WO2002101078A2 - Cellulases, nucleic acids encoding them and methods for making and using them - Google Patents

Cellulases, nucleic acids encoding them and methods for making and using them Download PDF

Info

Publication number
WO2002101078A2
WO2002101078A2 PCT/US2002/018782 US0218782W WO02101078A2 WO 2002101078 A2 WO2002101078 A2 WO 2002101078A2 US 0218782 W US0218782 W US 0218782W WO 02101078 A2 WO02101078 A2 WO 02101078A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
sequence
polypeptide
cellulase
seq
Prior art date
Application number
PCT/US2002/018782
Other languages
French (fr)
Other versions
WO2002101078A8 (en
WO2002101078A9 (en
Inventor
Jay M. Short
Eric J. Mathur
David E. Lam
Original Assignee
Diversa Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Diversa Corporation filed Critical Diversa Corporation
Publication of WO2002101078A2 publication Critical patent/WO2002101078A2/en
Publication of WO2002101078A9 publication Critical patent/WO2002101078A9/en
Publication of WO2002101078A8 publication Critical patent/WO2002101078A8/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • C12N15/1027Mutagenizing nucleic acids by DNA shuffling, e.g. RSR, STEP, RPR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2434Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G16B30/10Sequence alignment; Homology search
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • G16B30/20Sequence assembly
    • GPHYSICS
    • G16INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16BBIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00ICT specially adapted for sequence analysis involving nucleotides or amino acids

Definitions

  • This invention relates generally to hydrolases, e.g., cellulase enzymes, polynucleotides encoding these enzymes, the use of such polynucleotides and polypeptides and methods of making and using them.
  • the invention provides enzymes having carboxymethyl cellulase activity.
  • BACKGROUND [0002 ] Cellulose, a fibrous, tough, water-insoluble substance is found in the cell walls of plants, particularly, in stalks, stems, trunks and all the woody portions of plant tissues. Cellulose constitutes much of the mass of wood, and cotton is almost pure cellulose. Because cellulose is a linear, unbranched homopolysaccharide of 10,000 to 15,000 D-glucose units, it resembles amylose and the main chains of glycogen. But there is a very important difference; in cellulose, the glucose residues have the beta configuration, whereas in amylose, amylopectin and glycogen the glucose is in the alpha configuration. The glucose residues in cellulose are linked by (beta 1, 4)glycosidic bonds. This difference gives cellulose and amylose very different 3-dimensional structures and physical properties.
  • thermophilic organotrophic eubacteria presently known have been isolated and characterized. These bacteria, which belong to the genus Thermotoga, are fermentative microorganisms metabolizing a variety of carbohydrates (Huber, R. and Stetter, K.O., in Ballows, et al.,
  • T. maritima is a eubacterium that is strictly anaerobic, rod-shaped, fermentative, hyperthermophilic, and grows between 55°C. and
  • T. maritima cells have a sheath-like structure and monotrichous flagellation.
  • T. maritima is classified in the eubacterium kingdom by virtue of having murein and fatty acid-containing lipids, diphtheria-toxin-resistant elongation factor 2, an RNA polymerase subunit pattern, and sensitivity to antibiotics.
  • Enzymes are highly selective catalysts. Their hallmark is the ability to catalyze reactions with extraordinarily stereo-, regio-, and chemo- selectivities that are unparalleled in conventional synthetic chemistry. Moreover, enzymes are remarkably versatile. They can be tailored to function in organic solvents, operate at extreme pH's and temperatures, and catalyze reactions with compounds that are structurally unrelated to their natural, physiological substrates.
  • Enzymes are reactive toward a wide range of natural and unnatural substrates, thus enabling the modification of virtually any organic lead compound.
  • enzymes are highly enantio- and regio- selective.
  • the high degree of functional group specificity exhibited by enzymes enables one to keep track of each reaction in a synthetic sequence leading to a new active compound.
  • Enzymes are also capable of catalyzing many diverse reactions unrelated to their physiological function in nature. For example, peroxidases catalyze the oxidation of phenols by hydrogen peroxide. Peroxidases can also catalyze hydroxylation reactions that are not related to the native function of the enzyme.
  • Other examples are proteases that catalyze the breakdown of polypeptides. In organic solution some proteases can also acylate sugars, a function unrelated to the native function of these enzymes.
  • Each biocatalyst is specific for one functional group, or several related functional groups, and can react with many starting compounds containing this functional group.
  • the biocatalytic reactions produce a population of derivatives from a single starting compound. These derivatives can be subjected to another round of biocatalytic reactions to produce a second population of derivative compounds. Thousands of variations of the original compound can be produced with each iteration of biocatalytic derivatization.
  • Enzymes react at specific sites of a starting compound without affecting the rest of the molecule, a process which is very difficult to achieve using traditional chemical methods.
  • This high degree of biocatalytic specificity provides the means to identify a single active compound within the library.
  • the library is characterized by the series of biocatalytic reactions used to produce it, a so-called "biosynthetie history". Screening the library for biological activities and tracing the biosynthetie history identifies the specific reaction sequence producing the active compound. The reaction sequence is repeated and the structure of the synthesized compound determined.
  • This mode of identification unlike other synthesis and screening approaches, does not require immobilization technologies, and compounds can be synthesized and tested free in solution using virtually any type of screening assay. It is important to note, that the high degree of specificity of enzyme reactions on functional groups allows for the "tracking" of specific enzymatic reactions that make up the biocatalytically produced library.
  • the invention provides isolated or recombinant nucleic acids comprising a nucleic acid sequence at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the nucleic acids encode at least one polypeptide having a cellulase activity and the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual inspection.
  • the nucleic acid comprises a sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 200 residues.
  • the nucleic acid can comprise a nucleic acid sequence having at least 50% sequence identity to
  • the nucleic acid can also comprise the nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 400 residues.
  • the nucleic acid can comprise the nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 500 residues.
  • the nucleic acid can have at least 50% sequence identity to SEQ ID NO:l
  • ID NO:l over a region of at least about 900 residues, or the full length of the coding sequence.
  • the nucleic acid can comprise a nucleic acid sequence having at least 60% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, having at least 70%) sequence identity to SEQ ED NO:l over a region of at least about 100 residues, having at least 80% sequence identity to SEQ ID NO: 1 over a region of at least about 100 residues, having at least 85% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, having at least 90% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, having at least 95%, or greater, sequence identity to SEQ ED
  • the isolated or recombinant nucleic acid encodes a polypeptide having a sequence as set forth in SEQ ID NO:2.
  • the sequence comparison algorithm is a BLAST version 2.2.2 algorithm.
  • the filtering setting is set to blastall -p blastp -d "nr pataa" -F F, and all other options are set to default.
  • the cellulase activity comprises a carboxymethyl cellulase activity.
  • the cellulase activity comprises hydro lyzing a glycosidic linkage.
  • the glycosidic linkage can comprise a (beta 1, 4)glycosidic bond.
  • the cellulase activity comprises hydrolysis of a cellulose.
  • the cellulase activity can comprise hydrolysis of a cellulose to a glucopyranose.
  • the isolated or recombinant nucleic acid encodes a polypeptide having cellulase activity that is thermostable. The polypeptide retains a cellulase activity under conditions comprising a temperature range of between about 37°C to about 70°C.
  • the isolated or recombinant nucleic acid encodes a polypeptide having cellulase activity, which is thermotolerant.
  • the polypeptide retains a cellulase activity after exposure to a temperature comprising a range from greater than 37°C to about 90°C.
  • the polypeptide retains a cellulase activity after exposure to a temperature comprising a range from greater than 37°C to about 50°C.
  • the isolated or recombinant nucleic acid comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the nucleic acid can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90,100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 residues in length or the full length of the gene or transcript, with or without a signal sequence, as describe herein.
  • the stringent conditions can include a wash step comprising a wash in 0.2X SSC at a temperature of about 65oC for about 15 minutes.
  • the invention provides a nucleic acid probe for identifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the probe comprises at least 10, 20, 30, 40, 50, 60, 70, 80, 90,100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 consecutive bases of a sequence selected from a group consisting of a sequence as set forth in SEQ ED NO:l, wherein the probe identifies the nucleic acid by binding or hybridization.
  • the probe can comprise an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a sequence as set forth in SEQ ID NO:l.
  • the invention provides a nucleic acid probe for identifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the probe comprises a nucleic acid sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection.
  • the nucleic acid probe can comprise an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a nucleic acid sequence as set forth in SEQ ED NO:l.
  • the nucleic acid probe can comprise a nucleic acid sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to a region of at least about 100 residues of a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
  • the invention provides an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the primer pair is capable of amplifying a nucleic acid sequence as set forth in SEQ ID NO: l,or a subsequence thereof .
  • One or each member of the amplification primer sequence pair can comprise an oligonucleotide comprising at least about 10 to 50 consecutive bases of the sequence, or about 8 to 60 consecutive bases of sequence.
  • the invention provides a method of amplifying a nucleic acid encoding a polypeptide with a cellulase activity comprising amplification of a template nucleic acid with an amplification primer sequence pair capable of amplifying a nucleic acid sequence as set forth in SEQ ID NO:l, or subsequence thereof.
  • the invention provides expression cassettes comprising a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ D NO:l, or a subsequence thereof.
  • a nucleic acid of the invention e.g., a nucleic acid comprising a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ D NO:l, or a subsequence thereof.
  • the invention provides vectors comprising a nucleic acid of the invention, for example, a nucleic acid comprising a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
  • a nucleic acid of the invention for example, a nucleic acid comprising a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
  • the invention provides cloning vehicles comprising a nucleic acid of the invention or a vector of the invention.
  • the cloning vehicle can comprise a viral vector, a plasmid, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage or an artificial chromosome.
  • the viral vector can comprise an adenovirus vector, a retroviral vectors or an adeno-associated viral vector.
  • the cloning vehicle can comprise a bacterial artificial chromosome (BAC), a plasmid, a bacteriophage PI -derived vector (PAC), a yeast artificial chromosome (YAC), a mammalian artificial chromosome (MAC).
  • BAC bacterial artificial chromosome
  • PAC bacteriophage PI -derived vector
  • YAC yeast artificial chromosome
  • MAC mammalian artificial chromosome
  • the invention provides transformed cells comprising a nucleic acid of the invention or a vector of the invention or a cloning vehicle of the invention.
  • the vector can comprise a nucleic acid of the invention, e.g., a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
  • the invention provides transformed cells comprising a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
  • the transformed cell is a bacterial cell, a mammalian cell, a fungal cell, a yeast cell, an insect cell or a plant cell.
  • the invention provides transgenic non-human animals comprising a nucleic acid of the invention or a vector of the invention. They can comprise a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
  • the transgenic non-human animal is a mouse.
  • the invention provides transgenic plants comprising a nucleic acid of the invention or a vector of the invention. They can comprise a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
  • the transgenic non-human plant can be a corn plant, a potato plant, a tomato plant, a wheat plant, an oilseed plant, a rapeseed plant, a soybean plant or a tobacco plant.
  • the invention provides transgenic seeds comprising a nucleic acid of the invention or a vector of the invention. They can comprise a nucleic acid sequence having at least 98% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
  • the transgenic seed can be a corn seed, a wheat kernel, an oilseed, a rapeseed, a soybean seed, a palm kernel, a sunflower seed, a sesame seed, a peanut or a tobacco plant seed.
  • the invention provides an antisense oligonucleotide comprising a nucleic acid of the invention; e.g., a sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence having at least 50% sequence identity to
  • the antisense oligonucleotide can be between about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 bases, about 70 to 110, or about 80 to 120 bases in length.
  • the invention provides methods of inhibiting the translation of a cellulase message in a cell comprising administering to the cell or expressing in the cell an antisense oligonucleotide of the invention, e.g., a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
  • an antisense oligonucleotide of the invention e.g., a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence
  • the invention provides an isolated or recombinant polypeptide comprising an amino acid sequence having at least 50% sequence identity to SEQ ED NO:2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO:l.
  • the polypeptide can have a cellulase activity.
  • the isolated or recombinant polypeptide has a carboxymethyl cellulase activity that, e.g., comprises hydrolysis of a glycosidic linkage.
  • the glycosidic linkage can be a (beta 1, 4)glycosidic bond.
  • the cellulase activity comprises hydrolysis of a starch.
  • the cellulase activity comprises hydrolysis of a starch to glucopyranose.
  • the isolated or recombinant polypeptide can comprise a cellulase activity that is thermostable.
  • the polypeptide can retain a cellulase activity under conditions comprising a temperature range of between about 37°C to about 70°C.
  • the isolated or recombinant polypeptide can comprise the cellulase activity that is thermotolerant.
  • the polypeptide can retain a cellulase activity after exposure to a temperature in the range from greater than
  • the polypeptide can retain a cellulase activity after exposure to a temperature in the range from greater than 37°C to about 50°C.
  • polypeptide sequence is encoded by an amino acid sequence having at least 50% sequence identity to SEQ ID NO:2 over a region of at least about 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 residues.
  • polypeptide is encoded by amino acid sequence having at least
  • the isolated or recombinant polypeptide can have an amino acid sequence as set forth in SEQ ED NO:2.
  • the invention provides isolated or recombinant polypeptides, wherein the polypeptide has a cellulase activity and lacks a signal sequence and comprises an amino acid sequence having at least 50% sequence identity to SEQ ID NO:2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO:l.
  • the isolated or recombinant polypeptide can comprise a cellulase activity that comprises a thermostability when heated to a temperature in the range from about 37°C to about 50°C, about 50°C to about 70°C or about 70°C to about 90°C.
  • the thermostable cellulase activity can comprise a specific activity at about 37°C in the range from about 100 to about 1000 units per milligram of protein.
  • the thermostable cellulase activity can comprise a specific activity from about 500 to about 750 units per milligram of protein.
  • thermostable cellulase activity can also comprise a specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein or in the range from about 750 to about 1000 units per milligram of protein.
  • the isolated or recombinant polypeptide can comprise a cellulase activity that comprises thermotolerance after being heated to an elevated temperature in the range from about 37°C to about 90°C or in the range from about 37°C to about 70°C.
  • the thermotolerance comprises retention of at least half of the specific activity of the cellulase at 37°C after being heated to the elevated temperature.
  • the thermotolerance comprises retention of specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein after being heated to the elevated temperature.
  • the invention provides an isolated or recombinant polypeptide comprising an amino acid sequence having at least 50% sequence identity to SEQ ID NO: 2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ID NO.l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO: 1.
  • the polypeptide can comprise at least one glycosylation site. En one aspect, glycosylation is an amino acid sequence having at least 50% sequence identity to SEQ ID NO: 2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ID NO.l over a region of at least about 100 residues, wherein
  • the isolated or recombinant polypeptide can be glycosylated after being expressed in a P. pastoris or a S. pombe.
  • the isolated or recombinant polypeptide can retain a cellulase activity under conditions comprising about pH 4.5, 5, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0.
  • the invention provides protein preparations comprising a polypeptide of the invention, where the protein preparation comprises a liquid, a solid or a gel.
  • the invention provides heterodimers comprising a polypeptide of the invention and a second domain.
  • the second domain can be a polypeptide and the heterodimer can be a fusion protein.
  • the second domain is an epitope and a tag.
  • the invention provides immobilized polypeptides having a cellulase activity, wherein the polypeptide is a polypeptide of the invention, or is a polypeptide encoded by a nucleic acid of the invention, or a polypeptide comprising the polypeptide of the invention and a second domain.
  • the polypeptide can be immobilized on, e.g., a cell, a metal, a resin, a polymer, a ceramic, a glass, a microelectrode, a graphitic particle, a bead, a gel, a plate, an array or a capillary tube.
  • the invention provides arrays comprising an immobilized polypeptide, wherein the polypeptide is a polypeptide of the invention, or is a polypeptide encoded by a nucleic acid of the invention, or a polypeptide comprising the polypeptide of the invention and a second domain.
  • the invention provides arrays comprising the nucleic acid of the invention or an isolated or recombinant nucleic acid, wherein the nucleic acid comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO: 1 , wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the invention provides an array comprising an immobilized antibody of the invention.
  • the invention provides isolated or recombinant antibodies that specifically bind to a polypeptide of the invention or to a polypeptide encoded by the nucleic acid of the invention or an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the antibody can be a monoclonal or a polyclonal antibody.
  • the invention provides hybridomas comprising an antibody of the invention.
  • the invention provides food supplements for an animal comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • They can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the polypeptide can be glycosylated.
  • the invention provides edible enzyme delivery matrices comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. They can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the edible enzyme delivery matrix comprises a pellet.
  • the edible enzyme delivery matrix comprises the polypeptide that can be glycosylated.
  • the edible enzyme delivery matrix comprises the polypeptide, wherein the cellulase activity is thermotolerant or thermostable.
  • the invention provides cellulose compositions comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the invention provides detergent compositions comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the detergent composition comprises cellulase that can be a nonsurface-active cellulase.
  • cellulase can be a surface-active cellulase.
  • the invention provides cellulose-containing fabrics comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
  • the invention provides methods of isolating or identifying a polypeptide with cellulase activity comprising the steps of: (a) providing an antibody of the invention;
  • step (b) providing a sample comprising polypeptides; and (c) contacting the sample of step (b) with the antibody of step (a) under conditions wherein the antibody can specifically bind to the polypeptide, thereby isolating or identifying a cellulase.
  • the invention provides methods of making an anti-cellulase antibody comprising administering to a non-human animal a nucleic acid of the invention, or an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or a polypeptide of the invention, in an amount sufficient to generate a humoral immune response, thereby making an anti-cellulase antibody.
  • the invention provides methods of producing a recombinant polypeptide comprising the steps of: (a) providing a nucleic acid of the invention , e.g., a nucleic acid comprising a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, operably linked to a promoter; and (b) expressing the nucleic acid of step
  • the method can further comprise transforming a host cell with the nucleic acid of step (a) followed by expressing the nucleic acid of step (a), thereby producing a recombinant polypeptide in a transformed cell.
  • the invention provides methods for identifying a polypeptide having a cellulase activity comprising the following steps: (a) providing a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity, (b) providing a cellulase substrate; and (c) contacting the polypeptide or a fragment or variant thereof of step (a) with the substrate of step (b) and detecting an decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product detects a polypeptide having a cellulase activity.
  • the method can further comprise a substrate comprising a cellulose.
  • the invention provides methods for identifying a cellulase substrate comprising the following steps: (a) providing a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED
  • nucleic acid encodes a polypeptide having a cellulase activity
  • step (b) providing a test substrate
  • step (c) contacting the polypeptide of step (a) with the test substrate of step (b) and detecting a decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product identifies the test substrate as a cellulase substrate.
  • the invention provides methods of determining whether a compound specifically binds to a polypeptide comprising the following steps: (a) expressing a nucleic acid or a vector comprising the nucleic acid under conditions permissive for translation of the nucleic acid to a polypeptide, wherein the nucleic acid is a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; (b) contacting the polypeptide with the test compound; and (c) determining whether the test compound specifically binds to the polypeptide, thereby determining that the compound specifically binds to the polypeptide.
  • the invention provides methods for identifying a modulator of a cellulase activity comprising the following steps: (a) providing a cellulase polypeptide of the invention or a cellulase polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention.
  • the nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a test compound; (c) contacting the polypeptide of step (a) with the test compound of step (b) and measuring an activity of the cellulase, wherein a change in the cellulase activity measured in the presence of the test compound compared to the activity in the absence of the test compound provides a determination that the test compound modulates the cellulase activity.
  • the cellulase activity is measured by providing a cellulase substrate and detecting a decrease in the amount of the substrate or an increase in the amount of a reaction product, or, an increase in the amount of the substrate or a decrease in the amount of a reaction product.
  • the decrease in the amount of the substrate or the increase in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an activator of cellulase activity.
  • the increase in the amount of the substrate or the decrease in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an inhibitor of cellulase activity.
  • the invention provides computer systems comprising a processor and a data storage device wherein said data storage device has stored thereon a polypeptide sequence or a nucleic acid sequence of the invention or subsequence thereof.
  • the computer system can further comprise a sequence comparison algorithm and a data storage device having at least one reference sequence stored thereon.
  • the sequence comparison algorithm can comprise a computer program that indicates polymorphisms.
  • the computer system can further comprise an identifier that identifies one or more features in said sequence.
  • the invention provides computer readable mediums having stored thereon a polypeptide sequence or a nucleic acid sequence of the invention, or subsequence thereof.
  • the nucleic acid can encode a cellulase polypeptide encoded by a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; or subsequence thereof.
  • the invention provides methods for identifying a feature in a sequence comprising the steps of: (a) reading the sequence using a computer program which identifies one or more features in a sequence, wherein the sequence comprises a polypeptide sequence or a nucleic acid sequence of the invention; and (b) identifying one or more features in the sequence with the computer program.
  • the invention provides methods for comparing a first sequence to a second sequence comprising the steps of: (a) reading the first sequence and the second sequence through use of a computer program which compares sequences, wherein the first sequence comprises a polypeptide sequence or a nucleic acid sequence of the invention; and (b) determining differences between the first sequence and the second sequence with the computer program.
  • the step of determining differences between the first sequence and the second sequence further comprises the step of identifying polymorphisms.
  • the method further comprises an identifier that identifies one or more features in a sequence.
  • the method further comprises reading the first sequence using a computer program and identifying one or more features in the sequence.
  • the invention provides methods for isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample comprising the steps of: (a) providing an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the primer pair is capable of amplifying SEQ ID NO:l, or a subsequence thereof, or another nucleic acid of the invention; (b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to the amplification primer pair; and, (c) combining the nucleic acid of step (b) with the amplification primer pair of step (a) and amplifying nucleic acid from the environmental sample, thereby isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample.
  • each member of the primer pair for ampl
  • the invention provides methods for isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample comprising the steps of: (a) providing a polynucleotide probe comprising a nucleic acid of the invention, or a subsequence thereof; (b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to a polynucleotide probe of step (a); (c) combining the isolated nucleic acid or the treated environmental sample of step (b) with the polynucleotide probe of step (a); and (d) isolating a nucleic acid that specifically hybridizes with the polynucleotide probe of step (a), thereby isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from a soil sample.
  • the environmental sample comprises a water sample, a liquid sample, a soil sample, an air sample or a biological sample.
  • the biological sample is derived from a bacterial cell, a protozoan cell, an insect cell, a yeast cell, a plant cell, a fungal cell or a mammalian cell.
  • the invention provides methods of generating a variant of a nucleic acid encoding a cellulase comprising the steps of: (a) providing a template nucleic acid comprising a nucleic acid of the invention, e.g., an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) modifying, deleting or adding one or more nucleotides in the template sequence, or a combination thereof, to generate a variant of the template nucleic acid.
  • a template nucleic acid comprising a nucleic acid of the invention, e.g., an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nu
  • the method further comprises expressing the variant nucleic acid to generate a variant cellulase polypeptide.
  • the modifications, additions or deletions are introduced by a method selected from the group consisting of error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR) and a combination thereof.
  • the modifications, additions or deletions are introduced by a method selected from the group consisting of recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation, error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, synthetic ligation reassembly (SLR), gene reassembly
  • the method can be iteratively repeated until a cellulase having an altered or different activity or an altered or different stability from that of a cellulase encoded by the template nucleic acid is produced.
  • the variant cellulase polypeptide is thermotolerant, wherein the cellulase retains some activity after being exposed to an elevated temperature.
  • the variant cellulase polypeptide has increased glycosylation as compared to the cellulase encoded by a template nucleic acid.
  • the variant cellulase polypeptide has a cellulase activity under a high temperature, wherein the cellulase encoded by the template nucleic acid is not active under the high temperature.
  • the method is iteratively repeated until a cellulase coding sequence having an altered codon usage from that of the template nucleic acid is produced.
  • the method can be iteratively repeated until a cellulase gene having higher or lower level of message expression or stability from that of the template nucleic acid is produced.
  • the invention provides methods for modifying codons in a nucleic acid encoding a cellulase to increase its expression in a host cell, the method comprising (a) providing a template nucleic acid comprising a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) identifying a non-preferred or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a
  • the invention provides methods for modifying codons in a nucleic acid encoding a cellulase, the method comprising (a) providing a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) identifying a codon in the nucleic acid of step (a) and replacing it with a different codon encoding the same amino acid as the replaced codon, thereby modifying codons in a nucleic acid encoding a cellulase.
  • a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid
  • the invention provides methods for modifying codons in a nucleic acid encoding a cellulase to increase its expression in a host cell, the method comprising (a) providing a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) identifying a non-prefe ⁇ ed or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over- represented in coding sequences in genes in the host cell and a non-preferred
  • the invention provides methods for modifying a codon in a nucleic acid encoding a cellulase to decrease its expression in a host cell, the method comprising (a) providing a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity; and (b) identifying at least one preferred codon in the nucleic acid of step (a) and replacing it with a non-preferred or less preferred codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in a host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying
  • the invention provides methods for producing a library of nucleic acids encoding a plurality of modified cellulase active sites or substrate binding sites, wherein the modified active sites or substrate binding sites are derived from a first nucleic acid comprising a sequence encoding a first active site or a first substrate binding site the method comprising: (a) providing a first nucleic acid encoding a first active site or first substrate binding site, wherein the first nucleic acid sequence comprises a sequence of the invention, e.g., a nucleic acid that hybridizes under stringent conditions to a sequence as set forth in SEQ ED NO:l, and the nucleic acid encodes a cellulase active site or a cellulase substrate binding site; (b) providing a set of mutagenic oligonucleotides that encode naturally-occurring amino acid variants at a plurality of targeted codons in the first nucleic acid; and, (c) using the set of mutagenic
  • the method comprises mutagenizing the first nucleic acid of step (a) by a method comprising an optimized directed evolution system.
  • the method can further comprise mutagenizing the first nucleic acid of step (a) by a method comprising gene site-saturation mutagenesis (GSSM), a synthetic ligation reassembly (SLR), error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR) and a combination thereof.
  • GSSM gene site-saturation mutagenesis
  • SLR synthetic ligation reassembly
  • the method can further comprise mutagenizing the first nucleic acid of step (a) or variants by a method comprising recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair- deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation and a combination thereof.
  • the invention provides methods for making a small molecule comprising the steps of: (a) providing a plurality of biosynthetie enzymes capable of synthesizing or modifying a small molecule, wherein one of the enzymes comprises a cellulase enzyme encoded by a nucleic acid of the invention , e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a substrate for at least one of the enzymes of step (a); and (c) reacting the substrate of step (b) with the enzymes under conditions that facilitate a plurality of biocatalytic reactions to generate a small molecule by a series of biocatalytic reactions.
  • a nucleic acid of the invention e.g., a nucleic acid which comprises a sequence that hybridizes under stringent
  • the invention provides methods for modifying a small molecule comprising the steps: (a) providing a cellulase enzyme encoded by a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence of a nucleic acid of the invention or an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a small molecule; and (c) reacting the enzyme of step (a) with the small molecule of step (b) under conditions that facilitate an enzymatic reaction catalyzed by the cellulase enzyme, thereby modifying a small molecule by a cellulase enzymatic reaction.
  • a cellulase enzyme encoded by a nucleic acid of the invention e.g., a nucleic acid compris
  • the method comprises a plurality of small molecule substrates for the enzyme of step (a), thereby generating a library of modified small molecules produced by at least one enzymatic reaction catalyzed by the cellulase enzyme.
  • the method further comprises a plurality of additional enzymes under conditions that facilitate a plurality of biocatalytic reactions by the enzymes to form a library of modified small molecules produced by the plurality of enzymatic reactions.
  • the method further comprises the step of testing the library to determine if a particular modified small molecule that exhibits a desired activity is present within the library.
  • the step of testing the library can further comprise the steps of systematically eliminating all but one of the biocatalytic reactions used to produce a portion of the plurality of the modified small molecules within the library by testing the portion of the modified small molecule for the presence or absence of the particular modified small molecule with a desired activity, and identifying at least one specific biocatalytic reaction that produces the particular modified small molecule of desired activity.
  • the invention provides methods for determining a functional fragment of a cellulase enzyme comprising the steps of: (a) providing a cellulase enzyme, wherein the enzyme comprises an amino acid sequence of a polypeptide of the invention, or an isolated or recombinant nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; and (b) deleting a plurality of amino acid residues from the sequence of step (a) and testing the remaining subsequence for a cellulase activity, thereby determining a functional fragment of a cellulase enzyme.
  • the cellulase activity is measured by providing a cellulase substrate and detecting a decrease in the amount of the substrate or an increase in the amount of a reaction product.
  • a decrease in the amount of an enzyme substrate or an increase in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an activator of cellulase activity.
  • the invention provides the method for whole cell engineering of new or modified phenotypes by using real-time metabolic flux analysis, the method comprising the following steps: (a) making a modified cell by modifying the genetic composition of a cell, wherein the genetic composition is modified by addition to the cell of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) culturing the modified cell to generate a plurality of modified cells; (c) measuring at least one metabolic parameter of the cell by monitoring the cell culture of step (b) in real time; and,(d) analyzing the data of step
  • the genetic composition of the cell is modified by a method comprising deletion of a sequence or modification of a sequence in the cell, or, knocking out the expression of a gene.
  • the method further comprises selecting a cell comprising a newly engineered phenotype. En one aspect, the method further comprises culturing the selected cell, thereby generating a new cell strain comprising a newly engineered phenotype.
  • the invention provides methods for hydrolyzing a cellulose comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or, a polypeptide encoded by a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED
  • nucleic acid encodes a polypeptide having a cellulase activity
  • providing a composition comprising a cellulose and (c) contacting the polypeptide of step
  • the composition comprises a cellulose-containing pulp or a paper product.
  • the invention provides methods for hydrolyzing a glycosidic linkage comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or, a polypeptide encoded by a nucleic acid having a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a composition comprising a glycosidic linkage; and (c) contacting the polypeptide of step (a) with the composition of step (b) under conditions wherein the polypeptide hydrolyzes the glycosidic linkage.
  • the glycosidic linkage can be a (beta 1, 4)glycosidic bond.
  • the invention provides methods of increasing thermotolerance or thermostability of a cellulase polypeptide, the method comprising glycosylating a cellulase polypeptide of the invention, e.g., wherein the cellulase comprises at least thirty contiguous amino acids of a sequence of a polypeptide of the invention, or a polypeptide encoded by a of the invention; or a polypeptide having a sequence as set forth in SEQ ID NO: 2, thereby increasing the thermotolerance or thermostability of the cellulase polypeptide.
  • the method further comprises the cellulase specific activity is thermostable or thermotolerant at a temperature in the range from greater than about 37°C to about 90°C.
  • the invention provides methods for overexpressing a recombinant cellulase in a cell comprising expressing a vector comprising a nucleic acid of the invention, e.g., a nucleic acid having at least 50% to about 98% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof, wherein overexpression is effected by use of a high activity promoter, a dicistronic vector or by gene amplification of the vector.
  • a vector comprising a nucleic acid of the invention, e.g., a nucleic acid having at least 50% to about 98% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis
  • the invention provides methods for treating a cellulose-containing fabric comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid of the invention,; (b) providing a fabric comprising a cellulase; and (c) contacting the polypeptide of step (a) and the composition of step (b) under conditions wherein the cellulase can treat the cellulose-containing fabric .
  • the invention provides methods for treating a printed paper comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid of the invention; (b) providing a pulp slurry, wherein the pulp slurry is made from pulping the printed paper; and (c) contacting the polypeptide of step (a) and the pulp slurry of step (b) under conditions wherein the cellulase can treat the printed paper.
  • the invention provides method for treating solid or liquid waste products comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid of the invention; (b) providing a solid or a liquid waste; and (c) contacting the polypeptide of step (a) and the solid or liquid waste of step (b) under conditions wherein the cellulase can treat the waste.
  • polynucleotide sequences and polypeptides of the present invention comprise hydrolase activity, e.g., they include endoglucanases having carboxymethyl cellulose activity.
  • the present invention exploits the unique catalytic properties of enzymes.
  • biocatalysts i.e., purified or crude enzymes, non-living or living cells
  • the present invention uses selected biocatalysts and reaction conditions that are specific for functional groups that are present in many starting compounds.
  • the invention provides an isolated nucleic acid having a sequence as set forth in SEQ ED NO:l and variants thereof having at least 50% sequence identity to SEQ ID NO:l and encoding polypeptides having cellulase activity.
  • One aspect of the invention is an isolated nucleic acid having a sequence as set forth in SEQ ED NO:l, sequences substantially identical thereto, and sequences complementary thereto.
  • Another aspect of the invention is an isolated nucleic acid including at least
  • the invention provides an isolated nucleic acid encoding a polypeptide having a sequence as set forth in SEQ ED NO:2 and variants thereof encoding a polypeptide having cellulase activity and having at least 50% sequence identity to such sequence.
  • Another aspect of the invention is an isolated nucleic acid encoding a polypeptide or a functional fragment thereof having a sequence as set forth in SEQ ID NO: 2, and sequences substantially identical thereto.
  • Another aspect of the invention is an isolated nucleic acid encoding a polypeptide having at least 10 consecutive amino acids of a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • the invention provides a purified polypeptide having a sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is an isolated or purified antibody that specifically binds to a polypeptide having a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is an isolated or purified antibody or binding fragment thereof, which specifically binds to a polypeptide having at least 10 consecutive amino acids of SEQ ID NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is a method of making a polypeptide having a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto. The method includes introducing a nucleic acid encoding the polypeptide into a host cell, wherein the nucleic acid is operably linked to a promoter, and culturing the host cell under conditions that allow expression of the nucleic acid.
  • Another aspect of the invention is a method of making a polypeptide having at least 10 amino acids of a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • the method includes introducing a nucleic acid encoding the polypeptide into a host cell, wherein the nucleic acid is operably linked to a promoter, and culturing the host cell under conditions that allow expression of the nucleic acid, thereby producing the polypeptide.
  • Another aspect of the invention is a method of generating a variant including obtaining a nucleic acid having a sequence as set forth in SEQ ID NO:l, sequences substantially identical thereto, sequences complementary to SEQ ID NO:l, fragments comprising at least 30 consecutive nucleotides of SEQ ED NO:l, and changing one or more nucleotides in the sequence to another nucleotide, deleting one or more nucleotides in the sequence, or adding one or more nucleotides to the sequence.
  • Another aspect of the invention is a computer readable medium having stored thereon a sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is a computer system including a processor and a data storage device wherein the data storage device has stored thereon a sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide having a sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is a method for comparing a first sequence to a reference sequence wherein the first sequence is a nucleic acid having a sequence as set forth SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide code of SEQ ED NO:2, and sequences substantially identical thereto. The method includes reading the first sequence and the reference sequence through use of a computer program that compares sequences; and determining differences between the first sequence and the reference sequence with the computer program.
  • Another aspect of the invention is a method for identifying a feature in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide having a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, including reading the sequence through the use of a computer program which identifies features in sequences; and identifying features in the sequence with the computer program.
  • Another aspect of the invention is an assay for identifying fragments or variants of SEQ ED NO:2, and sequences substantially identical thereto, which retain the enzymatic function of SEQ ED NO:2, and sequences substantially identical thereto.
  • the assay includes contacting SEQ ED NO:2, sequences substantially identical thereto, or polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate thereby identifying a fragment or variant of such sequences.
  • Another aspect of the invention is a method for modifying small molecules, including contacting a polypeptide encoded by a polynucleotide described herein or enzymatically active fragments thereof with a small molecule to produce a modified small molecule.
  • Figure 1 is a block diagram of an exemplary computer system of the invention.
  • Figure 2 is a flow diagram illustrating one aspect of a process of the invention for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
  • Figure 3 is a flow diagram illustrating one aspect of a process of the invention in a computer for determining whether two sequences are homologous.
  • Figure 4 is a flow diagram illustrating one aspect of an identifier process of the invention 300 for detecting the presence of a feature in a sequence.
  • Figure 5 A-C shows an illustration of the full-length DNA and co ⁇ esponding deduced amino acid sequence of an exemplary enzyme of the present invention.
  • the invention provides cellulases, nucleic acids encoding polypeptides comprising cellulase activity and methods of making and using them.
  • the present invention provides a carboxymethyl cellulase and the polynucleotide encoding it.
  • cellulase includes, but is not limited to, enzymes having any cellulase activity, e.g., catalyzing the hydrolysis of the beta 1,4 glycosidic bonds in cellulose.
  • the polynucleotides of the invention encode polypeptides having various cellulase activities.
  • the cellulases of the invention also include thermotolerant and thermoresistant enzymes and enzymes that have activity in high and low pH conditions.
  • antibody includes a peptide or polypeptide derived from, modeled after or substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, capable of specifically binding an antigen (e.g., a cellulase of the invention) or epitope, see, e.g. Fundamental Immunology, Third Edition, W.E. Paul, ed., Raven Press, N.Y. (1993); Wilson (1994) J. Emmunol. Methods 175:267-273;
  • antibody includes antigen-binding portions, i.e., "antigen binding sites,” (e.g., fragments, subsequences, complementarity determining regions (CDRs)) that retain capacity to bind antigen, including (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and
  • CHI domains (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • CDR complementarity determining region
  • array or “microarray” or “biochip” or “chip” as used herein is a plurality of target elements, each target element comprising a defined amount of one or more polypeptides, e.g., a cellulase of the invention, including antibodies, or nucleic acids immobilized onto a defined area of a substrate surface, as discussed in further detail, below.
  • expression cassette refers to a nucleotide sequence which is capable of affecting expression of a structural gene (i.e., a protein coding sequence, such as a cellulase of the invention) in a host compatible with such sequences.
  • Expression cassettes include at least a promoter operably linked with the polypeptide coding sequence; and, optionally, with other sequences, e.g., transcription termination signals. Additional factors necessary or helpful in effecting expression may also be used, e.g., enhancers.
  • expression cassettes also include plasmids, expression vectors, recombinant viruses, any form of recombinant "naked DNA” vector, and the like.
  • a "vector” comprises a nucleic acid that can infect, transfect, transiently or permanently transduce a cell. It will be recognized that a vector can be a naked nucleic acid, or a nucleic acid complexed with protein or lipid.
  • the vector optionally comprises viral or bacterial nucleic acids and/or proteins, and/or membranes (e.g., a cell membrane, a viral lipid envelope, etc.).
  • Vectors include, but are not limited to replicons (e.g., RNA replicons, bacteriophages) to which fragments of DNA may be attached and become replicated.
  • Vectors thus include, but are not limited to RNA, autonomous self-replicating circular or linear DNA or RNA (e.g., plasmids, viruses, and the like, see, e.g., U.S. Patent No. 5,217,879), and includes both the expression and non-expression plasmids.
  • a recombinant microorganism or cell culture is described as hosting an "expression vector" this includes both extra-chromosomal circular and linear DNA and DNA that has been inco ⁇ orated into the host chromosome(s).
  • the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is inco ⁇ orated within the host's genome.
  • nucleic acid or “nucleic acid sequence” as used herein refer to an oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA (e.g., mRNA, rRNA, tRNA) of genomic or synthetic origin which may be single- stranded or double-stranded and may represent a sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material, natural or synthetic in origin, including, e.g., iRNA, ribonucleoproteins (e.g., iRNPs).
  • DNA or RNA e.g., mRNA, rRNA, tRNA
  • PNA peptide nucleic acid
  • DNA-like or RNA-like material natural or synthetic in origin, including, e.g., iRNA, ribonucleoproteins (e.g., iRNPs
  • nucleic acids i.e., oligonucleotides, containing known analogues of natural nucleotides.
  • the term also encompasses nucleic-acid-like structures with synthetic backbones, see e.g., Mata (1997) Toxicol. Appl. Pharmacol. 144:189-197; Strauss-Soukup (1997) Biochemistry 36:8692-8698; Straussense Nucleic Acid Drug Dev 6:153-156.
  • amino acid or “amino acid sequence” as used herein refer to an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • an isolated material or composition can also be a "purified" composition, i.e., it does not require absolute purity; rather, it is intended as a relative definition.
  • Individual nucleic acids obtained from a library can be conventionally purified to electrophoretic homogeneity.
  • the invention provides nucleic acids that have been purified from genomic DNA or from other sequences in a library or other environment by at least one, two, three, four, five or more orders of magnitude.
  • nucleic acid is adjacent to a "backbone” nucleic acid to which it is not adjacent in its natural environment.
  • nucleic acids represent 5% or more of the number of nucleic acid inserts in a population of nucleic acid "backbone molecules.”
  • Backbone molecules include nucleic acids such as expression vectors, self-replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid insert of interest.
  • the enriched nucleic acids represent 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules.
  • Recombinant polypeptides or proteins refer to polypeptides or proteins produced by recombinant DNA techniques; e.g., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein.
  • Synthetic polypeptides or protein are those prepared by chemical synthesis, as described in further detail, below.
  • a promoter sequence is "operably linked to" a coding sequence when RNA polymerase which initiates transcription at the promoter will transcribe the coding sequence into mRNA, as discussed further, below.
  • Oligonucleotide refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands that may be chemically synthesized.
  • Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase.
  • a synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • phrase “substantially identical” in the context of two nucleic acids or polypeptides refers to two or more sequences that have at least 50%, 60%, 70%, 75%,
  • nucleic acid and polypeptide sequences having substantial identity to an exemplary sequence of the invention, e.g., SEQ ID NO: 1
  • nucleic acid sequences of the invention can be substantially identical over the entire length of a polypeptide coding region.
  • a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence by one or more conservative or non-conservative amino acid substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site of the molecule, and provided that the polypeptide essentially retains its functional properties.
  • a conservative amino acid substitution for example, substitutes one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine).
  • One or more amino acids can be deleted, for example, from a cellulase polypeptide, resulting in modification of the structure of the polypeptide, without significantly altering its biological activity.
  • amino- or carboxyl-terminal amino acids that are not required for cellulase biological activity can be removed.
  • Modified polypeptide sequences of the invention can be assayed for cellulase biological activity by any number of methods, including contacting the modified polypeptide sequence with a cellulase substrate and determining whether the modified polypeptide decreases the amount of specific substrate in the assay or increases the bioproducts of the enzymatic reaction of a functional cellulase with the substrate, as discussed further, below.
  • Hybridization refers to the process by which a nucleic acid strand joins with a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations.
  • Suitably stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art. For example, stringency can be increased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature, altering the time of hybridization, as described in detail, below.
  • nucleic acids of the invention are defined by their ability to hybridize under various stringency conditions (e.g., high, medium, and low), as set forth herein.
  • variant refers to polynucleotides or polypeptides of the invention, e.g., a cellulase of the invention, modified at one or more base pairs, codons, introns, exons, or amino acid residues (respectively) yet still retain the biological activity of a cellulase of the invention.
  • Variants can be produced by any number of means included methods such as, for example, error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site- specific mutagenesis, gene reassembly, GSSM and any combination thereof.
  • Techniques for producing variant cellulases having activity at a pH or temperature for example, that is different from a wild-type cellulases, are included herein.
  • GS SM saturatedation mutagenesis
  • GS SM saturation mutagenesis
  • optical mutagenesis includes a method that uses degenerate oligonucleotide primers to introduce point mutations into a polynucleotide, as described in detail, below.
  • optical mutagenesis system or “optimized directed evolution” includes a method for reassembling fragments of related nucleic acid sequences, e.g., related genes, and explained in detail, below.
  • SLR synthetic ligation reassembly
  • nucleic acid or “nucleic acid sequence” as used herein refer to an oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent a sense or antisense strand, peptide nucleic acid (PNA), or to any DNA- like or RNA-like material, natural or synthetic in origin.
  • a "nucleic acid sequence” of the invention includes, for example, a sequence encoding a polypeptide as set forth in SEQ ED NO:2, and variants thereof.
  • a “nucleic acid sequence” of the invention includes, for example, a sequence as set forth in SEQ ED NO:l, sequences complementary thereto, fragments of the foregoing sequences and variants thereof.
  • a "coding sequence of ' or a "nucleotide sequence encoding" a particular polypeptide or protein is a nucleic acid sequence which is transcribed and translated into a polypeptide or protein when placed under the control of appropriate regulatory sequences.
  • the term "gene” means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as, where applicable, intervening sequences (introns) between individual coding segments (exons).
  • amino acid or “amino acid sequence” as used herein refer to an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules.
  • polypeptide refers to amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain modified amino acids other than the 20 gene-encoded amino acids.
  • the polypeptides e.g., a cellulase of the invention, may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide.
  • a given polypeptide may have many types of modifications. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphytidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arg
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide e.g., a cellulase of the invention, present in a living bacterium or animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • the term "purified” does not require absolute purity; rather, it is intended as a relative definition. Individual nucleic acids obtained from a library have been conventionally purified to electrophoretic homogeneity. The sequences obtained from these clones could not be obtained directly either from the library or from total human DNA.
  • the purified nucleic acids of the invention have been purified from the remainder of the genomic DNA in the organism by at least 10 4 -10 6 fold.
  • the term “purified” also includes nucleic acids which have been purified from the remainder of the genomic DNA or from other sequences in a library or other environment by at least one order of magnitude, typically two or three orders, and more typically four or five orders of magnitude.
  • the term “recombinant” means that the nucleic acid is adj acent to a "backbone” nucleic acid to which it is not adjacent in its natural environment. Additionally, to be “enriched” the nucleic acids will represent 5% or more of the number of nucleic acid inserts in a population of nucleic acid backbone molecules.
  • Backbone molecules according to the invention include nucleic acids such as expression vectors, self-replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid insert of interest.
  • the enriched nucleic acids represent 15 > or more of the number of nucleic acid inserts in the population of recombinant backbone molecules.
  • the enriched nucleic acids represent 50% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules. In a one aspect, the enriched nucleic acids represent 90% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules.
  • Recombinant polypeptides or proteins refer to polypeptides or proteins produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein.
  • synthetic polypeptides or protein are those prepared by chemical synthesis. Solid-phase chemical peptide synthesis methods can also be used to synthesize the polypeptide or fragments of the invention. Such method have been known in the art since the early 1960's (Merrifield, R. B., J Am. Chem. Soc, 85:2149-2154, 1963) (See also Stewart, J. M. and Young, j.
  • a plate of rods or pins is inverted and inserted into a second plate of corresponding wells or reservoirs, which contain solutions for attaching or anchoring an appropriate amino acid to the pin's or rod's tips.
  • a process step i.e., inverting and inserting the rod's and pin's tips into appropriate solutions, amino acids are built into desired peptides.
  • FMOC peptide synthesis systems are available. For example, assembly of a polypeptide or fragment can be carried out on a solid support using an Applied Biosystems, Ene. Model 431 A automated peptide synthesizer. Such equipment provides ready access to the peptides of the invention, either by direct synthesis or by synthesis of a series of fragments that can be coupled using other known techniques.
  • a promoter sequence is "operably linked to" a coding sequence when RNA polymerase which initiates transcription at the promoter will transcribe the coding sequence into mRNA.
  • "Plasmids” are designated by a lower case “p” preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. En addition, equivalent plasmids to those described herein are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical pu ⁇ oses typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the pu ⁇ ose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer.
  • Oligonucleotide refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences that have at least 50%, 55%, 60%, 65%, 70%, 15%, 80%, 85%) and in some aspects 90-95% or 90-99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the known sequence comparison algorithms or by visual inspection.
  • the substantial identity exists over a region of at least about 100 residues, and most commonly the sequences are substantially identical over at least about 150-200 residues.
  • the sequences are substantially identical over the entire length of the coding regions.
  • a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence by one or more conservative or non-conservative amino acid substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site of the molecule, and provided that the polypeptide essentially retains its functional properties.
  • a conservative amino acid substitution for example, substitutes one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine).
  • One or more amino acids can be deleted, for example, from an cellulase polypeptide, resulting in modification of the structure of the polypeptide, without significantly altering its biological activity.
  • amino- or carboxyl-terminal amino acids that are not required for cellulase biological activity can be removed.
  • Modified polypeptide sequences of the invention can be assayed for cellulase biological activity by any number of methods, including contacting the modified polypeptide sequence with a cellulase substrate and determining whether the modified polypeptide decreases the amount of specific substrate in the assay or increases the bioproducts of the enzymatic reaction of a functional cellulase polypeptide with the substrate.
  • Fragments as used herein are a portion of a naturally occurring protein which can exist in at least two different conformations. Fragments can have the same or substantially the same amino acid sequence as the naturally occurring protein. “Substantially the same” means that an amino acid sequence is largely, but not entirely, the same, but retains at least one functional activity of the sequence to which it is related. En general two amino acid sequences are "substantially the same” or “substantially homologous” if they are at least about 85% identical. Fragments which have different three dimensional structures as the naturally occurring protein are also included.
  • Hybridization refers to the process by which a nucleic acid strand joins with a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations. Suitably stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art.
  • stringency can be increased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature.
  • hybridization under high stringency conditions could occur in about 50% formamide at about 37°C to 42°C.
  • Hybridization could occur under reduced stringency conditions in about 35% to 25% formamide at about 30°C to 35°C.
  • hybridization could occur under high stringency conditions at 42°C in 50% formamide, 5X SSPE, 0.3%) SDS, and 200 n/ml sheared and denatured salmon sperm DNA.
  • Hybridization could occur under reduced stringency conditions as described above, but in 35% formamide at a reduced temperature of 35°C.
  • the temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly. Variations on the above ranges and conditions are well known in the art.
  • the term "variant" refers to polynucleotides or polypeptides of the invention modified at one or more base pairs, codons, introns, exons, or amino acid residues (respectively) yet still retain the biological activity of a cellulase of the invention.
  • Variants can be produced by any number of means included methods such as, for example, error- prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, GSSM and any combination thereof.
  • thermostable and “thermostability” as used herein with reference to an enzyme mean the ability of the enzyme to function at increased temperatures, for example to have comparable specific activity at 70°C and at 85° C at a common pH.
  • a "thermostable” enzyme will maintain much or all of its activity at an increased temperature or may be more active at an increased temperature than at its normal temperature (e.g., room temperature) or its optimum temperature prior to mutagenesis to obtain enhanced thermostability.
  • thermotolerant and “thermotolerance” as used herein with reference to an enzyme mean the ability of the enzyme to function normally after exposure to high temperature, even though the high temperature may temporarily deactivate the enzyme.
  • the invention provides nucleic acids, including expression cassettes such as expression vectors, encoding the polypeptides and cellulases of the invention.
  • the invention also includes methods for discovering new cellulase sequences using the nucleic acids of the invention.
  • methods for modifying the nucleic acids of the invention by, e.g., synthetic ligation reassembly, optimized directed evolution system and/or saturation mutagenesis.
  • the nucleic acids of the invention can be made, isolated and/or manipulated by, e.g., cloning and expression of cDNA libraries, amplification of message or genomic
  • homologous genes can be modified by manipulating a template nucleic acid, as described herein.
  • the invention can be practiced in conjunction with any method or protocol or device known in the art, which are well described in the scientific and patent literature.
  • RNA, iRNA, antisense nucleic acid, cDNA, genomic DNA, vectors, viruses or hybrids thereof may be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/ generated recombinantly. Recombinant polypeptides generated from these nucleic acids can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including bacterial, mammalian, yeast, insect or plant cell expression systems.
  • these nucleic acids can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc.
  • nucleic acids such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook, ed., MOLECULAR CLONING: A LABORATORY
  • Another useful means of obtaining and manipulating nucleic acids used to practice the methods of the invention is to clone from genomic samples, and, if desired, screen and re-clone inserts isolated or amplified from, e.g., genomic clones or cDNA clones.
  • Sources of nucleic acid used in the methods of the invention include genomic or cDNA libraries contained in, e.g., mammalian artificial chromosomes (MACs), see, e.g., U.S. Patent Nos. 5,721,118; 6,025,155; human artificial chromosomes, see, e.g., Rosenfeld
  • yeast artificial chromosomes YAC
  • bacterial artificial chromosomes BAC
  • PI artificial chromosomes see, e.g., Woon (1998) Genomics 50:306-316
  • Pl-derived vectors see, e.g., Kern (1997) Biotechniques 23:120-124; cosmids, recombinant viruses, phages or plasmids.
  • nucleic acid encoding a polypeptide of the invention is assembled in appropriate phase with a leader sequence capable of directing secretion of the translated polypeptide or fragment thereof.
  • the invention provides fusion proteins and nucleic acids encoding them.
  • a polypeptide of the invention can be fused to a heterologous peptide or polypeptide, such as N-terminal identification peptides which impart desired characteristics, such as increased stability or simplified purification.
  • Peptides and polypeptides of the invention can also be synthesized and expressed as fusion proteins with one or more additional domains linked thereto for, e.g., producing a more immunogenic peptide, to more readily isolate a recombinantly synthesized peptide, to identify and isolate antibodies and antibody- expressing B cells, and the like.
  • Detection and purification facilitating domains include, e.g., metal chelating peptides such as polyhistidine tracts and histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Emmunex Co ⁇ , Seattle WA).
  • metal chelating peptides such as polyhistidine tracts and histidine-tryptophan modules that allow purification on immobilized metals
  • protein A domains that allow purification on immobilized immunoglobulin
  • the domain utilized in the FLAGS extension/affinity purification system Emmunex Co ⁇ , Seattle WA.
  • the inclusion of a cleavable linker sequences such as Factor Xa or enterokinase (Invitrogen, San Diego CA) between a purification domain and the motif-comprising peptide or polypeptide to facilitate purification.
  • an expression vector can include an epitope-encoding nucleic acid sequence linked to six histidine residues followed by a thioredoxin and an enterokinase cleavage site (see e.g., Williams (1995) Biochemistry 34:1787-1797; Dobeli
  • the invention provides nucleic acid (e.g., DNA) sequences of the invention operatively linked to expression (e.g., transcriptional or translational) control sequence(s),. e.g., promoters or enhancers, to direct or modulate RNA synthesis/ expression.
  • expression control sequence can be in an expression vector.
  • Exemplary bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and t ⁇ .
  • Exemplary eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein I.
  • Promoters suitable for expressing, or over-expressing, a polypeptide in bacteria include the E. coli lac or t ⁇ promoters, the lad promoter, the lacZ promoter, the T3 promoter, the T7 promoter, the gpt promoter, the lambda PR promoter, the lambda PL promoter, promoters from operons encoding glycolytic enzymes such as 3- phosphoglycerate kinase (PGK), and the acid phosphatase promoter.
  • PGK 3- phosphoglycerate kinase
  • Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter. Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used. Expression vectors and cloning vehicles
  • the invention provides expression vectors and cloning vehicles comprising nucleic acids of the invention, e.g., sequences encoding the cellulases of the invention, for expression, and over-expression, of the polypeptides of the invention (and nucleic acids, e.g., antisense).
  • Expression vectors and cloning vehicles of the invention can comprise viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), PI -based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, Aspergillus and yeast).
  • Vectors of the invention can include chromosomal, non- chromosomal and synthetic DNA sequences.
  • exemplary vectors are include: bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXTl, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia).
  • any other plasmid or other vector may be used so long as they are replicable and viable in the host.
  • Low copy number or high copy number vectors may be employed with the present invention.
  • the expression vector may comprise a promoter, a ribo some binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • Mammalian expression vectors can comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. En some aspects, DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • the expression vectors contain one or more selectable marker genes to permit selection of host cells containing the vector.
  • selectable markers include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E. coli, and the S. cerevisiae TRP1 gene.
  • Promoter regions can be selected from any desired gene using chloramphenicol transferase (CAT) vectors or other vectors with selectable markers.
  • CAT chloramphenicol transferase
  • Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels.
  • Enhancers are c* ' _?-acting elements of DNA, usually from about 10 to about 300 bp in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adeno virus enhancers.
  • a DNA sequence may be inserted into a vector by a variety of procedures.
  • DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases.
  • blunt ends in both the insert and the vector may be ligated.
  • a variety of cloning techniques are known in the art, e.g., as described in Ausubel and Sambrook. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the vector may be in the form of a plasmid, a viral particle, or a phage.
  • vectors include chromosomal, non-chromosomal and synthetic DNA sequences, derivatives of S V40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by, e.g., Sambrook.
  • Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322
  • Particular eukaryotic vectors include pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used as long as it is replicable and viable in the host cell.
  • the invention also provides a transformed cell comprising a nucleic acid sequence of the invention, e.g., a sequence encoding a cellulase of the invention, a vector of the invention.
  • the host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells.
  • Exemplary bacterial cells include E. coli, Streptomyces, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus.
  • Exemplary insect cells include Drosophila S2 and Spodoptera Sf9.
  • Exemplary animal cells include CHO, COS or
  • the vector may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection,
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention.
  • the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
  • Cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.
  • Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art.
  • the expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • mammalian cell culture systems can also be employed to express, or over-express, recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines.
  • the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides produced by host cells containing the vector may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may or may not also include an initial methionine amino acid residue.
  • Cell-free translation systems can also be employed to produce a polypeptide of the invention.
  • Cell-free translation systems can use mRNAs transcribed from a DNA construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof.
  • the DNA construct may be linearized prior to conducting an in vitro transcription reaction.
  • the transcribed mRNA is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
  • the expression vectors can contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • nucleic acids encoding the polypeptides of the invention, or modified nucleic acids can be reproduced by, e.g., amplification.
  • the invention provides amplification primer sequence pairs for amplifying nucleic acids encoding polypeptides with a cellulase activity, where the primer pairs are capable of amplifying nucleic acid sequences including the exemplary SEQ ED NO:l, or a subsequence thereof.
  • Amplification reactions can also be used to quantify the amount of nucleic acid in a sample (such as the amount of message in a cell sample), label the nucleic acid (e.g., to apply it to an array or a blot), detect the nucleic acid, or quantify the amount of a specific nucleic acid in a sample.
  • message isolated from a cell or a cDNA library are amplified.
  • the skilled artisan can select and design suitable oligonucleotide amplification primers.
  • Amplification methods are also well known in the art, and include, e.g., polymerase chain reaction, PCR (see, e.g., PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. Innis, Academic Press, N.Y. (1990) and PCR STRATEGIES (1995), ed. Innis, Academic Press, Inc., N.Y., ligase chain reaction (LCR) (see, e.g., Wu (1989) Genomics 4:560; Landegren (1988) Science 241 :1077; Barringer (1990) Gene 89:117); transcription amplification (see, e.g., Kwoh (1989) Proc. Natl. Acad.
  • PCR see, e.g., PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. Innis, Academic Press, N.Y. (1990) and PCR STRATEGIES (1995
  • the invention provides an isolated or recombinant nucleic acid comprising a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the nucleic acids encode at least one polypeptide having a cellulase activity and the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual inspection.
  • the nucleic acid sequence has at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, 98.5%, 99% or 99.5%o sequence identity to SEQ ID NO:l over a region of at least about 50 residues, 100 residues, 150 residues, 200 residues, 250 residues, 300 residues, 350 residues, 400 residues, 450 residues, 500 residues, 550 residues, 600 residues, 700 residues, 800 residues, 900 residues or the full length of the sequence.
  • the nucleic acid sequence can have a sequence as set forth in SEQ ID NO: 1.
  • the extent of sequence identity may be determined using any computer program and associated parameters, including those described herein, such as BLAST 2.2.2.
  • Homologous sequences also include RNA sequences in which uridines replace the thymines in the nucleic acid sequences.
  • the homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid sequences as set forth herein can be represented in the traditional single character format (see, e.g., Stryer, Lubert. Biochemistry, 3rd Ed., W H Freeman & Co., New York) or in any other format which records the identity of the nucleotides in a sequence.
  • sequence comparison programs identified herein are used in this aspect of the invention. Protein and/or nucleic acid sequence identities (homologies) may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are not limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990; Thompson et al., Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al., Methods Enzymol. 266:383-402, 1996; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990; Altschul et al., Nature Genetics 3:266-272, 1993.
  • Homology or identity can be measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705
  • identity in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are
  • one sequence can act as a reference sequence (an exemplary sequence SEQ ID NO:l, SEQ ID NO:2) to which test sequences are compared.
  • a sequence comparison algorithm test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • the sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a "comparison window" includes reference to a segment of any one of the number of contiguous residues.
  • continugous residues ranging anywhere from 20 to the full length of exemplary sequences SEQ ID NO:l, SEQ ID NO:2 are compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. If the reference sequence has the requisite sequence identity to SEQ ID NO:l, SEQ ED NO:2, e.g., 50%) to 99% sequence identity to SEQ ED NO:l, SEQ ID NO:2, that sequence is within the scope of the invention.
  • subsequences ranging from about 20 to 600, about 50 to 200, and about 100 to 150 are compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequence for comparison are well-known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443, 1970, by the search for similarity method of person & Lipman, Proc. Nat'l. Acad. Sci.
  • Such alignment programs can also be used to screen genome databases to identify polynucleotide sequences having substantially identical sequences.
  • a number of genome databases are available, for example, a substantial portion of the human genome is available as part of the Human Genome Sequencing Project (Gibbs, 1995).
  • Several genomes have been sequenced, e.g., M. genitalium (Fraser et al., 1995), M. jannaschii (Bult et al., 1996), H. influenzae (Fleischmann et al., 1995), E. coli (Blattner et al., 1997), and yeast (S. cerevisiae) (Mewes et al., 1997), and D.
  • BLAST, BLAST 2.0 and BLAST 2.2.2 algorithms are also used to practice the invention. They are described, e.g., in Altschul (1977) Nuc. Acids Res. 25:3389-3402; Altschul (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology ⁇ nformation. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is refe ⁇ ed to as the neighborhood word score threshold (Altschul (1990) supra).
  • HSPs high scoring sequence pairs
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • W wordlength
  • E expectation
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873).
  • One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, less than about 0.01, or less than about 0.001.
  • BLAST Basic Local Alignment Search Tool
  • BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database
  • BLASTN compares a nucleotide query sequence against a nucleotide sequence database
  • BLASTX compares the six-frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database
  • TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands)
  • TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
  • the BLAST programs identify homologous sequences by identifying similar segments, which are referred to herein as "high-scoring segment pairs," between a query amino or nucleic acid sequence and a test sequence which can be obtained from a protein or nucleic acid sequence database.
  • High-scoring segment pairs can be identified (i.e., aligned) by means of a scoring matrix, many of which are known in the art.
  • An exemplary scoring matrix used is the BLOSUM62 matrix (Gonnet et al., Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61, 1993).
  • the PAM or PAM250 matrices may be used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington: National Biomedical Research Foundation).
  • the NCB1 BLAST 2.2.2 programs is used, default options to blastp. There are about 38 setting options in the BLAST 2.2.2 program. En this exemplary aspect of the invention, all default values are used except for the default filtering setting (i.e., all parameters set to default except filtering which is set to OFF); in its place a "-F F" setting is used, which disables filtering. Use of default filtering often results in Karlin- Altschul violations due to short length of sequence.
  • NCBI BLAST 2.2.2 program setting is set forth in Example 1, below. Note that the "-W" option defaults to 0. This means that, if not set, the word size defaults to 3 for proteins and 11 for nucleotides.
  • the invention provides a means for generating hybrid polynucleotides that may encode biologically active hybrid polypeptides (e.g., hybrid cellulase).
  • the original polynucleotides encode biologically active polypeptides.
  • the method of the invention produces new hybrid polypeptides by utilizing cellular processes which integrate the sequence of the original polynucleotides such that the resulting hybrid polynucleotide encodes a polypeptide demonstrating activities derived from the original biologically active polypeptides.
  • the original polynucleotides may encode a particular enzyme from different microorganisms.
  • An enzyme encoded by a first polynucleotide from one organism or variant may, for example, function effectively under a particular environmental condition, e.g. high salinity.
  • An enzyme encoded by a second polynucleotide from a different organism or variant may function effectively under a different environmental condition, such as extremely high temperatures.
  • a hybrid polynucleotide containing sequences from the first and second original polynucleotides may encode an enzyme which exhibits characteristics of both enzymes encoded by the original polynucleotides.
  • the enzyme encoded by the hybrid polynucleotide may function effectively under environmental conditions shared by each of the enzymes encoded by the first and second polynucleotides, e.g., high salinity and extreme temperatures.
  • Enzymes encoded by the polynucleotides of the invention include, but are not limited to, hydrolases, such as cellulases.
  • a hybrid polypeptide resulting from the method of the invention may exhibit specialized enzyme activity not displayed in the original enzymes. For example, following recombination and/or reductive reassortment of polynucleotides encoding hydrolase activities, the resulting hybrid polypeptide encoded by a hybrid polynucleotide can be screened for specialized hydrolase activities obtained from each of the original enzymes, i.e. the type of bond on which the hydrolase acts and the temperature at which the hydrolase functions.
  • the hydrolase may be screened to ascertain those chemical functionalities which distinguish the hybrid hydrolase from the original hydrolases, such as: (a) amide (peptide bonds), i.e., proteases; (b) ester bonds, i.e., esterases and lipases; (c) acetals, i.e., glycosidases and, for example, the temperature, pH or salt concentration at which the hybrid polypeptide functions.
  • amide (peptide bonds) i.e., proteases
  • ester bonds i.e., esterases and lipases
  • acetals i.e., glycosidases and, for example, the temperature, pH or salt concentration at which the hybrid polypeptide functions.
  • Sources of the original polynucleotides may be isolated from individual organisms ("isolates”), collections of organisms that have been grown in defined media
  • enrichment cultures or, uncultivated organisms (“environmental samples”).
  • environment samples uncultivated organisms
  • the use of a culture-independent approach to derive polynucleotides encoding novel bioactivities from environmental samples can be used to allow access to untapped resources of biodiversity.
  • Environmental libraries are generated from environmental samples and represent the collective genomes of naturally occurring organisms archived in cloning vectors that can be propagated in suitable prokaryotic hosts. Because the cloned DNA is initially extracted directly from environmental samples, the libraries are not limited to the small fraction of prokaryotes that can be grown in pure culture. Additionally, a normalization of the environmental DNA present in these samples could allow more equal representation of the DNA from all of the species present in the original sample. This can dramatically increase the efficiency of finding interesting genes from minor constituents of the sample which may be under-represented by several orders of magnitude compared to the dominant species.
  • gene libraries generated from one or more uncultivated microorganisms are screened for an activity of interest.
  • Potential pathways encoding bioactive molecules of interest are first captured in prokaryotic cells in the form of gene expression libraries.
  • Polynucleotides encoding activities of interest are isolated from such libraries and introduced into a host cell. The host cell is grown under conditions which promote recombination and/or reductive reassortment creating potentially active biomolecules with novel or enhanced activities.
  • the microorganisms from which the polynucleotide may be prepared include prokaryotic microorganisms, such as Eubacte ⁇ a and Archaebacteria, and lower eukaryotic microorganisms such as fungi, some algae and protozoa.
  • Polynucleotides may be isolated from environmental samples in which case the nucleic acid may be recovered without culturing of an organism or recovered from one or more cultured organisms.
  • such microorganisms may be extremophiles, such as hyperthermophiles, psychrophiles, psychrotrophs, halophiles, barophiles and acidophiles.
  • Polynucleotides encoding enzymes isolated from extremophilic microorganisms can be used. Such enzymes may function at temperatures above 100°C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0°C in arctic waters, in the saturated salt environment of the
  • Dead Sea at pH values around 0 in coal deposits and geothermal sulfur-rich springs, or at pH values greater than 11 in sewage sludge.
  • esterases and lipases cloned and expressed from extremophilic organisms show high activity throughout a wide range of temperatures and pHs.
  • a suitable host cell is any cell which is capable of promoting recombination and/or reductive reassortment.
  • the selected polynucleotides can be in a vector which includes appropriate control sequences.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or, the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-
  • bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera SJ9
  • animal cells such as CHO
  • COS or Bowes melanoma COS or Bowes melanoma; adenoviruses; and plant cells.
  • the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described in "SV40- transformed simian cells support the replication of early SV40 mutants" (Gluzman, 1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3,
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • Host cells containing the polynucleotides of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the clones which are identified as having the specified enzyme activity may then be sequenced to identify the polynucleotide sequence encoding an enzyme having the enhanced activity.
  • the present invention can be used to generate novel polynucleotides encoding biochemical pathways from one or more operons or gene clusters or portions thereof.
  • bacteria and many eukaryotes have a coordinated mechanism for regulating genes whose products are involved in related processes.
  • the genes are clustered, in structures referred to as "gene clusters," on a single chromosome and are transcribed together under the control of a single regulatory sequence, including a single promoter which initiates transcription of the entire cluster.
  • a gene cluster is a group of adjacent genes that are either identical or related, usually as to their function.
  • An example of a biochemical pathway encoded by gene clusters are polyketides. Polyketides are molecules which are an extremely rich source of bioactivities, including antibiotics
  • Polyketide synthases are multifunctional enzymes that catalyze the biosynthesis of an enormous variety of carbon chains differing in length and patterns of functionality and cyclization. Polyketide synthase genes fall into gene clusters and at least one type
  • Gene cluster DNA can be isolated from different organisms and ligated into vectors, particularly vectors containing expression regulatory sequences which can control and regulate the production of a detectable protein or protein-related array activity from the ligated gene clusters.
  • vectors which have an exceptionally large capacity for exogenous DNA introduction are particularly appropriate for use with such gene clusters and are described by way of example herein to include the f-factor (or fertility factor) of E. coli.
  • This f-factor of E. coli is a plasmid which affect high-frequency transfer of itself during conjugation and is ideal to achieve and stably propagate large DNA fragments, such as gene clusters from mixed microbial samples.
  • cloning vectors referred to as "fosmids” or bacterial artificial chromosome (BAC) vectors. These are derived from E. coli f-factor which is able to stably integrate large segments of genomic DNA. When integrated with DNA from a mixed uncultured environmental sample, this makes it possible to achieve large genomic fragments in the form of a stable "environmental DNA library.”
  • Another type of vector for use in the present invention is a cosmid vector. Cosmid vectors were originally designed to clone and propagate large segments of genomic DNA. Cloning into cosmid vectors is described in detail in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ⁇ dopathic Cold Spring Harbor Laboratory Press (1989).
  • two or more vectors containing different polyketide synthase gene clusters can be introduced into a suitable host cell. Regions of partial sequence homology shared by the gene clusters will promote processes which result in sequence reorganization resulting in a hybrid gene cluster. The novel hybrid gene cluster can then be screened for enhanced activities not found in the original gene clusters.
  • the invention relates to a method for producing a biologically active hybrid polypeptide and screening such a polypeptide for enhanced activity by:
  • the DNA may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXTl, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia).
  • any other plasmid or other vector may be used so long as they are replicable and viable in the host.
  • Low copy number or high copy number vectors may be employed with the present invention.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct RNA synthesis.
  • promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • Promoter regions can be selected from any desired gene using chloramphenicol transferase (CAT) vectors or other vectors with selectable markers.
  • CAT chloramphenicol transferase
  • the expression vectors can contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the method involves the generation of constructs containing consecutive sequences (original encoding sequences), their insertion into an appropriate vector, and their subsequent introduction into an appropriate host cell.
  • the reassortment of the individual molecular identities occurs by combinatorial processes between the consecutive sequences in the construct possessing regions of homology, or between quasi-repeated units.
  • the reassortment process recombines and/or reduces the complexity and extent of the repeated sequences, and results in the production of novel molecular species.
  • Various treatments may be applied to enhance the rate of reassortment. These could include treatment with ultra-violet light, or DNA damaging chemicals, and/or the use of host cell lines displaying enhanced levels of "genetic instability".
  • the reassortment process may involve homologous recombination or the natural property of quasi-repeated sequences to direct their own evolution.
  • Quadsi-repeated sequences play a role in genetic instability.
  • “quasi-repeats” are repeats that are not restricted to their original unit structure. Quasi-repeated units can be presented as an array of sequences in a construct; consecutive units of similar sequences. Once ligated, the junctions between the consecutive sequences become essentially invisible and the quasi-repetitive nature of the resulting construct is now continuous at the molecular level. The deletion process the cell performs to reduce the complexity of the resulting construct operates between the quasi- repeated sequences.
  • the quasi-repeated units provide a practically limitless repertoire of templates upon which slippage events can occur.
  • the constructs containing the quasi- repeats thus effectively provide sufficient molecular elasticity that deletion (and potentially insertion) events can occur virtually anywhere within the quasi-repetitive units.
  • the quasi -repeated sequences are all ligated in the same orientation, for instance head to tail or vice versa, the cell cannot distinguish individual units. Consequently, the reductive process can occur throughout the sequences.
  • the inversion delineates the endpoints of the adjacent unit so that deletion formation will favor the loss of discrete units.
  • the sequences can be in the same orientation.
  • Sequences can be assembled in a head to tail orientation using any of a variety of methods, including the following:
  • the recovery of the re-assorted sequences relies on the identification of cloning vectors with a reduced repetitive index (Rl).
  • the re-assorted encoding sequences can then be recovered by amplification.
  • the products are re-cloned and expressed.
  • the recovery of cloning vectors with reduced Rl can be affected by:
  • Encoding sequences for example, genes
  • genes may demonstrate a high degree of homology and encode quite diverse protein products.
  • These types of sequences are particularly useful in the present invention as quasi-repeats.
  • the examples illustrated below demonstrate the reassortment of nearly identical original encoding sequences (quasi-repeats), this process is not limited to such nearly identical repeats.
  • the following example demonstrates a method of the invention.
  • Encoding nucleic acid sequences (quasi-repeats) derived from three (3) unique species are described. Each sequence encodes a protein with a distinct set of properties. Each of the sequences differs by a single or a few base pairs at a unique position in the sequence.
  • the quasi- repeated sequences are separately or collectively amplified and ligated into random assemblies such that all possible permutations and combinations are available in the population of ligated molecules.
  • the number of quasi-repeat units can be controlled by the assembly conditions.
  • the average number of quasi -repeated units in a construct is defined as the repetitive index (Rl).
  • the constructs may, or may not be size fractionated on an agarose gel according to published protocols, inserted into a cloning vector, and transfected into an appropriate host cell.
  • the cells are then propagated and "reductive reassortment" is effected.
  • the rate of the reductive reassortment process may be stimulated by the introduction of DNA damage if desired.
  • the reduction in Rl is mediated by deletion formation between repeated sequences by an "intra-molecular” mechanism, or mediated by recombination-like events through "inter-molecular” mechanisms is immaterial. The end result is a reassortment of the molecules into all possible combinations.
  • the method comprises the additional step of screening the library members of the shuffled pool to identify individual shuffled library members having the ability to bind or otherwise interact, or catalyze a particular reaction (e.g., such as catalytic domain of an enzyme) with a predetermined macromolecule, such as for example a proteinaceous receptor, an oligosaccharide, virion, or other predetermined compound or structure.
  • a particular reaction e.g., such as catalytic domain of an enzyme
  • a predetermined macromolecule such as for example a proteinaceous receptor, an oligosaccharide, virion, or other predetermined compound or structure.
  • polypeptides that are identified from such libraries can be used for therapeutic, diagnostic, research and related pu ⁇ oses (e.g. , catalysts, solutes for increasing osmolarity of an aqueous solution, and the like), and/or can be subjected to one or more additional cycles of shuffling and/or selection.
  • pu ⁇ oses e.g. , catalysts, solutes for increasing osmolarity of an aqueous solution, and the like
  • polynucleotides generated by the method of the invention can be subjected to agents or processes which promote the introduction of mutations into the original polynucleotides.
  • the introduction of such mutations would increase the diversity of resulting hybrid polynucleotides and polypeptides encoded therefrom.
  • the agents or processes which promote mutagenesis can include, but are not limited to: (+)-CC-1065, or a synthetic analog such as (+)-CC-1065-(N3- Adenine (See Sun and Hurley, (1992); an N- acetylated or deacetylated 4'-fluro-4-aminobiphenyl adduct capable of inhibiting DNA synthesis (See , for example, van de Poll et al. (1992)); or a N-acetylated or deacetylated 4- aminobiphenyl adduct capable of inhibiting DNA synthesis (See also, van de Poll et al. (1992), pp.
  • trivalent chromium a trivalent chromium salt, a polycyclic aromatic hydrocarbon (PAH) DNA adduct capable of inhibiting DNA replication, such as 7- bromomethyl-benz[ ⁇ ]anthracene ("BMA”), tris(2,3-dibromopropyl)phosphate (“Tris-BP”), l,2-dibromo-3-chloropropane (“DBCP”), 2-bromoacrolein (2BA), benzo[ ⁇ ]pyrene-7,8- dihydrodiol-9-10-epoxide (“BPDE”), a platinum(II) halogen salt, N-hydroxy-2-amino-3- methylimidazo[4,5-
  • BMA 7- bromomethyl-benz[ ⁇ ]anth
  • One exemplary means for slowing or halting PCR amplification consist of UV light (+)-CC-1065 and (+)-CC-1065-(N3- Adenine).
  • Particularly encompassed means are DNA adducts or polynucleotides comprising the DNA adducts from the polynucleotides or polynucleotides pool, which can be released or removed by a process including heating the solution comprising the polynucleotides prior to further processing.
  • the invention is directed to a method of producing recombinant proteins having biological activity by treating a sample comprising double- stranded template polynucleotides encoding a wild-type protein under conditions according to the invention which provide for the production of hybrid or re-assorted polynucleotides.
  • the isolated nucleic acids SEQ ID NO: 1 may be used to prepare one of the polypeptides of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of SEQ ID NO:2, and sequences substantially identical thereto.
  • another aspect of the invention is an isolated nucleic acid which encodes SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of SEQ ID NO:2.
  • the coding sequences of these nucleic acids may be identical to SEQ ID NO:l, or a fragment thereof or may be different coding sequences which encode SEQ ID NO:2, sequences substantially identical thereto, and fragments having at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids SEQ ID NO:2, as a result of the redundancy or degeneracy of the genetic code.
  • the genetic code is well known to those of skill in the art and can be obtained, for example, on page 214 of B. Lewin, Genes VI, Oxford University Press, 1997.
  • the isolated nucleic acid which encodes SEQ ID NO:2, and sequences substantially identical thereto may include, but is not limited to: only the coding sequence of SEQ ID NO:l, and sequences substantially identical thereto, and additional coding sequences, such as leader sequences or proprotein sequences and non-coding sequences, such as introns or non-coding sequences 5' and/or 3' of the coding sequence.
  • additional coding sequences such as leader sequences or proprotein sequences and non-coding sequences, such as introns or non-coding sequences 5' and/or 3' of the coding sequence.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only the coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • SEQ ID NO:l may be mutagenized using conventional techniques, such as site directed mutagenesis, or other techniques familiar to those skilled in the art, to introduce silent changes SEQ ID NO:l, and sequences substantially identical thereto.
  • silent changes include, for example, changes which do not alter the amino acid sequence encoded by the polynucleotide. Such changes may be desirable in order to increase the level of the polypeptide produced by host cells containing a vector encoding the polypeptide by introducing codons or codon pairs which occur frequently in the host organism.
  • the invention also relates to polynucleotides which have nucleotide changes which result in amino acid substitutions, additions, deletions, fusions and truncations in SEQ ID NO:2, and sequences substantially identical thereto.
  • nucleotide changes may be introduced using techniques such as site directed mutagenesis, random chemical mutagenesis, exonuclease III deletion, and other recombinant DNA techniques.
  • nucleotide changes may be naturally occurring allelic variants which are isolated by identifying nucleic acids which specifically hybridize to probes comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:l, and sequences substantially identical thereto (or the sequences complementary thereto) under conditions of high, moderate, or low stringency as provided herein.
  • polypeptides comprising the sequence of SEQ ID NO:l, and sequences substantially identical thereto, or fragments comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
  • polypeptides may be obtained by inserting a nucleic acid encoding the polypeptide into a vector such that the coding sequence is operably linked to a sequence capable of driving the expression of the encoded polypeptide in a suitable host cell.
  • the expression vector may comprise a promoter, a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • Promoters suitable for expressing the polypeptide or fragment thereof in bacteria include the E. coli lac or trp promoters, the lad promoter, the lacZ promoter, the
  • T3 promoter the T7 promoter, the gpt promoter, the lambda PR promoter, the lambda Pi promoter, promoters from operons encoding glycolytic enzymes such as 3- phosphoglycerate kinase (PGK), and the acid phosphatase promoter.
  • Fungal promoters include the ⁇ factor promoter.
  • Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late
  • SV40 promoter LTRs from retroviruses, and the mouse metallothionein-I promoter.
  • Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used.
  • Mammalian expression vectors may also comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences.
  • DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
  • Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels.
  • Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 bp in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancers.
  • the expression vectors typically contain one or more selectable marker genes to permit selection of host cells containing the vector.
  • selectable markers include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E. coli, and the S. cerevisiae TRPl gene.
  • nucleic acid encoding SEQ ID NO:2 and sequences substantially identical thereto, or fragments comprising at least about 5, 10, 15, 20, 25, 30,
  • the nucleic acid can encode a fusion polypeptide in which one of the polypeptides of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof is fused to heterologous peptides or polypeptides, such as N-terminal identification peptides which impart desired characteristics, such as increased stability or simplified purification.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases.
  • blunt ends in both the insert and the vector may be ligated.
  • a variety of cloning techniques are disclosed in Ausubel et al. Current Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997 and Sambrook et al, Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press (1989). Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the vector may be, for example, in the form of a plasmid, a viral particle, or a phage.
  • Other vectors include chromosomal, nonchromosomal and synthetic DNA sequences, derivatives of SV40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • a variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, N.Y., (1989).
  • Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pDIO, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7.
  • Particular eukaryotic vectors include pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia).
  • any other vector may be used as long as it is replicable and viable in the host cell.
  • the host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, mammalian cells, insect cells, or plant cells.
  • prokaryotic cells such as E. coli, Streptomyces, Bacillus subtilis ⁇ Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus
  • fungal cells such as yeast
  • insect cells such as Drosophila S2 and Spodoptera S ⁇
  • animal cells such as CHO, COS or Bowes melanoma
  • adenoviruses The selection of an appropriate host is within the abilities of those skilled in the art.
  • the vector may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection,
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention.
  • the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.
  • Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art.
  • the expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts (described by Gluzman, Cell, 23:175, 1981), and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3,
  • the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides produced by host cells containing the vector may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may or may not also include an initial methionine amino acid residue.
  • SEQ ID NO:2 and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof can be synthetically produced by conventional peptide synthesizers.
  • fragments or portions of the polypeptides may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
  • DNA construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof.
  • the DNA construct may be linearized prior to conducting an in vitro transcription reaction.
  • the transcribed mR A is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
  • the invention also relates to variants of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40,
  • variants include derivatives or analogs of these polypeptides.
  • the variants may differ in amino acid sequence from SEQ ID NO:2, and sequences substantially identical thereto, by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
  • the variants may be naturally occurring or created in vitro. En particular, such variants may be created using genetic engineering techniques such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives may be created using chemical synthesis or modification procedures.
  • variants are also familiar to those skilled in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids which encode polypeptides having characteristics which enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Typically, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
  • variants may be created using error prone PCR.
  • error prone PCR In error prone
  • PCR is performed under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product.
  • Error prone PCR is described in Leung, D.W., et al,
  • nucleic acids to be mutagemzed are mixed with
  • PCR primers for achieving a high rate of point mutation along the entire length of the PCR product.
  • the reaction may be performed using 20 fmoles of nucleic acid to be mutagemzed, 30pmole of each PCR primer, a reaction buffer comprising
  • PCR 50mM KC1, lOmM Tris HCl (pH 8.3) and 0.01% gelatin, 7mM MgCl 2 , 0.5mM MnCl 2 , 5 units of Taq polymerase, 0.2mM dGTP, 0.2mM dATP, ImM dCTP, and ImM dTTP.
  • PCR may be performed for 30 cycles of 94° C for 1 min, 45° C for 1 min, and 72° C for 1 min.
  • the mutagenized nucleic acids are cloned into an appropriate vector and the activities of the polypeptides encoded by the mutagenized nucleic acids is evaluated.
  • Variants may also be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest. Oligonucleotide mutagenesis is described in Reidhaar-Olson, J.F. & Sauer, R.T., et al, Science, 241:53-57,
  • Assembly PCR involves the assembly of a PCR product from a mixture of small DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in U.S.
  • Still another method of generating variants is sexual PCR mutagenesis.
  • sexual PCR mutagenesis forced homologous recombination occurs between DNA molecules of different but highly related DNA sequence in vitro, as a result of random fragmentation of the DNA molecule based on sequence homology, followed by fixation of the crossover by primer extension in a PCR reaction.
  • Sexual PCR mutagenesis is described in Stemmer, W.P., PNAS, USA, 91:10747-10751, 1994. Briefly, in such procedures a plurality of nucleic acids to be recombined are digested with DNase to generate fragments having an average size of 50-200 nucleotides.
  • Fragments of the desired average size are purified and resuspended in a PCR mixture.
  • PCR is conducted under conditions which facilitate recombination between the nucleic acid fragments.
  • PCR may be performed by resuspending the purified fragments at a concentration of 10-30ng/ ⁇ l in a solution of 0.2mM of each dNTP, 2.2mM MgC12, 50mM KCL, lOmM Tris HCl, pH 9.0, and 0.1%) Triton X-100.
  • oligonucleotides may be included in the PCR reactions.
  • the Klenow fragment of DNA polymerase I may be used in a first set of PCR reactions and Taq polymerase may be used in a subsequent set of PCR reactions. Recombinant sequences are isolated and the activities of the polypeptides they encode are assessed.
  • Variants may also be created by in vivo mutagenesis.
  • random mutations in a sequence of interest are generated by propagating the sequence of interest in a bacterial strain, such as an E. coli strain, which carries mutations in one or more of the DNA repair pathways.
  • a bacterial strain such as an E. coli strain
  • Such "mutator" strains have a higher random mutation rate than that of a wild-type parent. Propagating the DNA in one of these strains will eventually generate random mutations within the DNA.
  • Mutator strains suitable for use for in vivo mutagenesis are described in PCT Publication No. WO 91/16427, published October 31, 1991, entitled “Methods for Phenotype Creation from Multiple Gene Populations.”
  • cassette mutagenesis a small region of a double stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence.
  • the oligonucleotide often contains completely and/or partially randomized native sequence.
  • Recursive ensemble mutagenesis may also be used to generate variants.
  • Recursive ensemble mutagenesis is an algorithm for protein engineering (protein mutagenesis) developed to produce diverse populations of pheno typically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis. Recursive ensemble mutagenesis is described in Arkin, A.P. and Youvan, D.C., PNAS, USA, 89:7811-7815, 1992.
  • variants are created using exponential ensemble mutagenesis.
  • Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins.
  • Exponential ensemble mutagenesis is described in Delegrave, S. and Youvan, D.C., Biotechnology Research, 11:1548-1552, 1993. Random and site- directed mutagenesis are described in Arnold, F.H., Current Opinion in Biotechnology, 4:450-455, 1993.
  • the variants are created using shuffling procedures wherein portions of a plurality of nucleic acids which encode distinct polypeptides are fused together to create chimeric nucleic acid sequences which encode chimeric polypeptides as described in U.S. Patent No. 5,965,408, filed July 9, 1996, entitled, "Method of DNA Reassembly by Interrupting Synthesis", and U.S. Patent No.
  • variants of SEQ ED NO:2 may be variants in which one or more of the amino acid residues of SEQ ED NO:2 are substituted with a conserved or non-conserved amino acid residue (e.g., a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
  • a conserved or non-conserved amino acid residue e.g., a conserved amino acid residue
  • Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the following replacements: replacements of an aliphatic amino acid such as Alanine, Valine, Leucine and Isoleucine with another aliphatic amino acid; replacement of a Serine with a Threonine or vice versa; replacement of an acidic residue such as Aspartic acid and Glutamic acid with another acidic residue; replacement of a residue bearing an amide group, such as Asparagine and Glutamine, with another residue bearing an amide group; exchange of a basic residue such as Lysine and Arginine with another basic residue; and replacement of an aromatic residue such as Phenylalanine, Tyrosine with another aromatic residue. [00272] Other variants are those in which one or more of the amino acid residues of
  • SEQ ID NO:2 includes a substituent group.
  • polypeptide is associated with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol).
  • a compound to increase the half-life of the polypeptide for example, polyethylene glycol
  • Additional variants are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence or a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.
  • the fragments, derivatives and analogs retain the same biological function or activity as SEQ ID NO:2, and sequences substantially identical thereto.
  • the fragment, derivative, or analog includes a proprotein, such that the fragment, derivative, or analog can be activated by cleavage of the proprotein portion to produce an active polypeptide.
  • polypeptides or fragments thereof which have at least about 50%>, at least about 55%, at least about 60%, at least about 65%>, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to SEQ ED NO:2, and sequences substantially identical thereto, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40,
  • homology may be determined using any of the programs described above which aligns the polypeptides or fragments being compared and determines the extent of amino acid identity or similarity between them. It will be appreciated that amino acid "homology" includes conservative amino acid substitutions such as those described above.
  • the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures.
  • the sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing.
  • the sequence of the prospective homologous polypeptide or fragment can be compared to SEQ ED NO:2, and sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75,
  • Another aspect of the invention is an assay for identifying fragments or variants of SEQ ID NO:2, and sequences substantially identical thereto, which retain the enzymatic function of SEQ ID NO:2, and sequences substantially identical thereto.
  • the fragments or variants of said polypeptides may be used to catalyze biochemical reactions, which indicate that the fragment or variant retains the enzymatic activity of SEQ ID NO:2.
  • the assay for determining if fragments of variants retain the enzymatic activity of SEQ ED NO:2, and sequences substantially identical thereto includes the steps of; contacting the polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate.
  • SEQ ED NO:2 and sequences substantially identical thereto or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be used in a variety of applications.
  • the polypeptides or fragments thereof may be used to catalyze biochemical reactions.
  • a substance containing a glycosidic linkage e.g., a starch
  • SEQ ID NO:2 or sequences substantially identical thereto under conditions which facilitate the hydrolysis of the glycosidic linkage.
  • SEQ ID NO:2 and sequences substantially identical thereto or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may also be used to generate antibodies which bind specifically to the polypeptides or fragments.
  • the resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample.
  • a protein preparation such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.
  • the antibody is attached to a solid support, such as a bead or other column matrix.
  • the protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to SEQ ID NO:2, and sequences substantially identical thereto, or fragment thereof. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
  • binding may be determined using any of a variety of procedures familiar to those skilled in the art. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
  • 50, 75, 100, or 150 consecutive amino acids thereof can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, for example, a nonhuman.
  • the antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Nature, 256:495-497, 1975), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today 4:72,
  • Patent No. 4,946,778 can be adapted to produce single chain antibodies to SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20,
  • transgenic mice may be used to express humanized antibodies to these polypeptides or fragments thereof.
  • Antibodies generated against SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be used in screening for similar polypeptides from other organisms and samples. En such techniques, polypeptides from the organism are contacted with the antibody and those polypeptides which specifically bind the antibody are detected. Any of the procedures described above may be used to detect antibody binding. One such screening assay is described in "Methods for Measuring Cellulase
  • SEQ ED NO:l encompasses the nucleotide sequence of SEQ ID NO:l, and sequences substantially identical thereto, as well as sequences homologous to SEQ ID NO:l, and fragments thereof and sequences complementary to all of the preceding sequences.
  • the fragments include portions of SEQ ID NO:l
  • nucleotide sequences substantially identical thereto comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of SEQ ID NO:l, and sequences substantially identical thereto.
  • Homologous sequences and fragments of SEQ ID NO:l refer to a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%,
  • homology may be determined using any of the computer programs and parameters described herein, including
  • the homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, can be represented in the traditional single character format
  • polypeptide sequence of SEQ ID NO:2 encompasses the polypeptide sequence of SEQ ID NO:2, and sequences substantially identical thereto, which are encoded by a sequence as set forth in SEQ ID NO: 1 , polypeptide sequences homologous to SEQ ID NO:2, and sequences substantially identical thereto, or fragments of any of the preceding sequences.
  • homologous polypeptide sequences refer to a polypeptide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%,
  • homology may be determined using any of the computer programs and parameters described herein, including FASTA version 3.0t78 with the default parameters or with any modified parameters.
  • the homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error.
  • the polypeptide fragments comprise at least 5, 10, 15,
  • polypeptide codes as set forth in SEQ ID NO:2, and sequences substantially identical thereto can be represented in the traditional single character format or three letter format (See the inside back cover of Stryer, Lubert. Biochemistry, 3rd Ed.. W. H Freeman & Co., New York.) or in any other format which relates the identity of the polypeptides in a sequence.
  • the sequence of the invention can be stored, recorded, and manipulated on any medium which can be read and accessed by a computer. Accordingly, the invention provides computers, computer systems, computer readable mediums, computer programs products and the like recorded or stored thereon the nucleic acid and polypeptide sequences of the invention, e.g., the exemplary sequences SEQ ID NO:l, SEQ ED NO:2.
  • the words "recorded” and “stored” refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any known methods for recording information on a computer readable medium to generate manufactures comprising one or more of the nucleic acid and/or polypeptide sequences of the invention.
  • nucleic acid sequence as set forth in SEQ ID NO:l and a polypeptide sequence as set forth in SEQ ID NO:2 can be stored, recorded, and manipulated on any medium which can be read and accessed by a computer.
  • the words “recorded” and “stored” refer to a process for storing information on a computer medium.
  • a skilled artisan can readily adopt any of the presently known methods for recording information on a computer readable medium to generate manufactures comprising one or more of the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, one or more of the polypeptide sequences as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is a computer readable medium having recorded thereon at least 2, 5, 10, 15, or 20 nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto.
  • Another aspect of the invention is a computer readable medium having recorded thereon one or more of the nucleic acid sequences as set forth SEQ ID NO:l, and sequences substantially identical thereto.
  • Another aspect of the invention is a computer readable medium having recorded thereon one or more of the polypeptide sequences as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is a computer readable medium having recorded thereon at least 2, 5, 10, 15, or 20 of the sequences as set forth above.
  • Computer readable media include magnetically readable media, optically readable media, electronically readable media and magnetic/optical media.
  • the computer readable media may be a hard disk, a floppy disk, a magnetic tape, CD-ROM, Digital Versatile Disk (DVD), Random Access Memory (RAM), or Read Only Memory (ROM) as well as other types of other media known to those skilled in the art.
  • the invention include systems (e.g., internet based systems), particularly computer systems which store and manipulate the sequence information described herein.
  • One example of a computer system 100 is illustrated in block diagram form in Figure 1.
  • a computer system refers to the hardware components, software components, and data storage components used to analyze a nucleotide sequence of a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2.
  • the computer system 100 typically includes a processor for processing, accessing and manipulating the sequence data.
  • the processor 105 can be any well-known type of central processing unit, such as, for example, the Pentium Ell from Intel Co ⁇ oration, or similar processor from Sun, Motorola, Compaq, AMD or International Business Machines.
  • the computer system 100 is a general pu ⁇ ose system that comprises the processor 105 and one or more internal data storage components 110 for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components.
  • the computer system 100 includes a processor 105 connected to a bus which is connected to a main memory 115 (e.g., implemented as RAM) and one or more internal data storage devices 110, such as a hard drive and/or other computer readable media having data recorded thereon.
  • the computer system 100 further includes one or more data retrieving device 118 for reading the data stored on the internal data storage devices 110.
  • the data retrieving device 118 may represent, for example, a floppy disk drive, a compact disk drive, a magnetic tape drive, or a modem capable of connection to a remote data storage system (e.g., via the internet) etc.
  • the internal data storage device 110 is a removable computer readable medium such as a floppy disk, a compact disk, a magnetic tape, etc. containing control logic and/or data recorded thereon.
  • the computer system 100 may advantageously include or be programmed by appropriate software for reading the control logic and/or the data from the data storage component once inserted in the data retrieving device.
  • the computer system 100 includes a display 120 which is used to display output to a computer user.
  • the computer system 100 can be linked to other computer systems 125a-c in a network or wide area network to provide centralized access to the computer system 100.
  • Software for accessing and processing the nucleotide sequences of a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, may reside in main memory 115 during execution.
  • the computer system 100 may further comprise a sequence comparison algorithm for comparing a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, stored on a computer readable medium to a reference nucleotide or polypeptide sequence(s) stored on a computer readable medium.
  • a "sequence comparison algorithm” refers to one or more programs which are implemented (locally or remotely) on the computer system 100 to compare a nucleotide sequence with other nucleotide sequences and/or compounds stored within a data storage means.
  • sequence comparison algorithm may compare the nucleotide sequences of a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, stored on a computer readable medium to reference sequences stored on a computer readable medium to identify homologies or structural motifs.
  • sequence comparison programs identified elsewhere in this patent specification are particularly contemplated for use in this aspect of the invention. Protein and/or nucleic acid sequence homologies may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art.
  • Such algorithms and programs include, but are by no means limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al, J. Mol. Biol. 215(3):403-410, 1990; Thompson et al, Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al, Methods Enzymol. 266:383-402, 1996; Altschul et al, J. Mol. Biol. 215(3):403-410, 1990; Altschul et al, Nature Genetics 3:266-272, 1993).
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WE 53705.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WE 53705.
  • homology and “identity” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aligned for maximum correspondence over a comparison window or designated region as measured using any number of sequence comparison algorithms or by manual alignment and visual inspection.
  • sequence comparison For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequence for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol.
  • a number of genome databases are available, for example, a substantial portion of the human genome is available as part of the Human Genome Sequencing Project (Gibbs, 1995). At least twenty- one other genomes have already been sequenced, including, for example, M. genitalium (Fraser et al, 1995), M. jannaschii (Bult et al, 1996), H. influenzae (Fleischmann et al, 1995), E. coli (Blattner et al, 1997), and yeast (S. cerevisiae) (Mewes et al, 1997), andD. melanogaster (Adams et al, 2000).
  • BLAST and BLAST 2.0 algorithms are described in Altschul et al, Nuc. Acids Res. 25:3389- 3402, 1977, and Altschul et al, J. Mol. Biol. 215:403-410, 1990, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
  • This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence.
  • T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • HSPs high scoring sequence pairs
  • M Reward score for a pair of matching residues; always >0.
  • a scoring matrix is used to calculate the cumulative score.
  • Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873, 1993).
  • One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, or less than about 0.01, or less than about 0.001.
  • BLAST Basic Local Alignment Search Tool
  • five specific BLAST programs are used to perform the following task:
  • BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database
  • BLASTN compares a nucleotide query sequence against a nucleotide sequence database
  • BLASTX compares the six-frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database
  • [00306] (4) TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands); and
  • [00307] (5) TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
  • the BLAST programs identify homologous sequences by identifying similar segments, which are referred to herein as "high-scoring segment pairs," between a query amino or nucleic acid sequence and a test sequence which can be obtained from a protein or nucleic acid sequence database.
  • High-scoring segment pairs can be identified (i.e., aligned) by means of a scoring matrix, many of which are known in the art.
  • the scoring matrix can be BLOSUM62 matrix (Gonnet et al, Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61, 1993).
  • the PAM or PAM250 matrices may also be used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington:
  • the parameters used with the above algorithms may be adapted depending on the sequence length and degree of homology studied. In some aspects, the parameters may be the default parameters used by the algorithms in the absence of instructions from the user.
  • Figure 2 is a flow diagram illustrating one aspect of a process 200 for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
  • the database of sequences can be a private database stored within the computer system 100, or a public database such as GENBANK that is available through the Internet.
  • the process 200 begins at a start state 201 and then moves to a state 202 wherein the new sequence to be compared is stored to a memory in a computer system 100.
  • the memory could be any type of memory, including RAM or an internal storage device.
  • the process 200 then moves to a state 204 wherein a database of sequences is opened for analysis and comparison.
  • the process 200 then moves to a state 206 wherein the first sequence stored in the database is read into a memory on the computer.
  • a comparison is then performed at a state 210 to determine if the first sequence is the same as the second sequence. It is important to note that this step is not limited to performing an exact comparison between the new sequence and the first sequence in the database.
  • the process 200 moves to a state 214 wherein the name of the sequence from the database is displayed to the user. This state notifies the user that the sequence with the displayed name fulfills the homology constraints that were entered.
  • the process 200 moves to a decision state 218 wherein a determination is made whether more sequences exist in the database. If no more sequences exist in the database, then the process 200 terminates at an end state 220. However, if more sequences do exist in the database, then the process 200 moves to a state 224 wherein a pointer is moved to the next sequence in the database so that it can be compared to the new sequence.
  • the new sequence is aligned and compared with every sequence in the database. It should be noted that if a determination had been made at the decision state 212 that the sequences were not homologous, then the process 200 would move immediately to the decision state 218 in order to determine if any other sequences were available in the database for comparison.
  • one aspect of the invention is a computer system comprising a processor, a data storage device having stored thereon a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, a data storage device having retrievably stored thereon reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ID NO:, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, and a sequence comparer for conducting the comparison.
  • the sequence comparer may indicate a homology level between the sequences compared or identify structural motifs in the above described nucleic acid code of SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, or it may identify structural motifs in sequences which are compared to these nucleic acid codes and polypeptide codes.
  • the data storage device may have stored thereon the sequences of at least 2, 5, 10, 15, 20, 25, 30 or 40 or more of the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or the polypeptide sequences as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
  • Another aspect of the invention is a method for determining the level of homology between a nucleic acid sequence as set forth in SEQ ED NO: 1, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, and a reference nucleotide sequence.
  • the method including reading the nucleic acid code or the polypeptide code and the reference nucleotide or polypeptide sequence through the use of a computer program which determines homology levels and determining homology between the nucleic acid code or polypeptide code and the reference nucleotide or polypeptide sequence with the computer program.
  • the computer program may be any of a number of computer programs for determining homology levels, including those specifically enumerated herein, (e.g., BLAST2N with the default parameters or with any modified parameters).
  • the method may be implemented using the computer systems described above. The method may also be performed by reading at least 2, 5, 10, 15, 20, 25, 30 or 40 or more of the above described nucleic acid sequences as set forth in SEQ ID NO:l, or the polypeptide sequences as set forth in SEQ ID NO:2 through use of the computer program and determining homology between the nucleic acid codes or polypeptide codes and reference nucleotide sequences or polypeptide sequences.
  • Figure 3 is a flow diagram illustrating one aspect of a process 250 in a computer for determining whether two sequences are homologous.
  • the process 250 begins at a start state 252 and then moves to a state 254 wherein a first sequence to be compared is stored to a memory.
  • the second sequence to be compared is then stored to a memory at a state 256.
  • the process 250 then moves to a state 260 wherein the first character in the first sequence is read and then to a state 262 wherein the first character of the second sequence is read.
  • the sequence is a nucleotide sequence, then the character would normally be either A, T, C, G or U.
  • the sequence is a protein sequence, then it is can be in the single letter amino acid code so that the first and sequence sequences can be easily compared.
  • the level of homology is determined by calculating the proportion of characters between the sequences that were the same out of the total number of sequences in the first sequence. Thus, if every character in a first 100 nucleotide sequence aligned with a every character in a second sequence, the homology level would be 100%.
  • the computer program may be a computer program which compares the nucleotide sequences of a nucleic acid sequence as set forth in the invention, to one or more reference nucleotide sequences in order to determine whether the nucleic acid code of SEQ ED NO:l, and sequences substantially identical thereto, differs from a reference nucleic acid sequence at one or more positions.
  • such a program records the length and identity of inserted, deleted or substituted nucleotides with respect to the sequence of either the reference polynucleotide or a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto.
  • the computer program may be a program which determines whether a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, contains a single nucleotide polymo ⁇ hism (SNP) with respect to a reference nucleotide sequence.
  • another aspect of the invention is a method for determining whether a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, differs at one or more nucleotides from a reference nucleotide sequence comprising the steps of reading the nucleic acid code and the reference nucleotide sequence through use of a computer program which identifies differences between nucleic acid sequences and identifying differences between the nucleic acid code and the reference nucleotide sequence with the computer program.
  • the computer program is a program which identifies single nucleotide polymo ⁇ hisms. The method may be implemented by the computer systems described above and the method illustrated in Figure 3.
  • the method may also be performed by reading at least 2, 5, 10, 15, 20, 25, 30, or 40 or more of the nucleic acid sequences as set forth in SEQ ED NO:l, and sequences substantially identical thereto, and the reference nucleotide sequences through the use of the computer program and identifying differences between the nucleic acid codes and the reference nucleotide sequences with the computer program.
  • the computer based system may further comprise an identifier for identifying features within a nucleic acid sequence as set forth in SEQ ED NO:l or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
  • an “identifier” refers to one or more programs which identifies certain features within a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
  • the identifier may comprise a program which identifies an open reading frame in a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto.
  • Figure 5 is a flow diagram illustrating one aspect of an identifier process 300 for detecting the presence of a feature in a sequence.
  • the process 300 begins at a start state 302 and then moves to a state 304 wherein a first sequence that is to be checked for features is stored to a memory 115 in the computer system 100.
  • the process 300 then moves to a state 306 wherein a database of sequence features is opened.
  • a database would include a list of each feature's attributes along with the name of the feature. For example, a feature name could be
  • the features may be structural polypeptide motifs such as alpha helices, beta sheets, or functional polypeptide motifs such as enzymatic active sites, helix-turn-helix motifs or other motifs known to those skilled in the art.
  • the process 300 moves to a state 308 wherein the first feature is read from the database.
  • a comparison of the attribute of the first feature with the first sequence is then made at a state 310.
  • a determination is then made at a decision state 316 whether the attribute of the feature was found in the first sequence. If the attribute was found, then the process 300 moves to a state 318 wherein the name of the found feature is displayed to the user.
  • the process 300 then moves to a decision state 320 wherein a determination is made whether move features exist in the database. If no more features do exist, then the process 300 terminates at an end state 324.
  • the process 300 reads the next sequence feature at a state 326 and loops back to the state 310 wherein the attribute of the next feature is compared against the first sequence. It should be noted, that if the feature attribute is not found in the first sequence at the decision state 316, the process 300 moves directly to the decision state 320 in order to determine if any more features exist in the database.
  • another aspect of the invention is a method of identifying a feature within a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, comprising reading the nucleic acid code(s) or polypeptide code(s) through the use of a computer program which identifies features therein and identifying features within the nucleic acid code(s) with the computer program.
  • computer program comprises a computer program which identifies open reading frames. The method may be performed by reading a single sequence or at least 2, 5, 10, 15,
  • a nucleic acid sequence as set forth in SEQ ID NO: 1 , and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, may be stored and manipulated in a variety of data processor programs in a variety of formats.
  • a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto may be stored as text in a word processing file, such as MicrosoftWORD or WORDPERFECT or as an ASCIE file in a variety of database programs familiar to those of skill in the art, such as DB2, SYBASE, or ORACLE.
  • a word processing file such as MicrosoftWORD or WORDPERFECT
  • ASCIE file such as a variety of database programs familiar to those of skill in the art, such as DB2, SYBASE, or ORACLE.
  • sequence comparison algorithms may be used as sequence comparison algorithms, identifiers, or sources of reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • sequence comparison algorithms identifiers, or sources of reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
  • the programs and databases which may be used include, but are not limited to: MacPattern (EMBL), DiscoveryBase (Molecular Applications Group), GeneMine (Molecular Applications Group), Look (Molecular Applications Group), MacLook (Molecular Applications Group), BLAST and BLAST2 (NCB1), BLASTN and BLASTX (Altschul et al, J. Mol. Biol. 215: 403, 1990), FASTA (Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85: 2444, 1988), FASTDB (Brutlag et al. Comp. App. Biosci.
  • Motifs which may be detected using the above programs include sequences encoding leucine zippers, helix -turn-helix motifs, glycosylation sites, ubiquitination sites, alpha helices, and beta sheets, signal sequences encoding signal peptides which direct the secretion of the encoded proteins, sequences implicated in transcription regulation such as homeoboxes, acidic stretches, enzymatic active sites, substrate binding sites, and enzymatic cleavage sites.
  • the invention provides isolated or recombinant nucleic acids that hybridize under stringent conditions to an exemplary sequence of the invention, e.g., a sequence as set forth in SEQ ID NO: 1, or a nucleic acid that encodes a polypeptide comprising a sequence as set forth in SEQ ED NO:2.
  • the stringent conditions can be highly stringent conditions, medium stringent conditions, low stringent conditions, including the high and reduced stringency conditions described herein.
  • nucleic acids of the invention as defined by their ability to hybridize under stringent conditions can be between about five residues and the full length of the molecule of SEQ ID NO:l; e.g., they can be at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, 80, 90, 100, 150, 200, 250, 300, 350, 400 residues in length. Nucleic acids shorter than full length are also included. These nucleic acids are useful as, e.g., hybridization probes, labeling probes, PCR oligonucleotide probes, iRNA, antisense or sequences encoding antibody binding peptides (epitopes), motifs, active sites and the like.
  • nucleic acids of the invention are defined by their ability to hybridize under high stringency comprises conditions of about 50% formamide at about 37°C to 42°C. In one aspect, nucleic acids of the invention are defined by their ability to hybridize under reduced stringency comprising conditions in about 35% to 25 %> formamide at about 30°C to 35°C. Alternatively, nucleic acids of the invention are defined by their ability to hybridize under high stringency comprising conditions at 42°C in 50% formamide, 5X SSPE, 0.3% SDS, and a repetitive sequence blocking nucleic acid, such as cot-1 or salmon sperm DNA (e.g., 200 n/ml sheared and denatured salmon sperm DNA).
  • cot-1 or salmon sperm DNA e.g., 200 n/ml sheared and denatured salmon sperm DNA.
  • nucleic acids of the invention are defined by their ability to hybridize under reduced stringency conditions comprising 35% formamide at a reduced temperature of 35°C.
  • reduced stringency conditions comprising 35% formamide at a reduced temperature of 35°C.
  • the temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly.
  • Nucleic acids of the invention are also defined by their ability to hybridize under high, medium, and low stringency conditions as set forth in Ausubel and Sambrook. Variations on the above ranges and conditions are well known in the art.
  • nucleic acid hybridization reactions the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
  • Hybridization may be carried out under conditions of low stringency, moderate stringency or high stringency.
  • nucleic acid hybridization a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45°C in a solution consisting of 0.9 M NaCl, 50 mM NaH 2 PO 4 , pH 7.0, 5.0 mM Na 2 EDTA, 0.5% SDS, 10X Denhardt's, and 0.5 mg/ml polyriboadenylic acid. Approximately 2 X 10 7 cpm (specific activity 4-9 X 10 8 cpm/ug) of 32 P end- labeled oligonucleotide probe are then added to the solution.
  • the membrane is washed for 30 minutes at room temperature in IX SET (150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na 2 EDTA) containing 0.5% SDS, followed by a 30 minute wash in fresh IX SET at T m -10°C for the oligonucleotide probe.
  • IX SET 150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na 2 EDTA
  • the membrane is then exposed to auto-radiographic film for detection of hybridization signals.
  • Stringency may be varied by conducting the hybridization at varying temperatures below the melting temperatures of the probes.
  • the melting temperature, T m is the temperature (under defined ionic strength and pH) at which 50%> of the target sequence hybridizes to a perfectly complementary probe.
  • Very stringent conditions are selected to be equal to or about 5°C lower than the T m for a particular probe.
  • the melting temperature of the probe may be calculated using the following formulas:
  • T m melting temperature
  • Prehybridization may be carried out in 6X SSC, 5X Denhardt's reagent, 0.5%> SDS, lOO ⁇ g denatured fragmented salmon sperm DNA or 6X SSC, 5X Denhardt's reagent, 0.5%) SDS, lOO ⁇ g denatured fragmented salmon sperm DNA, 50% formamide.
  • the formulas for SSC and Denhardt's solutions are listed in Sambrook et al, supra.
  • Hybridization is conducted by adding the detectable probe to the prehybridization solutions listed above. Where the probe comprises double stranded DNA, it is denatured before addition to the hybridization solution. The filter is contacted with the hybridization solution for a sufficient period of time to allow the probe to hybridize to cDNAs or genomic DNAs containing sequences complementary thereto or homologous thereto. For probes over 200 nucleotides in length, the hybridization maybe carried out at 15-25°C below the T m . For shorter probes, such as oligonucleotide probes, the hybridization may be conducted at 5-10°C below the T m . Typically, for hybridizations in 6X SSC, the hybridization is conducted at approximately 68°C. Usually, for hybridizations in 50% formamide containing solutions, the hybridization is conducted at approximately 42°C. All of the foregoing hybridizations would be considered to be under conditions of high stringency.
  • the filter is washed to remove any non-specifically bound detectable probe.
  • the stringency used to wash the filters can also be varied depending on the nature of the nucleic acids being hybridized, the length of the nucleic acids being hybridized, the degree of complementarity, the nucleotide sequence composition (e.g., GC v. AT content), and the nucleic acid type (e.g., RNA v. DNA). Examples of progressively higher stringency condition washes are as follows: 2X SSC, 0.1 % SDS at room temperature for 15 minutes (low stringency); 0.1X SSC, 0.5% SDS at room temperature for 30 minutes to 1 hour (moderate stringency); 0.
  • the above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence.
  • less stringent conditions may be used.
  • the hybridization temperature may be decreased in increments of 5°C from 68°C to 42°C in a hybridization buffer having a Na+ concentration of approximately 1M.
  • the filter may be washed with 2X SSC, 0.5% SDS at the temperature of hybridization. These conditions are considered to be “moderate” conditions above 50°C and "low” conditions below 50°C.
  • a specific example of "moderate” hybridization conditions is when the above hybridization is conducted at 55°C.
  • hybridization may be carried out in buffers, such as 6X SSC, containing formamide at a temperature of 42°C.
  • concentration of formamide in the hybridization buffer may be reduced in 5%> increments from 50% to 0% to identify clones having decreasing levels of homology to the probe.
  • the filter may be washed with 6X SSC, 0.5%> SDS at 50°C. These conditions are considered to be “moderate” conditions above 25% formamide and "low” conditions below 25% formamide.
  • a specific example of "moderate” hybridization conditions is when the above hybridization is conducted at 30%> formamide.
  • a specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 10%> formamide.
  • the preceding methods may be used to isolate nucleic acids having a sequence with at least about 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, or at least 50%, homology to the nucleic acid sequence of SEQ ID NO:l, and sequences substantially identical thereto, or fragments comprising at least about 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases thereof, and the sequences complementary thereto. Homology may be measured using the alignment algorithm.
  • the homologous polynucleotides may have a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein.
  • allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NO:l or the sequences complementary thereto.
  • nucleic acids which encode polypeptides having at least about 99%>, at least 95%, at least 90%, at least
  • sequence alignment algorithm e.g., such as the FASTA version 3.0t78 algorithm with the default parameters.
  • Oligonucleotides probes and methods for using them
  • the invention also provides nucleic acid probes for identifying nucleic acids encoding a polypeptide with a cellulase activity.
  • the probe comprises at least
  • a probe of the invention can be at least about 5, 6, 7, 8 or 9 to about 40, about 10 to 50, about 20 to 60 about 30 to 70, consecutive bases of a sequence as set forth in SEQ ED NO:l.
  • the probes identify a nucleic acid by binding or hybridization.
  • the probes can be used in arrays of the invention, see discussion below, including, e.g., capillary arrays.
  • the probes of the invention can also be used to isolate other nucleic acids or polypeptides.
  • the probes of the invention can be used to determine whether a biological sample, such as a soil sample, contains an organism having a nucleic acid sequence of the invention or an organism from which the nucleic acid was obtained.
  • a biological sample potentially harboring the organism from which the nucleic acid was isolated is obtained and nucleic acids are obtained from the sample.
  • the nucleic acids are contacted with the probe under conditions which permit the probe to specifically hybridize to any complementary sequences present in the sample.
  • conditions which permit the probe to specifically hybridize to complementary sequences may be determined by placing the probe in contact with complementary sequences from samples known to contain the complementary sequence, as well as control sequences which do not contain the complementary sequence.
  • Hybridization conditions such as the salt concentration of the hybridization buffer, the formamide concentration of the hybridization buffer, or the hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to complementary nucleic acids (see discussion on specific hybridization conditions).
  • the isolated SEQ ID NO : 1 and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:l, and sequences substantially identical thereto, or the sequences complementary thereto may also be used as probes to determine whether a biological sample, such as a soil sample, contains an organism having a nucleic acid sequence of the invention or an organism from which the nucleic acid was obtained. En such procedures, a biological sample potentially harboring the organism from which the nucleic acid was isolated is obtained and nucleic acids are obtained from the sample. The nucleic acids are contacted with the probe under conditions which permit the probe to specifically hybridize to any complementary sequences from which are present therein.
  • conditions which permit the probe to specifically hybridize to complementary sequences may be determined by placing the probe in contact with complementary sequences from samples known to contain the complementary sequence as well as control sequences which do not contain the complementary sequence.
  • Hybridization conditions such as the salt concentration of the hybridization buffer, the formamide concentration of the hybridization buffer, or the hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to complementary nucleic acids.
  • Hybridization may be detected by labeling the probe with a detectable agent such as a radioactive isotope, a fluorescent dye or an enzyme capable of catalyzing the formation of a detectable product.
  • detectable agent such as a radioactive isotope, a fluorescent dye or an enzyme capable of catalyzing the formation of a detectable product.
  • Many methods for using the labeled probes to detect the presence of complementary nucleic acids in a sample are familiar to those skilled in the art. These include Southern Blots, Northern Blots, colony hybridization procedures, and dot blots. Protocols for each of these procedures are provided in Ausubel et al. Current Protocols in Molecular Biology.
  • more than one probe may be used in an amplification reaction to determine whether the sample contains an organism containing a nucleic acid sequence of the invention (e.g., an organism from which the nucleic acid was isolated).
  • the probes comprise oligonucleotides.
  • the amplification reaction may comprise a PCR reaction.
  • the amplification may comprise a ligase chain reaction, 3SR, or strand displacement reaction.
  • the nucleic acids in the sample are contacted with the probes, the amplification reaction is performed, and any resulting amplification product is detected.
  • the amplification product may be detected by performing gel electrophoresis on the reaction products and staining the gel with an intercalator such as ethidium bromide.
  • an intercalator such as ethidium bromide.
  • one or more of the probes may be labeled with a radioactive isotope and the presence of a radioactive amplification product may be detected by autoradiography after gel electrophoresis.
  • sequences substantially identical thereto may also be used in chromosome walking procedures to identify clones containing genomic sequences located adjacent to the sequence of SEQ ID NO:l, and sequences substantially identical thereto. Such methods allow the isolation of genes which encode additional proteins from the host organism.
  • the related nucleic acids may be cDNAs or genomic DNAs from organisms other than the one from which the nucleic acid was isolated.
  • the other organisms may be related organisms.
  • a nucleic acid sample is contacted with the probe under conditions which permit the probe to specifically hybridize to related sequences. Hybridization of the probe to nucleic acids from the related organism is then detected using any of the methods described above. Inhibiting Expression of a Cellulase
  • the invention further provides for nucleic acids complementary to (e.g., antisense sequences to) the nucleic acid sequences of the invention.
  • Antisense sequences are capable of inhibiting the transport, splicing or transcription of cellulase-encoding genes. The inhibition can be effected through the targeting of genomic DNA or messenger RNA. The transcription or function of targeted nucleic acid can be inhibited, for example, by hybridization and/or cleavage.
  • One particularly useful set of inhibitors provided by the present invention includes oligonucleotides which are able to either bind cellulase gene or message, in either case preventing or inhibiting the production or function of a cellulase enzyme. The association can be though sequence specific hybridization.
  • Another useful class of inhibitors includes oligonucleotides which cause inactivation or cleavage of cellulase message.
  • the oligonucleotide can have enzyme activity which causes such cleavage, such as ribozymes.
  • the oligonucleotide can be chemically modified or conjugated to an enzyme or composition capable of cleaving the complementary nucleic acid. One may screen a pool of many different such oligonucleotides for those with the desired activity.
  • the invention provides antisense oligonucleotides capable of binding cellulase message which can inhibit cellulase activity by targeting mRNA.
  • Strategies for designing antisense oligonucleotides are well described in the scientific and patent literature, and the skilled artisan can design such cellulase oligonucleotides using the novel reagents of the invention.
  • gene walking/ RNA mapping protocols to screen for effective antisense oligonucleotides are well known in the art, see, e.g., Ho (2000) Methods Enzymol. 314:168-183, describing an RNA mapping assay, which is based on standard molecular techniques to provide an easy and reliable method for potent antisense sequence selection. See also Smith (2000) Euro. J. Pharm. Sci. 11:191-198.
  • Naturally occurring nucleic acids are used as antisense oligonucleotides.
  • the antisense oligonucleotides can be of any length; for example, in alternative aspects, the antisense oligonucleotides are between about 5 to 100, about 10 to 80, about 15 to 60, about 18 to 40. The optimal length can be determined by routine screening. The antisense oligonucleotides can be present at any concentration. The optimal concentration can be determined by routine screening. A wide variety of synthetic, non-naturally occurring nucleotide and nucleic acid analogues are known which can address this potential problem.
  • PNAs peptide nucleic acids
  • non-ionic backbones such as N-(2- aminoethyl) glycine units
  • Antisense oligonucleotides having phosphorothioate linkages can also be used, as described in WO 97/03211; WO 96/39154;
  • Antisense oligonucleotides having synthetic DNA backbone analogues provided by the invention can also include phosphoro-dithioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate, and mo ⁇ holino carbamate nucleic acids, as described above.
  • Combinatorial chemistry methodology can be used to create vast numbers of oligonucleotides that can be rapidly screened for specific oligonucleotides that have appropriate binding affinities and specificities toward any target, such as the sense and antisense cellulase sequences of the invention (see, e.g., Gold (1995) J. of Biol. Chem.
  • the invention provides for with ribozymes capable of binding cellulase message which can inhibit cellulase enzyme activity by targeting mRNA.
  • ribozymes capable of binding cellulase message which can inhibit cellulase enzyme activity by targeting mRNA.
  • Strategies for designing ribozymes and selecting the cellulase-specific antisense sequence for targeting are well described in the scientific and patent literature, and the skilled artisan can design such ribozymes using the novel reagents of the invention.
  • Ribozymes act by binding to a target RNA through the target RNA binding portion of a ribozyme which is held in close proximity to an enzymatic portion of the RNA that cleaves the target RNA.
  • the ribozyme recognizes and binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cleave and inactivate the target RNA.
  • Cleavage of a target RNA in such a manner will destroy its ability to direct synthesis of an encoded protein if the cleavage occurs in the coding sequence. After a ribozyme has bound and cleaved its RNA target, it is typically released from that RNA and so can bind and cleave new targets repeatedly.
  • a ribozyme can be advantageous over other technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its transcription, translation or association with another molecule) as the effective concentration of ribozyme necessary to effect a therapeutic treatment can be lower than that of an antisense oligonucleotide.
  • antisense technology where a nucleic acid molecule simply binds to a nucleic acid target to block its transcription, translation or association with another molecule
  • This potential advantage reflects the ability of the ribozyme to act enzymatically.
  • a single ribozyme molecule is able to cleave many molecules of target RNA.
  • a ribozyme is typically a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechanism of binding, but also on the mechanism by which the molecule inhibits the expression of the RNA to which it binds. That is, the inhibition is caused by cleavage of the RNA target and so specificity is defined as the ratio of the rate of cleavage of the targeted RNA over the rate of cleavage of non-targeted RNA. This cleavage mechanism is dependent upon factors additional to those involved in base pairing. Thus, the specificity of action of a ribozyme can be greater than that of antisense oligonucleotide binding the same RNA site.
  • the enzymatic ribozyme RNA molecule can be formed in a hammerhead motif, but may also be formed in the motif of a hai ⁇ in, hepatitis delta virus, group I intron or RNase P-like RNA (in association with an RNA guide sequence).
  • hammerhead motifs are described by Rossi (1992) Aids Research and Human Retroviruses 8:183; hai ⁇ in motifs by Hampel (1989) Biochemistry 28:4929, and Hampel (1990) Nue Acids Res.
  • RNA molecule of this invention has a specific substrate binding site complementary to one or more of the target gene RNA regions, and has nucleotide sequence within or surrounding that substrate binding site which imparts an RNA cleaving activity to the molecule.
  • the invention provides methods of generating variants of the nucleic acids of the invention, e.g., those encoding a cellulase enzyme. These methods can be repeated or used in various combinations to generate cellulase enzymes having an altered or different activity or an altered or different stability from that of a cellulase encoded by the template nucleic acid. These methods also can be repeated or used in various combinations, e.g., to generate variations in gene/ message expression, message translation or message stability.
  • the genetic composition of a cell is altered by, e.g., modification of a homologous gene ex vivo, followed by its reinsertion into the cell.
  • a nucleic acid of the invention can be altered by any means. For example, random or stochastic methods, or, non-stochastic, or "directed evolution," methods.
  • Methods for random mutation of genes are well known in the art, see, e.g., U.S. Patent No. 5,830,696.
  • mutagens can be used to randomly mutate a gene. Mutagens include, e.g., ultraviolet light or gamma irradiation, or a chemical mutagen, e.g., mitomycin, nitrous acid, photoactivated psoralens, alone or in combination, to induce DNA breaks amenable to repair by recombination.
  • Other chemical mutagens include, for example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid.
  • Other mutagens are analogues of nucleotide precursors, e.g., nitrosoguanidine, 5-bromouracil, 2- aminopurine, or acridine. These agents can be added to a PCR reaction in place of the nucleotide precursor thereby mutating the sequence.
  • Intercalating agents such as proflavine, acriflavine, quinacrine and the like can also be used. [ 00355 ] Any technique in molecular biology can be used, e.g., random PCR mutagenesis, see, e.g., Rice (1992) Proc.
  • nucleic acids e.g., genes
  • can be reassembled after random, or "stochastic," fragmentation see, e.g., U.S. Patent Nos. 6,291,242; 6,287,862; 6,287,861; 5,955,358; 5,830,721; 5,824,514; 5,811,238; 5,605,793.
  • modifications, additions or deletions are introduced by error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR), recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair- deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation
  • Mutational methods of generating diversity include, for example, site- directed mutagenesis (Ling et al. (1997) "Approaches to DNA mutagenesis: an overview" Anal Biochem. 254(2): 157-178; Dale et al. (1996) “Oligonucleotide-directed random mutagenesis using the phosphorothioate method” Methods Mol. Biol. 57:369-374; Smith (1985) "In vitro mutagenesis” Ann. Rev. Genet. 19:423-462; Botstein & Shortle (1985) "Strategies and applications of in vitro mutagenesis” Science 229:1193-1201; Carter (1986) "Site-directed mutagenesis” Biochem.
  • Additional protocols used in the methods of the invention include point mismatch repair (Kramer (1984) "Point Mismatch Repair” Cell 38:879-887), mutagenesis using repair-deficient host strains (Carter et al. (1985) "Improved oligonucleotide site- directed mutagenesis using M13 vectors" Nucl. Acids Res. 13: 4431-4443; and Carter
  • Non-stochastic, or "directed evolution,” methods include, e.g., saturation mutagenesis (GSSM), synthetic ligation reassembly (SLR), or a combination thereof are used to modify the nucleic acids of the invention to generate cellulases with new or altered properties (e.g., activity under highly acidic or alkaline conditions, high temperatures, and the like).
  • Polypeptides encoded by the modified nucleic acids can be screened for an activity before testing for an cellulase or other activity. Any testing modality or protocol can be used, e.g., using a capillary array platform. See, e.g., U.S. Patent Nos. 6,280,926; 5,939,250.
  • non-stochastic gene modification a "directed evolution process” is used to generate cellulases with new or altered properties. Variations of this method have been termed “gene site-saturation mutagenesis,” “site-saturation mutagenesis,” “saturation mutagenesis” or simply “GSSM.” It can be used in combination with other mutagenization processes. See, e.g., U.S. Patent Nos. 6,171,820; 6,238,884.
  • GSSM comprises providing a template polynucleotide and a plurality of oligonucleotides, wherein each oligonucleotide comprises a sequence homologous to the template polynucleotide, thereby targeting a specific sequence of the template polynucleotide, and a sequence that is a variant of the homologous gene; generating progeny polynucleotides comprising non-stochastic sequence variations by replicating the template polynucleotide with the oligonucleotides, thereby generating polynucleotides comprising homologous gene sequence variations.
  • the invention also provides for the use of proprietary codon primers (containing a degenerate N,N,N sequence) to introduce point mutations into a polynucleotide, so as to generate a set of progeny polypeptides in which a full range of single amino acid substitutions is represented at each amino acid position (gene site saturated mutagenesis (GSSM)).
  • GSSM gene site saturated mutagenesis
  • the oligos used are comprised contiguously of a first homologous sequence, a degenerate N,N,N sequence, and can be a second homologous sequence.
  • downstream progeny translational products from the use of such oligos include all possible amino acid changes at each amino acid site along the polypeptide, because the degeneracy of the N,N,N sequence includes codons for all 20 amino acids.
  • N,N,N cassette is used for subjecting each original codon in a parental polynucleotide template to a full range of codon substitutions.
  • N,N,N cassettes are used - either in the same oligo or not, for subjecting at least two original codons in a parental polynucleotide template to a full range of codon substitutions.
  • N,N,N sequence can be contained in one oligo to introduce amino acid mutations at more than one site.
  • This plurality of N,N,N sequences can be directly contiguous, or separated by one or more additional nucleotide sequence(s).
  • oligos serviceable for introducing additions and deletions can be used either alone or in combination with the codons containing an N,N,N sequence, to introduce any combination or permutation of amino acid additions, deletions, and/or substitutions.
  • N,N,N triplets i.e. a degenerate (N,N,N) n sequence.
  • the present invention provides for the use of degenerate cassettes having less degeneracy than the N,N,N sequence.
  • N,N,G/T or an N,N, G/C triplet sequence as disclosed in the instant invention is advantageous for several reasons.
  • this invention provides a means to systematically and fairly easily generate the substitution of the full range of possible amino acids (for a total of 20 amino acids) into each and every amino acid position in a polypeptide.
  • the invention provides a way to systematically and fairly easily generate 2000 distinct species (i.e., 20 possible amino acids per position times 100 amino acid positions). It is appreciated that there is provided, through the use of an oligo containing a degenerate N,N,G/T or an N,N, G/C triplet sequence, 32 individual sequences that code for 20 possible amino acids.
  • each saturation mutagenesis reaction vessel contains polynucleotides encoding at least 20 progeny polypeptide molecules such that all 20 amino acids are represented at the one specific amino acid position corresponding to the codon position mutagenized in the parental polynucleotide.
  • the 32-fold degenerate progeny polypeptides generated from each saturation mutagenesis reaction vessel can be subjected to clonal amplification (e.g., cloned into a suitable E.
  • progeny polypeptide When an individual progeny polypeptide is identified by screening to display a favorable change in property (when compared to the parental polypeptide), it can be sequenced to identify the correspondingly favorable amino acid substitution contained therein. It is appreciated that upon mutagenizing each and every amino acid position in a parental polypeptide using saturation mutagenesis as disclosed herein, favorable amino acid changes may be identified at more than one amino acid position. One or more new progeny molecules can be generated that contain a combination of all or part of these favorable amino acid substitutions.
  • the permutations include 3 possibilities at each position (no change from the original amino acid, and each of two favorable changes) and 3 positions.
  • site-saturation mutagenesis can be used together with shuffling, chimerization, recombination and other mutagenizing processes, along with screening.
  • This invention provides for the use of any mutagenizing process(es), including saturation mutagenesis, in an iterative manner. n one exemplification, the iterative use of any mutagenizing process(es) is used in combination with screening.
  • this invention provides for the use of saturation mutagenesis in combination with additional mutagenization processes, such as process where two or more related polynucleotides are introduced into a suitable host cell such that a hybrid polynucleotide is generated by recombination and reductive reassortment.
  • mutagenesis can be use to replace each of any number of bases in a polynucleotide sequence, wherein the number of bases to be mutagenized can be every integer from 15 to 100,000.
  • the number of bases to be mutagenized can be every integer from 15 to 100,000.
  • a separate nucleotide is used for mutagenizing each position or group of positions along a polynucleotide sequence.
  • a group of 3 positions to be mutagenized may be a codon.
  • the mutations can be introduced using a mutagenic primer, containing a heterologous cassette, also referred to as a mutagenic cassette.
  • Cassettes can have from 1 to 500 bases. Each nucleotide position in such heterologous cassettes be N, A, C, G, T, A/C, A G, A/T, C/G, C/T, G/T, C/G/T, C/G/T,
  • saturation mutagenesis is comprised of mutagenizing a complete set of mutagenic cassettes (wherein each cassette can be about 1-500 bases in length) in defined polynucleotide sequence to be mutagenized (wherein the sequence to be mutagemzed can be from about 15 to 100,000 bases in length).
  • each cassette can be about 1-500 bases in length
  • defined polynucleotide sequence to be mutagenized wherein the sequence to be mutagemzed can be from about 15 to 100,000 bases in length.
  • a grouping of mutations to be introduced into one cassette can be different or the same from a second grouping of mutations to be introduced into a second cassette during the application of one round of saturation mutagenesis.
  • Such groupings are exemplified by deletions, additions, groupings of particular codons, and groupings of particular nucleotide cassettes.
  • sequences to be mutagenized include a whole gene, pathway, cDNA, an entire open reading frame (ORF), and entire promoter, enhancer, repressor/transactivator, origin of replication, intron, operator, or any polynucleotide functional group.
  • a "defined sequences" for this pu ⁇ ose may be any polynucleotide that a 15 base-polynucleotide sequence, and polynucleotide sequences of lengths between 15 bases and 15,000 bases (this invention specifically names every integer in between). Considerations in choosing groupings of codons include types of amino acids encoded by a degenerate mutagenic cassette.
  • a grouping of mutations can be introduced into a mutagenic cassette to provide for degenerate codon substitutions (using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids at each position, and a library of polypeptides encoded thereby.
  • One aspect of the invention is an isolated nucleic acid comprising the sequence SEQ ID NO.: 1, and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:l (or the sequences complementary thereto).
  • the isolated, nucleic acids may comprise DNA, including cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the isolated nucleic acids may comprise RNA. Synthetic Ligation Reassembly (SLR)
  • the invention provides a non-stochastic gene modification system termed "synthetic ligation reassembly,” or simply “SLR,” a “directed evolution process,” to generate cellulases with new or altered properties.
  • SLR is a method of ligating oligonucleotide fragments together non-stochastically. This method differs from stochastic oligonucleotide shuffling in that the nucleic acid building blocks are not shuffled, concatenated or chimerized randomly, but rather are assembled non-stochastically. See, e.g., U.S. Patent Application Serial No.
  • SLR comprises the following steps: (a) providing a template polynucleotide, wherein the template polynucleotide comprises sequence encoding a homologous gene; (b) providing a plurality of building block polynucleotides, wherein the building block polynucleotides are designed to cross-over reassemble with the template polynucleotide at a predetermined sequence, and a building block polynucleotide comprises a sequence that is a variant of the homologous gene and a sequence homologous to the template polynucleotide flanking the variant sequence; (c) combining a building block polynucleotide with a template polynucleotide such that the building block polynucleotide cross-over reassembles with the template polynucle
  • the present invention provides a non-stochastic method termed synthetic gene reassembly, that is somewhat related to stochastic shuffling, save that the nucleic acid building blocks are not shuffled or concatenated or chimerized randomly, but rather are assembled non-stochastically.
  • the SLR method does not depend on the presence of a high level of homology between polynucleotides to be shuffled.
  • the invention can be used to non- stochastically generate libraries (or sets) of progeny molecules comprised of over 10 100 different chimeras. Conceivably, SLR can even be used to generate libraries comprised of over io 1000 different progeny chimeras.
  • the invention provides a non-stochastic method of producing a set of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised of the steps of generating by design a plurality of specific nucleic acid building blocks having serviceable mutually compatible ligatable ends, and assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved.
  • the mutually compatible ligatable ends of the nucleic acid building blocks to be assembled are considered to be "serviceable" for this type of ordered assembly if they enable the building blocks to be coupled in predetermined orders.
  • the overall assembly order in which the nucleic acid building blocks can be coupled is specified by the design of the ligatable ends and, if more than one assembly step is to be used, then the overall assembly order in which the nucleic acid building blocks can be coupled is also specified by the sequential order of the assembly step(s).
  • the annealed building pieces are treated with an enzyme, such as a ligase (e.g., T4 DNA ligase) to achieve covalent bonding of the building pieces.
  • a ligase e.g., T4 DNA ligase
  • nucleic acid building blocks is obtained upon analysis of the sequences of a set of progenitor nucleic acid templates that serve as a basis for producing a progeny set of finalized chimeric nucleic acid molecules.
  • progenitor nucleic acid templates thus serve as a source of sequence information that aids in the design of the nucleic acid building blocks that are to be mutagenized, i.e. chimerized or shuffled.
  • the invention provides for the chimerization of a family of related genes and their encoded family of related products.
  • the encoded products are enzymes.
  • the cellulase of the present invention can be mutagenized in accordance with the methods described herein.
  • the sequences of a plurality of progenitor nucleic acid templates are aligned in order to select one or more demarcation points, which demarcation points can be located at an area of homology.
  • the demarcation points can be used to delineate the boundaries of nucleic acid building blocks to be generated.
  • the demarcation points identified and selected in the progenitor molecules serve as potential chimerization points in the assembly of the progeny molecules.
  • a serviceable demarcation point is an area of homology
  • a demarcation point (comprised of at least one homologous nucleotide base) shared by at least two progenitor templates, but the demarcation point can be an area of homology that is shared by at least half of the progenitor templates, at least two thirds of the progenitor templates, at least three fourths of the progenitor templates, or almost all of the progenitor templates.
  • a serviceable demarcation point is an area of homology that is shared by all of the progenitor templates.
  • the gene reassembly process is performed exhaustively in order to generate an exhaustive library.
  • all possible ordered combinations of the nucleic acid building blocks are represented in the set of finalized chimeric nucleic acid molecules.
  • the assembly order i.e. the order of assembly of each building block in the 5' to 3 sequence of each finalized chimeric nucleic acid
  • the assembly order is by design (or non-stochastic). Because of the non-stochastic nature of the method, the possibility of unwanted side products is greatly reduced.
  • the method provides that the gene reassembly process is performed systematically, for example to generate a systematically compartmentalized library, with compartments that can be screened systematically, e.g., one by one.
  • the invention provides that, through the selective and judicious use of specific nucleic acid building blocks, coupled with the selective and judicious use of sequentially stepped assembly reactions, an experimental design can be achieved where specific sets of progeny products are made in each of several reaction vessels. This allows a systematic examination and screening procedure to be performed. Thus, it allows a potentially very large number of progeny molecules to be examined systematically in smaller groups.
  • the instant invention provides for the generation of a library (or set) comprised of a large number of progeny molecules.
  • the progeny molecules generated can comprise a library of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design.
  • a generated library is comprised of greater than 10 3 to greater than io 1000 different progeny molecular species.
  • a set of finalized chimeric nucleic acid molecules, produced as described is comprised of a polynucleotide encoding a polypeptide.
  • this polynucleotide is a gene, which may be a man-made gene.
  • this polynucleotide is a gene pathway, which may be a man-made gene pathway.
  • the invention provides that one or more man-made genes generated by the invention may be inco ⁇ orated into a man-made gene pathway, such as pathway operable in a eukaryotic organism (including a plant).
  • the synthetic nature of the step in which the building blocks are generated allows the design and introduction of nucleotides (e.g., one or more nucleotides, which may be, for example, codons or introns or regulatory sequences) that can later be optionally removed in an in vitro process (e.g., by mutagenesis) or in an in vivo process (e.g., by utilizing the gene splicing ability of a host organism). It is appreciated that in many instances the introduction of these nucleotides may also be desirable for many other reasons in addition to the potential benefit of creating a serviceable demarcation point.
  • nucleotides e.g., one or more nucleotides, which may be, for example, codons or introns or regulatory sequences
  • the invention provides that a nucleic acid building block can be used to introduce an intron.
  • the invention provides that functional introns may be introduced into a man-made gene of the invention.
  • the invention also provides that functional introns may be introduced into a man-made gene pathway of the invention.
  • the invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially introduced intron(s).
  • the invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced intron(s).
  • the artificially introduced intron(s) are functional in one or more host cells for gene splicing much in the way that naturally-occurring introns serve functionally in gene splicing.
  • the invention provides a process of producing man- made intron-containing polynucleotides to be introduced into host organisms for recombination and/or splicing.
  • a man-made gene produced using the invention can also serve as a substrate for recombination with another nucleic acid.
  • a man-made gene pathway produced using the invention can also serve as a substrate for recombination with another nucleic acid.
  • the recombination is facilitated by, or occurs at, areas of homology between the man-made, intron-containing gene and a nucleic acid, which serves as a recombination partner.
  • the recombination partner may also be a nucleic acid generated by the invention, including a man-made gene or a man-made gene pathway.
  • the synthetic gene reassembly method of the invention utilizes a plurality of nucleic acid building blocks, each of which can have two ligatable ends.
  • the two ligatable ends on each nucleic acid building block may be two blunt ends (i.e. each having an overhang of zero nucleotides), or one blunt end and one overhang, or two overhangs.
  • a useful overhang for this pu ⁇ ose may be a 3 ' overhang or a 5 ' overhang.
  • a nucleic acid building block may have a 3 ' overhang or alternatively a 5 ' overhang or alternatively two 3' overhangs or alternatively two 5' overhangs.
  • the overall order in which the nucleic acid building blocks are assembled to form a finalized chimeric nucleic acid molecule is determined by pu ⁇ oseful experimental design and is not random.
  • a nucleic acid building block is generated by chemical synthesis of two single-stranded nucleic acids (also referred to as single-stranded oligos) and contacting them so as to allow them to anneal to form a double-stranded nucleic acid building block.
  • a double-stranded nucleic acid building block can be of variable size.
  • Sizes for building block range can be from 1 base pair (bp) (not including any overhangs) to 100,000 base pairs (not including any overhangs). Other size ranges are also provided, which have lower limits of from 1 bp to 10,000 bp (including every integer value in between), and upper limits of from 2 bp to 100, 000 bp (including every integer value in between). Many methods exist by which a double-stranded nucleic acid building block can be generated that is serviceable for the invention; and these are known in the art and can be readily performed by the skilled artisan.
  • a double-stranded nucleic acid building block is generated by first generating two single stranded nucleic acids and allowing them to anneal to form a double-stranded nucleic acid building block.
  • the two strands of a double- stranded nucleic acid building block may be complementary at every nucleotide apart from any that form an overhang; thus containing no mismatches, apart from any overhang(s).
  • the two strands of a double-stranded nucleic acid building block are complementary at fewer than every nucleotide apart from any that form an overhang.
  • a double-stranded nucleic acid building block can be used to introduce codon degeneracy.
  • the codon degeneracy can be introduced using the site-saturation mutagenesis described herein, using one or more N,N,G/T cassettes or alternatively using one or more N,N,N cassettes.
  • the in vivo recombination method of the invention can be performed blindly on a pool of unknown hybrids or alleles of a specific polynucleotide or sequence. However, it is not necessary to know the actual DNA or RNA sequence of the specific polynucleotide.
  • the approach of using recombination within a mixed population of genes can be useful for the generation of any useful proteins, for example, interleukin I, antibodies, tPA and growth hormone.
  • This approach may be used to generate proteins having altered specificity or activity.
  • the approach may also be useful for the generation of hybrid nucleic acid sequences, for example, promoter regions, introns, exons, enhancer sequences, 31 untranslated regions or 51 untranslated regions of genes.
  • This approach may be used to generate genes having increased rates of expression.
  • This approach may also be useful in the study of repetitive DNA sequences.
  • this approach may be useful to mutate ribozymes or aptamers.
  • En one aspect the invention described herein is directed to the use of repeated cycles of reductive reassortment, recombination and selection which allow for the directed molecular evolution of highly complex linear sequences, such as DNA, RNA or proteins thorough recombination.
  • the invention includes a method for producing a hybrid polynucleotide from at least a first polynucleotide and a second polynucleotide.
  • the invention can be used to produce a hybrid polynucleotide by introducing at least a first polynucleotide and a second polynucleotide which share at least one region of partial sequence homology into a suitable host cell.
  • the regions of partial sequence homology promote processes wliich result in sequence reorganization producing a hybrid polynucleotide.
  • hybrid polynucleotide is any nucleotide sequence which results from the method of the present invention and contains sequence from at least two original polynucleotide sequences. Such hybrid polynucleotides can result from intermolecular recombination events which promote sequence integration between DNA molecules. In addition, such hybrid polynucleotides can result from intramolecular reductive reassortment processes which utilize repeated sequences to alter a nucleotide sequence within a DNA molecule.
  • the invention provides methods for modifying cellulase-encoding nucleic acids to modify codon usage.
  • the invention provides methods for modifying codons in a nucleic acid encoding a cellulase to increase or decrease its expression in a host cell.
  • the invention also provides nucleic acids encoding a cellulase modified to increase its expression in a host cell, cellulase enzymes so modified, and methods of making the modified cellulase enzymes.
  • the method comprises identifying a "non-preferred” or a "less preferred” codon in cellulase-encoding nucleic acid and replacing one or more of these non-prefe ⁇ ed or less preferred codons with a "preferred codon” encoding the same amino acid as the replaced codon and at least one non-preferred or less preferred codon in the nucleic acid has been replaced by a preferred codon encoding the same amino acid.
  • a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell.
  • Host cells for expressing the nucleic acids, expression cassettes and vectors of the invention include bacteria, yeast, fungi, plant cells, insect cells and mammalian cells.
  • the invention provides methods for optimizing codon usage in all of these cells, codon-altered nucleic acids and polypeptides made by the codon-altered nucleic acids.
  • Exemplary host cells include gram negative bacteria, such as Escherichia coli and Pseudomonas fluorescens; gram positive bacteria, such as Streptomyces diversa, Lactobacillus gasseri, Lactococcus lactis, Lactococcus cremoris, Bacillus subtilis.
  • Exemplary host cells also include eukaryotic organisms, e.g., various yeast, such as Saccharomyces sp., including Saccharomyces cerevisiae, Schizosaccharomycespom.be, Pichia pastoris, and Kluyveromyces lactis, Hansenula polymorpha, Aspergillus niger, and mammalian cells and cell lines and insect cells and cell lines.
  • yeast such as Saccharomyces sp., including Saccharomyces cerevisiae, Schizosaccharomycespom.be, Pichia pastoris, and Kluyveromyces lactis, Hansenula polymorpha, Aspergillus niger, and mammalian cells and cell lines and insect cells and cell lines.
  • the codons of a nucleic acid encoding an cellulase isolated from a bacterial cell are modified such that the nucleic acid is optimally expressed in a bacterial cell different from the bacteria from which the cellulase was derived, a yeast, a fungi, a plant cell, an insect cell or a mammalian cell.
  • Methods for optimizing codons are well known in the art, see, e.g., U.S. Patent No. 5,795,737; Baca (2000) Ent. J. Parasitol.
  • the invention provides transgenic non-human animals comprising a nucleic acid, a polypeptide, an expression cassette or vector or a transfected or transformed cell of the invention.
  • the transgenic non-human animals can be, e.g., goats, rabbits, sheep, pigs, cows, rats and mice, comprising the nucleic acids of the invention. These animals can be used, e.g., as in vivo models to study cellulase activity, or, as models to screen for modulators of cellulase activity in vivo.
  • the coding sequences for the polypeptides to be expressed in the transgenic non-human animals can be designed to be constitutive, or, under the control of tissue-specific, developmental-specific or inducible transcriptional regulatory factors.
  • Transgenic non-human animals can be designed and generated using any method known in the art; see, e.g., U.S. Patent Nos. 6,211,428; 6,187,992; 6,156,952;
  • the transgenic or modified animals of the invention can also be used to practice the methods of the invention.
  • the transgenic or modified animals of the invention comprise a "knockout animal,” e.g., a “knockout mouse,” engineered not to express or to be unable to express a cellulase.
  • transgenic non-human organisms which contain a heterologous sequence encoding a cellulase of the invention (e.g., SEQ ID NO:2).
  • a cellulase of the invention e.g., SEQ ID NO:2
  • Various methods to make the transgenic animals of the subject invention can be employed. Generally speaking, three such methods may be employed. In one such method, an embryo at the pronuclear stage (a "one cell embryo”) is harvested from a female and the transgene is microinjected into the embryo, in which case the transgene will be chromosomally integrated into both the germ cells and somatic cells of the resulting mature animal.
  • embryonic stem cells are isolated and the transgene inco ⁇ orated therein by electroporation, plasmid transfection or microinjection, followed by reintroduction of the stem cells into the embryo where they colonize and contribute to the germ line. Methods for microinjection of mammalian species is described in U.S. Pat. No. 4,873,191.
  • embryonic cells are infected with a retrovirus containing the transgene whereby the germ cells of the embryo have the transgene chromosomally integrated therein.
  • retrovirus infection can be used for avian species, for example as described in U.S. Pat No. 5,162,215.
  • micro-injection is to be used with avian species, however, a published procedure by Love et al., (Biotechnol., 12, Jan 1994) can be utilized whereby the embryo is obtained from a sacrificed hen approximately two and one-half hours after the laying of the previous laid egg, the transgene is microinjected into the cytoplasm of the germinal disc and the embryo is cultured in a host shell until maturity.
  • the animals to be made transgenic are bovine or porcine
  • microinjection can be hampered by the opacity of the ova thereby making the nuclei difficult to identify by traditional differential interference-contrast microscopy.
  • the ova can first be centrifuged to segregate the pronuclei for better visualization.
  • the "non-human animals” of the invention bovine, porcine, ovine and avian animals (e.g., cow, pig, sheep, chicken).
  • the "transgenic non-human animals” of the invention are produced by introducing "transgenes" into the germline of the non-human animal. Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell.
  • the zygote is the best target for micro-injection.
  • the use of zygotes as is target for gene transfer has a major advantage in that in most cases the injected DNA will be inco ⁇ orated into the host gene before the first cleavage (Brinster et al., Proc.
  • transgenic is used to describe an animal which includes exogenous genetic material within all of its cells.
  • a “transgenic” animal can be produced by crossbreeding two chimeric animals which include exogenous genetic material within cells used in reproduction. Twenty-five percent of the resulting offspring will be transgenic i.e., animals which include the exogenous genetic material within all of their cells in both alleles, 50% of the resulting animals will include the exogenous genetic material within one allele and 25% will include no exogenous genetic material.
  • the transgene is digested and purified free from any vector DNA, e.g., by gel electrophoresis.
  • the transgene can include an operatively associated promoter which interacts with cellular proteins involved in transcription, ultimately resulting in constitutive expression.
  • Promoters useful in this regard include those from cytomegalovirus (CMV) , Moloney leukemia virus (MLV), and he ⁇ es virus, as well as those from the genes encoding metallothionein, skeletal actin, P-enolpyruvate carboxylase (PEPCK), phosphoglycerate (PGK), DHFR, and thymidine kinase.
  • Promoters for viral long terminal repeats such as Rous Sarcoma Virus can also be employed.
  • exemplary promoters include those for the chicken J-globin gene, chicken lysozyme gene, and avian leukosis virus.
  • Constructs useful in plasmid transfection of embryonic stem cells will employ additional regulatory elements well known in the art such as enhancer elements to stimulate transcription, splice acceptors, termination and polyadenylation signals, and ribosome binding sites to permit translation.
  • Retroviral infection can also be used to introduce transgene into a non- human animal, as described above. The developing non-human embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres can be targets for retroviral infection (Jaenich, R., Proc. Natl. Acad. Sci. USA 73:1260-1264, 1976). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan, et al. (1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).
  • the viral vector system used to introduce the transgene is typically a replication-defective retro virus carrying the transgene (Jahner, et al., Proc. Natl. Acad. Sci.
  • founders will be mosaic for the transgene since inco ⁇ oration occurs only in a subset of the cells which formed the transgenic nonhuman animal. Further, the founder may contain various retro viral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. En addition, it is also possible to introduce transgenes into the germ line, albeit with low efficiency, by intrauterine retroviral infection of the mid-gestation embryo (D. Jahner et al., supra).
  • ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (M. J. Evans et al., Nature 292:154-156, 1981; M. O. Bradley et al., Nature 309:255-258, 1984; Gossler, et al., Proc. Natl. Acad. Sci. USA 83:9065D9069, 1986; and Robertson et al., Nature 322:445-448, 1986).
  • Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retro virus-mediated transduction.
  • Such transformed ES cells can thereafter be combined with blastocysts from a nonhuman animal.
  • the ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal.
  • the cellulase enzymes, fragments thereof and nucleic acids that encode the enzymes and fragments can be affixed to a solid support. This is often economical and efficient in the use of the cellulases in industrial processes. For example, a consortium or cocktail of cellulase enzymes (or active fragments thereof), which are used in a specific chemical reaction, can be attached to a solid support and dunked into a process vat. The enzymatic reaction can occur. Then, the solid support can be taken out of the vat, along with the enzymes affixed thereto, for repeated use.
  • an isolated nucleic acid of the invention is affixed to a solid support.
  • the solid support is selected from the group of a gel, a resin, a polymer, a ceramic, a glass, a microelectrode and any combination thereof.
  • solid supports useful in this invention include gels.
  • Some examples of gels include Sepharose, gelatin, glutaraldehyde, chitosan-treated glutaraldehyde, albumin-glutaraldehyde, chitosan-Xanthan, toyopearl gel (polymer gel), alginate, alginate-polylysine, carrageenan, agarose, glyoxyl agarose, magnetic agarose, dextran-agarose, poly(Carbamoyl Sulfonate) hydrogel, BSA-PEG hydrogel, phosphorylated polyvinyl alcohol (PVA), monoaminoethyl-N-aminoethyl (MANA), amino, or any combination thereof.
  • Another solid support useful in the present invention are resins or polymers.
  • resins or polymers include cellulose, acrylamide, nylon, rayon, polyester, anion-exchange resin, AMBERLITETM XAD-7, AMBERLITETM XAD-8,
  • Some examples include non-porous ceramic, porous ceramic,
  • Another type of solid support useful in the present invention is glass. Some examples include non-porous glass, porous glass, aminopropyl glass or any combination thereof. Another type of solid support that can be used is a microelectrode. An example is a polyethyleneimine-coated magnetite. Graphitic particles can be used as a solid support.
  • a solid support is a cell, such as a red blood cell.
  • Methods of immobilization There are many methods that would be known to one of skill in the art for immobilizing enzymes or fragments thereof, or nucleic acids, onto a solid support. Some examples of such methods include, e.g., electrostatic droplet generation, electrochemical means, via adso ⁇ tion, via covalent binding, via cross-linking, via a chemical reaction or process, via encapsulation, via entrapment, via calcium alginate, or via poly (2- hydroxyethyl methacrylate). Like methods are described in Methods in Enzymology,
  • Capillary arrays such as the GIGAMATRIXTM, Diversa Co ⁇ oration, San
  • Nucleic acids or polypeptides of the invention can be immobilized to or applied to an array, including capillary arrays.
  • Arrays can be used to screen for or monitor libraries of compositions (e.g., small molecules, antibodies, nucleic acids, etc.) for their ability to bind to or modulate the activity of a nucleic acid or a polypeptide of the invention.
  • Capillary arrays provide another system for holding and screening samples.
  • a sample screening apparatus can include a plurality of capillaries formed into an array of adjacent capillaries, wherein each capillary comprises at least one wall defining a lumen for retaining a sample.
  • the apparatus can further include interstitial material disposed between adjacent capillaries in the array, and one or more reference indicia formed within of the interstitial material.
  • a capillary for screening a sample wherein the capillary is adapted for being bound in an array of capillaries, can include a first wall defining a lumen for retaining the sample, and a second wall formed of a filtering material, for filtering excitation energy provided to the lumen to excite the sample.
  • a polypeptide or nucleic acid e.g., a ligand
  • a first component into at least a portion of a capillary of a capillary array.
  • Each capillary of the capillary a ⁇ ay can comprise at least one wall defining a lumen for retaining the first component.
  • An air bubble can be introduced into the capillary behind the first component.
  • a second component can be introduced into the capillary, wherein the second component is separated from the first component by the air bubble.
  • a sample of interest can be introduced as a first liquid labeled with a detectable particle into a capillary of a capillary array, wherein each capillary of the capillary array comprises at least one wall defining a lumen for retaining the first liquid and the detectable particle, and wherein the at least one wall is coated with a binding material for binding the detectable particle to the at least one wall.
  • the method can further include removing the first liquid from the capillary tube, wherein the bound detectable particle is maintained within the capillary, and introducing a second liquid into the capillary tube.
  • the capillary array can include a plurality of individual capillaries comprising at least one outer wall defining a lumen.
  • the outer wall of the capillary can be one or more walls fused together.
  • the wall can define a lumen that is cylindrical, square, hexagonal or any other geometric shape so long as the walls form a lumen for retention of a liquid or sample.
  • the capillaries of the capillary array can be held together in close proximity to form a planar structure.
  • the capillaries can be bound together, by being fused (e.g., where the capillaries are made of glass), glued, bonded, or clamped side-by- side.
  • the capillary array can be formed of any number of individual capillaries, for example, a range from 100 to 4,000,000 capillaries.
  • a capillary array can form a microtiter plate having about 100,000 or more individual capillaries bound together.
  • Nucleic acids or polypeptides of the invention can be immobilized to or applied to an array.
  • Arrays can be used to screen for or monitor libraries of compositions (e.g., small molecules, antibodies, nucleic acids, etc.) for their ability to bind to or modulate the activity of a nucleic acid or a polypeptide of the invention.
  • a monitored parameter is transcript expression of a cellulase gene.
  • One or more, or, all the transcripts of a cell can be measured by hybridization of a sample comprising transcripts of the cell, or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic acids on an array, or "biochip.”
  • array By using an “array” of nucleic acids on a microchip, some or all of the transcripts of a cell can be simultaneously quantified.
  • arrays comprising genomic nucleic acid can also be used to determine the genotype of a newly engineered strain made by the methods of the invention.
  • Polypeptide arrays can also be used to simultaneously quantify a plurality of proteins.
  • arrays are generically a plurality of “spots” or “target elements,” each target element comprising a defined amount of one or more biological molecules, e.g., oligonucleotides, immobilized onto a defined area of a substrate surface for specific binding to a sample molecule, e.g., mRNA transcripts.
  • biological molecules e.g., oligonucleotides
  • any known array and/or method of making and using arrays can be inco ⁇ orated in whole or in part, or variations thereof, as described, for example, in U.S. Patent Nos. 6,277,628; 6,277,489; 6,261,776; 6,258,606;
  • the invention provides isolated or recombinant polypeptides having a sequence identity to an exemplary sequence of the invention, e.g., SEQ ED NO:2.
  • the identity can be over the full length of the polypeptide, or, the identity can be over a region of at least about 50, 77, 100, 150, 200, 250, 300 or more residues (to the full length of the polypeptide).
  • Polypeptides of the invention can also be shorter than the full length of exemplary polypeptides (e.g., SEQ ID NO:2).
  • the invention provides polypeptides (peptides, fragments) ranging in size between about 5 and the full length of a polypeptide, e.g., a cellulase; exemplary sizes being of about 5, 10,
  • Peptides of the invention can be useful as, e.g., labeling probes, antigens, toleragens, motifs, cellulase active sites.
  • Polypeptides and peptides of the invention can be isolated from natural sources, be synthetic, or be recombinantly generated polypeptides. Peptides and proteins can be recombinantly expressed in vitro or in vivo. The peptides and polypeptides of the invention can be made and isolated using any method known in the art. Polypeptide and peptides of the invention can also be synthesized, whole or in part, using chemical methods well known in the art. See e.g., Caruthers (1980) Nucleic Acids Res. Symp. Ser. 215-223;
  • peptide synthesis can be performed using various solid- phase techniques (see e.g., Roberge (1995) Science 269:202; Merrifield (1997) Methods Enzymol. 289:3 D 13) and automated synthesis may be achieved, e.g., using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.
  • the peptides and polypeptides of the invention can also be glycosylated.
  • the glycosylation can be added post-translationally either chemically or by cellular biosynthetie mechanisms, wherein the later inco ⁇ orates the use of known glycosylation motifs, which can be native to the sequence or can be added as a peptide or added in the nucleic acid coding sequence.
  • the glycosylation can be O-linked or N-linked, or, a combination thereof.
  • the peptides and polypeptides of the invention include all “mimetic” and “peptidomimetic” forms.
  • the terms “mimetic” and “peptidomimetic” refer to a synthetic chemical compound which has substantially the same structural and/or functional characteristics of the polypeptides of the invention.
  • the mimetic can be either entirely composed of synthetic, non-natural analogues of amino acids, or, is a chimeric molecule of partly natural peptide amino acids and partly non-natural analogs of amino acids.
  • the mimetic can also inco ⁇ orate any amount of natural amino acid conservative substitutions as long as such substitutions also do not substantially alter the mimetic's structure and/or activity.
  • a mimetic composition is within the scope of the invention if it has a cellulase activity.
  • Polypeptide mimetic compositions of the invention can contain any combination of non-natural structural components.
  • mimetic compositions of the invention include one or all of the following three structural groups: a) residue linkage groups other than the natural amide bond ("peptide bond") linkages; b) non-natural residues in place of naturally occurring amino acid residues; or c) residues which induce secondary structural mimicry, i.e., to induce or stabilize a secondary structure, e.g., a beta turn, gamma turn, beta sheet, alpha helix conformation, and the like.
  • a polypeptide of the invention can be characterized as a mimetic when all or some of its residues are joined by chemical means other than natural peptide bonds.
  • Endividual peptidomimetic residues can be joined by peptide bonds, other chemical bonds or coupling means, such as, e.g., glutaraldehyde, N-hydroxysuccinimide esters, bifunctional maleimides, N,N'-dicyclohexylcarbodiimide (DCC) or N,N'- diisopropylcarbodiimide (DEC).
  • glutaraldehyde N-hydroxysuccinimide esters
  • bifunctional maleimides N,N'-dicyclohexylcarbodiimide (DCC) or N,N'- diisopropylcarbodiimide (DEC).
  • a polypeptide of the invention can also be characterized as a mimetic by containing all or some non-natural residues in place of naturally occurring amino acid residues.
  • Non-natural residues are well described in the scientific and patent literature; a few exemplary non-natural compositions useful as mimetics of natural amino acid residues and guidelines are described below.
  • Mimetics of aromatic amino acids can be generated by replacing by, e.g., D- or L- naphylalanine; D- or L- phenylglycine; D- or L-2 thieneylalanine; D- or L-l, -2, 3-, or 4- pyreneylalanine; D- or L-3 thieneylalanine; D- or L-(2-pyridinyl)-alanine; D- or L-(3-pyridinyl)-alanine; D- or L-(2-pyrazinyl)-alanine; D- or L-(4-isopropyl)-phenylglycine; D-(trifluoromethyl)-phenylglycine; D-(trifluoromethyl)- phenylalanine; D-p-fluoro-phenylalanine; D- or L-p-biphenylphenylalanine; K- or L-p- methoxy-biphenylphen
  • Aromatic rings of a non-natural amino acid include, e.g., thiazolyl, thiophenyl, pyrazolyl, benzimidazolyl, naphthyl, furanyl, pyrrolyl, and pyridyl aromatic rings.
  • Mimetics of acidic amino acids can be generated by substitution by, e.g., non-carboxylate amino acids while maintaining a negative charge; (phosphono)alanine; sulfated threonine.
  • Carboxyl side groups e.g., aspartyl or glutamyl
  • Carboxyl side groups can also be selectively modified by reaction with carbodumides (R'-N-C-N-R') such as, e.g., l-cyclohexyl-3(2- mo ⁇ holinyl-(4-ethyl) carbodiimide or l-ethyl-3(4-azonia- 4,4- dimetholpentyl) carbodiimide.
  • Aspartyl or glutamyl can also be converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
  • Mimetics of basic amino acids can be generated by substitution with, e.g., (in addition to lysine and arginine) the amino acids ornithine, citrulline, or (guanidino)-acetic acid, or (guanidino)alkyl-acetic acid, where alkyl is defined above.
  • Nitrile derivative e.g., containing the CN-moiety in place of COOH
  • Asparaginyl and glutaminyl residues can be deaminated to the corresponding aspartyl or glutamyl residues.
  • Arginine residue mimetics can be generated by reacting arginyl with, e.g., one or more conventional reagents, including, e.g., phenylglyoxal, 2,3-butanedione, 1,2-cyclo-hexanedione, or ninhydrin, and can be under alkaline conditions.
  • Tyrosine residue mimetics can be generated by reacting tyrosyl with, e.g., aromatic diazonium compounds or tetranitromethane. N-acetylimidizol and tetranitromethane can be used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively.
  • Cysteine residue mimetics can be generated by reacting cysteinyl residues with, e.g., alpha-haloacetates such as 2-chloroacetic acid or chloroacetamide and corresponding amines; to give carboxymethyl or carboxyamidomethyl derivatives.
  • alpha-haloacetates such as 2-chloroacetic acid or chloroacetamide and corresponding amines
  • Cysteine residue mimetics can also be generated by reacting cysteinyl residues with, e.g., bromo-trifluoroacetone, alpha-bromo-beta-(5-imidozoyl) propionic acid; chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide; methyl 2-pyridyl disulfide; p- chloromercuribenzoate; 2-chloromercuri-4 nitrophenol; or, chloro-7-nitrobenzo-oxa-l,3- diazole.
  • cysteinyl residues e.g., bromo-trifluoroacetone, alpha-bromo-beta-(5-imidozoyl) propionic acid
  • chloroacetyl phosphate N-alkylmaleimides
  • 3-nitro-2-pyridyl disulfide methyl 2-pyridyl disulfide
  • Lysine mimetics can be generated (and amino terminal residues can be altered) by reacting lysinyl with, e.g., succinic or other carboxylic acid anhydrides. Lysine and other alpha-amino-containing residue mimetics can also be generated by reaction with imidoesters, such as methyl picolinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride, trinitro-benzenesulfonic acid, O-methylisourea, 2,4, pentanedione, and transamidase-catalyzed reactions with glyoxylate. Mimetics of methionine can be generated by reaction with, e.g., methionine sulfoxide.
  • Mimetics of proline include, e.g., pipecolic acid, thiazolidine carboxylic acid, 3- or 4- hydroxy proline, dehydroprohne, 3- or 4-methylproline, or 3,3,-dimethylproline.
  • Histidine residue mimetics can be generated by reacting histidyl with, e.g., diethylprocarbonate or para-bromophenacyl bromide.
  • mimetics include, e.g., those generated by hydroxylation of proline and lysine; phosphorylation of the hydroxyl groups of seryl or threonyl residues; methylation of the alpha- amino groups of lysine, arginine and histidine; acetylation of the N-terminal amine; methylation of main chain amide residues or substitution with N-methyl amino acids; or amidation of C-terminal carboxyl groups.
  • a residue, e.g., an amino acid, of a polypeptide of the invention can also be replaced by an amino acid (or peptidomimetic residue) of the opposite chirality.
  • an amino acid or peptidomimetic residue of the opposite chirality.
  • any amino acid naturally occurring in the L-configuration (which can also be referred to as the R or S, depending upon the structure of the chemical entity) can be replaced with the amino acid of the same chemical structural type or a peptidomimetic, but of the opposite chirality, referred to as the D- amino acid, but also can be referred to as the R- or S- form.
  • the invention also provides methods for modifying the polypeptides of the invention by either natural processes, such as post-translational processing (e.g., phosphorylation, acylation, etc), or by chemical modification techniques, and the resulting modified polypeptides. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also a given polypeptide may have many types of modifications.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphatidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
  • GPI anchor formation hydroxylation, iodination, methylation, myristolyation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation.
  • Creighton, T.E. Proteins - Structure and Molecular
  • Solid-phase chemical peptide synthesis methods can also be used to synthesize the polypeptide or fragments of the invention. Such method have been known in the art since the early 1960's (Merrifield, R. B., J. Am. Chem. Soc, 85:2149-2154, 1963)
  • FMOC peptide synthesizer By repeating such a process step, i.e., inverting and inserting the rod's and pin's tips into appropriate solutions, amino acids are built into desired peptides.
  • a number of available FMOC peptide synthesis systems are available. For example, assembly of a polypeptide or fragment can be carried out on a solid support using an Applied Biosystems, Inc. Model 431 ATM automated peptide synthesizer. Such equipment provides ready access to the peptides of the invention, either by direct synthesis or by synthesis of a series of fragments that can be coupled using other known techniques.
  • polypeptides or fragments thereof which have at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or more than about 95% homology to one of the polypeptides of SEQ ID NO:2, sequences substantially identical thereto, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 250, 300 consecutive amino acids thereof.
  • Homology may be determined using any of the programs described above which aligns the polypeptides or fragments being compared and determines the extent of amino acid identity or similarity between them. It will be appreciated that amino acid "homology" includes conservative amino acid substitutions such as those described above.
  • polypeptides or fragments having homology to one of the polypeptides of SEQ ED NO:2, sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may be obtained by isolating the nucleic acids encoding them using the techniques described above.
  • the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures.
  • the sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing.
  • the sequence of the prospective homologous polypeptide or fragment can be compared to one of the polypeptides of SEQ ID NO:2, sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using any of the programs described herein.
  • Another aspect of the invention is an assay for identifying fragments or variants of SEQ ED NO:2, or sequences substantially identical thereto, which retain the enzymatic function of the polypeptides of SEQ ID NO:2 and sequences substantially identical thereto.
  • the fragments or variants of the polypeptides may be used to catalyze biochemical reactions, which indicate that said fragment or variant retains the enzymatic activity of the polypeptides in SEQ ID NO:2.
  • the assay for determining if fragments of variants retain the enzymatic activity of the polypeptides of SEQ ID NO:2, and sequences substantially identical thereto includes the steps of; contacting the polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate.
  • polypeptides of SEQ ID NO:2, sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be used in a variety of applications.
  • the polypeptides or fragments thereof may be used to catalyze biochemical reactions.
  • a process for utilizing a polypeptide having SEQ ID NO:2, and sequences substantially identical thereto, or polynucleotides encoding such polypeptides for hydrolyzing haloalkanes In such procedures, a substance containing a haloalkane compound is contacted with one of the polypeptides of SEQ ID NO:2, sequences substantially identical thereto, under conditions which facilitate the hydrolysis of the compound.
  • the invention provides isolated or recombinant antibodies that specifically bind to a cellulase of the invention. These antibodies can be used to isolate, identify or quantify the cellulases of the invention or related polypeptides. These antibodies can be used to inhibit the activity of an enzyme of the invention. These antibodies can be used to isolated polypeptides related to those of the invention, e.g., related cellulase enzymes.
  • the antibodies can be used in immunoprecipitation, staining (e.g., FACS), immunoaffinity columns, and the like.
  • nucleic acid sequences encoding for specific antigens can be generated by immunization followed by isolation of polypeptide or nucleic acid, amplification or cloning and immobilization of polypeptide onto an array of the invention.
  • the methods of the invention can be used to modify the structure of an antibody produced by a cell to be modified, e.g., an antibody's affinity can be increased or decreased.
  • the ability to make or modify antibodies can be a phenotype engineered into a cell by the methods of the invention.
  • Antibodies also can be generated in vitro, e.g., using recombinant antibody binding site expressing phage display libraries, in addition to the traditional in vivo methods using animals.
  • the polypeptides can be used to generate antibodies which bind specifically to the polypeptides of the invention.
  • the resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample.
  • a protein preparation such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to one of the polypeptides of the invention.
  • the antibody is attached to a solid support, such as a bead or other column matrix.
  • the protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to one of the polypeptides of the invention. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
  • binding may be determined using any of a variety of procedures familiar to those skilled in the art. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
  • Polyclonal antibodies generated against the polypeptides of the invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, for example, a nonhuman. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique, the trioma technique, the human B-cell hybridoma technique, and the
  • Antibodies generated against the polypeptides of the invention may be used in screening for similar polypeptides from other organisms and samples. In such techniques, polypeptides from the organism are contacted with the antibody and those polypeptides which specifically bind the antibody are detected. Any of the procedures described above may be used to detect antibody binding.
  • polypeptides of SEQ ED NO:2 sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may also be used to generate antibodies which bind specifically to the enzyme polypeptides or fragments.
  • the resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample.
  • a protein preparation such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to one of a polypeptide of SEQ ED NO:2, sequences substantially identical thereto, or fragments of the foregoing sequences.
  • the antibody is attached to a solid support, such as a bead or other column matrix.
  • the protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to one of the polypeptides of SEQ ED NO:2, sequences substantially identical thereto, or fragment thereof. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
  • binding may be determined using any of a variety of procedures familiar to those skilled in the art. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
  • kits comprising the compositions, e.g., nucleic acids, expression cassettes, vectors, cells, polypeptides (e.g., cellulases) and/or antibodies of the invention.
  • the kits also can contain instructional material teaching the methodologies and industrial uses of the invention, as described herein. Measuring Metabolic Parameters
  • the methods of the invention involve whole cell evolution, or whole cell engineering, of a cell to develop a new cell strain having a new phenotype by modifying the genetic composition of the cell, where the genetic composition is modified by addition to the cell of a nucleic acid of the invention.
  • At least one metabolic parameter of a modified cell is monitored in the cell in a "real time” or "on-line” time frame.
  • a plurality of cells such as a cell culture, is monitored in "real time” or "on-line.”
  • a plurality of metabolic parameters is monitored in "real time” or "on-line.”
  • Metabolic flux analysis is based on a known biochemistry framework.
  • a linearly independent metabolic matrix is constructed based on the law of mass conservation and on the pseudo-steady state hypothesis (PSSH) on the intracellular metabolites.
  • PSSH pseudo-steady state hypothesis
  • pathway components e.g. allosteric interactions, enzyme-enzyme interactions etc.
  • Metabolic phenotype relies on the changes of the whole metabolic network within a cell. Metabolic phenotype relies on the change of pathway utilization with respect to environmental conditions, genetic regulation, developmental state and the genotype, etc.
  • the dynamic behavior of the cells, their phenotype and other properties are analyzed by investigating the pathway utilization. For example, if the glucose supply is increased and the oxygen decreased during the yeast fermentation, the utilization of respiratory pathways will be reduced and/or stopped, and the utilization of the fermentative pathways will dominate. Control of physiological state of cell cultures will become possible after the pathway analysis.
  • the methods of the invention can help determine how to manipulate the fermentation by determining how to change the substrate supply, temperature, use of inducers, etc. to control the physiological state of cells to move along desirable direction.
  • the MFA results can also be compared with transcriptome and proteome data to design experiments and protocols for metabolic engineering or gene shuffling, etc.
  • any modified or new phenotype can be conferred and detected, including new or improved characteristics in the cell. Any aspect of metabolism or growth can be monitored. Monitoring expression of an mRNA transcript
  • the engineered phenotype comprises increasing or decreasing the expression of an mRNA transcript or generating new transcripts in a cell.
  • mRNA transcript, or message can be detected and quantified by any method known in the art, including, e.g., Northern blots, quantitative amplification reactions, hybridization to arrays, and the like.
  • Quantitative amplification reactions include, e.g., quantitative PCR, including, e.g., quantitative reverse transcription polymerase chain reaction, or RT-PCR; quantitative real time RT-PCR, or "real-time kinetic RT-PCR" (see, e.g., Kreuzer (2001) Br. J. Haematol. 114:313-318; Xia (2001) Transplantation 72:907-914).
  • the engineered phenotype is generated by knocking out expression of a homologous gene.
  • the gene's coding sequence or one or more transcriptional control elements can be knocked out, e.g., promoters enhancers.
  • the expression of a transcript can be completely ablated or only decreased.
  • the engineered phenotype comprises increasing the expression of a homologous gene. This can be effected by knocking out of a negative control element, including a transcriptional regulatory element acting in cis- or trans- , or, mutagenizing a positive control element.
  • transcripts of a cell can be measured by hybridization of a sample comprising transcripts of the cell, or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic acids on an array. Monitoring expression of a polypeptides, peptides and amino acids
  • the engineered phenotype comprises increasing or decreasing the expression of a polypeptide or generating new polypeptides in a cell.
  • Polypeptides, peptides and amino acids can be detected and quantified by any method known in the art, including, e.g., nuclear magnetic resonance (NMR), spectrophotometry, radiography (protein radiolabeling), electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, various immunological methods, e.g.
  • 1 ⁇ acids can be monitored by feeding a mixture of uniformly C-labeled and unlabeled carbon source compounds into a bioreaction network. Analysis of the resulting labeling pattern enables both a comprehensive characterization of the network topology and the determination of metabolic flux ratios of the amino acids; see, e.g., Szyperski (1999) Metab. Eng. 1:189-197.
  • the present invention exploits the unique catalytic properties of enzymes.
  • biocatalysts i.e., purified or crude enzymes, non-living or living cells
  • the present invention uses selected biocatalysts and reaction conditions that are specific for functional groups that are present in many starting compounds, such as small molecules.
  • Each biocatalyst is specific for one functional group, or several related functional groups, and can react with many starting compounds containing this functional group.
  • the biocatalytic reactions produce a population of derivatives from a single starting compound. These derivatives can be subjected to another round of biocatalytic reactions to produce a second population of derivative compounds. Thousands of variations of the original small molecule or compound can be produced with each iteration of biocatalytic derivatization.
  • Enzymes react at specific sites of a starting compound without affecting the rest of the molecule, a process which is very difficult to achieve using traditional chemical methods.
  • This high degree of biocatalytic specificity provides the means to identify a single active compound within the library.
  • the library is characterized by the series of biocatalytic reactions used to produce it, a so called "biosynthetie history". Screening the library for biological activities and tracing the biosynthetie history identifies the specific reaction sequence producing the active compound. The reaction sequence is repeated and the structure of the synthesized compound determined.
  • This mode of identification unlike other synthesis and screening approaches, does not require immobilization technologies, and compounds can be synthesized and tested free in solution using virtually any type of screening assay. It is important to note, that the high degree of specificity of enzyme reactions on functional groups allows for the "tracking" of specific enzymatic reactions that make up the biocatalytically produced library.
  • the invention provides a method for modifying small molecules, comprising contacting a polypeptide encoded by a polynucleotide described herein or enzymatically active fragments thereof with a small molecule to produce a modified small molecule.
  • a library of modified small molecules is tested to determine if a modified small molecule is present within the library which exhibits a desired activity.
  • a specific biocatalytic reaction which produces the modified small molecule of desired activity is identified by systematically eliminating each of the biocatalytic reactions used to produce a portion of the library, and then testing the small molecules produced in the portion of the library for the presence or absence of the modified small molecule with the desired activity.
  • biocatalytic reactions which produce the modified small molecule of desired activity is optionally repeated.
  • the biocatalytic reactions are conducted with a group of biocatalysts that react with distinct structural moieties found within the structure of a small molecule, each biocatalyst is specific for one structural moiety or a group of related structural moieties; and each biocatalyst reacts with many different small molecules which contain the distinct structural moiety.
  • the invention provides detergent compositions comprising one or more polypeptides of the invention.
  • Surface- active and/or non-surface-active can be used.
  • the amount of total cellulase, surface-active and/or non-surface- active, used in the present invention can be from about 0.0001%> to about 1.0%, or from about 0.0002% to about 0.5%, by weight, of the detergent composition.
  • the surface-active cellulase is from about 5%> to about 67% and the non- surface-active cellulase is from about 33% to about 95%> of the total cellulase activity in the enzymatic mixture.
  • the optimum pH of the total enzymatic mixture is between about 5 to about 10.5.
  • polypeptides of the invention can be used in any detergent composition, which are well known in the art, see, e.g., U.S. Patent No. 6,322,595; 6,313,081.
  • a laundry detergent composition is provided. It can comprise 0.8 ppm to 80 ppm of a cellulase of the invention. Treating fabrics
  • the invention provides methods of treating fabrics using one or more polypeptides of the invention.
  • the polypeptides of the invention can be used in any fabric- treating method, which are well known in the art, see, e.g., U.S. Patent No. 6,300,122; 6,294,366.
  • the feel and appearance of a cellulosic-containing fabric is improved by a method comprising contacting the fabric with a cellulase of the invention in a solution.
  • the fabric is treated with the solution under pressure.
  • the enzymes of the invention can be used to treat cellulosic materials, including cotton- containing fabrics, as detergent additives and in aqueous compositions.
  • the concentration of cellulase can be readily determined by the skilled artisan based on the desired result.
  • the cellulase composition is present in a concentration of from about 1 to 1000 PPM, or between about 10-400 PPM total protein.
  • the enzymes of the invention are used with a surfactant.
  • the surfactant can be present in a concentration of greater than about 100 PPM, or from about
  • Suitable surfactants include any surfactant compatible with the cellulase and the fabric including, for example, anionic, non-ionic and ampholytic surfactants.
  • Suitable anionic surfactants for use herein include linear or branched alkylbenzenesulfonates; alkyl or alkenyl ether sulfates having linear or branched alkyl groups or alkenyl groups; alkyl or alkenyl sulfates; olefinsulfonates; alkanesulfonates and the like.
  • Suitable counter ions for anionic surfactants include alkali metal ions such as sodium and potassium; alkaline earth metal ions such as calcium and magnesium; ammonium ion; and alkanolamines having 1 to 3 alkanol groups of carbon number 2 or 3.
  • Ampholytic surfactants include quaternary ammonium salt sulfonates, and betaine-type ampholytic surfactants. Such ampholytic surfactants have both the positive and negative charged groups in the same molecule.
  • Nonionic surfactants generally comprise polyoxyalkylene ethers, as well as higher fatty acid alkanolamides or alkylene oxide adduct thereof, and fatty acid glycerine monoesters. Mixtures of surfactants can also be employed in manners known in the art.
  • the invention provides methods of treating paper and paper pulp using one or more polypeptides of the invention.
  • the polypeptides of the invention can be used in any paper- or pulp-treating method, which are well known in the art, see, e.g., U.S. Patent
  • the invention provides a method for deinking and decolorizing a printed paper containing a dye, comprising pulping a printed paper to obtain a pulp slurry, and dislodging an ink from the pulp slurry in the presence of a cellulase of the invention (other enzymes, e.g., amylases, can also be added).
  • a cellulase of the invention other enzymes, e.g., amylases, can also be added.
  • Other steps can include decolorizing the dye contained in the pulp slurry with one or more laccases in the presence of oxygen and one or more chemical mediators and separating the released ink from the pulp slurry, then recovering the decolorized pulp.
  • the invention provides a method for enhancing the freeness of pulp, e.g., pulp made from secondary fiber, by adding an enzymatic mixture comprising a cellulase of the invention (can also include other enzymes, e.g., pectinase enzymes) to the pulp and treating under conditions to cause a reaction to produce an enzymatically treated pulp.
  • an enzymatic mixture comprising a cellulase of the invention (can also include other enzymes, e.g., pectinase enzymes)
  • the freeness of the enzymatically treated pulp is increased from the initial freeness of the secondary fiber pulp without a loss in brightness.
  • the invention provides a solid waste digestion process using cellulases of the invention.
  • the methods can comprise reducing the mass and volume of substantially untreated solid waste having cellulose as its major component.
  • Solid waste can be treated with an enzymatic digestive process in the presence of an enzymatic solution (including an enzyme of the invention) at a controlled temperature. This results in a reaction without appreciable bacterial fermentation from added microorganisms.
  • the solid waste is converted into a liquefied waste and any residual solid waste.
  • the resulting liquefied waste can be separated from said any residual solidified waste. See e.g., U.S. Patent No. 5,709,796.
  • a T. maritima genomic library was constructed in the Lambda ZapII® cloning vector (Stratagene Cloning Systems), and mass excision was performed according to the manufacturers protocol to yield a gene library in the pBluescript cloning vector.
  • the pBluescript library was screened in SOLR E. Coli cells (Stratagene) for CMCase activity and a positive clone was identified and isolated. This clone was used to inoculate an overnight culture of Luria Broth liquid medium as per Ausubel, F. M., et al., Short
  • DNA was isolated from the overnight culture using an alkaline lysis mini-prep protocol as per Maniatis, T., et al., Molecular Cloning, Cold Spring Harbor Press, New York (1982).
  • Mini-prep DNA was then used to transform competent E. coli cells, XL1 blue (Stratagene) according to the manufacturer's protocol. A single clone was then used to inoculate a 100 ml overnight culture of Luria Broth liquid medium and plasmid DNA was isolated from this overnight using midi-prep procedure according to the manufacturer's protocol
  • the midi-prep plasmid DNA was partially sequenced with an ABI 377 and a putative open reading frame was identified within the sequenced region.
  • the sequence information was used in the generation of primer sequences which were subsequently used to PCR amplify the target gene encoding the CMCase activity.
  • the primer sequences used were as follows:
  • the amplification product was subcloned into the pBluescript II cloning vector (Stratagene).
  • the plasmid clone was transformed in to XL1 Blue cells again for verification.
  • the plasmid clone contains the DNA encoding the CMCase enzyme of the present invention as shown in FIG. 1 and deposited as ATCC No. 97245.
  • a pBluescript II clone containing the DNA encoding the enzyme of the present invention may be obtained from the ATCC, ATCC Deposit No.97245.
  • This pBluescript II clone containing the DNA of the present invention is used to transform E. coli XL1 Blue cells and the E. coli XL1 Blue cells are used to inoculate a 5 ml overnight culture of Luria Broth liquid medium. The 5 ml culture was aliquotted into 1 ml aliquots, and each aliquot was used to inoculate 1 liter of 5X LB culture media. Cells were grown overnight in five 2-liter shake flasks at 37° C. Each one liter cell culture pellet was resuspended in 150 ml of 25 mM Tris, pH 8.0 and then spun at 4K ⁇ m for 10 minutes at
  • the resulting pellet was resuspended in 5 ml of 25 mM Tris, pH 8.0, and sonicated with a microsonicator tip 10 times at 30 second intervals.
  • the cell debris was spun out in a

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Theoretical Computer Science (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Analytical Chemistry (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Medical Informatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Evolutionary Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

This invention provides hydrolases, e.g., cellulase enzymes, polynucleotides encoding these enzymes, the use of such polynucleotides and polypeptides and methods of making and using them. In one aspect, the invention provides enzymes having carboxymethyl cellulase activity.

Description

CELLULASES, NUCLEIC ACIDS ENCODING THEM AND METHODS FOR MAKING AND USING THEM
TECHNICAL FIELD [0001] This invention relates generally to hydrolases, e.g., cellulase enzymes, polynucleotides encoding these enzymes, the use of such polynucleotides and polypeptides and methods of making and using them. In one aspect, the invention provides enzymes having carboxymethyl cellulase activity.
BACKGROUND [0002 ] Cellulose, a fibrous, tough, water-insoluble substance is found in the cell walls of plants, particularly, in stalks, stems, trunks and all the woody portions of plant tissues. Cellulose constitutes much of the mass of wood, and cotton is almost pure cellulose. Because cellulose is a linear, unbranched homopolysaccharide of 10,000 to 15,000 D-glucose units, it resembles amylose and the main chains of glycogen. But there is a very important difference; in cellulose, the glucose residues have the beta configuration, whereas in amylose, amylopectin and glycogen the glucose is in the alpha configuration. The glucose residues in cellulose are linked by (beta 1, 4)glycosidic bonds. This difference gives cellulose and amylose very different 3-dimensional structures and physical properties.
[0003] Cellulose cannot be used by most animals as a source of stored fuel, because the (beta 1, 4) linkages of cellulose are not hydrolyzed by alpha-amylases. Termites readily digest cellulose but only because their intestinal tract harbors a symbiotic microorganism, trichonympha, which secretes cellulase, an enzyme that hydrolyzes (beta 1, 4) linkages between glucose units. The only vertebrates able to use cellulose as food are cattle and other ruminant animals (sheep, goats, camels and giraffes). The extra stomachs "rumens" of these animals teem with bacteria and protists that secrete cellulase. [0004] The enzymatic hydrolysis of cellulose is considered to require the action of both endoglucanases (1,4-beta-D-glucan glucanohydrolase) and exoglucanases (1,4-beta- D-glucan cellobiohydrolase). A synergistic interaction of these enzymes is necessary for the complete hydrolysis of crystalline cellulose, (Caughlin (1985) Genet. Eng. Rev., 3:39- 109). For the complete degradation of cellulose (cellulose to glucose), β-glucosidase might be required if the "exo" enzyme does not release glucose, 1 ,4-β-d-Glucan glucohydrolase is another type of "exo" cellulase. [0005] Thermophilic bacteria have received considerable attention as sources of highly active and thermostable cellulolytic and xylanolytic enzymes (Bronneomeier, K. and
Staudenbauer, W.L., D.R. Woods (Ed.), The Clostridia and Biotechnology, Butterworth
Publishers, Stoneham, Mass. (1993)). Recently, the most extremely thermophilic organotrophic eubacteria presently known have been isolated and characterized. These bacteria, which belong to the genus Thermotoga, are fermentative microorganisms metabolizing a variety of carbohydrates (Huber, R. and Stetter, K.O., in Ballows, et al.,
(Ed.), The Prokaryotes, 2nd Ed., Springer- Velag, N.Y., pgs. 3809-3819 (1992)).
[0006] In Huber et al., 1986, Arch. Microbial. 144:324-333, the isolation of the bacterium Thermotoga maritima is described. T. maritima is a eubacterium that is strictly anaerobic, rod-shaped, fermentative, hyperthermophilic, and grows between 55°C. and
90°C, with an optimum growth temperature of about 80° C. This eubacterium has been isolated from geothermally heated sea floors in Italy arid the Azores. T. maritima cells have a sheath-like structure and monotrichous flagellation. T. maritima is classified in the eubacterium kingdom by virtue of having murein and fatty acid-containing lipids, diphtheria-toxin-resistant elongation factor 2, an RNA polymerase subunit pattern, and sensitivity to antibiotics.
[0007] Enzymes are highly selective catalysts. Their hallmark is the ability to catalyze reactions with exquisite stereo-, regio-, and chemo- selectivities that are unparalleled in conventional synthetic chemistry. Moreover, enzymes are remarkably versatile. They can be tailored to function in organic solvents, operate at extreme pH's and temperatures, and catalyze reactions with compounds that are structurally unrelated to their natural, physiological substrates.
[0008] Enzymes are reactive toward a wide range of natural and unnatural substrates, thus enabling the modification of virtually any organic lead compound.
Moreover, unlike traditional chemical catalysts, enzymes are highly enantio- and regio- selective. The high degree of functional group specificity exhibited by enzymes enables one to keep track of each reaction in a synthetic sequence leading to a new active compound. Enzymes are also capable of catalyzing many diverse reactions unrelated to their physiological function in nature. For example, peroxidases catalyze the oxidation of phenols by hydrogen peroxide. Peroxidases can also catalyze hydroxylation reactions that are not related to the native function of the enzyme. Other examples are proteases that catalyze the breakdown of polypeptides. In organic solution some proteases can also acylate sugars, a function unrelated to the native function of these enzymes. [0009] Each biocatalyst is specific for one functional group, or several related functional groups, and can react with many starting compounds containing this functional group.
[0010] The biocatalytic reactions produce a population of derivatives from a single starting compound. These derivatives can be subjected to another round of biocatalytic reactions to produce a second population of derivative compounds. Thousands of variations of the original compound can be produced with each iteration of biocatalytic derivatization.
[0011] Enzymes react at specific sites of a starting compound without affecting the rest of the molecule, a process which is very difficult to achieve using traditional chemical methods. This high degree of biocatalytic specificity provides the means to identify a single active compound within the library. The library is characterized by the series of biocatalytic reactions used to produce it, a so-called "biosynthetie history". Screening the library for biological activities and tracing the biosynthetie history identifies the specific reaction sequence producing the active compound. The reaction sequence is repeated and the structure of the synthesized compound determined. This mode of identification, unlike other synthesis and screening approaches, does not require immobilization technologies, and compounds can be synthesized and tested free in solution using virtually any type of screening assay. It is important to note, that the high degree of specificity of enzyme reactions on functional groups allows for the "tracking" of specific enzymatic reactions that make up the biocatalytically produced library.
[0012] Many of the procedural steps are performed using robotic automation enabling the execution of many thousands of biocatalytic reactions and screening assays per day as well as ensuring a high level of accuracy and reproducibility. As a result, a library of derivative compounds can be produced in a matter of weeks which would take years to produce using current chemical methods. (For further teachings on modification of molecules, including small molecules, see PCT US94/09174).
[0013] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
SUMMARY
[0014 ] The invention provides isolated or recombinant nucleic acids comprising a nucleic acid sequence at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the nucleic acids encode at least one polypeptide having a cellulase activity and the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual inspection.
[ 0015 ] In one aspect, the nucleic acid comprises a sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 200 residues. The nucleic acid can comprise a nucleic acid sequence having at least 50% sequence identity to
SEQ ID NO:l over a region of at least about 300 residues. The nucleic acid can also comprise the nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 400 residues. The nucleic acid can comprise the nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 500 residues. The nucleic acid can have at least 50% sequence identity to SEQ ID
NO:l over a region of at least about 600 residues, at least 50% sequence identity to SEQ ID
NO:l over a region of at least about 700 residues, at least 50% sequence identity to SEQ ID
NO:l over a region of at least about 800 residues, or at least 50% sequence identity to SEQ
ID NO:l over a region of at least about 900 residues, or the full length of the coding sequence.
[0016] The nucleic acid can comprise a nucleic acid sequence having at least 60% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, having at least 70%) sequence identity to SEQ ED NO:l over a region of at least about 100 residues, having at least 80% sequence identity to SEQ ID NO: 1 over a region of at least about 100 residues, having at least 85% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, having at least 90% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, having at least 95%, or greater, sequence identity to SEQ ED
NO:l over a region of at least about 100 residues, or a sequence as set forth in SEQ ED
NO:l.
[ 0017 ] In one aspect, the isolated or recombinant nucleic acid encodes a polypeptide having a sequence as set forth in SEQ ID NO:2.
[0018] In one aspect, the sequence comparison algorithm is a BLAST version 2.2.2 algorithm. In one aspect, the filtering setting is set to blastall -p blastp -d "nr pataa" -F F, and all other options are set to default.
[0019] In one aspect, the cellulase activity comprises a carboxymethyl cellulase activity.
[0020] In one aspect, the cellulase activity comprises hydro lyzing a glycosidic linkage. The glycosidic linkage can comprise a (beta 1, 4)glycosidic bond. [0021] En one aspect, the cellulase activity comprises hydrolysis of a cellulose. The cellulase activity can comprise hydrolysis of a cellulose to a glucopyranose. [ 0022 ] In one aspect, the isolated or recombinant nucleic acid encodes a polypeptide having cellulase activity that is thermostable. The polypeptide retains a cellulase activity under conditions comprising a temperature range of between about 37°C to about 70°C.
[0023] In one aspect, the isolated or recombinant nucleic acid encodes a polypeptide having cellulase activity, which is thermotolerant. The polypeptide retains a cellulase activity after exposure to a temperature comprising a range from greater than 37°C to about 90°C. Alternatively, the polypeptide retains a cellulase activity after exposure to a temperature comprising a range from greater than 37°C to about 50°C. [0024] In one aspect, the isolated or recombinant nucleic acid comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity. The nucleic acid can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90,100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 residues in length or the full length of the gene or transcript, with or without a signal sequence, as describe herein. The stringent conditions can include a wash step comprising a wash in 0.2X SSC at a temperature of about 65oC for about 15 minutes.
[0025] The invention provides a nucleic acid probe for identifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the probe comprises at least 10, 20, 30, 40, 50, 60, 70, 80, 90,100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 consecutive bases of a sequence selected from a group consisting of a sequence as set forth in SEQ ED NO:l, wherein the probe identifies the nucleic acid by binding or hybridization. The probe can comprise an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a sequence as set forth in SEQ ID NO:l. [0026] The invention provides a nucleic acid probe for identifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the probe comprises a nucleic acid sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900 or 950 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection. The nucleic acid probe can comprise an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a nucleic acid sequence as set forth in SEQ ED NO:l. The nucleic acid probe can comprise a nucleic acid sequence having at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity to a region of at least about 100 residues of a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
[0027] The invention provides an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the primer pair is capable of amplifying a nucleic acid sequence as set forth in SEQ ID NO: l,or a subsequence thereof . One or each member of the amplification primer sequence pair can comprise an oligonucleotide comprising at least about 10 to 50 consecutive bases of the sequence, or about 8 to 60 consecutive bases of sequence. The invention provides a method of amplifying a nucleic acid encoding a polypeptide with a cellulase activity comprising amplification of a template nucleic acid with an amplification primer sequence pair capable of amplifying a nucleic acid sequence as set forth in SEQ ID NO:l, or subsequence thereof.
[0028] The invention provides expression cassettes comprising a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ D NO:l, or a subsequence thereof.
[0029] The invention provides vectors comprising a nucleic acid of the invention, for example, a nucleic acid comprising a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
[0030] The invention provides cloning vehicles comprising a nucleic acid of the invention or a vector of the invention. The cloning vehicle can comprise a viral vector, a plasmid, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage or an artificial chromosome. The viral vector can comprise an adenovirus vector, a retroviral vectors or an adeno-associated viral vector. The cloning vehicle can comprise a bacterial artificial chromosome (BAC), a plasmid, a bacteriophage PI -derived vector (PAC), a yeast artificial chromosome (YAC), a mammalian artificial chromosome (MAC). [0031] The invention provides transformed cells comprising a nucleic acid of the invention or a vector of the invention or a cloning vehicle of the invention. The vector can comprise a nucleic acid of the invention, e.g., a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
[0032 ] The invention provides transformed cells comprising a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof. En one aspect, the transformed cell is a bacterial cell, a mammalian cell, a fungal cell, a yeast cell, an insect cell or a plant cell.
[0033] The invention provides transgenic non-human animals comprising a nucleic acid of the invention or a vector of the invention. They can comprise a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof. In one aspect, the transgenic non-human animal is a mouse.
[0034] The invention provides transgenic plants comprising a nucleic acid of the invention or a vector of the invention. They can comprise a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof. The transgenic non-human plant can be a corn plant, a potato plant, a tomato plant, a wheat plant, an oilseed plant, a rapeseed plant, a soybean plant or a tobacco plant.
[0035] The invention provides transgenic seeds comprising a nucleic acid of the invention or a vector of the invention. They can comprise a nucleic acid sequence having at least 98% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof. The transgenic seed can be a corn seed, a wheat kernel, an oilseed, a rapeseed, a soybean seed, a palm kernel, a sunflower seed, a sesame seed, a peanut or a tobacco plant seed.
[0036] The invention provides an antisense oligonucleotide comprising a nucleic acid of the invention; e.g., a sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence having at least 50% sequence identity to
SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, or a subsequence thereof. The antisense oligonucleotide can be between about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 bases, about 70 to 110, or about 80 to 120 bases in length.
[0037] The invention provides methods of inhibiting the translation of a cellulase message in a cell comprising administering to the cell or expressing in the cell an antisense oligonucleotide of the invention, e.g., a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof.
[ 0038] The invention provides an isolated or recombinant polypeptide comprising an amino acid sequence having at least 50% sequence identity to SEQ ED NO:2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO:l. The polypeptide can have a cellulase activity. In one aspect, the isolated or recombinant polypeptide has a carboxymethyl cellulase activity that, e.g., comprises hydrolysis of a glycosidic linkage. The glycosidic linkage can be a (beta 1, 4)glycosidic bond. In alternative aspects, the cellulase activity comprises hydrolysis of a starch. In one aspect, the cellulase activity comprises hydrolysis of a starch to glucopyranose. The isolated or recombinant polypeptide can comprise a cellulase activity that is thermostable. The polypeptide can retain a cellulase activity under conditions comprising a temperature range of between about 37°C to about 70°C. In one aspect, the isolated or recombinant polypeptide can comprise the cellulase activity that is thermotolerant. The polypeptide can retain a cellulase activity after exposure to a temperature in the range from greater than
37°C to about 90°C. En another aspect, the polypeptide can retain a cellulase activity after exposure to a temperature in the range from greater than 37°C to about 50°C.
[0039] In alternative aspects, the polypeptide sequence is encoded by an amino acid sequence having at least 50% sequence identity to SEQ ID NO:2 over a region of at least about 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 residues. In one aspect, the polypeptide is encoded by amino acid sequence having at least
60%, 65%, 70%, 75%), 80%, 85%, 90%, 95% sequence identity to SEQ ID NO:2 over a region of at least about 100 residues. The isolated or recombinant polypeptide can have an amino acid sequence as set forth in SEQ ED NO:2.
[0040] The invention provides isolated or recombinant polypeptides, wherein the polypeptide has a cellulase activity and lacks a signal sequence and comprises an amino acid sequence having at least 50% sequence identity to SEQ ID NO:2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO:l. The isolated or recombinant polypeptide can comprise a cellulase activity that comprises a thermostability when heated to a temperature in the range from about 37°C to about 50°C, about 50°C to about 70°C or about 70°C to about 90°C. In one aspect, the thermostable cellulase activity can comprise a specific activity at about 37°C in the range from about 100 to about 1000 units per milligram of protein. In another aspect, the thermostable cellulase activity can comprise a specific activity from about 500 to about 750 units per milligram of protein.
The thermostable cellulase activity can also comprise a specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein or in the range from about 750 to about 1000 units per milligram of protein. Alternatively, the isolated or recombinant polypeptide can comprise a cellulase activity that comprises thermotolerance after being heated to an elevated temperature in the range from about 37°C to about 90°C or in the range from about 37°C to about 70°C. In one aspect, the thermotolerance comprises retention of at least half of the specific activity of the cellulase at 37°C after being heated to the elevated temperature. En another aspect, the thermotolerance comprises retention of specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein after being heated to the elevated temperature.
[0041] The invention provides an isolated or recombinant polypeptide comprising an amino acid sequence having at least 50% sequence identity to SEQ ID NO: 2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ID NO.l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO: 1. The polypeptide can comprise at least one glycosylation site. En one aspect, glycosylation is an
N-linked glycosylation. In one aspect, the isolated or recombinant polypeptide can be glycosylated after being expressed in a P. pastoris or a S. pombe. The isolated or recombinant polypeptide can retain a cellulase activity under conditions comprising about pH 4.5, 5, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0.
[0042 ] The invention provides protein preparations comprising a polypeptide of the invention, where the protein preparation comprises a liquid, a solid or a gel.
[0043] The invention provides heterodimers comprising a polypeptide of the invention and a second domain. The second domain can be a polypeptide and the heterodimer can be a fusion protein. In alternative aspects, the second domain is an epitope and a tag.
[0044] The invention provides immobilized polypeptides having a cellulase activity, wherein the polypeptide is a polypeptide of the invention, or is a polypeptide encoded by a nucleic acid of the invention, or a polypeptide comprising the polypeptide of the invention and a second domain. The polypeptide can be immobilized on, e.g., a cell, a metal, a resin, a polymer, a ceramic, a glass, a microelectrode, a graphitic particle, a bead, a gel, a plate, an array or a capillary tube.
[0045] The invention provides arrays comprising an immobilized polypeptide, wherein the polypeptide is a polypeptide of the invention, or is a polypeptide encoded by a nucleic acid of the invention, or a polypeptide comprising the polypeptide of the invention and a second domain. The invention provides arrays comprising the nucleic acid of the invention or an isolated or recombinant nucleic acid, wherein the nucleic acid comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO: 1 , wherein the nucleic acid encodes a polypeptide having a cellulase activity. The invention provides an array comprising an immobilized antibody of the invention.
[0046] The invention provides isolated or recombinant antibodies that specifically bind to a polypeptide of the invention or to a polypeptide encoded by the nucleic acid of the invention or an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity. The antibody can be a monoclonal or a polyclonal antibody. The invention provides hybridomas comprising an antibody of the invention.
[0047 ] The invention provides food supplements for an animal comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. They can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity. En one aspect, the polypeptide can be glycosylated.
[0048] The invention provides edible enzyme delivery matrices comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. They can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity. In one aspect, the edible enzyme delivery matrix comprises a pellet. En another aspect, the edible enzyme delivery matrix comprises the polypeptide that can be glycosylated. En one aspect, the edible enzyme delivery matrix comprises the polypeptide, wherein the cellulase activity is thermotolerant or thermostable.
[0049] The invention provides cellulose compositions comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
[0050] The invention provides detergent compositions comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity. En one aspect, the detergent composition comprises cellulase that can be a nonsurface-active cellulase. En another aspect, cellulase can be a surface-active cellulase.
[0051] The invention provides cellulose-containing fabrics comprising a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
[0052 ] The invention provides methods of isolating or identifying a polypeptide with cellulase activity comprising the steps of: (a) providing an antibody of the invention;
(b) providing a sample comprising polypeptides; and (c) contacting the sample of step (b) with the antibody of step (a) under conditions wherein the antibody can specifically bind to the polypeptide, thereby isolating or identifying a cellulase. The invention provides methods of making an anti-cellulase antibody comprising administering to a non-human animal a nucleic acid of the invention, or an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or a polypeptide of the invention, in an amount sufficient to generate a humoral immune response, thereby making an anti-cellulase antibody.
[0053] The invention provides methods of producing a recombinant polypeptide comprising the steps of: (a) providing a nucleic acid of the invention , e.g., a nucleic acid comprising a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, operably linked to a promoter; and (b) expressing the nucleic acid of step
(a) under conditions that allow expression of the polypeptide, thereby producing a recombinant polypeptide. The method can further comprise transforming a host cell with the nucleic acid of step (a) followed by expressing the nucleic acid of step (a), thereby producing a recombinant polypeptide in a transformed cell.
[0054] The invention provides methods for identifying a polypeptide having a cellulase activity comprising the following steps: (a) providing a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity, (b) providing a cellulase substrate; and (c) contacting the polypeptide or a fragment or variant thereof of step (a) with the substrate of step (b) and detecting an decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product detects a polypeptide having a cellulase activity. The method can further comprise a substrate comprising a cellulose.
[0055] The invention provides methods for identifying a cellulase substrate comprising the following steps: (a) providing a polypeptide of the invention or a polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED
NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, (b) providing a test substrate; and (c) contacting the polypeptide of step (a) with the test substrate of step (b) and detecting a decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product identifies the test substrate as a cellulase substrate.
[0056] The invention provides methods of determining whether a compound specifically binds to a polypeptide comprising the following steps: (a) expressing a nucleic acid or a vector comprising the nucleic acid under conditions permissive for translation of the nucleic acid to a polypeptide, wherein the nucleic acid is a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; (b) contacting the polypeptide with the test compound; and (c) determining whether the test compound specifically binds to the polypeptide, thereby determining that the compound specifically binds to the polypeptide.
[0057 ] The invention provides methods for identifying a modulator of a cellulase activity comprising the following steps: (a) providing a cellulase polypeptide of the invention or a cellulase polypeptide encoded by a nucleic acid of the invention or an isolated or recombinant nucleic acid of the invention. The nucleic acids can comprise, e.g., a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a test compound; (c) contacting the polypeptide of step (a) with the test compound of step (b) and measuring an activity of the cellulase, wherein a change in the cellulase activity measured in the presence of the test compound compared to the activity in the absence of the test compound provides a determination that the test compound modulates the cellulase activity.
[ 0058 ] En one aspect, the cellulase activity is measured by providing a cellulase substrate and detecting a decrease in the amount of the substrate or an increase in the amount of a reaction product, or, an increase in the amount of the substrate or a decrease in the amount of a reaction product. The decrease in the amount of the substrate or the increase in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an activator of cellulase activity. The increase in the amount of the substrate or the decrease in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an inhibitor of cellulase activity.
[0059] The invention provides computer systems comprising a processor and a data storage device wherein said data storage device has stored thereon a polypeptide sequence or a nucleic acid sequence of the invention or subsequence thereof.
[0060] En one aspect, the computer system can further comprise a sequence comparison algorithm and a data storage device having at least one reference sequence stored thereon. The sequence comparison algorithm can comprise a computer program that indicates polymorphisms. The computer system can further comprise an identifier that identifies one or more features in said sequence.
[0061] The invention provides computer readable mediums having stored thereon a polypeptide sequence or a nucleic acid sequence of the invention, or subsequence thereof.
The nucleic acid can encode a cellulase polypeptide encoded by a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; or subsequence thereof.
[0062 ] The invention provides methods for identifying a feature in a sequence comprising the steps of: (a) reading the sequence using a computer program which identifies one or more features in a sequence, wherein the sequence comprises a polypeptide sequence or a nucleic acid sequence of the invention; and (b) identifying one or more features in the sequence with the computer program.
[0063] The invention provides methods for comparing a first sequence to a second sequence comprising the steps of: (a) reading the first sequence and the second sequence through use of a computer program which compares sequences, wherein the first sequence comprises a polypeptide sequence or a nucleic acid sequence of the invention; and (b) determining differences between the first sequence and the second sequence with the computer program. In one aspect, the step of determining differences between the first sequence and the second sequence further comprises the step of identifying polymorphisms. In one aspect, the method further comprises an identifier that identifies one or more features in a sequence. En another aspect, the method further comprises reading the first sequence using a computer program and identifying one or more features in the sequence.
[0064] The invention provides methods for isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample comprising the steps of: (a) providing an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the primer pair is capable of amplifying SEQ ID NO:l, or a subsequence thereof, or another nucleic acid of the invention; (b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to the amplification primer pair; and, (c) combining the nucleic acid of step (b) with the amplification primer pair of step (a) and amplifying nucleic acid from the environmental sample, thereby isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample. In one aspect, each member of the amplification primer sequence pair comprises an oligonucleotide comprising at least about
10 to 50, or, 20 to 60, consecutive bases of a sequence as set forth in SEQ ID NO:l.
[0065] The invention provides methods for isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample comprising the steps of: (a) providing a polynucleotide probe comprising a nucleic acid of the invention, or a subsequence thereof; (b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to a polynucleotide probe of step (a); (c) combining the isolated nucleic acid or the treated environmental sample of step (b) with the polynucleotide probe of step (a); and (d) isolating a nucleic acid that specifically hybridizes with the polynucleotide probe of step (a), thereby isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from a soil sample. [0066] En alternative aspects, the environmental sample comprises a water sample, a liquid sample, a soil sample, an air sample or a biological sample. En alternative aspects, the biological sample is derived from a bacterial cell, a protozoan cell, an insect cell, a yeast cell, a plant cell, a fungal cell or a mammalian cell.
[0067] The invention provides methods of generating a variant of a nucleic acid encoding a cellulase comprising the steps of: (a) providing a template nucleic acid comprising a nucleic acid of the invention, e.g., an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) modifying, deleting or adding one or more nucleotides in the template sequence, or a combination thereof, to generate a variant of the template nucleic acid. [0068] En one aspect, the method further comprises expressing the variant nucleic acid to generate a variant cellulase polypeptide. In alternative aspects, the modifications, additions or deletions are introduced by a method selected from the group consisting of error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR) and a combination thereof. En alternative aspects, the modifications, additions or deletions are introduced by a method selected from the group consisting of recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation, error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, synthetic ligation reassembly (SLR), gene reassembly, gene site saturated mutagenesis (GSSM) and a combination thereof. [0069] En one aspect, the method can be iteratively repeated until a cellulase having an altered or different activity or an altered or different stability from that of a cellulase encoded by the template nucleic acid is produced. In one aspect, the variant cellulase polypeptide is thermotolerant, wherein the cellulase retains some activity after being exposed to an elevated temperature. En another aspect, the variant cellulase polypeptide has increased glycosylation as compared to the cellulase encoded by a template nucleic acid. In one aspect, the variant cellulase polypeptide has a cellulase activity under a high temperature, wherein the cellulase encoded by the template nucleic acid is not active under the high temperature. In one aspect, the method is iteratively repeated until a cellulase coding sequence having an altered codon usage from that of the template nucleic acid is produced. The method can be iteratively repeated until a cellulase gene having higher or lower level of message expression or stability from that of the template nucleic acid is produced.
[0070] The invention provides methods for modifying codons in a nucleic acid encoding a cellulase to increase its expression in a host cell, the method comprising (a) providing a template nucleic acid comprising a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) identifying a non-preferred or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to increase its expression in a host cell.
[0071] The invention provides methods for modifying codons in a nucleic acid encoding a cellulase, the method comprising (a) providing a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) identifying a codon in the nucleic acid of step (a) and replacing it with a different codon encoding the same amino acid as the replaced codon, thereby modifying codons in a nucleic acid encoding a cellulase. [0072] The invention provides methods for modifying codons in a nucleic acid encoding a cellulase to increase its expression in a host cell, the method comprising (a) providing a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity, or, providing a polypeptide of the invention; or a subsequence thereof; and (b) identifying a non-prefeπed or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over- represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to increase its expression in a host cell. [0073] The invention provides methods for modifying a codon in a nucleic acid encoding a cellulase to decrease its expression in a host cell, the method comprising (a) providing a template nucleic acid comprising a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity; and (b) identifying at least one preferred codon in the nucleic acid of step (a) and replacing it with a non-preferred or less preferred codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in a host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to decrease its expression in a host cell. En alternative aspects, the host cell is a bacterial cell, a fungal cell, an insect cell, a yeast cell, a plant cell or a mammalian cell.
[0074] The invention provides methods for producing a library of nucleic acids encoding a plurality of modified cellulase active sites or substrate binding sites, wherein the modified active sites or substrate binding sites are derived from a first nucleic acid comprising a sequence encoding a first active site or a first substrate binding site the method comprising: (a) providing a first nucleic acid encoding a first active site or first substrate binding site, wherein the first nucleic acid sequence comprises a sequence of the invention, e.g., a nucleic acid that hybridizes under stringent conditions to a sequence as set forth in SEQ ED NO:l, and the nucleic acid encodes a cellulase active site or a cellulase substrate binding site; (b) providing a set of mutagenic oligonucleotides that encode naturally-occurring amino acid variants at a plurality of targeted codons in the first nucleic acid; and, (c) using the set of mutagenic oligonucleotides to generate a set of active site- encoding or substrate binding site-encoding variant nucleic acids encoding a range of amino acid variations at each amino acid codon that was mutagenized, thereby producing a library of nucleic acids encoding a plurality of modified cellulase active sites or substrate binding sites. En alternative aspects, the method comprises mutagenizing the first nucleic acid of step (a) by a method comprising an optimized directed evolution system. The method can further comprise mutagenizing the first nucleic acid of step (a) by a method comprising gene site-saturation mutagenesis (GSSM), a synthetic ligation reassembly (SLR), error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR) and a combination thereof. The method can further comprise mutagenizing the first nucleic acid of step (a) or variants by a method comprising recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair- deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation and a combination thereof.
[0075] The invention provides methods for making a small molecule comprising the steps of: (a) providing a plurality of biosynthetie enzymes capable of synthesizing or modifying a small molecule, wherein one of the enzymes comprises a cellulase enzyme encoded by a nucleic acid of the invention , e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a substrate for at least one of the enzymes of step (a); and (c) reacting the substrate of step (b) with the enzymes under conditions that facilitate a plurality of biocatalytic reactions to generate a small molecule by a series of biocatalytic reactions. [0076] The invention provides methods for modifying a small molecule comprising the steps: (a) providing a cellulase enzyme encoded by a nucleic acid of the invention, e.g., a nucleic acid comprising a sequence of a nucleic acid of the invention or an isolated or recombinant nucleic acid, which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a small molecule; and (c) reacting the enzyme of step (a) with the small molecule of step (b) under conditions that facilitate an enzymatic reaction catalyzed by the cellulase enzyme, thereby modifying a small molecule by a cellulase enzymatic reaction. In one aspect, the method comprises a plurality of small molecule substrates for the enzyme of step (a), thereby generating a library of modified small molecules produced by at least one enzymatic reaction catalyzed by the cellulase enzyme. In one aspect, the method further comprises a plurality of additional enzymes under conditions that facilitate a plurality of biocatalytic reactions by the enzymes to form a library of modified small molecules produced by the plurality of enzymatic reactions. En one aspect, the method further comprises the step of testing the library to determine if a particular modified small molecule that exhibits a desired activity is present within the library. The step of testing the library can further comprise the steps of systematically eliminating all but one of the biocatalytic reactions used to produce a portion of the plurality of the modified small molecules within the library by testing the portion of the modified small molecule for the presence or absence of the particular modified small molecule with a desired activity, and identifying at least one specific biocatalytic reaction that produces the particular modified small molecule of desired activity.
[0077] The invention provides methods for determining a functional fragment of a cellulase enzyme comprising the steps of: (a) providing a cellulase enzyme, wherein the enzyme comprises an amino acid sequence of a polypeptide of the invention, or an isolated or recombinant nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; and (b) deleting a plurality of amino acid residues from the sequence of step (a) and testing the remaining subsequence for a cellulase activity, thereby determining a functional fragment of a cellulase enzyme. En one aspect, the cellulase activity is measured by providing a cellulase substrate and detecting a decrease in the amount of the substrate or an increase in the amount of a reaction product. In one aspect, a decrease in the amount of an enzyme substrate or an increase in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an activator of cellulase activity. [0078] The invention provides the method for whole cell engineering of new or modified phenotypes by using real-time metabolic flux analysis, the method comprising the following steps: (a) making a modified cell by modifying the genetic composition of a cell, wherein the genetic composition is modified by addition to the cell of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) culturing the modified cell to generate a plurality of modified cells; (c) measuring at least one metabolic parameter of the cell by monitoring the cell culture of step (b) in real time; and,(d) analyzing the data of step
(c) to determine if the measured parameter differs from a comparable measurement in an unmodified cell under similar conditions, thereby identifying an engineered phenotype in the cell using real-time metabolic flux analysis. In one aspect, the genetic composition of the cell is modified by a method comprising deletion of a sequence or modification of a sequence in the cell, or, knocking out the expression of a gene. In one aspect, the method further comprises selecting a cell comprising a newly engineered phenotype. En one aspect, the method further comprises culturing the selected cell, thereby generating a new cell strain comprising a newly engineered phenotype.
[0079] The invention provides methods for hydrolyzing a cellulose comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or, a polypeptide encoded by a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED
NO: 1, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a composition comprising a cellulose; and (c) contacting the polypeptide of step
(a) with the composition of step (b) under conditions wherein the polypeptide hydrolyzes the cellulose. In one aspect, the composition comprises a cellulose-containing pulp or a paper product.
[0080] The invention provides methods for hydrolyzing a glycosidic linkage comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or, a polypeptide encoded by a nucleic acid having a sequence of a nucleic acid of the invention, e.g., a nucleic acid which comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity; (b) providing a composition comprising a glycosidic linkage; and (c) contacting the polypeptide of step (a) with the composition of step (b) under conditions wherein the polypeptide hydrolyzes the glycosidic linkage. The glycosidic linkage can be a (beta 1, 4)glycosidic bond.
[0081] The invention provides methods of increasing thermotolerance or thermostability of a cellulase polypeptide, the method comprising glycosylating a cellulase polypeptide of the invention, e.g., wherein the cellulase comprises at least thirty contiguous amino acids of a sequence of a polypeptide of the invention, or a polypeptide encoded by a of the invention; or a polypeptide having a sequence as set forth in SEQ ID NO: 2, thereby increasing the thermotolerance or thermostability of the cellulase polypeptide. In one aspect, the method further comprises the cellulase specific activity is thermostable or thermotolerant at a temperature in the range from greater than about 37°C to about 90°C.
[ 0082 ] The invention provides methods for overexpressing a recombinant cellulase in a cell comprising expressing a vector comprising a nucleic acid of the invention, e.g., a nucleic acid having at least 50% to about 98% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, or a subsequence thereof, wherein overexpression is effected by use of a high activity promoter, a dicistronic vector or by gene amplification of the vector.
[0083] The invention provides methods for treating a cellulose-containing fabric comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid of the invention,; (b) providing a fabric comprising a cellulase; and (c) contacting the polypeptide of step (a) and the composition of step (b) under conditions wherein the cellulase can treat the cellulose-containing fabric .
[0084] The invention provides methods for treating a printed paper comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid of the invention; (b) providing a pulp slurry, wherein the pulp slurry is made from pulping the printed paper; and (c) contacting the polypeptide of step (a) and the pulp slurry of step (b) under conditions wherein the cellulase can treat the printed paper.
[0085] The invention provides method for treating solid or liquid waste products comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises a polypeptide of the invention, or a polypeptide encoded by a nucleic acid of the invention; (b) providing a solid or a liquid waste; and (c) contacting the polypeptide of step (a) and the solid or liquid waste of step (b) under conditions wherein the cellulase can treat the waste.
[0086] The polynucleotide sequences and polypeptides of the present invention comprise hydrolase activity, e.g., they include endoglucanases having carboxymethyl cellulose activity.
[0087] The present invention exploits the unique catalytic properties of enzymes.
Whereas the use of biocatalysts (i.e., purified or crude enzymes, non-living or living cells) in chemical transformations normally requires the identification of a particular biocatalyst that reacts with a specific starting compound, the present invention uses selected biocatalysts and reaction conditions that are specific for functional groups that are present in many starting compounds.
[0088] The invention provides an isolated nucleic acid having a sequence as set forth in SEQ ED NO:l and variants thereof having at least 50% sequence identity to SEQ ID NO:l and encoding polypeptides having cellulase activity.
[0089] One aspect of the invention is an isolated nucleic acid having a sequence as set forth in SEQ ED NO:l, sequences substantially identical thereto, and sequences complementary thereto.
[0090] Another aspect of the invention is an isolated nucleic acid including at least
10 consecutive bases of SEQ ID NO:l, sequences substantially identical thereto, and the sequences complementary thereto.
[0091] In yet another aspect, the invention provides an isolated nucleic acid encoding a polypeptide having a sequence as set forth in SEQ ED NO:2 and variants thereof encoding a polypeptide having cellulase activity and having at least 50% sequence identity to such sequence.
[0092 ] Another aspect of the invention is an isolated nucleic acid encoding a polypeptide or a functional fragment thereof having a sequence as set forth in SEQ ID NO: 2, and sequences substantially identical thereto.
[0093] Another aspect of the invention is an isolated nucleic acid encoding a polypeptide having at least 10 consecutive amino acids of a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
[0094] En yet another aspect, the invention provides a purified polypeptide having a sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto. [0095] Another aspect of the invention is an isolated or purified antibody that specifically binds to a polypeptide having a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
[0096] Another aspect of the invention is an isolated or purified antibody or binding fragment thereof, which specifically binds to a polypeptide having at least 10 consecutive amino acids of SEQ ID NO:2, and sequences substantially identical thereto. [0097] Another aspect of the invention is a method of making a polypeptide having a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto. The method includes introducing a nucleic acid encoding the polypeptide into a host cell, wherein the nucleic acid is operably linked to a promoter, and culturing the host cell under conditions that allow expression of the nucleic acid.
[0098] Another aspect of the invention is a method of making a polypeptide having at least 10 amino acids of a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto. The method includes introducing a nucleic acid encoding the polypeptide into a host cell, wherein the nucleic acid is operably linked to a promoter, and culturing the host cell under conditions that allow expression of the nucleic acid, thereby producing the polypeptide.
[0099] Another aspect of the invention is a method of generating a variant including obtaining a nucleic acid having a sequence as set forth in SEQ ID NO:l, sequences substantially identical thereto, sequences complementary to SEQ ID NO:l, fragments comprising at least 30 consecutive nucleotides of SEQ ED NO:l, and changing one or more nucleotides in the sequence to another nucleotide, deleting one or more nucleotides in the sequence, or adding one or more nucleotides to the sequence. [00100] Another aspect of the invention is a computer readable medium having stored thereon a sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto.
[00101] Another aspect of the invention is a computer system including a processor and a data storage device wherein the data storage device has stored thereon a sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide having a sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto. [00102 ] Another aspect of the invention is a method for comparing a first sequence to a reference sequence wherein the first sequence is a nucleic acid having a sequence as set forth SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide code of SEQ ED NO:2, and sequences substantially identical thereto. The method includes reading the first sequence and the reference sequence through use of a computer program that compares sequences; and determining differences between the first sequence and the reference sequence with the computer program.
[00103] Another aspect of the invention is a method for identifying a feature in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide having a sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, including reading the sequence through the use of a computer program which identifies features in sequences; and identifying features in the sequence with the computer program. [00104] Another aspect of the invention is an assay for identifying fragments or variants of SEQ ED NO:2, and sequences substantially identical thereto, which retain the enzymatic function of SEQ ED NO:2, and sequences substantially identical thereto. The assay includes contacting SEQ ED NO:2, sequences substantially identical thereto, or polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate thereby identifying a fragment or variant of such sequences. [00105] Another aspect of the invention is a method for modifying small molecules, including contacting a polypeptide encoded by a polynucleotide described herein or enzymatically active fragments thereof with a small molecule to produce a modified small molecule.
[00106] The details of one or more aspects of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. [00107] All publications, patents, patent applications, GenBank sequences and ATCC deposits, cited herein are hereby expressly incoφorated by reference for all purposes.
DESCRIPTION OF DRAWINGS [00108] The following drawings are illustrative of aspects of the invention and are not meant to limit the scope of the invention as encompassed by the claims. [00109] Figure 1 is a block diagram of an exemplary computer system of the invention. [00110] Figure 2 is a flow diagram illustrating one aspect of a process of the invention for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
[00111] Figure 3 is a flow diagram illustrating one aspect of a process of the invention in a computer for determining whether two sequences are homologous.
[00112] Figure 4 is a flow diagram illustrating one aspect of an identifier process of the invention 300 for detecting the presence of a feature in a sequence.
[00113] Figure 5 A-C shows an illustration of the full-length DNA and coπesponding deduced amino acid sequence of an exemplary enzyme of the present invention.
[00114] Like reference symbols in the various drawings indicate like elements.
DETAILED DESCREPTEON
[00115] The invention provides cellulases, nucleic acids encoding polypeptides comprising cellulase activity and methods of making and using them. En one aspect, the present invention provides a carboxymethyl cellulase and the polynucleotide encoding it.
As used herein, the term "cellulase" includes, but is not limited to, enzymes having any cellulase activity, e.g., catalyzing the hydrolysis of the beta 1,4 glycosidic bonds in cellulose. The polynucleotides of the invention encode polypeptides having various cellulase activities. The cellulases of the invention also include thermotolerant and thermoresistant enzymes and enzymes that have activity in high and low pH conditions.
Definitions
[00116] The term "antibody" includes a peptide or polypeptide derived from, modeled after or substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, capable of specifically binding an antigen (e.g., a cellulase of the invention) or epitope, see, e.g. Fundamental Immunology, Third Edition, W.E. Paul, ed., Raven Press, N.Y. (1993); Wilson (1994) J. Emmunol. Methods 175:267-273;
Yarmush (1992) J. Biochem. Biophys. Methods 25:85-97. The term antibody includes antigen-binding portions, i.e., "antigen binding sites," (e.g., fragments, subsequences, complementarity determining regions (CDRs)) that retain capacity to bind antigen, including (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and
CHI domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHI domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Single chain antibodies are also included by reference in the term "antibody." [00117] The terms "array" or "microarray" or "biochip" or "chip" as used herein is a plurality of target elements, each target element comprising a defined amount of one or more polypeptides, e.g., a cellulase of the invention, including antibodies, or nucleic acids immobilized onto a defined area of a substrate surface, as discussed in further detail, below.
[00118] As used herein, the terms "computer," "computer program" and "processor" are used in their broadest general contexts and incorporate all such devices. [00119] The term "expression cassette" as used herein refers to a nucleotide sequence which is capable of affecting expression of a structural gene (i.e., a protein coding sequence, such as a cellulase of the invention) in a host compatible with such sequences. Expression cassettes include at least a promoter operably linked with the polypeptide coding sequence; and, optionally, with other sequences, e.g., transcription termination signals. Additional factors necessary or helpful in effecting expression may also be used, e.g., enhancers. "Operably linked" as used herein refers to linkage of a promoter upstream from a DNA sequence such that the promoter mediates transcription of the DNA sequence. Thus, expression cassettes also include plasmids, expression vectors, recombinant viruses, any form of recombinant "naked DNA" vector, and the like. A "vector" comprises a nucleic acid that can infect, transfect, transiently or permanently transduce a cell. It will be recognized that a vector can be a naked nucleic acid, or a nucleic acid complexed with protein or lipid. The vector optionally comprises viral or bacterial nucleic acids and/or proteins, and/or membranes (e.g., a cell membrane, a viral lipid envelope, etc.). Vectors include, but are not limited to replicons (e.g., RNA replicons, bacteriophages) to which fragments of DNA may be attached and become replicated. Vectors thus include, but are not limited to RNA, autonomous self-replicating circular or linear DNA or RNA (e.g., plasmids, viruses, and the like, see, e.g., U.S. Patent No. 5,217,879), and includes both the expression and non-expression plasmids. Where a recombinant microorganism or cell culture is described as hosting an "expression vector" this includes both extra-chromosomal circular and linear DNA and DNA that has been incoφorated into the host chromosome(s). Where a vector is being maintained by a host cell, the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is incoφorated within the host's genome.
[00120] The phrases "nucleic acid" or "nucleic acid sequence" as used herein refer to an oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA (e.g., mRNA, rRNA, tRNA) of genomic or synthetic origin which may be single- stranded or double-stranded and may represent a sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material, natural or synthetic in origin, including, e.g., iRNA, ribonucleoproteins (e.g., iRNPs). The term encompasses nucleic acids, i.e., oligonucleotides, containing known analogues of natural nucleotides. The term also encompasses nucleic-acid-like structures with synthetic backbones, see e.g., Mata (1997) Toxicol. Appl. Pharmacol. 144:189-197; Strauss-Soukup (1997) Biochemistry 36:8692-8698; Samstag (1996) Antisense Nucleic Acid Drug Dev 6:153-156. [00121] "Amino acid" or "amino acid sequence" as used herein refer to an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules. [00122] As used herein, the term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment. As used herein, an isolated material or composition can also be a "purified" composition, i.e., it does not require absolute purity; rather, it is intended as a relative definition. Individual nucleic acids obtained from a library can be conventionally purified to electrophoretic homogeneity. In alternative aspects, the invention provides nucleic acids that have been purified from genomic DNA or from other sequences in a library or other environment by at least one, two, three, four, five or more orders of magnitude. [00123] As used herein, the term "recombinant" means that the nucleic acid is adjacent to a "backbone" nucleic acid to which it is not adjacent in its natural environment. In one aspect, nucleic acids represent 5% or more of the number of nucleic acid inserts in a population of nucleic acid "backbone molecules." "Backbone molecules" according to the invention include nucleic acids such as expression vectors, self-replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid insert of interest. In one aspect, the enriched nucleic acids represent 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules. "Recombinant" polypeptides or proteins refer to polypeptides or proteins produced by recombinant DNA techniques; e.g., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein. "Synthetic" polypeptides or protein are those prepared by chemical synthesis, as described in further detail, below.
[00124] A promoter sequence is "operably linked to" a coding sequence when RNA polymerase which initiates transcription at the promoter will transcribe the coding sequence into mRNA, as discussed further, below.
[00125] "Oligonucleotide" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands that may be chemically synthesized.
Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
[00126] The phrase "substantially identical" in the context of two nucleic acids or polypeptides, refers to two or more sequences that have at least 50%, 60%, 70%, 75%,
80%, 85%>, 90%, 95%, 98% or 99% nucleotide or amino acid residue (sequence) identity, when compared and aligned for maximum correspondence, as measured using one any known sequence comparison algorithm, as discussed in detail below, or by visual inspection. En alternative aspects, the invention provides nucleic acid and polypeptide sequences having substantial identity to an exemplary sequence of the invention, e.g., SEQ
ID NO:l, SEQ ID NO:2, over a region of at least about 100 residues, 150 residues, 200 residues, 300 residues, 400 residues, or a region ranging from between about 50 residues to the full length of the nucleic acid or polypeptide. Nucleic acid sequences of the invention can be substantially identical over the entire length of a polypeptide coding region.
[00127] Additionally a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence by one or more conservative or non-conservative amino acid substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site of the molecule, and provided that the polypeptide essentially retains its functional properties. A conservative amino acid substitution, for example, substitutes one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine). One or more amino acids can be deleted, for example, from a cellulase polypeptide, resulting in modification of the structure of the polypeptide, without significantly altering its biological activity. For example, amino- or carboxyl-terminal amino acids that are not required for cellulase biological activity can be removed. Modified polypeptide sequences of the invention can be assayed for cellulase biological activity by any number of methods, including contacting the modified polypeptide sequence with a cellulase substrate and determining whether the modified polypeptide decreases the amount of specific substrate in the assay or increases the bioproducts of the enzymatic reaction of a functional cellulase with the substrate, as discussed further, below.
[00128] "Hybridization" refers to the process by which a nucleic acid strand joins with a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations. Suitably stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art. For example, stringency can be increased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature, altering the time of hybridization, as described in detail, below. En alternative aspects, nucleic acids of the invention are defined by their ability to hybridize under various stringency conditions (e.g., high, medium, and low), as set forth herein. [00129] The term "variant" refers to polynucleotides or polypeptides of the invention, e.g., a cellulase of the invention, modified at one or more base pairs, codons, introns, exons, or amino acid residues (respectively) yet still retain the biological activity of a cellulase of the invention. Variants can be produced by any number of means included methods such as, for example, error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site- specific mutagenesis, gene reassembly, GSSM and any combination thereof. Techniques for producing variant cellulases having activity at a pH or temperature, for example, that is different from a wild-type cellulases, are included herein.
[00130] The term "saturation mutagenesis" or "GS SM" includes a method that uses degenerate oligonucleotide primers to introduce point mutations into a polynucleotide, as described in detail, below. [00131] The term "optimized directed evolution system" or "optimized directed evolution" includes a method for reassembling fragments of related nucleic acid sequences, e.g., related genes, and explained in detail, below.
[00132 ] The term "synthetic ligation reassembly" or "SLR" includes a method of ligating oligonucleotide fragments in a non-stochastic fashion, and explained in detail, below.
[00133] The phrases "nucleic acid" or "nucleic acid sequence" as used herein refer to an oligonucleotide, nucleotide, polynucleotide, or to a fragment of any of these, to DNA or RNA of genomic or synthetic origin which may be single-stranded or double-stranded and may represent a sense or antisense strand, peptide nucleic acid (PNA), or to any DNA- like or RNA-like material, natural or synthetic in origin. En one aspect, a "nucleic acid sequence" of the invention includes, for example, a sequence encoding a polypeptide as set forth in SEQ ED NO:2, and variants thereof. En another aspect, a "nucleic acid sequence" of the invention includes, for example, a sequence as set forth in SEQ ED NO:l, sequences complementary thereto, fragments of the foregoing sequences and variants thereof.
[00134] A "coding sequence of ' or a "nucleotide sequence encoding" a particular polypeptide or protein, is a nucleic acid sequence which is transcribed and translated into a polypeptide or protein when placed under the control of appropriate regulatory sequences.
[00135 ] The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as, where applicable, intervening sequences (introns) between individual coding segments (exons).
[00136] "Amino acid" or "amino acid sequence" as used herein refer to an oligopeptide, peptide, polypeptide, or protein sequence, or to a fragment, portion, or subunit of any of these, and to naturally occurring or synthetic molecules.
[00137] The term "polypeptide" as used herein, refers to amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain modified amino acids other than the 20 gene-encoded amino acids. The polypeptides, e.g., a cellulase of the invention, may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also a given polypeptide may have many types of modifications. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphytidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation. (See Creighton, T.E., Proteins - Structure and Molecular Properties 2nd Ed., W.H. Freeman and Company, New York (1993); Posttranslational Covalent Modification of Proteins, B.C. Johnson, Ed., Academic Press, New York, pp. 1-12 (1983)). [00138] As used herein, the term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide, e.g., a cellulase of the invention, present in a living bacterium or animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
[00139] As used herein, the term "purified" does not require absolute purity; rather, it is intended as a relative definition. Individual nucleic acids obtained from a library have been conventionally purified to electrophoretic homogeneity. The sequences obtained from these clones could not be obtained directly either from the library or from total human DNA. The purified nucleic acids of the invention have been purified from the remainder of the genomic DNA in the organism by at least 104-106 fold. However, the term "purified" also includes nucleic acids which have been purified from the remainder of the genomic DNA or from other sequences in a library or other environment by at least one order of magnitude, typically two or three orders, and more typically four or five orders of magnitude.
[00140] As used herein, the term "recombinant" means that the nucleic acid is adj acent to a "backbone" nucleic acid to which it is not adjacent in its natural environment. Additionally, to be "enriched" the nucleic acids will represent 5% or more of the number of nucleic acid inserts in a population of nucleic acid backbone molecules. Backbone molecules according to the invention include nucleic acids such as expression vectors, self-replicating nucleic acids, viruses, integrating nucleic acids, and other vectors or nucleic acids used to maintain or manipulate a nucleic acid insert of interest. Typically, the enriched nucleic acids represent 15 > or more of the number of nucleic acid inserts in the population of recombinant backbone molecules. More typically, the enriched nucleic acids represent 50% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules. In a one aspect, the enriched nucleic acids represent 90% or more of the number of nucleic acid inserts in the population of recombinant backbone molecules.
[00141] "Recombinant" polypeptides or proteins refer to polypeptides or proteins produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide or protein. "Synthetic" polypeptides or protein are those prepared by chemical synthesis. Solid-phase chemical peptide synthesis methods can also be used to synthesize the polypeptide or fragments of the invention. Such method have been known in the art since the early 1960's (Merrifield, R. B., J Am. Chem. Soc, 85:2149-2154, 1963) (See also Stewart, J. M. and Young, j. D., Solid Phase Peptide Synthesis, 2nd Ed., Pierce Chemical Co., Rockford, 111., pp. 11-12)) and have recently been employed in commercially available laboratory peptide design and synthesis kits (Cambridge Research Biochemicals). Such commercially available laboratory kits have generally utilized the teachings of H. M. Geysen et al, Proc. Natl. Acad. Sci, USA, 81 :3998 (1984) and provide for synthesizing peptides upon the tips of a multitude of "rods" or "pins" all of which are connected to a single plate. When such a system is utilized, a plate of rods or pins is inverted and inserted into a second plate of corresponding wells or reservoirs, which contain solutions for attaching or anchoring an appropriate amino acid to the pin's or rod's tips. By repeating such a process step, i.e., inverting and inserting the rod's and pin's tips into appropriate solutions, amino acids are built into desired peptides. In addition, a number of available FMOC peptide synthesis systems are available. For example, assembly of a polypeptide or fragment can be carried out on a solid support using an Applied Biosystems, Ene. Model 431 A automated peptide synthesizer. Such equipment provides ready access to the peptides of the invention, either by direct synthesis or by synthesis of a series of fragments that can be coupled using other known techniques.
[00142 ] A promoter sequence is "operably linked to" a coding sequence when RNA polymerase which initiates transcription at the promoter will transcribe the coding sequence into mRNA. "Plasmids" are designated by a lower case "p" preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. En addition, equivalent plasmids to those described herein are known in the art and will be apparent to the ordinarily skilled artisan.
[00143] "Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical puφoses, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the puφose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion, gel electrophoresis may be performed to isolate the desired fragment. [00144] "Oligonucleotide" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated. [00145] The phrase "substantially identical" in the context of two nucleic acids or polypeptides, refers to two or more sequences that have at least 50%, 55%, 60%, 65%, 70%, 15%, 80%, 85%) and in some aspects 90-95% or 90-99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the known sequence comparison algorithms or by visual inspection. Typically, the substantial identity exists over a region of at least about 100 residues, and most commonly the sequences are substantially identical over at least about 150-200 residues. In some aspects, the sequences are substantially identical over the entire length of the coding regions.
[00146] Additionally a "substantially identical" amino acid sequence is a sequence that differs from a reference sequence by one or more conservative or non-conservative amino acid substitutions, deletions, or insertions, particularly when such a substitution occurs at a site that is not the active site of the molecule, and provided that the polypeptide essentially retains its functional properties. A conservative amino acid substitution, for example, substitutes one amino acid for another of the same class (e.g., substitution of one hydrophobic amino acid, such as isoleucine, valine, leucine, or methionine, for another, or substitution of one polar amino acid for another, such as substitution of arginine for lysine, glutamic acid for aspartic acid or glutamine for asparagine). One or more amino acids can be deleted, for example, from an cellulase polypeptide, resulting in modification of the structure of the polypeptide, without significantly altering its biological activity. For example, amino- or carboxyl-terminal amino acids that are not required for cellulase biological activity can be removed. Modified polypeptide sequences of the invention can be assayed for cellulase biological activity by any number of methods, including contacting the modified polypeptide sequence with a cellulase substrate and determining whether the modified polypeptide decreases the amount of specific substrate in the assay or increases the bioproducts of the enzymatic reaction of a functional cellulase polypeptide with the substrate.
[00147] "Fragments" as used herein are a portion of a naturally occurring protein which can exist in at least two different conformations. Fragments can have the same or substantially the same amino acid sequence as the naturally occurring protein. "Substantially the same" means that an amino acid sequence is largely, but not entirely, the same, but retains at least one functional activity of the sequence to which it is related. En general two amino acid sequences are "substantially the same" or "substantially homologous" if they are at least about 85% identical. Fragments which have different three dimensional structures as the naturally occurring protein are also included. An example of this, is a "pro-form" molecule, such as a low activity proprotein that can be modified by cleavage to produce a mature enzyme with significantly higher activity. [00148] "Hybridization" refers to the process by which a nucleic acid strand joins with a complementary strand through base pairing. Hybridization reactions can be sensitive and selective so that a particular sequence of interest can be identified even in samples in which it is present at low concentrations. Suitably stringent conditions can be defined by, for example, the concentrations of salt or formamide in the prehybridization and hybridization solutions, or by the hybridization temperature, and are well known in the art. En particular, stringency can be increased by reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature. For example, hybridization under high stringency conditions could occur in about 50% formamide at about 37°C to 42°C. Hybridization could occur under reduced stringency conditions in about 35% to 25% formamide at about 30°C to 35°C. In particular, hybridization could occur under high stringency conditions at 42°C in 50% formamide, 5X SSPE, 0.3%) SDS, and 200 n/ml sheared and denatured salmon sperm DNA. Hybridization could occur under reduced stringency conditions as described above, but in 35% formamide at a reduced temperature of 35°C. The temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly. Variations on the above ranges and conditions are well known in the art. [00149] The term "variant" refers to polynucleotides or polypeptides of the invention modified at one or more base pairs, codons, introns, exons, or amino acid residues (respectively) yet still retain the biological activity of a cellulase of the invention. Variants can be produced by any number of means included methods such as, for example, error- prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, GSSM and any combination thereof.
[00150] The terms "thermostable" and "thermostability" as used herein with reference to an enzyme mean the ability of the enzyme to function at increased temperatures, for example to have comparable specific activity at 70°C and at 85° C at a common pH. A "thermostable" enzyme will maintain much or all of its activity at an increased temperature or may be more active at an increased temperature than at its normal temperature (e.g., room temperature) or its optimum temperature prior to mutagenesis to obtain enhanced thermostability.
[00151] The terms "thermotolerant" and "thermotolerance" as used herein with reference to an enzyme mean the ability of the enzyme to function normally after exposure to high temperature, even though the high temperature may temporarily deactivate the enzyme.
Generating and Manipulating Nucleic Acids [ 00152 ] The invention provides nucleic acids, including expression cassettes such as expression vectors, encoding the polypeptides and cellulases of the invention. The invention also includes methods for discovering new cellulase sequences using the nucleic acids of the invention. Also provided are methods for modifying the nucleic acids of the invention by, e.g., synthetic ligation reassembly, optimized directed evolution system and/or saturation mutagenesis. [00153] The nucleic acids of the invention can be made, isolated and/or manipulated by, e.g., cloning and expression of cDNA libraries, amplification of message or genomic
DNA by PCR, and the like. In practicing the methods of the invention, homologous genes can be modified by manipulating a template nucleic acid, as described herein. The invention can be practiced in conjunction with any method or protocol or device known in the art, which are well described in the scientific and patent literature.
General Techniques
[00154] The nucleic acids used to practice this invention, whether RNA, iRNA, antisense nucleic acid, cDNA, genomic DNA, vectors, viruses or hybrids thereof, may be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/ generated recombinantly. Recombinant polypeptides generated from these nucleic acids can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including bacterial, mammalian, yeast, insect or plant cell expression systems.
[00155] Alternatively, these nucleic acids can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc.
105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic.
Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979)
Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra.
Lett. 22:1859; U.S. Patent No. 4,458,066.
[00156] Techniques for the manipulation of nucleic acids, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook, ed., MOLECULAR CLONING: A LABORATORY
MANUAL (2ND ED.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989); CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, ed. John Wiley & Sons, Inc., New York
(1997); LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY:
HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I. Theory and Nucleic Acid Preparation,
Tijssen, ed. Elsevier, N.Y. (1993).
[00157] Another useful means of obtaining and manipulating nucleic acids used to practice the methods of the invention is to clone from genomic samples, and, if desired, screen and re-clone inserts isolated or amplified from, e.g., genomic clones or cDNA clones. Sources of nucleic acid used in the methods of the invention include genomic or cDNA libraries contained in, e.g., mammalian artificial chromosomes (MACs), see, e.g., U.S. Patent Nos. 5,721,118; 6,025,155; human artificial chromosomes, see, e.g., Rosenfeld
(1997) Nat. Genet. 15:333-335; yeast artificial chromosomes (YAC); bacterial artificial chromosomes (BAC); PI artificial chromosomes, see, e.g., Woon (1998) Genomics 50:306-316; Pl-derived vectors (PACs), see, e.g., Kern (1997) Biotechniques 23:120-124; cosmids, recombinant viruses, phages or plasmids.
[00158] En one aspect, a nucleic acid encoding a polypeptide of the invention is assembled in appropriate phase with a leader sequence capable of directing secretion of the translated polypeptide or fragment thereof.
[00159] The invention provides fusion proteins and nucleic acids encoding them. A polypeptide of the invention can be fused to a heterologous peptide or polypeptide, such as N-terminal identification peptides which impart desired characteristics, such as increased stability or simplified purification. Peptides and polypeptides of the invention can also be synthesized and expressed as fusion proteins with one or more additional domains linked thereto for, e.g., producing a more immunogenic peptide, to more readily isolate a recombinantly synthesized peptide, to identify and isolate antibodies and antibody- expressing B cells, and the like. Detection and purification facilitating domains include, e.g., metal chelating peptides such as polyhistidine tracts and histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Emmunex Coφ, Seattle WA). The inclusion of a cleavable linker sequences such as Factor Xa or enterokinase (Invitrogen, San Diego CA) between a purification domain and the motif-comprising peptide or polypeptide to facilitate purification. For example, an expression vector can include an epitope-encoding nucleic acid sequence linked to six histidine residues followed by a thioredoxin and an enterokinase cleavage site (see e.g., Williams (1995) Biochemistry 34:1787-1797; Dobeli
(1998) Protein Expr. Purifi 12:404-414). The histidine residues facilitate detection and purification while the enterokinase cleavage site provides a means for purifying the epitope from the remainder of the fusion protein. Technology pertaining to vectors encoding fusion proteins and application of fusion proteins are well described in the scientific and patent literature, see e.g., Kroll (1993) DNA Cell. Biol., 12:441-53.
Trans criptional and translational control sequences
[00160] The invention provides nucleic acid (e.g., DNA) sequences of the invention operatively linked to expression (e.g., transcriptional or translational) control sequence(s),. e.g., promoters or enhancers, to direct or modulate RNA synthesis/ expression. The expression control sequence can be in an expression vector. Exemplary bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and tφ. Exemplary eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein I.
[00161] Promoters suitable for expressing, or over-expressing, a polypeptide in bacteria include the E. coli lac or tφ promoters, the lad promoter, the lacZ promoter, the T3 promoter, the T7 promoter, the gpt promoter, the lambda PR promoter, the lambda PL promoter, promoters from operons encoding glycolytic enzymes such as 3- phosphoglycerate kinase (PGK), and the acid phosphatase promoter. Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter. Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used. Expression vectors and cloning vehicles
[00162 ] The invention provides expression vectors and cloning vehicles comprising nucleic acids of the invention, e.g., sequences encoding the cellulases of the invention, for expression, and over-expression, of the polypeptides of the invention (and nucleic acids, e.g., antisense). Expression vectors and cloning vehicles of the invention can comprise viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), PI -based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, Aspergillus and yeast). Vectors of the invention can include chromosomal, non- chromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. Exemplary vectors are include: bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXTl, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid or other vector may be used so long as they are replicable and viable in the host. Low copy number or high copy number vectors may be employed with the present invention.
[00163] The expression vector may comprise a promoter, a ribo some binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression. Mammalian expression vectors can comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. En some aspects, DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
[00164] En one aspect, the expression vectors contain one or more selectable marker genes to permit selection of host cells containing the vector. Such selectable markers include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E. coli, and the S. cerevisiae TRP1 gene. Promoter regions can be selected from any desired gene using chloramphenicol transferase (CAT) vectors or other vectors with selectable markers.
[00165] Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels. Enhancers are c*'_?-acting elements of DNA, usually from about 10 to about 300 bp in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adeno virus enhancers.
[00166] A DNA sequence may be inserted into a vector by a variety of procedures.
En general, the DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases.
Alternatively, blunt ends in both the insert and the vector may be ligated. A variety of cloning techniques are known in the art, e.g., as described in Ausubel and Sambrook. Such procedures and others are deemed to be within the scope of those skilled in the art.
[00167] The vector may be in the form of a plasmid, a viral particle, or a phage.
Other vectors include chromosomal, non-chromosomal and synthetic DNA sequences, derivatives of S V40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by, e.g., Sambrook.
[00168] Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322
(ATCC 37017), pI K223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1
(Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pDIO, psiX174 pBluescript II KS, ρNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7. Particular eukaryotic vectors include pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used as long as it is replicable and viable in the host cell.
Host cells and transformed cells
[00169] The invention also provides a transformed cell comprising a nucleic acid sequence of the invention, e.g., a sequence encoding a cellulase of the invention, a vector of the invention. The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, such as bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells, or plant cells. Exemplary bacterial cells include E. coli, Streptomyces, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus. Exemplary insect cells include Drosophila S2 and Spodoptera Sf9. Exemplary animal cells include CHO, COS or
Bowes melanoma or any mouse or human cell line. The selection of an appropriate host is within the abilities of those skilled in the art.
[00170] The vector may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection,
DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis, L., Dibner,
M., Battey, I., Basic Methods in Molecular Biology, (1986)).
[00171] Where appropriate, the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
[00172] Cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification. Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art. The expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography (HPLC) can be employed for final purification steps.
[00173] Various mammalian cell culture systems can also be employed to express, or over-express, recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3, CHO, HeLa and BHK cell lines. [00174] The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Depending upon the host employed in a recombinant production procedure, the polypeptides produced by host cells containing the vector may be glycosylated or may be non-glycosylated. Polypeptides of the invention may or may not also include an initial methionine amino acid residue. [00175] Cell-free translation systems can also be employed to produce a polypeptide of the invention. Cell-free translation systems can use mRNAs transcribed from a DNA construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof. En some aspects, the DNA construct may be linearized prior to conducting an in vitro transcription reaction. The transcribed mRNA is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
[00176] The expression vectors can contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli. Amplification of Nucleic Acids
[00177] En practicing the invention, nucleic acids encoding the polypeptides of the invention, or modified nucleic acids, can be reproduced by, e.g., amplification. The invention provides amplification primer sequence pairs for amplifying nucleic acids encoding polypeptides with a cellulase activity, where the primer pairs are capable of amplifying nucleic acid sequences including the exemplary SEQ ED NO:l, or a subsequence thereof. One of skill in the art can design amplification primer sequence pairs for any part of or the full length of these sequences [00178] Amplification reactions can also be used to quantify the amount of nucleic acid in a sample (such as the amount of message in a cell sample), label the nucleic acid (e.g., to apply it to an array or a blot), detect the nucleic acid, or quantify the amount of a specific nucleic acid in a sample. In one aspect of the invention, message isolated from a cell or a cDNA library are amplified. The skilled artisan can select and design suitable oligonucleotide amplification primers. Amplification methods are also well known in the art, and include, e.g., polymerase chain reaction, PCR (see, e.g., PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. Innis, Academic Press, N.Y. (1990) and PCR STRATEGIES (1995), ed. Innis, Academic Press, Inc., N.Y., ligase chain reaction (LCR) (see, e.g., Wu (1989) Genomics 4:560; Landegren (1988) Science 241 :1077; Barringer (1990) Gene 89:117); transcription amplification (see, e.g., Kwoh (1989) Proc. Natl. Acad. Sci. USA 86:1173); and, self-sustained sequence replication (see, e.g., Guatelli (1990) Proc. Natl. Acad. Sci. USA 87:1874); Q Beta replicase amplification (see, e.g., Smith (1997) J. Clin. Microbiol. 35:1477-1491), automated Q-beta replicase amplification assay (see, e.g., Burg (1996) Mol. Cell. Probes 10:257-271) and other RNA polymerase mediated techniques (e.g., NASBA, Cangene, Mississauga, Ontario); see also Berger (1987) Methods Enzymol. 152:307-316; Sambrook; Ausubel; U.S. Patent Nos. 4,683,195 and 4,683,202; Sooknanan (1995) Biotechnology 13:563-564. Determining the degree of sequence identity
[00179] The invention provides an isolated or recombinant nucleic acid comprising a nucleic acid sequence having at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the nucleic acids encode at least one polypeptide having a cellulase activity and the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual inspection. In alternative embodiments the nucleic acid sequence has at least 60%, 70%, 80%, 85%, 90%, 95%, 98%, 98.5%, 99% or 99.5%o sequence identity to SEQ ID NO:l over a region of at least about 50 residues, 100 residues, 150 residues, 200 residues, 250 residues, 300 residues, 350 residues, 400 residues, 450 residues, 500 residues, 550 residues, 600 residues, 700 residues, 800 residues, 900 residues or the full length of the sequence. The nucleic acid sequence can have a sequence as set forth in SEQ ID NO: 1. In one aspect, the extent of sequence identity (homology) may be determined using any computer program and associated parameters, including those described herein, such as BLAST 2.2.2. or FASTA version 3.0t78, with the default parameters. [00180] Homologous sequences also include RNA sequences in which uridines replace the thymines in the nucleic acid sequences. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid sequences as set forth herein can be represented in the traditional single character format (see, e.g., Stryer, Lubert. Biochemistry, 3rd Ed., W H Freeman & Co., New York) or in any other format which records the identity of the nucleotides in a sequence.
[00181] Various sequence comparison programs identified herein are used in this aspect of the invention. Protein and/or nucleic acid sequence identities (homologies) may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are not limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990; Thompson et al., Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al., Methods Enzymol. 266:383-402, 1996; Altschul et al., J. Mol. Biol. 215(3):403-410, 1990; Altschul et al., Nature Genetics 3:266-272, 1993.
[00182 ] Homology or identity can be measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705). Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications. The terms "homology" and "identity" in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aligned for maximum correspondence over a comparison window or designated region as measured using any number of sequence comparison algorithms or by manual alignment and visual inspection. For sequence comparison, one sequence can act as a reference sequence (an exemplary sequence SEQ ID NO:l, SEQ ID NO:2) to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. [00183] A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous residues. For example, in alternative aspects of the invention, continugous residues ranging anywhere from 20 to the full length of exemplary sequences SEQ ID NO:l, SEQ ID NO:2 are compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. If the reference sequence has the requisite sequence identity to SEQ ID NO:l, SEQ ED NO:2, e.g., 50%) to 99% sequence identity to SEQ ED NO:l, SEQ ID NO:2, that sequence is within the scope of the invention. In alternative embodiments, subsequences ranging from about 20 to 600, about 50 to 200, and about 100 to 150 are compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequence for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443, 1970, by the search for similarity method of person & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection. Other algorithms for determining homology or identity include, for example, in addition to a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological Enformation), ALEGN, AM AS (Analysis of Multiply Aligned Sequences), AMPS (Protein Multiple Sequence Alignment), ASSET (Aligned Segment Statistical Evaluation Tool), BANDS, BESTSCOR, B1OSCAN (Biological Sequence Comparative Analysis Node), BLEMPS (BLocks EMProved Searcher), FASTA, Entervals & Points, BMB, CLUSTAL V, CLUSTAL W, CONSENSUS, LCONSENSUS, WCONSENSUS, Smith- Waterman algorithm, DARWIN, Las Vegas algorithm, FNAT (Forced Nucleotide Alignment Tool), Framealign, Framesearch, DYNAMIC, FILTER, FSAP (Fristensky Sequence Analysis Package), GAP (Global Alignment Program), GENAL, G BBS, GenQuest, ESSC (Sensitive Sequence Comparison), LALEGN (Local Sequence Alignment), LCP (Local Content Program), MACAW (Multiple Alignment Construction & Analysis Workbench), MAP (Multiple Alignment Program), MBLKP, MBLKN, PEMA (Pattern-Induced Multi-sequence Alignment), SAGA (Sequence Alignment by Genetic Algorithm) and WHAT-EF. Such alignment programs can also be used to screen genome databases to identify polynucleotide sequences having substantially identical sequences. A number of genome databases are available, for example, a substantial portion of the human genome is available as part of the Human Genome Sequencing Project (Gibbs, 1995). Several genomes have been sequenced, e.g., M. genitalium (Fraser et al., 1995), M. jannaschii (Bult et al., 1996), H. influenzae (Fleischmann et al., 1995), E. coli (Blattner et al., 1997), and yeast (S. cerevisiae) (Mewes et al., 1997), and D. melanogaster (Adams et al., 2000). Significant progress has also been made in sequencing the genomes of model organism, such as mouse, C. elegans, and Arabadopsis sp. Databases containing genomic information annotated with some functional information are maintained by different organization, and are accessible via the internet.
[ 00184 ] BLAST, BLAST 2.0 and BLAST 2.2.2 algorithms are also used to practice the invention. They are described, e.g., in Altschul (1977) Nuc. Acids Res. 25:3389-3402; Altschul (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Εnformation. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is refeπed to as the neighborhood word score threshold (Altschul (1990) supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=- 4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectations (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, expectation (E) of 10, M=5, N= -4, and a comparison of both strands. The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873). One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, less than about 0.01, or less than about 0.001. En one aspect, protein and nucleic acid sequence homologies are evaluated using the Basic Local Alignment Search Tool ("BLAST"). For example, five specific BLAST programs can be used to perform the following task: (1) BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database; (2) BLASTN compares a nucleotide query sequence against a nucleotide sequence database; (3) BLASTX compares the six-frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database; (4) TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands); and, (5) TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database. The BLAST programs identify homologous sequences by identifying similar segments, which are referred to herein as "high-scoring segment pairs," between a query amino or nucleic acid sequence and a test sequence which can be obtained from a protein or nucleic acid sequence database. High-scoring segment pairs can be identified (i.e., aligned) by means of a scoring matrix, many of which are known in the art. An exemplary scoring matrix used is the BLOSUM62 matrix (Gonnet et al., Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61, 1993). Alternatively, the PAM or PAM250 matrices may be used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington: National Biomedical Research Foundation).
[00185] En one aspect of the invention, to determine if a nucleic acid has the requisite sequence identity to be within the scope of the invention, the NCB1 BLAST 2.2.2 programs is used, default options to blastp. There are about 38 setting options in the BLAST 2.2.2 program. En this exemplary aspect of the invention, all default values are used except for the default filtering setting (i.e., all parameters set to default except filtering which is set to OFF); in its place a "-F F" setting is used, which disables filtering. Use of default filtering often results in Karlin- Altschul violations due to short length of sequence.
[00186] The default values used in this exemplary aspect of the invention include: [00187 ] "Filter for low complexity: ON
[00188] > Word Size: 3
[00189] > Matrix: Blosum62
[00190] > Gap Costs: Existence:ll
[00191] > Extension: 1"
[00192 ] "Filter for low complexity: ON
[00193] Other default settings are: filter for low complexity OFF, word size of 3 for protein, BLOSUM62 matrix, gap existence penalty of -11 and a gap extension penalty of - 1.
[ 00194 ] An exemplary NCBI BLAST 2.2.2 program setting is set forth in Example 1, below. Note that the "-W" option defaults to 0. This means that, if not set, the word size defaults to 3 for proteins and 11 for nucleotides.
[00195] The invention provides a means for generating hybrid polynucleotides that may encode biologically active hybrid polypeptides (e.g., hybrid cellulase). In one aspect, the original polynucleotides encode biologically active polypeptides. The method of the invention produces new hybrid polypeptides by utilizing cellular processes which integrate the sequence of the original polynucleotides such that the resulting hybrid polynucleotide encodes a polypeptide demonstrating activities derived from the original biologically active polypeptides. For example, the original polynucleotides may encode a particular enzyme from different microorganisms. An enzyme encoded by a first polynucleotide from one organism or variant may, for example, function effectively under a particular environmental condition, e.g. high salinity. An enzyme encoded by a second polynucleotide from a different organism or variant may function effectively under a different environmental condition, such as extremely high temperatures. A hybrid polynucleotide containing sequences from the first and second original polynucleotides may encode an enzyme which exhibits characteristics of both enzymes encoded by the original polynucleotides. Thus, the enzyme encoded by the hybrid polynucleotide may function effectively under environmental conditions shared by each of the enzymes encoded by the first and second polynucleotides, e.g., high salinity and extreme temperatures.
[00196] Enzymes encoded by the polynucleotides of the invention include, but are not limited to, hydrolases, such as cellulases. A hybrid polypeptide resulting from the method of the invention may exhibit specialized enzyme activity not displayed in the original enzymes. For example, following recombination and/or reductive reassortment of polynucleotides encoding hydrolase activities, the resulting hybrid polypeptide encoded by a hybrid polynucleotide can be screened for specialized hydrolase activities obtained from each of the original enzymes, i.e. the type of bond on which the hydrolase acts and the temperature at which the hydrolase functions. Thus, for example, the hydrolase may be screened to ascertain those chemical functionalities which distinguish the hybrid hydrolase from the original hydrolases, such as: (a) amide (peptide bonds), i.e., proteases; (b) ester bonds, i.e., esterases and lipases; (c) acetals, i.e., glycosidases and, for example, the temperature, pH or salt concentration at which the hybrid polypeptide functions.
[00197 ] Sources of the original polynucleotides may be isolated from individual organisms ("isolates"), collections of organisms that have been grown in defined media
("enrichment cultures"), or, uncultivated organisms ("environmental samples"). The use of a culture-independent approach to derive polynucleotides encoding novel bioactivities from environmental samples can be used to allow access to untapped resources of biodiversity.
[00198] "Environmental libraries" are generated from environmental samples and represent the collective genomes of naturally occurring organisms archived in cloning vectors that can be propagated in suitable prokaryotic hosts. Because the cloned DNA is initially extracted directly from environmental samples, the libraries are not limited to the small fraction of prokaryotes that can be grown in pure culture. Additionally, a normalization of the environmental DNA present in these samples could allow more equal representation of the DNA from all of the species present in the original sample. This can dramatically increase the efficiency of finding interesting genes from minor constituents of the sample which may be under-represented by several orders of magnitude compared to the dominant species.
[00199] For example, gene libraries generated from one or more uncultivated microorganisms are screened for an activity of interest. Potential pathways encoding bioactive molecules of interest are first captured in prokaryotic cells in the form of gene expression libraries. Polynucleotides encoding activities of interest are isolated from such libraries and introduced into a host cell. The host cell is grown under conditions which promote recombination and/or reductive reassortment creating potentially active biomolecules with novel or enhanced activities.
[00200] The microorganisms from which the polynucleotide may be prepared include prokaryotic microorganisms, such as Eubacteήa and Archaebacteria, and lower eukaryotic microorganisms such as fungi, some algae and protozoa. Polynucleotides may be isolated from environmental samples in which case the nucleic acid may be recovered without culturing of an organism or recovered from one or more cultured organisms. In one aspect, such microorganisms may be extremophiles, such as hyperthermophiles, psychrophiles, psychrotrophs, halophiles, barophiles and acidophiles. Polynucleotides encoding enzymes isolated from extremophilic microorganisms can be used. Such enzymes may function at temperatures above 100°C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0°C in arctic waters, in the saturated salt environment of the
Dead Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich springs, or at pH values greater than 11 in sewage sludge. For example, several esterases and lipases cloned and expressed from extremophilic organisms show high activity throughout a wide range of temperatures and pHs.
[ 00201 ] Polynucleotides selected and isolated as hereinabove described are introduced into a suitable host cell. A suitable host cell is any cell which is capable of promoting recombination and/or reductive reassortment. The selected polynucleotides can be in a vector which includes appropriate control sequences. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or, the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-
Dextran mediated transfection, or electroporation (Davis et al, 1986).
[00202] As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera SJ9; animal cells such as CHO,
COS or Bowes melanoma; adenoviruses; and plant cells. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
[00203] With particular references to various mammalian cell culture systems that can be employed to express recombinant protein, examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described in "SV40- transformed simian cells support the replication of early SV40 mutants" (Gluzman, 1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3,
CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. DNA sequences derived from the
SV40 splice, and polyadenylation sites may be used to provide the required non-transcribed genetic elements. [00204] Host cells containing the polynucleotides of interest can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. The clones which are identified as having the specified enzyme activity may then be sequenced to identify the polynucleotide sequence encoding an enzyme having the enhanced activity.
[00205] In another aspect, the present invention can be used to generate novel polynucleotides encoding biochemical pathways from one or more operons or gene clusters or portions thereof. For example, bacteria and many eukaryotes have a coordinated mechanism for regulating genes whose products are involved in related processes. The genes are clustered, in structures referred to as "gene clusters," on a single chromosome and are transcribed together under the control of a single regulatory sequence, including a single promoter which initiates transcription of the entire cluster. Thus, a gene cluster is a group of adjacent genes that are either identical or related, usually as to their function. An example of a biochemical pathway encoded by gene clusters are polyketides. Polyketides are molecules which are an extremely rich source of bioactivities, including antibiotics
(such as tetracyclines and erythromycin), anti-cancer agents (daunomycin), immunosuppressants (FK506 and rapamycin), and veterinary products (monensin). Many polyketides (produced by polyketide synthases) are valuable as therapeutic agents.
Polyketide synthases are multifunctional enzymes that catalyze the biosynthesis of an enormous variety of carbon chains differing in length and patterns of functionality and cyclization. Polyketide synthase genes fall into gene clusters and at least one type
(designated type I) of polyketide synthases have large size genes and enzymes, complicating genetic manipulation and in vitro studies of these genes/proteins.
[00206] Gene cluster DNA can be isolated from different organisms and ligated into vectors, particularly vectors containing expression regulatory sequences which can control and regulate the production of a detectable protein or protein-related array activity from the ligated gene clusters. Use of vectors which have an exceptionally large capacity for exogenous DNA introduction are particularly appropriate for use with such gene clusters and are described by way of example herein to include the f-factor (or fertility factor) of E. coli. This f-factor of E. coli is a plasmid which affect high-frequency transfer of itself during conjugation and is ideal to achieve and stably propagate large DNA fragments, such as gene clusters from mixed microbial samples. One aspect is to use cloning vectors, referred to as "fosmids" or bacterial artificial chromosome (BAC) vectors. These are derived from E. coli f-factor which is able to stably integrate large segments of genomic DNA. When integrated with DNA from a mixed uncultured environmental sample, this makes it possible to achieve large genomic fragments in the form of a stable "environmental DNA library." Another type of vector for use in the present invention is a cosmid vector. Cosmid vectors were originally designed to clone and propagate large segments of genomic DNA. Cloning into cosmid vectors is described in detail in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Εd„ Cold Spring Harbor Laboratory Press (1989). Once ligated into an appropriate vector, two or more vectors containing different polyketide synthase gene clusters can be introduced into a suitable host cell. Regions of partial sequence homology shared by the gene clusters will promote processes which result in sequence reorganization resulting in a hybrid gene cluster. The novel hybrid gene cluster can then be screened for enhanced activities not found in the original gene clusters.
[00207] Therefore, in a one aspect, the invention relates to a method for producing a biologically active hybrid polypeptide and screening such a polypeptide for enhanced activity by:
[00208] 1 ) introducing at least a first polynucleotide in operable linkage and a second polynucleotide in operable linkage, said at least first polynucleotide and second polynucleotide sharing at least one region of partial sequence homology, into a suitable host cell;
[00209] 2) growing the host cell under conditions which promote sequence reorganization resulting in a hybrid polynucleotide in operable linkage;
[ 00210 ] 3) expressing a hybrid polypeptide encoded by the hybrid polynucleotide;
[00211] 4) screening the hybrid polypeptide under conditions which promote identification of enhanced biological activity; and
[00212 ] 5) isolating the a polynucleotide encoding the hybrid polypeptide.
[00213] Methods for screening for various enzyme activities are known to those of skill in the art and are discussed throughout the present specification. Such methods may be employed when isolating the polypeptides and polynucleotides of the invention.
[00214] As representative examples of expression vectors which may be used, there may be mentioned viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral DNA (e.g., vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), PI -based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, Aspergillus and yeast). Thus, for example, the DNA may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, (lambda-ZAP vectors (Stratagene); ptrc99a, pKK223-3, pDR540, pRIT2T (Pharmacia); Eukaryotic: pXTl, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pSVLSV40 (Pharmacia). However, any other plasmid or other vector may be used so long as they are replicable and viable in the host. Low copy number or high copy number vectors may be employed with the present invention. [00215] The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct RNA synthesis. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression. Promoter regions can be selected from any desired gene using chloramphenicol transferase (CAT) vectors or other vectors with selectable markers. In addition, the expression vectors can contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli. [00216] In vivo reassortment is focused on "inter-molecular" processes collectively referred to as "recombination" which in bacteria, is generally viewed as a "RecA- dependent" phenomenon. The invention can rely on recombination processes of a host cell to recombine and re-assort sequences, or the cells' ability to mediate reductive processes to decrease the complexity of quasi-repeated sequences in the cell by deletion. This process of "reductive reassortment" occurs by an "intra-molecular", RecA-independent process. [00217] Therefore, in another aspect of the invention, novel polynucleotides can be generated by the process of reductive reassortment. The method involves the generation of constructs containing consecutive sequences (original encoding sequences), their insertion into an appropriate vector, and their subsequent introduction into an appropriate host cell. The reassortment of the individual molecular identities occurs by combinatorial processes between the consecutive sequences in the construct possessing regions of homology, or between quasi-repeated units. The reassortment process recombines and/or reduces the complexity and extent of the repeated sequences, and results in the production of novel molecular species. Various treatments may be applied to enhance the rate of reassortment. These could include treatment with ultra-violet light, or DNA damaging chemicals, and/or the use of host cell lines displaying enhanced levels of "genetic instability". Thus the reassortment process may involve homologous recombination or the natural property of quasi-repeated sequences to direct their own evolution.
[00218] Repeated or "quasi-repeated" sequences play a role in genetic instability. In the present invention, "quasi-repeats" are repeats that are not restricted to their original unit structure. Quasi-repeated units can be presented as an array of sequences in a construct; consecutive units of similar sequences. Once ligated, the junctions between the consecutive sequences become essentially invisible and the quasi-repetitive nature of the resulting construct is now continuous at the molecular level. The deletion process the cell performs to reduce the complexity of the resulting construct operates between the quasi- repeated sequences. The quasi-repeated units provide a practically limitless repertoire of templates upon which slippage events can occur. The constructs containing the quasi- repeats thus effectively provide sufficient molecular elasticity that deletion (and potentially insertion) events can occur virtually anywhere within the quasi-repetitive units. [00219] When the quasi -repeated sequences are all ligated in the same orientation, for instance head to tail or vice versa, the cell cannot distinguish individual units. Consequently, the reductive process can occur throughout the sequences. In contrast, when for example, the units are presented head to head, rather than head to tail, the inversion delineates the endpoints of the adjacent unit so that deletion formation will favor the loss of discrete units. Thus, the sequences can be in the same orientation. Random orientation of quasi -repeated sequences will result in the loss of reassortment efficiency, while consistent orientation of the sequences will offer the highest efficiency. However, while having fewer of the contiguous sequences in the same orientation decreases the efficiency, it may still provide sufficient elasticity for the effective recovery of novel molecules. Constructs can be made with the quasi-repeated sequences in the same orientation to allow higher efficiency. [00220] Sequences can be assembled in a head to tail orientation using any of a variety of methods, including the following:
[00221] a) Primers that include a poly- A head and poly-T tail which when made single-stranded would provide orientation can be utilized. This is accomplished by having the first few bases of the primers made from RNA and hence easily removed RNAse H.
[00222] b) Primers that include unique restriction cleavage sites can be utilized. Multiple sites, a battery of unique sequences, and repeated synthesis and ligation steps would be required.
[00223] c) The inner few bases of the primer could be thiolated and an exonuclease used to produce properly tailed molecules.
[00224] The recovery of the re-assorted sequences relies on the identification of cloning vectors with a reduced repetitive index (Rl). The re-assorted encoding sequences can then be recovered by amplification. The products are re-cloned and expressed. The recovery of cloning vectors with reduced Rl can be affected by:
[00225] 1 ) The use of vectors only stably maintained when the construct is reduced in complexity.
[00226] 2) The physical recovery of shortened vectors by physical procedures. In this case, the cloning vector would be recovered using standard plasmid isolation procedures and size fractionated on either an agarose gel, or column with a low molecular weight cut off utilizing standard procedures.
[00227] 3) The recovery of vectors containing interrupted genes which can be selected when insert size decreases.
[00228] 4) The use of direct selection techniques with an expression vector and the appropriate selection.
[00229] Encoding sequences (for example, genes) from related organisms may demonstrate a high degree of homology and encode quite diverse protein products. These types of sequences are particularly useful in the present invention as quasi-repeats. However, while the examples illustrated below demonstrate the reassortment of nearly identical original encoding sequences (quasi-repeats), this process is not limited to such nearly identical repeats.
[00230] The following example demonstrates a method of the invention. Encoding nucleic acid sequences (quasi-repeats) derived from three (3) unique species are described. Each sequence encodes a protein with a distinct set of properties. Each of the sequences differs by a single or a few base pairs at a unique position in the sequence. The quasi- repeated sequences are separately or collectively amplified and ligated into random assemblies such that all possible permutations and combinations are available in the population of ligated molecules. The number of quasi-repeat units can be controlled by the assembly conditions. The average number of quasi -repeated units in a construct is defined as the repetitive index (Rl).
[00231] Once formed, the constructs may, or may not be size fractionated on an agarose gel according to published protocols, inserted into a cloning vector, and transfected into an appropriate host cell. The cells are then propagated and "reductive reassortment" is effected. The rate of the reductive reassortment process may be stimulated by the introduction of DNA damage if desired. Whether the reduction in Rl is mediated by deletion formation between repeated sequences by an "intra-molecular" mechanism, or mediated by recombination-like events through "inter-molecular" mechanisms is immaterial. The end result is a reassortment of the molecules into all possible combinations.
[00232 ] Optionally, the method comprises the additional step of screening the library members of the shuffled pool to identify individual shuffled library members having the ability to bind or otherwise interact, or catalyze a particular reaction (e.g., such as catalytic domain of an enzyme) with a predetermined macromolecule, such as for example a proteinaceous receptor, an oligosaccharide, virion, or other predetermined compound or structure.
[00233] The polypeptides that are identified from such libraries can be used for therapeutic, diagnostic, research and related puφoses (e.g. , catalysts, solutes for increasing osmolarity of an aqueous solution, and the like), and/or can be subjected to one or more additional cycles of shuffling and/or selection.
[00234] In another aspect, it is envisioned that prior to or during recombination or reassortment, polynucleotides generated by the method of the invention can be subjected to agents or processes which promote the introduction of mutations into the original polynucleotides. The introduction of such mutations would increase the diversity of resulting hybrid polynucleotides and polypeptides encoded therefrom. The agents or processes which promote mutagenesis can include, but are not limited to: (+)-CC-1065, or a synthetic analog such as (+)-CC-1065-(N3- Adenine (See Sun and Hurley, (1992); an N- acetylated or deacetylated 4'-fluro-4-aminobiphenyl adduct capable of inhibiting DNA synthesis (See , for example, van de Poll et al. (1992)); or a N-acetylated or deacetylated 4- aminobiphenyl adduct capable of inhibiting DNA synthesis (See also, van de Poll et al. (1992), pp. 751-758); trivalent chromium, a trivalent chromium salt, a polycyclic aromatic hydrocarbon (PAH) DNA adduct capable of inhibiting DNA replication, such as 7- bromomethyl-benz[α]anthracene ("BMA"), tris(2,3-dibromopropyl)phosphate ("Tris-BP"), l,2-dibromo-3-chloropropane ("DBCP"), 2-bromoacrolein (2BA), benzo[α]pyrene-7,8- dihydrodiol-9-10-epoxide ("BPDE"), a platinum(II) halogen salt, N-hydroxy-2-amino-3- methylimidazo[4,5- |-quinoline ("N-hydroxy-IQ"), and N-hydroxy-2-amino-l-methyl-6- phenylimidazo [4, 5 -/] -pyridine ("N-hydroxy-PhlP"). One exemplary means for slowing or halting PCR amplification consist of UV light (+)-CC-1065 and (+)-CC-1065-(N3- Adenine). Particularly encompassed means are DNA adducts or polynucleotides comprising the DNA adducts from the polynucleotides or polynucleotides pool, which can be released or removed by a process including heating the solution comprising the polynucleotides prior to further processing.
[00235] In another aspect the invention is directed to a method of producing recombinant proteins having biological activity by treating a sample comprising double- stranded template polynucleotides encoding a wild-type protein under conditions according to the invention which provide for the production of hybrid or re-assorted polynucleotides. [00236] As discussed in more detail below, the isolated nucleic acids SEQ ID NO: 1 , and sequences substantially identical thereto, may be used to prepare one of the polypeptides of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of SEQ ID NO:2, and sequences substantially identical thereto. [00237] Accordingly, another aspect of the invention is an isolated nucleic acid which encodes SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of SEQ ID NO:2. The coding sequences of these nucleic acids may be identical to SEQ ID NO:l, or a fragment thereof or may be different coding sequences which encode SEQ ID NO:2, sequences substantially identical thereto, and fragments having at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids SEQ ID NO:2, as a result of the redundancy or degeneracy of the genetic code. The genetic code is well known to those of skill in the art and can be obtained, for example, on page 214 of B. Lewin, Genes VI, Oxford University Press, 1997.
[00238] The isolated nucleic acid which encodes SEQ ID NO:2, and sequences substantially identical thereto, may include, but is not limited to: only the coding sequence of SEQ ID NO:l, and sequences substantially identical thereto, and additional coding sequences, such as leader sequences or proprotein sequences and non-coding sequences, such as introns or non-coding sequences 5' and/or 3' of the coding sequence. Thus, as used herein, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only the coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
[00239] Alternatively, SEQ ID NO:l, and sequences substantially identical thereto, may be mutagenized using conventional techniques, such as site directed mutagenesis, or other techniques familiar to those skilled in the art, to introduce silent changes SEQ ID NO:l, and sequences substantially identical thereto. As used herein, "silent changes" include, for example, changes which do not alter the amino acid sequence encoded by the polynucleotide. Such changes may be desirable in order to increase the level of the polypeptide produced by host cells containing a vector encoding the polypeptide by introducing codons or codon pairs which occur frequently in the host organism. [00240] The invention also relates to polynucleotides which have nucleotide changes which result in amino acid substitutions, additions, deletions, fusions and truncations in SEQ ID NO:2, and sequences substantially identical thereto. Such nucleotide changes may be introduced using techniques such as site directed mutagenesis, random chemical mutagenesis, exonuclease III deletion, and other recombinant DNA techniques. Alternatively, such nucleotide changes may be naturally occurring allelic variants which are isolated by identifying nucleic acids which specifically hybridize to probes comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:l, and sequences substantially identical thereto (or the sequences complementary thereto) under conditions of high, moderate, or low stringency as provided herein.
[00241] Another aspect of the invention is an isolated or purified polypeptide comprising the sequence of SEQ ID NO:l, and sequences substantially identical thereto, or fragments comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. As discussed above, such polypeptides may be obtained by inserting a nucleic acid encoding the polypeptide into a vector such that the coding sequence is operably linked to a sequence capable of driving the expression of the encoded polypeptide in a suitable host cell. For example, the expression vector may comprise a promoter, a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression. [00242] Promoters suitable for expressing the polypeptide or fragment thereof in bacteria include the E. coli lac or trp promoters, the lad promoter, the lacZ promoter, the
T3 promoter, the T7 promoter, the gpt promoter, the lambda PR promoter, the lambda Pi promoter, promoters from operons encoding glycolytic enzymes such as 3- phosphoglycerate kinase (PGK), and the acid phosphatase promoter. Fungal promoters include the α factor promoter. Eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, heat shock promoters, the early and late
SV40 promoter, LTRs from retroviruses, and the mouse metallothionein-I promoter. Other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses may also be used.
[00243] Mammalian expression vectors may also comprise an origin of replication, any necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. In some aspects, DNA sequences derived from the SV40 splice and polyadenylation sites may be used to provide the required non-transcribed genetic elements.
[00244] Vectors for expressing the polypeptide or fragment thereof in eukaryotic cells may also contain enhancers to increase expression levels. Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 bp in length that act on a promoter to increase its transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and the adenovirus enhancers.
[00245] In addition, the expression vectors typically contain one or more selectable marker genes to permit selection of host cells containing the vector. Such selectable markers include genes encoding dihydrofolate reductase or genes conferring neomycin resistance for eukaryotic cell culture, genes conferring tetracycline or ampicillin resistance in E. coli, and the S. cerevisiae TRPl gene.
[00246] In some aspects, the nucleic acid encoding SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least about 5, 10, 15, 20, 25, 30,
35, 40, 50, 75, 100, or 150 consecutive amino acids thereof is assembled in appropriate phase with a leader sequence capable of directing secretion of the translated polypeptide or fragment thereof. Optionally, the nucleic acid can encode a fusion polypeptide in which one of the polypeptides of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof is fused to heterologous peptides or polypeptides, such as N-terminal identification peptides which impart desired characteristics, such as increased stability or simplified purification.
[00247] The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is ligated to the desired position in the vector following digestion of the insert and the vector with appropriate restriction endonucleases. Alternatively, blunt ends in both the insert and the vector may be ligated. A variety of cloning techniques are disclosed in Ausubel et al. Current Protocols in Molecular Biology, John Wiley 503 Sons, Inc. 1997 and Sambrook et al, Molecular Cloning: A Laboratory Manual 2d Ed., Cold Spring Harbor Laboratory Press (1989). Such procedures and others are deemed to be within the scope of those skilled in the art.
[00248] The vector may be, for example, in the form of a plasmid, a viral particle, or a phage. Other vectors include chromosomal, nonchromosomal and synthetic DNA sequences, derivatives of SV40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. A variety of cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, N.Y., (1989).
[00249] Particular bacterial vectors which may be used include the commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, WI, USA) pQE70, pQE60, pQE-9 (Qiagen), pDIO, psiX174 pBluescript II KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8 and pCM7. Particular eukaryotic vectors include pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia). However, any other vector may be used as long as it is replicable and viable in the host cell.
[ 00250 ] The host cell may be any of the host cells familiar to those skilled in the art, including prokaryotic cells, eukaryotic cells, mammalian cells, insect cells, or plant cells. As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Bacillus subtilis^ Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, fungal cells, such as yeast, insect cells such as Drosophila S2 and Spodoptera Sβ, animal cells such as CHO, COS or Bowes melanoma, and adenoviruses. The selection of an appropriate host is within the abilities of those skilled in the art.
[ 00251 ] The vector may be introduced into the host cells using any of a variety of techniques, including transformation, transfection, transduction, viral infection, gene guns, or Ti-mediated gene transfer. Particular methods include calcium phosphate transfection,
DEAE-Dextran mediated transfection, lipofection, or electroporation (Davis, L., Dibner,
M., Battey, I., Basic Methods in Molecular Biology, (1986)).
[ 00252 ] Where appropriate, the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the invention. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter may be induced by appropriate means (e.g., temperature shift or chemical induction) and the cells may be cultured for an additional period to allow them to produce the desired polypeptide or fragment thereof.
[00253] Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.
Microbial cells employed for expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. Such methods are well known to those skilled in the art. The expressed polypeptide or fragment thereof can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the polypeptide. If desired, high performance liquid chromatography
(HPLC) can be employed for final purification steps.
[ 00254 ] Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts (described by Gluzman, Cell, 23:175, 1981), and other cell lines capable of expressing proteins from a compatible vector, such as the C127, 3T3,
CHO, HeLa and BHK cell lines.
[00255] The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Depending upon the host employed in a recombinant production procedure, the polypeptides produced by host cells containing the vector may be glycosylated or may be non-glycosylated. Polypeptides of the invention may or may not also include an initial methionine amino acid residue.
[00256] Alternatively, SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof can be synthetically produced by conventional peptide synthesizers. En other aspects, fragments or portions of the polypeptides may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
[00257] Cell-free translation systems can also be employed to produce SEQ ED
NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10,
15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using mRNAs transcribed from a DNA construct comprising a promoter operably linked to a nucleic acid encoding the polypeptide or fragment thereof. In some aspects, the DNA construct may be linearized prior to conducting an in vitro transcription reaction. The transcribed mR A is then incubated with an appropriate cell-free translation extract, such as a rabbit reticulocyte extract, to produce the desired polypeptide or fragment thereof.
[ 00258 ] The invention also relates to variants of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40,
50, 75, 100, or 150 consecutive amino acids thereof. The term "variant" includes derivatives or analogs of these polypeptides. In particular, the variants may differ in amino acid sequence from SEQ ID NO:2, and sequences substantially identical thereto, by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
[00259] The variants may be naturally occurring or created in vitro. En particular, such variants may be created using genetic engineering techniques such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives may be created using chemical synthesis or modification procedures.
[00260] Other methods of making variants are also familiar to those skilled in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids which encode polypeptides having characteristics which enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Typically, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.
[00261] For example, variants may be created using error prone PCR. In error prone
PCR, PCR is performed under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product. Error prone PCR is described in Leung, D.W., et al,
Technique, 1:11-15, 1989) and Caldwell, R. C. & Joyce G.F., PCR Methods Applic, 2:28-
33, 1992. Briefly, in such procedures, nucleic acids to be mutagemzed are mixed with
PCR primers, reaction buffer, MgCl2, MnCl2, Taq polymerase and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product. For example, the reaction may be performed using 20 fmoles of nucleic acid to be mutagemzed, 30pmole of each PCR primer, a reaction buffer comprising
50mM KC1, lOmM Tris HCl (pH 8.3) and 0.01% gelatin, 7mM MgCl2, 0.5mM MnCl2, 5 units of Taq polymerase, 0.2mM dGTP, 0.2mM dATP, ImM dCTP, and ImM dTTP. PCR may be performed for 30 cycles of 94° C for 1 min, 45° C for 1 min, and 72° C for 1 min.
However, it will be appreciated that these parameters may be varied as appropriate. The mutagenized nucleic acids are cloned into an appropriate vector and the activities of the polypeptides encoded by the mutagenized nucleic acids is evaluated.
[00262 ] Variants may also be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest. Oligonucleotide mutagenesis is described in Reidhaar-Olson, J.F. & Sauer, R.T., et al, Science, 241:53-57,
1988. Briefly, in such procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized. Clones containing the mutagenized DNA are recovered and the activities of the polypeptides they encode are assessed.
[00263] Another method for generating variants is assembly PCR. Assembly PCR involves the assembly of a PCR product from a mixture of small DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in U.S.
Patent No. 5,965,408, filed July 9, 1996, entitled, "Method of DNA Reassembly by
Interrupting Synthesis."
[00264] Still another method of generating variants is sexual PCR mutagenesis. In sexual PCR mutagenesis, forced homologous recombination occurs between DNA molecules of different but highly related DNA sequence in vitro, as a result of random fragmentation of the DNA molecule based on sequence homology, followed by fixation of the crossover by primer extension in a PCR reaction. Sexual PCR mutagenesis is described in Stemmer, W.P., PNAS, USA, 91:10747-10751, 1994. Briefly, in such procedures a plurality of nucleic acids to be recombined are digested with DNase to generate fragments having an average size of 50-200 nucleotides. Fragments of the desired average size are purified and resuspended in a PCR mixture. PCR is conducted under conditions which facilitate recombination between the nucleic acid fragments. For example, PCR may be performed by resuspending the purified fragments at a concentration of 10-30ng/μl in a solution of 0.2mM of each dNTP, 2.2mM MgC12, 50mM KCL, lOmM Tris HCl, pH 9.0, and 0.1%) Triton X-100. 2.5 units of Taq polymerase per lOOμl of reaction mixture is added and PCR is performed,using the following regime: 94° C for 60 seconds, 94° C for 30 seconds, 50-55° C for 30 seconds, 72° C for 30 seconds (30-45 times) and 72° C for 5 minutes. However, it will be appreciated that these parameters may be varied as appropriate. In some aspects, oligonucleotides may be included in the PCR reactions. In other aspects, the Klenow fragment of DNA polymerase I may be used in a first set of PCR reactions and Taq polymerase may be used in a subsequent set of PCR reactions. Recombinant sequences are isolated and the activities of the polypeptides they encode are assessed.
[00265] Variants may also be created by in vivo mutagenesis. In some aspects, random mutations in a sequence of interest are generated by propagating the sequence of interest in a bacterial strain, such as an E. coli strain, which carries mutations in one or more of the DNA repair pathways. Such "mutator" strains have a higher random mutation rate than that of a wild-type parent. Propagating the DNA in one of these strains will eventually generate random mutations within the DNA. Mutator strains suitable for use for in vivo mutagenesis are described in PCT Publication No. WO 91/16427, published October 31, 1991, entitled "Methods for Phenotype Creation from Multiple Gene Populations."
[00266] Variants may also be generated using cassette mutagenesis. In cassette mutagenesis a small region of a double stranded DNA molecule is replaced with a synthetic oligonucleotide "cassette" that differs from the native sequence. The oligonucleotide often contains completely and/or partially randomized native sequence.
[00267] Recursive ensemble mutagenesis may also be used to generate variants. Recursive ensemble mutagenesis is an algorithm for protein engineering (protein mutagenesis) developed to produce diverse populations of pheno typically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis. Recursive ensemble mutagenesis is described in Arkin, A.P. and Youvan, D.C., PNAS, USA, 89:7811-7815, 1992.
[00268] In some aspects, variants are created using exponential ensemble mutagenesis. Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins. Exponential ensemble mutagenesis is described in Delegrave, S. and Youvan, D.C., Biotechnology Research, 11:1548-1552, 1993. Random and site- directed mutagenesis are described in Arnold, F.H., Current Opinion in Biotechnology, 4:450-455, 1993.
[00269] En some aspects, the variants are created using shuffling procedures wherein portions of a plurality of nucleic acids which encode distinct polypeptides are fused together to create chimeric nucleic acid sequences which encode chimeric polypeptides as described in U.S. Patent No. 5,965,408, filed July 9, 1996, entitled, "Method of DNA Reassembly by Interrupting Synthesis", and U.S. Patent No. 5,939,250, filed May 22, 1996, entitled, "Production of Enzymes Having Desired Activities by Mutagenesis." [00270] The variants of SEQ ED NO:2 may be variants in which one or more of the amino acid residues of SEQ ED NO:2 are substituted with a conserved or non-conserved amino acid residue (e.g., a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code.
[ 00271 ] Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the following replacements: replacements of an aliphatic amino acid such as Alanine, Valine, Leucine and Isoleucine with another aliphatic amino acid; replacement of a Serine with a Threonine or vice versa; replacement of an acidic residue such as Aspartic acid and Glutamic acid with another acidic residue; replacement of a residue bearing an amide group, such as Asparagine and Glutamine, with another residue bearing an amide group; exchange of a basic residue such as Lysine and Arginine with another basic residue; and replacement of an aromatic residue such as Phenylalanine, Tyrosine with another aromatic residue. [00272] Other variants are those in which one or more of the amino acid residues of
SEQ ID NO:2 includes a substituent group.
[00273] Still other variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol).
[00274] Additional variants are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence or a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.
[00275] In some aspects, the fragments, derivatives and analogs retain the same biological function or activity as SEQ ID NO:2, and sequences substantially identical thereto. En other aspects, the fragment, derivative, or analog includes a proprotein, such that the fragment, derivative, or analog can be activated by cleavage of the proprotein portion to produce an active polypeptide.
[00276] Another aspect of the invention is polypeptides or fragments thereof which have at least about 50%>, at least about 55%, at least about 60%, at least about 65%>, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to SEQ ED NO:2, and sequences substantially identical thereto, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40,
50, 75, 100, or 150 consecutive amino acids thereof. Homology may be determined using any of the programs described above which aligns the polypeptides or fragments being compared and determines the extent of amino acid identity or similarity between them. It will be appreciated that amino acid "homology" includes conservative amino acid substitutions such as those described above.
[00277] The polypeptides or fragments having homology to SEQ ID NO:2, and sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15,
20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be obtained by isolating the nucleic acids encoding them using the techniques described above.
[00278] Alternatively, the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures. The sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing. The sequence of the prospective homologous polypeptide or fragment can be compared to SEQ ED NO:2, and sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75,
100, or 150 consecutive amino acids thereof using any of the programs described above. [00279] Another aspect of the invention is an assay for identifying fragments or variants of SEQ ID NO:2, and sequences substantially identical thereto, which retain the enzymatic function of SEQ ID NO:2, and sequences substantially identical thereto. For example the fragments or variants of said polypeptides, may be used to catalyze biochemical reactions, which indicate that the fragment or variant retains the enzymatic activity of SEQ ID NO:2.
[00280] The assay for determining if fragments of variants retain the enzymatic activity of SEQ ED NO:2, and sequences substantially identical thereto includes the steps of; contacting the polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate.
[00281] SEQ ED NO:2, and sequences substantially identical thereto or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be used in a variety of applications. For example, the polypeptides or fragments thereof may be used to catalyze biochemical reactions. In accordance with one aspect of the invention, there is provided a process for utilizing SEQ ID NO:2, and sequences substantially identical thereto or polynucleotides encoding such polypeptides for hydrolyzing glycosidic linkages. In such procedures, a substance containing a glycosidic linkage (e.g., a starch) is contacted with SEQ ID NO:2, or sequences substantially identical thereto under conditions which facilitate the hydrolysis of the glycosidic linkage. [00282 ] SEQ ID NO:2, and sequences substantially identical thereto or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may also be used to generate antibodies which bind specifically to the polypeptides or fragments. The resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample. In such procedures, a protein preparation, such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. [00283] In immunoaffinity procedures, the antibody is attached to a solid support, such as a bead or other column matrix. The protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to SEQ ID NO:2, and sequences substantially identical thereto, or fragment thereof. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
[00284] The ability of proteins in a biological sample to bind to the antibody may be determined using any of a variety of procedures familiar to those skilled in the art. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
[00285] Polyclonal antibodies generated against SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40,
50, 75, 100, or 150 consecutive amino acids thereof can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, for example, a nonhuman. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide.
[00286] For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Nature, 256:495-497, 1975), the trioma technique, the human B-cell hybridoma technique (Kozbor et al, Immunology Today 4:72,
1983), and the EBV-hybridoma technique (Cole, et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
[00287] Techniques described for the production of single chain antibodies (U. S .
Patent No. 4,946,778) can be adapted to produce single chain antibodies to SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20,
25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof. Alternatively, transgenic mice may be used to express humanized antibodies to these polypeptides or fragments thereof.
[00288] Antibodies generated against SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof may be used in screening for similar polypeptides from other organisms and samples. En such techniques, polypeptides from the organism are contacted with the antibody and those polypeptides which specifically bind the antibody are detected. Any of the procedures described above may be used to detect antibody binding. One such screening assay is described in "Methods for Measuring Cellulase
Activities", Methods in Enzymology, Vol 160, pp. 87-116.
[00289] As used herein the term "SEQ ED NO:l" encompasses the nucleotide sequence of SEQ ID NO:l, and sequences substantially identical thereto, as well as sequences homologous to SEQ ID NO:l, and fragments thereof and sequences complementary to all of the preceding sequences. The fragments include portions of SEQ ID
NO:l, comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of SEQ ID NO:l, and sequences substantially identical thereto.
Homologous sequences and fragments of SEQ ID NO:l, and sequences substantially identical thereto, refer to a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%,
80%, 75%o, 70%, 65%, 60%, 55% or 50% homology to these sequences. Homology may be determined using any of the computer programs and parameters described herein, including
FASTA version 3.0t78 with the default parameters. Homologous sequences also include
RNA sequences in which uridines replace the thymines in the nucleic acid sequences as set forth in SEQ ID NO: 1. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. It will be appreciated that the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, can be represented in the traditional single character format
(See the inside back cover of Stryer, Lubert. Biochemistry, 3rd Ed., W. H Freeman & Co.,
New York.) or in any other format which records the identity of the nucleotides in a sequence.
[00290] As used herein the term "a polypeptide sequence as set forth in SEQ ID
NO:2" encompasses the polypeptide sequence of SEQ ID NO:2, and sequences substantially identical thereto, which are encoded by a sequence as set forth in SEQ ID NO: 1 , polypeptide sequences homologous to SEQ ID NO:2, and sequences substantially identical thereto, or fragments of any of the preceding sequences. Homologous polypeptide sequences refer to a polypeptide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, 80%, 75%,
70%, 65%, 60%, 55% or 50% homology to SEQ ID NO:2. Homology may be determined using any of the computer programs and parameters described herein, including FASTA version 3.0t78 with the default parameters or with any modified parameters. The homologous sequences may be obtained using any of the procedures described herein or may result from the correction of a sequencing error. The polypeptide fragments comprise at least 5, 10, 15,
20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of SEQ ID NO:2, and sequences substantially identical thereto. It will be appreciated that the polypeptide codes as set forth in SEQ ID NO:2, and sequences substantially identical thereto, can be represented in the traditional single character format or three letter format (See the inside back cover of Stryer, Lubert. Biochemistry, 3rd Ed.. W. H Freeman & Co., New York.) or in any other format which relates the identity of the polypeptides in a sequence. Computer systems and computer program products
[00291] To determine and identify sequence identities, structural homologies, motifs and the like in silico the sequence of the invention can be stored, recorded, and manipulated on any medium which can be read and accessed by a computer. Accordingly, the invention provides computers, computer systems, computer readable mediums, computer programs products and the like recorded or stored thereon the nucleic acid and polypeptide sequences of the invention, e.g., the exemplary sequences SEQ ID NO:l, SEQ ED NO:2. As used herein, the words "recorded" and "stored" refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any known methods for recording information on a computer readable medium to generate manufactures comprising one or more of the nucleic acid and/or polypeptide sequences of the invention.
[00292] It will be appreciated by those skilled in the art that a nucleic acid sequence as set forth in SEQ ID NO:l and a polypeptide sequence as set forth in SEQ ID NO:2 can be stored, recorded, and manipulated on any medium which can be read and accessed by a computer. As used herein, the words "recorded" and "stored" refer to a process for storing information on a computer medium. A skilled artisan can readily adopt any of the presently known methods for recording information on a computer readable medium to generate manufactures comprising one or more of the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, one or more of the polypeptide sequences as set forth in SEQ ED NO:2, and sequences substantially identical thereto. Another aspect of the invention is a computer readable medium having recorded thereon at least 2, 5, 10, 15, or 20 nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto.
[00293] Another aspect of the invention is a computer readable medium having recorded thereon one or more of the nucleic acid sequences as set forth SEQ ID NO:l, and sequences substantially identical thereto. Another aspect of the invention is a computer readable medium having recorded thereon one or more of the polypeptide sequences as set forth in SEQ ID NO:2, and sequences substantially identical thereto. Another aspect of the invention is a computer readable medium having recorded thereon at least 2, 5, 10, 15, or 20 of the sequences as set forth above. Computer readable media include magnetically readable media, optically readable media, electronically readable media and magnetic/optical media. For example, the computer readable media may be a hard disk, a floppy disk, a magnetic tape, CD-ROM, Digital Versatile Disk (DVD), Random Access Memory (RAM), or Read Only Memory (ROM) as well as other types of other media known to those skilled in the art. [00294] Aspects of the invention include systems (e.g., internet based systems), particularly computer systems which store and manipulate the sequence information described herein. One example of a computer system 100 is illustrated in block diagram form in Figure 1. As used herein, "a computer system" refers to the hardware components, software components, and data storage components used to analyze a nucleotide sequence of a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2. The computer system 100 typically includes a processor for processing, accessing and manipulating the sequence data. The processor 105 can be any well-known type of central processing unit, such as, for example, the Pentium Ell from Intel Coφoration, or similar processor from Sun, Motorola, Compaq, AMD or International Business Machines.
[00295] Typically the computer system 100 is a general puφose system that comprises the processor 105 and one or more internal data storage components 110 for storing data, and one or more data retrieving devices for retrieving the data stored on the data storage components. A skilled artisan can readily appreciate that any one of the currently available computer systems are suitable. In one aspect, the computer system 100 includes a processor 105 connected to a bus which is connected to a main memory 115 (e.g., implemented as RAM) and one or more internal data storage devices 110, such as a hard drive and/or other computer readable media having data recorded thereon. En some aspects, the computer system 100 further includes one or more data retrieving device 118 for reading the data stored on the internal data storage devices 110. The data retrieving device 118 may represent, for example, a floppy disk drive, a compact disk drive, a magnetic tape drive, or a modem capable of connection to a remote data storage system (e.g., via the internet) etc. In some aspects, the internal data storage device 110 is a removable computer readable medium such as a floppy disk, a compact disk, a magnetic tape, etc. containing control logic and/or data recorded thereon. The computer system 100 may advantageously include or be programmed by appropriate software for reading the control logic and/or the data from the data storage component once inserted in the data retrieving device. The computer system 100 includes a display 120 which is used to display output to a computer user. It should also be noted that the computer system 100 can be linked to other computer systems 125a-c in a network or wide area network to provide centralized access to the computer system 100. [00296] Software for accessing and processing the nucleotide sequences of a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, (such as search tools, compare tools, and modeling tools etc.) may reside in main memory 115 during execution.
[00297] In some aspects, the computer system 100 may further comprise a sequence comparison algorithm for comparing a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, stored on a computer readable medium to a reference nucleotide or polypeptide sequence(s) stored on a computer readable medium. A "sequence comparison algorithm" refers to one or more programs which are implemented (locally or remotely) on the computer system 100 to compare a nucleotide sequence with other nucleotide sequences and/or compounds stored within a data storage means. For example, the sequence comparison algorithm may compare the nucleotide sequences of a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, stored on a computer readable medium to reference sequences stored on a computer readable medium to identify homologies or structural motifs. Various sequence comparison programs identified elsewhere in this patent specification are particularly contemplated for use in this aspect of the invention. Protein and/or nucleic acid sequence homologies may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are by no means limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85(8):2444-2448, 1988; Altschul et al, J. Mol. Biol. 215(3):403-410, 1990; Thompson et al, Nucleic Acids Res. 22(2):4673-4680, 1994; Higgins et al, Methods Enzymol. 266:383-402, 1996; Altschul et al, J. Mol. Biol. 215(3):403-410, 1990; Altschul et al, Nature Genetics 3:266-272, 1993). Homology or identity can be measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WE 53705). Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications.
The terms "homology" and "identity" in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aligned for maximum correspondence over a comparison window or designated region as measured using any number of sequence comparison algorithms or by manual alignment and visual inspection.
[ 00298 ] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. [00299] A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequence for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol 48:443, 1970, by the search for similarity method of person & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988, by computerized implementations of these algorithms (GAP, BESTF1T, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WE), or by manual alignment and visual inspection. Other algorithms for determining homology or identity include, for example, in addition to a BLAST program (Basic Local Alignment Search Tool at the National Center for Biological information), ALIGN, AMAS (Analysis of Multiply Aligned Sequences), AMPS (Protein Multiple Sequence Alignment), ASSET (Aligned Segment Statistical Evaluation Tool), BANDS, BESTSCOR, BIOSCAN (Biological Sequence Comparative Analysis Node), BLIMPS (BLocks EVIProved Searcher), FASTA, Intervals & Points, BMB, CLUSTAL V, CLUSTAL W, CONSENSUS, LCONSENSUS, WCONSENSUS, Smith- Waterman algorithm, DARWIN, Las Vegas algorithm, FNAT (Forced Nucleotide Alignment Tool), Framealign, Framesearch, DYNAMIC, FILTER, FSAP (Fristensky
Sequence Analysis Package), GAP (Global Alignment Program), GENAL, GIBBS, GenQuest, ISSC (Sensitive Sequence Comparison), LALIGN (Local Sequence Alignment), LCP (Local Content Program), MACAW (Multiple Alignment Construction & Analysis Workbench), MAP (Multiple Alignment Program), MBLKP, MBLKN, PIMA (Pattern- Induced Multi-sequence Alignment), SAGA (Sequence Alignment by Genetic Algorithm) and WHAT-EF. Such alignment programs can also be used to screen genome databases to identify polynucleotide sequences having substantially identical sequences. A number of genome databases are available, for example, a substantial portion of the human genome is available as part of the Human Genome Sequencing Project (Gibbs, 1995). At least twenty- one other genomes have already been sequenced, including, for example, M. genitalium (Fraser et al, 1995), M. jannaschii (Bult et al, 1996), H. influenzae (Fleischmann et al, 1995), E. coli (Blattner et al, 1997), and yeast (S. cerevisiae) (Mewes et al, 1997), andD. melanogaster (Adams et al, 2000). Significant progress has also been made in sequencing the genomes of model organism, such as mouse, C. elegans, and Arabadopsis sp. Several databases containing genomic information annotated with some functional information are maintained by different organization, and are accessible via the internet. [00300] One example of an algorithm used in the methods of the invention is BLAST and BLAST 2.0 algorithms, which are described in Altschul et al, Nuc. Acids Res. 25:3389- 3402, 1977, and Altschul et al, J. Mol. Biol. 215:403-410, 1990, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectations (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989) alignments (B) of 50, expectation (E) of 10, M=5, N= -4, and a comparison of both strands.
[00301] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873, 1993). One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, or less than about 0.01, or less than about 0.001.
[ 00302 ] In one aspect, protein and nucleic acid sequence homologies are evaluated using the Basic Local Alignment Search Tool ("BLAST") In particular, five specific BLAST programs are used to perform the following task:
[00303] (1) BLASTP and BLAST3 compare an amino acid query sequence against a protein sequence database;
[00304] (2) BLASTN compares a nucleotide query sequence against a nucleotide sequence database;
[00305] (3) BLASTX compares the six-frame conceptual translation products of a query nucleotide sequence (both strands) against a protein sequence database; [00306] (4) TBLASTN compares a query protein sequence against a nucleotide sequence database translated in all six reading frames (both strands); and [00307] (5) TBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database. [00308] The BLAST programs identify homologous sequences by identifying similar segments, which are referred to herein as "high-scoring segment pairs," between a query amino or nucleic acid sequence and a test sequence which can be obtained from a protein or nucleic acid sequence database. High-scoring segment pairs can be identified (i.e., aligned) by means of a scoring matrix, many of which are known in the art. The scoring matrix can be BLOSUM62 matrix (Gonnet et al, Science 256:1443-1445, 1992; Henikoff and Henikoff, Proteins 17:49-61, 1993). Alternatively, the PAM or PAM250 matrices may also be used (see, e.g., Schwartz and Dayhoff, eds., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington:
National Biomedical Research Foundation). BLAST programs are accessible through the
U.S. National Library of Medicine. The parameters used with the above algorithms may be adapted depending on the sequence length and degree of homology studied. In some aspects, the parameters may be the default parameters used by the algorithms in the absence of instructions from the user.
[00309] Figure 2 is a flow diagram illustrating one aspect of a process 200 for comparing a new nucleotide or protein sequence with a database of sequences in order to determine the homology levels between the new sequence and the sequences in the database.
The database of sequences can be a private database stored within the computer system 100, or a public database such as GENBANK that is available through the Internet. The process
200 begins at a start state 201 and then moves to a state 202 wherein the new sequence to be compared is stored to a memory in a computer system 100. As discussed above, the memory could be any type of memory, including RAM or an internal storage device. The process 200 then moves to a state 204 wherein a database of sequences is opened for analysis and comparison. The process 200 then moves to a state 206 wherein the first sequence stored in the database is read into a memory on the computer. A comparison is then performed at a state 210 to determine if the first sequence is the same as the second sequence. It is important to note that this step is not limited to performing an exact comparison between the new sequence and the first sequence in the database. Well-known methods are known to those of skill in the art for comparing two nucleotide or protein sequences, even if they are not identical. For example, gaps can be introduced into one sequence in order to raise the homology level between the two tested sequences. The parameters that control whether gaps or other features are introduced into a sequence during comparison are normally entered by the user of the computer system. Once a comparison of the two sequences has been performed at the state 210, a determination is made at a decision state 210 whether the two sequences are the same. Of course, the term "same" is not limited to sequences that are absolutely identical. Sequences that are within the homology parameters entered by the user will be marked as "same" in the process 200. If a determination is made that the two sequences are the same, the process 200 moves to a state 214 wherein the name of the sequence from the database is displayed to the user. This state notifies the user that the sequence with the displayed name fulfills the homology constraints that were entered. Once the name of the stored sequence is displayed to the user, the process 200 moves to a decision state 218 wherein a determination is made whether more sequences exist in the database. If no more sequences exist in the database, then the process 200 terminates at an end state 220. However, if more sequences do exist in the database, then the process 200 moves to a state 224 wherein a pointer is moved to the next sequence in the database so that it can be compared to the new sequence. In this manner, the new sequence is aligned and compared with every sequence in the database. It should be noted that if a determination had been made at the decision state 212 that the sequences were not homologous, then the process 200 would move immediately to the decision state 218 in order to determine if any other sequences were available in the database for comparison. Accordingly, one aspect of the invention is a computer system comprising a processor, a data storage device having stored thereon a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, a data storage device having retrievably stored thereon reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ID NO:, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, and a sequence comparer for conducting the comparison. The sequence comparer may indicate a homology level between the sequences compared or identify structural motifs in the above described nucleic acid code of SEQ ID NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, or it may identify structural motifs in sequences which are compared to these nucleic acid codes and polypeptide codes. In some aspects, the data storage device may have stored thereon the sequences of at least 2, 5, 10, 15, 20, 25, 30 or 40 or more of the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or the polypeptide sequences as set forth in SEQ ED NO:2, and sequences substantially identical thereto.
[00310] Another aspect of the invention is a method for determining the level of homology between a nucleic acid sequence as set forth in SEQ ED NO: 1, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, and a reference nucleotide sequence. The method including reading the nucleic acid code or the polypeptide code and the reference nucleotide or polypeptide sequence through the use of a computer program which determines homology levels and determining homology between the nucleic acid code or polypeptide code and the reference nucleotide or polypeptide sequence with the computer program. The computer program may be any of a number of computer programs for determining homology levels, including those specifically enumerated herein, (e.g., BLAST2N with the default parameters or with any modified parameters). The method may be implemented using the computer systems described above. The method may also be performed by reading at least 2, 5, 10, 15, 20, 25, 30 or 40 or more of the above described nucleic acid sequences as set forth in SEQ ID NO:l, or the polypeptide sequences as set forth in SEQ ID NO:2 through use of the computer program and determining homology between the nucleic acid codes or polypeptide codes and reference nucleotide sequences or polypeptide sequences. [00311] Figure 3 is a flow diagram illustrating one aspect of a process 250 in a computer for determining whether two sequences are homologous. The process 250 begins at a start state 252 and then moves to a state 254 wherein a first sequence to be compared is stored to a memory. The second sequence to be compared is then stored to a memory at a state 256. The process 250 then moves to a state 260 wherein the first character in the first sequence is read and then to a state 262 wherein the first character of the second sequence is read. It should be understood that if the sequence is a nucleotide sequence, then the character would normally be either A, T, C, G or U. If the sequence is a protein sequence, then it is can be in the single letter amino acid code so that the first and sequence sequences can be easily compared.
[ 00312 ] A determination is then made at a decision state 264 whether the two characters are the same. If they are the same, then the process 250 moves to a state 268 wherein the next characters in the first and second sequences are read. A determination is then made whether the next characters are the same. If they are, then the process 250 continues this loop until two characters are not the same. If a determination is made that the next two characters are not the same, the process 250 moves to a decision state 274 to determine whether there are any more characters either sequence to read. [00313] If there are not any more characters to read, then the process 250 moves to a state 276 wherein the level of homology between the first and second sequences is displayed to the user. The level of homology is determined by calculating the proportion of characters between the sequences that were the same out of the total number of sequences in the first sequence. Thus, if every character in a first 100 nucleotide sequence aligned with a every character in a second sequence, the homology level would be 100%. [00314] Alternatively, the computer program may be a computer program which compares the nucleotide sequences of a nucleic acid sequence as set forth in the invention, to one or more reference nucleotide sequences in order to determine whether the nucleic acid code of SEQ ED NO:l, and sequences substantially identical thereto, differs from a reference nucleic acid sequence at one or more positions. Optionally such a program records the length and identity of inserted, deleted or substituted nucleotides with respect to the sequence of either the reference polynucleotide or a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto. In one aspect, the computer program may be a program which determines whether a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, contains a single nucleotide polymoφhism (SNP) with respect to a reference nucleotide sequence. [00315] Accordingly, another aspect of the invention is a method for determining whether a nucleic acid sequence as set forth in SEQ ID NO:l, and sequences substantially identical thereto, differs at one or more nucleotides from a reference nucleotide sequence comprising the steps of reading the nucleic acid code and the reference nucleotide sequence through use of a computer program which identifies differences between nucleic acid sequences and identifying differences between the nucleic acid code and the reference nucleotide sequence with the computer program. In some aspects, the computer program is a program which identifies single nucleotide polymoφhisms. The method may be implemented by the computer systems described above and the method illustrated in Figure 3. The method may also be performed by reading at least 2, 5, 10, 15, 20, 25, 30, or 40 or more of the nucleic acid sequences as set forth in SEQ ED NO:l, and sequences substantially identical thereto, and the reference nucleotide sequences through the use of the computer program and identifying differences between the nucleic acid codes and the reference nucleotide sequences with the computer program. [00316] In other aspects the computer based system may further comprise an identifier for identifying features within a nucleic acid sequence as set forth in SEQ ED NO:l or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto. An "identifier" refers to one or more programs which identifies certain features within a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto. In one aspect, the identifier may comprise a program which identifies an open reading frame in a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto. Figure 5 is a flow diagram illustrating one aspect of an identifier process 300 for detecting the presence of a feature in a sequence. The process 300 begins at a start state 302 and then moves to a state 304 wherein a first sequence that is to be checked for features is stored to a memory 115 in the computer system 100. The process 300 then moves to a state 306 wherein a database of sequence features is opened. Such a database would include a list of each feature's attributes along with the name of the feature. For example, a feature name could be
"Initiation Codon" and the attribute would be "ATG". Another example would be the feature name "TAATAA Box" and the feature attribute would be "TAATAA". An example of such a database is produced by the University of Wisconsin Genetics Computer
Group (www.gcg.com). Alternatively, the features may be structural polypeptide motifs such as alpha helices, beta sheets, or functional polypeptide motifs such as enzymatic active sites, helix-turn-helix motifs or other motifs known to those skilled in the art. Once the database of features is opened at the state 306, the process 300 moves to a state 308 wherein the first feature is read from the database. A comparison of the attribute of the first feature with the first sequence is then made at a state 310. A determination is then made at a decision state 316 whether the attribute of the feature was found in the first sequence. If the attribute was found, then the process 300 moves to a state 318 wherein the name of the found feature is displayed to the user. The process 300 then moves to a decision state 320 wherein a determination is made whether move features exist in the database. If no more features do exist, then the process 300 terminates at an end state 324.
However, if more features do exist in the database, then the process 300 reads the next sequence feature at a state 326 and loops back to the state 310 wherein the attribute of the next feature is compared against the first sequence. It should be noted, that if the feature attribute is not found in the first sequence at the decision state 316, the process 300 moves directly to the decision state 320 in order to determine if any more features exist in the database. Accordingly, another aspect of the invention is a method of identifying a feature within a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, comprising reading the nucleic acid code(s) or polypeptide code(s) through the use of a computer program which identifies features therein and identifying features within the nucleic acid code(s) with the computer program. In one aspect, computer program comprises a computer program which identifies open reading frames. The method may be performed by reading a single sequence or at least 2, 5, 10, 15,
20, 25, 30, or 40 of the nucleic acid sequences as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or the polypeptide sequences as set forth in SEQ ED NO:2, and sequences substantially identical thereto, through the use of the computer program and identifying features within the nucleic acid codes or polypeptide codes with the computer program. [00317] A nucleic acid sequence as set forth in SEQ ID NO : 1 , and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto, may be stored and manipulated in a variety of data processor programs in a variety of formats. For example, a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ED NO:2, and sequences substantially identical thereto, may be stored as text in a word processing file, such as MicrosoftWORD or WORDPERFECT or as an ASCIE file in a variety of database programs familiar to those of skill in the art, such as DB2, SYBASE, or ORACLE. In addition, many computer programs and databases may be used as sequence comparison algorithms, identifiers, or sources of reference nucleotide sequences or polypeptide sequences to be compared to a nucleic acid sequence as set forth in SEQ ED NO:l, and sequences substantially identical thereto, or a polypeptide sequence as set forth in SEQ ID NO:2, and sequences substantially identical thereto. The following list is intended not to limit the invention but to provide guidance to programs and databases which are useful with the nucleic acid sequences as set forth in SEQ ID NO:l, and sequences substantially identical thereto, or the polypeptide sequences as set forth in SEQ ED NO:2, and sequences substantially identical thereto. The programs and databases which may be used include, but are not limited to: MacPattern (EMBL), DiscoveryBase (Molecular Applications Group), GeneMine (Molecular Applications Group), Look (Molecular Applications Group), MacLook (Molecular Applications Group), BLAST and BLAST2 (NCB1), BLASTN and BLASTX (Altschul et al, J. Mol. Biol. 215: 403, 1990), FASTA (Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85: 2444, 1988), FASTDB (Brutlag et al. Comp. App. Biosci. 6:237-245, 1990), Catalyst (Molecular Simulations Inc.), Catalyst/SHAPE (Molecular Simulations Inc.), Cerius .DBAccess (Molecular Simulations Inc.), HypoGen (Molecular Simulations Ene), Ensight II, (Molecular Simulations Inc.), Discover (Molecular Simulations Inc.), CHARMm (Molecular Simulations Inc.), Felix (Molecular Simulations Inc.), DelPhi, (Molecular Simulations Inc.), QuanteMM, (Molecular Simulations Inc.), Homology (Molecular Simulations Ene), Modeler (Molecular Simulations Inc.), ISIS (Molecular Simulations Ene), Quanta/Protein Design (Molecular Simulations Inc.), WebLab (Molecular Simulations Ene), WebLab Diversity Explorer (Molecular Simulations Inc.), Gene Explorer (Molecular Simulations Inc.), SeqFold (Molecular Simulations Inc.), the MDL Available Chemicals Directory database, the MDL Drug Data Report data base, the Comprehensive Medicinal Chemistry database, Derwent's World Drug Index database, the BioByteMasterFile database, the Genbank database, and the Genseqn database. Many other programs and data bases would be apparent to one of skill in the art given the present disclosure.
[00318] Motifs which may be detected using the above programs include sequences encoding leucine zippers, helix -turn-helix motifs, glycosylation sites, ubiquitination sites, alpha helices, and beta sheets, signal sequences encoding signal peptides which direct the secretion of the encoded proteins, sequences implicated in transcription regulation such as homeoboxes, acidic stretches, enzymatic active sites, substrate binding sites, and enzymatic cleavage sites.
Hybridization of nucleic acids
[00319] The invention provides isolated or recombinant nucleic acids that hybridize under stringent conditions to an exemplary sequence of the invention, e.g., a sequence as set forth in SEQ ID NO: 1, or a nucleic acid that encodes a polypeptide comprising a sequence as set forth in SEQ ED NO:2. The stringent conditions can be highly stringent conditions, medium stringent conditions, low stringent conditions, including the high and reduced stringency conditions described herein. In alternative embodiments, nucleic acids of the invention as defined by their ability to hybridize under stringent conditions can be between about five residues and the full length of the molecule of SEQ ID NO:l; e.g., they can be at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, 80, 90, 100, 150, 200, 250, 300, 350, 400 residues in length. Nucleic acids shorter than full length are also included. These nucleic acids are useful as, e.g., hybridization probes, labeling probes, PCR oligonucleotide probes, iRNA, antisense or sequences encoding antibody binding peptides (epitopes), motifs, active sites and the like.
[00320] In one aspect, nucleic acids of the invention are defined by their ability to hybridize under high stringency comprises conditions of about 50% formamide at about 37°C to 42°C. In one aspect, nucleic acids of the invention are defined by their ability to hybridize under reduced stringency comprising conditions in about 35% to 25 %> formamide at about 30°C to 35°C. Alternatively, nucleic acids of the invention are defined by their ability to hybridize under high stringency comprising conditions at 42°C in 50% formamide, 5X SSPE, 0.3% SDS, and a repetitive sequence blocking nucleic acid, such as cot-1 or salmon sperm DNA (e.g., 200 n/ml sheared and denatured salmon sperm DNA). In one aspect, nucleic acids of the invention are defined by their ability to hybridize under reduced stringency conditions comprising 35% formamide at a reduced temperature of 35°C. [00321] Following hybridization, the filter may be washed with 6X SSC, 0.5% SDS at 50°C. These conditions are considered to be "moderate" conditions above 25%> formamide and "low" conditions below 25% formamide. A specific example of "moderate" hybridization conditions is when the above hybridization is conducted at 30% formamide. A specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 10%> formamide.
[00322 ] The temperature range corresponding to a particular level of stringency can be further narrowed by calculating the purine to pyrimidine ratio of the nucleic acid of interest and adjusting the temperature accordingly. Nucleic acids of the invention are also defined by their ability to hybridize under high, medium, and low stringency conditions as set forth in Ausubel and Sambrook. Variations on the above ranges and conditions are well known in the art.
[00323] En nucleic acid hybridization reactions, the conditions used to achieve a particular level of stringency will vary, depending on the nature of the nucleic acids being hybridized. For example, the length, degree of complementarity, nucleotide sequence composition (e.g., GC v. AT content), and nucleic acid type (e.g., RNA v. DNA) of the hybridizing regions of the nucleic acids can be considered in selecting hybridization conditions. An additional consideration is whether one of the nucleic acids is immobilized, for example, on a filter.
[00324] Hybridization may be carried out under conditions of low stringency, moderate stringency or high stringency. As an example of nucleic acid hybridization, a polymer membrane containing immobilized denatured nucleic acids is first prehybridized for 30 minutes at 45°C in a solution consisting of 0.9 M NaCl, 50 mM NaH2PO4, pH 7.0, 5.0 mM Na2EDTA, 0.5% SDS, 10X Denhardt's, and 0.5 mg/ml polyriboadenylic acid. Approximately 2 X 107 cpm (specific activity 4-9 X 108 cpm/ug) of 32P end- labeled oligonucleotide probe are then added to the solution. After 12-16 hours of incubation, the membrane is washed for 30 minutes at room temperature in IX SET (150 mM NaCl, 20 mM Tris hydrochloride, pH 7.8, 1 mM Na2EDTA) containing 0.5% SDS, followed by a 30 minute wash in fresh IX SET at Tm-10°C for the oligonucleotide probe. The membrane is then exposed to auto-radiographic film for detection of hybridization signals. [00325] By varying the stringency of the hybridization conditions used to identify nucleic acids, such as cDNAs or genomic DNAs, which hybridize to the detectable probe, nucleic acids having different levels of homology to the probe can be identified and isolated. Stringency may be varied by conducting the hybridization at varying temperatures below the melting temperatures of the probes. The melting temperature, Tm, is the temperature (under defined ionic strength and pH) at which 50%> of the target sequence hybridizes to a perfectly complementary probe. Very stringent conditions are selected to be equal to or about 5°C lower than the Tm for a particular probe. The melting temperature of the probe may be calculated using the following formulas:
[00326] For probes between 14 and 70 nucleotides in length the melting temperature (Tm) is calculated using the formula: Tm=81.5+16.6(log [Na+])+0.41 (fraction G+C)-(600/N) where N is the length of the probe.
[00327] If the hybridization is carried out in a solution containing formamide, the melting temperature may be calculated using the equation: Tm=81.5+16.6(log [Na+])+0.41 (fraction G+C)-(0.63% formamide)-(600/N) where N is the length of the probe.
[00328] Prehybridization may be carried out in 6X SSC, 5X Denhardt's reagent, 0.5%> SDS, lOOμg denatured fragmented salmon sperm DNA or 6X SSC, 5X Denhardt's reagent, 0.5%) SDS, lOOμg denatured fragmented salmon sperm DNA, 50% formamide. The formulas for SSC and Denhardt's solutions are listed in Sambrook et al, supra.
[00329] Hybridization is conducted by adding the detectable probe to the prehybridization solutions listed above. Where the probe comprises double stranded DNA, it is denatured before addition to the hybridization solution. The filter is contacted with the hybridization solution for a sufficient period of time to allow the probe to hybridize to cDNAs or genomic DNAs containing sequences complementary thereto or homologous thereto. For probes over 200 nucleotides in length, the hybridization maybe carried out at 15-25°C below the Tm. For shorter probes, such as oligonucleotide probes, the hybridization may be conducted at 5-10°C below the Tm. Typically, for hybridizations in 6X SSC, the hybridization is conducted at approximately 68°C. Usually, for hybridizations in 50% formamide containing solutions, the hybridization is conducted at approximately 42°C. All of the foregoing hybridizations would be considered to be under conditions of high stringency.
[00330] Following hybridization, the filter is washed to remove any non-specifically bound detectable probe. The stringency used to wash the filters can also be varied depending on the nature of the nucleic acids being hybridized, the length of the nucleic acids being hybridized, the degree of complementarity, the nucleotide sequence composition (e.g., GC v. AT content), and the nucleic acid type (e.g., RNA v. DNA). Examples of progressively higher stringency condition washes are as follows: 2X SSC, 0.1 % SDS at room temperature for 15 minutes (low stringency); 0.1X SSC, 0.5% SDS at room temperature for 30 minutes to 1 hour (moderate stringency); 0. IX SSC, 0.5% SDS for 15 to 30 minutes at between the hybridization temperature and 68°C (high stringency); and 0.15M NaCl for 15 minutes at 72°C (very high stringency). A final low stringency wash can be conducted in 0. IX SSC at room temperature. The examples above are merely illustrative of one set of conditions that can be used to wash filters. One of skill in the art would know that there are numerous recipes for different stringency washes. Some other examples are given below. [00331] Nucleic acids which have hybridized to the probe are identified by autoradiography or other conventional techniques.
[00332] The above procedure may be modified to identify nucleic acids having decreasing levels of homology to the probe sequence. For example, to obtain nucleic acids of decreasing homology to the detectable probe, less stringent conditions may be used. For example, the hybridization temperature may be decreased in increments of 5°C from 68°C to 42°C in a hybridization buffer having a Na+ concentration of approximately 1M. Following hybridization, the filter may be washed with 2X SSC, 0.5% SDS at the temperature of hybridization. These conditions are considered to be "moderate" conditions above 50°C and "low" conditions below 50°C. A specific example of "moderate" hybridization conditions is when the above hybridization is conducted at 55°C. A specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 45°C. [00333] Alternatively, the hybridization may be carried out in buffers, such as 6X SSC, containing formamide at a temperature of 42°C. In this case, the concentration of formamide in the hybridization buffer may be reduced in 5%> increments from 50% to 0% to identify clones having decreasing levels of homology to the probe. Following hybridization, the filter may be washed with 6X SSC, 0.5%> SDS at 50°C. These conditions are considered to be "moderate" conditions above 25% formamide and "low" conditions below 25% formamide. A specific example of "moderate" hybridization conditions is when the above hybridization is conducted at 30%> formamide. A specific example of "low stringency" hybridization conditions is when the above hybridization is conducted at 10%> formamide. [00334] For example, the preceding methods may be used to isolate nucleic acids having a sequence with at least about 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, or at least 50%, homology to the nucleic acid sequence of SEQ ID NO:l, and sequences substantially identical thereto, or fragments comprising at least about 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases thereof, and the sequences complementary thereto. Homology may be measured using the alignment algorithm. For example, the homologous polynucleotides may have a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein. Such allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NO:l or the sequences complementary thereto.
[ 00335 ] Additionally, the above procedures may be used to isolate nucleic acids which encode polypeptides having at least about 99%>, at least 95%, at least 90%, at least
85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, or at least 50%) homology to a polypeptide having the sequence of SEQ ID NO:2, and sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40,
50, 75, 100, or 150 consecutive amino acids thereof as determined using a sequence alignment algorithm (e.g., such as the FASTA version 3.0t78 algorithm with the default parameters).
Oligonucleotides probes and methods for using them
[00336] The invention also provides nucleic acid probes for identifying nucleic acids encoding a polypeptide with a cellulase activity. In one aspect, the probe comprises at least
10 consecutive bases of a sequence as set forth in SEQ ID NO:l. Alternatively, a probe of the invention can be at least about 5, 6, 7, 8 or 9 to about 40, about 10 to 50, about 20 to 60 about 30 to 70, consecutive bases of a sequence as set forth in SEQ ED NO:l. The probes identify a nucleic acid by binding or hybridization. The probes can be used in arrays of the invention, see discussion below, including, e.g., capillary arrays. The probes of the invention can also be used to isolate other nucleic acids or polypeptides.
[00337] The probes of the invention can be used to determine whether a biological sample, such as a soil sample, contains an organism having a nucleic acid sequence of the invention or an organism from which the nucleic acid was obtained. In such procedures, a biological sample potentially harboring the organism from which the nucleic acid was isolated is obtained and nucleic acids are obtained from the sample. The nucleic acids are contacted with the probe under conditions which permit the probe to specifically hybridize to any complementary sequences present in the sample. Where necessary, conditions which permit the probe to specifically hybridize to complementary sequences may be determined by placing the probe in contact with complementary sequences from samples known to contain the complementary sequence, as well as control sequences which do not contain the complementary sequence. Hybridization conditions, such as the salt concentration of the hybridization buffer, the formamide concentration of the hybridization buffer, or the hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to complementary nucleic acids (see discussion on specific hybridization conditions).
[00338] The isolated SEQ ID NO : 1 , and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:l, and sequences substantially identical thereto, or the sequences complementary thereto may also be used as probes to determine whether a biological sample, such as a soil sample, contains an organism having a nucleic acid sequence of the invention or an organism from which the nucleic acid was obtained. En such procedures, a biological sample potentially harboring the organism from which the nucleic acid was isolated is obtained and nucleic acids are obtained from the sample. The nucleic acids are contacted with the probe under conditions which permit the probe to specifically hybridize to any complementary sequences from which are present therein.
[00339] Where necessary, conditions which permit the probe to specifically hybridize to complementary sequences may be determined by placing the probe in contact with complementary sequences from samples known to contain the complementary sequence as well as control sequences which do not contain the complementary sequence. Hybridization conditions, such as the salt concentration of the hybridization buffer, the formamide concentration of the hybridization buffer, or the hybridization temperature, may be varied to identify conditions which allow the probe to hybridize specifically to complementary nucleic acids.
[00340] If the sample contains the organism from which the nucleic acid was isolated, specific hybridization of the probe is then detected. Hybridization may be detected by labeling the probe with a detectable agent such as a radioactive isotope, a fluorescent dye or an enzyme capable of catalyzing the formation of a detectable product. [00341] Many methods for using the labeled probes to detect the presence of complementary nucleic acids in a sample are familiar to those skilled in the art. These include Southern Blots, Northern Blots, colony hybridization procedures, and dot blots. Protocols for each of these procedures are provided in Ausubel et al. Current Protocols in Molecular Biology. John Wiley 503 Sons, Ene (1997) and Sambrook et al, Molecular Cloning: A Laboratory Manual 2d Ed.. Cold Spring Harbor Laboratory Press (1989). [00342] Alternatively, more than one probe (at least one of which is capable of specifically hybridizing to any complementary sequences which are present in the nucleic acid sample), may be used in an amplification reaction to determine whether the sample contains an organism containing a nucleic acid sequence of the invention (e.g., an organism from which the nucleic acid was isolated). Typically, the probes comprise oligonucleotides. In one aspect, the amplification reaction may comprise a PCR reaction.
PCR protocols are described in Ausubel and Sambrook, supra. Alternatively, the amplification may comprise a ligase chain reaction, 3SR, or strand displacement reaction.
(See Barany, F., "The Ligase Chain Reaction in a PCR World", PCR Methods and
Applications 1:5-16, 1991; E. Fahy et al, "Self-sustained Sequence Replication (3SR): An
Isothermal Transcription-based Amplification System Alternative to PCR", PCR Methods and
Applications 1:25-33, 1991; and Walker G.T. et al, "Strand Displacement Amplification-an
Isothermal in vitro DNA Amplification Technique", Nucleic Acid Research 20:1691-1696,
1992. In such procedures, the nucleic acids in the sample are contacted with the probes, the amplification reaction is performed, and any resulting amplification product is detected. The amplification product may be detected by performing gel electrophoresis on the reaction products and staining the gel with an intercalator such as ethidium bromide. Alternatively, one or more of the probes may be labeled with a radioactive isotope and the presence of a radioactive amplification product may be detected by autoradiography after gel electrophoresis.
[00343] Probes derived from sequences near the ends of the sequence of SEQ ED
NO:l, and sequences substantially identical thereto, may also be used in chromosome walking procedures to identify clones containing genomic sequences located adjacent to the sequence of SEQ ID NO:l, and sequences substantially identical thereto. Such methods allow the isolation of genes which encode additional proteins from the host organism.
[00344] The isolated nucleic acid of SEQ ID NO: 1 , and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least
10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ
ID NO:l, and sequences substantially identical thereto, or the sequences complementary thereto may be used as probes to identify and isolate related nucleic acids. En some aspects, the related nucleic acids may be cDNAs or genomic DNAs from organisms other than the one from which the nucleic acid was isolated. For example, the other organisms may be related organisms. En such procedures, a nucleic acid sample is contacted with the probe under conditions which permit the probe to specifically hybridize to related sequences. Hybridization of the probe to nucleic acids from the related organism is then detected using any of the methods described above. Inhibiting Expression of a Cellulase
[00345] The invention further provides for nucleic acids complementary to (e.g., antisense sequences to) the nucleic acid sequences of the invention. Antisense sequences are capable of inhibiting the transport, splicing or transcription of cellulase-encoding genes. The inhibition can be effected through the targeting of genomic DNA or messenger RNA. The transcription or function of targeted nucleic acid can be inhibited, for example, by hybridization and/or cleavage. One particularly useful set of inhibitors provided by the present invention includes oligonucleotides which are able to either bind cellulase gene or message, in either case preventing or inhibiting the production or function of a cellulase enzyme. The association can be though sequence specific hybridization. Another useful class of inhibitors includes oligonucleotides which cause inactivation or cleavage of cellulase message. The oligonucleotide can have enzyme activity which causes such cleavage, such as ribozymes. The oligonucleotide can be chemically modified or conjugated to an enzyme or composition capable of cleaving the complementary nucleic acid. One may screen a pool of many different such oligonucleotides for those with the desired activity. Antisense Oligonucleotides
[00346] The invention provides antisense oligonucleotides capable of binding cellulase message which can inhibit cellulase activity by targeting mRNA. Strategies for designing antisense oligonucleotides are well described in the scientific and patent literature, and the skilled artisan can design such cellulase oligonucleotides using the novel reagents of the invention. For example, gene walking/ RNA mapping protocols to screen for effective antisense oligonucleotides are well known in the art, see, e.g., Ho (2000) Methods Enzymol. 314:168-183, describing an RNA mapping assay, which is based on standard molecular techniques to provide an easy and reliable method for potent antisense sequence selection. See also Smith (2000) Euro. J. Pharm. Sci. 11:191-198.
[00347] Naturally occurring nucleic acids are used as antisense oligonucleotides.
The antisense oligonucleotides can be of any length; for example, in alternative aspects, the antisense oligonucleotides are between about 5 to 100, about 10 to 80, about 15 to 60, about 18 to 40. The optimal length can be determined by routine screening. The antisense oligonucleotides can be present at any concentration. The optimal concentration can be determined by routine screening. A wide variety of synthetic, non-naturally occurring nucleotide and nucleic acid analogues are known which can address this potential problem.
For example, peptide nucleic acids (PNAs) containing non-ionic backbones, such as N-(2- aminoethyl) glycine units can be used. Antisense oligonucleotides having phosphorothioate linkages can also be used, as described in WO 97/03211; WO 96/39154;
Mata (1997) Toxicol Appl Pharmacol 144:189-197; Antisense Therapeutics, ed. Agarwal
(Humana Press, Totowa, N.J., 1996). Antisense oligonucleotides having synthetic DNA backbone analogues provided by the invention can also include phosphoro-dithioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate, and moφholino carbamate nucleic acids, as described above.
[00348] Combinatorial chemistry methodology can be used to create vast numbers of oligonucleotides that can be rapidly screened for specific oligonucleotides that have appropriate binding affinities and specificities toward any target, such as the sense and antisense cellulase sequences of the invention (see, e.g., Gold (1995) J. of Biol. Chem.
270:13581-13584).
Inhibitory Ribozymes
[00349] The invention provides for with ribozymes capable of binding cellulase message which can inhibit cellulase enzyme activity by targeting mRNA. Strategies for designing ribozymes and selecting the cellulase-specific antisense sequence for targeting are well described in the scientific and patent literature, and the skilled artisan can design such ribozymes using the novel reagents of the invention. Ribozymes act by binding to a target RNA through the target RNA binding portion of a ribozyme which is held in close proximity to an enzymatic portion of the RNA that cleaves the target RNA. Thus, the ribozyme recognizes and binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cleave and inactivate the target RNA.
Cleavage of a target RNA in such a manner will destroy its ability to direct synthesis of an encoded protein if the cleavage occurs in the coding sequence. After a ribozyme has bound and cleaved its RNA target, it is typically released from that RNA and so can bind and cleave new targets repeatedly.
[00350] In some circumstances, the enzymatic nature of a ribozyme can be advantageous over other technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its transcription, translation or association with another molecule) as the effective concentration of ribozyme necessary to effect a therapeutic treatment can be lower than that of an antisense oligonucleotide. This potential advantage reflects the ability of the ribozyme to act enzymatically. Thus, a single ribozyme molecule is able to cleave many molecules of target RNA. In addition, a ribozyme is typically a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechanism of binding, but also on the mechanism by which the molecule inhibits the expression of the RNA to which it binds. That is, the inhibition is caused by cleavage of the RNA target and so specificity is defined as the ratio of the rate of cleavage of the targeted RNA over the rate of cleavage of non-targeted RNA. This cleavage mechanism is dependent upon factors additional to those involved in base pairing. Thus, the specificity of action of a ribozyme can be greater than that of antisense oligonucleotide binding the same RNA site.
[00351] The enzymatic ribozyme RNA molecule can be formed in a hammerhead motif, but may also be formed in the motif of a haiφin, hepatitis delta virus, group I intron or RNase P-like RNA (in association with an RNA guide sequence). Examples of such hammerhead motifs are described by Rossi (1992) Aids Research and Human Retroviruses 8:183; haiφin motifs by Hampel (1989) Biochemistry 28:4929, and Hampel (1990) Nue Acids Res. 18:299; the hepatitis delta virus motif by Perrotta (1992) Biochemistry 31:16; the RNaseP motif by Guerrier-Takada (1983) Cell 35:849; and the group I intron by Cech, U.S. Pat. No. 4,987,071. The recitation of these specific motifs is not intended to be limiting; those skilled in the art will recognize that an enzymatic RNA molecule of this invention has a specific substrate binding site complementary to one or more of the target gene RNA regions, and has nucleotide sequence within or surrounding that substrate binding site which imparts an RNA cleaving activity to the molecule. Modification of Nucleic Acids
[00352 ] . The invention provides methods of generating variants of the nucleic acids of the invention, e.g., those encoding a cellulase enzyme. These methods can be repeated or used in various combinations to generate cellulase enzymes having an altered or different activity or an altered or different stability from that of a cellulase encoded by the template nucleic acid. These methods also can be repeated or used in various combinations, e.g., to generate variations in gene/ message expression, message translation or message stability. En another aspect, the genetic composition of a cell is altered by, e.g., modification of a homologous gene ex vivo, followed by its reinsertion into the cell.
[00353] A nucleic acid of the invention can be altered by any means. For example, random or stochastic methods, or, non-stochastic, or "directed evolution," methods. [ 00354 ] Methods for random mutation of genes are well known in the art, see, e.g., U.S. Patent No. 5,830,696. For example, mutagens can be used to randomly mutate a gene. Mutagens include, e.g., ultraviolet light or gamma irradiation, or a chemical mutagen, e.g., mitomycin, nitrous acid, photoactivated psoralens, alone or in combination, to induce DNA breaks amenable to repair by recombination. Other chemical mutagens include, for example, sodium bisulfite, nitrous acid, hydroxylamine, hydrazine or formic acid. Other mutagens are analogues of nucleotide precursors, e.g., nitrosoguanidine, 5-bromouracil, 2- aminopurine, or acridine. These agents can be added to a PCR reaction in place of the nucleotide precursor thereby mutating the sequence. Intercalating agents such as proflavine, acriflavine, quinacrine and the like can also be used. [ 00355 ] Any technique in molecular biology can be used, e.g., random PCR mutagenesis, see, e.g., Rice (1992) Proc. Natl. Acad. Sci. USA 89:5467-5471; or, combinatorial multiple cassette mutagenesis, see, e.g., Crameri (1995) Biotechniques 18:194-196. Alternatively, nucleic acids, e.g., genes, can be reassembled after random, or "stochastic," fragmentation, see, e.g., U.S. Patent Nos. 6,291,242; 6,287,862; 6,287,861; 5,955,358; 5,830,721; 5,824,514; 5,811,238; 5,605,793. En alternative aspects, modifications, additions or deletions are introduced by error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR), recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair- deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation, and/or a combination of these and other methods.
[00356] The following publications describe a variety of recursive recombination procedures and/or methods which can be incoφorated into the methods of the invention: Stemmer (1999) "Molecular breeding of viruses for targeting and other clinical properties" Tumor Targeting 4:1-4; Ness (1999) Nature Biotechnology 17:893-896; Chang (1999) "Evolution of a cytokine using DNA family shuffling" Nature Biotechnology 17:793-797; Minshull (1999) "Protein evolution by molecular breeding" Current Opinion in Chemical
Biology 3:284-290; Christians (1999) "Directed evolution of thymidine kinase for AZT phosphorylation using DNA family shuffling" Nature Biotechnology 17:259-264; Crameri (1998) "DNA shuffling of a family of genes from diverse species accelerates directed evolution" Nature 391:288-291; Crameri (1997) "Molecular evolution of an arsenate detoxification pathway by DNA shuffling," Nature Biotechnology 15:436-438; Zhang (1997) "Directed evolution of an effective fucosidase from a galactosidase by DNA shuffling and screening" Proc. Natl. Acad. Sci. USA 94:4504-4509; Patten et al. (1997) "Applications of DNA Shuffling to Pharmaceuticals and Vaccines" Current Opinion in Biotechnology 8:724-733; Crameri et al. (1996) "Construction and evolution of antibody- phage libraries by DNA shuffling" Nature Medicine 2:100-103; Crameri et al. (1996) "improved green fluorescent protein by molecular evolution using DNA shuffling" Nature Biotechnology 14:315-319; Gates et al. (1996) "Affinity selective isolation of ligands from peptide libraries through display on a lac repressor 'headpiece dimer ' Journal of Molecular Biology 255:373-386; Stemmer (1996) "Sexual PCR and Assembly PCR" In: The Encyclopedia of Molecular Biology. VCH Publishers, New York, pp.447-457; Crameri and Stemmer (1995) "Combinatorial multiple cassette mutagenesis creates all the permutations of mutant and wildtype cassettes" BioTechniques 18:194-195; Stemmer et al. (1995) "Single-step assembly of a gene and entire plasmid form large numbers of oligodeoxyribonucleotides" Gene, 164:49-53; Stemmer (1995) "The Evolution of Molecular Computation" Science 270: 1510; Stemmer (1995) "Searching Sequence Space" Bio/Technology 13:549-553; Stemmer (1994) "Rapid evolution of a protein in vitro by DNA shuffling" Nature 370:389-391; and Stemmer (1994) "DNA shuffling by random fragmentation and reassembly: En vitro recombination for molecular evolution." Proc. Natl. Acad. Sci. USA 91:10747-10751.
[00357] Mutational methods of generating diversity include, for example, site- directed mutagenesis (Ling et al. (1997) "Approaches to DNA mutagenesis: an overview" Anal Biochem. 254(2): 157-178; Dale et al. (1996) "Oligonucleotide-directed random mutagenesis using the phosphorothioate method" Methods Mol. Biol. 57:369-374; Smith (1985) "In vitro mutagenesis" Ann. Rev. Genet. 19:423-462; Botstein & Shortle (1985) "Strategies and applications of in vitro mutagenesis" Science 229:1193-1201; Carter (1986) "Site-directed mutagenesis" Biochem. J. 237:1-7; and Kunkel (1987) "The efficiency of oligonucleotide directed mutagenesis" in Nucleic Acids & Molecular Biology (Eckstein, F. and Lilley, D. M. J. eds., Springer Verlag, Berlin)); mutagenesis using uracil containing templates (Kunkel (1985) "Rapid and efficient site-specific mutagenesis without phenotypic selection" Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) "Rapid and efficient site-specific mutagenesis without phenotypic selection" Methods in Enzymol. 154, 367-382; and Bass et al. (1988) "Mutant Tφ repressors with new DNA-binding specificities" Science 242:240-245); oligonucleotide-directed mutagenesis (Methods in Enzymol. 100: 468-500 (1983); Methods in Enzymol. 154: 329-350 (1987); Zoller & Smith (1982) "Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any DNA fragment" Nucleic Acids Res. 10:6487-6500; Zoller & Smith (1983) "Oligonucleotide-directed mutagenesis of DNA fragments cloned into Ml 3 vectors" Methods in Enzymol. 100:468-500; and Zoller & Smith (1987) "Oligonucleotide-directed mutagenesis: a simple method using two oligonucleotide primers and a single-stranded DNA template" Methods in Enzymol. 154:329-350); phosphorothioate-modified DNA mutagenesis (Taylor et al. (1985) "The use of phosphorothioate-modified DNA in restriction enzyme reactions to prepare nicked DNA" Nucl. Acids Res. 13: 8749-8764; Taylor et al. (1985) "The rapid generation of oligonucleotide-directed mutations at high frequency using phosphorothioate-modified DNA" Nucl. Acids Res. 13: 8765-8787 (1985); Nakamaye (1986) "Inhibition of restriction endonuclease Nci I cleavage by phosphorothioate groups and its application to oligonucleotide-directed mutagenesis" Nucl. Acids Res. 14: 9679-9698; Sayers et al. (1988) "Y-T Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis" Nucl. Acids Res. 16:791-802; and Sayers et al. (1988) "Strand specific cleavage of phosphorothioate-containing DNA by reaction with restriction endonucleases in the presence of ethidium bromide" Nucl. Acids Res. 16: 803-814); mutagenesis using gapped duplex DNA (Kramer et al. (1984) "The gapped duplex DNA approach to oligonucleotide-directed mutation construction" Nucl. Acids Res. 12: 9441-9456; Kramer & Fritz (1987) Methods in Enzymol. "Oligonucleotide-directed construction of mutations via gapped duplex DNA" 154:350-367; Kramer et al. (1988) "Improved enzymatic in vitro reactions in the gapped duplex DNA approach to oligonucleotide-directed construction of mutations" Nucl. Acids Res. 16: 7207; and Fritz et al. (1988) "Oligonucleotide-directed construction of mutations: a gapped duplex DNA procedure without enzymatic reactions in vitro" Nucl. Acids Res. 16: 6987-6999).
[00358] Additional protocols used in the methods of the invention include point mismatch repair (Kramer (1984) "Point Mismatch Repair" Cell 38:879-887), mutagenesis using repair-deficient host strains (Carter et al. (1985) "Improved oligonucleotide site- directed mutagenesis using M13 vectors" Nucl. Acids Res. 13: 4431-4443; and Carter
(1987) "Emproved oligonucleotide-directed mutagenesis using M13 vectors" Methods in Enzymol. 154: 382-403), deletion mutagenesis (Eghtedarzadeh (1986) "Use of oligonucleotides to generate large deletions" Nucl. Acids Res. 14: 5115), restriction- selection and restriction-selection and restriction-purification (Wells et al. (1986) "Importance of hydrogen-bond formation in stabilizing the transition state of subtilisin" Phil. Trans. R. Soc. Lond. A 317: 415-423), mutagenesis by total gene synthesis (Nambiar et al. (1984) "Total synthesis and cloning of a gene coding for the ribonuclease S protein" Science 223: 1299-1301; Sakamar and Khorana (1988) "Total synthesis and expression of a gene for the a-subunit of bovine rod outer segment guanine nucleotide-binding protein (transducin)" Nucl. Acids Res. 14: 6361-6372; Wells et al. (1985) "Cassette mutagenesis: an efficient method for generation of multiple mutations at defined sites" Gene 34:315-323; and Grundstrom et al. (1985) "Oligonucleotide-directed mutagenesis by microscale 'shotgun' gene synthesis" Nucl. Acids Res. 13: 3305-3316), double-strand break repair (Mandecki (1986); Arnold (1993) "Protein engineering for unusual environments" Current Opinion in Biotechnology 4:450-455. "Oligonucleotide-directed double-strand break repair in plasmids of Escherichia coli: a method for site-specific mutagenesis" Proc. Natl. Acad. Sci. USA, 83:7177-7181). Additional details on many of the above methods can be found in Methods in Enzymology Volume 154, which also describes useful controls for troubleshooting problems with various mutagenesis methods. See also U.S. Patent Nos. 5,605,793 to Stemmer (Feb. 25, 1997), "Methods for In Vitro Recombination;" U.S. Pat. No. 5,811,238 to Stemmer et al. (Sep. 22, 1998) "Methods for Generating Polynucleotides having Desired Characteristics by Iterative Selection and Recombination;" U.S. Pat. No. 5,830,721 to Stemmer et al. (Nov. 3, 1998), "DNA Mutagenesis by Random Fragmentation and Reassembly;" U.S. Pat. No. 5,834,252 to Stemmer, et al. (Nov. 10, 1998) "End- Complementary Polymerase Reaction;" U.S. Pat. No. 5,837,458 to Minshull, et al. (Nov. 17, 1998), "Methods and Compositions for Cellular and Metabolic Engineering;" WO 95/22625, Stemmer and Crameri, "Mutagenesis by Random Fragmentation and Reassembly;" WO 96/33207 by Stemmer and Lipschutz "End Complementary Polymerase Chain Reaction;" WO 97/20078 by Stemmer and Crameri "Methods for Generating Polynucleotides having Desired Characteristics by Iterative Selection and Recombination;" WO 97/35966 by Minshull and Stemmer, "Methods and Compositions for Cellular and Metabolic Engineering;" WO 99/41402 by Punnonen et al. "Targeting of Genetic Vaccine Vectors;" WO 99/41383 by Punnonen et al. "Antigen Library ImLmunization;" WO 99/41369 by Punnonen et al. "Genetic Vaccine Vector Engineering;" WO 99/41368 by
Punnonen et al. "Optimization of Immunomodulatory Properties of Genetic Vaccines;" EP 752008 by Stemmer and Crameri, "DNA Mutagenesis by Random Fragmentation and
Reassembly;" EP 0932670 by Stemmer "Evolving Cellular DNA Uptake by Recursive
Sequence Recombination;" WO 99/23107 by Stemmer et al., "Modification of Virus
Tropism and Host Range by Viral Genome Shuffling;" WO 99/21979 by Apt et al.,
"Human Papillomavirus Vectors;" WO 98/31837 by del Cardayre et al. "Evolution of
Whole Cells and Organisms by Recursive Sequence Recombination;" WO 98/27230 by
Patten and Stemmer, "Methods and Compositions for Polypeptide Engineering;" WO
98/27230 by Stemmer et al., "Methods for Optimization of Gene Therapy by Recursive
Sequence Shuffling and Selection," WO 00/00632, "Methods for Generating Highly
Diverse Libraries," WO 00/09679, "Methods for Obtaining in Vitro Recombined
Polynucleotide Sequence Banks and Resulting Sequences," WO 98/42832 by Arnold et al.,
"Recombination of Polynucleotide Sequences Using Random or Defined Primers," WO
99/29902 by Arnold et al., "Method for Creating Polynucleotide and Polypeptide
Sequences," WO 98/41653 by Vind, "An in Vitro Method for Construction of a DNA
Library," WO 98/41622 by Borchert et al, "Method for Constructing a Library Using DNA
Shuffling," and WO 98/42727 by Pati and Zarling, "Sequence Alterations using
Homologous Recombination."
[00359] Certain U. S . applications provide additional details regarding various diversity generating methods, including "SHUFFLING OF CODON ALTERED GENES" by Patten et al. filed Sep. 28, 1999, (U.S. Ser. No. 09/407,800); "EVOLUTION OF
WHOLE CELLS AND ORGANISMS BY RECURSIVE SEQUENCE
RECOMBINATION" by del Cardayre et al., filed Jul. 15, 1998 (U.S. Ser. No. 09/166,188), and Jul. 15, 1999 (U.S. Ser. No. 09/354,922); "OLIGONUCLEOTIDE MEDIATED
NUCLEIC ACID RECOMBINATION" by Crameri et al., filed Sep. 28, 1999 (U.S. Ser.
No. 09/408,392), and "OLIGONUCLEOTIDE MEDIATED NUCLEIC ACED
RECOMBINATION" by Crameri et al., filed Jan. 18, 2000 (PCT/US00/01203); "USE OF
CODON- VARIED OLIGONUCLEOTIDE SYNTHESIS FOR SYNTHETIC
SHUFFLING" by Welch et al., filed Sep. 28, 1999 (U.S. Ser. No. 09/408,393);
"METHODS FOR MAKING CHARACTER STRINGS, POLYNUCLEOTIDES &
POLYPEPTIDES HAVING DESIRED CHARACTERISTICS" by Selifonov et al., filed
Jan. 18, 2000, (PCT/USOO/01202) and, e.g. "METHODS FOR MAKING CHARACTER
STRINGS, POLYNUCLEOTIDES & POLYPEPTIDES HAVING DESIRED
CHARACTERISTECS" by Selifonov et al., filed Jul. 18, 2000 (U.S. Ser. No. 09/618,579);
"METHODS OF POPULATING DATA STRUCTURES FOR USE IN EVOLUTIONARY SIMULATIONS" by Selifonov and Stemmer, filed Jan. 18, 2000 (PCT/US00/01138); and "SINGLE-STRANDED NUCLEIC ACED TEMPLATE- MEDIATED RECOMBINATION AND NUCLEIC ACID FRAGMENT ISOLATION" by Affholter, filed Sep. 6, 2000 (U.S. Ser. No. 09/656,549).
[ 00360 ] Non-stochastic, or "directed evolution," methods include, e.g., saturation mutagenesis (GSSM), synthetic ligation reassembly (SLR), or a combination thereof are used to modify the nucleic acids of the invention to generate cellulases with new or altered properties (e.g., activity under highly acidic or alkaline conditions, high temperatures, and the like). Polypeptides encoded by the modified nucleic acids can be screened for an activity before testing for an cellulase or other activity. Any testing modality or protocol can be used, e.g., using a capillary array platform. See, e.g., U.S. Patent Nos. 6,280,926; 5,939,250.
Saturation mutagenesis, or, GSSM
[00361] In one aspect of the invention, non-stochastic gene modification, a "directed evolution process," is used to generate cellulases with new or altered properties. Variations of this method have been termed "gene site-saturation mutagenesis," "site-saturation mutagenesis," "saturation mutagenesis" or simply "GSSM." It can be used in combination with other mutagenization processes. See, e.g., U.S. Patent Nos. 6,171,820; 6,238,884. En one aspect, GSSM comprises providing a template polynucleotide and a plurality of oligonucleotides, wherein each oligonucleotide comprises a sequence homologous to the template polynucleotide, thereby targeting a specific sequence of the template polynucleotide, and a sequence that is a variant of the homologous gene; generating progeny polynucleotides comprising non-stochastic sequence variations by replicating the template polynucleotide with the oligonucleotides, thereby generating polynucleotides comprising homologous gene sequence variations.
[00362 ] The invention also provides for the use of proprietary codon primers (containing a degenerate N,N,N sequence) to introduce point mutations into a polynucleotide, so as to generate a set of progeny polypeptides in which a full range of single amino acid substitutions is represented at each amino acid position (gene site saturated mutagenesis (GSSM)). The oligos used are comprised contiguously of a first homologous sequence, a degenerate N,N,N sequence, and can be a second homologous sequence. The downstream progeny translational products from the use of such oligos include all possible amino acid changes at each amino acid site along the polypeptide, because the degeneracy of the N,N,N sequence includes codons for all 20 amino acids. [00363] En one aspect, one such degenerate oligo (comprised of one degenerate
N,N,N cassette) is used for subjecting each original codon in a parental polynucleotide template to a full range of codon substitutions. En another aspect, at least two degenerate
N,N,N cassettes are used - either in the same oligo or not, for subjecting at least two original codons in a parental polynucleotide template to a full range of codon substitutions.
Thus, more than one N,N,N sequence can be contained in one oligo to introduce amino acid mutations at more than one site. This plurality of N,N,N sequences can be directly contiguous, or separated by one or more additional nucleotide sequence(s). In another aspect, oligos serviceable for introducing additions and deletions can be used either alone or in combination with the codons containing an N,N,N sequence, to introduce any combination or permutation of amino acid additions, deletions, and/or substitutions.
[00364] En a particular exemplification, it is possible to simultaneously mutagenize two or more contiguous amino acid positions using an oligo that contains contiguous
N,N,N triplets, i.e. a degenerate (N,N,N)n sequence.
[00365] In another aspect, the present invention provides for the use of degenerate cassettes having less degeneracy than the N,N,N sequence. For example, it may be desirable in some instances to use (e.g. in an oligo) a degenerate triplet sequence comprised of only one N, where said N can be in the first second or third position of the triplet. Any other bases including any combinations and permutations thereof can be used in the remaining two positions of the triplet. Alternatively, it may be desirable in some instances to use (e.g., in an oligo) a degenerate N,N,N triplet sequence, N,N,G/T, or an N,N, G/C triplet sequence.
[00366] It is appreciated, however, that the use of a degenerate triplet (such as
N,N,G/T or an N,N, G/C triplet sequence) as disclosed in the instant invention is advantageous for several reasons. In one aspect, this invention provides a means to systematically and fairly easily generate the substitution of the full range of possible amino acids (for a total of 20 amino acids) into each and every amino acid position in a polypeptide. Thus, for a 100 amino acid polypeptide, the invention provides a way to systematically and fairly easily generate 2000 distinct species (i.e., 20 possible amino acids per position times 100 amino acid positions). It is appreciated that there is provided, through the use of an oligo containing a degenerate N,N,G/T or an N,N, G/C triplet sequence, 32 individual sequences that code for 20 possible amino acids. Thus, in a reaction vessel in which a parental polynucleotide sequence is subjected to saturation mutagenesis using one such oligo, there are generated 32 distinct progeny polynucleotides encoding 20 distinct polypeptides. In contrast, the use of a non-degenerate oligo in site- directed mutagenesis leads to only one progeny polypeptide product per reaction vessel. [00367] This invention also provides for the use of nondegenerate oligos, which can optionally be used in combination with degenerate primers disclosed. It is appreciated that in some situations, it is advantageous to use nondegenerate oligos to generate specific point mutations in a working polynucleotide. This provides a means to generate specific silent point mutations, point mutations leading to corresponding amino acid changes, and point mutations that cause the generation of stop codons and the corresponding expression of polypeptide fragments. Thus, in one aspect of this invention, each saturation mutagenesis reaction vessel contains polynucleotides encoding at least 20 progeny polypeptide molecules such that all 20 amino acids are represented at the one specific amino acid position corresponding to the codon position mutagenized in the parental polynucleotide. The 32-fold degenerate progeny polypeptides generated from each saturation mutagenesis reaction vessel can be subjected to clonal amplification (e.g., cloned into a suitable E. coli host using an expression vector) and subjected to expression screening. When an individual progeny polypeptide is identified by screening to display a favorable change in property (when compared to the parental polypeptide), it can be sequenced to identify the correspondingly favorable amino acid substitution contained therein. It is appreciated that upon mutagenizing each and every amino acid position in a parental polypeptide using saturation mutagenesis as disclosed herein, favorable amino acid changes may be identified at more than one amino acid position. One or more new progeny molecules can be generated that contain a combination of all or part of these favorable amino acid substitutions. For example, if 2 specific favorable amino acid changes are identified in each of 3 amino acid positions in a polypeptide, the permutations include 3 possibilities at each position (no change from the original amino acid, and each of two favorable changes) and 3 positions. Thus, there are 3 x 3 x 3 or 27 total possibilities, including 7 that were previously examined - 6 single point mutations (i.e., 2 at each of three positions) and no change at any position.
[00368] In yet another aspect, site-saturation mutagenesis can be used together with shuffling, chimerization, recombination and other mutagenizing processes, along with screening. This invention provides for the use of any mutagenizing process(es), including saturation mutagenesis, in an iterative manner. n one exemplification, the iterative use of any mutagenizing process(es) is used in combination with screening. Thus, in a non- limiting exemplification, this invention provides for the use of saturation mutagenesis in combination with additional mutagenization processes, such as process where two or more related polynucleotides are introduced into a suitable host cell such that a hybrid polynucleotide is generated by recombination and reductive reassortment.
[00369] En addition to performing mutagenesis along the entire sequence of a gene, the instant invention provides that mutagenesis can be use to replace each of any number of bases in a polynucleotide sequence, wherein the number of bases to be mutagenized can be every integer from 15 to 100,000. Thus, instead of mutagenizing every position along a molecule, one can subject every or a discrete number of bases (e.g., a subset totaling from
15 to 100,000) to mutagenesis. In one aspect, a separate nucleotide is used for mutagenizing each position or group of positions along a polynucleotide sequence. A group of 3 positions to be mutagenized may be a codon. The mutations can be introduced using a mutagenic primer, containing a heterologous cassette, also referred to as a mutagenic cassette. Cassettes can have from 1 to 500 bases. Each nucleotide position in such heterologous cassettes be N, A, C, G, T, A/C, A G, A/T, C/G, C/T, G/T, C/G/T,
A G/T, A/C/T, A/C/G, or E, where E is any base that is not A, C, G, or T (E can be referred to as a designer oligo).
[00370] In a general sense, saturation mutagenesis is comprised of mutagenizing a complete set of mutagenic cassettes (wherein each cassette can be about 1-500 bases in length) in defined polynucleotide sequence to be mutagenized (wherein the sequence to be mutagemzed can be from about 15 to 100,000 bases in length). Thus, a group of mutations
(ranging from 1 to 100 mutations) is introduced into each cassette to be mutagenized. A grouping of mutations to be introduced into one cassette can be different or the same from a second grouping of mutations to be introduced into a second cassette during the application of one round of saturation mutagenesis. Such groupings are exemplified by deletions, additions, groupings of particular codons, and groupings of particular nucleotide cassettes.
[00371] Defined sequences to be mutagenized include a whole gene, pathway, cDNA, an entire open reading frame (ORF), and entire promoter, enhancer, repressor/transactivator, origin of replication, intron, operator, or any polynucleotide functional group. Generally, a "defined sequences" for this puφose may be any polynucleotide that a 15 base-polynucleotide sequence, and polynucleotide sequences of lengths between 15 bases and 15,000 bases (this invention specifically names every integer in between). Considerations in choosing groupings of codons include types of amino acids encoded by a degenerate mutagenic cassette. [ 00372 ] In one aspect, a grouping of mutations can be introduced into a mutagenic cassette to provide for degenerate codon substitutions (using degenerate oligos) that code for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids at each position, and a library of polypeptides encoded thereby.
[00373] One aspect of the invention is an isolated nucleic acid comprising the sequence SEQ ID NO.: 1, and sequences substantially identical thereto, the sequences complementary thereto, or a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive bases of SEQ ID NO:l (or the sequences complementary thereto). The isolated, nucleic acids may comprise DNA, including cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. Alternatively, the isolated nucleic acids may comprise RNA. Synthetic Ligation Reassembly (SLR)
[00374] The invention provides a non-stochastic gene modification system termed "synthetic ligation reassembly," or simply "SLR," a "directed evolution process," to generate cellulases with new or altered properties. SLR is a method of ligating oligonucleotide fragments together non-stochastically. This method differs from stochastic oligonucleotide shuffling in that the nucleic acid building blocks are not shuffled, concatenated or chimerized randomly, but rather are assembled non-stochastically. See, e.g., U.S. Patent Application Serial No. (USSN) 09/332,835 entitled "Synthetic Ligation Reassembly in Directed Evolution" and filed on June 14, 1999 ("USSN 09/332,835"). In one aspect, SLR comprises the following steps: (a) providing a template polynucleotide, wherein the template polynucleotide comprises sequence encoding a homologous gene; (b) providing a plurality of building block polynucleotides, wherein the building block polynucleotides are designed to cross-over reassemble with the template polynucleotide at a predetermined sequence, and a building block polynucleotide comprises a sequence that is a variant of the homologous gene and a sequence homologous to the template polynucleotide flanking the variant sequence; (c) combining a building block polynucleotide with a template polynucleotide such that the building block polynucleotide cross-over reassembles with the template polynucleotide to generate polynucleotides comprising homologous gene sequence variations.
[00375] In one aspect, the present invention provides a non-stochastic method termed synthetic gene reassembly, that is somewhat related to stochastic shuffling, save that the nucleic acid building blocks are not shuffled or concatenated or chimerized randomly, but rather are assembled non-stochastically.
[00376] The SLR method does not depend on the presence of a high level of homology between polynucleotides to be shuffled. The invention can be used to non- stochastically generate libraries (or sets) of progeny molecules comprised of over 10100 different chimeras. Conceivably, SLR can even be used to generate libraries comprised of over io1000 different progeny chimeras.
[00377] Thus, in one aspect, the invention provides a non-stochastic method of producing a set of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design, which method is comprised of the steps of generating by design a plurality of specific nucleic acid building blocks having serviceable mutually compatible ligatable ends, and assembling these nucleic acid building blocks, such that a designed overall assembly order is achieved.
[00378] The mutually compatible ligatable ends of the nucleic acid building blocks to be assembled are considered to be "serviceable" for this type of ordered assembly if they enable the building blocks to be coupled in predetermined orders. Thus, in one aspect, the overall assembly order in which the nucleic acid building blocks can be coupled is specified by the design of the ligatable ends and, if more than one assembly step is to be used, then the overall assembly order in which the nucleic acid building blocks can be coupled is also specified by the sequential order of the assembly step(s). In a one aspect of the invention, the annealed building pieces are treated with an enzyme, such as a ligase (e.g., T4 DNA ligase) to achieve covalent bonding of the building pieces. [00379] In a another aspect, the design of nucleic acid building blocks is obtained upon analysis of the sequences of a set of progenitor nucleic acid templates that serve as a basis for producing a progeny set of finalized chimeric nucleic acid molecules. These progenitor nucleic acid templates thus serve as a source of sequence information that aids in the design of the nucleic acid building blocks that are to be mutagenized, i.e. chimerized or shuffled.
[00380] In one exemplification, the invention provides for the chimerization of a family of related genes and their encoded family of related products. In a particular exemplification, the encoded products are enzymes. The cellulase of the present invention can be mutagenized in accordance with the methods described herein. [00381] Thus, in one aspect of the invention, the sequences of a plurality of progenitor nucleic acid templates are aligned in order to select one or more demarcation points, which demarcation points can be located at an area of homology. The demarcation points can be used to delineate the boundaries of nucleic acid building blocks to be generated. Thus, the demarcation points identified and selected in the progenitor molecules serve as potential chimerization points in the assembly of the progeny molecules.
[ 00382 ] Typically a serviceable demarcation point is an area of homology
(comprised of at least one homologous nucleotide base) shared by at least two progenitor templates, but the demarcation point can be an area of homology that is shared by at least half of the progenitor templates, at least two thirds of the progenitor templates, at least three fourths of the progenitor templates, or almost all of the progenitor templates. In one aspect, a serviceable demarcation point is an area of homology that is shared by all of the progenitor templates.
[00383] In a one aspect, the gene reassembly process is performed exhaustively in order to generate an exhaustive library. In other words, all possible ordered combinations of the nucleic acid building blocks are represented in the set of finalized chimeric nucleic acid molecules. At the same time, the assembly order (i.e. the order of assembly of each building block in the 5' to 3 sequence of each finalized chimeric nucleic acid) in each combination is by design (or non-stochastic). Because of the non-stochastic nature of the method, the possibility of unwanted side products is greatly reduced.
[0038 ] In another aspect, the method provides that the gene reassembly process is performed systematically, for example to generate a systematically compartmentalized library, with compartments that can be screened systematically, e.g., one by one. In other words the invention provides that, through the selective and judicious use of specific nucleic acid building blocks, coupled with the selective and judicious use of sequentially stepped assembly reactions, an experimental design can be achieved where specific sets of progeny products are made in each of several reaction vessels. This allows a systematic examination and screening procedure to be performed. Thus, it allows a potentially very large number of progeny molecules to be examined systematically in smaller groups.
[00385] Because of its ability to perform chimerizations in a manner that is highly flexible yet exhaustive and systematic as well, particularly when there is a low level of homology among the progenitor molecules, the instant invention provides for the generation of a library (or set) comprised of a large number of progeny molecules.
Because of the non-stochastic nature of the instant gene reassembly invention, the progeny molecules generated can comprise a library of finalized chimeric nucleic acid molecules having an overall assembly order that is chosen by design. En a particularly aspect, such a generated library is comprised of greater than 103 to greater than io1000 different progeny molecular species.
[00386] In one aspect, a set of finalized chimeric nucleic acid molecules, produced as described is comprised of a polynucleotide encoding a polypeptide. According to one aspect, this polynucleotide is a gene, which may be a man-made gene. According to another aspect, this polynucleotide is a gene pathway, which may be a man-made gene pathway. The invention provides that one or more man-made genes generated by the invention may be incoφorated into a man-made gene pathway, such as pathway operable in a eukaryotic organism (including a plant).
[00387] In another exemplification, the synthetic nature of the step in which the building blocks are generated allows the design and introduction of nucleotides (e.g., one or more nucleotides, which may be, for example, codons or introns or regulatory sequences) that can later be optionally removed in an in vitro process (e.g., by mutagenesis) or in an in vivo process (e.g., by utilizing the gene splicing ability of a host organism). It is appreciated that in many instances the introduction of these nucleotides may also be desirable for many other reasons in addition to the potential benefit of creating a serviceable demarcation point.
[00388] Thus, according to another aspect, the invention provides that a nucleic acid building block can be used to introduce an intron. Thus, the invention provides that functional introns may be introduced into a man-made gene of the invention. The invention also provides that functional introns may be introduced into a man-made gene pathway of the invention. Accordingly, the invention provides for the generation of a chimeric polynucleotide that is a man-made gene containing one (or more) artificially introduced intron(s).
[00389] Accordingly, the invention also provides for the generation of a chimeric polynucleotide that is a man-made gene pathway containing one (or more) artificially introduced intron(s). En one aspect, the artificially introduced intron(s) are functional in one or more host cells for gene splicing much in the way that naturally-occurring introns serve functionally in gene splicing. The invention provides a process of producing man- made intron-containing polynucleotides to be introduced into host organisms for recombination and/or splicing.
[00390] A man-made gene produced using the invention can also serve as a substrate for recombination with another nucleic acid. Likewise, a man-made gene pathway produced using the invention can also serve as a substrate for recombination with another nucleic acid. In one aspect, the recombination is facilitated by, or occurs at, areas of homology between the man-made, intron-containing gene and a nucleic acid, which serves as a recombination partner. In one aspect, the recombination partner may also be a nucleic acid generated by the invention, including a man-made gene or a man-made gene pathway. Recombination may be facilitated by or may occur at areas of homology that exist at the one (or more) artificially introduced intron(s) in the man-made gene. [00391] The synthetic gene reassembly method of the invention utilizes a plurality of nucleic acid building blocks, each of which can have two ligatable ends. The two ligatable ends on each nucleic acid building block may be two blunt ends (i.e. each having an overhang of zero nucleotides), or one blunt end and one overhang, or two overhangs. [00392] A useful overhang for this puφose may be a 3 ' overhang or a 5 ' overhang. Thus, a nucleic acid building block may have a 3 ' overhang or alternatively a 5 ' overhang or alternatively two 3' overhangs or alternatively two 5' overhangs. The overall order in which the nucleic acid building blocks are assembled to form a finalized chimeric nucleic acid molecule is determined by puφoseful experimental design and is not random. According to one aspect, a nucleic acid building block is generated by chemical synthesis of two single-stranded nucleic acids (also referred to as single-stranded oligos) and contacting them so as to allow them to anneal to form a double-stranded nucleic acid building block. A double-stranded nucleic acid building block can be of variable size. The sizes of these building blocks can be small or large. Sizes for building block range can be from 1 base pair (bp) (not including any overhangs) to 100,000 base pairs (not including any overhangs). Other size ranges are also provided, which have lower limits of from 1 bp to 10,000 bp (including every integer value in between), and upper limits of from 2 bp to 100, 000 bp (including every integer value in between). Many methods exist by which a double-stranded nucleic acid building block can be generated that is serviceable for the invention; and these are known in the art and can be readily performed by the skilled artisan.
[00393] According to one aspect, a double-stranded nucleic acid building block is generated by first generating two single stranded nucleic acids and allowing them to anneal to form a double-stranded nucleic acid building block. The two strands of a double- stranded nucleic acid building block may be complementary at every nucleotide apart from any that form an overhang; thus containing no mismatches, apart from any overhang(s). According to another aspect, the two strands of a double-stranded nucleic acid building block are complementary at fewer than every nucleotide apart from any that form an overhang. Thus, according to this aspect, a double-stranded nucleic acid building block can be used to introduce codon degeneracy. The codon degeneracy can be introduced using the site-saturation mutagenesis described herein, using one or more N,N,G/T cassettes or alternatively using one or more N,N,N cassettes.
[00394] The in vivo recombination method of the invention can be performed blindly on a pool of unknown hybrids or alleles of a specific polynucleotide or sequence. However, it is not necessary to know the actual DNA or RNA sequence of the specific polynucleotide.
[00395] The approach of using recombination within a mixed population of genes can be useful for the generation of any useful proteins, for example, interleukin I, antibodies, tPA and growth hormone. This approach may be used to generate proteins having altered specificity or activity. The approach may also be useful for the generation of hybrid nucleic acid sequences, for example, promoter regions, introns, exons, enhancer sequences, 31 untranslated regions or 51 untranslated regions of genes. Thus this approach may be used to generate genes having increased rates of expression. This approach may also be useful in the study of repetitive DNA sequences. Finally, this approach may be useful to mutate ribozymes or aptamers.
[00396] En one aspect the invention described herein is directed to the use of repeated cycles of reductive reassortment, recombination and selection which allow for the directed molecular evolution of highly complex linear sequences, such as DNA, RNA or proteins thorough recombination.
[00397 ] In vivo shuffling of molecules is useful in providing variants and can be performed utilizing the natural property of cells to recombine multimers. While recombination in vivo has provided the major natural route to molecular diversity, genetic recombination remains a relatively complex process that involves 1) the recognition of homologies; 2) strand cleavage, strand invasion, and metabolic steps leading to the production of recombinant chiasma; and finally 3) the resolution of chiasma into discrete recombined molecules. The formation of the chiasma requires the recognition of homologous sequences.
[00398] In another aspect, the invention includes a method for producing a hybrid polynucleotide from at least a first polynucleotide and a second polynucleotide. The invention can be used to produce a hybrid polynucleotide by introducing at least a first polynucleotide and a second polynucleotide which share at least one region of partial sequence homology into a suitable host cell. The regions of partial sequence homology promote processes wliich result in sequence reorganization producing a hybrid polynucleotide. The term "hybrid polynucleotide", as used herein, is any nucleotide sequence which results from the method of the present invention and contains sequence from at least two original polynucleotide sequences. Such hybrid polynucleotides can result from intermolecular recombination events which promote sequence integration between DNA molecules. In addition, such hybrid polynucleotides can result from intramolecular reductive reassortment processes which utilize repeated sequences to alter a nucleotide sequence within a DNA molecule.
Optimizing codons to achieve high levels of protein expression in host cells [00399] The invention provides methods for modifying cellulase-encoding nucleic acids to modify codon usage. In one aspect, the invention provides methods for modifying codons in a nucleic acid encoding a cellulase to increase or decrease its expression in a host cell. The invention also provides nucleic acids encoding a cellulase modified to increase its expression in a host cell, cellulase enzymes so modified, and methods of making the modified cellulase enzymes. The method comprises identifying a "non-preferred" or a "less preferred" codon in cellulase-encoding nucleic acid and replacing one or more of these non-prefeπed or less preferred codons with a "preferred codon" encoding the same amino acid as the replaced codon and at least one non-preferred or less preferred codon in the nucleic acid has been replaced by a preferred codon encoding the same amino acid. A preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell.
[00400] Host cells for expressing the nucleic acids, expression cassettes and vectors of the invention include bacteria, yeast, fungi, plant cells, insect cells and mammalian cells. Thus, the invention provides methods for optimizing codon usage in all of these cells, codon-altered nucleic acids and polypeptides made by the codon-altered nucleic acids. Exemplary host cells include gram negative bacteria, such as Escherichia coli and Pseudomonas fluorescens; gram positive bacteria, such as Streptomyces diversa, Lactobacillus gasseri, Lactococcus lactis, Lactococcus cremoris, Bacillus subtilis. Exemplary host cells also include eukaryotic organisms, e.g., various yeast, such as Saccharomyces sp., including Saccharomyces cerevisiae, Schizosaccharomycespom.be, Pichia pastoris, and Kluyveromyces lactis, Hansenula polymorpha, Aspergillus niger, and mammalian cells and cell lines and insect cells and cell lines. Thus, the invention also includes nucleic acids and polypeptides optimized for expression in these organisms and species.
[00401] For example, the codons of a nucleic acid encoding an cellulase isolated from a bacterial cell are modified such that the nucleic acid is optimally expressed in a bacterial cell different from the bacteria from which the cellulase was derived, a yeast, a fungi, a plant cell, an insect cell or a mammalian cell. Methods for optimizing codons are well known in the art, see, e.g., U.S. Patent No. 5,795,737; Baca (2000) Ent. J. Parasitol.
30:113-118; Hale (1998) Protein Expr. Purif. 12:185-188; Narum (2001) Infect. Emmunol.
69:7250-7253. See also Narum (2001) Infect. Immunol. 69:7250-7253, describing optimizing codons in mouse systems; Outchkourov (2002) Protein Expr. Purif. 24:18-24, describing optimizing codons in yeast; Feng (2000) Biochemistry 39:15399-15409, describing optimizing codons in E. coli; Humphreys (2000) Protein Expr. Purif. 20:252-
264, describing optimizing codon usage that affects secretion in E. coli.
Transgenic non-human animals
[00402] The invention provides transgenic non-human animals comprising a nucleic acid, a polypeptide, an expression cassette or vector or a transfected or transformed cell of the invention. The transgenic non-human animals can be, e.g., goats, rabbits, sheep, pigs, cows, rats and mice, comprising the nucleic acids of the invention. These animals can be used, e.g., as in vivo models to study cellulase activity, or, as models to screen for modulators of cellulase activity in vivo. The coding sequences for the polypeptides to be expressed in the transgenic non-human animals can be designed to be constitutive, or, under the control of tissue-specific, developmental-specific or inducible transcriptional regulatory factors. Transgenic non-human animals can be designed and generated using any method known in the art; see, e.g., U.S. Patent Nos. 6,211,428; 6,187,992; 6,156,952;
6,118,044; 6,111,166; 6,107,541; 5,959,171; 5,922,854; 5,892,070; 5,880,327; 5,891,698;
5,639,940; 5,573,933; 5,387,742; 5,087,571, describing making and using transformed cells and eggs and transgenic mice, rats, rabbits, sheep, pigs and cows. See also, e.g.,
Pollock (1999) J. Immunol. Methods 231:147-157, describing the production of recombinant proteins in the milk of transgenic dairy animals; Baguisi (1999) Nat.
Biotechnol. 17:456-461, demonstrating the production of transgenic goats. U.S. Patent No.
6,211,428, describes making and using transgenic non-human mammals which express in their brains a nucleic acid construct comprising a DNA sequence. U.S. Patent No.
5,387,742, describes injecting cloned recombinant or synthetic DNA sequences into fertilized mouse eggs, implanting the injected eggs in pseudo-pregnant females, and growing to term transgenic mice whose cells express proteins related to the pathology of Alzheimer's disease. U.S. Patent No. 6,187,992, describes making and using a transgenic mouse whose genome comprises a disruption of the gene encoding amyloid precursor protein (APP).
[00403] "Knockout animals" can also be used to practice the methods of the invention. For example, in one aspect, the transgenic or modified animals of the invention comprise a "knockout animal," e.g., a "knockout mouse," engineered not to express or to be unable to express a cellulase.
[00404] En another aspect, transgenic non-human organisms are provided which contain a heterologous sequence encoding a cellulase of the invention (e.g., SEQ ID NO:2). Various methods to make the transgenic animals of the subject invention can be employed. Generally speaking, three such methods may be employed. In one such method, an embryo at the pronuclear stage (a "one cell embryo") is harvested from a female and the transgene is microinjected into the embryo, in which case the transgene will be chromosomally integrated into both the germ cells and somatic cells of the resulting mature animal. En another such method, embryonic stem cells are isolated and the transgene incoφorated therein by electroporation, plasmid transfection or microinjection, followed by reintroduction of the stem cells into the embryo where they colonize and contribute to the germ line. Methods for microinjection of mammalian species is described in U.S. Pat. No. 4,873,191. En yet another such method, embryonic cells are infected with a retrovirus containing the transgene whereby the germ cells of the embryo have the transgene chromosomally integrated therein. When the animals to be made transgenic are avian, because avian fertilized ova generally go through cell division for the first twenty hours in the oviduct, microinjection into the pronucleus of the fertilized egg is problematic due to the inaccessibility of the pronucleus. Therefore, of the methods to make transgenic animals described generally above, retrovirus infection can be used for avian species, for example as described in U.S. Pat No. 5,162,215. If micro-injection is to be used with avian species, however, a published procedure by Love et al., (Biotechnol., 12, Jan 1994) can be utilized whereby the embryo is obtained from a sacrificed hen approximately two and one-half hours after the laying of the previous laid egg, the transgene is microinjected into the cytoplasm of the germinal disc and the embryo is cultured in a host shell until maturity. When the animals to be made transgenic are bovine or porcine, microinjection can be hampered by the opacity of the ova thereby making the nuclei difficult to identify by traditional differential interference-contrast microscopy. To overcome this problem, the ova can first be centrifuged to segregate the pronuclei for better visualization. [00405] The "non-human animals" of the invention bovine, porcine, ovine and avian animals (e.g., cow, pig, sheep, chicken). The "transgenic non-human animals" of the invention are produced by introducing "transgenes" into the germline of the non-human animal. Embryonal target cells at various developmental stages can be used to introduce transgenes. Different methods are used depending on the stage of development of the embryonal target cell. The zygote is the best target for micro-injection. The use of zygotes as is target for gene transfer has a major advantage in that in most cases the injected DNA will be incoφorated into the host gene before the first cleavage (Brinster et al., Proc. Natl. Acad. Sci. USA 82:4438-4442, 1985). As a consequence, all cells of the transgenic non- human animal will carry the incoφorated transgene. This will in general also be reflected in the efficient transmission of the transgene to offspring of the founder since 50%> of the germ cells will harbor the transgene.
[00406] The term "transgenic" is used to describe an animal which includes exogenous genetic material within all of its cells. A "transgenic" animal can be produced by crossbreeding two chimeric animals which include exogenous genetic material within cells used in reproduction. Twenty-five percent of the resulting offspring will be transgenic i.e., animals which include the exogenous genetic material within all of their cells in both alleles, 50% of the resulting animals will include the exogenous genetic material within one allele and 25% will include no exogenous genetic material.
[ 00407 ] In the microinjection method useful in the practice of the subject invention, the transgene is digested and purified free from any vector DNA, e.g., by gel electrophoresis. The transgene can include an operatively associated promoter which interacts with cellular proteins involved in transcription, ultimately resulting in constitutive expression. Promoters useful in this regard include those from cytomegalovirus (CMV) , Moloney leukemia virus (MLV), and heφes virus, as well as those from the genes encoding metallothionein, skeletal actin, P-enolpyruvate carboxylase (PEPCK), phosphoglycerate (PGK), DHFR, and thymidine kinase. Promoters for viral long terminal repeats (LTRs) such as Rous Sarcoma Virus can also be employed. When the animals to be made transgenic are avian, exemplary promoters include those for the chicken J-globin gene, chicken lysozyme gene, and avian leukosis virus. Constructs useful in plasmid transfection of embryonic stem cells will employ additional regulatory elements well known in the art such as enhancer elements to stimulate transcription, splice acceptors, termination and polyadenylation signals, and ribosome binding sites to permit translation. [00408] Retroviral infection can also be used to introduce transgene into a non- human animal, as described above. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R., Proc. Natl. Acad. Sci. USA 73:1260-1264, 1976). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan, et al. (1986) in Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). The viral vector system used to introduce the transgene is typically a replication-defective retro virus carrying the transgene (Jahner, et al., Proc. Natl. Acad. Sci. USA 82: 6927-6931, 1985; Van der Putten, et al., Proc. Natl. Acad. Sci. USA 82: 6148-6152, 1985). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart, et al., EMBO J. 6: 383-388, 1987). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (D. Jahner et al., Nature 298: 623-628, 1982). Most of the founders will be mosaic for the transgene since incoφoration occurs only in a subset of the cells which formed the transgenic nonhuman animal. Further, the founder may contain various retro viral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. En addition, it is also possible to introduce transgenes into the germ line, albeit with low efficiency, by intrauterine retroviral infection of the mid-gestation embryo (D. Jahner et al., supra).
[00409] A third type of target cell for transgene introduction is the embryonal stem cell (ES). ES cells are obtained from pre-implantation embryos cultured in vitro and fused with embryos (M. J. Evans et al., Nature 292:154-156, 1981; M. O. Bradley et al., Nature 309:255-258, 1984; Gossler, et al., Proc. Natl. Acad. Sci. USA 83:9065D9069, 1986; and Robertson et al., Nature 322:445-448, 1986). Transgenes can be efficiently introduced into the ES cells by DNA transfection or by retro virus-mediated transduction. Such transformed ES cells can thereafter be combined with blastocysts from a nonhuman animal. The ES cells thereafter colonize the embryo and contribute to the germ line of the resulting chimeric animal. (For review see Jaenisch, R., Science 240:1468-1474, 1988). Screening Methodologies and "On-line" Monitoring Devices [00410] En practicing the methods of the invention, a variety of apparatus and methodologies can be used to in conjunction with the polypeptides and nucleic acids of the invention, e.g., to screen polypeptides for cellulase activity, to screen compounds as potential modulators of activity (e.g., potentiation or inhibition of enzyme activity), for antibodies that bind to a polypeptide of the invention, for nucleic acids that hybridize to a nucleic acid of the invention, and the like.
Immobilized Enzyme Solid Supports
[00411] The cellulase enzymes, fragments thereof and nucleic acids that encode the enzymes and fragments can be affixed to a solid support. This is often economical and efficient in the use of the cellulases in industrial processes. For example, a consortium or cocktail of cellulase enzymes (or active fragments thereof), which are used in a specific chemical reaction, can be attached to a solid support and dunked into a process vat. The enzymatic reaction can occur. Then, the solid support can be taken out of the vat, along with the enzymes affixed thereto, for repeated use. En one embodiment of the invention, an isolated nucleic acid of the invention is affixed to a solid support. In another embodiment of the invention, the solid support is selected from the group of a gel, a resin, a polymer, a ceramic, a glass, a microelectrode and any combination thereof.
[ 00412 ] For example, solid supports useful in this invention include gels. Some examples of gels include Sepharose, gelatin, glutaraldehyde, chitosan-treated glutaraldehyde, albumin-glutaraldehyde, chitosan-Xanthan, toyopearl gel (polymer gel), alginate, alginate-polylysine, carrageenan, agarose, glyoxyl agarose, magnetic agarose, dextran-agarose, poly(Carbamoyl Sulfonate) hydrogel, BSA-PEG hydrogel, phosphorylated polyvinyl alcohol (PVA), monoaminoethyl-N-aminoethyl (MANA), amino, or any combination thereof.
[00413] Another solid support useful in the present invention are resins or polymers.
Some examples of resins or polymers include cellulose, acrylamide, nylon, rayon, polyester, anion-exchange resin, AMBERLITE™ XAD-7, AMBERLITE™ XAD-8,
AMBERLITE™ IRA-94, AMBERLITE™ IRC-50, polyvinyl, polyacrylic, polymethacrylate, or any combination thereof, another type of solid support useful in the present invention is ceramic. Some examples include non-porous ceramic, porous ceramic,
SiO2, Al2O3. Another type of solid support useful in the present invention is glass. Some examples include non-porous glass, porous glass, aminopropyl glass or any combination thereof. Another type of solid support that can be used is a microelectrode. An example is a polyethyleneimine-coated magnetite. Graphitic particles can be used as a solid support.
Another example of a solid support is a cell, such as a red blood cell.
Methods of immobilization [00414] There are many methods that would be known to one of skill in the art for immobilizing enzymes or fragments thereof, or nucleic acids, onto a solid support. Some examples of such methods include, e.g., electrostatic droplet generation, electrochemical means, via adsoφtion, via covalent binding, via cross-linking, via a chemical reaction or process, via encapsulation, via entrapment, via calcium alginate, or via poly (2- hydroxyethyl methacrylate). Like methods are described in Methods in Enzymology,
Immobilized Enzymes and Cells, Part C. 1987. Academic Press. Edited by S. P. Colowick and N. O. Kaplan. Volume 136; and Immobilization of Enzymes and Cells. 1997.
Humana Press. Edited by G. F. Bickerstaff Series: Methods in Biotechnology, Edited by J.
M. Walker.
Capillary Arrays
[00415] Capillary arrays, such as the GIGAMATRIX™, Diversa Coφoration, San
Diego, CA, can be used to in the methods of the invention. Nucleic acids or polypeptides of the invention can be immobilized to or applied to an array, including capillary arrays.
Arrays can be used to screen for or monitor libraries of compositions (e.g., small molecules, antibodies, nucleic acids, etc.) for their ability to bind to or modulate the activity of a nucleic acid or a polypeptide of the invention. Capillary arrays provide another system for holding and screening samples. For example, a sample screening apparatus can include a plurality of capillaries formed into an array of adjacent capillaries, wherein each capillary comprises at least one wall defining a lumen for retaining a sample.
The apparatus can further include interstitial material disposed between adjacent capillaries in the array, and one or more reference indicia formed within of the interstitial material. A capillary for screening a sample, wherein the capillary is adapted for being bound in an array of capillaries, can include a first wall defining a lumen for retaining the sample, and a second wall formed of a filtering material, for filtering excitation energy provided to the lumen to excite the sample.
[00416] A polypeptide or nucleic acid, e.g., a ligand, can be introduced into a first component into at least a portion of a capillary of a capillary array. Each capillary of the capillary aπay can comprise at least one wall defining a lumen for retaining the first component. An air bubble can be introduced into the capillary behind the first component.
A second component can be introduced into the capillary, wherein the second component is separated from the first component by the air bubble. A sample of interest can be introduced as a first liquid labeled with a detectable particle into a capillary of a capillary array, wherein each capillary of the capillary array comprises at least one wall defining a lumen for retaining the first liquid and the detectable particle, and wherein the at least one wall is coated with a binding material for binding the detectable particle to the at least one wall. The method can further include removing the first liquid from the capillary tube, wherein the bound detectable particle is maintained within the capillary, and introducing a second liquid into the capillary tube.
[00417] The capillary array can include a plurality of individual capillaries comprising at least one outer wall defining a lumen. The outer wall of the capillary can be one or more walls fused together. Similarly, the wall can define a lumen that is cylindrical, square, hexagonal or any other geometric shape so long as the walls form a lumen for retention of a liquid or sample. The capillaries of the capillary array can be held together in close proximity to form a planar structure. The capillaries can be bound together, by being fused (e.g., where the capillaries are made of glass), glued, bonded, or clamped side-by- side. The capillary array can be formed of any number of individual capillaries, for example, a range from 100 to 4,000,000 capillaries. A capillary array can form a microtiter plate having about 100,000 or more individual capillaries bound together. Arrays, or "BioChips"
[00418] Nucleic acids or polypeptides of the invention can be immobilized to or applied to an array. Arrays can be used to screen for or monitor libraries of compositions (e.g., small molecules, antibodies, nucleic acids, etc.) for their ability to bind to or modulate the activity of a nucleic acid or a polypeptide of the invention. For example, in one aspect of the invention, a monitored parameter is transcript expression of a cellulase gene. One or more, or, all the transcripts of a cell can be measured by hybridization of a sample comprising transcripts of the cell, or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic acids on an array, or "biochip." By using an "array" of nucleic acids on a microchip, some or all of the transcripts of a cell can be simultaneously quantified. Alternatively, arrays comprising genomic nucleic acid can also be used to determine the genotype of a newly engineered strain made by the methods of the invention. "Polypeptide arrays" can also be used to simultaneously quantify a plurality of proteins.
[00419] The present invention can be practiced with any known "array," also referred to as a "microarray" or "nucleic acid array" or "polypeptide array" or "antibody array" or "biochip," or variation thereof. Arrays are generically a plurality of "spots" or "target elements," each target element comprising a defined amount of one or more biological molecules, e.g., oligonucleotides, immobilized onto a defined area of a substrate surface for specific binding to a sample molecule, e.g., mRNA transcripts.
[00420] In practicing the methods of the invention, any known array and/or method of making and using arrays can be incoφorated in whole or in part, or variations thereof, as described, for example, in U.S. Patent Nos. 6,277,628; 6,277,489; 6,261,776; 6,258,606;
6,054,270; 6,048,695; 6,045,996; 6,022,963; 6,013,440; 5,965,452; 5,959,098; 5,856,174;
5,830,645; 5,770,456; 5,632,957; 5,556,752; 5,143,854; 5,807,522; 5,800,992; 5,744,305;
5,700,637; 5,556,752; 5,434,049; see also, e.g., WO 99/51773; WO 99/09217; WO
97/46313; WO 96/17958; see also, e.g., Johnston (1998) Curr. Biol. 8:R171-R174;
Schummer (1997) Biotechniques 23:1087-1092; Kern (1997) Biotechniques 23:120-124;
Solinas-Toldo (1997) Genes, Chromosomes & Cancer 20:399-407; Bowtell (1999) Nature
Genetics Supp. 21:25-32. See also published U.S. patent applications Nos. 20010018642;
20010019827; 20010016322; 20010014449; 20010014448; 20010012537; 20010008765.
Polypeptides and peptides
[00421] The invention provides isolated or recombinant polypeptides having a sequence identity to an exemplary sequence of the invention, e.g., SEQ ED NO:2. As discussed above, the identity can be over the full length of the polypeptide, or, the identity can be over a region of at least about 50, 77, 100, 150, 200, 250, 300 or more residues (to the full length of the polypeptide). Polypeptides of the invention can also be shorter than the full length of exemplary polypeptides (e.g., SEQ ID NO:2). In alternative embodiment, the invention provides polypeptides (peptides, fragments) ranging in size between about 5 and the full length of a polypeptide, e.g., a cellulase; exemplary sizes being of about 5, 10,
15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 125, 150, 175, 200, 250,
300 or more residues, e.g., contiguous residues of the exemplary cellulases of SEQ ED
NO:2. Peptides of the invention can be useful as, e.g., labeling probes, antigens, toleragens, motifs, cellulase active sites.
[00422 ] Polypeptides and peptides of the invention can be isolated from natural sources, be synthetic, or be recombinantly generated polypeptides. Peptides and proteins can be recombinantly expressed in vitro or in vivo. The peptides and polypeptides of the invention can be made and isolated using any method known in the art. Polypeptide and peptides of the invention can also be synthesized, whole or in part, using chemical methods well known in the art. See e.g., Caruthers (1980) Nucleic Acids Res. Symp. Ser. 215-223;
Horn (1980) Nucleic Acids Res. Symp. Ser. 225-232; Banga, A.K., Therapeutic Peptides and Proteins, Formulation, Processing and Delivery Systems (1995) Technomic Publishing Co., Lancaster, PA. For example, peptide synthesis can be performed using various solid- phase techniques (see e.g., Roberge (1995) Science 269:202; Merrifield (1997) Methods Enzymol. 289:3 D 13) and automated synthesis may be achieved, e.g., using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.
[00423] The peptides and polypeptides of the invention can also be glycosylated. The glycosylation can be added post-translationally either chemically or by cellular biosynthetie mechanisms, wherein the later incoφorates the use of known glycosylation motifs, which can be native to the sequence or can be added as a peptide or added in the nucleic acid coding sequence. The glycosylation can be O-linked or N-linked, or, a combination thereof.
[00424] The peptides and polypeptides of the invention, as defined above, include all "mimetic" and "peptidomimetic" forms. The terms "mimetic" and "peptidomimetic" refer to a synthetic chemical compound which has substantially the same structural and/or functional characteristics of the polypeptides of the invention. The mimetic can be either entirely composed of synthetic, non-natural analogues of amino acids, or, is a chimeric molecule of partly natural peptide amino acids and partly non-natural analogs of amino acids. The mimetic can also incoφorate any amount of natural amino acid conservative substitutions as long as such substitutions also do not substantially alter the mimetic's structure and/or activity. As with polypeptides of the invention which are conservative variants, routine experimentation will determine whether a mimetic is within the scope of the invention, i.e., that its structure and/or function is not substantially altered. Thus, in one aspect, a mimetic composition is within the scope of the invention if it has a cellulase activity.
[00425] Polypeptide mimetic compositions of the invention can contain any combination of non-natural structural components. In alternative aspect, mimetic compositions of the invention include one or all of the following three structural groups: a) residue linkage groups other than the natural amide bond ("peptide bond") linkages; b) non-natural residues in place of naturally occurring amino acid residues; or c) residues which induce secondary structural mimicry, i.e., to induce or stabilize a secondary structure, e.g., a beta turn, gamma turn, beta sheet, alpha helix conformation, and the like. For example, a polypeptide of the invention can be characterized as a mimetic when all or some of its residues are joined by chemical means other than natural peptide bonds.
Endividual peptidomimetic residues can be joined by peptide bonds, other chemical bonds or coupling means, such as, e.g., glutaraldehyde, N-hydroxysuccinimide esters, bifunctional maleimides, N,N'-dicyclohexylcarbodiimide (DCC) or N,N'- diisopropylcarbodiimide (DEC). Linking groups that can be an alternative to the traditional amide bond ("peptide bond") linkages include, e.g., ketomethylene (e.g., -C(=O)-CH2- for -C(=O)-NH-), aminomethylene (CH2-NH), ethylene, olefin (CH=CH), ether (CH2-O), thioether (CH2-S), tetrazole (CN4-), thiazole, retroamide, thioamide, or ester (see, e.g., Spatola (1983) in Chemistry and Biochemistry of Amino Acids, Peptides and Proteins, Vol. 7, pp 267-357, "Peptide Backbone Modifications," Marcell Dekker, NY).
[00426] A polypeptide of the invention can also be characterized as a mimetic by containing all or some non-natural residues in place of naturally occurring amino acid residues. Non-natural residues are well described in the scientific and patent literature; a few exemplary non-natural compositions useful as mimetics of natural amino acid residues and guidelines are described below. Mimetics of aromatic amino acids can be generated by replacing by, e.g., D- or L- naphylalanine; D- or L- phenylglycine; D- or L-2 thieneylalanine; D- or L-l, -2, 3-, or 4- pyreneylalanine; D- or L-3 thieneylalanine; D- or L-(2-pyridinyl)-alanine; D- or L-(3-pyridinyl)-alanine; D- or L-(2-pyrazinyl)-alanine; D- or L-(4-isopropyl)-phenylglycine; D-(trifluoromethyl)-phenylglycine; D-(trifluoromethyl)- phenylalanine; D-p-fluoro-phenylalanine; D- or L-p-biphenylphenylalanine; K- or L-p- methoxy-biphenylphenylalanine; D- or L-2-indole(alkyl)alanines; and, D- or L- alkylainines, where alkyl can be substituted or unsubstituted methyl, ethyl, propyl, hexyl, butyl, pentyl, isopropyl, iso-butyl, sec-isotyl, iso-pentyl, or a non-acidic amino acids. Aromatic rings of a non-natural amino acid include, e.g., thiazolyl, thiophenyl, pyrazolyl, benzimidazolyl, naphthyl, furanyl, pyrrolyl, and pyridyl aromatic rings.
[00427] Mimetics of acidic amino acids can be generated by substitution by, e.g., non-carboxylate amino acids while maintaining a negative charge; (phosphono)alanine; sulfated threonine. Carboxyl side groups (e.g., aspartyl or glutamyl) can also be selectively modified by reaction with carbodumides (R'-N-C-N-R') such as, e.g., l-cyclohexyl-3(2- moφholinyl-(4-ethyl) carbodiimide or l-ethyl-3(4-azonia- 4,4- dimetholpentyl) carbodiimide. Aspartyl or glutamyl can also be converted to asparaginyl and glutaminyl residues by reaction with ammonium ions. Mimetics of basic amino acids can be generated by substitution with, e.g., (in addition to lysine and arginine) the amino acids ornithine, citrulline, or (guanidino)-acetic acid, or (guanidino)alkyl-acetic acid, where alkyl is defined above. Nitrile derivative (e.g., containing the CN-moiety in place of COOH) can be substituted for asparagine or glutamine. Asparaginyl and glutaminyl residues can be deaminated to the corresponding aspartyl or glutamyl residues. Arginine residue mimetics can be generated by reacting arginyl with, e.g., one or more conventional reagents, including, e.g., phenylglyoxal, 2,3-butanedione, 1,2-cyclo-hexanedione, or ninhydrin, and can be under alkaline conditions. Tyrosine residue mimetics can be generated by reacting tyrosyl with, e.g., aromatic diazonium compounds or tetranitromethane. N-acetylimidizol and tetranitromethane can be used to form O-acetyl tyrosyl species and 3-nitro derivatives, respectively. Cysteine residue mimetics can be generated by reacting cysteinyl residues with, e.g., alpha-haloacetates such as 2-chloroacetic acid or chloroacetamide and corresponding amines; to give carboxymethyl or carboxyamidomethyl derivatives. Cysteine residue mimetics can also be generated by reacting cysteinyl residues with, e.g., bromo-trifluoroacetone, alpha-bromo-beta-(5-imidozoyl) propionic acid; chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide; methyl 2-pyridyl disulfide; p- chloromercuribenzoate; 2-chloromercuri-4 nitrophenol; or, chloro-7-nitrobenzo-oxa-l,3- diazole. Lysine mimetics can be generated (and amino terminal residues can be altered) by reacting lysinyl with, e.g., succinic or other carboxylic acid anhydrides. Lysine and other alpha-amino-containing residue mimetics can also be generated by reaction with imidoesters, such as methyl picolinimidate, pyridoxal phosphate, pyridoxal, chloroborohydride, trinitro-benzenesulfonic acid, O-methylisourea, 2,4, pentanedione, and transamidase-catalyzed reactions with glyoxylate. Mimetics of methionine can be generated by reaction with, e.g., methionine sulfoxide. Mimetics of proline include, e.g., pipecolic acid, thiazolidine carboxylic acid, 3- or 4- hydroxy proline, dehydroprohne, 3- or 4-methylproline, or 3,3,-dimethylproline. Histidine residue mimetics can be generated by reacting histidyl with, e.g., diethylprocarbonate or para-bromophenacyl bromide. Other mimetics include, e.g., those generated by hydroxylation of proline and lysine; phosphorylation of the hydroxyl groups of seryl or threonyl residues; methylation of the alpha- amino groups of lysine, arginine and histidine; acetylation of the N-terminal amine; methylation of main chain amide residues or substitution with N-methyl amino acids; or amidation of C-terminal carboxyl groups.
[00428] A residue, e.g., an amino acid, of a polypeptide of the invention can also be replaced by an amino acid (or peptidomimetic residue) of the opposite chirality. Thus, any amino acid naturally occurring in the L-configuration (which can also be referred to as the R or S, depending upon the structure of the chemical entity) can be replaced with the amino acid of the same chemical structural type or a peptidomimetic, but of the opposite chirality, referred to as the D- amino acid, but also can be referred to as the R- or S- form. [00429] The invention also provides methods for modifying the polypeptides of the invention by either natural processes, such as post-translational processing (e.g., phosphorylation, acylation, etc), or by chemical modification techniques, and the resulting modified polypeptides. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also a given polypeptide may have many types of modifications. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphatidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation. See, e.g., Creighton, T.E., Proteins - Structure and Molecular
Properties 2nd Ed., W.H. Freeman and Company, New York (1993); Posttranslational
Covalent Modification of Proteins, B.C. Johnson, Ed., Academic Press, New York, pp. 1-
12 (1983).
[00430] Solid-phase chemical peptide synthesis methods can also be used to synthesize the polypeptide or fragments of the invention. Such method have been known in the art since the early 1960's (Merrifield, R. B., J. Am. Chem. Soc, 85:2149-2154, 1963)
(See also Stewart, J. M. and Young, J. D., Solid Phase Peptide Synthesis, 2nd Ed., Pierce
Chemical Co., Rockford, 111., pp. 11-12)) and have recently been employed in commercially available laboratory peptide design and synthesis kits (Cambridge Research
Biochemicals). Such commercially available laboratory kits have generally utilized the teachings of H. M. Geysen et al, Proc. Natl. Acad. Sci., USA, 81:3998 (1984) and provide for synthesizing peptides upon the tips of a multitude of "rods" or "pins" all of which are connected to a single plate. When such a system is utilized, a plate of rods or pins is inverted and inserted into a second plate of corresponding wells or reservoirs, which contain solutions for attaching or anchoring an appropriate amino acid to the pin's or rod's tips. By repeating such a process step, i.e., inverting and inserting the rod's and pin's tips into appropriate solutions, amino acids are built into desired peptides. In addition, a number of available FMOC peptide synthesis systems are available. For example, assembly of a polypeptide or fragment can be carried out on a solid support using an Applied Biosystems, Inc. Model 431 A™ automated peptide synthesizer. Such equipment provides ready access to the peptides of the invention, either by direct synthesis or by synthesis of a series of fragments that can be coupled using other known techniques. [00431] Another aspect of the invention is polypeptides or fragments thereof which have at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or more than about 95% homology to one of the polypeptides of SEQ ID NO:2, sequences substantially identical thereto, or a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 250, 300 consecutive amino acids thereof. Homology may be determined using any of the programs described above which aligns the polypeptides or fragments being compared and determines the extent of amino acid identity or similarity between them. It will be appreciated that amino acid "homology" includes conservative amino acid substitutions such as those described above.
[00432] The polypeptides or fragments having homology to one of the polypeptides of SEQ ED NO:2, sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may be obtained by isolating the nucleic acids encoding them using the techniques described above.
[00433] Alternatively, the homologous polypeptides or fragments may be obtained through biochemical enrichment or purification procedures. The sequence of potentially homologous polypeptides or fragments may be determined by proteolytic digestion, gel electrophoresis and/or microsequencing. The sequence of the prospective homologous polypeptide or fragment can be compared to one of the polypeptides of SEQ ID NO:2, sequences substantially identical thereto, or a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof using any of the programs described herein.
[00434] Another aspect of the invention is an assay for identifying fragments or variants of SEQ ED NO:2, or sequences substantially identical thereto, which retain the enzymatic function of the polypeptides of SEQ ID NO:2 and sequences substantially identical thereto. For example the fragments or variants of the polypeptides, may be used to catalyze biochemical reactions, which indicate that said fragment or variant retains the enzymatic activity of the polypeptides in SEQ ID NO:2. [00435] The assay for determining if fragments of variants retain the enzymatic activity of the polypeptides of SEQ ID NO:2, and sequences substantially identical thereto, includes the steps of; contacting the polypeptide fragment or variant with a substrate molecule under conditions which allow the polypeptide fragment or variant to function, and detecting either a decrease in the level of substrate or an increase in the level of the specific reaction product of the reaction between the polypeptide and substrate.
[00436] The polypeptides of SEQ ID NO:2, sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may be used in a variety of applications. For example, the polypeptides or fragments thereof may be used to catalyze biochemical reactions. In accordance with one aspect of the invention, there is provided a process for utilizing a polypeptide having SEQ ID NO:2, and sequences substantially identical thereto, or polynucleotides encoding such polypeptides for hydrolyzing haloalkanes. In such procedures, a substance containing a haloalkane compound is contacted with one of the polypeptides of SEQ ID NO:2, sequences substantially identical thereto, under conditions which facilitate the hydrolysis of the compound.
Antibodies and Antibody-based screening methods
[00437] The invention provides isolated or recombinant antibodies that specifically bind to a cellulase of the invention. These antibodies can be used to isolate, identify or quantify the cellulases of the invention or related polypeptides. These antibodies can be used to inhibit the activity of an enzyme of the invention. These antibodies can be used to isolated polypeptides related to those of the invention, e.g., related cellulase enzymes.
[00438] The antibodies can be used in immunoprecipitation, staining (e.g., FACS), immunoaffinity columns, and the like. If desired, nucleic acid sequences encoding for specific antigens can be generated by immunization followed by isolation of polypeptide or nucleic acid, amplification or cloning and immobilization of polypeptide onto an array of the invention. Alternatively, the methods of the invention can be used to modify the structure of an antibody produced by a cell to be modified, e.g., an antibody's affinity can be increased or decreased. Furthermore, the ability to make or modify antibodies can be a phenotype engineered into a cell by the methods of the invention.
[00439] Methods of immunization, producing and isolating antibodies (polyclonal and monoclonal) are known to those of skill in the art and described in the scientific and patent literature, see, e.g., Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY,
Wiley/Greene, NY (1991); Stites (eds.) BASIC AND CLINICAL IMMUNOLOGY (7th ed.) Lange Medical Publications, Los Altos, CA ("Stites"); Goding, MONOCLONAL ANTIBODIES: PRINCIPLES AND PRACTICE (2d ed.) Academic Press, New York, NY (1986); Kohler (1975) Nature 256:495; Harlow (1988) ANTIBODIES, A LABORATORY MANUAL, Cold Spring Harbor Publications, New York. Antibodies also can be generated in vitro, e.g., using recombinant antibody binding site expressing phage display libraries, in addition to the traditional in vivo methods using animals. See, e.g., Hoogenboom (1997) Trends Biotechnol. 15:62-70; Katz (1997) Annu. Rev. Biophys. Biomol. Struct. 26:27-45. [00440] The polypeptides can be used to generate antibodies which bind specifically to the polypeptides of the invention. The resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample. In such procedures, a protein preparation, such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to one of the polypeptides of the invention. [00441] In immunoaffinity procedures, the antibody is attached to a solid support, such as a bead or other column matrix. The protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to one of the polypeptides of the invention. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
[00442 ] The ability of proteins in a biological sample to bind to the antibody may be determined using any of a variety of procedures familiar to those skilled in the art. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
[00443] Polyclonal antibodies generated against the polypeptides of the invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, for example, a nonhuman. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies which may bind to the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from cells expressing that polypeptide. [00444] For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique, the trioma technique, the human B-cell hybridoma technique, and the
EBV-hybridoma technique (see, e.g., Cole (1985) in Monoclonal Antibodies and Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96). Techniques described for the production of single chain antibodies (see, e.g., U.S. Patent No. 4,946,778) can be adapted to produce single chain antibodies to the polypeptides of the invention. Alternatively, transgenic mice may be used to express humanized antibodies to these polypeptides or fragments thereof.
[00445] Antibodies generated against the polypeptides of the invention may be used in screening for similar polypeptides from other organisms and samples. In such techniques, polypeptides from the organism are contacted with the antibody and those polypeptides which specifically bind the antibody are detected. Any of the procedures described above may be used to detect antibody binding.
[00446] The polypeptides of SEQ ED NO:2, sequences substantially identical thereto, or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof, may also be used to generate antibodies which bind specifically to the enzyme polypeptides or fragments. The resulting antibodies may be used in immunoaffinity chromatography procedures to isolate or purify the polypeptide or to determine whether the polypeptide is present in a biological sample. In such procedures, a protein preparation, such as an extract, or a biological sample is contacted with an antibody capable of specifically binding to one of a polypeptide of SEQ ED NO:2, sequences substantially identical thereto, or fragments of the foregoing sequences.
[00447] En immunoaffinity procedures, the antibody is attached to a solid support, such as a bead or other column matrix. The protein preparation is placed in contact with the antibody under conditions in which the antibody specifically binds to one of the polypeptides of SEQ ED NO:2, sequences substantially identical thereto, or fragment thereof. After a wash to remove non-specifically bound proteins, the specifically bound polypeptides are eluted.
[ 00448 ] The ability of proteins in a biological sample to bind to the antibody may be determined using any of a variety of procedures familiar to those skilled in the art. For example, binding may be determined by labeling the antibody with a detectable label such as a fluorescent agent, an enzymatic label, or a radioisotope. Alternatively, binding of the antibody to the sample may be detected using a secondary antibody having such a detectable label thereon. Particular assays include ELISA assays, sandwich assays, radioimmunoassays, and Western Blots.
Kits [00449] The invention provides kits comprising the compositions, e.g., nucleic acids, expression cassettes, vectors, cells, polypeptides (e.g., cellulases) and/or antibodies of the invention. The kits also can contain instructional material teaching the methodologies and industrial uses of the invention, as described herein. Measuring Metabolic Parameters
[00450] The methods of the invention involve whole cell evolution, or whole cell engineering, of a cell to develop a new cell strain having a new phenotype by modifying the genetic composition of the cell, where the genetic composition is modified by addition to the cell of a nucleic acid of the invention. To detect the new phenotype, at least one metabolic parameter of a modified cell is monitored in the cell in a "real time" or "on-line" time frame. En one aspect, a plurality of cells, such as a cell culture, is monitored in "real time" or "on-line." En one aspect, a plurality of metabolic parameters is monitored in "real time" or "on-line."
[00451] Metabolic flux analysis (MFA) is based on a known biochemistry framework. A linearly independent metabolic matrix is constructed based on the law of mass conservation and on the pseudo-steady state hypothesis (PSSH) on the intracellular metabolites. In practicing the methods of the invention, metabolic networks are established, including the:
[00452 ] identity of all pathway substrates, products and intermediary metabolites
[00453] identity of all the chemical reactions interconverting the pathway metabolites, the stoichiometry of the pathway reactions,
[00454] identity of all the enzymes catalyzing the reactions, the enzyme reaction kinetics,
[00455] the regulatory interactions between pathway components, e.g. allosteric interactions, enzyme-enzyme interactions etc,
[00456] intracellular compartmentalization of enzymes or any other supramolecular organization of the enzymes, and,
[00457] - the presence of any concentration gradients of metabolites, enzymes or effector molecules or diffusion barriers to their movement.
[00458] Once the metabolic network for a given strain is built, mathematic presentation by matrix notion can be introduced to estimate the intracellular metabolic fluxes if the on-line metabolome data is available.
[00459] Metabolic phenotype relies on the changes of the whole metabolic network within a cell. Metabolic phenotype relies on the change of pathway utilization with respect to environmental conditions, genetic regulation, developmental state and the genotype, etc. In one aspect of the methods of the invention, after the on-line MFA calculation, the dynamic behavior of the cells, their phenotype and other properties are analyzed by investigating the pathway utilization. For example, if the glucose supply is increased and the oxygen decreased during the yeast fermentation, the utilization of respiratory pathways will be reduced and/or stopped, and the utilization of the fermentative pathways will dominate. Control of physiological state of cell cultures will become possible after the pathway analysis. The methods of the invention can help determine how to manipulate the fermentation by determining how to change the substrate supply, temperature, use of inducers, etc. to control the physiological state of cells to move along desirable direction. In practicing the methods of the invention, the MFA results can also be compared with transcriptome and proteome data to design experiments and protocols for metabolic engineering or gene shuffling, etc.
[00460] In practicing the methods of the invention, any modified or new phenotype can be conferred and detected, including new or improved characteristics in the cell. Any aspect of metabolism or growth can be monitored. Monitoring expression of an mRNA transcript
[00461] In one aspect of the invention, the engineered phenotype comprises increasing or decreasing the expression of an mRNA transcript or generating new transcripts in a cell. mRNA transcript, or message can be detected and quantified by any method known in the art, including, e.g., Northern blots, quantitative amplification reactions, hybridization to arrays, and the like. Quantitative amplification reactions include, e.g., quantitative PCR, including, e.g., quantitative reverse transcription polymerase chain reaction, or RT-PCR; quantitative real time RT-PCR, or "real-time kinetic RT-PCR" (see, e.g., Kreuzer (2001) Br. J. Haematol. 114:313-318; Xia (2001) Transplantation 72:907-914).
[00462] In one aspect of the invention, the engineered phenotype is generated by knocking out expression of a homologous gene. The gene's coding sequence or one or more transcriptional control elements can be knocked out, e.g., promoters enhancers. Thus, the expression of a transcript can be completely ablated or only decreased. [00463] In one aspect of the invention, the engineered phenotype comprises increasing the expression of a homologous gene. This can be effected by knocking out of a negative control element, including a transcriptional regulatory element acting in cis- or trans- , or, mutagenizing a positive control element. [00464] As discussed below in detail, one or more, or, all the transcripts of a cell can be measured by hybridization of a sample comprising transcripts of the cell, or, nucleic acids representative of or complementary to transcripts of a cell, by hybridization to immobilized nucleic acids on an array. Monitoring expression of a polypeptides, peptides and amino acids
[00465] In one aspect of the invention, the engineered phenotype comprises increasing or decreasing the expression of a polypeptide or generating new polypeptides in a cell. Polypeptides, peptides and amino acids can be detected and quantified by any method known in the art, including, e.g., nuclear magnetic resonance (NMR), spectrophotometry, radiography (protein radiolabeling), electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, various immunological methods, e.g. immunoprecipitation, immunodiffusion, immuno-electrophoresis, radioimmunoassays (REAs), enzyme-linked immunosorbent assays (ELESAs), immuno-fluorescent assays, gel electrophoresis (e.g., SDS-PAGE), staining with antibodies, fluorescent activated cell sorter (FACS), pyrolysis mass spectrometry, Fourier-Transform Infrared Spectrometry, Raman spectrometry, GC-MS, and LC-Electrospray and cap-LC-tandem-electrospray mass spectrometries, and the like. Novel bioactivities can also be screened using methods, or variations thereof, described in U.S. Patent No. 6,057,103. Furthermore, as discussed below in detail, one or more, or, all the polypeptides of a cell can be measured using a protein array.
[00466] Biosynthetically directed fractional 13C labeling of proteinogenic amino
1 ^ acids can be monitored by feeding a mixture of uniformly C-labeled and unlabeled carbon source compounds into a bioreaction network. Analysis of the resulting labeling pattern enables both a comprehensive characterization of the network topology and the determination of metabolic flux ratios of the amino acids; see, e.g., Szyperski (1999) Metab. Eng. 1:189-197.
[00467] The present invention exploits the unique catalytic properties of enzymes. Whereas the use of biocatalysts (i.e., purified or crude enzymes, non-living or living cells) in chemical transformations normally requires the identification of a particular biocatalyst that reacts with a specific starting compound, the present invention uses selected biocatalysts and reaction conditions that are specific for functional groups that are present in many starting compounds, such as small molecules. Each biocatalyst is specific for one functional group, or several related functional groups, and can react with many starting compounds containing this functional group.
[00468] The biocatalytic reactions produce a population of derivatives from a single starting compound. These derivatives can be subjected to another round of biocatalytic reactions to produce a second population of derivative compounds. Thousands of variations of the original small molecule or compound can be produced with each iteration of biocatalytic derivatization.
[00469] Enzymes react at specific sites of a starting compound without affecting the rest of the molecule, a process which is very difficult to achieve using traditional chemical methods. This high degree of biocatalytic specificity provides the means to identify a single active compound within the library. The library is characterized by the series of biocatalytic reactions used to produce it, a so called "biosynthetie history". Screening the library for biological activities and tracing the biosynthetie history identifies the specific reaction sequence producing the active compound. The reaction sequence is repeated and the structure of the synthesized compound determined. This mode of identification, unlike other synthesis and screening approaches, does not require immobilization technologies, and compounds can be synthesized and tested free in solution using virtually any type of screening assay. It is important to note, that the high degree of specificity of enzyme reactions on functional groups allows for the "tracking" of specific enzymatic reactions that make up the biocatalytically produced library.
[00470] Many of the procedural steps are performed using robotic automation enabling the execution of many thousands of biocatalytic reactions and screening assays per day as well as ensuring a high level of accuracy and reproducibility. As a result, a library of derivative compounds can be produced in a matter of weeks which would take years to produce using current chemical methods.
[00471] En a particular aspect, the invention provides a method for modifying small molecules, comprising contacting a polypeptide encoded by a polynucleotide described herein or enzymatically active fragments thereof with a small molecule to produce a modified small molecule. A library of modified small molecules is tested to determine if a modified small molecule is present within the library which exhibits a desired activity. A specific biocatalytic reaction which produces the modified small molecule of desired activity is identified by systematically eliminating each of the biocatalytic reactions used to produce a portion of the library, and then testing the small molecules produced in the portion of the library for the presence or absence of the modified small molecule with the desired activity. The specific biocatalytic reactions which produce the modified small molecule of desired activity is optionally repeated. The biocatalytic reactions are conducted with a group of biocatalysts that react with distinct structural moieties found within the structure of a small molecule, each biocatalyst is specific for one structural moiety or a group of related structural moieties; and each biocatalyst reacts with many different small molecules which contain the distinct structural moiety. Industrial Applications Detergent Compositions
[00472 ] The invention provides detergent compositions comprising one or more polypeptides of the invention. Surface- active and/or non-surface-active can be used. The amount of total cellulase, surface-active and/or non-surface- active, used in the present invention can be from about 0.0001%> to about 1.0%, or from about 0.0002% to about 0.5%, by weight, of the detergent composition. In one aspect, of the detergent composition, the surface-active cellulase is from about 5%> to about 67% and the non- surface-active cellulase is from about 33% to about 95%> of the total cellulase activity in the enzymatic mixture. In one aspect, the optimum pH of the total enzymatic mixture is between about 5 to about 10.5.
[00473] The polypeptides of the invention can be used in any detergent composition, which are well known in the art, see, e.g., U.S. Patent No. 6,322,595; 6,313,081. For example, in one aspect, a laundry detergent composition is provided. It can comprise 0.8 ppm to 80 ppm of a cellulase of the invention. Treating fabrics
[00474] The invention provides methods of treating fabrics using one or more polypeptides of the invention. The polypeptides of the invention can be used in any fabric- treating method, which are well known in the art, see, e.g., U.S. Patent No. 6,300,122; 6,294,366. For example, in one aspect, the feel and appearance of a cellulosic-containing fabric is improved by a method comprising contacting the fabric with a cellulase of the invention in a solution. In one aspect, the fabric is treated with the solution under pressure. The enzymes of the invention can be used to treat cellulosic materials, including cotton- containing fabrics, as detergent additives and in aqueous compositions. The exact concentration of cellulase can be readily determined by the skilled artisan based on the desired result. In one aspect, the cellulase composition is present in a concentration of from about 1 to 1000 PPM, or between about 10-400 PPM total protein. [00475] In one aspect, the enzymes of the invention are used with a surfactant. The surfactant can be present in a concentration of greater than about 100 PPM, or from about
200-15,000 PPM. Suitable surfactants include any surfactant compatible with the cellulase and the fabric including, for example, anionic, non-ionic and ampholytic surfactants.
Suitable anionic surfactants for use herein include linear or branched alkylbenzenesulfonates; alkyl or alkenyl ether sulfates having linear or branched alkyl groups or alkenyl groups; alkyl or alkenyl sulfates; olefinsulfonates; alkanesulfonates and the like. Suitable counter ions for anionic surfactants include alkali metal ions such as sodium and potassium; alkaline earth metal ions such as calcium and magnesium; ammonium ion; and alkanolamines having 1 to 3 alkanol groups of carbon number 2 or 3.
Ampholytic surfactants include quaternary ammonium salt sulfonates, and betaine-type ampholytic surfactants. Such ampholytic surfactants have both the positive and negative charged groups in the same molecule. Nonionic surfactants generally comprise polyoxyalkylene ethers, as well as higher fatty acid alkanolamides or alkylene oxide adduct thereof, and fatty acid glycerine monoesters. Mixtures of surfactants can also be employed in manners known in the art.
Treating paper
[00476] The invention provides methods of treating paper and paper pulp using one or more polypeptides of the invention. The polypeptides of the invention can be used in any paper- or pulp-treating method, which are well known in the art, see, e.g., U.S. Patent
No. 6,241,849; 6,066,233; 5,582,681. For example, in one aspect, the invention provides a method for deinking and decolorizing a printed paper containing a dye, comprising pulping a printed paper to obtain a pulp slurry, and dislodging an ink from the pulp slurry in the presence of a cellulase of the invention (other enzymes, e.g., amylases, can also be added).
Other steps can include decolorizing the dye contained in the pulp slurry with one or more laccases in the presence of oxygen and one or more chemical mediators and separating the released ink from the pulp slurry, then recovering the decolorized pulp.
[00477] In another aspect, the invention provides a method for enhancing the freeness of pulp, e.g., pulp made from secondary fiber, by adding an enzymatic mixture comprising a cellulase of the invention (can also include other enzymes, e.g., pectinase enzymes) to the pulp and treating under conditions to cause a reaction to produce an enzymatically treated pulp. The freeness of the enzymatically treated pulp is increased from the initial freeness of the secondary fiber pulp without a loss in brightness.
Other industrial applications [00478] The enzymes of the invention can be used in a variety of other industrial applications, e.g., in waste treatment. For example, in one aspect, the invention provides a solid waste digestion process using cellulases of the invention. The methods can comprise reducing the mass and volume of substantially untreated solid waste having cellulose as its major component. Solid waste can be treated with an enzymatic digestive process in the presence of an enzymatic solution (including an enzyme of the invention) at a controlled temperature. This results in a reaction without appreciable bacterial fermentation from added microorganisms. The solid waste is converted into a liquefied waste and any residual solid waste. The resulting liquefied waste can be separated from said any residual solidified waste. See e.g., U.S. Patent No. 5,709,796.
[00479] The invention will be further described with reference to the following examples; however, it is to be understood that the invention is not limited to such examples.
EXAMPLES
[00480] The following examples are intended to illustrate, but not to limit, the invention. While the procedures described in the examples are typical of those that can be used to carry out certain aspects of the invention, other procedures known to those skilled in the art can also be used.
EXAMPLE 1 : Bacterial Expression and Purification of CMCase
[00481] A T. maritima genomic library was constructed in the Lambda ZapII® cloning vector (Stratagene Cloning Systems), and mass excision was performed according to the manufacturers protocol to yield a gene library in the pBluescript cloning vector. The pBluescript library was screened in SOLR E. Coli cells (Stratagene) for CMCase activity and a positive clone was identified and isolated. This clone was used to inoculate an overnight culture of Luria Broth liquid medium as per Ausubel, F. M., et al., Short
Protocols in Molecular Biology. 2d Ed., Harvard Medical School (1992). The plasmid
DNA was isolated from the overnight culture using an alkaline lysis mini-prep protocol as per Maniatis, T., et al., Molecular Cloning, Cold Spring Harbor Press, New York (1982).
Mini-prep DNA was then used to transform competent E. coli cells, XL1 blue (Stratagene) according to the manufacturer's protocol. A single clone was then used to inoculate a 100 ml overnight culture of Luria Broth liquid medium and plasmid DNA was isolated from this overnight using midi-prep procedure according to the manufacturer's protocol
(Qiagen). The midi-prep plasmid DNA was partially sequenced with an ABI 377 and a putative open reading frame was identified within the sequenced region. The sequence information was used in the generation of primer sequences which were subsequently used to PCR amplify the target gene encoding the CMCase activity. The primer sequences used were as follows:
5' TTATTGCGGCCGCTTAAGGAGGAAAAATTATGGGTGTTGATCCTTTTGAA 3'
(SEQ. ID NO: 3) and 5' TTATTGGATCCGAAGGTTGAAACCACGCCATCT 3' (SEQ.
ID NO: 4).
[00482] The amplification product was subcloned into the pBluescript II cloning vector (Stratagene). The plasmid clone was transformed in to XL1 Blue cells again for verification. The plasmid clone contains the DNA encoding the CMCase enzyme of the present invention as shown in FIG. 1 and deposited as ATCC No. 97245.
[00483] A pBluescript II clone containing the DNA encoding the enzyme of the present invention may be obtained from the ATCC, ATCC Deposit No.97245. This pBluescript II clone containing the DNA of the present invention is used to transform E. coli XL1 Blue cells and the E. coli XL1 Blue cells are used to inoculate a 5 ml overnight culture of Luria Broth liquid medium. The 5 ml culture was aliquotted into 1 ml aliquots, and each aliquot was used to inoculate 1 liter of 5X LB culture media. Cells were grown overnight in five 2-liter shake flasks at 37° C. Each one liter cell culture pellet was resuspended in 150 ml of 25 mM Tris, pH 8.0 and then spun at 4K φm for 10 minutes at
4°C. The resulting pellet was resuspended in 5 ml of 25 mM Tris, pH 8.0, and sonicated with a microsonicator tip 10 times at 30 second intervals. The cell debris was spun out in a
SS-34 rotor at 12K φms for 10 minutes at 4° C. The resulting supernatant was then brought up to 10%) ethanol and incubated at 75° C. for 20 minutes. The flocculated proteins were spun out in an SS-34 rotor at 10K rpms for 10 minutes at 4° C. The resultant supernatant was then filtered through a 0.22 micron filter and applied to a weak anion exchange column
(Poros, PI). The column was eluted with a 250, 500, 800 mM NaCl step in a 10 mM Tris
Base/10 mM Bis Tris Propane buffer at pH 8.0 (anion buffer). The active CMCase fraction came off at the 250 mM step. This fraction was then diluted with the anion buffer to a concentration of 50 mM. It was then applied to a strong anion exchange column (Poros,
HQ) and the column was eluted with a 10 column volume gradient from 50 to 250 mM
NaCl using anion buffer. A one band fraction of a 35 kD cellulose comes off in this gradient at approximately 150 mM NaCl.
[00484] Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described. On Aug. 29,1995, a deposit of biologically samples identified above were made with the American Type Culture Collection (ATCC), having an address at 10801 University Boulevard, Manassas, Va. 20110-2209, U.S.A. The deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Puφose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of viable cultures for a period of thirty (30) years from the date of deposit and at least five (5) years after the most recent request for the furnishing of a sample of the deposit by the depository. The organisms will be made available by the ATCC under the terms of the Budapest Treaty, which assures permanent and unrestricted availability of the cultures to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC §122 and the Commissioner's rules pursuant thereto (including 37 CFR §1.12).
[00485] These deposits are provided merely as convenience to those of skill in the art, and are not an admission that a deposit is required under 35 USC §112. A license may be required to make, use, or sell the deposited materials, and no such license is hereby granted.
[00486] A number of aspects of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention.

Claims

WHAT IS CLAIMED IS:
1. An isolated or recombinant nucleic acid comprising a nucleic acid sequence at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the nucleic acids encode at least one polypeptide having a cellulase activity and the sequence identities are determined by analysis with a sequence comparison algorithm or by a visual inspection.
2. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 50% sequence identity to SEQ ID NO:l over a region of at least about 200 residues.
3. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 50% sequence identity to SEQ ID NO:l over a region of at least about 300 residues.
4. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 50%> sequence identity to SEQ ID NO:l over a region of at least about 400 residues.
5. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 50% sequence identity to SEQ ID NO: 1 over a region of at least about 500 residues.
6. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 50% sequence identity to SEQ ED NO:l over a region of at least about 600 residues.
7. The isolated or recombinant nucleic acid of claim 1 , wherein the nucleic acid sequence has at least 50% sequence identity to SEQ ED NO: 1 over a region of at least about 700 residues.
8. The isolated or recombinant nucleic acid of claim 1 , wherein the nucleic acid sequence has at least 50%o sequence identity to SEQ ED NO:l over a region of at least about 800 residues.
9. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 50% sequence identity to SEQ ID NO:l over a region of at least about 900 residues.
10. The isolated or recombinant nucleic acid of claim 1, wherein the nucleic acid sequence has at least 60%) sequence identity to SEQ ID NO:l over a region of at least about 100 residues.
11. The isolated or recombinant nucleic acid of claim 10, wherein the nucleic acid sequence has at least 70% sequence identity to SEQ ED NO:l over a region of at least about 100 residues.
12. The isolated or recombinant nucleic acid of claim 11 , wherein the nucleic acid sequence has at least 80% sequence identity to SEQ ED NO:l over a region of at least about 100 residues.
13. The isolated or recombinant nucleic acid of claim 12, wherein the nucleic acid sequence has at least 85%> sequence identity to SEQ ED NO:l over a region of at least about 100 residues.
14. The isolated or recombinant nucleic acid of claim 13, wherein the nucleic acid sequence has at least 90%o sequence identity to SEQ ED NO:l over a region of at least about 100 residues.
15. The isolated or recombinant nucleic acid of claim 14, wherein the nucleic acid sequence has at least 95%> sequence identity to SEQ ED NO:l over a region of at least about 100 residues.
16. The isolated or recombinant nucleic acid of claim 15, wherein the nucleic acid sequence has a sequence as set forth in SEQ ED NO:l.
17. The isolated or recombinant nucleic acid of claim 1 , wherein the nucleic acid sequence encodes a polypeptide having a sequence as set forth in SEQ ED NO:2.
18. The isolated or recombinant nucleic acid of claim 1 , wherein the sequence comparison algorithm is a BLAST version 2.2.2 algorithm where a filtering setting is set to blastall -p blastp -d "nr pataa" -F F, and all other options are set to default.
19. The isolated or recombinant nucleic acid of claim 1 , wherein the cellulase activity comprises a carboxymethyl cellulase activity.
20. The isolated or recombinant nucleic acid of claim 1 , wherein the cellulase activity comprises hydrolyzing a glycosidic linkage.
21. The isolated or recombinant nucleic acid of claim 20, wherein the glycosidic linkage is a (beta 1, 4)glycosidic bond.
22. The isolated or recombinant nucleic acid of claim 1, wherein the cellulase activity comprises hydrolysis of a cellulose.
23. The isolated or recombinant nucleic acid of claim 22, wherein the cellulase activity comprises hydrolysis of a cellulose to a glucopyranose.
24. The isolated or recombinant nucleic acid of claim 1 , wherein the cellulase activity is thermostable.
25. The isolated or recombinant nucleic acid of claim 24, wherein the polypeptide retains a cellulase activity under conditions comprising a temperature range of between about 37°C to about 70°C.
26. The isolated or recombinant nucleic acid of claim 1, wherein the cellulase activity is thermotolerant.
27. The isolated or recombinant nucleic acid of claim 24, wherein the polypeptide retains a cellulase activity after exposure to a temperature in the range from greater than 37°C to about 90°C.
28. The isolated or recombinant nucleic acid of claim 27, wherein the polypeptide retains a cellulase activity after exposure to a temperature in the range from greater than 37°C to about 50°C.
29. An isolated or recombinant nucleic acid, wherein the nucleic acid comprises a sequence that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO:l, wherein the nucleic acid encodes a polypeptide having a cellulase activity.
30. The isolated or recombinant nucleic acid of claim 29, wherein the nucleic acid is at least about 100 residues in length.
31. The isolated or recombinant nucleic acid of claim 30, wherein the nucleic acid is at least about 200 residues in length.
32. The isolated or recombinant nucleic acid of claim 31, wherein the nucleic acid is at least about 300 residues in length.
33. The isolated or recombinant nucleic acid of claim 32, wherein the nucleic acid is at least about 400 residues in length.
34. The isolated or recombinant nucleic acid of claim 33, wherein the nucleic acid is at least about 500 residues in length.
35. The isolated or recombinant nucleic acid of claim 29, wherein the stringent conditions include a wash step comprising a wash in 0.2X SSC at a temperature of about 65oC for about 15 minutes.
36. A nucleic acid probe for identifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the probe comprises at least 10 consecutive bases of a sequence selected from a group consisting of a sequence as set forth in SEQ ED NO: 1, wherein the probe identifies the nucleic acid by binding or hybridization.
37. The nucleic acid probe of claim 36, wherein the probe comprises an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a sequence as set forth in SEQ ID NO:l.
38. A nucleic acid probe for identifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the probe comprises a nucleic acid sequence having at least 50%> sequence identity to SEQ ID NO: 1 over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection.
39. The nucleic acid probe of claim 38, wherein the probe comprises an oligonucleotide comprising at least about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 consecutive bases of a nucleic acid sequence as set forth in SEQ ID NO:l.
40. The nucleic acid probe of claim 38, wherein the probe comprises a nucleic acid sequence having at least 95% sequence identity to a region of at least about 100 residues of a nucleic acid sequence as set forth in SEQ ED NO:l.
41. The nucleic acid probe of claim 38, wherein the probe comprises a subset of a sequence as set forth in SEQ ID NO: 1.
42. An amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the primer pair is capable of amplifying a nucleic acid sequence as set forth in SEQ ID NO:l.
43. The nucleic acid probe of claim 42, wherein each member of the amplification primer sequence pair comprises an oligonucleotide comprising at least about 10 to 50 consecutive bases of the sequence.
44. A method of amplifying a nucleic acid encoding a polypeptide with a cellulase activity comprising amplification of a template nucleic acid with an amplification primer sequence pair capable of amplifying a nucleic acid sequence as set forth in SEQ ID NO: 1.
45. An expression cassette comprising a nucleic acid comprising a nucleic acid sequence at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO: 1, or a subsequence thereof.
46. A vector comprising a nucleic acid comprising a nucleic acid sequence at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO: 1, or a subsequence thereof.
47. A cloning vehicle comprising a vector as set forth in claim 46, wherein the cloning vehicle comprises a viral vector, a plasmid, a phage, a phagemid, a cosmid, a fosmid, a bacteriophage or an artificial chromosome.
48. The cloning vehicle of claim 47, wherein the viral vector comprises an adenovirus vector, a retroviral vectors or an adeno-associated viral vector.
49. The cloning vehicle of claim 47, comprising a bacterial artificial chromosome (BAC), a plasmid, a bacteriophage PI -derived vector (PAC), a yeast artificial chromosome (YAC), a mammalian artificial chromosome (MAC).
50. A transformed cell comprising a vector, wherein the vector comprises a nucleic acid sequence at least 50% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
51. A transformed cell comprising a nucleic acid sequence having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
52. The transformed cell of claim 51 , wherein the cell is a bacterial cell, a mammalian cell , a fungal cell, a yeast cell, an insect cell or a plant cell.
53. A transgenic non-human animal comprising a nucleic acid sequence at least 50%> sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
54. The transgenic non-human animal of claim 53, wherein the animal is a mouse.
55. A transgenic plant comprising a nucleic acid sequence at least 50%> sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
56. The transgenic non-human plant of claim 55, wherein the plant is a corn plant, a potato plant, a tomato plant, a wheat plant, an oilseed plant, a rapeseed plant, a soybean plant or a tobacco plant.
57. A transgenic seed comprising a nucleic acid sequence at least 98%> sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
58. The transgenic seed of claim 57, wherein the seed is a corn seed, a wheat kernel, an oilseed, a rapeseed, a soybean seed, a palm kernel, a sunflower seed, a sesame seed, a peanut or a tobacco plant seed.
59. An antisense oligonucleotide comprising a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence at least 50%> sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
60. The antisense oligonucleotide of claim 59, wherein the antisense oligonucleotide is between about 10 to 50, about 20 to 60, about 30 to 70, about 40 to 80, or about 60 to 100 bases in length.
61. A method of inhibiting the translation of a cellulase message in a cell comprising administering to the cell or expressing in the cell an antisense oligonucleotide comprising a nucleic acid sequence complementary to or capable of hybridizing under stringent conditions to a nucleic acid sequence at least 98% sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ID NO:l, or a subsequence thereof.
62. An isolated or recombinant polypeptide comprising an amino acid sequence having at least 50%> sequence identity to SEQ ID NO:2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50% sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ID NO:l.
63. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide comprises a cellulase activity.
64. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity comprises a carboxymethyl cellulase activity.
65. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity comprises hydrolyzing a glycosidic linkage.
66. The isolated or recombinant polypeptide of claim 65, wherein the glycosidic linkage is a (beta 1, 4)glycosidic bond.
67. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity comprises hydrolysis of a starch.
68. The isolated or recombinant polypeptide of claim 67, wherein the cellulase activity comprises hydrolysis of a starch to glucopyranose.
69. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity is thermostable.
70. The isolated or recombinant nucleic acid of claim 69, wherein the polypeptide retains a cellulase activity under conditions comprising a temperature range of between about 37°C to about 70°C.
71. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity is thermotolerant.
72. The isolated or recombinant nucleic acid of claim 71, wherein the polypeptide retains a cellulase activity after exposure to a temperature in the range from greater than 37°C to about 90°C.
73. The isolated or recombinant nucleic acid of claim 72, wherein the polypeptide retains a cellulase activity after exposure to a temperature in the range from greater than 37°C to about 50°C.
74. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50%> sequence identity to SEQ ID NO:2 over a region of at least about 200 residues.
75. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50% sequence identity to SEQ ID NO:2 over a region of at least about 300 residues.
76. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50%> sequence identity to SEQ ID NO:2 over a region of at least about 400 residues.
77. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50%> sequence identity to SEQ ID NO:2 over a region of at least about 500 residues.
78. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50%> sequence identity to SEQ ID NO:2 over a region of at least about 600 residues.
79. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50% sequence identity to SEQ ID NO:2 over a region of at least about 700 residues.
80. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50%> sequence identity to SEQ ED NO:2 over a region of at least about 800 residues.
81. The isolated or recombinant polypeptide of claim 62, wherein the polypeptide sequence has at least 50%> sequence identity to SEQ ID NO:2 over a region of at least about 900 residues.
82. The isolated or recombinant polypeptide of claim 62, wherein the amino acid sequence has at least 60%> sequence identity to SEQ ID NO:2 over a region of at least about 100 residues.
83. The isolated or recombinant polypeptide of claim 82, wherein the amino acid sequence has at least 70%> sequence identity to SEQ ID NO:2 over a region of at least about 100 residues.
84. The isolated or recombinant polypeptide of claim 83, wherein the amino acid sequence has at least 80% sequence identity to SEQ ID NO:2 over a region of at least about 100 residues.
85. The isolated or recombinant polypeptide of claim 84, wherein the amino acid sequence has at least 90% sequence identity to SEQ ID NO:2 over a region of at least about 100 residues.
86. The isolated or recombinant polypeptide of claim 85, wherein the amino acid sequence has at least 95% sequence identity to SEQ ID NO:2 over a region of at least about 100 residues.
87. The isolated or recombinant polypeptide of claim 86, wherein the amino acid sequence has at least 95% sequence identity to SEQ ID NO:2.
88. The isolated or recombinant polypeptide of claim 87, wherein the amino acid sequence has a sequence as set forth in SEQ ID NO:2.
89. An isolated or recombinant polypeptide, wherein the polypeptide has a cellulase activity and lacks a signal sequence and comprises an amino acid sequence having at least 50%> sequence identity to SEQ ID NO: 2 over a region of at least about 100 residues, or, a polypeptide encoded by a nucleic acid comprising a sequence: (i) having at least 50%) sequence identity to SEQ ID NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, (ii) that hybridizes under stringent conditions to a nucleic acid as set forth in SEQ ED NO: 1.
90. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity comprises a thermostability when heated to a temperature in the range from about 37°C to about 50°C, about 50°C to about 70°C or about 70°C to about 90°C.
91. The isolated or recombinant polypeptide of claim 63 , wherein the thermostable cellulase activity comprises a specific activity at about 37°C in the range from about 100 to about 1000 units per milligram of protein.
92. The isolated or recombinant polypeptide of claim 63, wherein the thermostable cellulase activity comprises a specific activity from about 500 to about 750 units per milligram of protein.
93. The isolated or recombinant polypeptide of claim 63, wherein the thermostable cellulase activity comprises a specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein.
94. The isolated or recombinant polypeptide of claim 93, wherein the thermostable cellulase activity comprises a specific activity at 37°C in the range from about 750 to about 1000 units per milligram of protein.
95. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity is thermotolerance after being heated to an elevated temperature in the range from about 37°C to about 90°C.
96. The isolated or recombinant polypeptide of claim 63, wherein the cellulase activity is thermotolerance after being heated to a temperature in the range from about 37°C to about 70°C.
97. The isolated or recombinant polypeptide of claim 63, wherein the thermotolerance comprises retention of at least half of the specific activity of the cellulase at 37°C after being heated to the elevated temperature.
98. The isolated or recombinant polypeptide of claim 63, wherein the thermotolerance comprises retention of specific activity at 37°C in the range from about 500 to about 1200 units per milligram of protein after being heated to the elevated temperature.
99. The isolated or recombinant polypeptide of claim 62, wherein the cellulase comprises at least one glycosylation site.
100. The isolated or recombinant polypeptide of claim 99, wherein glycosylation is an N-linked glycosylation.
101. The isolated or recombinant polypeptide of claim 99, wherein cellulase is glycosylated after being expressed in a P. pastoris or a S. pombe.
102. The isolated or recombinant polypeptide of claim 63, wherein the polypeptide retains a cellulase activity under conditions comprising about pH 5.
103. The isolated or recombinant polypeptide of claim 63, wherein the polypeptide retains a cellulase activity under conditions comprising about pH 4.5.
104. The isolated or recombinant polypeptide of claim 63, wherein the polypeptide retains a cellulase activity under conditions comprising about pH 9.0.
105. A protein preparation comprising a polypeptide as set forth in claim 62, wherein the protein preparation comprises a liquid, a solid or a gel.
106. A heterodimer comprising a polypeptide as set forth in claim 62 and a second domain.
107. The heterodimer of claim 106, wherein the second domain is a polypeptide and the heterodimer is a fusion protein.
108. The heterodimer of claim 106, wherein the second domain is an epitope.
109. The heterodimer of claim 106, wherein the second domain is a tag.
110. An immobilized polypeptide having a cellulase activity, wherein the polypeptide comprises a sequence as set forth in claim 62 or claim 106.
111. The immobilized polypeptide of claim 110, wherein the cellulase is immobilized on a cell, a metal, a resin, a polymer, a ceramic, a glass, a microelectrode, a graphitic particle, a bead, a gel, a plate, an array or a capillary tube.
112. An array comprising an immobilized polypeptide as set forth in claim 61 or claim 106.
113. An array comprising an immobilized nucleic acid as set forth in claim 1 or claim 29.
114. An isolated or recombinant antibody that specifically binds to a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29.
115. The isolated or recombinant antibody of claim 114, wherein the antibody is a monoclonal or a polyclonal antibody.
116. A hybridoma comprising an antibody that specifically binds to a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29.
117. A food supplement for an animal comprising a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29.
118. The food supplement of claim 117, wherein the polypeptide is glycosylated.
119. An edible enzyme delivery matrix comprising a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29, wherein the polypeptide comprises a cellulase activity.
120. The edible enzyme delivery matrix of claim 119, wherein the delivery matrix comprises a pellet.
121. The edible enzyme delivery matrix of claim 119, wherein the polypeptide is glycosylated.
122. The edible enzyme delivery matrix of claim 119, wherein the cellulase activity is thermotolerant.
123. The edible enzyme delivery matrix of claim 90, wherein the cellulase activity is thermostable.
124. A cellulose composition comprising a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29, wherein the polypeptide comprises a cellulase activity.
125. A detergent composition comprising a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29, wherein the polypeptide comprises a cellulase activity.
126. The detergent composition of claim 125, wherein the cellulase is a nonsurface-active cellulase.
127. The detergent composition of claim 125, wherein the cellulase is a surface-active cellulase.
128. A cellulose-containing fabric comprising a polypeptide as set forth in claim 62 or to a polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29, wherein the polypeptide comprises a cellulase activity.
129. A method of isolating or identifying a polypeptide with cellulase activity comprising the steps of:
(a) providing an antibody as set forth in claim 114;
(b) providing a sample comprising polypeptides; and
(c) contacting the sample of step (b) with the antibody of step (a) under conditions wherein the antibody can specifically bind to the polypeptide, thereby isolating or identifying a cellulase.
130. A method of making an anti-cellulase antibody comprising administering to a non-human animal a nucleic acid as set forth in claim 1 or claim 29, or a polypeptide as set forth in claim 62, in an amount sufficient to generate a humoral immune response, thereby making an anti-cellulase antibody.
131. A method of producing a recombinant polypeptide comprising the steps of:
(a) providing a nucleic acid operably linked to a promoter; wherein the nucleic acid comprises a sequence as set forth in claim 1 or claim 29; and
(b) expressing the nucleic acid of step (a) under conditions that allow expression of the polypeptide, thereby producing a recombinant polypeptide.
132. The method of claim 131, further comprising transforming a host cell with the nucleic acid of step (a) followed by expressing the nucleic acid of step (a), thereby producing a recombinant polypeptide in a transformed cell.
133. A method for identifying a polypeptide having a cellulase activity comprising the following steps:
(a) providing a polypeptide as set forth in claim 62 or a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 29;
(b) providing a cellulase substrate; and
(c) contacting the polypeptide or a fragment or variant thereof of step (a) with the substrate of step (b) and detecting an decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product detects a polypeptide having a cellulase activity.
134. The method of claim 133, wherein the substrate is a cellulose.
135. A method for identifying a cellulase substrate comprising the following steps:
(a) providing a polypeptide as set forth in claim 62 or a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 29;
(b) providing a test substrate; and
(c) contacting the polypeptide of step (a) with the test substrate of step (b) and detecting an decrease in the amount of substrate or an increase in the amount of reaction product, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product identifies the test substrate as a cellulase substrate.
136. A method of determining whether a compound specifically binds to a polypeptide comprising the following steps:
(a) expressing a nucleic acid or a vector comprising the nucleic acid under conditions permissive for translation of the nucleic acid to a polypeptide, wherein the nucleic acid has a sequence as set forth in claim 1 or claim 29, or, providing a polypeptide as set forth in claim 62;
(b) contacting the polypeptide with the test compound; and
(c) determining whether the test compound specifically binds to the polypeptide, thereby determining that the compound specifically binds to the polypeptide.
137. A method for identifying a modulator of a cellulase activity comprising the following steps:
(a) providing a cellulase polypeptide as set forth in claim 62 or a cellulase polypeptide encoded by a nucleic acid as set forth in claim 1 or claim 29;
(b) providing a test compound; (c) contacting the polypeptide of step (a) with the test compound of step (b) and measuring an activity of the cellulase, wherein a change in the cellulase activity measured in the presence of the test compound compared to the activity in the absence of the test compound provides a determination that the test compound modulates the cellulase activity.
138. The method of claim 138, wherein the cellulase activity is measured by providing a cellulase substrate and detecting a decrease in the amount of the substrate or an increase in the amount of a reaction product, or, an increase in the amount of the substrate or a decrease in the amount of a reaction product.
139. The method of claim 138, wherein a decrease in the amount of the substrate or an increase in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an activator of cellulase activity.
140. The method of claim 138, wherein an increase in the amount of the substrate or a decrease in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an inhibitor of cellulase activity.
141. A computer system comprising a processor and a data storage device wherein said data storage device has stored thereon a polypeptide sequence or a nucleic acid sequence, wherein the polypeptide sequence comprises sequence as set forth in claim 62, or subsequence thereof, and the nucleic acid comprises a sequence as set forth in claim 1 or claim 29, or subsequence thereof.
142. The computer system of claim 141, further comprising a sequence comparison algorithm and a data storage device having at least one reference sequence stored thereon.
143. The computer system of claim 142, wherein the sequence comparison algorithm comprises a computer program that indicates polymoφhisms.
144. The computer system of claim 141, further comprising an identifier that identifies one or more features in said sequence.
145. A computer readable medium having stored thereon a polypeptide sequence or a nucleic acid sequence, wherein the polypeptide sequence comprises sequence as set forth in claim 62, or subsequence thereof, and the nucleic acid comprises a sequence as set forth in claim 1 or claim 29, or subsequence thereof.
146. A method for identifying a feature in a sequence comprising the steps of:
(a) reading the sequence using a computer program which identifies one or more features in a sequence, wherein the sequence comprises a polypeptide sequence or a nucleic acid sequence, wherein the polypeptide sequence comprises sequence as set forth in claim 62 or subsequence thereof, and the nucleic acid comprises a sequence as set forth in claim 1 or claim 29 or subsequence thereof; and
(b) identifying one or more features in the sequence with the computer program.
147. A method for comparing a first sequence to a second sequence comprising the steps of:
(a) reading the first sequence and the second sequence through use of a computer program which compares sequences, wherein the first sequence comprises a polypeptide sequence or a nucleic acid sequence, wherein the polypeptide sequence comprises sequence as set forth in claim 62, or subsequence thereof, and the nucleic acid comprises a sequence as set forth in claim 1 or claim 29 or subsequence thereof; and
(b) determining differences between the first sequence and the second sequence with the computer program.
148. The method of claim 147, wherein the step of determining differences between the first sequence and the second sequence further comprises the step of identifying polymoφhisms.
149. The method of claim 147, further comprising an identifier that identifies one or more features in a sequence.
150. The method of claim 147, comprising reading the first sequence using a computer program and identifying one or more features in the sequence.
151. A method for isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample comprising the steps of:
(a) providing an amplification primer sequence pair for amplifying a nucleic acid encoding a polypeptide with a cellulase activity, wherein the primer pair is capable of amplifying SEQ ID NO:l, or a subsequence thereof;
(b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to the amplification primer pair; and, (c) combining the nucleic acid of step (b) with the amplification primer pair of step (a) and amplifying nucleic acid from the environmental sample, thereby isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample.
152. The method of claim 151, wherein each member of the amplification primer sequence pair comprises an oligonucleotide comprising at least about 10 to 50 consecutive bases of a sequence as set forth in SEQ ID NO:l.
153. A method for isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from an environmental sample comprising the steps of:
(a) providing a polynucleotide probe comprising a sequence as set forth in claim 1 or claim 29, or a subsequence thereof;
(b) isolating a nucleic acid from the environmental sample or treating the environmental sample such that nucleic acid in the sample is accessible for hybridization to a polynucleotide probe of step (a);
(c) combining the isolated nucleic acid or the treated environmental sample of step (b) with the polynucleotide probe of step (a); and
(d) isolating a nucleic acid that specifically hybridizes with the polynucleotide probe of step (a), thereby isolating or recovering a nucleic acid encoding a polypeptide with a cellulase activity from a soil sample.
154. The method of claim 151 or claim 153, wherein the environmental sample comprises a water sample, a liquid sample, a soil sample, an air sample or a biological sample.
155. The method of claim 154, wherein the biological sample is derived from a bacterial cell, a protozoan cell, an insect cell, a yeast cell, a plant cell, a fungal cell or a mammalian cell.
156. A method of generating a variant of a nucleic acid encoding a cellulase comprising the steps of:
(a) providing a template nucleic acid comprising a sequence as set forth in claim 1 or claim 29; and
(b) modifying, deleting or adding one or more nucleotides in the template sequence, or a combination thereof, to generate a variant of the template nucleic acid.
157. The method of claim 156, further comprising expressing the variant nucleic acid to generate a variant cellulase polypeptide.
158. The method of claim 156, wherein the modifications, additions or deletions are introduced by a method selected from the group consisting of error-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR) and a combination thereof.
159. The method of claim 156, wherein the modifications, additions or deletions are introduced by a method selected from the group consisting of recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil- containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction- purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation and a combination thereof.
160. The method of claim 156, wherein the modifications, additions or deletions are introduced by error-prone PCR.
161. The method of claim 156, wherein the modifications, additions or deletions are introduced by shuffling.
162. The method of claim 156, wherein the modifications, additions or deletions are introduced by oligonucleotide-directed mutagenesis.
163. The method of claim 156, wherein the modifications, additions or deletions are introduced by assembly PCR.
164. The method of claim 156, wherein the modifications, additions or deletions are introduced by sexual PCR mutagenesis.
165. The method of claim 156, wherein the modifications, additions or deletions are introduced by in vivo mutagenesis.
166. The method of claim 156, wherein the modifications, additions or deletions are introduced by cassette mutagenesis.
167. The method of claim 156, wherein the modifications, additions or deletions are introduced by recursive ensemble mutagenesis.
168. The method of claim 156, wherein the modifications, additions or deletions are introduced by exponential ensemble mutagenesis.
169. The method of claim 156, wherein the modifications, additions or deletions are introduced by site-specific mutagenesis.
170. The method of claim 156, wherein the modifications, additions or deletions are introduced by gene reassembly.
171. The method of claim 156, wherein the modifications, additions or deletions are introduced by synthetic ligation reassembly (SLR).
172. The method of claim 156, wherein the modifications, additions or deletions are introduced by gene site saturated mutagenesis (GSSM).
173. The method of claim 156, wherein method is iteratively repeated until a cellulase having an altered or different activity or an altered or different stability from that of a cellulase encoded by the template nucleic acid is produced.
174. The method of claim 173, wherein the variant cellulase polypeptide is thermotolerant, wherein the cellulase retains some activity after being exposed to an elevated temperature.
175. The method of claim 173, wherein the variant cellulase polypeptide has increased glycosylation as compared to the cellulase encoded by a template nucleic acid.
176. The method of claim 173, wherein the variant cellulase polypeptide has a cellulase activity under a high temperature, wherein the cellulase encoded by the template nucleic acid is not active under the high temperature.
177. The method of claim 156, wherein method is iteratively repeated until a cellulase coding sequence having an altered codon usage from that of the template nucleic acid is produced.
178. The method of claim 156, wherein method is iteratively repeated until a cellulase gene having higher or lower level of message expression or stability from that of the template nucleic acid is produced.
179. A method for modifying codons in a nucleic acid encoding a cellulase to increase its expression in a host cell, the method comprising
(a) providing a nucleic acid encoding a cellulase comprising a sequence as set forth in claim 1 or claim 29; and,
(b) identifying a non-preferred or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to increase its expression in a host cell.
180. A method for modifying codons in a nucleic acid encoding a cellulase, the method comprising
(a) providing a nucleic acid encoding a cellulase comprising a sequence as set forth in claim 1 or claim 29; and,
(b) identifying a codon in the nucleic acid of step (a) and replacing it with a different codon encoding the same amino acid as the replaced codon, thereby modifying codons in a nucleic acid encoding a cellulase.
181. A method for modifying codons in a nucleic acid encoding a cellulase to increase its expression in a host cell, the method comprising
(a) providing a nucleic acid encoding a cellulase comprising a sequence as set forth in claim 1 or claim 29; and,
(b) identifying a non-preferred or a less preferred codon in the nucleic acid of step (a) and replacing it with a preferred or neutrally used codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in the host cell and a non-preferred or less preferred codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to increase its expression in a host cell.
182. A method for modifying a codon in a nucleic acid encoding a cellulase to decrease its expression in a host cell, the method comprising
(a) providing a nucleic acid encoding a cellulase comprising a sequence as set forth in claim 1 or claim 29; and
(b) identifying at least one preferred codon in the nucleic acid of step (a) and replacing it with a non-preferred or less prefeπed codon encoding the same amino acid as the replaced codon, wherein a preferred codon is a codon over-represented in coding sequences in genes in a host cell and a non-preferred or less prefeπed codon is a codon under-represented in coding sequences in genes in the host cell, thereby modifying the nucleic acid to decrease its expression in a host cell.
183. The method of claim 181 or 182, wherein the host cell is a bacterial cell, a fungal cell, an insect cell, a yeast cell, a plant cell or a mammalian cell.
184. A method for producing a library of nucleic acids encoding a plurality of modified cellulase active sites or substrate binding sites, wherein the modified active sites or substrate binding sites are derived from a first nucleic acid comprising a sequence encoding a first active site or a first substrate binding site the method comprising:
(a) providing a first nucleic acid encoding a first active site or first substrate binding site, wherein the first nucleic acid sequence comprises a sequence that hybridizes under stringent conditions to a sequence as set forth in SEQ ED NO:l, and the nucleic acid encodes a cellulase active site or a cellulase substrate binding site;
(b) providing a set of mutagenic oligonucleotides that encode naturally- occurring amino acid variants at a plurality of targeted codons in the first nucleic acid; and,
(c) using the set of mutagenic oligonucleotides to generate a set of active site-encoding or substrate binding site-encoding variant nucleic acids encoding a range of amino acid variations at each amino acid codon that was mutagenized, thereby producing a library of nucleic acids encoding a plurality of modified cellulase active sites or substrate binding sites.
185. The method of claim 184, comprising mutagenizing the first nucleic acid of step (a) by a method comprising an optimized directed evolution system.
186. The method of claim 184, comprising mutagenizing the first nucleic acid of step (a) by a method comprising gene site-saturation mutagenesis (GSSM).
187. The method of claim 184, comprising mutagenizing the first nucleic acid of step (a) by a method comprising a synthetic ligation reassembly (SLR).
188. The method of claim 184, further comprising mutagenizing the first nucleic acid of step (a) or variants by a method comprising eπor-prone PCR, shuffling, oligonucleotide-directed mutagenesis, assembly PCR, sexual PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive ensemble mutagenesis, exponential ensemble mutagenesis, site-specific mutagenesis, gene reassembly, gene site saturated mutagenesis (GSSM), synthetic ligation reassembly (SLR) and a combination thereof.
189. The method of claim 184, further comprising mutagenizing the first nucleic acid of step (a) or variants by a method comprising recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, gapped duplex mutagenesis, point mismatch repair mutagenesis, repair-deficient host strain mutagenesis, chemical mutagenesis, radiogenic mutagenesis, deletion mutagenesis, restriction-selection mutagenesis, restriction-purification mutagenesis, artificial gene synthesis, ensemble mutagenesis, chimeric nucleic acid multimer creation and a combination thereof.
190. A method making a small molecule comprising the steps of:
(a) providing a plurality of biosynthetie enzymes capable of synthesizing or modifying a small molecule, wherein one of the enzymes comprises a cellulase enzyme encoded by a nucleic acid comprising a sequence as set forth in claim 1 or claim 29;
(b) providing a substrate for at least one of the enzymes of step (a); and
(c) reacting the substrate of step (b) with the enzymes under conditions that facilitate a plurality of biocatalytic reactions to generate a small molecule by a series of biocatalytic reactions.
191. A method for modifying a small molecule comprising the steps:
(a) providing a cellulase enzyme encoded by a nucleic acid comprising a sequence as set forth in claim 1 or claim 29;
(b) providing a small molecule; and
(c) reacting the enzyme of step (a) with the small molecule of step (b) under conditions that facilitate an enzymatic reaction catalyzed by the cellulase enzyme, thereby modifying a small molecule by a cellulase enzymatic reaction.
192. The method of claim 191, comprising a plurality of small molecule substrates for the enzyme of step (a), thereby generating a library of modified small molecules produced by at least one enzymatic reaction catalyzed by the cellulase enzyme.
193. The method of claim 191, further comprising a plurality of additional enzymes under conditions that facilitate a plurality of biocatalytic reactions by the enzymes to form a library of modified small molecules produced by the plurality of enzymatic reactions.
194. The method of claim 191, further comprising the step of testing the library to determine if a particular modified small molecule which exhibits a desired activity is present within the library.
195. The method of claim 194, wherein the step of testing the library further comprises the steps of systematically eliminating all but one of the biocatalytic reactions used to produce a portion of the plurality of the modified small molecules within the library by testing the portion of the modified small molecule for the presence or absence of the particular modified small molecule with a desired activity, and identifying at least one specific biocatalytic reaction that produces the particular modified small molecule of desired activity.
196. A method for determining a functional fragment of a cellulase enzyme comprising the steps of: (a) providing a cellulase enzyme, wherein the enzyme comprises an amino acid sequence as set forth in claim 62, or, is encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 29; and
(b) deleting a plurality of amino acid residues from the sequence of step (a) and testing the remaining subsequence for a cellulase activity, thereby determining a functional fragment of a cellulase enzyme.
197. The method of claim 196, wherein the cellulase activity is measured by providing a cellulase substrate and detecting an decrease in the amount of the substrate or an increase in the amount of a reaction product.
198. The method of claim 197, wherein a decrease in the amount of an enzyme substrate or an increase in the amount of the reaction product with the test compound as compared to the amount of substrate or reaction product without the test compound identifies the test compound as an activator of cellulase activity.
199. A method for whole cell engineering of new or modified phenotypes by using real-time metabolic flux analysis, the method comprising the following steps:
(a) making a modified cell by modifying the genetic composition of a cell, wherein the genetic composition is modified by addition to the cell of a nucleic acid comprising a sequence as set forth in claim 1 or claim 29;
(b) culturing the modified cell to generate a plurality of modified cells;
(c) measuring at least one metabolic parameter of the cell by monitoring the cell culture of step (b) in real time; and,
(d) analyzing the data of step (c) to determine if the measured parameter differs from a comparable measurement in an unmodified cell under similar conditions, thereby identifying an engineered phenotype in the cell using real-time metabolic flux analysis.
200. The method of claim 199, wherein the genetic composition of the cell is modified by a method comprising deletion of a sequence or modification of a sequence in the cell, or, knocking out the expression of a gene.
201. The method of claim 199, further comprising selecting a cell comprising a newly engineered phenotype.
202. The method of claim 201 , further comprising culturing the selected cell, thereby generating a new cell strain comprising a newly engineered phenotype.
203. A method for hydrolyzing a cellulose comprising the following steps: (a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises an amino acid sequence as set forth in claim 62, or, a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 29;
(b) providing a composition comprising a cellulose; and
(c) contacting the polypeptide of step (a) with the composition of step (b) under conditions wherein the polypeptide hydrolyzes the cellulose.
204. The method of claim 203, wherein the composition comprises a cellulose-containing pulp or a paper product.
205. A method for hydrolyzing a glycosidic linkage comprising the following steps:
(a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises an amino acid sequence as set forth in claim 62, or, a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 29;
(b) providing a composition comprising a glycosidic linkage; and
(c) contacting the polypeptide of step (a) with the composition of step (b) under conditions wherein the polypeptide hydrolyzes the glycosidic linkage.
206. The method of claim 205, wherein the glycosidic linkage is a (beta 1, 4)glycosidic bond.
207. A method of increasing thermotolerance or thermostability of a cellulase polypeptide, the method comprising glycosylating a cellulase polypeptide, wherein the cellulase comprises at least thirty contiguous amino acids of a sequence as set forth in claim 62, or a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 18, or a polypeptide having a sequence as set forth in SEQ ED NO: 2, thereby increasing the thermotolerance or thermostability of the cellulase polypeptide.
208. The method of claim 207, wherein the cellulase specific activity is thermostable or thermotolerant at a temperature in the range from greater than about 37°C to about 90°C.
209. A method for overexpressing a recombinant cellulase in a cell comprising expressing a vector comprising a nucleic acid comprising a nucleic acid sequence at least 98%> sequence identity to SEQ ED NO:l over a region of at least about 100 residues, wherein the sequence identities are determined by analysis with a sequence comparison algorithm or by visual inspection, or, a nucleic acid that hybridizes under stringent conditions to a nucleic acid sequence as set forth in SEQ ED NO: 1, or a subsequence thereof, wherein overexpression is effected by use of a high activity promoter, a dicistronic vector or by gene amplification of the vector.
210. A method for treating a cellulose-containing fabric comprising the following steps:
(a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises an amino acid sequence as set forth in claim 62, or, a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 18;
(b) providing a fabric comprising a cellulase; and
(c) contacting the polypeptide of step (a) and the composition of step (b) under conditions wherein the cellulase can treat the cellulose-containing fabric .
211. A method for treating a printed paper comprising the following steps:
(a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises an amino acid sequence as set forth in claim 62, or, a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 18;
(b) providing a pulp slurry, wherein the pulp slurry is made from pulping the printed paper; and
(c) contacting the polypeptide of step (a) and the pulp slurry of step (b) under conditions wherein the cellulase can treat the printed paper.
212. A method for treating solid or liquid waste products comprising the following steps:
(a) providing a polypeptide having a cellulase activity, wherein the polypeptide comprises an amino acid sequence as set forth in claim 62, or, a polypeptide encoded by a nucleic acid having a sequence as set forth in claim 1 or claim 18;
(b) providing a solid or a liquid waste; and
(c) contacting the polypeptide of step (a) and the solid or liquid waste of step (b) under conditions wherein the cellulase can treat the waste.
PCT/US2002/018782 2001-06-12 2002-06-12 Cellulases, nucleic acids encoding them and methods for making and using them WO2002101078A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/880,729 2001-06-12
US09/880,729 US20030044956A1 (en) 1995-08-23 2001-06-12 Enzymes having carboxymethyl cellulase activity and methods of use thereof

Publications (3)

Publication Number Publication Date
WO2002101078A2 true WO2002101078A2 (en) 2002-12-19
WO2002101078A9 WO2002101078A9 (en) 2013-10-31
WO2002101078A8 WO2002101078A8 (en) 2013-11-28

Family

ID=25376953

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/018782 WO2002101078A2 (en) 2001-06-12 2002-06-12 Cellulases, nucleic acids encoding them and methods for making and using them

Country Status (3)

Country Link
US (2) US20030044956A1 (en)
AU (1) AU2002322091A1 (en)
WO (1) WO2002101078A2 (en)

Cited By (116)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010048522A1 (en) 2008-10-24 2010-04-29 C5-6 Technologies, Inc. Thermostable cellulase and methods of use
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010080407A2 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing hydrolysis of cellulosic material
WO2010080408A2 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing enzymatic hydrolysis of cellulosic material in the presence of a peroxidase
WO2010080527A1 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for determining cellulolytic enhancing activity of a polypeptide
WO2010080532A1 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing hydrolysis of cellulosic material in the presence of cellobiose dehydrogenase
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011057086A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011123450A1 (en) 2010-03-31 2011-10-06 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2012003379A1 (en) 2010-06-30 2012-01-05 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2012021394A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044915A2 (en) 2010-10-01 2012-04-05 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012058293A1 (en) 2010-10-26 2012-05-03 Novozymes North America, Inc. Methods of saccharifying sugarcane trash
WO2012061517A1 (en) 2010-11-02 2012-05-10 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
WO2012059053A1 (en) 2010-11-04 2012-05-10 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012078656A1 (en) 2010-12-06 2012-06-14 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
WO2012103350A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012134626A2 (en) 2011-01-31 2012-10-04 Novozymes North America, Inc. Processes for enzymatic refining of pretreated cellulosic material for saccharification
WO2012130120A1 (en) 2011-03-25 2012-10-04 Novozymes A/S Method for degrading or converting cellulosic material
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012149192A1 (en) 2011-04-28 2012-11-01 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012159007A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2013016115A1 (en) 2011-07-22 2013-01-31 Novozymes North America, Inc. Processes for pretreating cellulosic material and improving hydrolysis thereof
WO2013019780A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013019827A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2013028915A2 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Methods for obtaining positive transformants of a filamentous fungal host cell
WO2013028912A2 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell
WO2013039776A1 (en) 2011-09-13 2013-03-21 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013064075A1 (en) 2011-10-31 2013-05-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013074956A2 (en) 2011-11-18 2013-05-23 Novozymes, Inc. Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2013075644A1 (en) 2011-11-22 2013-05-30 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079015A1 (en) 2011-12-01 2013-06-06 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013089889A2 (en) 2011-09-30 2013-06-20 Novozymes, Inc. Chimeric polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2013091547A1 (en) 2011-12-19 2013-06-27 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2013096652A1 (en) 2011-12-21 2013-06-27 Novozymes, Inc. Methods for determining the degradation of a biomass material
WO2013096369A1 (en) 2011-12-19 2013-06-27 Novozymes A/S Processes and compositions for increasing the digestibility of cellulosic materials
WO2013096603A2 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2013160247A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2014058896A1 (en) 2012-10-08 2014-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014066141A2 (en) 2012-10-24 2014-05-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014092832A2 (en) 2012-09-19 2014-06-19 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016037096A1 (en) 2014-09-05 2016-03-10 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
WO2016120298A1 (en) 2015-01-28 2016-08-04 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016120297A1 (en) 2015-01-28 2016-08-04 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016120296A1 (en) 2015-01-28 2016-08-04 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
EP3067428A1 (en) 2015-03-12 2016-09-14 BETA RENEWABLES S.p.A. A process for producing a hydrolyzed mixture from a pre-treated ligno-cellulosic slurry comprising a slurry liquid and slurry solids
WO2016169892A1 (en) 2015-04-20 2016-10-27 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016169893A1 (en) 2015-04-20 2016-10-27 Dsm Ip Assets B.V. Whole fermentation broth
WO2016207144A1 (en) 2015-06-22 2016-12-29 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2017211957A1 (en) 2016-06-09 2017-12-14 Dsm Ip Assets B.V. Seed train for large scale enzyme production
WO2018019948A1 (en) 2016-07-29 2018-02-01 Dsm Ip Assets B.V. Polypeptides having cellulolytic enhancing activity and uses thereof
WO2018096019A1 (en) 2016-11-24 2018-05-31 Dsm Ip Assets B.V. Enzyme composition
WO2018096017A1 (en) 2016-11-24 2018-05-31 Dsm Ip Assets B.V. Enzyme composition
WO2018185071A1 (en) 2017-04-03 2018-10-11 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019072732A1 (en) 2017-10-09 2019-04-18 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019086370A1 (en) 2017-10-30 2019-05-09 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019086369A1 (en) 2017-10-30 2019-05-09 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019185681A1 (en) 2018-03-28 2019-10-03 Dsm Ip Assets B.V. Enzyme composition
WO2019185680A1 (en) 2018-03-28 2019-10-03 Dsm Ip Assets B.V. Enzyme composition
WO2019219804A1 (en) 2018-05-17 2019-11-21 Dsm Ip Assets B.V. Process for producing a polypeptide
WO2019229108A1 (en) 2018-05-30 2019-12-05 Dsm Ip Assets B.V. Process for producing sugars from carbohydrate materials
WO2020058253A1 (en) 2018-09-18 2020-03-26 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020058249A1 (en) 2018-09-18 2020-03-26 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020058248A1 (en) 2018-09-18 2020-03-26 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020083951A1 (en) 2018-10-24 2020-04-30 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020182843A1 (en) 2019-03-12 2020-09-17 Dsm Ip Assets B.V. Process for producing a fermentation broth
WO2021048164A1 (en) 2019-09-10 2021-03-18 Dsm Ip Assets B.V. Enzyme composition
WO2022013148A1 (en) 2020-07-13 2022-01-20 Dsm Ip Assets B.V. Process for the production of biogas
WO2022214458A1 (en) 2021-04-06 2022-10-13 Dsm Ip Assets B.V. Enzyme composition
WO2022214460A1 (en) 2021-04-08 2022-10-13 Dsm Ip Assets B.V. Process for the preparation of a sugar product and a fermentation product
WO2022214457A1 (en) 2021-04-06 2022-10-13 Dsm Ip Assets B.V. Enzyme composition
WO2022214459A1 (en) 2021-04-06 2022-10-13 Dsm Ip Assets B.V. Enzyme composition

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100312070B1 (en) * 1999-03-15 2001-11-03 박호군 Method of Selecting Enzyme Variants Including High Throughput Screening
US9322042B2 (en) 2009-04-24 2016-04-26 The Regents Of The University Of California Thermostable cellulases, and mutants thereof, capable of hydrolyzing cellulose in ionic liquid
US9725749B2 (en) 2011-05-02 2017-08-08 The Regents Of The University Of California Glycoside hydrolases having multiple hydrolase activities
US20190203413A1 (en) 2016-09-16 2019-07-04 Basf Se Methods of Modifying Pulp Comprising Cellulase Enzymes and Products Thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5643791A (en) 1986-08-07 1997-07-01 University Of British Columbia Characterization and structure of an endodglucanase gene of Cellulomonas fimi
US5374553A (en) 1986-08-22 1994-12-20 Hoffmann-La Roche Inc. DNA encoding a thermostable nucleic acid polymerase enzyme from thermotoga maritima
US5962258A (en) 1995-08-23 1999-10-05 Diversa Corporation Carboxymethyl cellulase fromthermotoga maritima
US6479258B1 (en) * 1995-12-07 2002-11-12 Diversa Corporation Non-stochastic generation of genetic vaccines
US5939250A (en) * 1995-12-07 1999-08-17 Diversa Corporation Production of enzymes having desired activities by mutagenesis

Cited By (151)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2653539A1 (en) 2007-12-19 2013-10-23 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2009085935A2 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010048522A1 (en) 2008-10-24 2010-04-29 C5-6 Technologies, Inc. Thermostable cellulase and methods of use
EP2346894A4 (en) * 2008-10-24 2012-04-18 C5 6 Technologies Inc Thermostable cellulase and methods of use
EP2346894A1 (en) * 2008-10-24 2011-07-27 C5-6 Technologies, Inc. Thermostable cellulase and methods of use
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2010080527A1 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for determining cellulolytic enhancing activity of a polypeptide
EP3141609A1 (en) 2008-12-19 2017-03-15 Novozymes, Inc. Methods for increasing hydrolysis of cellulosic material in the presence of cellobiose dehydrogenase
WO2010080407A2 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing hydrolysis of cellulosic material
WO2010080408A2 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing enzymatic hydrolysis of cellulosic material in the presence of a peroxidase
WO2010080532A1 (en) 2008-12-19 2010-07-15 Novozymes, Inc. Methods for increasing hydrolysis of cellulosic material in the presence of cellobiose dehydrogenase
WO2010088387A1 (en) 2009-01-28 2010-08-05 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
WO2010108918A1 (en) 2009-03-24 2010-09-30 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011005867A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3269804A1 (en) 2009-09-17 2018-01-17 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3805348A2 (en) 2009-09-17 2021-04-14 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2011041397A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041405A1 (en) 2009-09-29 2011-04-07 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011039319A1 (en) 2009-09-30 2011-04-07 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011041504A1 (en) 2009-09-30 2011-04-07 Novozymes, Inc. Polypeptides derived from thermoascus crustaceus having cellulolytic enhancing activity and polynucleotides encoding same
EP2977382A2 (en) 2009-09-30 2016-01-27 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2011059740A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011057083A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2011057086A1 (en) 2009-11-06 2011-05-12 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2011123450A1 (en) 2010-03-31 2011-10-06 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2012003379A1 (en) 2010-06-30 2012-01-05 Novozymes A/S Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2012021394A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof
WO2012021401A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a bicyclic compound and uses thereof
WO2012021399A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a nitrogen-containing compound and uses thereof
WO2012021395A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a sulfur-containing compound and uses thereof
WO2012021408A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a dioxy compound and uses thereof
WO2012021400A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a heterocyclic compound and uses thereof
WO2012021410A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a liquor and uses thereof
WO2012021396A1 (en) 2010-08-12 2012-02-16 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and an organic compound and uses thereof
WO2012030799A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2735611A2 (en) 2010-08-30 2014-05-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP3470514A1 (en) 2010-08-30 2019-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044836A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012044915A2 (en) 2010-10-01 2012-04-05 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
EP3023492A1 (en) 2010-10-01 2016-05-25 Novozymes, Inc. Beta-glucosidase variants and polynucleotides encoding same
WO2012058293A1 (en) 2010-10-26 2012-05-03 Novozymes North America, Inc. Methods of saccharifying sugarcane trash
WO2012061517A1 (en) 2010-11-02 2012-05-10 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
WO2012059053A1 (en) 2010-11-04 2012-05-10 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012062220A1 (en) 2010-11-12 2012-05-18 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012078656A1 (en) 2010-12-06 2012-06-14 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
WO2012101206A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Novel glycoside hydrolases from thermophilic fungi
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012103350A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP3235903A1 (en) 2011-01-26 2017-10-25 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012103300A2 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012134626A2 (en) 2011-01-31 2012-10-04 Novozymes North America, Inc. Processes for enzymatic refining of pretreated cellulosic material for saccharification
WO2012113340A1 (en) 2011-02-23 2012-08-30 Novozymes Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012122518A1 (en) 2011-03-09 2012-09-13 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
EP3339442A1 (en) 2011-03-09 2018-06-27 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP3333258A2 (en) 2011-03-25 2018-06-13 Novozymes A/S Method for degrading or converting cellulosic material
WO2012130120A1 (en) 2011-03-25 2012-10-04 Novozymes A/S Method for degrading or converting cellulosic material
WO2012135659A2 (en) 2011-03-31 2012-10-04 Novozymes A/S Methods for enhancing the degradation or conversion of cellulosic material
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
WO2012149192A1 (en) 2011-04-28 2012-11-01 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012149344A1 (en) 2011-04-29 2012-11-01 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2012159007A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
WO2013016115A1 (en) 2011-07-22 2013-01-31 Novozymes North America, Inc. Processes for pretreating cellulosic material and improving hydrolysis thereof
WO2013019827A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
EP3382016A1 (en) 2011-08-04 2018-10-03 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP3091073A2 (en) 2011-08-04 2016-11-09 Novozymes Inc. Polypeptides having xylanase activity and polynucleotides encoding same
WO2013019780A2 (en) 2011-08-04 2013-02-07 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013028912A2 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell
WO2013028915A2 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Methods for obtaining positive transformants of a filamentous fungal host cell
WO2013039776A1 (en) 2011-09-13 2013-03-21 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013089889A2 (en) 2011-09-30 2013-06-20 Novozymes, Inc. Chimeric polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2013064075A1 (en) 2011-10-31 2013-05-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2013074956A2 (en) 2011-11-18 2013-05-23 Novozymes, Inc. Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP3382017A1 (en) 2011-11-18 2018-10-03 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP3409769A1 (en) 2011-11-18 2018-12-05 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2013119302A2 (en) 2011-11-21 2013-08-15 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
EP3219794A1 (en) 2011-11-21 2017-09-20 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
EP3597736A1 (en) 2011-11-21 2020-01-22 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
EP3342860A1 (en) 2011-11-22 2018-07-04 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013075644A1 (en) 2011-11-22 2013-05-30 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079015A1 (en) 2011-12-01 2013-06-06 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
EP3272862A1 (en) 2011-12-16 2018-01-24 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
WO2013096369A1 (en) 2011-12-19 2013-06-27 Novozymes A/S Processes and compositions for increasing the digestibility of cellulosic materials
WO2013091547A1 (en) 2011-12-19 2013-06-27 Novozymes, Inc. Polypeptides having catalase activity and polynucleotides encoding same
WO2013096603A2 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
WO2013096652A1 (en) 2011-12-21 2013-06-27 Novozymes, Inc. Methods for determining the degradation of a biomass material
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
WO2013160247A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
EP3279320A2 (en) 2012-04-27 2018-02-07 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
WO2013163590A2 (en) 2012-04-27 2013-10-31 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
WO2014092832A2 (en) 2012-09-19 2014-06-19 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
EP3586610A1 (en) 2012-10-08 2020-01-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014058896A1 (en) 2012-10-08 2014-04-17 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014066141A2 (en) 2012-10-24 2014-05-01 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
WO2014138672A1 (en) 2013-03-08 2014-09-12 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
EP3594335A1 (en) 2014-09-05 2020-01-15 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
WO2016037096A1 (en) 2014-09-05 2016-03-10 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
WO2016120297A1 (en) 2015-01-28 2016-08-04 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016120298A1 (en) 2015-01-28 2016-08-04 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
EP3640336A1 (en) 2015-01-28 2020-04-22 DSM IP Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016120296A1 (en) 2015-01-28 2016-08-04 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
EP3739045A2 (en) 2015-02-24 2020-11-18 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
WO2016142550A1 (en) 2015-03-12 2016-09-15 Beta Renewables S.P.A. A process for producing a hydrolyzed mixture from a pre-treated ligno-cellulosic slurry comprising a slurry liquid and slurry solids
EP3067428A1 (en) 2015-03-12 2016-09-14 BETA RENEWABLES S.p.A. A process for producing a hydrolyzed mixture from a pre-treated ligno-cellulosic slurry comprising a slurry liquid and slurry solids
WO2016169893A1 (en) 2015-04-20 2016-10-27 Dsm Ip Assets B.V. Whole fermentation broth
WO2016169892A1 (en) 2015-04-20 2016-10-27 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2016207144A1 (en) 2015-06-22 2016-12-29 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2017211957A1 (en) 2016-06-09 2017-12-14 Dsm Ip Assets B.V. Seed train for large scale enzyme production
WO2018019948A1 (en) 2016-07-29 2018-02-01 Dsm Ip Assets B.V. Polypeptides having cellulolytic enhancing activity and uses thereof
WO2018096017A1 (en) 2016-11-24 2018-05-31 Dsm Ip Assets B.V. Enzyme composition
WO2018096019A1 (en) 2016-11-24 2018-05-31 Dsm Ip Assets B.V. Enzyme composition
WO2018185071A1 (en) 2017-04-03 2018-10-11 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019072732A1 (en) 2017-10-09 2019-04-18 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019086369A1 (en) 2017-10-30 2019-05-09 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019086370A1 (en) 2017-10-30 2019-05-09 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars
WO2019185680A1 (en) 2018-03-28 2019-10-03 Dsm Ip Assets B.V. Enzyme composition
WO2019185681A1 (en) 2018-03-28 2019-10-03 Dsm Ip Assets B.V. Enzyme composition
WO2019219804A1 (en) 2018-05-17 2019-11-21 Dsm Ip Assets B.V. Process for producing a polypeptide
WO2019229108A1 (en) 2018-05-30 2019-12-05 Dsm Ip Assets B.V. Process for producing sugars from carbohydrate materials
WO2020058253A1 (en) 2018-09-18 2020-03-26 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020058248A1 (en) 2018-09-18 2020-03-26 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020058249A1 (en) 2018-09-18 2020-03-26 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020083951A1 (en) 2018-10-24 2020-04-30 Dsm Ip Assets B.V. Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars
WO2020182843A1 (en) 2019-03-12 2020-09-17 Dsm Ip Assets B.V. Process for producing a fermentation broth
WO2021048164A1 (en) 2019-09-10 2021-03-18 Dsm Ip Assets B.V. Enzyme composition
WO2022013148A1 (en) 2020-07-13 2022-01-20 Dsm Ip Assets B.V. Process for the production of biogas
WO2022214458A1 (en) 2021-04-06 2022-10-13 Dsm Ip Assets B.V. Enzyme composition
WO2022214457A1 (en) 2021-04-06 2022-10-13 Dsm Ip Assets B.V. Enzyme composition
WO2022214459A1 (en) 2021-04-06 2022-10-13 Dsm Ip Assets B.V. Enzyme composition
WO2022214460A1 (en) 2021-04-08 2022-10-13 Dsm Ip Assets B.V. Process for the preparation of a sugar product and a fermentation product

Also Published As

Publication number Publication date
AU2002322091A1 (en) 2002-12-23
US7422876B2 (en) 2008-09-09
WO2002101078A8 (en) 2013-11-28
WO2002101078A9 (en) 2013-10-31
US20030044956A1 (en) 2003-03-06
US20050123984A1 (en) 2005-06-09

Similar Documents

Publication Publication Date Title
WO2002101078A2 (en) Cellulases, nucleic acids encoding them and methods for making and using them
US8148324B2 (en) Chemoenzymatic methods for the synthesis of statins and statin intermediates
EP1497418B1 (en) Phospholipases, nucleic acids encoding them and methods for making and using them
US9150845B2 (en) Lyase enzymes, nucleic acids encoding them and methods for making and using them
EP2468853B1 (en) Method for enzymatic decolorization of pheophytin
EP2238242B9 (en) Transferases and oxidoreductases, nucleic acids encoding them and methods for making and using them
US9017990B2 (en) Methods for enzymatic decolorization of chlorophyll
US20060281908A1 (en) Xylose isomerases, nucleic acids encoding them and methods for making and using them
US20060259993A1 (en) Amidases, nucleic acids encoding them and methods for making and using them
WO2003068910A2 (en) Glycosidases, nucleic acids encoding them and methods of making and using them
US20110027346A1 (en) Lyase Enzymes, Nucleic Acids Encoding Them and Methods for Making and Using Them
WO2004085624A2 (en) Transaminases, deaminases and aminomutases and compositions and methods for enzymatic detoxification
WO2003068909A2 (en) Transaminases, nucleic acids encoding them and methods of making and using them
WO2002103032A2 (en) Catalases, nucleic acids encoding them and methods for making and using them
WO2004035729A2 (en) Esterases, nucleic acids encoding them and methods of making and using them
WO2003000921A2 (en) Alpha galactosides, nucleic acids encoding them and methods for making and using them
WO2004069848A2 (en) Amidases, nucleic acids encoding them and methods for making and using them
WO2003023029A1 (en) Polymerases, nucleic acids encoding them and methods for making and using them
WO2003027315A2 (en) Amidases, nucleic acids encoding them and methods for making and using them
WO2004007750A2 (en) Monooxygenases, nucleic acids encoding them and methods for making and using them
WO2003006610A2 (en) Thermostable phosphatases and methods of making and using them
WO2003000924A2 (en) Endoglucanases, nucleic acids encoding them and methods for making and using them
AU2003216125A1 (en) Amidases, nucleic acids encoding them and methods for making and using them

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)