WO2003013568A1 - Cytokine modulation therapy - Google Patents

Cytokine modulation therapy

Info

Publication number
WO2003013568A1
WO2003013568A1 PCT/US2001/024391 US0124391W WO03013568A1 WO 2003013568 A1 WO2003013568 A1 WO 2003013568A1 US 0124391 W US0124391 W US 0124391W WO 03013568 A1 WO03013568 A1 WO 03013568A1
Authority
WO
WIPO (PCT)
Prior art keywords
cytokine
tnfα
epo
agent
patient
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/024391
Other languages
French (fr)
Inventor
Loretta Itri
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Janssen Pharmaceuticals Inc
Original Assignee
Ortho McNeil Pharmaceutical Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ortho McNeil Pharmaceutical Inc filed Critical Ortho McNeil Pharmaceutical Inc
Priority to PCT/US2001/024391 priority Critical patent/WO2003013568A1/en
Publication of WO2003013568A1 publication Critical patent/WO2003013568A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1793Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52Purines, e.g. adenine
    • A61K31/522Purines, e.g. adenine having oxo groups directly attached to the heterocyclic ring, e.g. hypoxanthine, guanine, acyclovir
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/56Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • A61K38/1816Erythropoietin [EPO]

Definitions

  • Erythropoietin is a glycoprotein hormone produced by the kidney in response to tissue hypoxia that stimulates red blood cell production in the bone marrow.
  • the gene for erythropoietin has been cloned and expressed in Chinese hamster ovary (CHO) cells as described in United States Patent No. 4,703,008.
  • Recombinant human erythropoietin r-HuEPO, Epoetin alfa
  • r-HuEPO Epoetin alfa
  • Recombinant human erythropoietin acts by increasing the number of cells capable of differentiating into mature erythrocytes, triggering their differentiation and augmenting hemoglobin synthesis in developing erythroblasts (Krantz, S.B., Blood (1991) 77: 419- 434; Beckman, B.S. and Mason-Garcia, JVL, 77ze Faseb Journal (1991) 5: 2958-2964).
  • Epoetin alfa has been evaluated in normal subjects as well as in subjects with various anemic conditions. Epoetin alfa induces a brisk haematological response in normal human volunteers, provided that adequate supplies of iron are
  • Epoetin alfa is approved for sale in many countries for the treatment of anemia in chronic renal failure (dialysis and predialysis), anemia in zidovudine treated HIV positive patients (US), anemia in cancer patients receiving platinum-based chemotherapy, as a facilitator of autologous blood pre-donation, and as a perisurgical adjuvant to reduce the likelihood of requiring allogeneic blood transfusions in patients undergoing orthopedic surgery.
  • Epoetin alfa can correct anemia in cancer patients, at doses several times higher than those shown to be effective in renal patients.
  • Anemia may result from the disease itself, the effect of concomitantly administered chemotherapeutic agents, or a combination of both.
  • the condition often takes on the characteristics of the anemia of chronic disease (ACD).
  • ACD is associated with erythroid hypoplasia of the bone marrow, a somewhat shortened circulating life of red cells and decreased bone marrow re-utilization of iron. If erythropoietin levels are measured, they are found to be within the normal range, but inappropriately low for the degree of anemia.
  • the patient has a blunted erythropoietin response.
  • About 50-60% of anaemic cancer patients receiving chemotherapy responded with a hemoglobin rise of at least 2 g/dL to Epoetin alfa therapy given three times weekly at a dose of 150 IU/kg over a period of 12 weeks (Abels, R.I., Larholt, K.M., Krantz, K.D. and Bryant, E.C., Proceedings of the Beijing Symposium, Alpha Medical Press, Dayton, Ohio (1991) 121-141).
  • doses up to 300 IU kg were sometimes required, demonstrating the relative resistance to the effect of Epoetin alpha in these patients.
  • Tumor necrosis factor is part of a group of inflammatory cytokines that has been implicated in the pathologic changes seen in a number of diseases. TNF has been implicated as a contributing cause of fatigue, asthenia, anorexia and cachexia in a number of disorders. Elevated levels of TNF were associated with post-dialysis fatigue in one study (Dreisbach, A.W., Hendrickson, T., Beezhold, L.A., et al., Int. J. Artif. Organs (1998) 21:83-6) and were seen in patients with disorders of excessive daytime sleepiness in another.
  • TNF inhibition associated with the use of thalidomide has been exploited to treat the anorexia and cachexia of HIV disease (Haslett, P.A., J. Semin. Oncol. (1998) 25(6):53-57).
  • the "procachexic" characteristics of some inflammatory cytokines, and TNF in particular, were recently reviewed (Argiles, J.M. and L ⁇ pez-Soriano, F.J., Med. Res. Rev. (1999) 19:223-48).
  • TNF may act as a negative modulator of erythropoiesis.
  • murine models there are conflicting data regarding the ability to abrogate TNF mediated anemia. (Clibon, U., Bonewald, L., Caro, J., et al, Exp. Hematol (1990) 18:458-41; Johnson, C.S., Cook, C.A., Furmanski, P., Exp. Hxematol. (1990) 18:109-13.).
  • TNF blockade with a monoclonal antibody lead to improvement in the anemia of rheumatoid arthritis patients in one study (Davis, D., Charles, P.J., Potter, A., et al, Br. J. Rheumatol (1997) 36:950-6).
  • the present invention provides methods to determine the physiological relationship of cytokines in humans by administering a specific cytokine, or a specific anti-cytokine and then measuring changes in concentrations of other cytokines to produce a cytokine profile of a patient.
  • the present invention provides a method to produce cytokine modulation by EPO with or without an anti-Tumor Necrosis Factor compound.
  • Modulation of cytokines by administration of a therapeutic amount of EPO or with a combination of EPO and an anti- Tumor Necrosis Factor compound provides a novel means to treat diseases caused by aberrant concentrations of one or more cytokines in a patient and to alter the concentrations of cytokines to a desired level.
  • the present invention further provides methods to modulate the concentration of a specific cytokine or cytokine profile of a patient by administering a therapeutic regimen of a different cytokine, or an anti-cytokine agent, or a combination thereof.
  • the present invention also provides methods to produce cytokine gene expression profiles in response to EPO treatment in patients, modulate cytokine gene expression using EPO treatment and identifying the specific cytokines that are modulated in a patient treated with EPO.
  • Cytokines and hormones are produced and circulate within the body of an animal within concentration ranges that correspond with the biological activity of the cytokine.
  • the level of cytokine production by specific cells is controlled by specific cellular stimuli and the rate of metabolic clearance is controlled by the nature of the cytokine (polypeptide structure and glycosylation) and by the metabolic activity of the liver and filtration by the kidneys.
  • There are other mechanisms to modulate cytokine activity including inactivation of the cytokine by enzymatic nicking or by naturally occurring antagonists, for example soluble IL-1 receptor antagonist (IL-lra). Circulating soluble receptors or neutralizing antibodies are other well-known means to reduce the functional quantity of circulating cytokine.
  • cytokines exist in a homeostatic basis with each other and with other physiological systems, including metabolic and neurologic hormone control systems. For example, as described above, in human studies there is an association between circulating TNF levels and the need for increased doses of epoetin alpha in hemodialysis patients. There is no direct association known between these two cytokines; they are not currently known to cross-react with the other's receptor. The inventors contemplate that there is a physiologically relevant association between elevated TNF ⁇ and the biological activity of EPO, or vis a versa, that is not readily apparent using in vitro models or even known animal models.
  • TNF ⁇ chronic over expression results in disruption of metabolic homeostasis, resulting in metabolic wasting (cachexia) most likely through suppression of synthesis of lipoprotein lipase, an enzyme needed to release fatty acids bound to lipoproteins.
  • metabolic wasting a metabolic wasting
  • reduced levels of TNF ⁇ resulted in increased hemoglobin levels, despite only one known cytokine, EPO, being associated with this physiological response (Navaro, J F et al (1999) Scand J. Urol Nephrol 33(2) 121 - 125).
  • EPO cytokine
  • decreasing the levels of a cytokine, for instance TNF ⁇ may modulate the concentration of other cytokines, which could also be monitored in human subjects by the methods of the present invention.
  • TNF ⁇ cytokine
  • this method will greatly increase the rate to which beneficial therapeutic regimens will be developed and applied to the treatment of humans.
  • cytokine homeostasis The actual basis of cytokine homeostasis is likely to vary in different patient populations. For example patients with HIV or malignancies suffer from cachexia because of an imbalance of TNF ⁇ . Diabetic patients have disrupted homeostasis of their glucose metabolism either by modulated insulin levels, modulated glucagon levels, or a modulated receptor response to insulin. Various autoimmune diseases including rheumatoid arthritis and lupus are a result in disruption in the control of immune function, and have been associated with altered cytokine levels.
  • the methods of the present invention provide a means to treat different patient populations by administering a therapeutic amount of one agent and monitoring changes in the overall cytokine homeostasis, despite the fact that different patient populations will respond differently to different amounts of cytokine, for example EPO as described above.
  • the methods of the present invention of administering an agent in humans, and monitoring riiRNA levels of gene expression or new cytokine protein production is generally applicable to wide variety patient groups.
  • Erythropoietin is a preferred cytokine to administer therapeutically because it is well tolerated by the patient, as described above, and is well defined clinically in many different patient populations.
  • Administration of EPO has been demonstrated to increase hemoglobin and reticulocyte counts, not induce fever, and not induce immune response over repeated administration. EPO can be administered over a broad concentration range without detrimental effects.
  • the method of the present invention is a method to determine the physiological relationship of cytokines and producing changes in the cytokine profile of a patient comprising the steps: a) administering one or more specific cytokines, and b) measuring changes in concentrations of other cytokines.
  • the present invention is also applicable to producing changes in cytokines upon suppression of another cytokine. This could be achieved by a method to determine the physiological relationship of cytokines and producing changes in the cytokine profile of a patient comprising the steps: a) administering one or more specific anti-cytokine agent, and b) measuring changes in concentrations of other cytokines.
  • the present invention is also applicable to making changes in the cytokine profile of a patient comprising the steps: a) administering a therapeutic regimen of one or more anti-cytokine agents, and b) administering a therapeutic regimen of one or more different cytokine, and c) measuring changes in concentrations of other cytokines, wherein steps (a) and (b) can be in either order, or concurrently.
  • ELISA enzyme linked immunoassays
  • RNA is extracted from white blood cells and linearly amplified an estimated 10 6 -fold using commercially available RNA polymerase enzymes by methods well known in the art (Maniatis, T., Fritsch, E.F., Sambrook, J. in Molecular Cloning: A Laboratory Manual, 2 n Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).
  • aRNA individually amplified RNA
  • a microarray a.k.a. chip
  • human cDNAs for example cytokine cDNA's
  • non-specific cDNAs for example plant or insect cDNAs (for the determination of non-specific nucleic acid hybridization).
  • cytokine concentrations or cytokine gene expression levels after the patient is treated with a therapeutic regimen comprising a specific cytokine, for example EPO or in combination with a specific anti-cytokine, for example an anti-Tumor Necrosis Factor Compound.
  • a therapeutic regimen comprising a specific cytokine, for example EPO or in combination with a specific anti-cytokine, for example an anti-Tumor Necrosis Factor Compound.
  • the therapeutic regimen comprising a specific cytokine, for example EPO, or in combination with a specific anti-cytokine, for example an anti-Tumor Necrosis Factor Compound can be used to treat disease states that are associated with over or under expression of genes that are known to be modulated by the therapeutic regimen.
  • a specific cytokine for example EPO
  • a specific anti-cytokine for example an anti-Tumor Necrosis Factor Compound
  • Heterogeneity among patients with respect to gene expression which presumably reflects, at least in part, different sensory modalities transmitted can be cataloged and statistically analyzed for significance.
  • the coupling of immunochemistry, aRNA and DNA chip analysis can be done.
  • chips containing a larger number of cDNAs i.e., >10,000 can be completed to more fully identify differential gene expression.
  • Cataloging heterogeneity with respect to gene expression in response to a therapeutic regimen will provide a greater understanding in the observed variability of response to the therapeutic regimen and clinical effects observed during and after the therapeutic regimen comprising a cytokine, for example EPO, or in combination with an anti-cytokine, for example an anti-Tumor Necrosis Factor Compound.
  • TNF inflammatory cytokines
  • IL-l ⁇ IL-l ⁇
  • IL-l ⁇ inflammatory cytokines
  • IL-l ⁇ results in fever, acute phase plasma protein production, and initiates metabolic wasting (cachexia).
  • TNF can also alter the balance of the procoagulation and anticoagulation by the vascular endothelium.
  • Overexpression of TNF leads to increased levels of TL-6 and this is associated with bone marrow suppression.
  • TNF ⁇ vascular smooth muscle tone
  • cytokines that regulate lymphocyte activation, growth and differentiation, TL-2, TL-4, TGF ⁇ is likely to affect autoimmune disease states in individuals with over expressed cytokines and immunosuppression in individuals with under expressed cytokines.
  • This class of cytokines is primarily produced by CD4+ and CD8+ T cells, and activates the function of other effector cells, including macrophages, endothelial cells, NK cells, B cells, eosinophils, and other T cells, in a non-specific manner.
  • cytokines that regulate Immune-Mediated inflammation INF ⁇ , TNF ⁇ , EL-5, EL- 10, and IL-12 is likely to affect conditioned mediated by such responses.
  • Hematopoietic Cytokines This class of cytokines directs maturation of hematopoietic stem cells through progressive expansion and irreversible differentiation to form various leukocyte lineage, and erythrocytes.
  • the known members of this class of cytokines includes IL-3, GM-CSF, M-CSF, G-CSF, JL-7, EPO, IL-9, and IL-11. Overexpression or under expression of any of these cytokines is likely to disrupt the appropriate numbers of individual cell lineage.
  • EPO Erythropoietin
  • EPO molecules may include small organic or inorganic molecules, synthetic or natural amino acid peptides, purified protein from recombinant or natural expression systems, or synthetic or natural nucleic acid sequences, or any chemical derivatives of the aforementioned.
  • the generally preferred form of EPO is purified, recombinant EPO, distributed under the trademarks of EPREX® or ERYPO®.
  • Epoetin alfa is a sterile, clear, colorless, aqueous solution for injection, that is provided in prefilled, single-use syringes containing either 4,000 or 10,000 IU epoetin alfa (a recombinant human erythropoietin) and 2.5 mg/mL human serum albumin in 0.4 mL (4,000 IU syringe) or 1.0 mL (10,000 IU syringe) of phosphate buffer.
  • Erythropoietin shall include those proteins and other organic molecules that have the biological activity of human erythropoietin, as well as erythropoietin analogs, erythropoietin isoforms, erythropoietin mimetics, erythropoietin fragments, hybrid erythropoietin proteins, altered carbohydrate sialic acid content erythropoietin proteins, erythropoietin receptor agonists, renal erythropoietin, brain erythropoietin, oligomers and multimers of the above, homologues of the above, and muteins of the above, including but not limited to muteins having increased or decreased glycosylatin sites, regardless of the biological activity of same, and further regardless of the method of synthesis or manufacture thereof including but not limited to naturally occurring, recombinant, synthetic, transgenic, and gene activated methods.
  • anti- cytokine compound refers to drug products that decrease the amount of circulating, active cytokine.
  • the compound may achieve this by decreasing the amount of cytokine mRNA transcription, by increasing the rate of cytokine mRNA degradation, by decreasing mRNA translation into cytokine, or by decreasing cellular secretion of the cytokine.
  • Other suitable anti-cytokine compounds work by increasing the rate of clearance or decreasing the amount of functional cytokine protein in circulation.
  • the anti-cytokine compounds may be administered as combinations in order to maximize modulation of the cytokine profile of a patient since agents can be selected that act as cytokine inhibitors at different points in cytokine synthesis and pharmacokinetic activity.
  • anti- Tumor Necrosis Factor Compound refers to drug products that decrease the amount of circulating, active TNF ⁇ .
  • the compound may achieve this by decreasing the amount of cellular TNF ⁇ mRNA transcription, by decreasing mRNA translation into TNF ⁇ protein, or by decreasing cellular secretion of TNF ⁇ .
  • Roy A. Black, et. al, from Immunex Corporation has discovered a compound that inhibits the enzyme that releases TNF from cell surfaces (Nature, 370, 218(1994)). This compound, called TNF- ⁇ protease enzyme inhibitor, curbs production of soluble TNF.
  • Other suitable anti-TNF ⁇ compounds could work by increasing the rate of clearance or decreasing the amount of functional TNF ⁇ in circulation.
  • Preferred anti-TNF ⁇ compounds are Thalidomide, Pentoxifylline, Infliximab, glucocorticoids, and Etanercept.
  • the anti-TNF ⁇ compounds may be administered as combinations in order to maximize modulation of TNF since these agents acts as TNF ⁇ inhibitors at a different points in TNF synthesis and pharmacokinetic activity.
  • Pentoxifylline inhibits TNF- ⁇ gene transcription (Doherty, et al, Surgery (1991) 110:192), while thalidomide enhances TNF- ⁇ m-RNA degradation (Moreira, et al., 1993) and glucocorticoids such as dexamethasone inhibit TNF- ⁇ m-RNA translation (Han, et. al, J. Exp. Med. (1990) 172:391).
  • Infliximab and Etanercept act by reducing the amount of circulating, active TNF ⁇ .
  • Pentoxifylline decreases circulating TNF ⁇ at the Standard dose of 400 mg 3 times daily. Pentoxifylline inhibits TNF- ⁇ gene transcription (Doherty, et al, Surgery (1991) 110:192).
  • Glucocorticoids such as dexamethasone inhibit TNF- ⁇ m-RNA translation.
  • Desamethasone is administered orally, intramuscularly, or intravenously in the dose range of 8-40 mg (pediatric dose: 0.25-0.5 mg/kg). If given intravenously, dexamethasone should be given over 10-15 minutes, since rapid administration may cause sensations of generalized warmth, pharyngeal tingling or burning, or acute transient perianal and/or rectal pain.
  • Methylprednisolone is also administered orally, intramuscularly, or intravenously at doses and schedules that vary from 40-500 mg every 6-12 hours for up to 20 doses.
  • Thalidomide N- phthalidoglutarimide may act by enhancing TNF- ⁇ m-RNA degradation (Shannon, et al Amer. Society for Microbiology Ann. Mtg Configur (1990) Abs. U-53). Thalidomide is given by oral administration in the range of about 30 mg to 1500 mg per 24 hours, preferably 200 to 500 mg per 24 hours for an adult human weighting 70 kg.
  • REMICADETM is a monoclonal antibody that blocks the biological activity of circulating TNF ⁇ . Infliximab does not neutralize TNF ⁇ (lymphotoxin ⁇ ), a related cytokine that utilizes the same receptors as TNF ⁇ . Remicade is supplied as a sterile, white, lyophilized powder for intravenous infusion. Following reconstitution with 10 mL of Sterile Water for Injection, USP, the resulting pH is approximately 7.2. Each single-use vial contains 100 mg Infliximab, 500 mg sucrose, 0.5 mg polysorbate 80, 2.2 mg monobasic sodium phosphate and 6.1 mg dibasic sodium phosphate. No preservatives are present.
  • ENBRELTM is a dimeric fusion protein consisting of the extracellular ligand-binding portion of the human 75 kilodalton (p75) tumor necrosis factor receptor (TNFR) linked to the Fc portion of human IgGl.
  • the Fc component of Etanercept contains the j2 domain, the C H 3 domain and hinge region, but not the C H I domain of IgGl.
  • Etanercept is produced by recombinant DNA technology in a Chinese hamster ovary (CHO) mammalian cell expression system. It consists of 934 amino acids and has an apparent molecular weight of approximately 150 kilodaltons.
  • ENBRELTM is supplied as a sterile, white, preservative-free, lyophilized powder for parenteral administration after reconstitution with 1 mL of the supplied Sterile Bacteriostatic Water for Injection, USP (containing 0.9% benzyl alcohol). Following reconstitution, the solution of ENBRELTM is clear and colorless, with a pH of 7.4 ⁇ 0.3. Each single- use vial of ENBRELTM contains 25 mg Etanercept, 40 mg mannitol, 10 mg sucrose, and 1.2 mg tromethamine. ENBRELTM is administered as a single subcutaneous (SC) injection.
  • SC subcutaneous
  • the study will be a double-blind, randomized, placebo controlled trial.
  • cancer patients with treatment related anemia will be assigned in a 1:1 randomization to receive either epoetin alfa plus placebo (Regimen A) or epoetin alfa plus Etanercept (Regimen B).
  • Patients who do not achieve an increase in hemoglobin of 1 g/dl without transfusion after four weeks of treatment will receive an increased dose epoetin alfa during weeks 5-8.
  • Patients on Regimen A (epoetin alfa + placebo) who do not achieve an increase in hemoglobin of 2 g/dl over baseline by week 9 will be crossed over to Regimen B in an 8 week open label extension phase.
  • Patients on Regimen B who do not achieve a 2 g/dl increase in hemoglobin over baseline by week 9 will be taken off study. Responding patients will continue on their assigned treatment and blinding will be maintained for 16 weeks.
  • TNF ⁇ levels by EPO in patients administered EPO + placebo will be determined by differential protein expression and compared to the baseline values (TNF ⁇ levels prior to any treatment) and EPO+ETAN (Regimen B).
  • the modulation of TNF ⁇ by EPO + ETAN will be compared to established data of ETAN alone to determine if the anti-TNF ⁇ compound exhibits synergy with EPO in suppression of TNF ⁇ .
  • corticosteroids other than for occasional use for anti- emesis or pre-treatment for a medication
  • Randomization will be used to avoid bias in the assignment of patients to treatment, to increase the likelihood that subject attributes are evenly balanced across groups, and to enhance the validity of comparisons across treatment groups.
  • Investigators and patients will be blinded to the identity of Etanercept and placebo to enhance the validity of comparisons that are subject to observer bias or the placebo effect (e.g. -QoL end points).
  • EPO will be given to all patients in an open label manner. Patients will be assigned randomly to each treatment regimen.
  • Pre-Randomization Phase (Baseline) The following evaluations and procedures are to be performed within 14 days prior to randomization unless otherwise specified. All laboratory tests and QoL and cognitive measures must be performed prior to the start of the first chemotherapy course after randomization.
  • Subjects will be assigned to treatment groups based on a computer-generated randomization schedule. The randomization will be balanced by using permuted blocks and will be stratified by center and type of cancer. Based on this randomization code, the study drug will be packaged and labeled for each subject. [Subject numbers] [Medication code numbers] will be preprinted on the study drug labels and assigned sequentially as subjects qualify for the study and are randomized to treatment.
  • the Etanercept or placebo drug container will have a two-part, tear-off label with directions for use and other information on each part.
  • the tear-off section of the label will contain a concealed area identifying the study drug (e.g., active or placebo) and will be removed and attached to the subject's CRF when the drug is dispensed.
  • the second part of the label will remain affixed to the study drug container and will contain all identifying information except for the identity of the drug contained.
  • the study drugs will be identical in appearance and will be packaged in identical containers.
  • the blind should not be broken.
  • the blind should be broken only if specific emergency treatment would be dictated by knowing the treatment status of the subject. In such cases, the investigator must contact the sponsor. If the investigator is unable to contact the sponsor, the investigator may in an emergency determine the identity of the treatment by exposing the concealed area of the label attached to the subject's CRF. Individual code breaks by the investigator will normally result in withdrawal of the subject from the trial. The date, time, and reason for the unblinding must be documented on the appropriate page of the CRF (Study Completion Information) and the sponsor must be informed as soon as possible.
  • the randomization schedule will not be revealed to study subjects, parents or guardians, investigators and clinical staff, or site managers until all subjects have completed the double-blind phase of the trial.
  • the investigator will call the study sponsor with the week 9 hemoglobin results. If a patient is a non-responder, the study sponsor will inform the investigator of the patient's treatment assignment. Patients who do not respond to EPO + ETAN (Regimen B) will proceed to Off Study Evaluation procedures. Non-responding patients treated on EPO + placebo (Regimen A) will be treated with EPO + ETAN for an additional 8 weeks in an open label extension phase. Non-responding patients treated with EPO+ETAN who subsequently respond indicate synergistic action of the anti-tumor necrosis factor agent with EPO. Comparison of the response of patients treated with EPO or with EPO+ETAN will further indicate synergistic action of the combination therapy.
  • patients should remain blinded to study-related test results prior to the completion of each set of QoL and cognitive measures.
  • the treating physician may provide laboratory results as soon as the forms are completed for that visit.
  • evaluations For patients receiving every-three-week chemotherapy, evaluations should be completed at least 3 days following the end of the last dose of chemotherapy. For patients receiving every four week chemotherapy, evaluations should be completed within 3 days prior to the scheduled chemotherapy course.
  • Serum TNF ⁇ and anti-TNF ⁇ levels • FACT-An, Linear Analog Scale Assessment (LASA), CLOX and EXIT 25 within 3 days prior to the administration of chemotherapy
  • EPO will be started at a dose of 40,000 U per week given SC, without regard to the timing of chemotherapy. If at the evaluation prior to the week 5 dose the hemoglobin has not increased by at least 1 g/dl over the baseline value, the dose of EPO will be increased to 60,000 U per week for weeks 5-8. If the hemoglobin increases by at least 2 g/dl over baseline at the time of the week 9 evaluation, the patient will be considered a responder. Responders will continue to receive the dose of EPO given during weeks 5-8 until week 16. Non-responders will be offered the opportunity to receive EPO + ETAN in an
  • Placebo injections will be given at a dose of 1 ml SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and placebo are given together).
  • the patient should receive two doses of placebo during week 8, prior to the week 9 evaluation.
  • Responders will continue to receive placebo in a blinded manner through week 16.
  • Two placebo injections should be given in week 16, prior to the off study evaluation.
  • Non-responders will be offered the opportunity to receive EPO + ETAN in an 8 week open label extension.
  • EPO will be started at a dose of 40,000 U per week given SC, without regard to the timing of chemotherapy. If at the evaluation prior to the week 5 dose the hemoglobin has not increased by at least 1 g/dl over the baseline value, the dose of EPO will be increased to 60,000 U per week for weeks 5-8. If the hemoglobin increases by at least 2 g/dl over baseline at the time of the week 9 evaluation, the patient will be considered a responder. Responders will continue to receive the dose of EPO given during weeks 5-8 until week 16. Non-responders will proceed to the Off Study Evaluation at week 9.
  • ETAN injections will be given at a dose of 25 mg (1 ml) SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and ETAN are given together).
  • the patient should receive two doses of ETAN during week 8, prior to the week 9 evaluation. Responders will continue in ETAN through week 16. Two ETAN injections should be given during week 16 and prior to the off study evaluation. Non-responders will proceed to the off study evaluation at week 9.
  • ETAN EPO dose of 60.000 U/week at week 8 will continue on that dose for weeks 9-12.
  • ETAN will be given at a dose of 25 mg SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and placebo are given together).
  • ETAN will be started on the day of the week 9 EPO dose and continue until 2 doses are given during week 12. If the evaluation at week 13 indicates at least a 1- g/dl increase in hemoglobin over the week 9 value or a 2 g/dl increase over the baseline value, then the patient will be considered a responder and continue on study through week 16. ETAN should continue until 2 doses are given in week 16. The patient then will proceed to the Off Study Evaluation. If the patient is a non- responder at week 13, then the patient will proceed to the Off Study Evaluation.
  • ETAN ETAN will be given at a dose of 25 mg SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and placebo are given together).
  • the first dose of ETAN will be given on the day of the week 9 EPO dose and continue until 2 doses are given during week 12. If the evaluation at week 13 indicates at least a 1 g/dl increase in hemoglobin over the week 9 value, or a 2 g/dl increase over the baseline value, then the patient will continue on study through week 16 at the same dose of EPO. ETAN should continue until 2 doses are given during week 16 EPO.
  • EPO Dose Adjustment of EPO If the hemoglobin is > 13 g/dl on 2 consecutive evaluations, EPO should be withheld until the hemoglobin drops to 12 g/dl. EPO should then be resumed at 75% of the last dose given before discontinuation. If the hemoglobin increases by > 1.3 g/dl in a 2 week period, EPO should be continued at 75% of the previous dose. Patients who Develop Sepsis
  • Epoetin alfa 40,000 U/ml should be brought to room temperature and drawn up into a plastic syringe immediately prior to administration by SC injection according to standard techniques.
  • the EPO and ETAN/placebo may be given at the same time on day 1 of each week, but should be administered at separate sites.
  • Each vial of EPO should be used only once.
  • the maximum injection volume per site is 2 ml.
  • ETAN Study medication (ETAN/placebo) should be reconstituted with 1 ml of the supplied sterile bacteriostatic water for injection, USP (0.9% benzyl alcohol).
  • the diluent should be slowly injected into the vial. Some foaming may occur. To avoid excessive foaming, do not shake or agitate vigorously. Swirl gently until dissolution occurs, usually over less than 5 minutes. The solution should be clear and colorless.
  • the medication should then be drawn up into a plastic syringe and administered SC as soon as possible after reconstitution. New injections should be given at least 1 inch from an old site and never into areas where the skin is tender, bruised, hard or red.
  • Part 2 of the two-part vial label Prior to injection of the study medication, Part 2 of the two-part vial label is to be attached to the subject's case report form after entry of the subject's initials and number, and the date of study medication administration. Each vial of study medication should be used only once. Iron
  • Iron deficiency may develop during the use of EPO and may limit the efficacy of EPO if left untreated. If laboratory evidence of iron deficiency develops during the study, the patient should be given 150-200 mg of elemental iron per day. The appropriate formulation of the iron supplement is left to the discretion of the treating physician.
  • Patients may be transfused with packed red blood cells when judged to be necessary by the physician of record.
  • a hemoglobin level should be obtained at the time the type and cross-match specimen is drawn.
  • the pre-transfusion hemoglobin value, along with the number of units used and the total volume transfused, should be recorded in the case report form.
  • the sponsor must be notified in advance (or as soon as possible thereafter) of any instances in which prohibited therapies are administered.
  • ⁇ Response is defined as a 2g/dl or greater increase in the hemoglobin when compared to the Baseline value.
  • ⁇ Significant weight loss will be defined as Off Study Weight divided by Baseline Weight less than 0.90.
  • ⁇ Disease status will be defined according the current version of the RECIST Criteria issued by the National Cancer Institute.
  • RNA is extracted from the white blood cell samples with Micro RNA Isolation Kit (Stratagene, San Diego, CA). The pellet is resuspended in 11 ⁇ l of RNase free H2O, 1 ⁇ l of which is saved and used as a negative control for reverse transcription PCR (no RT control), and the remaining (10 ⁇ l) is processed for RT-PCR and RNA amplification.
  • RT Reverse Transcription
  • First stand synthesis is completed by adding together 10 ⁇ l of purified RNA from above and 1 ⁇ l of 0.5 mg/ml T7-oligodT primer (5'TCTAGTCGACGGCCAGTGAATTGTAATACGACTCACTATAGGGC
  • Ampliscribe T7 Transcription Kit (Epicentre Technologies) is used: 8 ⁇ l double-stranded cDNA, 2 ⁇ l of 10X Ampliscribe T7 buffer, 1.5 ⁇ l of each 100 mM ATP, CTP, GTP and UTP, 2 ⁇ l 0.1 M DTT and 2 ⁇ l of T7 RNA Polymerase, at 42°C for 3 hours. The aRNA is washed 3X in a Microcon-100 column, collected, and dried down to 10 ⁇ l.
  • 10 ⁇ l of aRNA from first round amplification is mixed together with 1 ⁇ l of lmg/ml random hexamers (Pharmacia), 70°C for 10 minutes, chilled on ice, equilibrated at room temperature for 10 minutes, then 4 ⁇ l 5X first stand buffer, 2 ⁇ l 0.1M DTT, 1 ⁇ l lOmM dNTPs, 1 ⁇ l RNasin and 1 ⁇ l Superscript RT II are added and incubated at room temperature for 5 minutes followed by 37°C for 1 hour. Then, 1 ⁇ l of RNase H is added and incubated at 37°C for 20 min.
  • 1 ⁇ l of aRNA from first round amplification is mixed together with 1 ⁇ l of lmg/ml random hexamers (Pharmacia), 70°C for 10 minutes, chilled on ice, equilibrated at room temperature for 10 minutes, then 4 ⁇ l 5X first stand buffer, 2 ⁇ l 0.1M D
  • Second strand cDNA synthesis 1 ⁇ l of 0.5 mg/ml T7-oligodT primer is added and incubated at 70°C for 5 minutes, 42°C for 10 minutes. Next, 30 ⁇ l of second strand synthesis buffer, 3 ⁇ l lOmM dNTPs, 4 ⁇ l Polymerse I, 1 ⁇ l E. coli RNase H, 1 ⁇ l E. coli DNA Ligase and 90 ⁇ l of RNase free H2O is added and incubated at 37°C for 2 hours. Then 2 ⁇ l of T4 DNA Polymerase is added atl6°C for 10 minutes. The double strand of cDNA is extracted with
  • cDNA is ready for second round T7 in vitro transcription as above and then a subsequent third round aRNA amplification.
  • Microarray Printing cDNA clones from whole white blood cells are printed on silylated slides (CEL Associates). cDNAs are PCR-amplified with 5' amino-linked primers and purified with Qiagen 96 PCR Purification Kits. The print spots are about 125 ⁇ m in diameter and are spaced 300 ⁇ m apart from center to center. Thirty plant genes are also printed on the slides as a control for non-specific hybridization.
  • Cy3 labeled cDNA probes are synthesized from aRNA of white blood cell
  • DRGs with Superscript Choice System for cDNA Synthesis (Gibco BRL). 5 ⁇ g aRNA, 3 ⁇ g random hexamer are mixed in a total volume of 26 ⁇ l (containing RNase free H O), heated to 70°C for 10 minutes and chilled on ice. Then,10 ⁇ l first strand buffer, 5 ⁇ l 0.1MDTT, 1.5 ⁇ l RNasin. 1 ⁇ l 25mMd(GAT)TP, 2 ⁇ l lmM dCTP, 2 ⁇ l Cy3-dCTP (Amersham) and 2.5 ⁇ l
  • the probes are vacuum dried and resuspended in 20 ⁇ l of hybridization buffer (5X SSC, 0.2% SDS) containing mouse Cotl DNA (Gibco BRL).
  • Printed glass slides are treated with sodium borohydrate solution (0.066M NaBH4, 0.06M Na AC) to ensure amino-linkage of cDNAs to the slides. Then, the slides are boiled in water for 2 minutes to denature the cDNA. Cy3 labeled probes are heated to 99°C for 5minutes, room temperature for 5 minutes and applied to the slides. The slides are covered with glass cover slips, sealed with DPX (Fluka) and hybridized at 60°C for 4-6 hours. At the end of hybridization slides are cooled to room temperature. The slides are washed in IX SSC, 0.2% SDS at 55°C for 5 minutes, 0.1X SSC, 0.2% SDS at 55°C for 5 minutes. After a quick rinse in 0.1X SSC, 0.2% SDS, the slides are air-blown dried and ready for scanning.
  • sodium borohydrate solution 0.066M NaBH4, 0.06M Na AC
  • Microarray Quantitation cDNA microarrays i.e., microscope slides
  • ScanArray 3000 General Scanning, Inc.
  • ImaGene Software Biodiscovery, Inc.
  • the intensity of each spot i.e., cDNA
  • the intensity of each spot is corrected by subtracting the immediate surrounding background.
  • the corrected intensities are normalized for each cDNA
  • each intensity is compared, via a one- sample t-test, to the 75-percentile value of 30 plant cDNAs that are present on each chip (representing non-specific nucleic acid hybridization).
  • the intensity for each cDNA from each patient set (patients within one therapeutic regimen, patient populations treated with different therapeutic regimens, and patient baseline) are grouped together respectively and intensity values are averaged for each corresponding cDNA.
  • Two-sample t test for one- tailed hypotheses is used to detect a gene expression difference between the different patient populations after a therapeutic regimen.
  • ELISA Commercial enemy linked immunoassays
  • R&D Systems R&D Systems, Minneapolis, MN or BioSource International
  • EPO or EPO/Anti-Tumor Necrosis Factor Compound Each assay is conducted according to the manufacture's instructions. Table 1 describes the assays that are conducted using serum drawn on each time point described above.
  • RNA is extracted from white blood cells of patients who received at least one doses of EPO or EPO+ETAN and is linearly amplified an estimated 10 6 -fold via T7 RNA polymerase.
  • one or more fluorescently labeled probes are synthesized from an individually amplified RNA (aRNA) and hybridized in triplicate to a microarray (a.k.a. chip) containing human cytokine cDNAs and other cDNA's such as plant cDNAs (for the determination of non-specific nucleic acid hybridization).
  • aRNA individually amplified RNA
  • a microarray a.k.a. chip
  • the binding of the labeled probe to a cytokine cDNA spot on the chip indicates the presence of mRNA encoding the cytokine.
  • the amount of labeled probe bound to the cytokine cDNA spot on the chip indicates the amount of mRNA encoding the cytokine. In this manner a cytokine profile is established for each patient.
  • the coefficient of variation is calculated (CV or standard deviation/mean X 100%). More importantly, independent amplifications ( ⁇ 10 6 -fold) of different sets of the same white blood cell subtype from different patients yields quite similar expression patterns.
  • Heterogeneity with respect to gene expression which presumably reflects, at least in part, different sensory modalities transmitted can be cataloged and statistically analyzed for significance.
  • the coupling of immunochemistry, aRNA and DNA chip analysis can be done.
  • chips containing a larger number of cDNAs i.e., >10,000 can be completed to more fully identify differential gene expression including genes other than cytokine genes.
  • Cataloging heterogeneity with respect to gene expression in response to a therapeutic regimen of EPO or EPO/anti-TNF will provide a greater understanding in the observed variability of response to EPO or EPO/ Anti-TNF and clinical effects observed during and after a therapeutic regimen of EPO or EPO/Anti-TNF.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides methods to determine the physiological relationship of different cytokines in humans by administering a therapeutic regimen of a cytokine, or an anti-cytokine, or a combination of a cytokine and an anti-cytokine, and measuring changes in concentrations of other cytokines. The present invention further provides methods to modulate the concentration of a target cytokine by administering a therapeutic regimen of a different cytokine, or an anti-cytokine, or a combination of a different cytokine and an anti-cytokine, and measuring changes in concentrations of other cytokines.

Description

TITLE OF THE INVENTION
CYTOKINE MODULATION THERAPY
BACKGROUND OF THE INVENTION Erythropoietin (EPO) is a glycoprotein hormone produced by the kidney in response to tissue hypoxia that stimulates red blood cell production in the bone marrow. The gene for erythropoietin has been cloned and expressed in Chinese hamster ovary (CHO) cells as described in United States Patent No. 4,703,008. Recombinant human erythropoietin (r-HuEPO, Epoetin alfa) has an amino acid sequence identical to that of human urinary erythropoietin, and the two are indistinguishable in chemical, physical and immunological tests.
Recombinant human erythropoietin acts by increasing the number of cells capable of differentiating into mature erythrocytes, triggering their differentiation and augmenting hemoglobin synthesis in developing erythroblasts (Krantz, S.B., Blood (1991) 77: 419- 434; Beckman, B.S. and Mason-Garcia, JVL, 77ze Faseb Journal (1991) 5: 2958-2964).
Although the kidney, liver and bone marrow have been implicated in the metabolism of endogenous EPO and Epoetin alfa in animals, the data are inconclusive. Erythropoietin is heavily glycosylated, which protects the molecule from rapid degradation in vivo. In both animal and human studies, urinary excretion of intact erythropoietin contributes about 3 to 10% of its total clearance. Pharmacokinetic data of studies in cancer patients indicate that the pharmacokinetics of exogenously administered Epoetin alfa is not remarkably altered in these patients.
In clinical trials to date, Epoetin alfa has been evaluated in normal subjects as well as in subjects with various anemic conditions. Epoetin alfa induces a brisk haematological response in normal human volunteers, provided that adequate supplies of iron are
Page l available to support increased hemoglobin synthesis. A majority of trials have investigated the safety and effectiveness of Epoetin alfa in the treatment of chronic renal failure and of anemia in cancer. Other trials have evaluated Epoetin alfa for the treatment of anemia associated with rheumatoid arthritis, prematurity, ADDS, bone marrow transplantation, myelofibrosis, sickle cell anemia, as a facilitator of presurgical autologous blood donation, and as a perisurgical adjuvant.
Epoetin alfa is approved for sale in many countries for the treatment of anemia in chronic renal failure (dialysis and predialysis), anemia in zidovudine treated HIV positive patients (US), anemia in cancer patients receiving platinum-based chemotherapy, as a facilitator of autologous blood pre-donation, and as a perisurgical adjuvant to reduce the likelihood of requiring allogeneic blood transfusions in patients undergoing orthopedic surgery.
Clinical experience has been collected over the past years to show that Epoetin alfa can correct anemia in cancer patients, at doses several times higher than those shown to be effective in renal patients. Anemia may result from the disease itself, the effect of concomitantly administered chemotherapeutic agents, or a combination of both. The condition often takes on the characteristics of the anemia of chronic disease (ACD). ACD is associated with erythroid hypoplasia of the bone marrow, a somewhat shortened circulating life of red cells and decreased bone marrow re-utilization of iron. If erythropoietin levels are measured, they are found to be within the normal range, but inappropriately low for the degree of anemia. Therefore the patient has a blunted erythropoietin response. About 50-60% of anaemic cancer patients receiving chemotherapy responded with a hemoglobin rise of at least 2 g/dL to Epoetin alfa therapy given three times weekly at a dose of 150 IU/kg over a period of 12 weeks (Abels, R.I., Larholt, K.M., Krantz, K.D. and Bryant, E.C., Proceedings of the Beijing Symposium, Alpha Medical Press, Dayton, Ohio (1991) 121-141). In a subsequent open-label dose titration study, doses up to 300 IU kg, were sometimes required, demonstrating the relative resistance to the effect of Epoetin alpha in these patients. In three large community based studies, which enrolled over 7,000 patients with a wide range of non- myeloid malignancies, quality of life improvements correlated with the change in hemoglobin from baseline. (Glaspy, J., Bukowski, R., Steinberg, D., et al., /. Clin. Oncol, (1997) 15:1218-34; Demetri, G.D., Kris, M., Wade, J., et al, J. Clin. Oncol. (1998) 16:3412-25; Gabrilove, J.L., Einhorn, L.H., Livingston, R.B., et al, American Society of Clinical Oncology Annual Meeting (1999) Abstract 2216). However, patients who did not experience an increase in hemoglobin over their baseline level did not show improvement in energy level, activity level, and overall quality of life. In each of the studies, approximately 35% of patients did not have an increase in their hemoglobin of 2 g/dl over baseline. Patients with progressive disease do not respond well to epoetin alfa, but the proportion (approximately 20%) of patients with progressive disease does not explain the overall rate of non-response of 35%. There is room to improve the overall response rate to erythropoietin in patients suffering from cancer.
Quality of life measures improve in association with increased hemoglobin levels in patients with cancer related anemia. Yet approximately one-third of patients fail to respond to erythropoietin treatment. Among the responders, quality of life measures improve significantly, but do not approach those seen in healthy subjects. TNF is implicated in many of the processes that complicate cancer therapy, including anemia, fatigue, and anorexia and cachexia. Cancer related fatigue has emerged as the most prevalent and bothersome symptom of cancer and its treatment. (Portenoy, R.K., Itri, L.M., The Oncologist (1999) 4:1-10). It is reported by 75%-100% of patients with cancer, depending on the patient's diagnosis, treatment and disease status. Cancer related fatigue is a multi-factorial problem. However, the treatment of cancer related anemia with erythropoietin has emerged as a safe and effective therapy to improve quality of life and relieve cancer anemia-related fatigue. In addition, it has been shown that in advanced renal failure patients treated with pentoxifylline alone TNF alpha decreased significantly and hemoglobin increased significantly (Navarrow, J. et al, Scan. J. Urol. Nephrol. (1999) 33(2): 121-125). Therefore, modulation of TNF simultaneously with EPO should increase the effectiveness of EPO for increasing hemoglobin levels, ameliorating anemia, and increasing the Quality of life measures in cancer patients.
Tumor necrosis factor (TNF) is part of a group of inflammatory cytokines that has been implicated in the pathologic changes seen in a number of diseases. TNF has been implicated as a contributing cause of fatigue, asthenia, anorexia and cachexia in a number of disorders. Elevated levels of TNF were associated with post-dialysis fatigue in one study (Dreisbach, A.W., Hendrickson, T., Beezhold, L.A., et al., Int. J. Artif. Organs (1998) 21:83-6) and were seen in patients with disorders of excessive daytime sleepiness in another. (Vgontzas, A.N., Papanicolaou, D.A., Bixler, E.O., et al., J. Clin. Endrocrinol. Metab. (1997) 82:1313-6) TNF inhibition associated with the use of thalidomide has been exploited to treat the anorexia and cachexia of HIV disease (Haslett, P.A., J. Semin. Oncol. (1998) 25(6):53-57). The "procachexic" characteristics of some inflammatory cytokines, and TNF in particular, were recently reviewed (Argiles, J.M. and Lόpez-Soriano, F.J., Med. Res. Rev. (1999) 19:223-48). The evidence of increased circulating TNF levels in cancer patients remains controversial; and, no single molecule has yet been identified as the mediator of cancer related cachexia. Still, TNF is an important candidate. An extensive review of asthenia echoes this sentiment. (Von Hoff, D.D., Cancer Therapeutics (1998) 1:184-97).
A number of pre-clinical and clinical studies have demonstrated that TNF may act as a negative modulator of erythropoiesis. In murine models, there are conflicting data regarding the ability to abrogate TNF mediated anemia. (Clibon, U., Bonewald, L., Caro, J., et al, Exp. Hematol (1990) 18:458-41; Johnson, C.S., Cook, C.A., Furmanski, P., Exp. Hxematol. (1990) 18:109-13.). In human studies, there is an association between circulating TNF levels and the need for increased doses of epoetin alfa in hemodialysis patients (Goiechea M, Nartin J, de Sequera P, et al. Kidney Int (1998) 54:1337-43) and between local production of TNF in the bone marrow of patients with the anemia of chronic disease secondary to rheumatoid arthritis. (Jongen- Lavrencic M, Peeters HR, Wognum A, et al. / Rheumatal (1997) 24:1504-9). TNF blockade with a monoclonal antibody lead to improvement in the anemia of rheumatoid arthritis patients in one study (Davis, D., Charles, P.J., Potter, A., et al, Br. J. Rheumatol (1997) 36:950-6).
This data suggests that cytokines can induce previously unknown physiological interactions with different cytokines.
SUMMARY OF THE INVENTION
The present invention provides methods to determine the physiological relationship of cytokines in humans by administering a specific cytokine, or a specific anti-cytokine and then measuring changes in concentrations of other cytokines to produce a cytokine profile of a patient.
The present invention provides a method to produce cytokine modulation by EPO with or without an anti-Tumor Necrosis Factor compound. Modulation of cytokines by administration of a therapeutic amount of EPO or with a combination of EPO and an anti- Tumor Necrosis Factor compound provides a novel means to treat diseases caused by aberrant concentrations of one or more cytokines in a patient and to alter the concentrations of cytokines to a desired level. The present invention further provides methods to modulate the concentration of a specific cytokine or cytokine profile of a patient by administering a therapeutic regimen of a different cytokine, or an anti-cytokine agent, or a combination thereof.
The present invention also provides methods to produce cytokine gene expression profiles in response to EPO treatment in patients, modulate cytokine gene expression using EPO treatment and identifying the specific cytokines that are modulated in a patient treated with EPO.
DETAILED DESCRIPTION OF THE INVENTION
Figure imgf000007_0001
Figure imgf000008_0001
Cytokines and hormones are produced and circulate within the body of an animal within concentration ranges that correspond with the biological activity of the cytokine. The level of cytokine production by specific cells is controlled by specific cellular stimuli and the rate of metabolic clearance is controlled by the nature of the cytokine (polypeptide structure and glycosylation) and by the metabolic activity of the liver and filtration by the kidneys. There are other mechanisms to modulate cytokine activity including inactivation of the cytokine by enzymatic nicking or by naturally occurring antagonists, for example soluble IL-1 receptor antagonist (IL-lra). Circulating soluble receptors or neutralizing antibodies are other well-known means to reduce the functional quantity of circulating cytokine. The inventors contemplate that cytokines exist in a homeostatic basis with each other and with other physiological systems, including metabolic and neurologic hormone control systems. For example, as described above, in human studies there is an association between circulating TNF levels and the need for increased doses of epoetin alpha in hemodialysis patients. There is no direct association known between these two cytokines; they are not currently known to cross-react with the other's receptor. The inventors contemplate that there is a physiologically relevant association between elevated TNFα and the biological activity of EPO, or vis a versa, that is not readily apparent using in vitro models or even known animal models. As a second example, chronic over expression of TNFα results in disruption of metabolic homeostasis, resulting in metabolic wasting (cachexia) most likely through suppression of synthesis of lipoprotein lipase, an enzyme needed to release fatty acids bound to lipoproteins. As a third example, reduced levels of TNFα resulted in increased hemoglobin levels, despite only one known cytokine, EPO, being associated with this physiological response (Navaro, J F et al (1999) Scand J. Urol Nephrol 33(2) 121 - 125). The inventors contemplate that this effect is not likely to be due to direct binding of TNFα on the EPO receptor, but that TNFα directly or indirectly modulates the hematopoietic process in some other way. For these reasons, the inventors contemplate that the most useful system in which to determine cytokine homeostatic relationships is by measuring changes in various cytokine concentration levels after administration of one or more cytokines in human subjects. Alternatively, decreasing the levels of a cytokine, for instance TNFα, may modulate the concentration of other cytokines, which could also be monitored in human subjects by the methods of the present invention. By monitoring direct physiological effects in patients after administration of one or more cytokines or anti-cytokine agents new therapeutic applications of the agents will be available. The inventors contemplate that this method will greatly increase the rate to which beneficial therapeutic regimens will be developed and applied to the treatment of humans.
The actual basis of cytokine homeostasis is likely to vary in different patient populations. For example patients with HIV or malignancies suffer from cachexia because of an imbalance of TNFα. Diabetic patients have disrupted homeostasis of their glucose metabolism either by modulated insulin levels, modulated glucagon levels, or a modulated receptor response to insulin. Various autoimmune diseases including rheumatoid arthritis and lupus are a result in disruption in the control of immune function, and have been associated with altered cytokine levels. The methods of the present invention provide a means to treat different patient populations by administering a therapeutic amount of one agent and monitoring changes in the overall cytokine homeostasis, despite the fact that different patient populations will respond differently to different amounts of cytokine, for example EPO as described above. The methods of the present invention of administering an agent in humans, and monitoring riiRNA levels of gene expression or new cytokine protein production is generally applicable to wide variety patient groups.
Some cytokines, particularly TNFα, can be very dangerous to a patient because of the potent biological activity of the cytokines. For example, high levels of TNFα can result in disseminated intravascular coagulation or septic shock.
Erythropoietin is a preferred cytokine to administer therapeutically because it is well tolerated by the patient, as described above, and is well defined clinically in many different patient populations. Administration of EPO has been demonstrated to increase hemoglobin and reticulocyte counts, not induce fever, and not induce immune response over repeated administration. EPO can be administered over a broad concentration range without detrimental effects.
The method of the present invention is a method to determine the physiological relationship of cytokines and producing changes in the cytokine profile of a patient comprising the steps: a) administering one or more specific cytokines, and b) measuring changes in concentrations of other cytokines.
The present invention is also applicable to producing changes in cytokines upon suppression of another cytokine. This could be achieved by a method to determine the physiological relationship of cytokines and producing changes in the cytokine profile of a patient comprising the steps: a) administering one or more specific anti-cytokine agent, and b) measuring changes in concentrations of other cytokines. Further, the present invention is also applicable to making changes in the cytokine profile of a patient comprising the steps: a) administering a therapeutic regimen of one or more anti-cytokine agents, and b) administering a therapeutic regimen of one or more different cytokine, and c) measuring changes in concentrations of other cytokines, wherein steps (a) and (b) can be in either order, or concurrently.
Differential Protein Expression
Commercial enzyme linked immunoassays (ELISA) (R&D Systems, Minneapolis, MN or BioSource International) are used to screen changes in the concentration of different proteins, for example cytokines, in the blood after the patient is treated with a therapeutic amount a cytokine, an anti-cytokine, or a combination thereof. Each assay is conducted according to the manufacture's instructions. Assays are conducted using blood drawn on each time point of clinical evaluation of the patient during the course of the therapeutic regimen. A cytokine profile is produced for each patient which is used to show changes in the cytokine concentrations in response to treatment. The cytokine profile may be modulated by the treatment to produce a desired cytokine profile in the patient.
Differential Gene Expression
RNA is extracted from white blood cells and linearly amplified an estimated 106-fold using commercially available RNA polymerase enzymes by methods well known in the art (Maniatis, T., Fritsch, E.F., Sambrook, J. in Molecular Cloning: A Laboratory Manual, 2n Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Once amplified, ffuorescently labeled probes are synthesized from an individually amplified RNA (aRNA) and hybridized in triplicate to a microarray (a.k.a. chip) containing human cDNAs, for example cytokine cDNA's, and non-specific cDNAs, for example plant or insect cDNAs (for the determination of non-specific nucleic acid hybridization).
Building Cytokine Concentration and Gene Expression Databases
Using immunochemical (protein) assays, aRNA and cDNA chips, one can determine blood cytokine concentrations or cytokine gene expression levels after the patient is treated with a therapeutic regimen comprising a specific cytokine, for example EPO or in combination with a specific anti-cytokine, for example an anti-Tumor Necrosis Factor Compound. These methods demonstrate that cytokine profiles generated via this integration of known technologies can be useful to produce databases that contain protein concentration and gene expression levels in response to a therapeutic regimen. Knowledge of genes that are modulated in response to the therapeutic regimen will give much greater understanding of the effects of the drug on individual cell types. The therapeutic regimen comprising a specific cytokine, for example EPO, or in combination with a specific anti-cytokine, for example an anti-Tumor Necrosis Factor Compound can be used to treat disease states that are associated with over or under expression of genes that are known to be modulated by the therapeutic regimen.
Heterogeneity among patients with respect to gene expression, which presumably reflects, at least in part, different sensory modalities transmitted can be cataloged and statistically analyzed for significance. To approach this more complicated heterogeneity, the coupling of immunochemistry, aRNA and DNA chip analysis can be done. In addition, chips containing a larger number of cDNAs (i.e., >10,000) can be completed to more fully identify differential gene expression. Cataloging heterogeneity with respect to gene expression in response to a therapeutic regimen will provide a greater understanding in the observed variability of response to the therapeutic regimen and clinical effects observed during and after the therapeutic regimen comprising a cytokine, for example EPO, or in combination with an anti-cytokine, for example an anti-Tumor Necrosis Factor Compound.
EFFECTS OF UNDER OR OVER EXPRESSED CYTOKINES OR GROWTH FACTORS Inflammatory Cytokines
Over-expression of inflammatory cytokines, including TNF, IL-lα, and IL-lβ results in fever, acute phase plasma protein production, and initiates metabolic wasting (cachexia). TNF can also alter the balance of the procoagulation and anticoagulation by the vascular endothelium. Overexpression of TNF leads to increased levels of TL-6 and this is associated with bone marrow suppression.
Further, high levels of TNF causes intravascular thrombosis, and reduces blood pressure and tissue perfusion by relaxing vascular smooth muscle tone. INFγ augments the many of the effects of TNF, so elevated INFγ alone may contribute to some of the previously noted effects via interaction with physiological levels of TNFα.
Cytokines That Regulate Lymphocyte Activation. Growth, and Differentiation
Modulation of cytokines that regulate lymphocyte activation, growth and differentiation, TL-2, TL-4, TGFβ is likely to affect autoimmune disease states in individuals with over expressed cytokines and immunosuppression in individuals with under expressed cytokines.
Cytokines That Regulate Immune-Mediated Inflammation
This class of cytokines is primarily produced by CD4+ and CD8+ T cells, and activates the function of other effector cells, including macrophages, endothelial cells, NK cells, B cells, eosinophils, and other T cells, in a non-specific manner.
Modulation of cytokines that regulate Immune-Mediated inflammation, INFγ, TNFβ, EL-5, EL- 10, and IL-12 is likely to affect conditioned mediated by such responses.
Hematopoietic Cytokines This class of cytokines directs maturation of hematopoietic stem cells through progressive expansion and irreversible differentiation to form various leukocyte lineage, and erythrocytes. The known members of this class of cytokines includes IL-3, GM-CSF, M-CSF, G-CSF, JL-7, EPO, IL-9, and IL-11. Overexpression or under expression of any of these cytokines is likely to disrupt the appropriate numbers of individual cell lineage.
Erythropoietin
The term Erythropoietin (EPO), as defined herein, refers to any molecule that specifically stimulates terminal differentiation of red blood cells from hematopoietic stem cells and stimulates production of hemoglobin. For example, but not to limit the scope of the current invention, EPO molecules may include small organic or inorganic molecules, synthetic or natural amino acid peptides, purified protein from recombinant or natural expression systems, or synthetic or natural nucleic acid sequences, or any chemical derivatives of the aforementioned. The generally preferred form of EPO is purified, recombinant EPO, distributed under the trademarks of EPREX® or ERYPO®. Epoetin alfa (EPREX®, ERYPO®) is a sterile, clear, colorless, aqueous solution for injection, that is provided in prefilled, single-use syringes containing either 4,000 or 10,000 IU epoetin alfa (a recombinant human erythropoietin) and 2.5 mg/mL human serum albumin in 0.4 mL (4,000 IU syringe) or 1.0 mL (10,000 IU syringe) of phosphate buffer.
The term "Erythropoietin" shall include those proteins and other organic molecules that have the biological activity of human erythropoietin, as well as erythropoietin analogs, erythropoietin isoforms, erythropoietin mimetics, erythropoietin fragments, hybrid erythropoietin proteins, altered carbohydrate sialic acid content erythropoietin proteins, erythropoietin receptor agonists, renal erythropoietin, brain erythropoietin, oligomers and multimers of the above, homologues of the above, and muteins of the above, including but not limited to muteins having increased or decreased glycosylatin sites, regardless of the biological activity of same, and further regardless of the method of synthesis or manufacture thereof including but not limited to naturally occurring, recombinant, synthetic, transgenic, and gene activated methods.
Anti-Cytokine Compounds
The term "anti- cytokine compound" refers to drug products that decrease the amount of circulating, active cytokine. The compound may achieve this by decreasing the amount of cytokine mRNA transcription, by increasing the rate of cytokine mRNA degradation, by decreasing mRNA translation into cytokine, or by decreasing cellular secretion of the cytokine. Other suitable anti-cytokine compounds work by increasing the rate of clearance or decreasing the amount of functional cytokine protein in circulation. The anti-cytokine compounds may be administered as combinations in order to maximize modulation of the cytokine profile of a patient since agents can be selected that act as cytokine inhibitors at different points in cytokine synthesis and pharmacokinetic activity.
Anti-TNFα Compounds
The term "anti- Tumor Necrosis Factor Compound" refers to drug products that decrease the amount of circulating, active TNFα. The compound may achieve this by decreasing the amount of cellular TNFα mRNA transcription, by decreasing mRNA translation into TNFα protein, or by decreasing cellular secretion of TNFα. Roy A. Black, et. al, from Immunex Corporation, has discovered a compound that inhibits the enzyme that releases TNF from cell surfaces (Nature, 370, 218(1994)). This compound, called TNF-α protease enzyme inhibitor, curbs production of soluble TNF. Other suitable anti-TNFα compounds could work by increasing the rate of clearance or decreasing the amount of functional TNFα in circulation. Preferred anti-TNFα compounds are Thalidomide, Pentoxifylline, Infliximab, glucocorticoids, and Etanercept. The anti-TNFα compounds may be administered as combinations in order to maximize modulation of TNF since these agents acts as TNFα inhibitors at a different points in TNF synthesis and pharmacokinetic activity. Pentoxifylline inhibits TNF-α gene transcription (Doherty, et al, Surgery (1991) 110:192), while thalidomide enhances TNF-α m-RNA degradation (Moreira, et al., 1993) and glucocorticoids such as dexamethasone inhibit TNF-α m-RNA translation (Han, et. al, J. Exp. Med. (1990) 172:391). Infliximab and Etanercept act by reducing the amount of circulating, active TNFα.
Pentoxifylline (PENTOXIL™, Trental) decreases circulating TNFα at the Standard dose of 400 mg 3 times daily. Pentoxifylline inhibits TNF-α gene transcription (Doherty, et al, Surgery (1991) 110:192).
Glucocorticoids such as dexamethasone inhibit TNF-α m-RNA translation. Desamethasone is administered orally, intramuscularly, or intravenously in the dose range of 8-40 mg (pediatric dose: 0.25-0.5 mg/kg). If given intravenously, dexamethasone should be given over 10-15 minutes, since rapid administration may cause sensations of generalized warmth, pharyngeal tingling or burning, or acute transient perianal and/or rectal pain. Methylprednisolone is also administered orally, intramuscularly, or intravenously at doses and schedules that vary from 40-500 mg every 6-12 hours for up to 20 doses. Thalidomide (N- phthalidoglutarimide) may act by enhancing TNF-α m-RNA degradation (Shannon, et al Amer. Society for Microbiology Ann. Mtg„ (1990) Abs. U-53). Thalidomide is given by oral administration in the range of about 30 mg to 1500 mg per 24 hours, preferably 200 to 500 mg per 24 hours for an adult human weighting 70 kg.
REMICADE™ (Infliximab) is a monoclonal antibody that blocks the biological activity of circulating TNFα. Infliximab does not neutralize TNFβ (lymphotoxin α), a related cytokine that utilizes the same receptors as TNFα. Remicade is supplied as a sterile, white, lyophilized powder for intravenous infusion. Following reconstitution with 10 mL of Sterile Water for Injection, USP, the resulting pH is approximately 7.2. Each single-use vial contains 100 mg Infliximab, 500 mg sucrose, 0.5 mg polysorbate 80, 2.2 mg monobasic sodium phosphate and 6.1 mg dibasic sodium phosphate. No preservatives are present. Data from a study of single intravenous infusions of 1, 5, 10 or 20 mg/kg show a direct and linear relationship between the dose administered and the maximum serum concentration (Cmax) and area under the concentration-time curve. The volume of distribution at steady state (Vd), clearance and mean residence time are independent of the administered dose. Infliximab has a prolonged terminal half-life and is predominantly distributed within the vascular compartment. A single infusion of the recommended dose of 5 mg/kg resulted in a median Cmax of 118 μg/mL, a median Vd equal to 3.0 liters and a terminal half-life of 9.5 days.
ENBREL™ (Etanercept) is a dimeric fusion protein consisting of the extracellular ligand-binding portion of the human 75 kilodalton (p75) tumor necrosis factor receptor (TNFR) linked to the Fc portion of human IgGl. The Fc component of Etanercept contains the j2 domain, the CH3 domain and hinge region, but not the CHI domain of IgGl. Etanercept is produced by recombinant DNA technology in a Chinese hamster ovary (CHO) mammalian cell expression system. It consists of 934 amino acids and has an apparent molecular weight of approximately 150 kilodaltons. ENBREL™ is supplied as a sterile, white, preservative-free, lyophilized powder for parenteral administration after reconstitution with 1 mL of the supplied Sterile Bacteriostatic Water for Injection, USP (containing 0.9% benzyl alcohol). Following reconstitution, the solution of ENBREL™ is clear and colorless, with a pH of 7.4 ± 0.3. Each single- use vial of ENBREL™ contains 25 mg Etanercept, 40 mg mannitol, 10 mg sucrose, and 1.2 mg tromethamine. ENBREL™ is administered as a single subcutaneous (SC) injection.
The following examples illustrate the present invention without, however, limiting the same thereto.
EXAMPLE 1 A Randomized, Controlled Trial of Epoetin Alfa and Etanercept
OVERVIEW OF STUDY DESIGN
The study will be a double-blind, randomized, placebo controlled trial. After initial evaluation for eligibility, cancer patients with treatment related anemia will be assigned in a 1:1 randomization to receive either epoetin alfa plus placebo (Regimen A) or epoetin alfa plus Etanercept (Regimen B). Patients who do not achieve an increase in hemoglobin of 1 g/dl without transfusion after four weeks of treatment will receive an increased dose epoetin alfa during weeks 5-8. Patients on Regimen A (epoetin alfa + placebo) who do not achieve an increase in hemoglobin of 2 g/dl over baseline by week 9 will be crossed over to Regimen B in an 8 week open label extension phase. Patients on Regimen B who do not achieve a 2 g/dl increase in hemoglobin over baseline by week 9 will be taken off study. Responding patients will continue on their assigned treatment and blinding will be maintained for 16 weeks.
All patients must have received at least one course of chemotherapy and be scheduled to receive a minimum of 8 weeks of additional chemotherapy after study enrollment. Measures of Quality of Life (QoL), executive function, and weight will be obtained at study entry and at weeks 9 and 17 or at the time of withdrawal from the study. Hematologic parameters will be measured bi- weekly. All measurements should be made within 3 days prior to a subsequent course of chemotherapy. Assessments of tumor response will be made at enrollment, with subsequent assessments at weeks 9 and 17 or at the time of withdrawal from the study.
The modulation of TNFα levels by EPO in patients administered EPO + placebo (Regimen A) will be determined by differential protein expression and compared to the baseline values (TNFα levels prior to any treatment) and EPO+ETAN (Regimen B). The modulation of TNFα by EPO + ETAN (Regimen B) will be compared to established data of ETAN alone to determine if the anti-TNFα compound exhibits synergy with EPO in suppression of TNFα.
STUDY POPULATION
General Considerations The specific inclusion and exclusion criteria for enrolling subjects in this study are described in the following sections. Exceptions to these inclusion/exclusion criteria should occur infrequently and should be discussed in advance with the Ortho Biotech medical monitor. If an exception is agreed upon and a subject is allowed to participate, the medical monitor will send confirmation to the site acknowledging the exception. This confirmation form or letter is to be kept with the case report forms (CRFs) both at the site and at the sponsor.
Inclusion Criteria
Subjects must satisfy the following criteria before entering the study:
• Histologically proven breast or lung cancer • Prior chemotherapy < 1 course
• No evidence of progressive disease at study entry
• Treatment related anemia (must have started chemotherapy prior to study entry) with hemoglobin > 8 g/dl and < 12 g/dl
• Age > 18 years • Iron replete (transferrin saturation of > 20% and serum ferritin > 100 ng/ml)
• ECOG Performance status of 0-1 (see Appendix X) as determined by the investigator of designee
• Life expectancy of at least 6 months • Scheduled to receive at least an 8 weeks of chemotherapy
• Understands and signs informed consent
Exclusion Criteria
Subjects who meet any of the following criteria will be excluded from participating in the study:
• Prior chemotherapy > 1 course Use of biological response modifiers or cytokines within 30 days of study entry
Diagnosis of rheumatoid arthritis, inflammatory bowel disease, or any disease for which Etanercept may be primary therapy
Chronic infection within 30 days of study entry
Active infection at study entry
Acute infection within 7 days of study entry
Brain metastases
Uncontrolled seizures
Uncontrolled hypertension
Transfusion within 2 months of study entry
Iron deficiency or other nutritional anemia
Active hemolytic anemia
Bleeding
Known hypersensitivity to mammalian cell-derived products
Known hypersensitivity to human albumin
Prior treatment with epoetin alfa or any investigational erythropoietin within 8 weeks of study entry
Significant medical disease other than cancer
Second malignancy, other than basal cell carcinoma of the skin, within 5 years of study entry
Use of corticosteroids other than for occasional use for anti- emesis or pre-treatment for a medication
Advanced or poorly controlled diabetes mellitus
Pregnant or lactating woman RANDOMIZATION AND BLINDING
Overview
Randomization will be used to avoid bias in the assignment of patients to treatment, to increase the likelihood that subject attributes are evenly balanced across groups, and to enhance the validity of comparisons across treatment groups. Investigators and patients will be blinded to the identity of Etanercept and placebo to enhance the validity of comparisons that are subject to observer bias or the placebo effect (e.g. -QoL end points). EPO will be given to all patients in an open label manner. Patients will be assigned randomly to each treatment regimen.
PROCEDURES
Pre-Randomization Phase (Baseline) The following evaluations and procedures are to be performed within 14 days prior to randomization unless otherwise specified. All laboratory tests and QoL and cognitive measures must be performed prior to the start of the first chemotherapy course after randomization.
• Patient demographics • ECOG Performance Status as rated by the investigator or designee
• Tumor assessment using the NCI RECIST Criteria within 14 days prior to randomization
• Chemotherapy, radiation and surgery history • Weight measured fully dressed except for shoes on the same scale to be used throughout the study
• Clinical laboratory tests • Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count within 3 days prior to randomization
• Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron, transferrin receptor levels
• RBC folate and vitamin B 12 levels
• BUN, creatinine
• AST, ALT, total bilirubin • Serum TNFα and anti-TNFα levels
• FACT-An, Linear Analog Scale Assessment (LASA), CLOX and EXIT 25 within 3 days prior to the administration of chemotherapy
• Transfusion history • Signed informed consent
Subjects will be assigned to treatment groups based on a computer-generated randomization schedule. The randomization will be balanced by using permuted blocks and will be stratified by center and type of cancer. Based on this randomization code, the study drug will be packaged and labeled for each subject. [Subject numbers] [Medication code numbers] will be preprinted on the study drug labels and assigned sequentially as subjects qualify for the study and are randomized to treatment.
To maintain the blind, the Etanercept or placebo drug container will have a two-part, tear-off label with directions for use and other information on each part. The tear-off section of the label will contain a concealed area identifying the study drug (e.g., active or placebo) and will be removed and attached to the subject's CRF when the drug is dispensed. The second part of the label will remain affixed to the study drug container and will contain all identifying information except for the identity of the drug contained. The study drugs will be identical in appearance and will be packaged in identical containers.
Under normal circumstances, the blind should not be broken. The blind should be broken only if specific emergency treatment would be dictated by knowing the treatment status of the subject. In such cases, the investigator must contact the sponsor. If the investigator is unable to contact the sponsor, the investigator may in an emergency determine the identity of the treatment by exposing the concealed area of the label attached to the subject's CRF. Individual code breaks by the investigator will normally result in withdrawal of the subject from the trial. The date, time, and reason for the unblinding must be documented on the appropriate page of the CRF (Study Completion Information) and the sponsor must be informed as soon as possible.
The randomization schedule will not be revealed to study subjects, parents or guardians, investigators and clinical staff, or site managers until all subjects have completed the double-blind phase of the trial.
To allow for the cross-over of non-responding patients randomized to EPO alone, the investigator will call the study sponsor with the week 9 hemoglobin results. If a patient is a non-responder, the study sponsor will inform the investigator of the patient's treatment assignment. Patients who do not respond to EPO + ETAN (Regimen B) will proceed to Off Study Evaluation procedures. Non-responding patients treated on EPO + placebo (Regimen A) will be treated with EPO + ETAN for an additional 8 weeks in an open label extension phase. Non-responding patients treated with EPO+ETAN who subsequently respond indicate synergistic action of the anti-tumor necrosis factor agent with EPO. Comparison of the response of patients treated with EPO or with EPO+ETAN will further indicate synergistic action of the combination therapy.
DOUBLE-BLIND TREATMENT PHASE
During this phase patients should remain blinded to study-related test results prior to the completion of each set of QoL and cognitive measures. The treating physician may provide laboratory results as soon as the forms are completed for that visit.
For patients receiving every-three-week chemotherapy, evaluations should be completed at least 3 days following the end of the last dose of chemotherapy. For patients receiving every four week chemotherapy, evaluations should be completed within 3 days prior to the scheduled chemotherapy course.
Week 3
• ECOG Performance Status as rated by the investigator or designee
• Weight measured fully dressed except for shoes on the same scale to be used throughout the study
• Clinical laboratory tests
• Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count • Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron, transferrin receptor levels
• Serum TNFα and anti-TNFα levels
• Transfusion history
Week 5
• ECOG Performance Status as rated by the investigator or designee • Chemotherapy, radiation and surgery history
• Weight measured fully dressed except for shoes on the same scale to be used throughout the study
• Clinical laboratory tests
• Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron, transferrin receptor levels
• Serum TNFα and anti-TNFα levels • Transfusion history
Week 9
(This Evaluation will serve as the Off-Study Evaluation for Non-Responders on Regimen B)
• ECOG Performance Status as rated by the investigator or designee
• Tumor assessment using the NCI RECIST Criteria (see Appendix X) within 14 days • Chemotherapy, radiation and surgery history
• Weight measured fully dressed except for shoes on the same scale to be used throughout the study
• Clinical laboratory tests • Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count
• Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron, transferrin receptor levels
• RBC folate and vitamin B 12 levels
• BUN, creatinine
• AST, ALT, total bilirubin
• Serum TNFα and anti-TNFα levels • FACT-An, Linear Analog Scale Assessment (LASA), CLOX and EXIT 25 within 3 days prior to the administration of chemotherapy
• Transfusion history
Responding patients on both regimes will continue on their assigned treatment and be evaluated through week 17 as follows.
Week 13
• ECOG Performance Status as rated by the investigator or designee • Clinical laboratory tests
Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count • Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron, transferrin receptor levels
• Serum TNFα and anti-TNFα levels
• Transfusion history
• Determination of response: non-responders already on 60,000 U/week proceed to Off Study Evaluation
Week 17 • Proceed to Off Study Evaluation
Open Label Extension Phase for Non-responders in Regimen A
Week 13 • ECOG Performance Status as rated by the investigator or designee
• Clinical laboratory tests
• Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count
• Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron, transferrin receptor levels
• Serum TNFα and anti-TNFα levels • Transfusion history Week 17 Proceed to Off Study Evaluation
OFF STUDY EVALUATION • ECOG Performance Status as rated by the investigator or designee
• Tumor assessment using the NCI RECIST Criteria within 14 days
• Chemotherapy, radiation and surgery history • Weight measured fully dressed except for shoes on the same scale to be used throughout the study
• Clinical laboratory tests
• Hemoglobin, hematocrit, MCV, absolute reticulocyte count, white blood cell count with differential and platelet count
• Iron studies: ferritin, total iron binding capacity (TIBC), transferrin saturation, serum iron
• BUN, creatinine
• AST, ALT, total bilirubin • Serum TNF and anti-TNF levels
• FACT-An, Linear Analog Scale Assessment (LASA), CLOX and EXIT 25 within 3 days prior to the administration of chemotherapy
Transfusion history DOSAGE AND ADMINISTRATION
Regimen A (EPO + Placebo)
EPO will be started at a dose of 40,000 U per week given SC, without regard to the timing of chemotherapy. If at the evaluation prior to the week 5 dose the hemoglobin has not increased by at least 1 g/dl over the baseline value, the dose of EPO will be increased to 60,000 U per week for weeks 5-8. If the hemoglobin increases by at least 2 g/dl over baseline at the time of the week 9 evaluation, the patient will be considered a responder. Responders will continue to receive the dose of EPO given during weeks 5-8 until week 16. Non-responders will be offered the opportunity to receive EPO + ETAN in an
8 week open label extension.
Placebo injections will be given at a dose of 1 ml SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and placebo are given together). The patient should receive two doses of placebo during week 8, prior to the week 9 evaluation. Responders will continue to receive placebo in a blinded manner through week 16. Two placebo injections should be given in week 16, prior to the off study evaluation. Non-responders will be offered the opportunity to receive EPO + ETAN in an 8 week open label extension.
Regimen B (EPO + ETAN)
EPO will be started at a dose of 40,000 U per week given SC, without regard to the timing of chemotherapy. If at the evaluation prior to the week 5 dose the hemoglobin has not increased by at least 1 g/dl over the baseline value, the dose of EPO will be increased to 60,000 U per week for weeks 5-8. If the hemoglobin increases by at least 2 g/dl over baseline at the time of the week 9 evaluation, the patient will be considered a responder. Responders will continue to receive the dose of EPO given during weeks 5-8 until week 16. Non-responders will proceed to the Off Study Evaluation at week 9.
ETAN injections will be given at a dose of 25 mg (1 ml) SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and ETAN are given together). The patient should receive two doses of ETAN during week 8, prior to the week 9 evaluation. Responders will continue in ETAN through week 16. Two ETAN injections should be given during week 16 and prior to the off study evaluation. Non-responders will proceed to the off study evaluation at week 9.
Open Label Phase for Non-Responders on Regimen A
To assess the effectiveness of ETAN in overcoming resistance to EPO, placebo will be replaced with ETAN at week 9 for patients who are non- responders in Regimen A. The following doses of EPO and ETAN will be given during weeks 9-16 in these patients:
(1) Patients on an EPO dose of 60.000 U/week at week 8 will continue on that dose for weeks 9-12. ETAN will be given at a dose of 25 mg SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and placebo are given together). ETAN will be started on the day of the week 9 EPO dose and continue until 2 doses are given during week 12. If the evaluation at week 13 indicates at least a 1- g/dl increase in hemoglobin over the week 9 value or a 2 g/dl increase over the baseline value, then the patient will be considered a responder and continue on study through week 16. ETAN should continue until 2 doses are given in week 16. The patient then will proceed to the Off Study Evaluation. If the patient is a non- responder at week 13, then the patient will proceed to the Off Study Evaluation.
(2) Patients on an EPO dose of 40,000 U/week at week 8 will continue that dose through for weeks 9-12. ETAN will be given at a dose of 25 mg SC, at a site separate from the EPO site, on days 1 and 4 of each week (day 1 is counted as the day the EPO and placebo are given together). The first dose of ETAN will be given on the day of the week 9 EPO dose and continue until 2 doses are given during week 12. If the evaluation at week 13 indicates at least a 1 g/dl increase in hemoglobin over the week 9 value, or a 2 g/dl increase over the baseline value, then the patient will continue on study through week 16 at the same dose of EPO. ETAN should continue until 2 doses are given during week 16 EPO. The patient then will proceed to the Off Study Evaluation. If the patient is a non-responder at week 13, then the EPO dose will be increased to 60,000 U/week and the patient will continue on study through week 16. ETAN should continue until 2 doses are given during week 16 EPO. The patient then will proceed to the Off Study Evaluation.
Dose Adjustment of EPO If the hemoglobin is > 13 g/dl on 2 consecutive evaluations, EPO should be withheld until the hemoglobin drops to 12 g/dl. EPO should then be resumed at 75% of the last dose given before discontinuation. If the hemoglobin increases by > 1.3 g/dl in a 2 week period, EPO should be continued at 75% of the previous dose. Patients Who Develop Sepsis
All study medication should be discontinued in patients who develop sepsis while on study. The Study Completion/Early Withdrawal form should be completed and the study sponsor informed immediately.
Administration of EPO
Epoetin alfa 40,000 U/ml should be brought to room temperature and drawn up into a plastic syringe immediately prior to administration by SC injection according to standard techniques. The EPO and ETAN/placebo may be given at the same time on day 1 of each week, but should be administered at separate sites. Each vial of EPO should be used only once. The maximum injection volume per site is 2 ml.
Administration of ETAN Study medication (ETAN/placebo) should be reconstituted with 1 ml of the supplied sterile bacteriostatic water for injection, USP (0.9% benzyl alcohol). The diluent should be slowly injected into the vial. Some foaming may occur. To avoid excessive foaming, do not shake or agitate vigorously. Swirl gently until dissolution occurs, usually over less than 5 minutes. The solution should be clear and colorless. The medication should then be drawn up into a plastic syringe and administered SC as soon as possible after reconstitution. New injections should be given at least 1 inch from an old site and never into areas where the skin is tender, bruised, hard or red. Prior to injection of the study medication, Part 2 of the two-part vial label is to be attached to the subject's case report form after entry of the subject's initials and number, and the date of study medication administration. Each vial of study medication should be used only once. Iron
Iron deficiency may develop during the use of EPO and may limit the efficacy of EPO if left untreated. If laboratory evidence of iron deficiency develops during the study, the patient should be given 150-200 mg of elemental iron per day. The appropriate formulation of the iron supplement is left to the discretion of the treating physician.
CONCOMITANT THERAPY
Patients may be transfused with packed red blood cells when judged to be necessary by the physician of record. A hemoglobin level should be obtained at the time the type and cross-match specimen is drawn. The pre-transfusion hemoglobin value, along with the number of units used and the total volume transfused, should be recorded in the case report form.
All concomitant therapy administered during the study will be recorded on the case report form. The use of androgens or hematinic agents (folate, B12) other than iron is prohibited during the study. The use of corticosteroids, other than occasional use as a pre-medication or an anti-emetic is prohibited during the study.
The sponsor must be notified in advance (or as soon as possible thereafter) of any instances in which prohibited therapies are administered.
EFFICACY EVALUATIONS The primary endpoints to be evaluated in this study are as follows:
1. comparison of the proportion of patients in each regimen who achieve a response by week 9 2. comparison of the change in scores on QoL measures in each regimen between Baseline, week 9 and Off Study in responders, and using an intent to treat analysis of all patients
3. the proportion of non-responders in Regimen A who show a response at week 13 and week 17 when crossed over to the EPO + ETAN arm (Regimen B)
4. comparison of the proportion of patients in each regimen who experience significant weight loss.
EFFICACY AND DISEASE STATUS EVALUATION CRITERIA
♦ Response is defined as a 2g/dl or greater increase in the hemoglobin when compared to the Baseline value.
♦ Significant weight loss will be defined as Off Study Weight divided by Baseline Weight less than 0.90.
♦ Disease status will be defined according the current version of the RECIST Criteria issued by the National Cancer Institute.
The following measurement tools will be used in this study:
• Linear Analog Scale Assessment
• Fact-An
• CLOX: An Executive Clock Drawing Task
• EXIT 25: The Executive Interview. EXAMPLE 2 Evaluation of Cytokine Modulation in Response to EPO or EPO+ETAN
Treatment
RNA EXTRACTION OF WHITE BLOOD CELL SAMPLES
Total RNA is extracted from the white blood cell samples with Micro RNA Isolation Kit (Stratagene, San Diego, CA). The pellet is resuspended in 11 μl of RNase free H2O, 1 μl of which is saved and used as a negative control for reverse transcription PCR (no RT control), and the remaining (10 μl) is processed for RT-PCR and RNA amplification.
Reverse Transcription (RT) of RNA
First stand synthesis is completed by adding together 10 μl of purified RNA from above and 1 μl of 0.5 mg/ml T7-oligodT primer (5'TCTAGTCGACGGCCAGTGAATTGTAATACGACTCACTATAGGGC
GT(21)-3'). Primer and RNA are incubated at 70°C 10 minutes, followed by 42°C for 5 minutes. Next, 4 μl of 5X first strand reaction buffer, 2 μl 0.1M DTT, 1 μl lOmM dNTPs, 1 μl RNasin and 1 μl Superscript II (Gibco BRL) are added and incubated at 42°C for one hour. Next, 30 μl second strand synthesis buffer, 3 μl 10 mM dNTPs, 4 μl DNA Polymerase I, 1 μl E. coli
RNase H, 1 μl E. coli DNA Ligase and 92 μl of RNase free H2O are added and incubated at 16°C for 2 hours, followed by 2 μl of T4 DNA Polymerase at 16°C for 10 minutes. Next, the cDNA is phenol-chloroform-extracted and washed 3X with 500 μl of H20 in a Microcon-100 column (Millipore). After collection from the column, the cDNA is dried down to 8 μl for in-vitro transcription. T7 RNA Polymerase Amplification (aRNA)
Ampliscribe T7 Transcription Kit (Epicentre Technologies) is used: 8 μl double-stranded cDNA, 2 μl of 10X Ampliscribe T7 buffer, 1.5 μl of each 100 mM ATP, CTP, GTP and UTP, 2 μl 0.1 M DTT and 2 μl of T7 RNA Polymerase, at 42°C for 3 hours. The aRNA is washed 3X in a Microcon-100 column, collected, and dried down to 10 μl.
Subsequent Rounds of aRNA Amplification
10 μl of aRNA from first round amplification is mixed together with 1 μl of lmg/ml random hexamers (Pharmacia), 70°C for 10 minutes, chilled on ice, equilibrated at room temperature for 10 minutes, then 4 μl 5X first stand buffer, 2 μl 0.1M DTT, 1 μl lOmM dNTPs, 1 μl RNasin and 1 μl Superscript RT II are added and incubated at room temperature for 5 minutes followed by 37°C for 1 hour. Then, 1 μl of RNase H is added and incubated at 37°C for 20 min. For second strand cDNA synthesis, 1 μl of 0.5 mg/ml T7-oligodT primer is added and incubated at 70°C for 5 minutes, 42°C for 10 minutes. Next, 30 μl of second strand synthesis buffer, 3 μl lOmM dNTPs, 4 μl Polymerse I, 1 μl E. coli RNase H, 1 μl E. coli DNA Ligase and 90 μl of RNase free H2O is added and incubated at 37°C for 2 hours. Then 2 μl of T4 DNA Polymerase is added atl6°C for 10 minutes. The double strand of cDNA is extracted with
150 μl of phenol chloroform to get rid of protein and purified with Microcon- 100 column (Millipore) to separate from the unincorporated nucleotides and salts. The cDNA is ready for second round T7 in vitro transcription as above and then a subsequent third round aRNA amplification. Microarray Printing cDNA clones from whole white blood cells are printed on silylated slides (CEL Associates). cDNAs are PCR-amplified with 5' amino-linked primers and purified with Qiagen 96 PCR Purification Kits. The print spots are about 125 μm in diameter and are spaced 300 μm apart from center to center. Thirty plant genes are also printed on the slides as a control for non-specific hybridization.
Microarray Probe Synthesis Cy3 labeled cDNA probes are synthesized from aRNA of white blood cell
DRGs with Superscript Choice System for cDNA Synthesis (Gibco BRL). 5 μg aRNA, 3 μg random hexamer are mixed in a total volume of 26 μl (containing RNase free H O), heated to 70°C for 10 minutes and chilled on ice. Then,10 μl first strand buffer, 5 μl 0.1MDTT, 1.5 μl RNasin. 1 μl 25mMd(GAT)TP, 2 μl lmM dCTP, 2 μl Cy3-dCTP (Amersham) and 2.5 μl
Superscript RT II are added and incubated at room temperature for 10 minutes and then 37°C for 2 hours. To degrade the aRNA template, 6 μl 3N NaOH is added and incubated at 65°C for 30 minutes. Then, 20 μl 1M Tris-HCl pH 7.4, 12 μl IN HC1 and 12 μl H2O are added. The probes are purified with Microcon 30 Columns (Millipore) and then with Qiagen Nucleotide Removal
Columns. The probes are vacuum dried and resuspended in 20 μl of hybridization buffer (5X SSC, 0.2% SDS) containing mouse Cotl DNA (Gibco BRL).
Microarray Hybridization and Washes
Printed glass slides are treated with sodium borohydrate solution (0.066M NaBH4, 0.06M Na AC) to ensure amino-linkage of cDNAs to the slides. Then, the slides are boiled in water for 2 minutes to denature the cDNA. Cy3 labeled probes are heated to 99°C for 5minutes, room temperature for 5 minutes and applied to the slides. The slides are covered with glass cover slips, sealed with DPX (Fluka) and hybridized at 60°C for 4-6 hours. At the end of hybridization slides are cooled to room temperature. The slides are washed in IX SSC, 0.2% SDS at 55°C for 5 minutes, 0.1X SSC, 0.2% SDS at 55°C for 5 minutes. After a quick rinse in 0.1X SSC, 0.2% SDS, the slides are air-blown dried and ready for scanning.
Microarray Quantitation cDNA microarrays (i.e., microscope slides) are scanned for cy3 fluorescence using the ScanArray 3000 (General Scanning, Inc.). ImaGene Software (Biodiscovery, Inc.) is subsequently used for quantitation. The intensity of each spot (i.e., cDNA) is corrected by subtracting the immediate surrounding background. Next, the corrected intensities are normalized for each cDNA
(i.e., spot) with the following formula: intensity (background corrected) / 75- percentile value of the intensity of the entire chip x 1000. To determine "nonspecific" nucleic acid hybridization, 75-percentile values are calculated from the individual averages of each plant cDNA (for a total of 30 different cDNAs).
Statistical Analyses
To assess correlation of intensity value for each cDNA between individual sets patients within one therapeutic regimen or between different patient populations treated with different therapeutic regimens scatter plots are used and linear relationships are measured. The coefficient of determination, R2 indicates the variability of intensity values in one group vs. the other. To statistically determine whether or not intensity values measured from microarray quantitation are true signals, each intensity is compared, via a one- sample t-test, to the 75-percentile value of 30 plant cDNAs that are present on each chip (representing non-specific nucleic acid hybridization). To determine which cDNAs are statistically significant in their differential gene expression, the intensity for each cDNA from each patient set (patients within one therapeutic regimen, patient populations treated with different therapeutic regimens, and patient baseline) are grouped together respectively and intensity values are averaged for each corresponding cDNA. Two-sample t test for one- tailed hypotheses is used to detect a gene expression difference between the different patient populations after a therapeutic regimen.
Differential Protein Expression
Commercial enemy linked immunoassays (ELISA) (R&D Systems, Minneapolis, MN or BioSource International) are used to screen changes in the level of different proteins in the blood after the patient is treated with a therapeutic amount of EPO or EPO/Anti-Tumor Necrosis Factor Compound. Each assay is conducted according to the manufacture's instructions. Table 1 describes the assays that are conducted using serum drawn on each time point described above.
TABLE 1
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000043_0002
Differential Gene Expression
RNA is extracted from white blood cells of patients who received at least one doses of EPO or EPO+ETAN and is linearly amplified an estimated 106-fold via T7 RNA polymerase. Once amplified, one or more fluorescently labeled probes are synthesized from an individually amplified RNA (aRNA) and hybridized in triplicate to a microarray (a.k.a. chip) containing human cytokine cDNAs and other cDNA's such as plant cDNAs (for the determination of non-specific nucleic acid hybridization). Expression in white blood cells in response to EPO, EPO+ETAN, or baseline cells is thus monitored in triplicate, requiring a total of 15 microarrays. The binding of the labeled probe to a cytokine cDNA spot on the chip indicates the presence of mRNA encoding the cytokine. The amount of labeled probe bound to the cytokine cDNA spot on the chip indicates the amount of mRNA encoding the cytokine. In this manner a cytokine profile is established for each patient.
To determine whether a signal corresponding to a particular cDNA is reproducible between different chips, for each white blood cell set, the coefficient of variation is calculated (CV or standard deviation/mean X 100%). More importantly, independent amplifications (~106-fold) of different sets of the same white blood cell subtype from different patients yields quite similar expression patterns.
Conversely, a comparison between different patients receiving the same therapy with a low correlation, demonstrates that a subset of genes are not differentially expressed based on the therapy, but upon a nonspecific factor unrelated to the clinical application. Building Gene Expression Databases Containing EPO or EPO + Anti-TNF Response Specificity
Using immunochemical (protein) assays, aRNA and cDNA chips, one can successfully screen different cell types after the patient is treated with a therapeutic amount of EPO or EPO/ Anti-Tumor Necrosis Factor Compound and subsequently identify differential gene expression. These methods demonstrate that expression profiles generated via this integration of known technologies can be useful to produce databases that contain cell type specific gene expression in response to therapy with EPO or EPO/Anti-Tumor Necrosis Factor Compound therapy. Knowledge of genes, in particular cytokine genes, that are modulated in response to the therapeutic regimen will give much greater understanding of the effects of the drug on individual cell types. Genes that are modulated allow the EPO or EPO/Anti-Tumor Necrosis Factor Compound drug regimens to treat disease states that are associated with over or under expression of genes that are known to be modulated by the drug regimen.
Heterogeneity with respect to gene expression, which presumably reflects, at least in part, different sensory modalities transmitted can be cataloged and statistically analyzed for significance. To approach this more complicated heterogeneity, the coupling of immunochemistry, aRNA and DNA chip analysis can be done. In addition, chips containing a larger number of cDNAs (i.e., >10,000) can be completed to more fully identify differential gene expression including genes other than cytokine genes. Cataloging heterogeneity with respect to gene expression in response to a therapeutic regimen of EPO or EPO/anti-TNF will provide a greater understanding in the observed variability of response to EPO or EPO/ Anti-TNF and clinical effects observed during and after a therapeutic regimen of EPO or EPO/Anti-TNF.

Claims

WHAT IS CLAIMED IS:
1. A method comprising the steps: a) administering a therapeutic regimen of a cytokine to a patient, and
b) measuring changes in concentrations of other cytokines.
2. The method of claim 1 wherein the cytokine of step (a) is erythropoietin (EPO).
A method comprising the steps: a) administering a therapeutic regimen of at least one anti- cytokine agent to a patient, and
b) measuring changes in concentrations of other cytokines.
4. The method of claim 3 wherein the anti-cytokine agent is an anti-Tumor Necrosis Factor α compound.
5. The method of claim 4 wherein the anti-Tumor Necrosis Factor agent decreases circulating, active TNFα by a mechanism selected from the group consisting of decreasing TNFα mRNA transcription, increasing TNFα mRNA degradation, inhibiting TNFα mRNA translation, decreasing cellular secretion of TNFα protein, and reducing the quantity of TNFα protein in the blood.
6. The method of claim 4 wherein the anti-Tumor Necrosis Factor agent is selected from a group consisting of Thalidomide, Pentoxifyllin, Infliximab, Glucocorticoid steroids, and Etanercept.
7. A method comprising the steps: a) administering a therapeutic regimen of at least one anti- cytokine agent to a patient, and
b) administering a therapeutic regimen of a cytokine the patient, and
c) measuring changes in concentrations of other cytokines,
wherein steps (a) and (b) can be in either order, or concurrently.
8. The method of claim 7 wherein the anti-cytokine agent is an anti-Tumor Necrosis Factor α compound.
9. The method of claim 8 wherein the anti-Tumor Necrosis Factor agent decreases circulating, active TNFα by a mechanism selected from the group consisting of decreasing TNFα mRNA transcription, increasing TNFα mRNA degradation, inhibiting TNFα mRNA translation, decreasing cellular secretion of TNFα protein, and reducing the quantity of TNFα protein in the blood.
10. The method of claim 8 wherein the anti-Tumor Necrosis Factor agent is selected from a group consisting of Thalidomide, Pentoxifyllin, Infliximab, Glucocorticoid steroids, and Etanercept.
11. The method of claim 7 wherein the cytokine of step (b) is erythropoietin (EPO).
12. The method of claim 7 wherein the anti-cytokine agent of step (a) is an anti- tumor necrosis factor agent and the cytokine of step (b) is erythropoietin.
13. The method of claim 12 wherein the anti-Tumor Necrosis Factor agent decreases circulating, active TNFα by a mechanism selected from a group consisting of decreasing TNFα mRNA transcription, increasing TNFα mRNA degradation, inhibiting TNFα mRNA translation, decreasing cellular secretion of TNFα protein, and reducing the quantity of TNFα protein in the blood.
14. The method of claim 12 wherein the anti-Tumor Necrosis Factor agent is selected from a group consisting of Thalidomide, Pentoxifyllin, Infliximab, Glucocorticoids, and Etanercept.
15. The method of claim 12 wherein the anti-cytokine agent of step (a) is Etanercept and the cytokine of step (b) is erythropoietin.
16. A method for modulating a target cytokine concentration in a patient by administering a therapeutic amount of a different cytokine.
17. A method for modulating a target cytokine concentration in a patient by administering a therapeutic amount of an anti-cytokine agent for a different cytokine.
18. A method for modulating a target cytokine concentration in a patient by administering a therapeutic amount of an anti-cytokine agent and administering a therapeutic amount of different cytokine, and wherein the anti- cytokine agent and the different cytokine can be administered in any order or concurrently.
19. A method for modulating expression of TNFα by administering a therapeutic amount of EPO.
20. A method for modulating expression of TNFα by administering a therapeutic amount of EPO and a therapeutic amount of an anti-Tumor Necrosis Factor agent.
21. The method of claim 20 wherein the anti-Tumor Necrosis Factor agent decreases circulating, active TNFα by a mechanism selected from a group consisting of decreasing TNFα mRNA transcription, increasing TNFα mRNA degradation, inhibiting TNFα mRNA translation, decreasing cellular secretion of TNFα protein, and reducing the quantity of TNFα protein blood.
22. The method of claim 20 wherein the anti-Tumor Necrosis Factor agent is selected from a group consisting of Thalidomide, Pentoxifyllin, Infliximab, Glucocorticoids, and Etanercept.
23. The method of claim 20 wherein the anti-cytokine agent of step (a) is Etanercept and the cytokine of step (b) is erythropoietin.
PCT/US2001/024391 2001-08-02 2001-08-02 Cytokine modulation therapy Ceased WO2003013568A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/US2001/024391 WO2003013568A1 (en) 2001-08-02 2001-08-02 Cytokine modulation therapy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2001/024391 WO2003013568A1 (en) 2001-08-02 2001-08-02 Cytokine modulation therapy

Publications (1)

Publication Number Publication Date
WO2003013568A1 true WO2003013568A1 (en) 2003-02-20

Family

ID=21742750

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/024391 Ceased WO2003013568A1 (en) 2001-08-02 2001-08-02 Cytokine modulation therapy

Country Status (1)

Country Link
WO (1) WO2003013568A1 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011028835A1 (en) 2009-09-02 2011-03-10 Concert Pharmaceuticals, Inc. Substituted xanthine derivatives
WO2012031138A2 (en) 2010-09-01 2012-03-08 Concert Pharmaceuticals, Inc. Polymorphs of (s)-1-(4,4,6,6,6-pentadeutero-5-hydroxyhexyl)-3-7-dimethyl-1h-purine-2,6(3h,7h)dione
WO2013013052A1 (en) 2011-07-19 2013-01-24 Concert Pharmaceuticals, Inc. Substituted xanthine derivatives
WO2013155465A1 (en) 2012-04-13 2013-10-17 Concert Pharmaceuticals, Inc. Substituted xanthine derivatives
WO2013159006A1 (en) 2012-04-20 2013-10-24 Concert Pharmaceuticals, Inc. Polymorphs of (s)-1-(4,4,6,6,6-pentadeutero-5-hydroxyhexyl)-3,7-dimethyl-1h-purine-2,6(3h,7h)-dione
WO2015160913A1 (en) 2014-04-18 2015-10-22 Concert Pharmaceuticals, Inc. Methods of treating hyperglycemia
EP2963040A1 (en) 2009-09-02 2016-01-06 Concert Pharmaceuticals Inc. Substituted xanthine derivatives
EP3199203A1 (en) 2008-02-29 2017-08-02 Concert Pharmaceuticals Inc. Substitued xanthine derivatives

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6074643A (en) * 1993-09-09 2000-06-13 Cli Oncology, Inc. Site-directed chemotherapy of metastases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6074643A (en) * 1993-09-09 2000-06-13 Cli Oncology, Inc. Site-directed chemotherapy of metastases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
FALCONE ET AL.: "Clinical results of recombinant erythropoietin in transfusion-dependent patients with refractory multiple myeloma: role of cytokines and monitoring of erythropoiesis", EUROPEAN JOURNAL OF HAEMATOLOGY, vol. 58, 1997, pages 314 - 319, XP002952551 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3199203A1 (en) 2008-02-29 2017-08-02 Concert Pharmaceuticals Inc. Substitued xanthine derivatives
WO2011028835A1 (en) 2009-09-02 2011-03-10 Concert Pharmaceuticals, Inc. Substituted xanthine derivatives
EP2963040A1 (en) 2009-09-02 2016-01-06 Concert Pharmaceuticals Inc. Substituted xanthine derivatives
WO2012031138A2 (en) 2010-09-01 2012-03-08 Concert Pharmaceuticals, Inc. Polymorphs of (s)-1-(4,4,6,6,6-pentadeutero-5-hydroxyhexyl)-3-7-dimethyl-1h-purine-2,6(3h,7h)dione
WO2013013052A1 (en) 2011-07-19 2013-01-24 Concert Pharmaceuticals, Inc. Substituted xanthine derivatives
WO2013155465A1 (en) 2012-04-13 2013-10-17 Concert Pharmaceuticals, Inc. Substituted xanthine derivatives
WO2013159006A1 (en) 2012-04-20 2013-10-24 Concert Pharmaceuticals, Inc. Polymorphs of (s)-1-(4,4,6,6,6-pentadeutero-5-hydroxyhexyl)-3,7-dimethyl-1h-purine-2,6(3h,7h)-dione
WO2015160913A1 (en) 2014-04-18 2015-10-22 Concert Pharmaceuticals, Inc. Methods of treating hyperglycemia

Similar Documents

Publication Publication Date Title
Da Silva et al. Tumor cells are the site of erythropoietin synthesis in human renal cancers associated with polycythemia
RU2225221C2 (en) Pharmaceutical compositions of erythropoietin
MXPA06014421A (en) Method of administering and using vegf inhibitors for the treatment of human cancer.
Hellström et al. Treatment of myelodysplastic syndromes with recombinant human erythropoietin
EP3967755B1 (en) Soluble npp1 for use in a method for treating pseudoxanthoma elasticum
JP5737826B2 (en) Treatment of anemia by inhibition of VEGF
Morreale et al. Clinical and economic comparison of epoetin alfa and darbepoetin alfa
JPWO2006115274A1 (en) Bone marrow erythroid progenitor cell differentiation promoter
WO2003013568A1 (en) Cytokine modulation therapy
US7531649B2 (en) Aptamers to human epidermal growth factor receptor-3
KR20210094584A (en) GDF15 analogs and methods for use in reducing body weight and/or reducing food intake
AU2025202964A1 (en) Combination Therapy Method of Treating Myeloproliferative Neoplasms with a Diphtheria Toxin-Human Interleukin-3 Conjugate in Combination with Other Agents
US6362162B1 (en) CML Therapy
AU2002357019A1 (en) Erythropoietin dosing regimen for treating anemia
Agarwal et al. Erythropoietic agents and the elderly
CN121622884A (en) Tumor treatment composition containing mesenchymal stem cell preparation and immune checkpoint inhibitor, kit and application thereof
EP1423693A1 (en) Erythropoietin and anti-tumor necrosis factor alpha combination therapy
KR20190131068A (en) Treatment of Lupus Using Humanized Anti-CXCR5 Antibodies
RU2845151C1 (en) Methods of treatment using ilt7-binding proteins
RU2837724C2 (en) Method of combinatorial therapy in treatment of myeloproliferative neoplasms with human interleukin-3 diphtheria toxin conjugate in combination with other agents
EP3157546B1 (en) Gcsf for use in the treatment of neurogenic immune suppression and/or prevention of related medical complications
RU2003334C1 (en) Method for treatment of patients having tumors
EP1043024B1 (en) Chronic myeloid leukemia (cml) therapy
Wick et al. Disturbances of Iron Distribution Diagnosis and Therapy
HK1075418A (en) Chronic myeloid leukemia (cml) therapy

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ PL PT RO RU SE SG SI SK SL TJ TM TR TT TZ UA UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZW AM AZ BY KG KZ MD TJ TM AT BE CH CY DE DK ES FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP