Batch culturing methods are common and well known in the art and examples may be found in Thomas D.
- continuous culture may be practiced with immobilized cells where carbon and nutrients are continuously added, and valuable products, by-products or waste products are continuously removed from the cell mass.
- Cell immobilization may be performed using a wide range of solid supports composed of natural and/or synthetic materials.
- Continuous or semi-continuous culture allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration.
- one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate.
- a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant.
- Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to media being drawn off must be balanced against the cell growth rate in the culture.
- Methods of modulating nutrients and growth factors for continuous culture processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology and a variety of methods are detailed by Brock, supra. Baeyer-Villiger monooxygenases having enhanced activity
- BVMO sequences may be used to produce gene products having enhanced or altered activity.
- Various methods are known for mutating a native gene sequence to produce a gene product with altered or enhanced activity including but not limited to error prone PCR (Melnikov et al., Nucleic Acids Research, (Feb. 15, 1999) Vol. 27, No. 4, pp. 1056-1062); site directed mutagenesis (Coombs et al., Proteins (1998), 259-311 , 1 plate. Editor(s): Angeletti, Ruth Hogue. Publisher: Academic, San Diego, CA) and "gene shuffling" (US 5,605,793; US 5,811 ,238; US 5,830,721; and US 5,837,458, incorporated herein by reference).
- the method of gene shuffling is particularly attractive due to its facile implementation, and high rate of mutagenesis and ease of screening.
- the process of gene shuffling involves the restriction endonuclease cleavage of a gene of interest into fragments of specific size in the presence of additional populations of DNA regions of both similarity to or difference to the gene of interest. This pool of fragments will then be denatured and reannealed to create a mutated gene. The mutated gene is then screened for altered activity.
- the BVMO sequences of the present invention may be mutated and screened for altered or enhanced activity by this method.
- the sequences should be double stranded and can be of various lengths ranging form 50 bp to 10 kb.
- the sequences may be randomly digested into fragments ranging from about 10 bp to 1000 bp, using restriction endonucleases well known in the art (Maniatis supra).
- populations of fragments that are hybridizable to all or portions of the microbial sequence may be added.
- a population of fragments which are not hybridizable to the instant sequence may also be added.
- these additional fragment populations are added in about a 10 to 20 fold excess by weight as compared to the total nucleic acid. Generally if this process is followed the number of different specific nucleic acid fragments in the mixture will be about 100 to about 1000.
- the mixed population of random nucleic acid fragments are denatured to form single-stranded nucleic acid fragments and then reannealed. Only those single-stranded nucleic acid fragments having regions of homology with other single-stranded nucleic acid fragments will reanneal.
- the random nucleic acid fragments may be denatured by heating. One skilled in the art could determine the conditions necessary to completely denature the double stranded nucleic acid. Preferably the temperature is from 80°C to 100°C.
- the nucleic acid fragments may be reannealed by cooling. Preferably the temperature is from 20°C to 75°C. Renaturation can be accelerated by the addition of polyethylene glycol ("PEG") or salt. A suitable salt concentration may range from 0 mM to 200 mM.
- PEG polyethylene glycol
- a suitable salt concentration may range from 0 mM to 200 mM.
- the annealed nucleic acid fragments are then incubated in the presence of a nucleic acid polymerase and dNTP's (i.e. dATP, dCTP, dGTP and dTTP).
- the nucleic acid polymerase may be the Klenow fragment, the Taq polymerase or any other DNA polymerase known in the art.
- the polymerase may be added to the random nucleic acid fragments prior to annealing, simultaneously with annealing or after annealing.
- the cycle of denaturation, renaturation and incubation in the presence of polymerase is repeated for a desired number of times. Preferably the cycle is repeated from 2 to 50 times, more preferably the sequence is repeated from 10 to 40 times.
- the resulting nucleic acid is a larger double-stranded polynucleotide ranging from about 50 bp to about 100 kb and may be screened for expression and altered activity by standard cloning and expression protocol. (Manatis supra).
- a hybrid protein can be assembled by fusion of functional domains using the gene shuffling (exon shuffling) method (Nixon et al, PNAS, 94:1069-1073 (1997)).
- the functional domain of the instant gene can be combined with the functional domain of other genes to create novel enzymes with desired catalytic function.
- a hybrid enzyme may be constructed using PCR overlap extension method and cloned into the various expression vectors using the techniques well known to those skilled in art.
- Rhodococcus erythropolis AN 12 Brevibacterium sp. HCU, Arthrobacter sp. BP2, Rhodococcus sp. phil , Rhodococcus sp. phi2, Acidovorax sp. CHX, and Acinetobacter sp. SE19 were isolated from enrichment of activated sludge obtained from industrial wastewater treatment facilities.
- Max Efficiency competent cells of E. coli DH5 ⁇ and DH10B were purchased from GIBCO/BRL (Gaithersburg, MD).
- Expression plasmid pQE30 were purchased from Qiagen (Valencia, CA), while cloning vector pCR2.1 and expression vector pTrc/His2-Topo were purchased from Invitrogen (San Diego, CA).
- Taxonomic identification of Rhodococcus erythropolis AN12, Brevibacterium sp. HCU, Arthrobacter sp. BP2, Rhodococcus sp. phil , Rhodococcus sp. phi2, Acidovorax sp. CHX, and Acinetobacter sp. SE19 was performed by PCR amplification of 16S rDNA from chromosomal DNA using primers corresponding to conserved regions of the 16S rDNA molecule (Table 2). The following temperature program was used: 95°C (5 min) for 1 cycle followed by 25 cycles of: 95°C (1 min), 55°C (1 min), 72°C (1 min), followed by a final extension at 72°C (8 min).
- the 16S rDNA gene sequence of each isolate was used as the query sequence for a BLAST search (Altschul, et al., Nucleic Acids Res. 25:3389-3402 (1997)) against GenBank for similar sequences.
- Seguencing Sequence was generated on an ABI Automatic sequencer using dye terminator technology (U.S. Patent 5,366,860; EP 272007) using a combination of vector and insert-specific primers. Sequence editing was performed using either Sequencher (Gene Codes Corp., Ann Arbor, Ml) or the Wisconsin GCG program (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wl) and the CONSED package
- GCG Genetics Computer Group Inc.
- GCG program “Pileup” the gap creation default value of 12 and the gap extension default value of 4 were used.
- GCG “Gap” or “Bestfit” programs the default gap creation penalty of 50 and the default gap extension penalty of 3 were used. In any case where GCG program parameters were not prompted for, in these or any other GCG program, default values were used.
- EXAMPLE 1 Monooxygenase Gene Discovery in a Mixed Microbial Population
- This Example describes the isolation of the cyclohexanone degrading organisms Arthrobacter sp. BP2, Rhodococcus sp. phil , and Rhodococcus sp. phi2 by enrichment of a mixed microbial community.
- Differential display techniques applied to cultures containing the mixed microbial population permitted discovery of monooxygenase genes.
- a mixed microbial community was obtained from a wastewater bioreactor and maintained on minimal medium (50 mM KHP0 (pH 7.0), 10 mM (NH 4 )S0 4 , 2 mM MgCI 2 , 0.7 mM CaCI 2 , 50 ⁇ M MnCI 2 , 1 ⁇ M FeCI 3 , 1 ⁇ M ZnCI 3 , 1.72 ⁇ M CuS0 4 , 2.53 ⁇ M CoCI 2 , 2.42 ⁇ M Na 2 Mo0 2 , and 0.0001% FeS0 4 ) with trace amounts of yeast extract casamino acids and peptone (YECAAP) at 0.1 % concentration with 0.1% cyclohexanol and cyclohexanone added as carbon sources. Increased culture growth in the presence of cyclohexanone indicated a microbial population with members that could convert cyclohexanone. Isolation of Strains
- Rhodococcus strain BP2 formed large colonies of a light yellow color.
- species phil formed small colonies that were orange in color.
- species phi2 formed small colonies that were red in color.
- strains were identified by comparing 16s rDNA sequences to known 16S rRNA sequences in the GenBank sequence database.
- the 16S rRNA gene sequence from strain BP2 (SEQ ID NO:1 ) was at least 99% homologous to the 16S rRNA gene sequences of bacteria belonging to the genus Arthrobacter.
- the 16S rRNA gene sequences from strains phil and phi2 were each at least 99% homologous to the 16S rRNA gene sequences of bacteria belonging to the genus of gram positive bacteria, Rhodococcus.
- the complete 16s DNA sequence of Rhodococcus sp. phil is shown as SEQ ID NO:2, while that of Rhodococcus sp. phi2 is listed as SEQ ID NO:3. Induction of cyclohexanone oxidation genes
- control and induced sample (2 mL each) were harvested at 1400 rpm in a 4 °C centrifuge and resuspended in 900 ⁇ l Buffer RLT (Qiagen, Valencia, CA).
- Buffer RLT Qiagen, Valencia, CA
- a 300 ⁇ l volume of zirconia beads Biospec Products, Bartlesville, OK was added and cells were disrupted using a bead beater (Biospec Products) at 2400 beats per min for 3 min.
- Each of these samples was split into six aliquots for nucleic acid isolation using the RNeasy Mini Kit (Qiagen, Valencia, CA) and each was eluted with 100 RNase-free dH 2 0 supplied with the kit.
- a set of 244 primers with the sequence CGGAGCAGATCGAVVVV (SEQ ID NO:63); where VWV represent all the combinations of the three bases A, G and C) was used in separate RT-PCR reactions as with RNA from either the control or induced cells.
- the SuperscriptTM One-StepTM RT-PCR System (Life Technologies Gibco BRL, Rockville, MD) reaction mixture was used with 2-5 ng of total RNA in a 25 ⁇ l total reaction volume.
- the PCR was conducted using the following temperature program:
- a 25 ⁇ l volume of a sodium cyanide elution buffer (10mg/ml NaCN, 20 mM Tris-HCI (pH 8.0), 50 mM KCI and 0.05% NP40) was incubated with an excised gel band of a differentially display fragment at 95°C for 20 min. Reamplification of this DNA fragment was achieved in a PCR reaction using 5 ⁇ l of the elution mixture in a 25 ⁇ l reaction using the primer from which the fragment was originally generated.
- the temperature program for reamplification was: 94 °C (5 min); 20 cycles of 94 °C (1 min), 55 °C (1 min), and 72 °C (1 min); followed by 72 °C (7 min).
- the reamplification products were directly cloned into the pCR2.1-TOPO vector (Invitrogen, Carlsbad, CA) and were sequenced using an ABI model 377 with ABI BigDye terminator sequencing chemistry (Perseptive Biosystems, Framinham, MA). Eight clones were submitted for sequencing from each reamplified band. The nucleotide sequence of the cloned fragments was compared against the non-redundant GenBank database using the BlastX program (NCBI). Seguencing of cyclohexanone oxidation pathway genes
- Oligonucleotides were designed to amplify by PCR individual differentially expressed fragments. Following DNA isolation from individual strains, these oligonucleotide primers were used to determine which strain contained DNA encoding the individual differentially expressed fragments. Cosmids were screened by PCR using primers designed against differentially displayed fragments with homology to known cyclohexanone degradation genes. Each recombinant E. coli cell culture carrying a cosmid clone (1.0 ⁇ l) was used as the template in a 25 ul PCR reaction mixture. The primer pair A102FI (SEQ ID NO: 108) and CONR (SEQ ID NO: 109) was used to screen the Arthrobacter sp.
- BP2 library primer pair A228FI (SEQ ID NO:110) and A228RI (SEQ ID NO:111 ) was used to screen the Rhodococcus sp. phi2 library, and the primer pair of A2FI (SEQ ID NO:112) and A34RI (SEQ ID NO:113) was used to screen the Rhodococcus sp. phil library.
- Cosmids from recombinant E. coli which produced the correct product size in PCR reactions were isolated, digested partially with Sau3AI and 10-15 kB fragments from this partial digest were sub-cloned into the blue/white screening vector pSU19 (Bartolome, B. et al. Gene.
- a halotolerant bacterium degrading cyclohexanol and cyclohexanone was performed on agar plates of a halophilic minimal medium (Per liter: 15 g Agar, 100 g NaCI, 10 g MgS0 4 , 2 g KCI, 1 g NH 4 CI, 50 mg KH 2 P0 4 , 2 mg FeS0 4 , 8 g, Tris-HCI (pH 7)) containing traces of yeast extract and casaminoacids (0.005% each) and incubated under vapors of cyclohexanone at 30°C.
- the inoculum was a resuspension of sludge from industrial wastewater treatment plant. After two weeks, beige colonies were observed and streaked to purity on fresh agar plates grown under the same conditions.
- the complete 16s DNA sequence of the isolated Brevibacterium sp. HCU was found to be unique and is shown as SEQ ID NO:4. Comparison to other 16S rRNA sequences in the GenBank sequence database found the 16S rRNA gene sequence from strain HCU was at least 99%o homologous to the 16S rRNA gene sequences of bacteria belonging to the genus Brevibacterium. Induction of the Cyclohexanone Degradation Pathway lnduciblity of the cyclohexanone pathway was tested by respirometry in low salt medium. One colony of Brevibacterium sp.
- HCU was inoculated in 300 ml of S12 mineral medium (50 mM KHP0 4 buffer (pH 7.0), 10 mM (NH4) 2 S0 4 , 2 mM MgCI 2 , 0.7 mM CaCI 2 , 50 uM MnCI 2 , 1 ⁇ M FeCI 3 , 1 ⁇ M ZnCI 3 , 1.72 ⁇ M CuS0 4 , 2.53 ⁇ M CoCl 2 , 2.42 ⁇ M Na 2 Mo0 2 , and 0.0001% FeS0 4 ) containing 0.005% yeast extract.
- the culture was then split into two flasks which received respectively 10 mM acetate and 10 mM cyclohexanone.
- the cyclohexanone oxidation pathway was induced by addition of 0.1 % cyclohexanone into one of two "split" 10 ml cultures of
- Brevibacterium sp. HCU grown in S12 medium. Each culture was chilled rapidly in an ice-water bath and transferred to a 15 ml tube. Cells were collected by centrifugation for 2 min at 12,000 x g in a rotor chilled to -4°C. The supernatants were discarded, the pellets resuspended in 0.7 ml of ice-cold solution of 1% SDS and 100 mM sodium acetate at pH 5 and transferred to a 2 ml tube containing 0.7 ml of aqueous phenol pH 5 and 0.3 ml of 0.5 mm zirconia beads (Biospec Products, Bartlesville, OK).
- the tubes were placed in a bead beater (Biospec) and disrupted at 2,400 beats per min for two min. Following the disruption of the cells, the liquid phases of the tubes were transferred to new microfuge tubes and the phases separated by centrifugation for 3 min at 15,000 x g.
- the aqueous phase containing total RNA was extracted twice more with phenol at pH 5 and twice with a mixture of phenol/chloroform/isoamyl alcohol pH 7.5 until a precipitate was no longer visible at the phenol/water interface. Nucleic acids were then recovered from the aqueous phase by ethanol precipitation with three volumes of ethanol and the pellet resuspended in 0.5 ml of diethyl pyrocarbonate (DEPC) treated water.
- DEPC diethyl pyrocarbonate
- RNAse-free DNAse Boehringer Mannheim, Indianapolis, IN
- the total RNA solution was then extracted twice with phenol/chloroform/isoamyl alcohol pH 7.5, recovered by ethanol precipitation and resuspended in 1 ml of DEPC treated water to an approximate concentration of 0.5 mg per ml.
- RT-PCR amplification experiments were performed on the total RNA from the control and induced cells, each using a single RT-PCR oligonucleotide. Briefly, 50 ⁇ l reverse transcription (RT) reactions were performed on 20-100 ng of total RNA using 100 U Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega, Madison, Wl) with 0.5 mM of each dNTP and 1 mM for each oligonucleotide primer. Reactions were prepared on ice and incubated at 37°C for 1 hr.
- MMLV Moloney Murine Leukemia Virus
- RAPD fragments were separated by electrophoresis on acrylamide gels (15 cm x 15 cm x 1.5 mm, 6% acrylamide, 29:1 acryl:bisacrylamide, 100 mM Tris, 90 mM borate, 1 mM EDTA pH 8.3). Five ⁇ l from each PCR reaction were analyzed with the reactions from the control and the induced RNA for each primer running side by side. Electrophoresis was performed at 1 V/cm. DNA fragments were visualized by silver staining using the Plus One® DNA silver staining kit in the Hoefer automated gel stainer (Amersham Pharmacia Biotech, Piscataway, NJ).
- Each reamplified fragment was cloned into the blue/white cloning vector pCR2.1 (Invitrogen, San Diego, CA) and sequenced using the universal forward and reverse primers (M13 Reverse Primer (SEQ ID NO:64) and M13 (-20) Forward Primer (SEQ ID NO:65). Extension of monooxygenase fragments by Out-PCR. Kilobase-long DNA fragments extending the sequences fragments identified by differential display were generated by "Out-PCR", a PCR technique using an arbitrary primer in addition to a sequence specific primer. The first step of this PCR-based gene walking technique consisted of randomly copying the chromosomal DNA using a primer of arbitrary sequence in a single round of amplification under low stringency conditions.
- the primers used for Out-PCR were chosen from a primer set used for mRNA differential display and their sequences were CGGAGCAGATCGAVVVV (SEQ ID NO:63) where VVVV was A, G or C.
- Ten Out-PCR reactions were performed, each using one primer of arbitrary sequence.
- the reactions (50 ⁇ l) included a 1X concentration of the rTth XL buffer provided by the manufacturer (Perkin-Elmer, Foster City, CA), 1.2 mM magnesium acetate, 0.2 mM of each dNTP, 10-100 ng genomic DNA, 0.4 mM of one arbitrary primer and 1 unit of rTth XL polymerase (Perkin-Elmer).
- each reaction was split into two tubes. One tube received a specific primer (0.4 mM) designed against the end of the sequence to be extended and directed outward, while the second tube received water and was used as a control. Thirty additional PCR cycles were performed under higher stringency conditions with denaturization at 94°C (1 min), annealing at 60°C (0.5 min) and extension at 72°C (10 min).
- the long extension time was designed to allow for the synthesis of long DNA fragments by the long range rTth XL DNA polymerase.
- the products of each pair of reactions were analyzed in adjacent lanes on an agarose gel. Bands present in the sample having received the specific primer but not in the control sample were excised from the agarose gel, melted in 0.5 ml H 2 0 and used as the template in a new set of PCR reactions.
- a 1X concentration of rTth XL buffer, 1.2 mM magnesium acetate, 0.2 mM of each dNTP, 0.4 mM of primers, 1/1000 dilution of the melted slice and 1 unit of rTth XL polymerase were used for these reactions.
- the PCR was performed at 94°C (1 min), 60°C (0.5 min), and 72°C (15 min) per cycle for 20 cycles.
- two control reactions lacking either the arbitrary primer or the specific primer, were included in order to confirm that the reamplification of the band of interest required both the specific and arbitrary primer.
- DNA fragments that required both the specific and arbitrary primer for amplification were sequenced.
- the long fragments obtained by Out-PCR were partially digested with Mbol and cloned into pCR2.1 (Invitrogen, Carlsbad, CA). Sequences for these partial fragments were obtained using primers designed against the vector sequence.
- This Example describes the isolation of the cyclohexane degrader Acidovorax sp. CHX. Discovery of a BVMO gene was accomplished using differential display methods. Strain Isolation An enrichment for bacteria growing on cyclohexane as a sole carbon source was started by adding 5 ml of an industrial wastewater sludge to 20 ml of mineral medium (50 mM KHP0 4 (pH 7.0), 10 mM (NH 4 )S0 4 , 2 mM MgCI 2 , 0.7 mM CaCI 2 , 50 ⁇ M MnCI 2 , 1 ⁇ M FeCI 3 , 1 ⁇ M ZnCI 3 , 1.72 ⁇ M CuS0 4 , 2.53 ⁇ M CoCI 2 , 2.42 ⁇ M Na 2 Mo0 2 , and 0.0001 % FeS0 ) in a 125 ml Erienmeyer flask sealed with a Teflon lined screw cap.
- mineral medium 50 mM KHP0 4
- a test tube containing 1 ml of a mixture of mineral oil and cyclohexane (8/1 v/v) was fitted in the flask to provide a low vapor pressure of cyclohexane (approximately 30% of the vapor pressure of pure cyclohexane).
- the enrichment was incubated at 30°C for a week. Periodically, 1 to 10 dilutions of the enrichment were performed in the same mineral medium supplemented with 0.005% of yeast extract under low cyclohexane vapors. After several transfers, white flocks could be seen in the enrichments under cyclohexane vapors. If cyclohexane was omitted, the flocks did not grow.
- the flocks could be grown with 4 ⁇ l of liquid cyclohexanone added directly to 10 ml of medium.
- To isolate colonies flocks were washed in medium and disrupted by thorough shaking in a bead beater. The cells released from the disrupted flocks were streaked onto R2A medium agar plates and incubated under cyclohexane vapors. Pinpoint colonies were picked under a dissecting microscope and inoculated in 10 ml of mineral medium supplemented with 0.01% yeast extract and 4 ⁇ l of cyclohexane. The flocks were grown, disrupted and streaked again until a pure culture was obtained.
- Taxonomic identification of this isolate was performed by PCR amplification of 16S rDNA, as described in the General Methods.
- the 16S rRNA gene sequence from strain CHX was at least 98% homologous to the 16S rRNA gene sequence of an uncultured bacterium (Seq. Accession number AF143840) and 95% homologous to the 16s rRNA gene sequences of the genus Acidovorax termperans (Accession number AF078766).
- the complete 16s DNA sequence of the isolated Acidovorax sp. CHX is shown as SEQ ID NO:5.
- Induction of Cyclohexane Degradation Genes For induction of cyclohexane degradation genes, colonies of
- Acidovorax sp. CHX were scraped from an R2A agar plate and inoculated into 25 ml R2A broth. This culture was incubated overnight at 30°C. The next day 25 ml of fresh R2A broth was added and growth was continued for 15 min. The culture was split into two separate flasks, each of which received 25 ml. To one of these flasks, 5 ⁇ l of pure cyclohexane was added to induce expression of cyclohexane degradation genes. The other flask was kept as a control. Differential display was used to identify the Acidovorax sp. CHX monooxygenase gene. Identification of cyclohexane induced gene sequences and sequencing cyclohexanone oxidation genes from strains was performed in a similar manner as described in Example 1.
- Acinetobacter sp. SE19 Discovery of a BV monooxygenase gene was accomplished by screening of cosmid libraries, followed by sequencing of shot-gun libraries. Isolation of Strain An enrichment for bacteria that grow on cyclohexanol was isolated from a cyclopentanol enrichment culture.
- the enrichment culture was established by inoculating 1 mL of activated sludge into 20 mL of S12 medium (10 mM ammonium sulfate, 50 mM potassium phosphate buffer (pH 7.0), 2 mM MgCI 2 , 0.7 mM CaCI 2 , 50 uM MnCI 2 , 1 uM FeCI 3 , 1 uM ZnCI 3 , 1.72 uM CuS0 4 , 2.53 uM CoCI 2 , 2.42 uM Na 2 Mo0 2 , and 0.0001 % FeS0 4 ) in a sealed 125 mL screw-cap Erienmeyer flask.
- S12 medium 10 mM ammonium sulfate, 50 mM potassium phosphate buffer (pH 7.0), 2 mM MgCI 2 , 0.7 mM CaCI 2 , 50 uM MnCI 2 , 1 uM FeCI 3 , 1 uM ZnCI 3
- the enrichment culture was supplemented with 100 ppm cyclopentanol added directly to the culture medium and was incubated at 35°C with reciprocal shaking.
- the enrichment culture was maintained by adding 100 ppm cyclopentanol every 2-3 days.
- the culture was diluted every 2-10 days by replacing 10 mL of the culture with the same volume of S12 medium. After 15 days of incubation, serial dilutions of the enrichment culture were spread onto LB plates. Single colonies were screened for the ability to grow on S12 liquid with cyclohexanol as the sole carbon and energy source. The cultures were grown at 35°C in sealed tubes.
- One of the isolates, strain SE19 was selected for further characterization.
- Acinetobacter sp. SE19 was grown in 25 ml LB medium for 6 h at 37°C with aeration. Bacterial cells were centrifuged at 6,000 rpm for 10 min in a Sorvall RC5C centrifuge at 4°C. Supernatant was decanted and the cell pellet was frozen at -80°C. Chromosomal DNA was prepared as outlined below with special care taken to avoid shearing of DNA. The cell pellet was gently resuspended in 5 ml of 50 mM Tris-10 mM EDTA (pH 8) and lysozyme was added to a final concentration of 2 mg/ml. The suspension was incubated at 37°C for 1 h.
- Sodium dodecyl sulfate was then added to a final concentration of 1% and proteinase K was added at 100 ⁇ g/ml.
- the suspension was incubated at 55°C for 2 h. The suspension became clear and the clear lysate was extracted with equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ). After centrifuging at 12,000 rpm for 20 min, the aqueous phase was carefully removed and transferred to a new tube. Two volumes of ethanol were added and the DNA was gently spooled with a sealed glass pasteur pipet. The DNA was dipped into a tube containing 70% ethanol.
- DNA was resuspended in 400 ⁇ l of TE (10 mMTris-1 mM EDTA, pH 8) with RNaseA (100 ⁇ g/ml) and stored at 4°C. The concentration and purity of DNA was determined spectrophotometrically by OD 26 o/OD 280 . A diluted aliquot of DNA was run on a 0.5% agarose gel to determine the intact nature of DNA. Chromosomal DNA was partially digested with Sau3AI
- DNA (10 ⁇ g) was digested with 0.5 unit of Sau3AI at room temperature in 100 ⁇ l of reaction volume. Aliquots of 20 ⁇ l were withdrawn at various time points of the digestion: e.g., 0, 3, 6, 9, 12 min. DNA loading buffer was added and samples were analyzed on a 0.5% agarose gel to determine the extent of digestion. A decrease in size of chromosomal DNA corresponded to an increase in the length of time for Sau3AI digestion. The preparative reaction was performed using 50 ⁇ g of DNA digested with 1 unit of Sau3AI for 3 min at room temperature.
- the digestion was terminated by addition of 8 mM of EDTA.
- the DNA was extracted once with phenol:chloroform:isoamyl alcohol and once with chloroform.
- the aqueous phase was adjusted to 0.3 M NaOAc and ethanol precipitated.
- the partially digested DNA was dephosphorylated with calf intestinal alkaline phosphatase and ligated to SuperCos 1 vector, which had been treated according to the instructions in the SuperCos 1 Cosmid Vector Kit.
- the ligated DNA was packaged into lamda phage using Gigapack III XL packaging extract, as recommended by Stratagene (manufacturer's instructions were followed).
- the packaged Acinetobacter genomic DNA library contained a phage titer of 5.6 x 1 ⁇ 4 colony forming units per ⁇ g of DNA as determined by transfecting E. co// XL1-Blue MR. Cosmid DNA was isolated from six randomly chosen E. coli transformants and found to contain large inserts of DNA (25-40kb).
- the cosmid library of Acinetobacter sp. SE19 was screened based on the homology of the cyclohexanone monooxygenase gene.
- GAGTCTGAGGGATCCTTAGGCATTGGCAGGTTGCTTGAT (SEQ ID NO:67) were designed based on the published sequence of cyclohexanone monooxygenase gene of Acinetobacter sp. NCIB 9871.
- the cosmid library was screened by PCR using monoL and monoR primers.
- Five positive clones (5B12, 5F5, 8F6, 14B3 and 14D7) were identified among about 1000 clones screened. They all contain inserts of 35-40 kb that show homology to the cyclohexanone monooxygenase gene amplified by monoL and monoR primers.
- cosmid clone 14B3 contains rearranged Acinetobacter DNA adjacent to the monooxygenase gene.
- Shot gun libraries of 5B12 and 8F6 were constructed. Cosmid DNA was sheared in a nebulizer (Inhalation Plastics Inc., Chicago, IL) at 20 psi for 45 sec and the 1-3 kb portion was gel purified. Purified DNA was treated with T4 DNA polymerase and T4 polynucleotide kinase following manufacturer's (GIBCO/BRL) instructions. Polished inserts were ligated into pUC18 vectors using Ready-To-Go pUC18Smal/BAP+Ligase (GIBCO/BRL). The ligated DNA was transformed into E. coli DH5 ⁇ cells and plated on LB with ampicillin and X-gal.
- Rhodococcus erythropolis AN12 strain from wastestream sludge.
- a shotgun sequencing strategy approach permitted sequencing of the entire microbial genome. Isolation of Rhodococcus erythropolis AN12 Strain AN 12 of Rhodococcus erythropolis was isolated on the basis of ability to grow on aniline as the sole source of carbon and energy. Bacteria that grow on aniline were isolated from an enrichment culture.
- the enrichment culture was established by inoculating 1 ml of activated sludge into 10 ml of S12 medium (10 mM ammonium sulfate, 50 mM potassium phosphate buffer (pH 7.0), 2 mM MgCI 2 , 0.7 mM CaCI 2 , 50 ⁇ M MnCI 2 , 1 ⁇ M FeCI 3 , 1 ⁇ M ZnCI 3 , 1.72 ⁇ M CuS0 4 , 2.53 ⁇ M CoCI 2 , 2.42 ⁇ M Na Mo0 2 , and 0.0001 % FeS0 4 ) in a 125 ml screw cap Erienmeyer flask.
- the activated sludge was obtained from a DuPont wastewater treatment facility.
- the enrichment culture was supplemented with 100 ppm aniline added directly to the culture medium and was incubated at 25°C with reciprocal shaking.
- the enrichment culture was maintained by adding 100 ppm of aniline every 2-3 days.
- the culture was diluted every 14 days by replacing 9.9 ml of the culture with the same volume of S12 medium.
- Bacteria that utilize aniline as a sole source of carbon and energy were isolated by spreading samples of the enrichment culture onto S12 agar. Aniline was placed on the interior of each petri dish lid. The petri dishes were sealed with parafilm and incubated upside down at room temperature (25°C). Representative bacterial colonies were then tested for the ability to use aniline as a sole source of carbon and energy.
- Colonies were transferred from the original S12 agar plates used for initial isolation to new S12 agar plates and supplied with aniline on the interior of each petri dish lid. The petri dishes were sealed with parafilm and incubated upside down at room temperature (25°C).
- a 16S rRNA gene of strain AN12 was sequenced (SEQ ID NO:6) as described in the General Methods and compared to other 16S rRNA sequences in the GenBank sequence database.
- the 16S rRNA gene sequence from strain AN 12 was at least 98% homologous to the 16S rRNA gene sequences of high G + C Gram positive bacteria belonging to the genus Rhodococcus.
- Genomic DNA and library construction were prepared according to published protocols (Fraser et al. Science 270(5235): 397-403 (1995)). A cell pellet was resuspended in a solution containing 100 mM Na-EDTA (pH 8.0), 10 mM Tris-HCI (pH 8.0), 400 mM NaCI, and 50 mM MgCI 2 . Genomic DNA preparation After resuspension, the cells were gently lysed in 10% SDS, and incubated for 30 minutes at 55°C.
- 3 %ldentity is defined as percentage of amino acids that are identical between the two proteins.
- D % Similarity is defined as percentage of amino acids that are identical or conserved between the two proteins.
- c Expect value The Expect value estimates the statistical significance of the match, specifying the number of matches, with a given score, that are expected in a search of a database of this size absolutely by chance.
- EXAMPLE 7 Cloning and Expression Of Monooxygenase Genes into Escherichia coli This example illustrates the expression in E. coli of isolated full length BVMO genes from Brevibacterium sp. HCU, Acinetobacter SE19, Rhodococcus sp. phil , Rhodococcus sp. phi2, Arthrobacter sp. BP2 and Acidovorax sp. CHX.
- BVMO's Full length BVMO's were PCR amplified, using chromosomal DNA as the template and the primers shown below in Table 4.
- chnB gene fragments were cloned into pTrcHis-TOPO TA vectors with either an N-terminal tail or C-terminal tail, as provided by the vector sequence (N-terminal tail for Brevibacterium sp.
- Rhodococcus sp. phil Rhodococcus sp. phi2
- Arthrobacter sp Arthrobacter
- Acidovorax sp. CHX monooxygenases were transformed into E. coli, with transformants grown in Luria-Bertani broth supplemented with ampicillin (100 ug/ml) and riboflavin (0.1 ug/ml) at 30°C until the absorbance at 600 nm (A600) reached 0.5. When the A600 was reached, the temperature was shifted to 16°C. The encoded monooxygenase sequences were expressed upon addition of IPTG to the culture media, 30 min after the temperature shift to 16°C. The cultures were grown further overnight (14 hrs) and harvested by centrifugation in a cold centrifuge.
- the cells were treated with lysozyme (100 mg/ml) for 30 min on ice and sonicated. Following sonication, cell extracts were centrifuged and the supernatant was equilibrated with Ni-NTA resin (Qiagen, Valencia, CA) for 1 hr at 4°C. Protein bound resin was washed successively with increasing concentrations of imidazole buffer until the protein of interest was released from the resin. The purified protein was concentrated and the buffer exchanged to remove the imidazole. The protein concentration was adjusted to 1 ug/ml.
- BV monooxygenases were PCR amplified, using chromosomal DNA as the template and the primers shown below in Table 6.
- the gene fragments were cloned into pTrcHis-TOPO TA vectors with either an N-terminal tail or C-terminal tail, as provided by the vector sequence. These vectors were transformed into E. coli, with transformants grown in Luria-Bertani broth supplemented with ampicillin (100 ug/ml).
- Example 9 was tested for activity according to its ability to convert cyclohexanone to caprolactone. Conversion of Cyclohexanone to Caprolactone.
- Clones containing the full length monooxygenase genes were transferred from LB agar plate to 5 mL of M63 minimal media (GIBCO) containing 10 mM glycerol, 50 ug/mL ampicillin, 0.1 mM IPTG, and 500 mg/L cyclohexanone.
- M63 minimal media containing 10 mM glycerol, 50 ug/mL ampicillin, 0.1 mM IPTG, and 500 mg/L cyclohexanone.
- a plasmid without an insert and a "no cell" control were also assayed.
- the encoded monooxygenase sequences were expressed upon addition of IPTG to the culture media.
- the cultures were incubated overnight at room temperature (24°C). Samples (1.25 mL) for analysis were taken immediately after inoculation and after overnight incubation; cells were removed by centrifugation (4°C, 13,000 rpm).
- Caprolactone formed by the action of the cloned monooxygenase was extracted from the aqueous phase with ethylacetate (1.0 ml aqueous/0.5 mL ethylacetate). Caprolactone was detected by gas chromotagraphy mass spectrometry (GC-MS) analysis, using an Agilent 6890 Gas chromatograph system.
- GC-MS gas chromotagraphy mass spectrometry
- the analysis of the ethylacetate phase was performed by injecting 1 uL of the ethyl acetate phase into the GC.
- the inlet temperature was 115°C and the column temperature profile was 50° C for 4 min and ramped to 250°C at 20°C/min, for a total run time of 14 min.
- the compounds were separated with an Hewlet Packard HP-5MS (5% phenyl Methyl Siloxane) column (30 m length, 250 urn diameter, and 0.25 urn film thickness).
- the mass spectrometer was run in Electron lonization mode.
- the background mass spectra was subtracted from the spectra at the retention time of caprolactone (9.857 min). Presence of caprolactone was confirmed by comparison of the test reactions to an authentic standard obtained from Aldrich Chemical Company (St. Louis, MO).
- This family comprises the chnB monooxygenase sequences of Arthrobacter sp. BP2 (SEQ ID NO:12), Rhodococcus sp. phil (SEQ ID NO:8), Rhodococcus sp. phi2 (SEQ ID NO: 10), Acidovorax sp. CHX (SEQ ID NO:14), Brevibacterium sp. HCU (SEQ ID NOs:16 and 18), and Rhodococcus erythropolis AN12 ORF10, ORF14, ORF19, and ORF20 (SEQ ID NOs:26, 34, 44 and 46).
- Acinetobacter sp. NCIMB9871 chnB NCBI Accession Number AB026668, based on Chen, Y.C. et al. (J Bacteriol. 170(2):781 -789 (1988)). Key biochemical characterization of this protein was performed by Donogue et al. (EurJ Biochem. 16;63(1): 175-92 (1976)), Trudgill et al, (Methods Enzymol. 188:70-77 (1990)), and Iwaki et al. (Appl Environ Microbiol. 65(11):5158-62 (1999)). This enzyme shares 72 of the 74 conserved amino acids in the signature sequence of Family 1 BV monooxygenases.
- Rhodococcus erythropolis HmB NCBI Accession Number AJ272366, based on the work of Barbirato et al. (FEBS Lett. 438 (3): 293-296 (1998)) and van der Werf et al. (Biol. Chem. 274 (37): 26296-26304 (1999)).
- Key biochemical characterization of this protein was performed by van der Werf, M,J. et al. (Microbiology 146 ( Pt 5):1129-41 (2000); Biochem J. 1 ;347 Pt 3:693-701 (2000); and Appl Environ Microbiol. 65(5):2092-102 (1999)).
- This enzyme is known as a carvone monooxygenase
- Rhodococcus rhodochrous smo NCBI Accession Number AB010439. This enzyme was sequenced and characterized by Morii, S. et al. (J. Biochem. 126 (3), 624-631 (1999)). This enzyme is known as a steroid monooxygenase. It shares 74 of the 74 conserved amino acids in the signature sequence of Family 1 BV monooxygenases. The enzymes described in the public domain having the highest sequence similarity to Group 1 have been characterized as dimethylaniline hydroxylases. BV Family 2 This family comprises the chnB monooxygenase sequences of
- Rhodococcus erythropolis AN 12 ORF9, ORF12, ORF15, ORF 16, and ORF18 (SEQ ID NOs:24, 30, 36, 38, and 42). Within a length of 497 amino acids, a total of 76 positions are conserved (100%).
- This signature sequence for Family 2 BV monooxygenases is shown beneath each alignment of proteins ( Figure 8) and is listed as SEQ ID NO:48. The ability to identify the signature sequence within this family of proteins was made possible by: 1) the number of sequences of BV monooxygenases; and 2) the characterization of their activity as BV-monooxygenases.
- This family comprises the chnB monooxygenase sequences of Rhodococcus erythropolis AN 12 ORF8, ORF 11 , ORF 13, and ORF17 (SEQ ID NOs:22, 28, 32, and 40). Within a length of 471 amino acids, a total of 41 positions are conserved (100%).
- This signature sequence for Family 3 BV monooxygenases is shown beneath each alignment of proteins ( Figure 9) and is listed as SEQ ID NO:49. The ability to identify the signature sequence within this family of proteins was made possible by: 1 ) the number of sequences of BV monooxygenases; and 2) the characterization of their activity as BV-monooxygenases.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002455084A CA2455084A1 (en) | 2001-08-29 | 2002-08-29 | Genes encoding baeyer-villiger monooxygenases |
US10/486,307 US20040267001A1 (en) | 2001-08-29 | 2002-08-29 | Genes encoding baeyer-villiger monooxygenases |
EP02759489A EP1516046A4 (en) | 2001-08-29 | 2002-08-29 | Genes encoding baeyer-villiger monooxygenases |
JP2003525594A JP2005512514A (en) | 2001-08-29 | 2002-08-29 | Genes coding for buyer / bilger monooxygenase |
NO20040790A NO20040790L (en) | 2001-08-29 | 2004-02-23 | Genes encoding Baeyer-Villiger mono-sygenases |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US31554601P | 2001-08-29 | 2001-08-29 | |
US60/315,546 | 2001-08-29 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2003020890A2 true WO2003020890A2 (en) | 2003-03-13 |
WO2003020890A3 WO2003020890A3 (en) | 2005-01-06 |
Family
ID=23224914
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2002/027549 WO2003020890A2 (en) | 2001-08-29 | 2002-08-29 | Genes encoding baeyer-villiger monooxygenases |
Country Status (6)
Country | Link |
---|---|
US (2) | US7105296B2 (en) |
EP (1) | EP1516046A4 (en) |
JP (1) | JP2005512514A (en) |
CA (1) | CA2455084A1 (en) |
NO (1) | NO20040790L (en) |
WO (1) | WO2003020890A2 (en) |
Cited By (34)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7956175B2 (en) | 2003-09-11 | 2011-06-07 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US7964343B2 (en) | 2003-05-13 | 2011-06-21 | Ibis Biosciences, Inc. | Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8017358B2 (en) | 2001-03-02 | 2011-09-13 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents |
US8026084B2 (en) | 2005-07-21 | 2011-09-27 | Ibis Biosciences, Inc. | Methods for rapid identification and quantitation of nucleic acid variants |
US8057993B2 (en) | 2003-04-26 | 2011-11-15 | Ibis Biosciences, Inc. | Methods for identification of coronaviruses |
US8073627B2 (en) | 2001-06-26 | 2011-12-06 | Ibis Biosciences, Inc. | System for indentification of pathogens |
US8084207B2 (en) | 2005-03-03 | 2011-12-27 | Ibis Bioscience, Inc. | Compositions for use in identification of papillomavirus |
US8097416B2 (en) | 2003-09-11 | 2012-01-17 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8148163B2 (en) | 2008-09-16 | 2012-04-03 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8158936B2 (en) | 2009-02-12 | 2012-04-17 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US8158354B2 (en) | 2003-05-13 | 2012-04-17 | Ibis Biosciences, Inc. | Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8163895B2 (en) | 2003-12-05 | 2012-04-24 | Ibis Biosciences, Inc. | Compositions for use in identification of orthopoxviruses |
US8173957B2 (en) | 2004-05-24 | 2012-05-08 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US8182992B2 (en) | 2005-03-03 | 2012-05-22 | Ibis Biosciences, Inc. | Compositions for use in identification of adventitious viruses |
US8187814B2 (en) | 2004-02-18 | 2012-05-29 | Ibis Biosciences, Inc. | Methods for concurrent identification and quantification of an unknown bioagent |
US8214154B2 (en) | 2001-03-02 | 2012-07-03 | Ibis Biosciences, Inc. | Systems for rapid identification of pathogens in humans and animals |
US8268565B2 (en) | 2001-03-02 | 2012-09-18 | Ibis Biosciences, Inc. | Methods for identifying bioagents |
US8298760B2 (en) | 2001-06-26 | 2012-10-30 | Ibis Bioscience, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8407010B2 (en) | 2004-05-25 | 2013-03-26 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA |
US8534447B2 (en) | 2008-09-16 | 2013-09-17 | Ibis Biosciences, Inc. | Microplate handling systems and related computer program products and methods |
US8546082B2 (en) | 2003-09-11 | 2013-10-01 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8550694B2 (en) | 2008-09-16 | 2013-10-08 | Ibis Biosciences, Inc. | Mixing cartridges, mixing stations, and related kits, systems, and methods |
US8563250B2 (en) | 2001-03-02 | 2013-10-22 | Ibis Biosciences, Inc. | Methods for identifying bioagents |
US8822156B2 (en) | 2002-12-06 | 2014-09-02 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
US8871471B2 (en) | 2007-02-23 | 2014-10-28 | Ibis Biosciences, Inc. | Methods for rapid forensic DNA analysis |
US8950604B2 (en) | 2009-07-17 | 2015-02-10 | Ibis Biosciences, Inc. | Lift and mount apparatus |
US9149473B2 (en) | 2006-09-14 | 2015-10-06 | Ibis Biosciences, Inc. | Targeted whole genome amplification method for identification of pathogens |
US9194877B2 (en) | 2009-07-17 | 2015-11-24 | Ibis Biosciences, Inc. | Systems for bioagent indentification |
US9598724B2 (en) | 2007-06-01 | 2017-03-21 | Ibis Biosciences, Inc. | Methods and compositions for multiple displacement amplification of nucleic acids |
US9816115B2 (en) | 2012-05-28 | 2017-11-14 | Lucite International Uk Limited | Process for the production of methyl methacrylate |
US9873906B2 (en) | 2004-07-14 | 2018-01-23 | Ibis Biosciences, Inc. | Methods for repairing degraded DNA |
US9890408B2 (en) | 2009-10-15 | 2018-02-13 | Ibis Biosciences, Inc. | Multiple displacement amplification |
WO2019056467A1 (en) * | 2017-09-20 | 2019-03-28 | 华东理工大学 | Burkholderia and applications thereof |
EP3733841A4 (en) * | 2018-02-07 | 2021-10-13 | Asymchem Laboratories (Tianjin) Co., Ltd | Monooxygenase mutant, preparation method therefor and application thereof |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
SI2510089T1 (en) | 2009-12-08 | 2015-12-31 | Codexis, Inc. | Synthesis of prazole compounds |
DK2649187T3 (en) | 2010-12-08 | 2018-01-29 | Codexis Inc | BIOCATALATORS AND METHODS FOR THE SYNTHESIS OF ARMODAFINIL |
MY197970A (en) | 2011-11-02 | 2023-07-25 | Genomatica Inc | Microorganisms and methods for the production of caprolactone |
CL2013003356A1 (en) | 2013-11-22 | 2014-08-08 | Univ Pontificia Catolica Chile | Mutants of the gene coding for the phenylacetone monooxygenase (pamo) enzyme isolated from fusca or thermononospora fusca thermofibide with substitutions at positions 93.94, and 440 (n, dyf, respectively) and specific combinations of positions 441,442,443 and / or 444 (god , poe, t, v, iowyq respectively) with high performance as catalysts in the conversion of cyclohexanone to epailon-caprolactone and high thermal stability, DNA conditioning and encoded amino acidic sequences. |
CN108570425B (en) * | 2018-03-08 | 2019-07-09 | 华东理工大学 | A kind of slow raw rhizobium monooxygenase and its preparing the application in chiral sulfoxide |
CN109402074B (en) * | 2018-11-05 | 2022-02-01 | 凯莱英医药集团(天津)股份有限公司 | Monooxygenase mutants and uses thereof |
EP3878953A4 (en) * | 2018-11-05 | 2022-08-10 | Asymchem Laboratories (Tianjin) Co., Ltd. | Monooxygenase mutant and application thereof |
FR3088324B1 (en) * | 2018-11-08 | 2020-10-09 | Inst Des Sciences Et Industries Du Vivant Et De Lenvironnement Agroparistech | BIOCATALYTICAL PROCESS FOR THE PRODUCTION OF 2H-HBO FROM LGO USING A CYCLOHEXANONE MONOOXYGENASE |
JP2022523225A (en) * | 2019-04-17 | 2022-04-21 | アシムケム ライフ サイエンス (ティエンジン) カンパニー リミテッド | Monooxygenase mutants and their use |
CN111662887B (en) * | 2020-06-03 | 2023-07-25 | 中国科学院成都生物研究所 | Styrene epoxidase from rhizobia and function thereof |
CN114480315B (en) * | 2022-02-16 | 2023-09-19 | 四川奥邦古得药业有限公司 | Baeyer-Villiger monooxygenase and application thereof in brivaracetam synthesis |
-
2002
- 2002-08-28 US US10/230,026 patent/US7105296B2/en not_active Expired - Fee Related
- 2002-08-29 WO PCT/US2002/027549 patent/WO2003020890A2/en not_active Application Discontinuation
- 2002-08-29 JP JP2003525594A patent/JP2005512514A/en active Pending
- 2002-08-29 EP EP02759489A patent/EP1516046A4/en not_active Withdrawn
- 2002-08-29 US US10/486,307 patent/US20040267001A1/en not_active Abandoned
- 2002-08-29 CA CA002455084A patent/CA2455084A1/en not_active Abandoned
-
2004
- 2004-02-23 NO NO20040790A patent/NO20040790L/en not_active Application Discontinuation
Non-Patent Citations (2)
Title |
---|
CHEN Y.C. ET AL: 'ACINEBACTER CYCLOHEXANONE MONOOXYGENASE: GENE CLONING AND SEQUENCE DETERMINATION' JOURNAL OF BACTERIOLOGY vol. 170, no. 2, February 1988, pages 781 - 789, XP001003043 * |
See also references of EP1516046A2 * |
Cited By (58)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8563250B2 (en) | 2001-03-02 | 2013-10-22 | Ibis Biosciences, Inc. | Methods for identifying bioagents |
US8214154B2 (en) | 2001-03-02 | 2012-07-03 | Ibis Biosciences, Inc. | Systems for rapid identification of pathogens in humans and animals |
US8815513B2 (en) | 2001-03-02 | 2014-08-26 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents in epidemiological and forensic investigations |
US8017358B2 (en) | 2001-03-02 | 2011-09-13 | Ibis Biosciences, Inc. | Method for rapid detection and identification of bioagents |
US8802372B2 (en) | 2001-03-02 | 2014-08-12 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy |
US9416424B2 (en) | 2001-03-02 | 2016-08-16 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
US8265878B2 (en) | 2001-03-02 | 2012-09-11 | Ibis Bioscience, Inc. | Method for rapid detection and identification of bioagents |
US9752184B2 (en) | 2001-03-02 | 2017-09-05 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA and characterization of mitochondrial DNA heteroplasmy |
US8268565B2 (en) | 2001-03-02 | 2012-09-18 | Ibis Biosciences, Inc. | Methods for identifying bioagents |
US8921047B2 (en) | 2001-06-26 | 2014-12-30 | Ibis Biosciences, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8073627B2 (en) | 2001-06-26 | 2011-12-06 | Ibis Biosciences, Inc. | System for indentification of pathogens |
US8298760B2 (en) | 2001-06-26 | 2012-10-30 | Ibis Bioscience, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8380442B2 (en) | 2001-06-26 | 2013-02-19 | Ibis Bioscience, Inc. | Secondary structure defining database and methods for determining identity and geographic origin of an unknown bioagent thereby |
US8822156B2 (en) | 2002-12-06 | 2014-09-02 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
US9725771B2 (en) | 2002-12-06 | 2017-08-08 | Ibis Biosciences, Inc. | Methods for rapid identification of pathogens in humans and animals |
US8057993B2 (en) | 2003-04-26 | 2011-11-15 | Ibis Biosciences, Inc. | Methods for identification of coronaviruses |
US8476415B2 (en) | 2003-05-13 | 2013-07-02 | Ibis Biosciences, Inc. | Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US8158354B2 (en) | 2003-05-13 | 2012-04-17 | Ibis Biosciences, Inc. | Methods for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US7964343B2 (en) | 2003-05-13 | 2011-06-21 | Ibis Biosciences, Inc. | Method for rapid purification of nucleic acids for subsequent analysis by mass spectrometry by solution capture |
US7956175B2 (en) | 2003-09-11 | 2011-06-07 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US8546082B2 (en) | 2003-09-11 | 2013-10-01 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8013142B2 (en) | 2003-09-11 | 2011-09-06 | Ibis Biosciences, Inc. | Compositions for use in identification of bacteria |
US8097416B2 (en) | 2003-09-11 | 2012-01-17 | Ibis Biosciences, Inc. | Methods for identification of sepsis-causing bacteria |
US8163895B2 (en) | 2003-12-05 | 2012-04-24 | Ibis Biosciences, Inc. | Compositions for use in identification of orthopoxviruses |
US8187814B2 (en) | 2004-02-18 | 2012-05-29 | Ibis Biosciences, Inc. | Methods for concurrent identification and quantification of an unknown bioagent |
US9447462B2 (en) | 2004-02-18 | 2016-09-20 | Ibis Biosciences, Inc. | Methods for concurrent identification and quantification of an unknown bioagent |
US8173957B2 (en) | 2004-05-24 | 2012-05-08 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US8987660B2 (en) | 2004-05-24 | 2015-03-24 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US9449802B2 (en) | 2004-05-24 | 2016-09-20 | Ibis Biosciences, Inc. | Mass spectrometry with selective ion filtration by digital thresholding |
US8407010B2 (en) | 2004-05-25 | 2013-03-26 | Ibis Biosciences, Inc. | Methods for rapid forensic analysis of mitochondrial DNA |
US9873906B2 (en) | 2004-07-14 | 2018-01-23 | Ibis Biosciences, Inc. | Methods for repairing degraded DNA |
US8084207B2 (en) | 2005-03-03 | 2011-12-27 | Ibis Bioscience, Inc. | Compositions for use in identification of papillomavirus |
US8182992B2 (en) | 2005-03-03 | 2012-05-22 | Ibis Biosciences, Inc. | Compositions for use in identification of adventitious viruses |
US8026084B2 (en) | 2005-07-21 | 2011-09-27 | Ibis Biosciences, Inc. | Methods for rapid identification and quantitation of nucleic acid variants |
US8551738B2 (en) | 2005-07-21 | 2013-10-08 | Ibis Biosciences, Inc. | Systems and methods for rapid identification of nucleic acid variants |
US9149473B2 (en) | 2006-09-14 | 2015-10-06 | Ibis Biosciences, Inc. | Targeted whole genome amplification method for identification of pathogens |
US8871471B2 (en) | 2007-02-23 | 2014-10-28 | Ibis Biosciences, Inc. | Methods for rapid forensic DNA analysis |
US9598724B2 (en) | 2007-06-01 | 2017-03-21 | Ibis Biosciences, Inc. | Methods and compositions for multiple displacement amplification of nucleic acids |
US8550694B2 (en) | 2008-09-16 | 2013-10-08 | Ibis Biosciences, Inc. | Mixing cartridges, mixing stations, and related kits, systems, and methods |
US9023655B2 (en) | 2008-09-16 | 2015-05-05 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8148163B2 (en) | 2008-09-16 | 2012-04-03 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US9027730B2 (en) | 2008-09-16 | 2015-05-12 | Ibis Biosciences, Inc. | Microplate handling systems and related computer program products and methods |
US8609430B2 (en) | 2008-09-16 | 2013-12-17 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8534447B2 (en) | 2008-09-16 | 2013-09-17 | Ibis Biosciences, Inc. | Microplate handling systems and related computer program products and methods |
US8252599B2 (en) | 2008-09-16 | 2012-08-28 | Ibis Biosciences, Inc. | Sample processing units, systems, and related methods |
US8158936B2 (en) | 2009-02-12 | 2012-04-17 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US9165740B2 (en) | 2009-02-12 | 2015-10-20 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US8796617B2 (en) | 2009-02-12 | 2014-08-05 | Ibis Biosciences, Inc. | Ionization probe assemblies |
US8950604B2 (en) | 2009-07-17 | 2015-02-10 | Ibis Biosciences, Inc. | Lift and mount apparatus |
US9194877B2 (en) | 2009-07-17 | 2015-11-24 | Ibis Biosciences, Inc. | Systems for bioagent indentification |
US9890408B2 (en) | 2009-10-15 | 2018-02-13 | Ibis Biosciences, Inc. | Multiple displacement amplification |
US9816115B2 (en) | 2012-05-28 | 2017-11-14 | Lucite International Uk Limited | Process for the production of methyl methacrylate |
WO2019056467A1 (en) * | 2017-09-20 | 2019-03-28 | 华东理工大学 | Burkholderia and applications thereof |
US11001866B2 (en) | 2017-09-20 | 2021-05-11 | Jiangsu Aosaikang Pharmaceutical Co., Ltd. | Burkholderia and applications thereof |
EP3733841A4 (en) * | 2018-02-07 | 2021-10-13 | Asymchem Laboratories (Tianjin) Co., Ltd | Monooxygenase mutant, preparation method therefor and application thereof |
JP2022031740A (en) * | 2018-02-07 | 2022-02-22 | アシムケム ラボラトリーズ (ティエンジン) カンパニー リミテッド | Monooxygenase mutant, preparation method therefor and application thereof |
JP7288496B2 (en) | 2018-02-07 | 2023-06-07 | アシムケム ラボラトリーズ (ティエンジン) カンパニー リミテッド | Monooxygenase mutants and their production methods and applications |
US11702640B2 (en) | 2018-02-07 | 2023-07-18 | Asymchem Laboratories (Tianjin) Co., Ltd. | Monooxygenase mutant, preparation method and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CA2455084A1 (en) | 2003-03-13 |
EP1516046A2 (en) | 2005-03-23 |
JP2005512514A (en) | 2005-05-12 |
EP1516046A4 (en) | 2005-12-21 |
NO20040790L (en) | 2004-04-21 |
US7105296B2 (en) | 2006-09-12 |
US20040267001A1 (en) | 2004-12-30 |
WO2003020890A3 (en) | 2005-01-06 |
US20030124695A1 (en) | 2003-07-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7105296B2 (en) | Genes encoding Baeyer-Villiger monooxygenases | |
US7049115B2 (en) | Genes encoding denitrification enzymes | |
US20070031951A1 (en) | Method for the production of resveratrol in a recombinant bacterial host cell | |
EP1313845A2 (en) | Methanotrophic carbon metabolism pathway genes and enzymes | |
US6951751B2 (en) | DNA and amino acid sequences of a tyrosine-inducible tyrosine ammonia lyase enzyme from the yeast Trichosporon cutaneum | |
US7067302B2 (en) | DNA and amino acid sequence of a tyrosine ammonia lyase enzyme from the bacterium Rhodobacter sphaeroides | |
US7057030B2 (en) | Rhodococcus gene encoding aldoxime dehydratase | |
EP1235911A2 (en) | Genes involved in cyclododecanone degradation pathway | |
WO2002020797A2 (en) | Genes encoding polypeptides from methylomonas sp. involved exopolysaccharide production | |
AU2002324821A1 (en) | Genes encoding baeyer-villiger monooxygenases | |
US20030077768A1 (en) | Use of xylene monooxygenase for the oxidation of substituted polycyclic aromatic compounds | |
EP1446491A1 (en) | Method for production of asymmetric carotenoids | |
US20030073206A1 (en) | Use of xylene monooxygenase for the oxidation of substituted monocyclic aromatic compounds |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2002324821 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2455084 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003525594 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2002759489 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10486307 Country of ref document: US |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWP | Wipo information: published in national office |
Ref document number: 2002759489 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2002759489 Country of ref document: EP |