WO2002074993A1 - A method for immobilizing molecules with physiological activity - Google Patents
A method for immobilizing molecules with physiological activity Download PDFInfo
- Publication number
- WO2002074993A1 WO2002074993A1 PCT/KR2000/001104 KR0001104W WO02074993A1 WO 2002074993 A1 WO2002074993 A1 WO 2002074993A1 KR 0001104 W KR0001104 W KR 0001104W WO 02074993 A1 WO02074993 A1 WO 02074993A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- molecule
- immobilizing
- group
- molecule according
- bond
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N11/00—Carrier-bound or immobilised enzymes; Carrier-bound or immobilised microbial cells; Preparation thereof
- C12N11/02—Enzymes or microbial cells immobilised on or in an organic carrier
- C12N11/06—Enzymes or microbial cells immobilised on or in an organic carrier attached to the carrier via a bridging agent
Definitions
- the present invention relates to a method of immobilizing a molecule with physiological activity on the surface of a supporting material.
- this invention relates to an effective method of immobilizing a molecule with physiological activities using the masking technology over the active sites of physiologically active molecules so as to maintain the physiological activities of immobilized molecules. Also, this invention relates to physiologically active molecules immobilized on a solid phase substrate according to the method.
- bio-molecules such as nucleic acids, proteins, enzymes, antigens, antibodies, and etc.
- the semiconductor technology enables bio-molecules, i.e., physiologically active molecules to be immobilized inside the restricted area on a tiny silicon chip.
- biotechnology comprising biochemical- screening technology has an ability to extract useful and vast information from the chip. Therefore, an effective method of immobilizing physiologically active molecules has been desirable in the field of drug development, chip development for a small diagnostic chip or a lab-on-a-chip(LOC), and various applications using the physiologically active molecules, which include separation process and inhibition process in biotechnology.
- LOC lab-on-a-chip
- a conventional method of immobilizing molecules with physiological activity introduces linkers of multiple functional groups on a solid phase substrate to build a support. Because of the multiple functional groups of the linkers and physiologically active molecules, the conventional method usually produces non-specific chemical bonds in-between functional groups. That is, through the reaction, the physiologically active molecules are immobilized by various kind of bonding including covalent bonding, ionic bonding, coordinate bonding, hydrogen bonding, packing, and etc., between amine groups, carboxylic groups, alcohol groups, aldehyde groups, thiol groups, and etc. existing on the surfaces of either physiologically active molecules or a support.
- a physiologically active molecule has a single or multiple active sites necessary for the expression of its specific activity.
- the active site contributes to the specific activity while forming a complex with specific compounds comprising a substrate of the molecules, a coenzyme, a corresponding antibody, an antigen, and etc.
- Many conventional immobilization methods fix linkers on the reactive functional groups of a solid phase substrate using a method of either physical adsorption or chemical reaction forming a covalent bond or a coordinate bond.
- a conventional immobilization method using said non-specific chemical bonds has following problems. Firstly, a plurality of chemical bonds can be formed between a physiologically active molecule and a support during the immobilization process. It is because there are several reactive functional groups on the surfaces of both. Therefore, nonspecific immobilization on various sites of a molecule often causes structural denature, destruction, and eventually, rapid loss of the physiological activity of an immobilized molecule. Secondly, the lack of specificity in the immobilization process can make reactions happen either directly on or near the active sites of a physiologically active molecule. Chemical bonds inside or around active sites of a physiologically active molecule affect an activity of the immobilized molecule due to the direct blocking or inliibition for complex formation. Therefore, the activity maintenance rate of an immobilized molecule is decreased.
- Said immobilization method using non-specific chemical bonds causes both steric hindrance of active sites of a physiologically active molecule and modification of the structure of a molecule. Therefore, the activity of a physiologically active molecule can be rapidly decreased during the practical immobilization process, and accordingly, the unit activity of a physiologically active molecule per unit area is decreased due to the deteriorated activity maintenance rate.
- an immobilization method which prevents direct damage on active sites of a molecule, were developed.
- the direct damage is resulted from chemical bonds over or near active sites.
- an activity maintenance rate were improved by increasing the unit activity per unit area of an immobilized molecule, specifically a physiologically active molecule.
- the present invention is directed to a method immobilizing a physiologically active molecule, which does not cause steric hindrance or structural modification of active sites by masking active sites of a physiologically active molecule.
- This invention is also directed to a method immobilizing a physiologically active molecule, which increases the unit activity per unit area of the molecule, there by improves activity maintenance rate.
- This invention is related to a method immobilizing a physiologically active molecule in order to be applied to the field of bio-chips including DNA chips and protein chips.
- the invention is also related to immobilized and physiologically active molecules having an excellent activity maintenance rate.
- the present invention directed to an effective method to immobilize a physiologically active molecule, maintaining the highest physiological activity comprises following steps: (a) in one of its methods aspects, this invention is directed to a step in which a physiologically active molecule reacts to a corresponding compound binding to the active site of the physiologically active molecule for the purpose of masking active sites of the molecule;
- this invention in one of its methods aspects, is directed to a step in which useful linkers are introduced on the surface of a solid phase substrate to form a support for immobilization of a molecule having masked active sites obtained from the step of (a);
- this invention in one of its methods aspects, is directed to a step in which the reaction rate is controlled during the reaction between molecules of masked active sites from the step of (a) and linkers in a support from the step of (b); and
- this invention in one of its methods aspects, is directed to a steps in which a molecule of masked active sites from the step (a) is immobilized on the surface of a support, reacting to the linkers formed on the surface of a solid phase substrate in the step of (b).
- a physiologically active molecule forms a complex with a corresponding compound that selectively binds to active sites of a physiologically active molecule.
- This masking step may precede the other immobilization steps for physiologically active molecules. Otherwise, the masking reaction may be simultaneously conducted during the other immobilization steps by direct adding of corresponding compounds for masking to an immobilization solution.
- a physiologically active molecule can be selected from the groups consisting of proteins, enzymes, antigens, antibodies, and etc.
- Each corresponding compound for masking active sites of the molecules is preferably selected either from the groups consisting of substrates, inhibitors, cofactors, chemical deformants, analogues, and derivatives thereof in the case of masking enzymes, or from the groups consisting of antigens, antibodies, and deformants thereof in the case of masking antibody and antigen.
- DNA, RNA, derivatives thereof, or analogues thereof can be used to mask active sites of enzymes whose substrates are DNA, and etc.
- antigens, antibodies, derivatives thereof, or analogues thereof can be used to mask active sites of corresponding antibodies or antigens.
- a masking compound can form a complex with a physiologically active molecule by binding to one active site or more of the molecule.
- various kinds of reaction can be used to form chemical bonding such as covalent bonding, ionic bonding, coordinate bonding, hydrogen bonding, and etc., or physical bonding such as dipole-dipole interaction, packing, and etc., or several combinations thereof. Depending on the case, it takes from a few seconds to more than 24 hours forming a complex.
- a reaction pH does not need to be specific other than the case that a physiological activity of a molecule is inhibited. However, it is preferred to optimize the pH range of a reaction, where selective masking of specific active sites is possible. It is also desirable to maintain a protection (masking) ratio of a physiologically active molecule in between 5% and 100%.
- Reactive functional groups on or near active sites of a physiologically active molecule can be protected from chemical or physical binding direct to reactive functional groups on a support.
- selective masking of active sites occurs while forming a complex of a physiologically active molecule and a corresponding selective compound.
- a physiologically active molecule whose active sites are masked can be immobilized on a support where multiple reactive functional groups are introduced on a solid phase substrate.
- a solid phase substrate is a common designation of a material on which a plurality of reactive functional groups can be introduced as linkers inside a specific surface area where physiologically active molecules would be immobilized.
- Introduction of the reactive functional groups on a solid phase substrate occurs by forming a thin film layer of linkers having reactive functional groups over the surface of a substrate.
- Linkers having reactive functional groups form a thin film layer on the surface of a solid phase substrate using various linkages including a covalent bond, an ionic bond, a coordinate bond, a hydrogen bond, packing, or several combinations thereof.
- a functional group of a linker can be selected from several functional groups consisting of a thiol group, a sulfide group, a disulfide group, a silane groups such as an alkoxysilnae group, a halogen silane group, and etc., a carboxylic group, an amine group, an alcohol group, an epoxy group, an aldehyde group, an alkylhallide group, an alkyl group, an alkene group, an alkyne group, an aryl group, and mixtures thereof.
- a solid phase substrate in this invention may be selected from a metal group consisting of Au, Ag, Pt, Cu, and etc., a nonmetal group consisting of silicone wafer, glass, silica, fused silica, etc., a semiconductor group and an oxide thereof, organic or inorganic polymer, dendrimer, solid or liquid phase polymer, and mixtures thereof.
- a solid phase substrate may be shaped in various forms such as planar, spherical, linear, porous, micro fabricated gel pad, nano particle, and etc. It may also include materials of various sizes more than nm scale for multiple introductions of reactive functional groups.
- Various sizes of substrate more than nm scale can be used because the distance between atoms in a molecule is in a A scale, and a size of a physiologically active molecule is in a range of a few nm to tens of nm.
- any size of a substrate can be used only if multiple introductions of reactive functional groups are possible.
- the reactive functional group of linkers consist of carboxylic, amine, alcohol, epoxy, aldehyde, thiol, sulfide, disulfide, alkyl halide, alkyl, alkene, alkyne, aryl, etc., and combinations thereof.
- the above reactive functional group of linkers is also used as a linking group to immobilize a physiologically active molecule on a support.
- Chemical or physical reaction resulting covalent bonding, ionic bonding, coordinate bonding, hydrogen bonding, or combinations thereof occurs between reactive functional groups of linkers and a physiologically active molecule.
- an amide bond, an amine bond, a sulfide bond, a disulfide bond, an ester bond, an ether bond, or combinations thereof can be produced between functional groups in a support and a physiologically active molecule.
- amine group of a physiologically active molecule connected to carboxylic group of a linker by an amide bond; amine group of a physiologically active molecule to aldehyde group of a linker by an imine bond; and thiol group of a physiologically active molecule to thiol group of a solid phase substrate by disulfide bonds.
- active sites of a physiologically active molecule are masked or protected by compounds selectively binding thereto, too many chemical bonds between a physiologically active molecule and reactive functional groups of a support through immobilization may destroy a tertiary structure of the molecule. It affects the structure of active sites, and gradually decreases the activity maintenance rate of an immobilized molecule.
- a down-kinetic-regulation technique in reaction kinetics is adopted to prevent the decrease in activity maintenance rate during the immobilization process. It means that the probability of immobilization is controlled to be low. However, in such a case that the down-kinetic-regulation technique is used excessively, the unit activity per unit area of a physiologically active molecule can be reduced concurrently with the decline of immobilization efficiency. Accordingly, it is preferable to optimize the reaction rate, while optimizing the other kinetic variables, thereto minimize the probability of multiple bond formation in immobilization and, simultaneously, maximize the activity maintenance rate.
- mole fractions of reactive functional groups on the surface of a support are controlled in the invention. Also, the concentration of a physiologically active molecule, pH of the reaction solution, reaction time, reaction temperature, and kinds of coupling reagents are regulated to maximize the efficiency in immobilizing molecules with physiological activity.
- mole fractions of reactive functional groups for immobilization existing on the surface of a support is controlled by introducing two kinds of thiol molecules having a different terminal group as a reactive functional group.
- One of the thiol molecules has comparatively long alkyl chain having a reactive functional group at the end, which is for immobilization of a physiologically active molecule.
- the other, a short-length thiol molecule preferably has non-reactive terminal group and is used to mask a support.
- the former thiol molecule is selected from the groups consisting of mercaptocarboxylic acid like 11-mercaptoundodecanoic acid, mercaptoaminoalkane, mercaptoaldehyde, dimercaptoalkane, and sulfide and disulfide groups having a reactive functional group such as carboxy, thiol, alcohol, aldehyde, amine, and etc.
- the latter thiol molecule is selected from the groups consisting of mercaptoalcohol like 6-mercapto-l-hexanol, mercaptoalkane like 1-hepatanethiol, and sulfide and disulfide groups having other non-reactive ending groups.
- the thiol molecule of a reactive functional group for immobilization is mercaptocarboxylic acid or mercaptoaminoalkane
- mercaptoalcohol or mercaptoalkane is used as the thiol molecule of a non-reactive terminal group
- the thiol molecule of a reactive functional group for immobilization is mercaptoaldehyde or dimercaptoalkane
- mercaptoalcohol or mercaptoalkane is used as the thiol molecule of a non-reactive terminal group.
- the mole fraction of a linker having a reactive functional group for immobilization is preferable approximately in the range between 0.05 and 50 %, more preferable between 0.05 and 30 % of total introduced linkers.
- the mole fraction of a linker having a reactive functional group for immobilization is more than 50%, multiple chemical bonds are formed between a physiologically active molecule and a support, and decrease of the activity of a immobilized molecule would be caused.
- the mole fraction is lower than 0.05%, the efficiency of immobilization and the activity maintenance rate is reduced, so the unit activity per unit area is decreased.
- a reactive functional group introduced on a support is activated by a coupling reagent such as l-ethyl-3-(3-dimethylaminopropyl)carbodiimide(EDC), N- hydroxysuccineimide (EDC-NHS), SOCl 2 , etc. Then, a physiologically active molecule is immobilized on a support using the activated linkers.
- a coupling reagent such as l-ethyl-3-(3-dimethylaminopropyl)carbodiimide(EDC), N- hydroxysuccineimide (EDC-NHS), SOCl 2 , etc.
- the concentration of a physiologically active molecule is preferably between 0.1 ⁇ g/ml and 1 mg/ml
- reaction pH is preferably between 4 and 10
- reaction time is preferably in the range of a few seconds to 24 hours.
- This invention may also comprise one additional step (e) where a masking compound selectively bound to active sites of an immobilized molecule with physiological activity is removed from the immobilized molecule.
- a masking compound is removed to expose active sites of a physiologically active molecule, thereby to minimize the deformation of active sites and to increase the activity maintenance rate.
- the masking compounds can be removed by heating, hydrolysis, dilution, dialysis, the change of pH, and etc.
- This invention comprises the method immobilizing a physiologically active molecule whose active sites are masked, the method controlling the immobilization rate to minimize the number of bonds between a physiologically active molecule and the surface of a support, thereby preventing or minimizing damage on the active sites of a physiologically active molecule, and the method maximizing the activity of an immobilized molecule with physiological activity per unit area by increasing the activity maintenance rate.
- BRIEF DESCRIPTION OF THE DRAWINGS Fig. la is an agarose-gel fluorescent photograph showing the activity of the Taq
- DNA polymerase immobilized on surface of a support either using the protected immobilization method (PIM) of this invention or using a conventional random immobilization method (RIM). It shows the aspect of activity change according to the change in a mole fraction of 1 1-mercaptoundodecanoic acid in a solution containing thiol molecules, which is for introduction of carboxylic group.
- PIM protected immobilization method
- RIM random immobilization method
- Fig. lb is a graph showing the relative activity of a Taq DNA polymerase immobilized on the surface of a support either by PPM or by a conventional RIM.
- Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig. la) using densitometer.
- Fig. 2a is an agarose-gel fluorescent photograph of the PCR products, showing the masking (protection) effect on the relative enzyme activity according to the invention.
- the product of PCR using a Taq DNA polymerase immobilized by PIM was analyzed to determine the effect of a masking (protection) ratio on the activity of an immobilized Taq DNA polymerase. Partially double-stranded DNA was used to protect active sites of a Taq DNA polymerase.
- Fig. 2b is a graph showing an effect of the masking (protection) ratio on the relative enzyme activity when using PIM to immobilize a Taq DNA polymerase.
- Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.2a) using densitometer.
- Fig. 3a is an agarose-gel fluorescent photograph of the PCR products showing an effect of pH in an immobilization reaction on the relative activity of the Taq DNA polymerase immobilized by PIM.
- Fig. 3b is a graph showing an effect of pH in an immobilization reaction on the relative activity of the Taq DNA polymerase immobilized by PIM. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.3a) using densitometer.
- Fig. 4a is an agarose-gel fluorescent photograph of PCR products showing change in the relative enzyme activity of the Taq DNA polymerase immobilized by PIM, according to the time course of immobilization reaction.
- Fig. 4b is a graph showing change in the relative enzyme activity of the Taq DNA polymerase immobilized by PIM, according to the time course of immobilization reaction. Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.4a) using densitometer.
- Fig. 5a is an agarose gel fluorescent photograph of PCR products, showing the activity of a Taq DNA polymerase either in an immobilized condition of this invention using
- Fig. 5b is a graph showing the activity of a Taq DNA polymerase either in an immobilized condition of this invention using PIM or in a dissolved condition, corresponding on the each cycle number of PCR reaction.
- Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.5 a) using densitometer.
- Fig. 6a is an agarose-gel fluorescent photograph of PCR products, showing the activity change of a Taq DNA polymerase immobilized by PIM according to the total amount of a Taq DNA polymerase, as the number of monolayers, used in immobilization.
- Fig. 6b is a graph showing an effect of the total amount of a Taq DNA polymerase, as the number of monolayers, used in the immobilization on the relative enzyme activity of a
- Taq DNA polymerase immobilized by PIM Each relative enzyme activity was evaluated through scanning of an agarose gel (Fig.5a) using densitometer.
- Fig. 7 is a graph showing the effect of the mole fraction of 11-mercaptoundodecanoic acid in the mixed thiol solution, introduced as a carboxylic group, on the activity of an immobilized anti-DNA antibody.
- Fig. 8 is a graph showing the effect of the concentration of a double-stranded DNA on the activity of an anti-DNA antibody immobilized using either PIM or RIM.
- Example Example 1 Immobilization of the Taq DNA polymerase a) Masking of active sites of the Taq DNA polymerase
- AmpliTaq GoldTM DNA polymerase purchased from Perkin Elmer Company was used as the Taq DNA polymerase.
- the polymerase is an enzyme with a molecular weight of 94 kDa consisting of 832 amino acids, and is chemically modified using heat-activation at 95 ° C for 10 minutes.
- a buffer solution in which a KS primer and a single stranded DNA (ss-DNA) consisting of 65 nucleic acids of the sequences shown below were mixed with a mole ratio of 1 :1, was incubated at 94 ° C for 10 minutes, and then it was slowly cooled down to 35 ° C (approximately, 1-2 minutes were required). During the incubation, a ss-DNA of 65 nucleic acids and a KS primer were annealed to produce partially double-stranded DNA. An appropriate mole of the Taq DNA polymerase was added to the solution, and the solution was incubated for 10 minutes at 72 ° C in a dry bath.
- ss-DNA single stranded DNA
- the solution was transferred to a 50 ° C dry bath and incubated for 20 minutes to carry out the masking reaction on active sites of the Taq DNA polymerase.
- the Taq DNA polymerase binds to 3' end of the partially double- stranded DNA where the structure of DNA changes from a double-stranded form to a single stranded form (S.H. Eom, J. Wang, T.A. Steitz, Nature, vol. 382, pp. 278-281, 1996), thereby active sites are protected.
- a ss-DNA of 65 nucleic acids and a KS primer were synthesized using a DNA synthesizer.
- the optimum pH for the masking reaction was pH 8.3, at which the Taq DNA polymerase has the highest activity.
- a glass fragment the dimension of 3.0 mm x 5.0 mm, was used as a substrate after vacuum-coating with Au to a thicl ⁇ iess of approximately 1000 A on the surface.
- the Au-coated glass fragment was immersed in Piranha solution at the temperature between 60 and 70 ° C for 10 to 15 minutes, and was washed with deionized water and then with the absolute ethanol right before every use.
- a thiolate-forming reaction between a linker of the thiol group and Au was carried out to build a monolayer film of thiol molecules (C.B. Bain, E.B. Troughton, Y.-T. Tao, J. Evall, G.M. Whitesides, and R.G. Nuzzo, J. Am. Chem. Soc, vol. I l l, pp. 321-335, 1989).
- a solution containing two kinds of thiol molecules i.e. one of a reactive functional group for immobilization and one of a non- reactive end group, was used.
- the mole fraction of a thiol molecule having a reactive functional group was tailored between 0 and 100 % to optimize the mole fraction of a reactive functional group on the surface of a support in immobilization.
- a thiol molecule introducing a carboxylic group of a reactive functional group for immobilization 11- mercaptoundodecanoic acid having relatively long alkyl chain was used.
- 6-mercapto-l-hexanol was used as a thiol molecule having a non-reactive end groups.
- An Au-coated glass substrate was exposed to 100 ⁇ i of ethanol solution containing thiol molecules whose total concentration of 2 mM. It was incubated at room temperature for 2 hours. Then, the substrate was washed using absolute ethanol thereby completed the introduction of carboxylic groups on the surface of a Au-coated substrate.
- reactive functional groups are spatially separated and protruded from the other end groups in the monolayer film of thiol molecules. It enables free movement of a physiologically active molecule after immobilization and reduces the effects of molecular interaction usually generated by the monolayer film of thiol molecules, thereby improves activity maintenance rate of immobilized physiologically active molecules.
- the substrate was taken out from the ethanol solution and re-incubated in the solution of the Taq DNA polymerase having the masked active sites. During incubation, an amide bond (-CO- NH-) is formed between an activated carboxylic group of a thiol molecule in monolayer film
- Example 2 Immobilization of an anti-DNA antibody a) Masking of active sites of an anti-DNA antibody An anti-DNA antibody recognizable of either a single or a double-stranded DNA, which is a monoclonal antibody of IgG2b isotype expressed in the abdominal cavity of a mouse that is immunized by the calf thymus DNA as an immunogen, was purchased from
- the antibody solution has total protein concentration of 25 g/L, and approximately 10% of which is the anti-DNA antibody.
- ⁇ -35S-dATP was mixed with an amount corresponding to 2% of total dNTPs in the solution of PCR reaction.
- KS primer 5 CGAGGTCGACGGTATCGATAAAAGAAAAGAAAGAATTC AAGAAAAGAAAAGG
- a glass fragment the dimension of 12.7 mm x 12.7 mm, was used as a substrate after vacuum-coating with Au to a thickness of approximately 1000 A on the surface.
- the Au-coated glass fragment was immersed in Piranha solution at a temperature between 60 and 70 ° C for 10 to 15 minutes, and was washed with deionized water and then with the absolute ethanol right before every use.
- 1 -Heptane thiol was used as the thiol molecule having a non-reactive end group.
- the monolayer of 11-mercaptoundodecanoic acid mixed with 1 -heptane thiol was formed on the surface of Au-coated substrate using the same method described in Example 1.
- the substrate was taken out from the MES buffer and re-incubated in the solution of the anti-DNA antibody whose active sites were masked.
- the total amount of anti-DNA antibody was about 33 fmol in the solution.
- the anti-DNA antibody was immobilized using an amide bond (-CO-NH-) between an activated carboxylic group on the surface of a support (sulfo- NHS ester) and a primary amine group of the antibody (-NH 2 ) (J. V. Staros, R. W. Wright, and D. M. Swingle, Anal Biochem., vol. 156. pp. 220-222, 1986; V. M. Mirsky, M.
- the immobilization reaction was conducted at the temperature of 10 ° C for 2 hours in the MES buffer solution (pH
- Example 3 Activity measurement of the immobilized Tag DNA polymerase The relative activity of an Taq DNA polymerase was calculated from the amplified amount of a template DNA after the polymerase-based cycled reaction (PCR) using the corresponding Taq DNA polymerase.
- the PCR solution of 50 ⁇ l contained 25 fmol of the 65 bp ss-DNA and either of 10 pmol of the KS primer or the SK primer.
- 10X PCR buffer solution (pH 8.3) from Perkin Elmer Company was 10-fold diluted to be used as a reaction buffer. A profile of the temperature cycle in the PCR is shown below: Initial denaturing step: 94 ° C, 10 min
- PCR cycle (20-45 cycles): 94 ° C, 30 s; 50 ° C, 60 s; 72 ° C , 30 s
- 20 ⁇ l of resulting solution from PCR was talcen and analyzed using agarose gel electrophoresis.
- the DNA separated in a gel can be dyed by ethidium bromide using a conventional method.
- the DNA amplified by PCR and separated by agarose gel electrophoresis was visualized using the fluorescence of ethidium bromide under UV radiation, and then quantified using a densitometer.
- Example 4 Confirmation for the effect of the mole fraction of a carboxylic group on the activity of an immobilized Taq DNA polymerase.
- Immobilization reaction was conducted in phosphate buffer solution (pH 8.3) at 50 ° C for 30 minutes. 0.75 pmol of the Taq DNA polymerase and 1.5 pmol of a DNA for masking active sites were added in 50 ⁇ l of the above buffer solution. 0.75 pmol of the Taq DNA polymerase is corresponding to the amount capable of forming triple layers of film on the 3 mm x 5 mm area of Au-coated substrate. After PCR of 35 cycles, the relative activity of the immobilized Taq DNA polymerase was calculated using the same method described in Example 3. Agarose gel fluorescent photograph of the PCR product was shown in Fig. la.
- the leftmost lane represents the DNA marker to indicate a size of each ds-DNA
- the rightmost lane represents the standard PCR result using a dissolved Taq DNA polymerase of the amount corresponding to build a monolayer film.
- the other lanes are for the PCR results when using the immobilized Taq DNA polymerase.
- the number at the bottom of each lane indicates the each mole fraction (%) of 11-mercaptoundecanoic acid in the total amount of thiol molecules, which was used to introduce carboxylic groups.
- the graph in Fig. lb shows the relative activity of the Taq DNA polymerase calculated from the Fig. la.
- the x-axis indicates mole fraction (%) of 11- mercaptoundecanoic acid used to introduce carboxylic groups in the total amount of thiol molecules.
- the y-axis indicates a relative activity of the immobilized Taq DNA polymerase, which is calculated on the basis of the standard activity measured when using the dissolved Taq DNA polymerase of the amount corresponding to build a monolayer film.
- the results by PIM of this invention where active sites of a Taq DNA polymerase were masked, were indicated by black dot ( • ).
- the results by PIM with the masked active sites showed higher activity than the results by RIM with the exposed active sites in the whole range of mole fraction of the carboxylic group.
- the Taq DNA polymerase immobilized by PIM showed its best activity at the mole fraction of approximately 5% carboxylic group. This indicates the fact that the activity of a immobilized polymerase having masked active sites can be maximize by controlling the mole fraction(%) of a carboxylic group on the surface of a support in terms of kinetics. In other words, the activity of an immobilized enzyme can be maximize by a kinetic control combining both the prevention of activity reduction occurred by multiple bond formation and the improvement of the activity maintenance by applying the masking technique on active sites.
- Example 5 The effect of a masking (protection) ratio on the activity of an immobilized Taq DNA polymerase.
- the activity of an immobilized Taq DNA polymerase was measured on various mole ratios of a partially double-stranded DNA versus the mole of a Taq DNA polymerase, in the range between 0 and 2, as shown in Fig. 2a and Fig. 2b.
- the leftmost land and the rightmost lane in Fig. 2a are the same as in Fig. la, and the other lanes indicate the results of PCR using an immobilized Taq DNA polymerase of various protection (masking) ratios.
- the number at the bottom indicates a percentage (%; multiplied by 100) value of the mole ratio of partially double-stranded DNA used for masking active sites versus the mole of a Taq DNA polymerase.
- Figs. 2a and 2b show the fact that a partially double-stranded DNA and a Taq DNA polymerase form an 1 : 1 complex in masking reaction(S.H. Eom, J. Wang, T.A.Steitz, Nature, vol. 382, pp. 278-281, 1996).
- Example 6 The effect of pH in a immobilization reaction on the activity of an immobilized Taq DNA polymerase
- the activity of an immobilized Taq DNA polymerase was measured on the various pH condition with the fixed mole fraction (5.0%) of 11-mercaptoundecanoic acid used to introduce a carboxylic group on the surface of Au-coated substrate.
- the other immobilization and PCR conditions were identical with the conditions in Example 4.
- the results are represented in Figs. 3a and 3b.
- the leftmost lane and the rightmost lane of Fig. 3a were the same as in Fig. la, and the other lanes indicate the results of PCR using an Taq DNA polymerase immobilized in various pH conditions.
- the pH of a buffer solution used in immobilization reaction is indicated at the bottom of each lane.
- Figs. 3a and 3b show the fact that the efficiency in a masking reaction is maximized at pH 8.3 which is the optimum pH of a Taq DNA polymerase for its enzyme activity.
- Example 7 The effect of immobilization time on the activity of an immobilized Tag
- the relative activity of an immobilized Taq DNA polymerase was measured at the various immobilization time with the fixed mole fraction (5.0%) of 1 1-mercaptoundecanoic acid used to introduce a carboxylic group on the surface of Au-coated substrate.
- the other immobilization and PCR conditions were identical with the conditions in Example 4.
- the results are represented in Fig. 4a and Fig. 4b.
- the leftmost and rightmost lane in Fig. 4a are the same as in Fig. la, and the other lanes indicate the results of PCR using an immobilized Taq DNA polymerase in various immobilization time.
- the immobilization reaction time was indicated as minutes at the bottom of each lane.
- Example 8 The activity comparison of a Taq DNA polymerase between in a dissolved condition and in an immobilized condition.
- the mole fraction of 11-mercaptoundecanoic acid in the total amount of thiol molecules was fixed to 5.0%.
- the total amount of a Taq DNA polymerase used in immobilization reaction was 0.75 pmol, which is a corresponding amount to build triple layers of the enzyme.
- the enzyme was also immobilized in the same immobilization condition as in Example 4.
- the activity of a Taq DNA polymerase either in a dissolved condition or in an immobilized condition was measured on the various numbers of PCR cycle. The results are represented in Figs. 5a and 5b. In Fig. 5a, the number of each PCR cycle is indicated at the bottom of each lane.
- Figs. 5a and 5b show the fact that the activity aspect of an immobilized Taq DNA polymerase observed through overall scope is similar to that of a dissolved Taq DNA polymerase, which insists that the maintenance rate of activity per unit molecule was maximized.
- Example 9 The effect of the total amount of a Taq DNA polymerase added in the immobilization reaction on the activity of a Taq DNA polymerase after immobilization
- the mole fraction of 11-mercaptoundecanoic acid in the total thiol molecules used to introduce carboxylic groups on the surface of a Au-coated substrate was fixed to 5.0%.
- the relative activity of a Taq DNA polymerase was measured while changing the total amount of a Taq DNA polymerase added in immobilization reaction.
- a Taq DNA polymerase used in the immobilization reaction is indicated at the bottom of each lane, as a number of monolayers in the range between 0 and 10.
- the mole concentration of a partially double-stranded DNA used to mask active sites of an enzyme was as twice as the total mole of a Taq DNA polymerase added in the immobilization.
- the other immobilization and PCR conditions were the same as in Example 4.
- Figs. 6a and 6b the leftmost lane and the rightmost lane in Fig. 6a are the same as in Fig. la, and the other lanes are the results of PCR amplification by the Taq DNA polymerases immobilized using various amounts of Taq DNA polymerase.
- Figs. 6a and 6b show the fact that the activity of an immobilized enzyme, a Taq DNA polymerase, can be increased by controlling the amount of a Taq DNA polymerase used in an immobilization reaction.
- Example 10 Measurement of the activity of an immobilized anti-DNA antibody The activity of an immobilized anti-DNA antibody was measured by quantifying the beta ray emitted from a 68 bp ds-DNA labeled with 35 S, used to mask active sites; using beta counter from Beckman (Model LS6500). The beta ray emission was measured by immersing the support having an immobilized antibody into 2 mL solution of scintillation cocktail.
- Example 11 The effect of a mole fraction of a carboxylic group on the surface of a substrate onto the activity of an immobilized anti-DNA antibody
- PIM - the immobilization method where the active sites were masked - generated the higher activity of an antibody than RIM - the conventional immobilization method where the active sites were not masked - in the whole scope of mole fractions of a carboxylic group.
- the activity of a masked antibody was the highest when the mole fraction of a carboxylic group was approximately 8%.
- x-axis is the same as in Fig. lb
- y axis is the relative activity of an antibody quantified by measuring the energy of a beta ray emitted from 35 S-labeled ds-DNA, which is selectively bound to immobilized anti-DNA antibody.
- Example 12 The effect of the concentration of an antigen (a 68 bp ds-DNA) on the activity of an immobilized anti-DNA antibody
Abstract
Description
Claims
Priority Applications (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/KR2000/001104 WO2002074993A1 (en) | 2000-10-04 | 2000-10-04 | A method for immobilizing molecules with physiological activity |
EP00966572A EP1330540A1 (en) | 2000-10-04 | 2000-10-04 | A method for immobilizing molecules with physiological activity |
KR1020037004398A KR20030045087A (en) | 2000-10-04 | 2001-09-29 | Immobilized dna polymerase |
AU2001294299A AU2001294299A1 (en) | 2000-10-04 | 2001-09-29 | Immobilized dna polymerase |
PCT/KR2001/001650 WO2002029027A1 (en) | 2000-10-04 | 2001-09-29 | Immobilized dna polymerase |
US10/406,155 US20040091602A1 (en) | 2000-10-04 | 2003-04-02 | Method for immobilizing biologically active molecules |
US10/406,154 US7238505B2 (en) | 2000-10-04 | 2003-04-02 | Immobilized DNA polymerase |
US11/809,188 US8067174B1 (en) | 2000-10-04 | 2007-05-30 | Polymerase chain reaction (PCR) method for amplifying a DNA template |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/KR2000/001104 WO2002074993A1 (en) | 2000-10-04 | 2000-10-04 | A method for immobilizing molecules with physiological activity |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2001/001239 Continuation-In-Part WO2003008570A1 (en) | 2000-10-04 | 2001-07-20 | A method for immobilizing molecules with physiological activity |
US10/406,155 Continuation-In-Part US20040091602A1 (en) | 2000-10-04 | 2003-04-02 | Method for immobilizing biologically active molecules |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002074993A1 true WO2002074993A1 (en) | 2002-09-26 |
Family
ID=19198277
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2000/001104 WO2002074993A1 (en) | 2000-10-04 | 2000-10-04 | A method for immobilizing molecules with physiological activity |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1330540A1 (en) |
AU (1) | AU2001294299A1 (en) |
WO (1) | WO2002074993A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100953612B1 (en) | 2003-06-02 | 2010-04-20 | 삼성에스디아이 주식회사 | Substrate for immobilizing physiological material, and a method of preparing the same |
US11230610B2 (en) | 2016-12-09 | 2022-01-25 | Seagen Inc. | Bivalent antibodies masked by coiled coils |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4714676A (en) * | 1982-09-16 | 1987-12-22 | Owens-Illinois Glass Container Inc. | Protein modification to provide enzyme activity |
US5932433A (en) * | 1993-07-30 | 1999-08-03 | Affymax Technologies N.V. | Biotinylation of proteins |
US6087188A (en) * | 1992-11-13 | 2000-07-11 | Alk A/S | Two-site immunoassay for an antibody with chemiluminescent label and biotin bound ligand |
-
2000
- 2000-10-04 WO PCT/KR2000/001104 patent/WO2002074993A1/en not_active Application Discontinuation
- 2000-10-04 EP EP00966572A patent/EP1330540A1/en not_active Withdrawn
-
2001
- 2001-09-29 AU AU2001294299A patent/AU2001294299A1/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4714676A (en) * | 1982-09-16 | 1987-12-22 | Owens-Illinois Glass Container Inc. | Protein modification to provide enzyme activity |
US6087188A (en) * | 1992-11-13 | 2000-07-11 | Alk A/S | Two-site immunoassay for an antibody with chemiluminescent label and biotin bound ligand |
US5932433A (en) * | 1993-07-30 | 1999-08-03 | Affymax Technologies N.V. | Biotinylation of proteins |
Non-Patent Citations (2)
Title |
---|
CHRISTOPH ET AL.: "Micropatterned immobilization of a G protein-coupled receptor and direct detection of G protein activation", NATURE BIOTECHNOL., vol. 17, 1999, pages 1105 - 1108, XP002183971, DOI: doi:10.1038/15090 * |
TURKOVA: "Oriented immobilization of biologically active proteins as a tool for revealing protein interactions and function", J. CHROMATOGR. B BIOMED. SCI APPL., vol. 722, 1999, pages 11 - 31, XP004156203, DOI: doi:10.1016/S0378-4347(98)00434-4 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR100953612B1 (en) | 2003-06-02 | 2010-04-20 | 삼성에스디아이 주식회사 | Substrate for immobilizing physiological material, and a method of preparing the same |
US11230610B2 (en) | 2016-12-09 | 2022-01-25 | Seagen Inc. | Bivalent antibodies masked by coiled coils |
Also Published As
Publication number | Publication date |
---|---|
AU2001294299A1 (en) | 2002-04-15 |
EP1330540A1 (en) | 2003-07-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Jia et al. | Molecular assembly of Schiff base interactions: construction and application | |
Jonkheijm et al. | Chemical strategies for generating protein biochips | |
Yang et al. | Programmable target-initiated DNAzyme walker walking along a spatially isolated and highly hybridizable substrate track on a nanoparticle surface | |
US9993794B2 (en) | Single molecule loading methods and compositions | |
US7993891B2 (en) | Method for binding reactive groups in observation area of zero mode waveguide | |
Balamurugan et al. | Surface immobilization methods for aptamer diagnostic applications | |
KR102138195B1 (en) | Site-specific conjugation to antibody lysine residues using solid-phase immobilized microbial transglutaminase MTG and MTG in solution | |
CA2643993C (en) | Methods and arrays for target analyte detection and determination of target analyte concentration in solution | |
JP2009511862A (en) | Reactive surfaces, substrates and surfaces, methods for making and using substrates | |
US20220050049A1 (en) | Methods and systems for integrated on-chip single-molecule detection | |
US20070238679A1 (en) | Articles having localized molecules disposed thereon and methods of producing same | |
US8067174B1 (en) | Polymerase chain reaction (PCR) method for amplifying a DNA template | |
JP5883386B2 (en) | Protein or peptide printing method, protein array or peptide array production method, and functional protein or functional peptide identification method | |
Yu et al. | Electrochemical biosensors with silver nanoparticles as signal labels | |
Dugas et al. | Surface sensitization techniques and recognition receptors immobilization on biosensors and microarrays | |
Chatzipetrou et al. | Direct creation of biopatterns via a combination of laser-based techniques and click chemistry | |
EP1330540A1 (en) | A method for immobilizing molecules with physiological activity | |
US20040091602A1 (en) | Method for immobilizing biologically active molecules | |
Lim et al. | Protected immobilization of Taq DNA polymerase by active site masking on self-assembled monolayers of ω-functionalized thiols | |
WO2003008570A1 (en) | A method for immobilizing molecules with physiological activity | |
WO2002029027A1 (en) | Immobilized dna polymerase | |
JP2008271876A (en) | Microreactor, multi-step enzymic reaction method using the same, and method for continuous synthesis of sugar chain | |
JP4797084B2 (en) | Biosensor substrate pattern manufacturing method and biosensor using the same | |
KR20040010640A (en) | A method for immobilizing molecules with physiological activity | |
KR20030088888A (en) | A method for immobilizing molecules with physiological activity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1020037004976 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000966572 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000966572 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1020037004976 Country of ref document: KR |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000966572 Country of ref document: EP |