WO2002074993A1

WO2002074993A1 - A method for immobilizing molecules with physiological activity

Info

Publication number: WO2002074993A1
Application number: PCT/KR2000/001104
Authority: WO
Inventors: Kee-Pyung Nahm; Hyun-Jin Hwang; Jeong-Hee Kim; Geumjung Rhim
Original assignee: Paxgenetica Inc.
Priority date: 2000-10-04
Filing date: 2000-10-04
Publication date: 2002-09-26
Also published as: AU2001294299A1; EP1330540A1

Abstract

The present invention relates to a method for immobilizing a physiologically active molecule whose active sites are masked so as to maintain the physiological activity of the molecule effectively. The method of the present invention comprises the steps of a) incubating the physiologically active molecule with a compound selectively binding to active sites of the molecule for masking the active sites of the molecule, b) introducing a linker that can bind to the masked molecule of steps a) on the surface of a substrate to form a support, c) controlling the rate of the reaction that the masked molecule of step a) bind to the linker on the surface of the support formed in step b), and d) binding the masked molecule of step a) to the linker on the surface of the support of step b) for immobilizing the physiologically active molecule. The method may further comprises the step of e) removing a compound selectively bound to the active sites of the molecule from the immobilized molecule. In this invention, the immobilization rate can be optimized by controlling mole ratio of a reactive functional group on the surface of a support, a mole concentration of the molecule with a physiological activity, pH, reaction time, reaction temperature, the coupling reagent, etc.

Description

A METHOD FOR IMMOBILIZING MOLECULES WITH PHYSIOLOGICAL

ACTIVITY

TECHNICAL FIELD

The present invention relates to a method of immobilizing a molecule with physiological activity on the surface of a supporting material.

Specifically, this invention relates to an effective method of immobilizing a molecule with physiological activities using the masking technology over the active sites of physiologically active molecules so as to maintain the physiological activities of immobilized molecules. Also, this invention relates to physiologically active molecules immobilized on a solid phase substrate according to the method.

BACKGROUND ART

Recently, many efforts have been poured to graft a semiconductor technology upon a biotechnology so as to broaden the application fields of various bio-molecules, such as nucleic acids, proteins, enzymes, antigens, antibodies, and etc. The semiconductor technology enables bio-molecules, i.e., physiologically active molecules to be immobilized inside the restricted area on a tiny silicon chip. Also, the biotechnology comprising biochemical- screening technology has an ability to extract useful and vast information from the chip. Therefore, an effective method of immobilizing physiologically active molecules has been desirable in the field of drug development, chip development for a small diagnostic chip or a lab-on-a-chip(LOC), and various applications using the physiologically active molecules, which include separation process and inhibition process in biotechnology.

A conventional method of immobilizing molecules with physiological activity introduces linkers of multiple functional groups on a solid phase substrate to build a support. Because of the multiple functional groups of the linkers and physiologically active molecules, the conventional method usually produces non-specific chemical bonds in-between functional groups. That is, through the reaction, the physiologically active molecules are immobilized by various kind of bonding including covalent bonding, ionic bonding, coordinate bonding, hydrogen bonding, packing, and etc., between amine groups, carboxylic groups, alcohol groups, aldehyde groups, thiol groups, and etc. existing on the surfaces of either physiologically active molecules or a support.

Usually, a physiologically active molecule has a single or multiple active sites necessary for the expression of its specific activity. The active site contributes to the specific activity while forming a complex with specific compounds comprising a substrate of the molecules, a coenzyme, a corresponding antibody, an antigen, and etc. Many conventional immobilization methods fix linkers on the reactive functional groups of a solid phase substrate using a method of either physical adsorption or chemical reaction forming a covalent bond or a coordinate bond. Then, functional groups like carboxylic groups of the linkers are activated by l-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDC), N-hydroxysuccinimide (EDC-NHS), SOCl₂, and etc. Thereby, physiologically active molecules are immobilized on the surface of the support by forming amide bonds between amine groups of the molecule and the activated carboxylic groups of the support (Anal Biochem., vol 185, p 131-135 (1990); Anal. Chem., vol 66, p 1369-1377 (1994); Biosens, Bioelectron. , vol 11, p 757-768 (1996); Biosens, Bioelectron. , vol 12, p 977-989 (1997); Science vol 289, p 1760-1763 (2000)). A conventional immobilization method using said non-specific chemical bonds has following problems. Firstly, a plurality of chemical bonds can be formed between a physiologically active molecule and a support during the immobilization process. It is because there are several reactive functional groups on the surfaces of both. Therefore, nonspecific immobilization on various sites of a molecule often causes structural denature, destruction, and eventually, rapid loss of the physiological activity of an immobilized molecule. Secondly, the lack of specificity in the immobilization process can make reactions happen either directly on or near the active sites of a physiologically active molecule. Chemical bonds inside or around active sites of a physiologically active molecule affect an activity of the immobilized molecule due to the direct blocking or inliibition for complex formation. Therefore, the activity maintenance rate of an immobilized molecule is decreased.

Said immobilization method using non-specific chemical bonds causes both steric hindrance of active sites of a physiologically active molecule and modification of the structure of a molecule. Therefore, the activity of a physiologically active molecule can be rapidly decreased during the practical immobilization process, and accordingly, the unit activity of a physiologically active molecule per unit area is decreased due to the deteriorated activity maintenance rate.

Therefore, it would be desirable if an immobilization method, which prevents direct damage on active sites of a molecule, were developed. The direct damage is resulted from chemical bonds over or near active sites. It would be also desirable if an activity maintenance rate were improved by increasing the unit activity per unit area of an immobilized molecule, specifically a physiologically active molecule.

DISCLOSURE OF THE INVENTION The present invention is directed to a method immobilizing a physiologically active molecule, which does not cause steric hindrance or structural modification of active sites by masking active sites of a physiologically active molecule.

This invention is also directed to a method immobilizing a physiologically active molecule, which increases the unit activity per unit area of the molecule, there by improves activity maintenance rate.

This invention is related to a method immobilizing a physiologically active molecule in order to be applied to the field of bio-chips including DNA chips and protein chips.

The invention is also related to immobilized and physiologically active molecules having an excellent activity maintenance rate. The present invention directed to an effective method to immobilize a physiologically active molecule, maintaining the highest physiological activity, comprises following steps: (a) in one of its methods aspects, this invention is directed to a step in which a physiologically active molecule reacts to a corresponding compound binding to the active site of the physiologically active molecule for the purpose of masking active sites of the molecule;

(b) in one of its methods aspects, this invention is directed to a step in which useful linkers are introduced on the surface of a solid phase substrate to form a support for immobilization of a molecule having masked active sites obtained from the step of (a);

(c) in one of its methods aspects, this invention is directed to a step in which the reaction rate is controlled during the reaction between molecules of masked active sites from the step of (a) and linkers in a support from the step of (b); and

(d) in one of its methods aspects, this invention is directed to a steps in which a molecule of masked active sites from the step (a) is immobilized on the surface of a support, reacting to the linkers formed on the surface of a solid phase substrate in the step of (b).

Through the step (a) of masking active sites, a physiologically active molecule forms a complex with a corresponding compound that selectively binds to active sites of a physiologically active molecule. This masking step may precede the other immobilization steps for physiologically active molecules. Otherwise, the masking reaction may be simultaneously conducted during the other immobilization steps by direct adding of corresponding compounds for masking to an immobilization solution.

In the present invention, a physiologically active molecule can be selected from the groups consisting of proteins, enzymes, antigens, antibodies, and etc. Each corresponding compound for masking active sites of the molecules is preferably selected either from the groups consisting of substrates, inhibitors, cofactors, chemical deformants, analogues, and derivatives thereof in the case of masking enzymes, or from the groups consisting of antigens, antibodies, and deformants thereof in the case of masking antibody and antigen. For examples, DNA, RNA, derivatives thereof, or analogues thereof can be used to mask active sites of enzymes whose substrates are DNA, and etc. Also, antigens, antibodies, derivatives thereof, or analogues thereof can be used to mask active sites of corresponding antibodies or antigens.

A masking compound can form a complex with a physiologically active molecule by binding to one active site or more of the molecule. For the binding, various kinds of reaction can be used to form chemical bonding such as covalent bonding, ionic bonding, coordinate bonding, hydrogen bonding, and etc., or physical bonding such as dipole-dipole interaction, packing, and etc., or several combinations thereof. Depending on the case, it takes from a few seconds to more than 24 hours forming a complex. A reaction pH does not need to be specific other than the case that a physiological activity of a molecule is inhibited. However, it is preferred to optimize the pH range of a reaction, where selective masking of specific active sites is possible. It is also desirable to maintain a protection (masking) ratio of a physiologically active molecule in between 5% and 100%.

Reactive functional groups on or near active sites of a physiologically active molecule can be protected from chemical or physical binding direct to reactive functional groups on a support. In the step of (a), selective masking of active sites occurs while forming a complex of a physiologically active molecule and a corresponding selective compound.

A physiologically active molecule whose active sites are masked can be immobilized on a support where multiple reactive functional groups are introduced on a solid phase substrate. In the invention, a solid phase substrate is a common designation of a material on which a plurality of reactive functional groups can be introduced as linkers inside a specific surface area where physiologically active molecules would be immobilized. Introduction of the reactive functional groups on a solid phase substrate occurs by forming a thin film layer of linkers having reactive functional groups over the surface of a substrate. Linkers having reactive functional groups form a thin film layer on the surface of a solid phase substrate using various linkages including a covalent bond, an ionic bond, a coordinate bond, a hydrogen bond, packing, or several combinations thereof. A functional group of a linker can be selected from several functional groups consisting of a thiol group, a sulfide group, a disulfide group, a silane groups such as an alkoxysilnae group, a halogen silane group, and etc., a carboxylic group, an amine group, an alcohol group, an epoxy group, an aldehyde group, an alkylhallide group, an alkyl group, an alkene group, an alkyne group, an aryl group, and mixtures thereof.

A solid phase substrate in this invention may be selected from a metal group consisting of Au, Ag, Pt, Cu, and etc., a nonmetal group consisting of silicone wafer, glass, silica, fused silica, etc., a semiconductor group and an oxide thereof, organic or inorganic polymer, dendrimer, solid or liquid phase polymer, and mixtures thereof. A solid phase substrate may be shaped in various forms such as planar, spherical, linear, porous, micro fabricated gel pad, nano particle, and etc. It may also include materials of various sizes more than nm scale for multiple introductions of reactive functional groups. Various sizes of substrate more than nm scale can be used because the distance between atoms in a molecule is in a A scale, and a size of a physiologically active molecule is in a range of a few nm to tens of nm. Thus, any size of a substrate can be used only if multiple introductions of reactive functional groups are possible. As mentioned before, the reactive functional group of linkers consist of carboxylic, amine, alcohol, epoxy, aldehyde, thiol, sulfide, disulfide, alkyl halide, alkyl, alkene, alkyne, aryl, etc., and combinations thereof. The above reactive functional group of linkers is also used as a linking group to immobilize a physiologically active molecule on a support.

Chemical or physical reaction resulting covalent bonding, ionic bonding, coordinate bonding, hydrogen bonding, or combinations thereof occurs between reactive functional groups of linkers and a physiologically active molecule. Through the immobilization reaction, an amide bond, an amine bond, a sulfide bond, a disulfide bond, an ester bond, an ether bond, or combinations thereof can be produced between functional groups in a support and a physiologically active molecule. For examples, amine group of a physiologically active molecule connected to carboxylic group of a linker by an amide bond; amine group of a physiologically active molecule to aldehyde group of a linker by an imine bond; and thiol group of a physiologically active molecule to thiol group of a solid phase substrate by disulfide bonds. Even if active sites of a physiologically active molecule are masked or protected by compounds selectively binding thereto, too many chemical bonds between a physiologically active molecule and reactive functional groups of a support through immobilization may destroy a tertiary structure of the molecule. It affects the structure of active sites, and gradually decreases the activity maintenance rate of an immobilized molecule. In the present invention, a down-kinetic-regulation technique in reaction kinetics is adopted to prevent the decrease in activity maintenance rate during the immobilization process. It means that the probability of immobilization is controlled to be low. However, in such a case that the down-kinetic-regulation technique is used excessively, the unit activity per unit area of a physiologically active molecule can be reduced concurrently with the decline of immobilization efficiency. Accordingly, it is preferable to optimize the reaction rate, while optimizing the other kinetic variables, thereto minimize the probability of multiple bond formation in immobilization and, simultaneously, maximize the activity maintenance rate.

For the optimization of reaction rate during immobilization process, mole fractions of reactive functional groups on the surface of a support are controlled in the invention. Also, the concentration of a physiologically active molecule, pH of the reaction solution, reaction time, reaction temperature, and kinds of coupling reagents are regulated to maximize the efficiency in immobilizing molecules with physiological activity.

In one of its method aspects in forming a thin film layer on a sopport, mole fractions of reactive functional groups for immobilization existing on the surface of a support is controlled by introducing two kinds of thiol molecules having a different terminal group as a reactive functional group. One of the thiol molecules has comparatively long alkyl chain having a reactive functional group at the end, which is for immobilization of a physiologically active molecule. The other, a short-length thiol molecule, preferably has non-reactive terminal group and is used to mask a support. The former thiol molecule is selected from the groups consisting of mercaptocarboxylic acid like 11-mercaptoundodecanoic acid, mercaptoaminoalkane, mercaptoaldehyde, dimercaptoalkane, and sulfide and disulfide groups having a reactive functional group such as carboxy, thiol, alcohol, aldehyde, amine, and etc. Also, the latter thiol molecule is selected from the groups consisting of mercaptoalcohol like 6-mercapto-l-hexanol, mercaptoalkane like 1-hepatanethiol, and sulfide and disulfide groups having other non-reactive ending groups. Preferably, in the case that the thiol molecule of a reactive functional group for immobilization is mercaptocarboxylic acid or mercaptoaminoalkane, mercaptoalcohol or mercaptoalkane is used as the thiol molecule of a non-reactive terminal group; or in the case that the thiol molecule of a reactive functional group for immobilization is mercaptoaldehyde or dimercaptoalkane, mercaptoalcohol or mercaptoalkane is used as the thiol molecule of a non-reactive terminal group.

The mole fraction of a linker having a reactive functional group for immobilization is preferable approximately in the range between 0.05 and 50 %, more preferable between 0.05 and 30 % of total introduced linkers. When the mole fraction of a linker having a reactive functional group for immobilization is more than 50%, multiple chemical bonds are formed between a physiologically active molecule and a support, and decrease of the activity of a immobilized molecule would be caused. Also, when the mole fraction is lower than 0.05%, the efficiency of immobilization and the activity maintenance rate is reduced, so the unit activity per unit area is decreased.

A reactive functional group introduced on a support is activated by a coupling reagent such as l-ethyl-3-(3-dimethylaminopropyl)carbodiimide(EDC), N- hydroxysuccineimide (EDC-NHS), SOCl₂, etc. Then, a physiologically active molecule is immobilized on a support using the activated linkers.

In order to optimize the immobilization reaction rate, the concentration of a physiologically active molecule is preferably between 0.1 μg/ml and 1 mg/ml, reaction pH is preferably between 4 and 10, and reaction time is preferably in the range of a few seconds to 24 hours. This invention may also comprise one additional step (e) where a masking compound selectively bound to active sites of an immobilized molecule with physiological activity is removed from the immobilized molecule. A masking compound is removed to expose active sites of a physiologically active molecule, thereby to minimize the deformation of active sites and to increase the activity maintenance rate. The masking compounds can be removed by heating, hydrolysis, dilution, dialysis, the change of pH, and etc.

This invention comprises the method immobilizing a physiologically active molecule whose active sites are masked, the method controlling the immobilization rate to minimize the number of bonds between a physiologically active molecule and the surface of a support, thereby preventing or minimizing damage on the active sites of a physiologically active molecule, and the method maximizing the activity of an immobilized molecule with physiological activity per unit area by increasing the activity maintenance rate. BRIEF DESCRIPTION OF THE DRAWINGS Fig. la is an agarose-gel fluorescent photograph showing the activity of the Taq

DNA polymerase immobilized on surface of a support either using the protected immobilization method (PIM) of this invention or using a conventional random immobilization method (RIM). It shows the aspect of activity change according to the change in a mole fraction of 1 1-mercaptoundodecanoic acid in a solution containing thiol molecules, which is for introduction of carboxylic group.

Fig. lb is a graph showing the relative activity of a Taq DNA polymerase immobilized on the surface of a support either by PPM or by a conventional RIM. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig. la) using densitometer. Fig. 2a is an agarose-gel fluorescent photograph of the PCR products, showing the masking (protection) effect on the relative enzyme activity according to the invention. The product of PCR using a Taq DNA polymerase immobilized by PIM was analyzed to determine the effect of a masking (protection) ratio on the activity of an immobilized Taq DNA polymerase. Partially double-stranded DNA was used to protect active sites of a Taq DNA polymerase.

Fig. 2b is a graph showing an effect of the masking (protection) ratio on the relative enzyme activity when using PIM to immobilize a Taq DNA polymerase. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.2a) using densitometer. Fig. 3a is an agarose-gel fluorescent photograph of the PCR products showing an effect of pH in an immobilization reaction on the relative activity of the Taq DNA polymerase immobilized by PIM.

Fig. 3b is a graph showing an effect of pH in an immobilization reaction on the relative activity of the Taq DNA polymerase immobilized by PIM. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.3a) using densitometer.

Fig. 4a is an agarose-gel fluorescent photograph of PCR products showing change in the relative enzyme activity of the Taq DNA polymerase immobilized by PIM, according to the time course of immobilization reaction. Fig. 4b is a graph showing change in the relative enzyme activity of the Taq DNA polymerase immobilized by PIM, according to the time course of immobilization reaction. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.4a) using densitometer.

Fig. 5a is an agarose gel fluorescent photograph of PCR products, showing the activity of a Taq DNA polymerase either in an immobilized condition of this invention using

PIM or in a dissolved condition, corresponding on the each cycle number of PCR reaction.

Fig. 5b is a graph showing the activity of a Taq DNA polymerase either in an immobilized condition of this invention using PIM or in a dissolved condition, corresponding on the each cycle number of PCR reaction. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.5 a) using densitometer.

Fig. 6a is an agarose-gel fluorescent photograph of PCR products, showing the activity change of a Taq DNA polymerase immobilized by PIM according to the total amount of a Taq DNA polymerase, as the number of monolayers, used in immobilization.

Fig. 6b is a graph showing an effect of the total amount of a Taq DNA polymerase, as the number of monolayers, used in the immobilization on the relative enzyme activity of a

Taq DNA polymerase immobilized by PIM. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.5a) using densitometer.

Fig. 7 is a graph showing the effect of the mole fraction of 11-mercaptoundodecanoic acid in the mixed thiol solution, introduced as a carboxylic group, on the activity of an immobilized anti-DNA antibody.

Fig. 8 is a graph showing the effect of the concentration of a double-stranded DNA on the activity of an anti-DNA antibody immobilized using either PIM or RIM. EXAMPLES

The present invention will now be explained in more detail with reference to the following Examples. However, these are to illustrate the present invention and the present invention is not limited thereto. Example Example 1 : Immobilization of the Taq DNA polymerase a) Masking of active sites of the Taq DNA polymerase

AmpliTaq GoldTM DNA polymerase purchased from Perkin Elmer Company was used as the Taq DNA polymerase. The polymerase is an enzyme with a molecular weight of 94 kDa consisting of 832 amino acids, and is chemically modified using heat-activation at 95 ^°C for 10 minutes.

A buffer solution, in which a KS primer and a single stranded DNA (ss-DNA) consisting of 65 nucleic acids of the sequences shown below were mixed with a mole ratio of 1 :1, was incubated at 94 ^°C for 10 minutes, and then it was slowly cooled down to 35 ^°C (approximately, 1-2 minutes were required). During the incubation, a ss-DNA of 65 nucleic acids and a KS primer were annealed to produce partially double-stranded DNA. An appropriate mole of the Taq DNA polymerase was added to the solution, and the solution was incubated for 10 minutes at 72 ^°C in a dry bath. Then, the solution was transferred to a 50 ^°C dry bath and incubated for 20 minutes to carry out the masking reaction on active sites of the Taq DNA polymerase. The Taq DNA polymerase binds to 3' end of the partially double- stranded DNA where the structure of DNA changes from a double-stranded form to a single stranded form (S.H. Eom, J. Wang, T.A. Steitz, Nature, vol. 382, pp. 278-281, 1996), thereby active sites are protected. A ss-DNA of 65 nucleic acids and a KS primer were synthesized using a DNA synthesizer. The optimum pH for the masking reaction was pH 8.3, at which the Taq DNA polymerase has the highest activity.

KS primer

5' CGAGGTCGACGGTATCF 3' ss-DNA

3 ' CC AGCTGCC ATAGCT ATTTTCTTTTCTTTCTTAAGTTCTTTTCTTTTCCTAGGTGA TCAAGATCT 5'

b) Formation of the monolayer film of thiol molecules on the surface of a support and introduction of the functional group having immobilization reactivity.

A glass fragment, the dimension of 3.0 mm x 5.0 mm, was used as a substrate after vacuum-coating with Au to a thiclαiess of approximately 1000 A on the surface. In order to secure purity of the surface, the Au-coated glass fragment was immersed in Piranha solution at the temperature between 60 and 70 ^°C for 10 to 15 minutes, and was washed with deionized water and then with the absolute ethanol right before every use.

For the introduction of functional groups having immobilization reactivity on the surface of an Au substrate, a thiolate-forming reaction between a linker of the thiol group and Au, namely Au-S bond forming reaction, was carried out to build a monolayer film of thiol molecules (C.B. Bain, E.B. Troughton, Y.-T. Tao, J. Evall, G.M. Whitesides, and R.G. Nuzzo, J. Am. Chem. Soc, vol. I l l, pp. 321-335, 1989). Wherein, a solution containing two kinds of thiol molecules, i.e. one of a reactive functional group for immobilization and one of a non- reactive end group, was used. The mole fraction of a thiol molecule having a reactive functional group was tailored between 0 and 100 % to optimize the mole fraction of a reactive functional group on the surface of a support in immobilization. As a thiol molecule introducing a carboxylic group of a reactive functional group for immobilization, 11- mercaptoundodecanoic acid having relatively long alkyl chain was used. Also, as a thiol molecule having a non-reactive end groups, 6-mercapto-l-hexanol was used. An Au-coated glass substrate was exposed to 100 βi of ethanol solution containing thiol molecules whose total concentration of 2 mM. It was incubated at room temperature for 2 hours. Then, the substrate was washed using absolute ethanol thereby completed the introduction of carboxylic groups on the surface of a Au-coated substrate.

As mentioned previously, reactive functional groups are spatially separated and protruded from the other end groups in the monolayer film of thiol molecules. It enables free movement of a physiologically active molecule after immobilization and reduces the effects of molecular interaction usually generated by the monolayer film of thiol molecules, thereby improves activity maintenance rate of immobilized physiologically active molecules. c) Activation of a carboxylic group of a thiol molecule in the monolayer film An Au-coated glass substrate on which carboxylic groups are introduced was exposed to 120 βH, of ethanol solution containing 10 mM of l-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDC) and 5 mM of N-hydroxysuccinimide (NHS), and it was incubated at room temperature for 2 hours. The carboxylic groups were activated to form NHS-esther by NHS in the presence of EDC (Z. Grabarek and J. Gergely, Anal. Biochem., vol. 185, pp. 131-135, 1990). d) Immobilization of the Taq DNA polymerase

After activating carboxylic groups of thiol molecules in the monolayer film, the substrate was taken out from the ethanol solution and re-incubated in the solution of the Taq DNA polymerase having the masked active sites. During incubation, an amide bond (-CO- NH-) is formed between an activated carboxylic group of a thiol molecule in monolayer film

(NHS-ester) and a primary amine group (-NH,) of a protein (Z. Grabarek and J. Gergely, Anal. Biochem., vol. 185, pp. 131-135, 1990; V.M. Mirsky, M. Riepl, and O.S. Wolfbeis, Biosens. Bioelectron., vol. 12, pp. 977-989, 1997), thereby immobilizes the Taq DNA polymerase on a support. The Immobilization reaction was optimized by tailoring the concentration of a polymerase, pH, reaction time, reaction temperature, and etc.

Example 2: Immobilization of an anti-DNA antibody a) Masking of active sites of an anti-DNA antibody An anti-DNA antibody recognizable of either a single or a double-stranded DNA, which is a monoclonal antibody of IgG2b isotype expressed in the abdominal cavity of a mouse that is immunized by the calf thymus DNA as an immunogen, was purchased from

Chemicon International Inc. Company (cat. No. MAB3032). The antibody solution has total protein concentration of 25 g/L, and approximately 10% of which is the anti-DNA antibody.

The anti-DNA antibody and the 68 bp double-stranded DNA (ds-DNA) labeled with ^3:,S, whose sequence is shown below, were mixed with an appropriate mole ratio, and the mixed solution was incubated at the temperature of 37 ^°C for 30 minutes. Amount of the anti-DNA antibody was approximately 33 frnol, and amount of the 68 bp ds-DNA used to mask active sites was approximately between 2 and 120 fmol. MES buffer solution of pH

6.0 was used in the reaction. For labeling of the 68 bp ds-DNA with beta nuclear species, α -35S-dATP was mixed with an amount corresponding to 2% of total dNTPs in the solution of PCR reaction.

KS primer 5 ' CGAGGTCGACGGTATCGATAAAAGAAAAGAAAGAATTC AAGAAAAGAAAAGG

ATCCACTAGTTCTAGA 3'

3 'GCTCCAGCTGCCATAGCTATTTTCTTTTCTTTCTTAAGTTCTTTTCTTTTCCTAGG TGATCAAGATCT ' SK primer

A glass fragment, the dimension of 12.7 mm x 12.7 mm, was used as a substrate after vacuum-coating with Au to a thickness of approximately 1000 A on the surface. In order to secure purity of the surface, the Au-coated glass fragment was immersed in Piranha solution at a temperature between 60 and 70 ^°C for 10 to 15 minutes, and was washed with deionized water and then with the absolute ethanol right before every use. 1 -Heptane thiol was used as the thiol molecule having a non-reactive end group. The monolayer of 11-mercaptoundodecanoic acid mixed with 1 -heptane thiol was formed on the surface of Au-coated substrate using the same method described in Example 1. A circular area of the Au-coated substrate, with the diameter of 9 mm, was exposed to 300 μi of ethanol solution containing the total thiol concentration of 2 mM, and it was incubated at room temperature for 2 hours. The resulting substrate having carboxylic groups on the surface was washed with the absolute ethanol. c) Activation of a carboxylic group of a thiol molecule in the monolayer film

An Au-coated glass substrate on which carboxylic groups are introduced was exposed to 300 μl of the MES buffer solution (pH 6.0) containing 10 mM of l-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDC) and 5 mM of N-hydroxysulfosuccinimide (sulfo- NHS) inside a circle area of 9 mm diameter. Then, it was incubated at room temperature for 2 hours. The carboxylic group was activated to form sulfo-NHS-ester by sulfo-NHS in the presence of EDC (J. V. Staros, R. W. Wright, and D. M. Swingle, Anal. Biochem., vol. 156, pp. 220-222, 1986). d) Immobilization of an anti-DNA antibody

After activating carboxylic groups of thiol molecules in the monolayer film, the substrate was taken out from the MES buffer and re-incubated in the solution of the anti-DNA antibody whose active sites were masked. The total amount of anti-DNA antibody was about 33 fmol in the solution. The anti-DNA antibody was immobilized using an amide bond (-CO-NH-) between an activated carboxylic group on the surface of a support (sulfo- NHS ester) and a primary amine group of the antibody (-NH₂) (J. V. Staros, R. W. Wright, and D. M. Swingle, Anal Biochem., vol. 156. pp. 220-222, 1986; V. M. Mirsky, M. Riepl, and O. S. Wolfbeis, Biosens. Bioelectron., vol. 12, pp. 977-989, 1997). The immobilization reaction was conducted at the temperature of 10^°C for 2 hours in the MES buffer solution (pH

6.0) containing ³⁵S-labeled ds-DNA for masking active sites of the antibody. 100 μl of the immobilization solution included 33 fmol of the anti-DNA antibody and 30 fmol of the 68 bp ds-DNA for masking active sites. Example 3 : Activity measurement of the immobilized Tag DNA polymerase The relative activity of an Taq DNA polymerase was calculated from the amplified amount of a template DNA after the polymerase-based cycled reaction (PCR) using the corresponding Taq DNA polymerase. PCR instrument of Model 480 from Perkin Elmer

Company was used in this invention. The ss-DNA of 65 bp whose sequence was shown in example 2 (a), was used as a template. Also, either the KS primer or the SK primer was used as a primer in the PCR. The PCR solution of 50 μl contained 25 fmol of the 65 bp ss-DNA and either of 10 pmol of the KS primer or the SK primer. 10X PCR buffer solution (pH 8.3) from Perkin Elmer Company was 10-fold diluted to be used as a reaction buffer. A profile of the temperature cycle in the PCR is shown below: Initial denaturing step: 94 ^°C, 10 min

PCR cycle (20-45 cycles): 94 ^°C, 30 s; 50 ^°C, 60 s; 72 ^°C , 30 s In order to quantify the amount of the DNA amplified in PCR, 20 μl of resulting solution from PCR was talcen and analyzed using agarose gel electrophoresis. The DNA separated in a gel can be dyed by ethidium bromide using a conventional method. The DNA amplified by PCR and separated by agarose gel electrophoresis, was visualized using the fluorescence of ethidium bromide under UV radiation, and then quantified using a densitometer. Example 4: Confirmation for the effect of the mole fraction of a carboxylic group on the activity of an immobilized Taq DNA polymerase.

Immobilization reaction was conducted in phosphate buffer solution (pH 8.3) at 50 ^°C for 30 minutes. 0.75 pmol of the Taq DNA polymerase and 1.5 pmol of a DNA for masking active sites were added in 50 μl of the above buffer solution. 0.75 pmol of the Taq DNA polymerase is corresponding to the amount capable of forming triple layers of film on the 3 mm x 5 mm area of Au-coated substrate. After PCR of 35 cycles, the relative activity of the immobilized Taq DNA polymerase was calculated using the same method described in Example 3. Agarose gel fluorescent photograph of the PCR product was shown in Fig. la. The leftmost lane represents the DNA marker to indicate a size of each ds-DNA, the rightmost lane represents the standard PCR result using a dissolved Taq DNA polymerase of the amount corresponding to build a monolayer film. The other lanes are for the PCR results when using the immobilized Taq DNA polymerase. The number at the bottom of each lane indicates the each mole fraction (%) of 11-mercaptoundecanoic acid in the total amount of thiol molecules, which was used to introduce carboxylic groups.

The graph in Fig. lb shows the relative activity of the Taq DNA polymerase calculated from the Fig. la. The x-axis indicates mole fraction (%) of 11- mercaptoundecanoic acid used to introduce carboxylic groups in the total amount of thiol molecules. The y-axis indicates a relative activity of the immobilized Taq DNA polymerase, which is calculated on the basis of the standard activity measured when using the dissolved Taq DNA polymerase of the amount corresponding to build a monolayer film. The results by PIM of this invention where active sites of a Taq DNA polymerase were masked, were indicated by black dot (^• ). The results by RIM of the conventional method, where active sites of a Taq DNA polymerase were not masked, were indicated by empty dot (° ).

Apparently, the results by PIM with the masked active sites showed higher activity than the results by RIM with the exposed active sites in the whole range of mole fraction of the carboxylic group. In particular, the Taq DNA polymerase immobilized by PIM showed its best activity at the mole fraction of approximately 5% carboxylic group. This indicates the fact that the activity of a immobilized polymerase having masked active sites can be maximize by controlling the mole fraction(%) of a carboxylic group on the surface of a support in terms of kinetics. In other words, the activity of an immobilized enzyme can be maximize by a kinetic control combining both the prevention of activity reduction occurred by multiple bond formation and the improvement of the activity maintenance by applying the masking technique on active sites.

Example 5: The effect of a masking (protection) ratio on the activity of an immobilized Taq DNA polymerase.

The activity of an immobilized Taq DNA polymerase was measured on various mole ratios of a partially double-stranded DNA versus the mole of a Taq DNA polymerase, in the range between 0 and 2, as shown in Fig. 2a and Fig. 2b. The leftmost land and the rightmost lane in Fig. 2a are the same as in Fig. la, and the other lanes indicate the results of PCR using an immobilized Taq DNA polymerase of various protection (masking) ratios. The number at the bottom indicates a percentage (%; multiplied by 100) value of the mole ratio of partially double-stranded DNA used for masking active sites versus the mole of a Taq DNA polymerase. The activity of an immobilized enzyme in Fig. 2b is described as a relative value calculated on the basis of the standard activity of a dissolved Taq DNA polymerase, as same as in Fig. lb. The mole fraction of 11-mercaptoundecanoic acid in the total thiol molecules was 5.0%ι. The total amount of a Taq DNA polymerase used in immobilization was 0.75 ppm corresponding to the amount that can build triple layers of the enzyme on the on the support. The enzyme was immobilized under the same conditions as in Example 4.

Figs. 2a and 2b show the fact that a partially double-stranded DNA and a Taq DNA polymerase form an 1 : 1 complex in masking reaction(S.H. Eom, J. Wang, T.A.Steitz, Nature, vol. 382, pp. 278-281, 1996).

Example 6: The effect of pH in a immobilization reaction on the activity of an immobilized Taq DNA polymerase

The activity of an immobilized Taq DNA polymerase was measured on the various pH condition with the fixed mole fraction (5.0%) of 11-mercaptoundecanoic acid used to introduce a carboxylic group on the surface of Au-coated substrate. The other immobilization and PCR conditions were identical with the conditions in Example 4. The results are represented in Figs. 3a and 3b. The leftmost lane and the rightmost lane of Fig. 3a were the same as in Fig. la, and the other lanes indicate the results of PCR using an Taq DNA polymerase immobilized in various pH conditions. The pH of a buffer solution used in immobilization reaction is indicated at the bottom of each lane. Figs. 3a and 3b show the fact that the efficiency in a masking reaction is maximized at pH 8.3 which is the optimum pH of a Taq DNA polymerase for its enzyme activity.

Example 7: The effect of immobilization time on the activity of an immobilized Tag

DNA polymerase.

The relative activity of an immobilized Taq DNA polymerase was measured at the various immobilization time with the fixed mole fraction (5.0%) of 1 1-mercaptoundecanoic acid used to introduce a carboxylic group on the surface of Au-coated substrate. The other immobilization and PCR conditions were identical with the conditions in Example 4. The results are represented in Fig. 4a and Fig. 4b. The leftmost and rightmost lane in Fig. 4a are the same as in Fig. la, and the other lanes indicate the results of PCR using an immobilized Taq DNA polymerase in various immobilization time. The immobilization reaction time was indicated as minutes at the bottom of each lane. In Figs. 4a and 4b, a rapid increase of the relative enzyme activity in a short period of

10 minutes insists an increase in the yield of immobilization reaction due to the low probability of multiple bond formation. Also, a slow decrease in a relatively long reaction period after the initial 10 minutes insists a decrease of the relative enzyme activity due to both the spatial limitation by a increased amount of an immobilized enzyme and the structural deformation by the multiple bond formation between an enzyme and a support. It also shows the fact that the immobilization reaction time, which is a kinetically important variable, could be optimized thereby suppress the probability of multiple bond formation and maximize the immobilization efficiency, i.e. maximize the unit activity of immobilized enzyme per unit area.

Example 8: The activity comparison of a Taq DNA polymerase between in a dissolved condition and in an immobilized condition.

The mole fraction of 11-mercaptoundecanoic acid in the total amount of thiol molecules was fixed to 5.0%. The total amount of a Taq DNA polymerase used in immobilization reaction was 0.75 pmol, which is a corresponding amount to build triple layers of the enzyme. The enzyme was also immobilized in the same immobilization condition as in Example 4. The activity of a Taq DNA polymerase either in a dissolved condition or in an immobilized condition was measured on the various numbers of PCR cycle. The results are represented in Figs. 5a and 5b. In Fig. 5a, the number of each PCR cycle is indicated at the bottom of each lane.

Figs. 5a and 5b show the fact that the activity aspect of an immobilized Taq DNA polymerase observed through overall scope is similar to that of a dissolved Taq DNA polymerase, which insists that the maintenance rate of activity per unit molecule was maximized.

Example 9: The effect of the total amount of a Taq DNA polymerase added in the immobilization reaction on the activity of a Taq DNA polymerase after immobilization

The mole fraction of 11-mercaptoundecanoic acid in the total thiol molecules used to introduce carboxylic groups on the surface of a Au-coated substrate was fixed to 5.0%. The relative activity of a Taq DNA polymerase was measured while changing the total amount of a Taq DNA polymerase added in immobilization reaction. A Taq DNA polymerase used in the immobilization reaction is indicated at the bottom of each lane, as a number of monolayers in the range between 0 and 10. The mole concentration of a partially double-stranded DNA used to mask active sites of an enzyme was as twice as the total mole of a Taq DNA polymerase added in the immobilization. The other immobilization and PCR conditions were the same as in Example 4. In the results shown in Figs. 6a and 6b, the leftmost lane and the rightmost lane in Fig. 6a are the same as in Fig. la, and the other lanes are the results of PCR amplification by the Taq DNA polymerases immobilized using various amounts of Taq DNA polymerase.

Figs. 6a and 6b show the fact that the activity of an immobilized enzyme, a Taq DNA polymerase, can be increased by controlling the amount of a Taq DNA polymerase used in an immobilization reaction.

Example 10: Measurement of the activity of an immobilized anti-DNA antibody The activity of an immobilized anti-DNA antibody was measured by quantifying the beta ray emitted from a 68 bp ds-DNA labeled with ³⁵S, used to mask active sites; using beta counter from Beckman (Model LS6500). The beta ray emission was measured by immersing the support having an immobilized antibody into 2 mL solution of scintillation cocktail.

Example 11 : The effect of a mole fraction of a carboxylic group on the surface of a substrate onto the activity of an immobilized anti-DNA antibody As same as in the case of a Taq DNA polymerase, PIM - the immobilization method where the active sites were masked - generated the higher activity of an antibody than RIM - the conventional immobilization method where the active sites were not masked - in the whole scope of mole fractions of a carboxylic group. Furthermore, the activity of a masked antibody was the highest when the mole fraction of a carboxylic group was approximately 8%. This shows the fact that the efficiency of the activity maintenance for a masked antibody can be kinetically maximized by controlling the mole fraction of a carboxylic group on the surface of a substrate. In other words, the unit activity of an immobilized antibody can be maximized by optimizing the activity maintenance rate applying the masking technique on active sites, and also by suppressing structural deformation due to the multiple bond formation.

In Fig. 7, x-axis is the same as in Fig. lb, and y axis is the relative activity of an antibody quantified by measuring the energy of a beta ray emitted from ³⁵S-labeled ds-DNA, which is selectively bound to immobilized anti-DNA antibody. The line of the filled dots

(• ) is from PIM - the immobilization reaction where active sites were masked - , and the line of the empty dot (° ) is from RIM - the conventional immobilization reaction where active sites were not masked. Example 12: The effect of the concentration of an antigen (a 68 bp ds-DNA) on the activity of an immobilized anti-DNA antibody

The change in the activity of an immobilized anti-DNA antibody according to the change in the mole concentration of a 68 bp ds-DNA, which is an antigen labeled with ^3≤S, is shown in Fig. 8. The relative activity of an immobilized anti-DNA antibody was confirmed while changing the mole concentration of a 68 bp ds-DNA for masking active sites. The total amount of an anti-DNA antibody used in an immobilization reaction was about 33 fmol, and the mole fraction of 11-mercaptoundecanoic acid in total thiol molecules was 10%). The other immobilization conditions, except the mole concentration of a 68 bp ds-DNA, were the same as in Example 11.

In .Fig. 8, the line of filled dots (• ) is the results when using PIM, and the line of empty dots (° ) is the results when using RIM. PIM produced a much higher activity than

RIM. In PIM, the active site protection (masking) by forming an antigen-antibody complex between an anti-DNA antibody and a 68 bp ds-DNA was saturated in the mole ratio of 1 : 1 to

1 :2.

Claims

1. A method for immobilizing a molecule with physiological activity on a substrate comprising the steps of: a) reacting a molecule with physiological activity with a compound selectively binding to active sites of the molecule for masking the active sites; b) introducing a linker on the surface of the substrate for providing a support for immobilization of the masked molecule of step a); and c) controlling the rate of the reaction between the masked molecule of step a) and the linker on the surface of the support of step b); thereby immobilizing the masked molecule with physiological activity of step a) to the linlcer on the surface of the support formed in step b).

2. The method for immobilizing a molecule according to claim 1, wherein the step b) comprises the steps of: forming a thin film layer of the linker on the surface of the substrate; and controlling the mole fraction of the linker having a reactive functional group and that of the linlcer having a non-reactive end group thereby controlling the mole fraction of a reactive functional group on the surface of the support.

3. The method for immobilizing a molecule according to claim 1, wherein the step c) further comprises the step of controlling the concentration of a molecule with physiological activity.

4. The method for immobilizing a molecule according to claim 1, wherein the step c) comprises the step of controlling pH of the reaction.

5. The method for immobilizing a molecule according to claim 1, wherein the step c) further comprises the step of controlling reaction time.

6. The method for immobilizing a molecule according to claim 1, wherein the step c) further comprises the step of controlling reaction temperature.

7. The method for immobilizing a molecule according to claim 1, wherein the method further comprises the step of activating a reactive functional group of the linlcer using a coupling reagent.

8. The method for immobilizing a molecule according to claim 1, wherein the molecule with a physiological activity is selected from the group consisting of a protein, an enzyme, an antigen and an antibody.

9. The method for immobilizing a molecule according to claim 1, wherein the compound selectively binding to an active site is selected from the group consisting of a substrate of a physiologically active molecule, an inhibitor, a cofactor, a deformant thereof, an analogue thereof, and a derivative thereof; and an antibody, an antigen, and a deformant thereof for masking a corresponding antigen or antibody.

10. The method for immobilizing a molecule according to claim 1, wherein the active site is one or more active sites or cofactor sites.

11. The method for immobilizing a molecule according to claim 1 , wherein the compound selectively binding to the active site form a covalent bond, an ionic bond, a coordinate bond, a hydrogen bond, a dipole-dipole bond, a packing, or combination thereof.

12. The method for immobilizing a molecule according to claim 1, wherein the masking ratio of the molecule is in the scope of 5 to 100%>.

13. The method for immobilizing a molecule according to claim 1, wherein the substrate is selected from the group consisting of a metal, a nonmetal, a semiconductor, and an oxide thereof, an organic or inorganic polymer, a dendrimer and a mixture thereof being shaped in planar, spherical, linear, microporous, microfabricated gel pads, or nanoparticles.

14. The method for immobilizing a molecule according to claim 1, wherein the linlcer of the step b) forms a bond such as a covalent bond, an ionic bond, a coordinate bond, a hydrogen bond, packing, or a combination of two or more thereof, on the surface of the substrate thereby forms a thin film layer of the linker on the surface of the substrate.

15. The method for immobilizing a molecule according to claim 14, wherein the linlcer has a functional group selected from the group consisting of thiol, sulfide, disulfide, silnane, carboxylic, amine, alcohol, aldehyde, epoxy, alkylhalide, alkyl, alkene, alkyne, aryl, and a combination thereof.

16. The method for immobilizing a molecule according to claim 1, wherein the linker has a functional group selected from the group consisting of carboxylic, amine, alcohol, aldehyde, epoxy, thiol, sulfide, disulfide, alkylhalide, alkyl, al ene, alkyne, aryl, and a combination thereof.

17. The method for immobilizing a molecule according to claim 1, wherein the molecule with physiological activity and the linker is connected by a covalent bond, an ionic bond, a coordinate bond, a hydrogen bond, packing or a combination thereof.

18. The method for immobilizing a molecule according to claim 1, wherein the molecule with physiological activity and the linlcer is connected by an amide bond, an amine bond, a sulfide bond, a disulfide bond, an ester bond, an ether bond, or a combination thereof.

19. The method for immobilizing a molecule according to claim 18, wherein an amine group of the molecule and a carboxylic group of the linker are connected through an amide bond.

20. The method for immobilizing a molecule according to claim 18, wherein a carboxylic group of the molecule and an amine group of the linker are connected through an amide bond.

21. The method for immobilizing a molecule according to claim 18, wherein an amine group of the molecule and an aldehyde group of the linker are connected through an imine bond.

22. The method for immobilizing a molecule according to claim 18, wherein an aldehyde group of the molecule and an amine group of the linker are connected through an imine bond.

23. The method for immobilizing a molecule according to claim 18, wherein a thiol group of the molecule and a thiol group of the linker are connected through a disulfide bond.

24. The method for immobilizing a molecule according to claim 2, wherein the linlcer having a reactive functional group is selected from the group consisting of mercaptocarboxylic acid, mercaptoaminoalkane, mercaptoaldehyde, dimercaptoalkane, carboxylic group, thiol group, alcohol group, aldehyde group or amine group, and the linker having a non-reactive end group is selected from the group consisting of mercaptoalkane, mercaptoalcohol, sulfide, and disulfide.

25. The method for immobilizing a molecule according to claim 24, wherein the linlcer having a reactive functional group is mercaptocarboxylic acid or mercaptoaminoalkane, and the linker having a non-reactive endl group is mercaptoalcohol or mercaptoalkane.

26. The method for immobilizing a molecule according to claim 24, wherein the linker having a reactive functional group is mercaptoaldehyde, and the linlcer having a non-reactive end group is mercaptoalcohol or mercaptoalkane.

27. The method for immobilizing a molecule according to claim 24, wherein the linker having a reactive functional group is dimercaptoalkane, and the linker having a non-reactive end group is mercaptoalcohol or mercaptoalkane.

28. The method for immobilizing a molecule according to claim 24, wherein mercaptocarboxylic acid is 11-mercaptoundodecanoic acid.

29. The method for immobilizing a molecule according to claim 24, wherein mercaptoalcohol is 6-mercapto-l-hexanol, and mercaptoalkane is 1-heptanthiol.

30. The method for immobilizing a molecule according to claim 3, wherein the rate of linlcer having a reactive functional group is 0.05 to 50% of total linkers.

31. The method for immobilizing a molecule according to claim 30, wherein the rate of linlcer having a reactive functional group is 0.05 to 30%> of total linkers.

32. The method for immobilizing a molecule according to claims 1, further comprising the step of removing the compound selectively bound to the molecules from the immobilized molecules.

33. An active-site-masked molecule with physiological activity, immobilized on a support according to any one of claims 1 to 32.

34. A molecules with physiological activity, immobilized on a support, from which a compound selectively bound thereto are removed, according to the method of claim 32.