WO2002066494A2 - Identification and cloning of a novel human gene, ret16, involved in the intracellular signaling cascade - Google Patents
Identification and cloning of a novel human gene, ret16, involved in the intracellular signaling cascade Download PDFInfo
- Publication number
- WO2002066494A2 WO2002066494A2 PCT/US2002/005162 US0205162W WO02066494A2 WO 2002066494 A2 WO2002066494 A2 WO 2002066494A2 US 0205162 W US0205162 W US 0205162W WO 02066494 A2 WO02066494 A2 WO 02066494A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- ret16
- polypeptide
- sequence
- polynucleotide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
Definitions
- the present invention relates to the identification and cloning of a novel full-length human RET16 gene and its encoded polypeptide product, which is expressed in TNF-stimulated human lung microvascular endothelial cells.
- the invention further relates to orthologs of RET16 and the putative role of the RET16 polynucleotide sequence and its encoded product as a cell signaling molecule in the intracellular signaling cascade.
- the present invention also relates to uses of the RET16 polynucleotide, polypeptide and modulators thereof in therapeutics and methods involving inflammation and inflammatory diseases, conditions, or disorders and/or involving diseases associated with uncontrolled cell growth, such as cancers, tumors, neoplasms and the like.
- inflammatory disease is characterized by infiltration of circulating blood cells, e.g., leukocytes, across the endothelium into the tissue.
- circulating blood cells e.g., leukocytes
- a number of key events occur in the endothelial cells that mediate this "gateway" function.
- the endothelial cells express receptors and chemokines that sequentially tether the leukocytes, activate them, cause them to tightly adhere, and extravasate between the endothelial cell junctions. This process is initiated by the production of early inflammatory mediators such as tumor necrosis factor (TNF).
- TNF tumor necrosis factor
- the coordinated stimulation of expression of this series of receptors and chemokines is mediated by intracellular signaling molecules, including transcription factors, kinases and scaffolding proteins. These signaling molecules form a signaling cascade that can be a "master switch” for the development of inflammatory processes. Components of this cascade, such as NF- ⁇ B, are known. The analysis of genes that are differentially expressed in TNF-activated endothelium can help to identify components of the above-described "master switch” cascade.
- the present invention provides the RET16 gene expressed in TNF- alpha-activated human endothelial cells, whose encoded product is regarded to function as a cell signaling molecule involved in the cell signaling cascade.
- Molecules which play a role in the cell signaling cascade are involved in cellular responses to inflammatory agents, such as cytokines, lymphokines, chemokines, leukotrienes and the like.
- RET16 is regarded to be involved in a variety of cell growth-related diseases or disorders.
- RET16 is a cytoplasmic protein having activity as a cell signaling protein.
- One aspect of the invention provides the RET16 polynucleotide sequence as depicted in SEQ ID NO:1.
- the present invention also provides a polynucleotide sequence comprising the complement of SEQ ID NO:1 , or variants thereof.
- the present invention features polynucleotide sequences which hybridize under moderate or high stringency conditions to the polynucleotide sequence of SEQ ID NO:1.
- Another aspect of the invention provides the RET16 polypeptide, encoded by the polynucleotide of SEQ ID NO:1 and having the amino acid sequence of SEQ ID NO:2, or a functional or biologically active portion thereof.
- an isolated, substantially purified RET16 protein is provided.
- Yet another aspect of the present invention provides an isolated polynucleotide sequence (1532 bp) of the human RET16 open reading frame cDNA (SEQ ID NO:3) and the polypeptide sequence encoded by the open reading frame human RET16 and having the amino acid sequence depicted in SEQ ID NO:4, or a functional or biologically active portion thereof.
- the 1532 bp human RET16 (also called RET16.1) open reading frame polynucleotide sequence cloned into a vector has been deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209 on March 7, 2001 under ATCC Accession No. PTA-3161 according to the terms of the Budapest Treaty.
- Vectors containing the cloned RET16 variant cDNAs, i.e., RET16.2 and RET16.3 have also been deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209 on March 7, 2001 under ATCC Accession No. PTA-3161 according to the terms of the Budapest Treaty.
- the present invention provides a RET16 cDNA nucleic acid sequence comprising ATCC Deposit Accession No. PTA- 3161.
- a further aspect of the present invention provides a polynucleotide sequence comprising the complement of SEQ ID NO:3, or variants thereof.
- the present invention features polynucleotide sequences which hybridize under moderate or high stringency conditions to the polynucleotide sequence of SEQ ID NO:3.
- a 630 bp partial nucleic acid sequence of human RET16 (SEQ ID NO:5) is provided.
- Another aspect of the present invention provides variants of RET16.
- an isolated RET16.2 variant polynucleotide (SEQ ID NO:12) and its encoded amino acid sequence (SEQ ID NO:13) are provided.
- an isolated RET16.3 variant polynucleotide (SEQ ID NO:14) and its encoded amino acid sequence (SEQ ID NO:15) are provided. Portions or fragments, preferably functional or biologically active portions or fragments of these sequences are also provided.
- An additional feature of the invention provides mouse and rat orthologs of the human RET16 protein. According to the invention, SEQ ID NO:6 depicts the polynucleotide sequence of the mouse RET16 ortholog.
- SEQ ID NO:7 depicts the amino acid sequence of the mouse RET16 polypeptide ortholog encoded by SEQ ID NO:6.
- SEQ ID NO:8 depicts a partial polynucleotide sequence of the rat RET16 ortholog; and
- SEQ ID NO:9 depicts the amino acid sequence of the partial polypeptide sequence of the rat RET16 ortholog encoded by SEQ ID NO:8.
- compositions comprising the RET16 polynucleotide sequence, preferably human RET16, or a fragment thereof, or the encoded RET16 polypeptide, or a fragment or portion thereof.
- pharmaceutical compositions comprising at least one RET16 polypeptide, or a functional portion thereof, wherein the compositions further comprise a pharmaceutically acceptable vehicle, e.g., a carrier, excipient, or diluent.
- Yet another aspect of the present invention provides N-terminal, C- terminal, or internal deletion polypeptides of the encoded RET16 polypeptides and compositions comprising these deletion polypeptides. Polynucleotides encoding these deletion polypeptides are also provided. The use of the deletion polypeptides as immunogenic and/or antigenic epitopes is described further herein.
- a further aspect of the present invention provides the polynucleotide sequences of RET16.1 , RET16.2, RET16.3 and the RET16 mouse ortholog lacking the initiating start codon, in addition to the resulting encoded polypeptides of RET16.1 , RET16.2, RET16.3 and mouse RET16.
- polynucleotide corresponding to nucleotides 151 through 1575 of SEQ ID NO:1 , and the polypeptide corresponding to amino acids 2 through 476 of SEQ ID NO:2 are provided; the polynucleotide corresponding to nucleotides 114 through 1262 of SEQ ID NO: 12, and the polypeptide corresponding to amino acids 2 through 384 of SEQ ID NO:13 are provided; the polynucleotide corresponding to nucleotides 139 through 1641 of SEQ ID NO:14, and the polypeptide corresponding to amino acids 2 through 502 of SEQ ID NO:15 are provided; and the polynucleotide corresponding to nucleotides 19 through 1443 of SEQ ID NO:6, and the polypeptide corresponding to amino acids 2 through 475 of SEQ ID NO:7. Also provided are recombinant vectors comprising the RET16.1 , RET16.2, RET16.3 and mouse RET16 encoding sequences, and host cells comprising
- Another aspect of the invention provides an antisense of the RET16 nucleic acid sequence, preferably, an antisense to the human RET16 nucleic acid sequence, as well as oligonucleotides, fragments, or portions of the RET16 nucleic acid molecule or antisense molecule. Also provided are expression vectors and host cells comprising polynucleotides that encode the human RET16 polypeptide, or portions or fragments thereof.
- Yet another aspect of the invention provides methods for producing a polypeptide comprising the amino acid sequence depicted in SEQ ID N0:2 or SEQ ID NO:4, or a fragment thereof, comprising the steps of a) cultivating a host cell containing an expression vector containing at least a functional fragment of the polynucleotide sequence encoding the human RET16 polypeptide according to this invention under conditions suitable for the expression of the polynucleotide; and b) recovering the polypeptide from the host cell.
- a further feature of the invention provides antibodies, and binding fragments thereof, which bind specifically to the RET16 polypeptide, or an epitope thereof, for use as therapeutics and diagnostic agents.
- Yet another feature of the invention provides methods for screening for agents or molecules which bind to and/or modulate the RET16 polypeptide, preferably human RET16 polypeptide, e.g., inhibitors, other intracellular signaling molecules and antagonists, as well as modulators, particularly, inhibitors and antagonists, particularly those that are obtained from the screening methods described. Also provided are methods to screen for inhibitors or activators of the interaction, e.g., a binding interaction, of the RET16 protein with one or more other cell signaling proteins.
- Another aspect of the invention provides a substantially purified antagonist or inhibitor of the RET16 polypeptides of the invention, e.g., SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO.13, or SEQ ID NO:15.
- a purified antibody that binds to a polypeptide comprising all or an immunogenic and/or antigenic portion of the amino acid sequence of the RET16 polypeptides of the invention, e.g., SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO.13, or SEQ ID NO:15 is provided.
- Yet another aspect of the invention provides a substantially purified agonist or activator of the RET16 polypeptides of the invention, e.g., SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO.13, or SEQ ID NO:15.
- a further aspect of the invention provides RET16 nucleic acid sequences, polypeptides, peptides and antibodies for use in the diagnosis and/or screening of disorders or diseases associated with expression of the RET16 polynucleotide and its encoded polypeptide involved in the cell signaling cascade as described herein (e.g., see FIG. 9).
- RET16 probes or primers for detecting RET16-related diseases and/or for monitoring a patient's response to therapy or treatments of RET16-associated diseases or disorders.
- the probe or primer sequences comprise nucleic acid or amino acid sequences of RET16 as described herein.
- kits for screening and diagnosis of disorders associated with aberrant or uncontrolled cellular expression of the RET16 polynucleotide and its encoded polypeptide as described herein can be employed for the determination of the nucleotide sequences of human RET16 alleles.
- the kits can comprise reagents and instructions for amplification-based assays, nucleic acid probe assays, protein nucleic acid probe assays, antibody assays, or any combination thereof.
- the invention provides a method for detecting a polynucleotide that encodes the RET16 polypeptide in a biological sample comprising the steps of: a) hybridizing the complement of the polynucleotide sequence encoding SEQ ID NO:2 or SEQ ID NO:4 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting the hybridization complex, wherein the presence of the complex correlates with the presence of a polynucleotide encoding the RET16 polypeptide in the biological sample.
- the nucleic acid material can be further amplified by the polymerase chain reaction prior to hybridization.
- Yet another aspect of this invention provides methods for detecting genetic predisposition, susceptibility and/or response to treatment or therapy of various RET16-associated diseases, disorders, or conditions, as described further herein.
- FIG. 1 presents an 1818 bp polynucleotide sequence of human RET16 DNA of the present invention (SEQ ID NO:1), which comprises the full length sequence of the predicted human RET16 transcript.
- the FIG. 1 nucleic acid sequence (SEQ ID NO:1) comprises the 1532 bp human RET16 open reading frame polynucleotide sequence presented herein as SEQ ID NO:3, (FIG. 4A), as well as additional 3' and 5' sequence.
- the coding sequence (CDS) of RET16 is encompassed by nucleotide 148 to nucleotide 1575 of SEQ ID NO:1.
- FIG. 2 shows the amino acid sequence (SEQ ID NO:2) encoded by the polynucleotide sequence of SEQ ID NO:1.
- the predicted molecular weight of RET16 i.e., RET16.1 , is 52.8 kilodaltons (Kd).
- FIG. 3 presents both the human RET16 polynucleotide coding sequence (SEQ ID NO:1) and the deduced amino acid sequence (SEQ ID NO:2) of the 1818 bp human RET16 sequence.
- the coding sequence begins at the ATG (methionine) codon at nucleotide position numbers 148-150 of the polynucleotide sequence of SEQ ID NO:1.
- FIG. 4A shows the human RET16 open reading frame (ORF) polynucleotide sequence of SEQ ID NO:3.
- FIG. 4B shows the human RET16 amino acid sequence of the polypeptide (SEQ ID NO:4) encoded by the ORF polynucleotide sequence of SEQ ID NO:3.
- FIG. 4C presents the 630 base pair partial nucleic acid sequence of human RET16 cDNA (SEQ ID NO:1)
- FIG. 5 shows the RET16 polynucleotide sequence derived from mouse, i.e., the murine RET16 ortholog, (SEQ ID NO:6).
- the coding sequence (CDS) of murine RET16 is encompassed by nucleotide 19 to nucleotide 1443 of SEQ ID NO:6.
- FIG. 6 shows the amino acid sequence of the murine RET16 polypeptide (SEQ ID NO:7) encoded by the polynucleotide sequence of murine RET16 cDNA (SEQ ID NO:6).
- the predicted molecular weight of mouse RET16 is 51.8 Kd.
- FIGS. 7A-7D show 10 day multiple tissue Northerns (MTNs) probed with the partial cDNA corresponding to the RET16 gene.
- MTNs tissue Northerns
- FIG. 7A presents the results of a human MTN blot in which RET16 transcript was detectable in all tissues, at varying levels.
- FIG. 7A expression was highest in kidney, pancreas and heart, with lower expression levels observed in the placenta, skeletal muscle and liver, and even lower levels in lung and brain.
- FIG. 7B presents the results of a human MTN blot II, in which RET16 transcript was detectable in all tissues, at varying levels.
- FIG. 7A presents the results of a human MTN blot in which RET16 transcript was detectable in all tissues, at varying levels.
- FIG. 7B expression was highest in the testis, with lower expression levels in ovary, prostate, and spleen, and even lower levels in thymus, small intestine, colon and peripheral blood leukocytes.
- FIG. 7C presents the results of a human MTN blot III, in which RET16 transcript was detectable in most tissues. In FIG. 7C, expression was highest in the thyroid, with lower levels observed in stomach, spinal cord, lymph node, trachea, and adrenal gland. RET16 transcript was virtually undetectable in the bone marrow, although a larger approximately 2.4 kb transcript was detected in bone marrow.
- FIG. 7D presents the results of a human cancer cell line MTN blot, in which RET16 transcript was detectable in several tumor lines. In FIG.
- FIG. 8 presents the results of the inhibition of RET16 expression using an antisense oligomer. Shown in FIG. 8 are the levels of RET16 mRNA expression after normalization to GAPDH mRNA expression. Each bar represents the average +/- standard deviation of triplicate transfections. Strong inhibition was observed with oligomer 11587, compared with the control oligomer (76.6%). (See Example 5).
- FIG. 9 presents the results of studies performed to determine the inhibition of E-selectin protein expression on TNF-stimulated HMVEC cells by transfection of antisense E-selectin and antisense RET16 oligonucleotides.
- the cells were transfected with the antisense or control oligonucleotides as desc ⁇ bed in Example 6. The cells were then stimulated for six hours with TNF-alpha and the cell surface expression of E-selectin was determined by an ELISA assay. (See Example 6).
- the bars represent the relative expression of E-selectin on the surface of HVEC.
- FIGS. 10A-10E show various alignments of the human RET16 amino acid sequence with other known and newly-provided sequences.
- the vertical lines between the sequence residues indicate ami ⁇ o acid identity.
- Two dots between sequence residues indicate amino acid similarity.
- One dot between sequence residues indicates amino acid dissimilarity.
- PileUp was used to generate a multiple sequence alignment on SEQ-WEB GCG, the Blosum62 scoring matrix, gap creation penalty of 8, and gap extension penalty of 2.
- PileUp creates a multiple sequence alignment using a simplification of the progressive alignment method of Feng and Doolittle (1987, J. Mol. Evol., 25:351-360). The method used is similar to that described by Higgins and Sharp (1989, CABIOS, 5:151-153).
- FIG. 10A presents a sequence alignment of a portion of the human RET16 amino acid sequence from SEQ ID NO:2 or SEQ ID NO:4, (top line) with a portion of the Het-E-1 amino acid sequence of Podospora anserina (bottom line of sequence).
- the published amino acid sequence of Podospora anserina beta transducin-like protein encoded by the het-e-1 gene (Accession Number L28125) is provided as SEQ ID NO:10.
- FIG. 10A presents a sequence alignment of a portion of the human RET16 amino acid sequence from SEQ ID NO:2 or SEQ ID NO:4, (top line) with a portion of the Het-E-1 amino acid sequence of Podospora anserina (bottom line of sequence).
- the published amino acid sequence of Podospora anserina beta transducin-like protein encoded by the het-e-1 gene (Accession Number L28125) is provided as SEQ ID NO:10.
- FIG. 10B presents a sequence alignment of a portion of the human RET16 amino acid sequence from SEQ ID NO:2 or SEQ ID NO:4, (top line), with a portion of the PKWA amino acid sequence of Thermomonospora curvata (bottom line of sequence).
- the published amino acid sequence of Thermomonospora curvata PKWA (pkwA) gene (Accession Number AF115313) is provided as SEQ ID NO: 11.
- FIG. 10C presents a sequence alignment of the human RET16 amino acid sequence (SEQ ID NO:2 or SEQ ID NO:4), top line, with the murine RET16 amino acid sequence (SEQ ID NO:7), bottom line.
- FIG. 10D presents a sequence alignment of human RET16 amino acid sequence (SEQ ID NO:2 or SEQ ID NO:4), top line, with rat RET16 amino acid sequence (SEQ ID NO:9), bottom line.
- FIG. 10E presents a multiple sequence alignment of human RET16 amino acid sequence (SEQ ID NO:2 or SEQ ID NO:4), (top line) with the Het-E-1 amino acid sequence of Podospora anserina (SEQ ID NO:10), (middle line); and the PKWA amino acid sequence of Thermomonospora curvata (SEQ ID NO:11), (bottom line of sequence).
- FIG. 11 shows reverse transcriptase polymerase chain reaction (RT- PCR) amplification of the human RET16 transcript from a variety of tissue sources (Example 3).
- FIG. 12 shows an electronic Northern depicting human (hu) RET16 expression.
- “Clone count” refers to the number of times that the RET16 sequence appeared in a random analysis of the RET16 clone in the listed tissue libraries (Incyte database), thereby confirming that the RET16 gene is expressed in the listed tissue.
- FIG. 13 shows the partial RET16 polynucleotide sequence isolated from rat (SEQ ID NO:8), i.e., the rat ortholog of the human RET16 gene.
- FIG. 14 shows the amino acid sequence of the rat RET16 partial polypeptide (SEQ ID NO:9) encoded by the polynucleotide sequence of the rat RET16 partial cDNA sequence (SEQ ID NO:8; FIG. 13).
- FIG. 15 shows a multiple sequence alignment of human (SEQ ID NO:2 or SEQ ID NO:4), mouse (SEQ ID NO:7) and rat (SEQ ID NO:9)
- RET16 amino acid sequences using the PileUp program described for FIGS. 10A-10E. Dark highlights indicate conservation among all three orthologs, while the lighter highlights indicate conservation between two of the orthologs. Note that the rat RET16 is only a partial polypeptide sequence. Human RET16 is 82.5% identical to mouse RET16 (muRET16) and 92.9% identical to partial rat RET16 (rRET16). MuRET16 is 98.5% identical to partial rRET16.
- FIG. 16 shows a multiple sequence alignment of the RET16.1 , RET16.2, RET16.3 splice variant polypeptide sequences.
- the lightly shaded boxes designate amino acids deleted in RET16.2, which is missing exons 5-8 of RET16.1. Darker shaded boxes designate the additional amino acids present in RET16.3 that are not present in the other RET16 sequences.
- FIG. 17 shows an alignment of WD and SAM domains in the human RET16 (SEQ ID NO:2 or SEQ ID NO:4) and murine RET16 (SEQ ID NO:7) polypeptide sequences.
- the lightly shaded regions indicate the WD repeats and the darker shaded region designates the SAM domain as indicated in the figure. Identical residues are indicated by the boxed regions.
- FIG. 18 shows the exon structures of human RET16 (also called RET16.1 herein), and the RET16.2 and RET16.3 splice variants.
- FIGS. 19A and 19B show the human RET16.2 splice variant polynucleotide sequence (SEQ ID NO:12) and encoded amino acid sequence (SEQ ID NO:13), (Example 2).
- the coding sequence (CDS) of human RET16.2 is encompassed by nucleotide 111 to nucleotide 1262 of SEQ ID NO:12.
- the predicted molecular weight of RET16.2 is 42.7 Kd.
- FIGS. 20A and 20B show the human RET16.3 splice variant polynucleotide sequence (SEQ ID NO:14) and encoded amino acid sequence (SEQ ID NO:15), (Example 2).
- the coding sequence (CDS) of human RET16.3 is encompassed by nucleotide 136 to nucleotide 1641 of SEQ ID NO: 14.
- the predicted molecular weight of RET16.3 is 55.6 Kd.
- FIG. 21 shows an alignment of the consensus residues of the U box domain of the RET16 protein (SEQ ID NO:24) of the present invention and the U box domain of protein PRP19 (SEQ ID NO:25).
- the annotation of the conserved consensus residues shown in FIG. 21 is modified from Aravind and Koonin, 2002, Current Biology, 10(4):R132-R134.
- RET16 polypeptide refers to the amino acid sequence of isolated and preferably substantially purified RET16 protein, which, although isolated from a human cDNA library source according to the present invention, can be obtained from any species, preferably mammalian, including mouse, rat, non-human primates, and more preferably, human; and from a variety of sources, including natural, synthetic, semi-synthetic, or recombinant.
- the present invention more particularly provides (i) a human RET16 polynucleotide sequence of the full-length human RET16 transcript (SEQ ID NO:1) and the encoded human RET16 polypeptide sequence (SEQ ID NO:2), (FIGS. 1-3); (ii) the human RET16 open reading frame polynucleotide sequence (SEQ ID NO:3) and the encoded human RET16 polypeptide sequence (SEQ ID NO:4); (iii) the murine RET16 polynucleotide sequence (SEQ ID NO:6) and the encoded murine RET16 amino acid sequence (SEQ ID NO:7), (FIGS.
- An agonist refers to a molecule which, when bound to the RET16 polypeptide, or a functional fragment thereof, increases or prolongs the duration of the effect of the RET16 polypeptide.
- Agonists can include proteins, nucleic acids, carbohydrates, or any other molecules that bind to and modulate the effect of RET16 polypeptide.
- An antagonist e.g., inhibitor refers to a molecule which, when bound to the RET16 polypeptide, or a functional fragment thereof, decreases or eliminates the amount or duration of the biological or immunological activity of RET16 polypeptide.
- Antagonists can include proteins, nucleic acids, carbohydrates, antibodies, or any other molecules that decrease, reduce or eliminate the effect and/or function of the RET16 polypeptide.
- Nucleic acid sequence refers to an oligonucleotide, nucleotide, or polynucleotide (e.g., cDNA, DNA, RNA), and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which can be single- or double-stranded, and represent the sense or antisense strand.
- fragments include nucleic acid sequences that are greater than about 10-60 nucleotides in length, preferably about 20-60 nucleotides, and also preferably include fragments that are at least 70-100 nucleotides, or which are at least 1000 nucleotides or greater in length. Nucleic acids for use as probes or primers can differ in length as described herein.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof, and to naturally occurring or synthetic molecules.
- Amino acid sequence fragments are typically from about 4 or 5 to about 35, preferably from about 5 to about 15 or 25 amino acids in length and, optimally, retain the biological activity or function of the RET16 polypeptide.
- larger amino acid fragments can be used, depending on the purpose therefor, e.g., fragments of from about 15 to about 50 or 60 amino acids.
- amino acid sequence is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule
- amino acid sequence and like terms, such as “polypeptide” or “protein” are not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
- RET16 polypeptide and RET16 protein are frequently used interchangeably herein to refer to the encoded product of the RET16 nucleic acid sequence of the present invention.
- a variant of the RET16 polypeptide can refer to an amino acid sequence that is altered by one or more amino acids.
- the variant can have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Minor variations can also include amino acid deletions or insertions, or both.
- Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing functional biological or immunological activity can be found using computer programs well known in the art, for example, DNASTAR software.
- allelic sequence is an alternative form of the RET16 nucleic acid sequence. Alleles can result from at least one mutation in the nucleic acid sequence and can yield altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given gene, whether natural or recombinant, can have none, one, or many allelic forms. Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions, or substitutions of nucleotides.
- Altered nucleic acid sequences encoding the RET16 polypeptide include nucleic acid sequences containing deletions, insertions and/or substitutions of different nucleotides resulting in a polynucleotide that encodes the same or a functionally equivalent RET16 polypeptide.
- Altered nucleic acid sequences can further include polymorphisms of the polynucleotide encoding the RET16 polypeptide; such polymorphisms may or may not be readily detectable using a particular oligonucleotide probe.
- the encoded protein can also contain deletions, insertions, or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent RET16 protein of the present invention.
- Deliberate amino acid substitutions can be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues, as long as the biological activity or function of RET16 protein is retained.
- negatively charged amino acids can include aspartic acid and glutamic acid
- positively charged amino acids can include lysine and arginine
- amino acids with uncharged polar head groups having similar hydrophilicity values can include leucine, isoleucine, and valine; glycine and alanine; asparagine and glutamine; serine and threonine; and phenylalanine and tyrosine.
- PNA protein nucleic acid
- PNA refers to an antisense molecule or anti- gene agent which comprises an oligonucleotide ("oligo") linked to a peptide backbone of amino acid residues, which terminates in lysine.
- PNA typically comprise oligos of at least 5 nucleotides linked to amino acid residues. These small molecules stop transcript elongation by binding to their complementary strand of nucleic acid (P.E. Nielsen et al., 1993, Anticancer Drug Des., 8:53-63).
- PNA can be pegylated to extend their lifespan in the cell where they preferentially bind to complementary single stranded DNA and RNA.
- Oligonucleotides or oligomers refer to a nucleic acid sequence, preferably comprising contiguous nucleotides, typically of at least about 6 nucleotides to about 60 nucleotides, preferably at least about 8 to 10 nucleotides in length, more preferably at least about 12 nucleotides in length, e.g., about 15 to 35 nucleotides, or about 15 to 25 nucleotides, or about 20 to 35 nucleotides, which can be typically used, for example, as probes or primers, in PCR amplification assays, hybridization assays, or in microarrays.
- oligonucleotide is substantially equivalent to the terms primer, probe, or amplimer, as commonly defined in the art. It will also be appreciated by those skilled in the pertinent art that a longer oligonucleotide probe, or mixtures of probes, e.g., degenerate probes, can be used to detect longer, or more complex, nucleic acid sequences, for example, genomic DNA. In such cases, the probe can comprise at least 20-200 nucleotides, preferably, at least 30-100 nucleotides, more preferably, 50-100 nucleotides.
- Amplification refers to the production of additional copies of a nucleic acid sequence and is generally carried out using polymerase chain reaction (PCR) technologies, which are well known and practiced in the art (See, D.W. Dieffenbach and G.S. Dveksler, 1995, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, NY).
- PCR polymerase chain reaction
- Microarray is an array of distinct polynucleotides or oligonucleotides synthesized on a substrate, such as paper, nylon, or other type of membrane; filter; chip; glass slide; or any other type of suitable solid support.
- antisense refers to nucleotide sequences, and compositions containing nucleic acid sequences, which are complementary to a specific DNA or RNA sequence.
- antisense strand is used in reference to a nucleic acid strand that is complementary to the "sense” strand.
- Antisense (i.e., complementary) nucleic acid molecules include PNA and can be produced by any method, including synthesis or transcription. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form duplexes which block either transcription or translation.
- the designation “negative” is sometimes used in reference to the antisense strand, and “positive” is sometimes used in reference to the sense strand.
- consensus refers to the sequence that reflects the most common choice of base or amino acid at each position among a series of related DNA, RNA, or protein sequences. Areas of particularly good agreement often represent conserved functional domains.
- a deletion refers to a change in either nucleotide or amino acid sequence and results in the absence of one or more nucleotides or amino acid residues.
- an insertion also termed “addition” refers to a change in a nucleotide or amino acid sequence that results in the addition of one or more nucleotides or amino acid residues, as compared with the naturally occurring molecule.
- a substitution refers to the replacement of one or more nucleotides or amino acids by different nucleotides or amino acids.
- a derivative nucleic acid molecule refers to the chemical modification of a nucleic acid encoding, or complementary to, the encoded RET16 polypeptide.
- a nucleic acid derivative encodes a polypeptide which retains the essential biological and/or functional characteristics of the natural molecule.
- a derivative polypeptide is one which is modified by glycosylation, pegylation, or any similar process that retains the biological and/or functional or immunological activity of the polypeptide from which it is derived.
- biologically active i.e., functional, refers to a protein or polypeptide or peptide fragment thereof having structural, regulatory, or biochemical functions of a naturally occurring molecule.
- immunologically active refers to the capability of the natural, recombinant, or synthetic RET16, or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells, for example, to generate antibodies, and to bind with specific antibodies.
- hybridization refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing.
- hybridization complex refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T bases. The hydrogen bonds can be further stabilized by base stacking interactions. The two complementary nucleic acid sequences hydrogen bond in an anti-parallel configuration.
- a hybridization complex can be formed in solution (e.g., C 0 t or R 0 t analysis), or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., membranes, filters, chips, pins, or glass slides, or any other appropriate substrate to which cells or their nucleic acids have been affixed).
- stringency or stringent conditions refer to the conditions for hybridization as defined by nucleic acid composition, salt and temperature. These conditions are well known in the art and can be altered to identify and/or detect identical or related polynucleotide sequences in a sample.
- a variety of equivalent conditions comprising either low, moderate, or high stringency depend on factors such as the length and nature of the sequence (DNA, RNA, base composition), reaction milieu (in solution or immobilized on a solid substrate), nature of the target nucleic acid (DNA, RNA, base composition), concentration of salts and the presence or absence of other reaction components (e.g., formamide, dextran sulfate and/or polyethylene glycol) and reaction temperature (within a range of from about 5°C below the melting temperature of the probe to about 20°C to 25°C below the melting temperature).
- reaction temperature within a range of from about 5°C below the melting temperature of the probe to about 20°C to 25°C below the melting temperature.
- One or more factors can be varied to generate conditions
- the stringency of hybridization can be altered in order to identify or detect identical or related polynucleotide sequences.
- Tm can be approximated by the formulas as known in the art, depending on a number of parameters, such as the length of the hybrid or probe in number of nucleotides, or hybridization buffer ingredients and conditions (See, for example, T. Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982 and J. Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989; Current Protocols in Molecular Biology, Eds. F.M.
- high stringency refers to conditions that permit hybridization of those nucleic acid sequences that form stable hybrids in 0.018M NaCl at about 65 Q C (i.e., if a hybrid is not stable in 0.018M NaCl at about 65 S C, it will not be stable under high stringency conditions).
- High stringency conditions can be provided, for instance, by hybridization in 50% formamide, 5x Denhart's solution, 5xSSPE (saline sodium phosphate EDTA) (1x SSPE buffer comprises 0.15 M NaCl, 10 mM Na 2 HP0 4 , 1 mM EDTA), (or 1x SSC buffer containing 150 mM NaCl, 15 mM Na 3 citrate • 2 H 2 0, pH 7.0), 0.2% SDS at about 42 9 C, followed by washing in 1x SSPE (or saline sodium citrate, SSC) and 0.1% SDS at a temperature of at least about 42°C, preferably about 55°C, more preferably about 65°C.
- 5xSSPE saline sodium phosphate EDTA
- 1x SSPE buffer comprises 0.15 M NaCl, 10 mM Na 2 HP0 4 , 1 mM EDTA
- Moderate stringency refers, by way of nonlimiting example, to conditions that permit hybridization in 50% formamide, 5x Denhart's solution, 5xSSPE (or SSC), 0.2% SDS at 42 Q C (to about 50 Q C), followed by washing in 0.2x SSPE (or SSC) and 0.2% SDS at a temperature of at least about 42°C, preferably about 55°C, more preferably about 65°C.
- Low stringency refers, by way of nonlimiting example, to conditions that permit hybridization in 10% formamide, 5x Denhart's solution, 6xSSPE (or SSC), 0.2% SDS at 42 9 C, followed by washing in 1x SSPE (or SSC) and 0.2% SDS at a temperature of about 45°C, preferably about 50°C.
- complementary or complementarity refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing.
- sequence "A-G-T” binds to the complementary sequence "T-C-A”.
- Complementarity between two single- stranded molecules can be "partial", in which only some of the nucleic acids bind, or it can be complete when total complementarity exists between single stranded molecules.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands, as well as in the design and use of PNA molecules.
- homology refers to a degree of complementarity. There can be partial sequence homology or complete homology, wherein complete homology is equivalent to identity, e.g., 100% identity.
- a partially complementary sequence that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid is referred to using the functional term "substantially homologous.”
- the inhibition of hybridization of the completely complementary sequence to the target sequence can be examined using a hybridization assay (e.g., Southern or Northern blot, solution hybridization and the like) under conditions of low stringency.
- a substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence or probe to the target sequence under conditions of low stringency.
- low stringency conditions do not permit non-specific binding; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
- the absence of nonspecific binding can be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e.g., less than about 30% identity). In the absence of non-specific binding, the probe will not hybridize to the second non-complementary target sequence.
- Those having skill in the art will know how to determine percent identity between/among sequences using, for example, algorithms such as those based on the CLUSTALW computer program (J.D.
- the BLASTP program uses as defaults a wordlength (W) of 3, and an expectation (E) of 10.
- a composition comprising a given polynucleotide sequence refers broadly to any composition containing the given polynucleotide sequence.
- the composition can comprise a dry formulation or an aqueous solution.
- Compositions comprising polynucleotide sequence e.g., SEQ ID NO:1 or SEQ ID NO:3 encoding RET16 polypeptide, or fragments thereof, can be employed as hybridization probes, or as primers.
- the probes and primers can be stored in freeze-dried form and can be in association with a stabilizing agent such as a carbohydrate.
- the probe can be employed in an aqueous solution containing salts (e.g., NaCl), detergents or surfactants (e.g., SDS) and other components (e.g., Denhardt's solution, dry milk, salmon sperm DNA, and the like).
- salts e.g., NaCl
- detergents or surfactants e.g., SDS
- other components e.g., Denhardt's solution, dry milk, salmon sperm DNA, and the like.
- substantially purified refers to nucleic acid sequences or amino acid sequences that are removed from their natural environment, i.e., isolated or separated by a variety of means, and are at least 60% free, preferably 75% to 85% free, and most preferably 90% or greater free from other components with which they are naturally associated.
- a biological sample suspected of containing nucleic acid encoding the RET16 protein, or fragments thereof, or the RET16 protein itself can comprise a body fluid, an extract from cells or tissue, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), organelle, or membrane isolated from a cell, a cell, nucleic acid such as genomic DNA (in solution or bound to a solid support such as for Southern analysis), RNA (in solution or bound to a solid support such as for Northern analysis), cDNA (in solution or bound to a solid support), a tissue, a tissue print and the like.
- Transformation refers to a process by which exogenous DNA enters and changes a recipient cell. It can occur under natural or artificial conditions using various methods well known in the art. Transformation can rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method is selected based on the type of host cell being transformed and can include, but is not limited to, viral infection, electroporation, heat shock, lipofection, and partial bombardment.
- Such "transformed” cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. Transformed cells also include those cells which transiently express the inserted DNA or RNA for limited periods of time.
- a protein refers to a molecule, the structure of which is developed from knowledge of the structure of the RET16 protein, or portions thereof, and as such, is able to effect some or all of the actions of the RET16 protein.
- portion refers to fragments or segments, for example, peptides, of that protein. The fragments can range in size from four or five amino acid residues to the entire amino acid sequence minus one amino acid.
- a protein comprising at least a portion of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO:4" can encompass the full-length human RET16 polypeptide, and fragments or segments of full-length RET16.
- antibody refers to intact molecules as well as fragments thereof, such as Fab, F(ab') 2 , Fv, which are capable of binding an epitopic or antigenic determinant.
- Antibodies that bind to RET16 polypeptides can be prepared using intact polypeptides or fragments containing small peptides of interest or prepared recombinantly for use as the immunizing antigen.
- the polypeptide or oligopeptide used to immunize an animal can be derived from the transition of RNA or synthesized chemically, and can be conjugated to a carrier protein, if desired.
- Commonly used carriers that are chemically coupled to peptides include bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), and thyroglobulin.
- BSA bovine serum albumin
- KLH keyhole limpet hemocyanin
- thyroglobulin The coupled peptide is then used to immunize the animal (e.g, a mouse, a rat, or a rabbit).
- humanized antibody refers to antibody molecules in which amino acids have been replaced in the non-antigen binding regions in order to more closely resemble a human antibody, while still retaining the original binding capability, e.g., as described in U.S. Patent No. 5,585,089 to C.L. Queen et al.
- antigenic determinant refers to that portion of a molecule that makes contact with a particular antibody (i.e., an epitope).
- a protein or fragment of a protein is used to immunize a host animal, numerous regions of the protein can induce the production of antibodies which bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to an antigenic determinants.
- An antigenic determinant can compete with the intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.
- specific binding or “specifically binding” refer to the interaction between a protein or peptide and a binding molecule, such as an agonist, an antagonist, or an antibody.
- the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope, or a structural determinant) of the protein that is recognized by the binding molecule.
- a particular structure e.g., an antigenic determinant or epitope, or a structural determinant
- an antibody is specific for epitope "A”
- the presence of a protein containing epitope A (or free, unlabeled A) in a reaction containing labeled "A” and the antibody will reduce the amount of labeled A bound to the antibody.
- correlates with expression of a polynucleotide indicates that the detection of the presence of ribonucleic acid that is similar to SEQ ID NO:1 or SEQ ID NO:2 by Northern analysis is indicative of the presence of mRNA encoding the RET16 polypeptide in a sample and thereby correlates with expression of the transcript from the polynucleotide encoding the protein.
- An alteration in the polynucleotide of SEQ ID NO:1 or SEQ ID NO:2 comprises any alteration in the sequence of the polynucleotides encoding the RET16 polypeptide, including deletions, insertions, and point mutations that can be detected using hybridization assays.
- alterations to the genomic DNA sequence which encodes the RET16 polypeptide e.g., by alterations in the pattern of restriction fragment length polymorphisms capable of hybridizing to SEQ ID NO:1 or SEQ ID NO:3
- the inability of a selected fragment of SEQ ID NO:1 or SEQ ID NO:3 to hybridize to a sample of genomic DNA e.g., using allele- specific oligonucleotide probes
- improper or unexpected hybridization such as hybridization to a locus other than the normal chromosomal locus for the polynucleotide sequence encoding the RET16 polypeptide (e.g., using fluorescent in situ hybridization (FISH) to metaphase chromosome spreads).
- FISH fluorescent in situ hybridization
- RET16 polynucleotides and encoded polypeptides. Specifically described herein are RET16 (also called RET16.1 herein) and variants RET16.2 and RET16.3. All references to "RET16” shall be construed to apply to RET16 (RET16.1), RET16.2 and RET16.3, unless otherwise specified herein.
- RNA expressed in TNF-stimulated human lung microvascular endothelial cells was analyzed to identify gene products that were likely to be involved in cellular regulatory events. Resting cells were stimulated for 1 hour with TNF-alpha, and the RNA was isolated from the cells. Complementary DNA (cDNA) was produced from the isolated RNA employing conventional procedures known and used by those having skill in the art. The cDNAs that were upregulated following TNF-alpha stimulation of the microvascular endothelial cells were identified using subtractive hybridization. (See Example 1). Polynucleotide cDNAs identified via this approach were assessed for potential roles in the signaling cascade as discussed below.
- RET16 gene antisense strategy Examples 5 and 6
- cells were transfected with antisense oligonucleotides and stimulated with TNF-alpha.
- the antisense oligonucleotide that were capable of inhibiting RET16 RNA were evaluated to select an oligo capable of blocking RNA expression.
- the most active RET16 gene antisense was found to be the 11587 oligo having the following sequence: UGCACAUGCCGCCAAGGAGCCAUCU (SEQ ID NO:16).
- Example 6 and FIG. 9 Reduction of the RNA level of the RET16 gene is presumed to reduce the level of the RET16 protein in the cell. Consequently, reducing the level of RET16 protein in the cell was able to interfere with the TNF-alpha signaling cascade, resulting in the decreased expression of E-selectin on the cell surface. As described in Example 6 and shown in FIG.
- antisense oligonucleotides directed against the RET16 polynucleotide resulted in significant inhibition of E-selectin expression in TNF-stimulated HMVEC cells.
- RET16 at least modulates E-selectin expression, either directly or indirectly.
- the results indicate that RET16 represents a positive modulator of E-selectin, which is associated with a number of inflammatory disorders known In the art.
- antagonists of RET16 are useful for the treatment, prevention, and/or amelioration of inflammatory disorders, as discussed further herein.
- antisense oligonucleotides directed against RET16 also resulted in inhibition of V-cam expression.
- RET16 also at least modulates V-cam expression, either directly or indirectly.
- the results indicate that RET16 represents a positive modulator of V-cam, as well.
- E-selectin represents a positive marker for inflammatory conditions
- E-selectin is expressed on the extracellular membrane of a variety of cells and tissue cell types. This association is mediated through the role of E-selectin in modulating cellular rolling of circulating leukocytes on vascular endothelial cells.
- the expression of soluble forms of E-selectin and v-cam have also been associated with inflammatory disorders (A.J. Gearing and W. Newman, 1993, Immunol, Today, 14(10):506-12). Recent studies have shown E-selectin and V-cam expression to be associated with the incidence of asthma, and particularly with the incidence of severe asthma (A. Hamzaoui et al., 2001 , Am. J. Inflamm., 10(6):339-42).
- E-selectin has been shown to be associated with the incidence of juvenile idiopathic arthritis (CY. Chen et al., 2002, Ann. Rheum, Dis., 61 (2): 167-70). E-selectin has also been associated with the incidence of hematogenous metastases of tumor cells (K. Ito et al., 2001 , J. Gastroenterol., 36(12):823-9); E-selectin has been associated with the incidence of hyperinsulinaemia and diabetes type 2 (B.R. Winkelmann et al., 2001 , Curr. Med. Res. Opin., 17(2):132-41 ; and G.
- E-selectin has been associated with the incidence of atherosclerosis and cardiovascular disease (E. Demerath et al., 2001 , Ann. Hum. Biol., 28(6):664-78); E-selectin and V-cam have been associated with the incidence of tumor progression and metastasis, in general, and particularly for colon cancer (D. Alexiou et al., 2001 , Eur. J. Cancer, 37(18):2392-7); E-selectin has been associated with the incidence of Wegener's granulomatosis (N. Ohta et al., 2001 , Auris. Nasus.
- E-selectin and V-cam have been associated with the incidence of stem cell transplantation complications (Y. Matsuda et al., 2001 , Bone Marrow Transplant, 27(9):977-82); E-selectin and V-cam have been associated with the incidence of thalassemia (D.S. Kyriakou et al., 2001 , Ann. Hematol., 80(10):577-83); E-selectin has been associated with the incidence of atherosclerosis (CM. Ballantyne, 2001 , Clin.
- E-selectin has been associated with the incidence of autoimmune disease (R.W. McMurray, 1996, Semin. Arthritis. Rheum., 25(4):215-33); E-selectin has been associated with the incidence of atherosclerosis, ischemia-reperfusion injury, acute lung injury, rheumatoid arthritis, and graft rejection (M.P. Bevilacqua et al., 1994, Ann. Rev. Med., 45:361 -78); and E-selectin has been associated with the incidence of allergic inflammation (CH. Smith et al., 1993, Am. Rev. Respir.
- RET16 polynucleotides and polypeptides, including fragments or antagonists of RET16 are useful for the treatment, prevention, and/or amelioration of any of the foregoing disorders.
- Polymorphic forms of E-selectin have also been associated with several diseases and disorders.
- the A561C E-selectin polymorphism has been associated with systemic lupus erythematosus (Magadmi et al., 2001 , J. Rheumatol., 28(12):2650-2); the E-selectin S128R polymorphism has been associated with coronary artery calcification (D.L.
- RET16 polynucleotides and polypeptides are useful for the treatment, prevention, and/or amelioration of any of the foregoing disorders.
- the present invention is directed to a human RET16 polypeptide comprising the amino acid sequence of SEQ ID NO:2 as shown in FIGS. 2 and 3, or SEQ ID NO:4, as shown in FIG. 4B.
- the RET16 polypeptide product is 476 amino acids in length (SEQ ID NO:2, FIG. 2).
- the human RET16 polypeptide shares 31 % identity with a portion of Podospora anserina Het-e-1 protein and 33% identity with a portion of Thermomonospora curvata PKWA protein as shown in FIG. 10E.
- full-length mouse and partial rat orthologs of human RET16 were identified as described herein. For example, FIGS.
- FIG. 5 and 6 provide the nucleic acid sequence (SEQ ID NO:6) and the encoded amino acid sequence (SEQ ID NO:7), respectively, of the murine RET16 ortholog.
- FIG. 13 provides the nucleic acid sequence (SEQ ID NO:8) of the partial rat RET16 ortholog and
- FIG. 14 shows the encoded amino acid sequence (SEQ ID NO:9) of the partial rat RET16 ortholog.
- the RET16 amino acid sequence was found to contain several sequence motifs common to other known proteins using the MOTIFS program in SEQWEB GCG. MOTIFS looks for protein motifs by searching protein sequences for regular-expression patterns described in the PROSITE Dictionary.
- the RET16 amino acid sequence contains 3 potential asparagine glycosylation sites at amino acids positions 150, 365, 460.
- the RET16 amino acid sequence contains potential cyclic adenosine monophosphate (amino acids 441 and 442), casein kinase II
- amino acids 7, 38, 136, 159, 164, 184, 194, 268, 333, and 370 amino acids 33, 38, 128, 136, 175, 439, 462 phosphorylation sites.
- the RET16 amino acid sequence was used to search the PFAM- HMM database for other protein domains.
- the PFAM-HMM database is a collection of protein families and domains and contains multiple protein alignments (A. Bateman et al., 1999, Nucleic Acids Research, 27:260-262). Seven potential WD40, beta-transducin (G-beta) repeats were identified, in addition to one sterile alpha motif (SAM) domain (FIG. 17).
- Beta-transducin is one of the three subunits (alpha, beta, and gamma) of the guanine nucleotide-binding proteins (G proteins) which act as intermediaries in the transduction of signals generated by transmembrane receptors.
- G proteins guanine nucleotide-binding proteins
- Structurally G-beta consists of eight tandem repeats of about 40 residues, each containing a central Trp-Asp motif (this type of repeat is sometimes called a WD-40 repeat).
- Such a repetitive segment has been shown to exist in a number of other proteins, including G- beta-like peptides, yeast STE4, MSI1 , CDC4, CDC20, MAK11 , PRP4,
- PWP1 and TUP1 slime-mould AAC3 and coronin, and Drosophila Groucho protein.
- the number of repeats within these proteins varies between 5 (PRP4, TUP1 , and Groucho) and 8 (G-beta, STE4, MSI1 , AAC3, CDC4, PWP1 , etc.).
- G-beta and G-beta-Iike proteins the repeats span the entire length of the sequence, while in other proteins, the repeats comprise the N- terminal, the central, or the C-terminal section.
- the sterile alpha motif (SAM) domain is a putative protein interaction module present in a wide variety of proteins involved in many biological processes.
- the SAM domain of approximately 70 residues is found in diverse eukaryotic organisms. SAM domains have been shown to homo- and hetero-oligomerize, but with a low binding affinity, and to mediate specific protein-protein interactions. Structural analyses show that the SAM domain is arranged in a small five-helix bundle with two large interfaces. In the case of the SAM domain of the Eph tyrosine kinase EphB2, each of these interfaces is able to form dimers. The presence of these two distinct binding surfaces suggests that SAM domains could form extended polymeric structures (D. Stapleton et al., 1999, Nature Struct. Biol., 6:44-49). The Incyte Genomics Lifeseq Gold database was used to perform preliminary expression analysis of RET16. According to the electronic
- RET16 was found to be expressed in several tumor tissues, including those from kidney, prostate, pituitary, esophagus, ovary, urinary bladder, lung, colon, paraganglion, adrenal, liver, uterus, and pancreas tissue. In addition, RET16 was found to be expressed in tissues from the following disease states: Huntington's disease, leukemia, cholelithisis, epilepsy, chronic ulcerative colitis, Alzheimer's disease, and lymphocytic thyroiditis.
- RET16 was found to be expressed in bronchial epithelial cells treated with 20% smoke for 20 hours, CD4+ T-lymphocytes treated with CD3 antibodies, a K-562 chronic myelogenous leukemia precursor line treated with 1 ⁇ M 5-aza- 2'deoxycytidine for 72 hours, and umbilical cord mononuclear cells treated with IL-5.
- Another embodiment of the present invention encompasses a murine ortholog, i.e., muRET16, of the human RET16 (huRET6) gene.
- huRET16 human RET16
- the coding sequence of huRET16 was used to search the mouse EST database, available to those in the art for performing the basic local alignment search tool (BLAST) analyses.
- the following murine EST's were identified: AU035693, AA118718, AA204608, W41056, AW146018, A1450495, AI875443, A1316544, AW494796,
- the muRET16 nucleic acid sequence (SEQ ID NO:6) has 80% identity with huRET16.
- the encoded muRET16 amino acid sequence (SEQ ID NO:7) is 82.5% identical to huRET16 (86.5% similarity).
- MuRET16 has 7 predicted WD repeats and 1 SAM domain, all having a score of >10.
- the carboxyl terminus of RET16 contains a U box domain, as determined based upon a Hidden Markov Model E value of 1.78e-23.
- the homology of the RET16 U box domain with the U box of protein PRP19 (S.C. Cheng et al., 1993, Mol. Cell. Biol., 13(3): 1876-82) and the alignment of consensus residues is shown in FIG. 21 (conserved residue annotation modified from Aravind and Koonin, 2001 , Current Biology, 10(4):R132- R134.
- PRP 19 is a pre-mRNA splicing factor that, in addition to the U box, contains WD40 repeats.
- U box domain-containing proteins typified by UFD2 mediate E3 ubiquitin conjugation reactions (Aravind and Koonin, Ibid).
- E3 ubiquitin ligases participate in the transfer of ubiquitin from an E2 ubiquitin ligase onto a substrate protein.
- Recent publications have provided strong evidence for the ubiquitin ligase activity of a series of U box-containing proteins (see, e.g., Hatakeyama et al., 2001 , J. Biol.
- the U box-containing protein provided E3 ubiquitin ligase activity in the presence of E1 and E2 ubiquitin ligases.
- deletion of the U box, or mutation of key conserved residues in the U box protein abrogated the ubiquitin ligase activity.
- the U box ubiquitin ligases are structurally distinct from HECT or RING finger E3s, and can be distinguished functionally by the ability to catalyze polyubiquitination of substrate proteins.
- RET16 is characterized as a ubiquitin ligase.
- assays can be performed as described in Hatakeyama et al., 2001 , Ibid., Murata et al. 2001 , Ibid, and Meachem et al., 2001 , Ibid.).
- Site directed mutagenesis can be used to identify those amino acids in a ubiquitin ligase protein that are necessary for ubiquitin ligase activity.
- deletion of all or a portions of the U box can be performed to confirm the role of the U box in mediating ubiquitin ligase activity.
- a polynucleotide encoding RET16 containing a deleted or mutated U box can be transfected into cells to reveal the functional role of expressed RET16 protein intracellularly. This same approach is amenable for isolating and identifying cellular substrate(s) for the ubiquitin ligases.
- the present invention encompasses a human RET16 nucleic acid sequence (SEQ ID NO:1 or SEQ ID NO:3) encoding the RET16 polypeptide (SEQ ID NO:2 or SEQ ID NO:4, respectively) and the use of the RET16 polynucleotides, polypeptides, or compositions thereof, in methods for screening for antagonists or inhibitors of the interaction of RET16 with other cellular signaling components involved generally in inflammatory processes, cell activation, or uncontrolled cell growth, and specifically in TNF-activated endothelium.
- This invention further embraces an isolated nucleic acid or polypeptide molecule that is at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1 %, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to a RET16 nucleic acid sequence or amino acid sequence according to the present invention.
- the invention encompasses an isolated polynucleotide, or fragment thereof, having a nucleotide sequence that is at least 82.0% identical to the sequence of SEQ ID NO: 12; an isolated polynucleotide, or fragment thereof, having a nucleotide sequence that is at least 68.2% identical to the sequence of SEQ ID NO: 12; and an isolated polynucleotide, or fragment thereof, having a nucleotide sequence that is at least 93.1% identical to the sequence of SEQ ID NO:14.
- the present invention encompasses an isolated polynucleotide, or fragment thereof, encoding an amino acid sequence of a cell signaling polypeptide, where the polypeptide has at least 82% sequence identity to the sequence of SEQ ID NO: 13; and an isolated polynucleotide, or fragment thereof, encoding an amino acid sequence of a cell signaling polypeptide, where the polypeptide has at least 95.0% sequence identity with the sequence of SEQ ID NO:15.
- the invention further encompasses an isolated and/or substantially purified cell signaling protein having an amino acid sequence that has at least 82% sequence identity with the sequence as set forth in SEQ ID NO:13; and an isolated and/or substantially purified cell signaling protein having an amino acid sequence that has at least 95% sequence identity with the sequence as set forth in SEQ ID NO:15.
- RET16 nucleic acid sequence and the RET16 polypeptide, or molecules that interact with all or a portion of the RET16 nucleic acid or amino acid sequence in methods for diagnosing, treating or preventing disorders or diseases associated with inflammation and cellular inflammatory processes or with cell growth or cell activation processes.
- the RET16 gene and polypeptide are useful for determining those cellular signaling molecules that associate with RET16 and which provide critical signals for the signaling cascade that can be involved with the master switch related to the development of inflammatory processes or intracellular signaling events triggered by receptor activation, stimulation, or uncontrolled cell growth.
- RET16 protein was first identified in a subtraction cDNA library from TNF- alpha-stimulated human lung microvascular endothelial cells.
- the full-length RET16 gene was isolated by extending clone sequences available from the Incyte and public EST databases, as described in Example 1.
- the present invention encompasses a polypeptide comprising the amino acid sequence of SEQ ID NO:2 as shown in FIGS. 2 and 3 and the open reading frame amino acid sequence of SEQ ID NO:4 as shown in FIG. 4B.
- the human RET16 polypeptide is 476 amino acids in length.
- 10A-10E portray the structural similarities among RET16 and several other proteins, namely a portion of Podospora anserina vegetable incompatibility protein Het-E-1 ; a portion of Thermomonospora curvata putative serine/threonine-protein kinase PWKA; the RET16 murine ortholog, and the partial RET16 rat ortholog.
- a RET16 variant has at least 75 to 80%, preferably at least 85 to 90%, and more preferably at least 90% amino acid sequence identity to the amino acid sequence (SEQ ID NO:2 or SEQ ID NO:4) disclosed herein, and which retains at least one biological, immunological, or other functional characteristic or activity of the RET16 polypeptide. Most preferred is a variant having at least 95% amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:4.
- An amino acid sequence variant of the RET16 protein can be categorized into one or more of three classes: substitutional, insertional, or deletional variants.
- variants are typically prepared by site-specific mutagenesis of nucleotides in the DNA encoding the RET16 protein, using cassette or PCR mutagenesis, or other techniques that are well known and practiced in the art, to produce DNA encoding the variant. Thereafter, the DNA is expressed in recombinant cell culture as described herein.
- Variant RET16 protein fragments having up to about 100-150 residues can be prepared by in vitro synthesis using conventional techniques. Two variants, RET16.2 and RET16.3 are described herein (see, Example 2; FIG. 16 -- multiple sequence alignments; FIG. 18 - exon structure; FIGS.
- amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variations of the RET16 protein amino acid sequence.
- the variants typically exhibit the same qualitative biological activity as that of the naturally occurring analogue, although variants can also be selected having modified characteristics.
- the mutation perse need not be predetermined.
- random mutagenesis can be performed at the target codon or region, and the expressed RET16 variants screened for the optimal combination of desired activity.
- substitution mutations at predetermined sites in DNA having a known sequence are well known, for example, M13 primer mutagenesis and PCR mutagenesis. Screening of the mutants is accomplished using assays of RET16 protein activities, for example, for binding domain mutations, competitive binding studies can be carried out.
- Amino acid substitutions are typically of single residues; insertions usually are on the order of from one to twenty amino acids, although considerably larger insertions can be tolerated. Deletions range from about one to about 20 residues, although in some cases, deletions can be much larger.
- substitutions that are less conservative than those shown in Table 1.
- substitutions can be made which more significantly affect the structure of the polypeptide backbone in the area of the alteration, for example, the alpha-helical, or beta-sheet structure; the charge or hydrophobicity of the molecule at the target site; or the bulk of the side chain.
- substitutions which generally are expected to produce the greatest changes in the polypeptide's properties are those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) a residue that does not have a side chain, e.g., glycine.
- RET16 variants will ordinarily exhibit the same qualitative biological activity or function, and elicit the same immune response, as the naturally occurring analogue, the variants are also selected to modify the characteristics of the RET16 protein as needed. Alternatively, the variant can be designed such the that biological activity of the RET16 protein is altered.
- the present invention encompasses polynucleotides which encode the RET16 polypeptide. Accordingly, any nucleic acid sequence which encodes the amino acid sequence of the RET16 polypeptide can be used to produce recombinant molecules that express RET16 protein.
- the present invention encompasses the RET16 polynucleotide comprising the nucleic acid sequence of SEQ ID NO:1 and SEQ ID NO:3, as shown in FIGS. 1 and 4A, respectively, and the murine ortholog of human RET16 comprising the nucleic acid sequence of SEQ ID NO:6, as well as the rat ortholog of human RET16 comprising the nucleic acid sequence of SEQ ID NO:8.
- the present invention provides cloned full-length open reading frame human RET16 cDNA (1532 bp), (also called RET16.1) deposited at the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209 on March 7, 2001 under ATCC Accession No. PTA-3161 according to the terms of the Budapest Treaty.
- the present invention encompasses a polynucleotide lacking the initiating start codon, in addition to the resulting encoded polypeptide of RET16.1.
- the present invention encompasses the polynucleotide corresponding to nucleotides 151 through 1575 of SEQ ID NO:1 , and the polypeptide corresponding to amino acids 2 through 476 of SEQ ID NO:2. Also encompassed are recombinant vectors comprising the RET16.1 encoding sequence, and host cells comprising the vector as described herein.
- the present invention encompasses a polynucleotide lacking the initiating start codon, in addition to the resulting encoded polypeptide of RET16.2. Specifically, the present invention encompasses the polynucleotide corresponding to nucleotides 114 through 1262 of SEQ ID NO:12, and the polypeptide corresponding to amino acids 2 through 384 of SEQ ID NO:13. Also encompassed are recombinant vectors comprising the RET16.2 encoding sequence, and host cells comprising the vector as described herein.
- the present invention encompasses a polynucleotide lacking the initiating start codon, in addition to the resulting encoded polypeptide of RET16.3. Specifically, the present invention encompasses the polynucleotide corresponding to nucleotides 139 through 1641 of SEQ ID NO: 14, and the polypeptide corresponding to amino acids 2 through 502 of SEQ ID NO:15. Also encompassed are recombinant vectors comprising the RET16.3 encoding sequence, and host cells comprising the vector as described herein.
- the present invention encompasses a polynucleotide lacking the initiating start codon, in addition to the resulting encoded polypeptide of the mouse RET16.
- the present invention encompasses the polynucleotide corresponding to nucleotides 19 through 1443 of SEQ ID NO:6, and the polypeptide corresponding to amino acids 2 through 475 of SEQ ID NO:7.
- recombinant vectors comprising the mouse RET16 encoding sequence, and host cells comprising the vector as described herein.
- the degeneracy of the genetic code results in the production of numerous nucleotide sequences encoding the RET16 polypeptide of the present invention. Some of the sequences bear minimal homology to the nucleotide sequences of any known and naturally occurring gene. Accordingly, the present invention contemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring RET16, and all such variations are to be considered as being specifically disclosed.
- nucleotide sequences which encode the RET16 polypeptide and its variants are preferably capable of hybridizing to the nucleotide sequence of the naturally occurring RET16 polypeptide under appropriately selected conditions of stringency, it may be advantageous to produce nucleotide sequences encoding the RET16 polypeptide, or its derivatives, which possess a substantially different codon usage. Codons can be selected to increase the rate at which expression of the peptide/polypeptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular codons are utilized by the host, for example, in plant cells or yeast cells or amphibian cells.
- the present invention also encompasses production of DNA sequences, or portions thereof, which encode the RET16 polypeptide, and its derivatives, entirely by synthetic chemistry. After production, the synthetic sequence can be inserted into any of the many available expression vectors and cell systems using reagents that are well known and practiced by those in the art. Moreover, synthetic chemistry can be used to introduce mutations into a sequence encoding RET16 polypeptide, or any fragment thereof.
- polynucleotide sequences that are capable of hybridizing to the claimed nucleotide sequence of RET16, such as that shown in SEQ ID NO:1 or SEQ ID NO:3, under various conditions of stringency.
- Hybridization conditions are typically based on the melting temperature (Tm) of the nucleic acid binding complex or probe (See, G.M. Wahl and S.L. Berger, 1987; Methods Enzymol., 152:399-407 and A.R. Kimmel, 1987; Methods of Enzymol., 152:507-511), and can be used at a defined stringency.
- sequences capable of hybridizing under moderately stringent conditions to the RET16 nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:3 and other sequences which are degenerate to those which encode the RET16 polypeptide e.g., as a nonlimiting example: prewashing solution of 2X SSC, 0.5% SDS, 1.0mM EDTA, pH 8.0, and hybridization conditions of 50°C, 5XSSC, overnight).
- polynucleotide sequences or fragments (peptides) thereof which encode the RET16 polypeptide can be used in recombinant DNA molecules to direct the expression of the RET16 polypeptide product, or fragments or functional equivalents thereof, in appropriate host cells.
- RET16 polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons can be advantageous to produce.
- codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
- the nucleotide sequence of the present invention can be engineered using methods generally known in the art in order to alter RET16 polypeptide-encoding sequences for a variety of reasons, including, but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product.
- DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
- site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, or introduce mutations, and the like.
- natural, modified, or recombinant nucleic acid sequences, or a fragment thereof, encoding the RET16 polypeptide can be ligated to a heterologous sequence to encode a fusion protein.
- a heterologous sequence For example, for screening peptide libraries for inhibitors or modulators of RET16 activity or binding, it may be useful to encode a chimeric RET16 protein that can be recognized by a commercially available antibody.
- a fusion protein can also be engineered to contain a cleavage site located between the RET16 protein-encoding sequence and the heterologous protein sequence, so that the RET16 protein can be cleaved and purified away from the heterologous moiety.
- the present invention encompasses a substantially purified cell signaling protein that is involved in the cell signaling cascade and is encoded by a polynucleotide having a nucleic acid sequence as set forth in SEQ ID NOS:1 , 3, 5, 6, 8, 12, or 14 or a nucleic acid sequence degenerate from that of SEQ ID NOS:1 , 3, 5, 6, 8, 12, or 14, as a result of redundancy of the genetic code.
- a fusion protein can further comprise all or a portion of the amino acid sequence of SEQ ID NOS:2, 4, 7, 9, 13, or 15, or an amino acid sequence having at least 80% sequence identity to the sequence as set forth in SEQ ID NOS:2, 4, 7, 9, 13, or 15, and an amino acid sequence of a second protein.
- ligand-binding assays are useful to identify inhibitor compounds that interfere with the function of the RET16 product, or activator compounds that stimulate the function of the RET16 protein. Such assays are useful even if the function of a protein is not known. These assays are designed to detect binding of test compounds to particular target molecules, e.g., proteins or peptides. The detection can involve direct measurement of binding. Alternatively, indirect indications of binding can involve stabilization of protein structure, or disruption or enhancement of a biological function. Non-limiting examples of useful ligand-binding assays are detailed below.
- BIAcore Biomolecular Interaction Assay
- Pharmacia Biosensor and described in the manufacturer's protocol (LKB Pharmacia, Sweden).
- the BIAcore system uses an affinity purified anti- GST antibody to immobilize GST-fusion proteins onto a sensor chip.
- the sensor utilizes surface plasmon resonance, which is an optical phenomenon that detects changes in refractive indices.
- a protein of interest e.g., the RET16 polypeptide, or fragment thereof, of the present invention, is coated onto a chip and test compounds are passed over the chip. Binding is detected by a change in the refractive index (surface plasmon resonance).
- ligand-binding assay involves scintillation proximity assays (SPA), as described in U.S. Patent No. 4,568,649.
- SPA scintillation proximity assays
- chaperonins are used to distinguish folded and unfolded proteins.
- a tagged protein is attached to SPA beads, and test compounds are added.
- the bead is then subjected to mild denaturing conditions, such as, for example, heat, exposure to SDS, and the like, and a purified labeled chaperonin is added.
- a test compound has bound to a target protein, the labeled chaperonin will not bind; conversely, if no test compound has bound, the protein will undergo some degree of denaturation and the chaperonin will bind.
- proteins containing mitochondrial targeting signals are imported into isolated mitochondria in vitro (Hurt et al., 1985, EMBO J., 4:2061-2068; Eilers and Schatz, 1986, Nature, 322:228-231).
- expression vectors are constructed in which nucleic acids encoding particular target proteins are inserted downstream of sequences encoding mitochondrial import signals.
- the chimeric proteins are synthesized and tested for their ability to be imported into isolated mitochondria in the absence and presence of test compounds.
- a test compound that binds to the target protein should inhibit its uptake into isolated mitochondria in vitro.
- Another type of ligand-binding assay suitable for use according to the present invention is the yeast two-hybrid system (Fields and Song, 1989, Nature, 340:245-246).
- the yeast two-hybrid system takes advantage of the properties of the GAL4 protein of the yeast S. cerevisiae.
- the GAL4 protein is a transcriptional activator required for the expression of genes encoding enzymes involving the utilization of galactose.
- GAL4 protein consists of two separable and functionally essential domains: an N-terminal domain, which binds to specific DNA sequences (UASG); and a C-terminal domain containing acidic regions, which is necessary to activate transcription.
- the native GAL4 protein containing both domains, is a potent activator of transcription when yeast cells are grown on galactose medium.
- the N- terminal domain binds to DNA in a sequence-specific manner but is unable to activate transcription.
- the C-terminal domain contains the activating regions but cannot activate transcription because it fails to be localized to UASG.
- a system of two hybrid proteins containing parts of GAL4 (1) a GAL4 DNA-binding domain fused to a protein 'X', and (2) a GAL4 activation region fused to a protein T. If X and Y can form a protein-protein complex and reconstitute proximity of the GAL4 domains, transcription of a gene regulated by UASG occurs. Creation of two hybrid proteins, each containing one of the interacting proteins X and Y, allows the activation region of UASG to be brought to its normal site of action.
- binding assay described in Fodor et al., 1991 , Science, 251 :767- 773, which involves testing the binding affinity of test compounds for a plurality of defined polymers synthesized on a solid substrate, can also be useful.
- Compounds that bind to the RET16 polypeptide, or portions thereof, according to this invention are potentially useful as agents for use in therapeutic compositions.
- sequences encoding the RET16 polypeptide can be synthesized in whole, or in part, using chemical methods well known in the art (See, for example, M.H. Caruthers et al., 1980, Nucl. Acids Res. Symp. Ser., 215-223 and T. Horn, T et al., 1980, Nucl.
- the protein itself can be produced using chemical methods to synthesize the amino acid sequence of the RET16 polypeptide, or a fragment or portion thereof.
- peptide synthesis can be performed using various solid-phase techniques (J.Y. Roberge et al., 1995, Science, 269:202-204) and automated synthesis can be achieved, for example, using the ABI 431 A Peptide Synthesizer (PE Biosystems).
- the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., T. Creighton, 1983, Proteins, Structures and Molecular Principles, WH Freeman and Co., New York, N.Y), by reversed-phase high performance liquid chromatography, or other purification methods as are known in the art.
- the composition of the synthetic peptides can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra).
- the amino acid sequence of the RET16 polypeptide or any portion thereof can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide. Expression of Human RET16 Protein
- the nucleotide sequences encoding the RET16 polypeptide, or functional equivalents can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- expression vector/host systems can be utilized to contain and express sequences encoding the RET16 polypeptide.
- Such expression vector/host systems include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast or fungi transformed with yeast or fungal expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)), or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems.
- the host cell employed is not limiting to the present invention.
- Control elements are those non- translated regions of the vector, e.g., enhancers, promoters, 5' and 3' untranslated regions, which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, La Jolla, CA) or PSPORT1 plasmid (Life Technologies), and the like, can be used.
- inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, La Jolla, CA) or PSPORT1 plasmid (Life Technologies), and the like, can be used.
- the baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO; and storage protein genes), or from plant viruses (e.g., viral promoters or leader sequences), can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferred. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding RET16, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
- Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO; and storage protein genes
- plant viruses e.g., viral promoters or leader sequences
- a number of expression vectors can be selected, depending upon the use intended for the expressed RET16 product.
- vectors which direct high level expression of fusion proteins that are readily purified can be used.
- Such vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene), in which the sequence encoding the RET16 polypeptide, or a peptide thereof, can be ligated into the vector in-frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase, so that a hybrid protein is produced; plN vectors (See, G.
- pGEX vectors can also be used to express foreign polypeptides, as fusion proteins with glutathione S-transferase (GST).
- GST glutathione S-transferase
- fusion proteins are soluble and can be easily purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- Proteins made in such systems can be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
- plant promoters such as the small subunit of RUBISCO, or heat shock promoters
- RUBISCO small subunit of RUBISCO
- heat shock promoters can be used (G. Coruzzi et al., 1984, EMBO J., 3:1671-1680; R. Broglie et al., 1984, Science, 224:838-843; and J. Winter et al., 1991 , Results Probl. Cell Differ. 17:85-105).
- These constructs can be introduced into plant cells by direct DNA transformation or pathogen- mediated transfection. Such techniques are described in a number of generally available reviews (See, for example, S. Hobbs or L.E. Murry, In: McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N.Y.; pp. 191-196).
- An insect system can also be used to express the RET16 polypeptide
- Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
- the sequences encoding the RET16 polypeptide can be cloned into a non-essential region of the virus such as the polyhedrin gene and placed under control of the polyhedrin promoter.
- Successful insertion of the RET16 polypeptide will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
- the recombinant viruses can then be used to infect, for example, S.
- a number of viral-based expression systems can be utilized.
- sequences encoding the RET16 polypeptide can be ligated into an adenovirus transcription/ translation complex containing the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing the RET16 polypeptide in infected host cells (J. Logan and T. Shenk, 1984, Proc. Natl. Acad. Sci., 81 :3655-3659).
- transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.
- RSV Rous sarcoma virus
- Specific initiation signals can also be used to achieve more efficient translation of sequences encoding the RET16 polypeptide. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding the RET16 polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals, including the ATG initiation codon, should be provided. Furthermore, the initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system that is used, such as those described in the literature (D. Scharf et al., 1994, Results Probl. Cell Differ., 20:125-162).
- a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion.
- modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
- Post-translational processing which cleaves a "prepro" form of the protein can also be used to facilitate correct insertion, folding and/or function.
- Different host cells having specific cellular machinery and characteristic mechanisms for such post-translational activities are available from the American Type Culture Collection (ATCC), American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110- 2209, and can be chosen to ensure the correct modification and processing of the foreign protein.
- ATCC American Type Culture Collection
- ATCC American Type Culture Collection
- 10801 University Boulevard, Manassas, VA 20110- 2209 stable expression is preferred.
- cell lines which stably express the RET16 protein can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same, or on a separate, vector.
- cells can be allowed to grow for 1 -2 days in an enriched cell culture medium before they are switched to selective medium.
- the purpose of the selectable marker is to confer resistance to selection, and its presence allows the growth and recovery of cells which successfully express the introduced sequences.
- Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type.
- HSV TK Herpes Simplex Virus thymidine kinase
- adenine phosphoribosyltransferase l. Lowy et al., 1980, Cell, 22:817-283 genes which can be employed in tk " or aprt " cells, respectively.
- anti- metabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dhfr, which confers resistance to methotrexate (M. Wigler et al., 1980, Proc. Natl.
- npt which confers resistance to the aminoglycosides neomycin and G-418 (F. Colbere-Garapin et al., 1981 , J. Mol. Biol., 150:1-14); and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, supra). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (S.C Hartman and R.C Mulligan, 1988, Proc. Natl.
- RET16 nucleic acid sequence polypeptide is inserted within a marker gene sequence
- recombinant cells containing sequences encoding the RET16 polypeptide can be identified by the absence of marker gene function.
- a marker gene can be placed in tandem with a sequence encoding the RET16 polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates co-expression of the tandem gene.
- host cells which contain the nucleic acid sequence encoding the RET16 polypeptide and which express the RET16 polypeptide product can be identified by a variety of procedures known to those having skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques, including membrane, solution, or chip based technologies, for the detection and/or quantification of nucleic acid or protein.
- the RET16 polypeptide is substantially purified after expression.
- RET16 proteins can be isolated or purified in a variety of ways known to and practiced by those having skill in the art, depending on what other components can be present in the sample. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including, but not limited to, ion exchange, hydrophobic affinity and reverse phase HPLC chromatography, and chromatofocusing.
- the RET16 protein can be purified using a standard anti-RET16 antibody column. Ultrafiltration and diafiltration techniques, in conjunction with protein concentration, are also useful. For general guidance in suitable purification techniques, see R. Scopes, 1982, Protein Purification, Springer-Verlag, NY. As will be understood by the skilled practitioner, the degree of purification necessary will vary depending on the intended use of the RET16 protein; in some instances, no purification will be necessary.
- fragments of the RET16 polypeptide can be produced by direct peptide synthesis using solid-phase techniques (J. Merrifield, 1963, J. Am. Chem. Soc, 85:2149-2154). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using ABI 431 A Peptide Synthesizer (PE Biosystems). Various fragments of the RET16 polypeptide can be chemically synthesized separately and then combined using chemical methods to produce the full length molecule.
- RET16 Polynucleotide The presence of polynucleotide sequences encoding the RET16 polypeptide can be detected by DNA-DNA or DNA-RNA hybridization, or by amplification using probes or portions or fragments of polynucleotides encoding the RET16 polypeptide. Nucleic acid amplification based assays involve the use of oligonucleotides or oligomers, based on the sequences encoding the RET16 polypeptide, to detect transformants containing DNA or RNA encoding the RET16 polypeptide.
- Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding the RET16 polypeptide include oligo-labeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.
- the sequences encoding the RET16 polypeptide, or any portions or fragments thereof can be cloned into a vector for the production of an mRNA probe.
- RNA polymerase such as T7, T3, or SP(6)
- T7, T3, or SP(6) an appropriate RNA polymerase
- Suitable reporter molecules or labels which can be used include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
- Host cells transformed with nucleotide sequences encoding the RET16 protein, or fragments thereof, can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
- the protein produced by a recombinant cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
- expression vectors containing polynucleotides which encode the RET16 protein can be designed to contain signal sequences which direct secretion of the RET16 protein through a prokaryotic or eukaryotic cell membrane.
- nucleic acid sequences encoding the RET16 protein can be joined to nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins.
- purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals; protein A domains that allow purification on immobilized immunoglobulin; and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, WA).
- cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the RET16 protein can be used to facilitate purification.
- One such expression vector provides for expression of a fusion protein containing RET16-encoding sequence and a nucleic acid encoding 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography) as described by J. Porath et al., 1992, Prot. Exp.
- enterokinase cleavage site provides a means for purifying from the fusion protein.
- enterokinase cleavage site provides a means for purifying from the fusion protein.
- HACs Human artificial chromosomes
- HACs can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid vector.
- HACs are linear microchromosomes which can contain DNA sequences of 10K to 10M in size, and contain all of the elements that are required for stable mitotic chromosome segregation and maintenance (See, J.J. Harrington et al., 1997, Nature Genet, 15:345-355).
- HACs of 6 to 10M are constructed and delivered via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles) for therapeutic purposes.
- Purified RET16 protein, or fragments thereof can be used to produce antibodies, or to screen libraries of pharmaceutical agents or other compounds, particularly, small molecules, to identify those which specifically bind RET16.
- Such antibodies can be useful as antagonists or inhibitors of the RET16 polypeptide of the present invention and can be polyclonal, monoclonal, or recombinantly produced.
- Antibodies specific for the RET16 polypeptide, or immunogenic peptide fragments thereof can be generated using methods that have long been known and conventionally practiced in the art. Such antibodies can include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by an Fab expression library. Neutralizing antibodies, (i.e., those which inhibit dimer formation) are especially preferred for therapeutic use.
- various hosts including goats, rabbits, sheep, rats, mice, humans, and others, can be immunized by injection with RET16 polypeptide, or any peptide fragment or oligopeptide thereof, which has immunogenic properties.
- various adjuvants can be used to increase the immunological response. Nonlimiting examples of suitable adjuvants include Freund's
- Adjuvants typically used in humans include BCG (bacilli Calmette Guerin) and Corynebacterium parvumn.
- the peptides, fragments, or oligopeptides used to induce antibodies to RET16 polypeptide have an amino acid sequence having at least five amino acids, and more preferably, at least 7- 10 amino acids. It is also preferable that the immunogens are identical to a portion of the amino acid sequence of the natural protein; they can also contain the entire amino acid sequence of a small, naturally occurring molecule.
- the peptides, fragments or oligopeptides can comprise a single epitope or antigenic determinant or multiple epitopes. Short stretches of RET16 amino acids can be fused with those of another protein, such as KLH, and antibodies are produced against the chimeric molecule.
- Monoclonal antibodies to RET16 polypeptide, or immunogenic fragments thereof can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (G. Kohler et al., 1975, Nature, 256:495-497; D. Kozbor et al., 1985, J. Immunol. Methods, 81 :31-42; R.J. Cote et al., 1983, Proc. Natl. Acad. Sci. USA,
- Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobulin libraries (D.R. Burton, 1991 , Proc. Natl. Acad. Sci. USA, 88:11120-3). Antibodies can also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (R. Orlandi et al., 1989, Proc. Natl. Acad. Sci. USA, 86:3833-3837 and G. Winter et al., 1991 , Nature, 349:293-299). Antibody fragments which contain specific binding sites for the
- RET16 polypeptide can also be generated.
- fragments include, but are not limited to, F(ab') 2 fragments which can be produced by pepsin digestion of the antibody molecule and Fab fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragments.
- Fab expression libraries can be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (W.D. Huse et al., 1989, Science, 254.1275-1281).
- Various immunoassays can be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
- Such immunoassays typically involve measuring the formation of complexes between the RET16 polypeptide and its specific antibody.
- a two- site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive with two non-interfering RET16 polypeptide epitopes is preferred, but a competitive binding assay can also be employed (Maddox, supra).
- the polynucleotide encoding the RET16 polypeptide, or any fragment or complement thereof can be used for therapeutic purposes.
- antisense to the polynucleotide encoding the RET16 polypeptide can be used in situations in which it would be desirable to block the transcription of RET16 mRNA.
- cells can be transformed or transfected with sequences complementary to polynucleotides encoding the RET16 polypeptide, as described in Example 4 herein.
- complementary molecules can be used to modulate human RET16 polynucleotide and polypeptide activity, or to achieve regulation of gene function.
- sense or antisense oligomers or oligonucleotides, or larger fragments can be designed from various locations along the coding or control regions of polynucleotide sequences encoding the RET16 polypeptide.
- Expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids can be used for delivery of nucleotide sequences to the targeted organ, tissue or cell population. Methods which are well known to those skilled in the art can be used to construct recombinant vectors which will express nucleic acid sequence that is complementary to the nucleic acid sequence encoding the RET16 polypeptide. These techniques are described both in J. Sambrook et al., supra and in F.M. Ausubel et al., supra.
- the gene encoding the RET16 polypeptide can be turned off by transforming a cell or tissue with an expression vector that expresses high levels of a RET16 polypeptide-encoding polynucleotide, or a fragment thereof.
- Such constructs can be used to introduce untranslatable sense or antisense sequences into a cell. Even in the absence of integration into the DNA, such vectors can continue to transcribe RNA molecules until they are disabled by endogenous nucleases. Transient expression can last for a month or more with a non-replicating vector, and even longer if appropriate replication elements are designed to be part of the vector system.
- Modifications of gene expression can be obtained by designing antisense molecules or complementary nucleic acid sequences ( DNA, RNA, or PNA), to the control, 5', or regulatory regions of the gene encoding the RET16 polypeptide, (e.g., signal sequence, promoters, enhancers, and introns). Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules.
- the antisense molecule or complementary sequence can also be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
- Ribozymes i.e., enzymatic RNA molecules
- Ribozymes can also be used to catalyze the specific cleavage of RNA.
- the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- Suitable examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding the RET16 polypeptide.
- ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC
- ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC
- short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for secondary structural features which can render the oligonucleotide inoperable.
- the suitability of candidate targets can also be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
- RNA molecules can be generated by in vitro and in vivo transcription of DNA sequences encoding human RET16. Such DNA sequences can be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP. Alternatively, the cDNA constructs that constitutively or inducibly synthesize complementary RET16 RNA can be introduced into cell lines, cells, or tissues.
- RNA molecules can be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2' O-methyl (rather than phosphodiesterase linkages) within the backbone of the molecule.
- an expression vector containing the complement of the polynucleotide encoding the RET16 polypeptide, or an antisense oligonucleotide can be administered to an individual to treat or prevent an inflammatory disease or disorder and/or a disease or disorder associated with uncontrolled cell growth, hyperactivity or stimulation.
- a variety of specialized oligonucleotide delivery techniques can be employed, for example, encapsulation in unilamellar liposomes and reconstituted Sendai virus envelopes for RNA and DNA delivery (Arad et al., 1986, Biochem. Biophys. Acta., 859:88-94).
- the proteins, antagonists, antibodies, agonists, complementary sequences, or vectors of the present invention can be administered in combination with other appropriate therapeutic agents.
- Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
- the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
- Any of the therapeutic methods described above can be applied to any individual in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. Screening Methods
- the RET16 protein and nucleic acid can be used in screening assays of candidate bioactive agents that modulate RET16 bioactivity, for potential use to treat inflammation disorders, for example, such as those involving activated and/or hyperactive cells, e.g., T-cells, B-cells, endothelial cells, macrophages, neutrophils, mast cells and eosinophils.
- RET16 protein and encoding nucleic acid, as well as the bioactive agents that modulate RET16 activity or function can be used as effectors in methods to regulate cell activation.
- RET16 polynucleotide and polypeptide can also be modulated by interactive molecules.
- modulate herein is meant that the bioactivity of RET16 is altered, i.e., either increased, augmented, or enhanced, such as by agonists; or decreased, inhibited, or blocked, such as by antagonists.
- RET16 bioactivity is inhibited.
- TNF-alpha which is a factor involved in inflammatory responses, and is a candidate ubiquitin ligase; it can play a role in intracellular signaling, or it can serve as part of the master switch for the development of inflammatory processes. Accordingly, RET16 can be used as a target to screen for antagonists or inhibitors of its function or expression in the cell signaling cascade.
- RET16 proteins and nucleic acids are used in screening assays to identify and detect candidate bioactive agents that modulate RET16 bioactivity, for potential use to treat diseases which can be caused by hyperactivated B and/or T cells, e.g., autoimmune disease, as well as to treat inflammatory diseases involving cells which produce cytokines and factors that promote, accelerate, or exacerbate inflammation, e.g., leukocytes, mast cells, natural killer cells, neutrophils, macrophages, eosinophils, polymorphonuclear leukocytes, and the like, or cell damage in a variety of body tissues.
- diseases which can be caused by hyperactivated B and/or T cells
- autoimmune disease e.g., autoimmune disease
- inflammatory diseases involving cells which produce cytokines and factors that promote, accelerate, or exacerbate inflammation e.g., leukocytes, mast cells, natural killer cells, neutrophils, macrophages, eosinophils, polymorphonuclear leukocyte
- Nonlimiting examples of inflammatory diseases in which the master switch of the intracellular signaling cascade can be upregulated, stimulated, or otherwise involved include arthritis (both rheumatoid and juvenile); psoriasis; asthma; ischemia- reperfusion; rejection of organ or tissue transplants; chronic obstructive pulmonary disease; inflammatory bowel diseases, including Crohn's disease and ulcerative colitis; inacute respiratory distress syndrome; systemic lupus erythematosis, multiple sclerosis and cystic fibrosis.
- RET16 polypeptide is non-diffusably bound to an insoluble support having isolated sample receiving areas (e.g. a microtiter plate, an array, etc.).
- isolated sample receiving areas e.g. a microtiter plate, an array, etc.
- suitable insoluble supports are that they can be made of any composition to which polypeptides can be bound, they are readily separated from soluble material, and they are otherwise compatible with the overall method of screening.
- the surface of such supports can be solid or porous and of any convenient size or shape.
- suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (e.g., polystyrene), polysaccharides, nylon or nitrocellulose.
- Microtiter plates and arrays are especially convenient, because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples.
- the particular manner of binding the polypeptide is not crucial, so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the peptide and is nondiffusable.
- Preferred methods of binding include the use of antibodies (which should not hinder the binding of RET16 to its associated proteins), direct binding to "sticky" or ionic supports, chemical crosslinking, etc.
- excess unbound material is removed by washing.
- the sample receiving areas can then be blocked as needed through incubation with bovine serum albumin (BSA), casein or other innocuous/nonreactive protein.
- BSA bovine serum albumin
- Novel binding agents include specific antibodies, non-natural binding agents identified in screens of chemical libraries, peptide analogs, etc. Of particular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays can be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, and the like.
- agent as used herein describes any molecule, e.g., protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., having the capability of directly or indirectly altering the bioactivity of RET16 proteins.
- a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
- one of these concentrations serves as a negative control, i.e., at zero concentration, or below the level of detection.
- Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 10,000 daltons, preferably, less than about 2000 to 5000 daltons, as a nonlimiting example.
- Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
- the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
- Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides.
- libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced.
- natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means.
- Known pharmacological agents can be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification to produce structural analogs.
- the candidate bioactive agent is labeled, and binding is determined directly.
- the screening assay is a binding assay
- one or more of the molecules can be joined to a label, where the label can directly or indirectly provide a detectable signal.
- Various labels include radioisotopes, fluorescent and chemiluminescent compounds, specific binding molecules, particles, e.g. magnetic particles, and the like.
- Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
- the complementary member would normally be labeled with a molecule which allows detection, in accordance with known procedures.
- only one of the components is labeled.
- more than one component can be labeled with different labels; for example, the RET16 polypeptide can be labeled with one fluorophor and the candidate agent labeled with another
- the candidate bioactive agent is labeled.
- Labeled candidate bioactive agents are incubated with the RET16 polypeptide for a time sufficient to allow binding, if present. Incubations can be performed at any temperature which facilitates optimal activity, typically between 4 9 C and 40 Q C Incubation periods are selected for optimum activity, but can also be optimized to facilitate rapid high throughput screening. Typically between 0.1 and 1 hour is sufficient. Excess reagent is generally removed or washed away. The presence or absence of the labeled component is detected to determine and indicate binding.
- reagents can be included in the screening assay.
- Such reagents include, but are not limited to, salts, neutral proteins, e.g. albumin, detergents, etc., which can be used to facilitate optimal protein- protein binding and/or reduce non-specific or background interactions.
- reagents that otherwise improve the efficiency of the assay such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. can be used.
- the mixture of components in the method can be added in any order that provides for the requisite binding.
- Kits are included as an embodiment of the present invention which comprise containers with reagents necessary to screen test compounds.
- kits include human RET16 polynucleotide or polypeptide and instructions for performing the assay.
- the ability to enhance specific characteristics of the invention e.g., the RET16 polynucleotides and/or proteins, through directed molecular evolution.
- Such an enhancement can, as non-limiting examples, benefit the following: the utility of the invention as an essential component in a kit; the physical attributes of the invention, such as its solubility, structure, or codon optimization; the specific biological activity of the invention, including any associated enzymatic activity, enzyme kinetics of the protein, the Ki, Kcat, Km, Vmax, Kd of the protein; protein-protein activity; protein-DNA binding activity; antagonist/inhibitory activity (including direct or indirect interaction); agonist activity (including direct or indirect interaction); the antigenicity of the protein (e.g., in which it would be desirable to either increase or decrease the antigenic potential of the protein); the immunogenicity of the protein; the ability of the protein to form dimers, trimers, or multimers with either itself or other proteins; and the antigenic efficacy of the invention, including its
- the ability to enhance specific characteristics of a protein can also apply to changing the characterized activity of an enzyme to an activity completely unrelated to its initially characterized activity.
- Other desirable enhancements of the invention are specific to each individual protein, and would thus be well known in the art and contemplated by the present invention.
- an engineered ubiquitin ligase enzyme can be constitutively active upon binding of its substrate.
- an engineered ubiquitin ligase enzyme can be constitutively active in the absence of substrate binding.
- an engineered ubiquitin ligase enzyme can be capable of being activated with less than all of the regulatory factors and/or conditions typically required for ubiquitin ligase enzyme activation (e.g., substrate binding, phosphorylation, conformational changes, etc.).
- ubiquitin ligase enzyme is useful in screens to identify ubiquitin ligase enzyme modulators, among other uses described herein.
- an engineered ubiquitin ligase enzyme can have altered substrate specificity, and/or enhanced ubiquitin ligase enzyme activity.
- an engineered ubiquitin ligase enzyme can have decreased ubiquitin ligase enzyme activity.
- Directed evolution is comprised of several steps.
- the first step establishes a library of variants for the gene or protein of interest.
- the most important step is then to select for those variants that entail the activity to be identified.
- the design of the screen is essential, since the screen should be selective enough to eliminate non-useful variants, but not so stringent as to eliminate all variants.
- the last step is then to repeat the above steps using the best variant from the previous screen. Each successive cycle can then be tailored as necessary, such as increasing the stringency of the screen, for example.
- reaction conditions can be utilized to carry out the DNA shuffling reaction.
- specific reaction conditions for DNA shuffling are provided, for example, as described in PNASUSA, 91 : 10747, (1994).
- the preparation can be in the form of simply purifying the DNA from contaminating cellular material, chemicals, buffers, oligonucleotide primers, deoxynucleotides, RNAs, etc., and can entail the use of DNA purification kits, such as those provided by Qiagen, Inc., or by Promega, Corp., for example.
- the DNA substrate Once the DNA substrate has been purified, it is subjected to Dnase I digestion.
- DNA substrate(s) About 2-4 ⁇ g of the DNA substrate(s) are digested with 0.0015 units of Dnase I (Sigma) per ⁇ l in 100 ⁇ l of 50 mM Tris-HCI, pH 7.4 / 1 mM MgCI 2 for 10-20 minutes at room temperature.
- the resulting DNA fragments of 10-50 bp are then purified by subjecting them to electrophoresis through a low-melting point agarose gel (2% ) and/or onto DE81 ion-exchange paper (Whatman).
- the DNA fragments can be purified using Microcon concentrators (Amicon) of the appropriate molecular weight cutoff, or oligonucleotide purification columns (Qiagen) can be used, in addition to other methods known in the art. If using DE81 ion-exchange paper, the 10- 50 bp fragments can be eluted from the paper using 1 M NaCl, followed by ethanoi precipitation.
- the resulting purified fragments are then subjected to a PCR assembly reaction by re-suspension in a PCR mixture containing: 2 mM of each dNTP, 2.2 mM MgCI 2 , 50 mM KCl, 10 mM Tris «HCL, pH 9.0, and 0.1% Triton X-100, at a final fragment concentration of 10-30 ng/ ⁇ l. No primers are added at this point.
- Taq DNA polymerase Promega is used at 2.5 units per 100 ⁇ l of reaction mixture.
- a PCR program of 94 C for 60 seconds (s); 94 C for 30s, 50-55 C for 30s, and 72 C for 30s using 30-45 cycles, followed by 72 C for 5 minutes using an MJ Research (Cambridge, MA) PTC-150 thermocycler is used.
- a 1 :40 dilution of the resulting primerless product is then introduced into a PCR mixture (using the same buffer mixture used for the assembly reaction) containing 0.8 ⁇ m of each primer and subjecting this mixture to 15 cycles of PCR (using 94 C for 30s, 50 C for 30s, and 72 C for 30s).
- the preferred primers are those which correspond to the nucleic acid sequences of the polynucleotide(s) utilized in the shuffling reaction.
- Such primers can consist of modified nucleic acid base pairs using methods known in the art and referred to elsewhere herein, or can contain additional sequences (i.e., for adding restriction sites, mutating specific base-pairs, etc.).
- the resulting shuffled, assembled, and amplified product can be purified using methods well known in the art (e.g., Qiagen PCR purification kits) and then subsequently cloned using appropriate restriction enzymes.
- DNA shuffling method can also be tailored to the desired level of mutagenesis using the methods described by Zhao et al. 1997, Nucl Acid Res., 25(6):1307-1308.
- the randomized pool can then be subjected to a specific screen to identify the variant possessing the desired characteristic(s).
- DNA corresponding to the variant can then be used as the DNA substrate for initiating another round of DNA shuffling.
- This cycle of shuffling, selecting the optimized variant of interest, and then re-shuffling, can be repeated until the ultimate variant is obtained.
- Examples of model screens applied to identify variants created using DNA shuffling technology can be found in the following publications: J. C Moore et al., 1997, J. Mol. Biol., 272:336-347; F.R. Cross et al., 1998, Mol. Cell. Biol., 18:2923-2931 ; and A. Crameri et al., 1997, Nat. Biotech., 15:436-438.
- DNA shuffling has several advantages. First, it makes use of beneficial mutations. When combined with screening, DNA shuffling allows the discovery of the best mutational combinations and does not assume that the best combination contains all the mutations in a population. Second, recombination occurs simultaneously with point mutagenesis. An effect of forcing DNA polymerase to synthesize full-length genes from the small fragment DNA pool results in a background mutagenesis rate. In combination with a stringent selection method, enzymatic activity has been evolved up to a 16000 fold increase over the wild-type form of the enzyme. In essence, the background mutagenesis yielded the genetic variability on which recombination acted to enhance the activity.
- a third feature of recombination is that it can be used to remove deleterious mutations.
- Such mutations can be removed by including in the assembly reaction an excess of the wild-type random-sized fragments, in addition to the random-sized fragments of the selected mutant from the previous selection.
- some of the most active variants of the polynucleotide/polypeptide/enzyme should have lost the inhibitory mutations.
- recombination enables parallel processing. This represents a significant advantage, since there are likely to be multiple characteristics that make a protein more desirable (e.g., solubility, activity, etc.). Since it is increasingly difficult to screen for more than one desirable characteristic or trait at a time, other methods of molecular evolution tend to be inhibitory. However, using recombination, it is possible to combine the randomized fragments of the best representative variants for the various traits, and then select for multiple properties at once.
- DNA shuffling can also be applied to the polynucleotides and polypeptides of the present invention to decrease their immunogenicity in a specif ied host.
- a particular variant of the present invention can be created and isolated using DNA shuffling technology.
- Such a variant can have all of the desired characteristics, although it may be highly immunogenic in a host due to its novel intrinsic structure.
- the desired characteristic can cause the polypeptide to have a non-native structure which could no longer be recognized as a "self” molecule, but rather as “foreign", and thus activate a host immune response directed against the novel variant.
- Such a problem can be overcome, for example, by including a copy of the gene sequence for a xenobiotic ortholog of the native protein with the gene sequence of the novel variant gene in one or more cycles of DNA shuffling.
- the molar ratio of the ortholog and the novel variant DNAs could be varied accordingly.
- the resulting hybrid variant identified contains at least some of the coding sequence which enabled the xenobiotic protein to evade the host immune system, as well as the coding sequence of the original novel variant that provided the desired characteristics.
- the present invention encompasses the application of DNA shuffling technology to the evolution of the polynucleotides and polypeptides of the invention, wherein one or more cycles of DNA shuffling include, in addition to the gene template DNA, oligonucleotides coding for known allelic sequences, optimized codon sequences, known variant sequences, known polynucleotide polymorphism sequences, known ortholog sequences, known homolog sequences, additional homologous sequences, additional non-homologous sequences, sequences from another species, and any number and combination of the above.
- WO 00/12680 provides methods and compositions for generating, modifying, adapting, and optimizing polynucleotide sequences that confer detectable phenotypic properties on plant species.
- Pharmaceutical Compositions A further embodiment of the present invention embraces physiologically acceptable and pharmaceutically acceptable compositions comprising RET16 nucleic acids, encoded polypeptides, or peptides, antibodies to RET16 polypeptides, or fragments thereof, mimetics, agonists (e.g., activators), or antagonists (e.g., inhibitors) of the RET16 polypeptide or polynucleotide..
- compositions can be administered alone or in combination with at least one other agent, such as a stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- a stabilizing compound which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
- the compositions can be administered to a patient alone, or in combination with other agents, drugs, hormones, or biological response modifiers.
- compositions for use in the present invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, vaginal, or rectal means.
- the pharmaceutical compositions can contain suitable pharmaceutically acceptable carriers or excipients comprising auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration are provided in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
- compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration.
- Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
- compositions for oral use can be obtained by the combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
- Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropyl- methylcellulose, or sodium carboxymethylcellulose; gums, including arabic and tragacanth, and proteins such as gelatin and collagen.
- disintegrating or solubilizing agents can be added, such as cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a physiologically acceptable salt thereof, such as sodium alginate.
- Dragee cores can be used in conjunction with physiologically suitable coatings, such as concentrated sugar solutions, which can also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification, or to characterize the quantity of active compound, i.e., dosage.
- Pharmaceutical preparations which can be used orally include push- fit capsules made of gelatin, as well as soft, scaled capsules made of gelatin and a coating, such as glycerol or sorbitol.
- Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
- a filler or binders such as lactose or starches
- lubricants such as talc or magnesium stearate
- stabilizers optionally, stabilizers.
- the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
- compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
- Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyloleate or triglycerides, or liposomes.
- the suspension can also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
- penetrants or permeation agents that are appropriate to the particular barrier to be permeated are used in the formulation.
- penetrants are generally known in the art.
- the pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, and the like. Salts tend to be more soluble in aqueous solvents, or other protonic solvents, than are the corresponding free base forms.
- the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1 - 50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, combined with a buffer prior to use.
- the pharmaceutical compositions After the pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. For administration of the RET16 product, such labeling would include amount, frequency, and method of administration.
- compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose.
- an effective dose or amount is well within the capability of those skilled in the art.
- the therapeutically effective dose can be estimated initially either in cell culture assays, e.g., using neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs.
- the animal model can also be used to determine the appropriate concentration range and route of administration. Such information can then be used and extrapolated to determine useful doses and routes for administration in humans.
- a therapeutically effective dose refers to that amount of active ingredient, for example, the RET16 polypeptide, or active fragments thereof, antibodies to the RET16 polypeptide, agonists or antagonists of the RET16 polypeptide, which ameliorates, reduces, or eliminates the symptoms or condition.
- Therapeutic efficacy and toxicity can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population).
- the dose ratio of toxic to therapeutic effects is the therapeutic index, which can be expressed as the ratio, ED 50 /LD 50 .
- Pharmaceutical compositions which exhibit large therapeutic indices are preferred.
- Preferred dosage contained in a pharmaceutical composition is within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
- Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Factors which may be taken into account include the severity of the individual's disease state, general health of the patient, age, weight, and gender of the patient, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. As a general guide, long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks, depending on half-life and clearance rate of the particular formulation.
- Normal dosage amounts can vary from 0.1 to 100,000 micrograms ( ⁇ g), up to a total dose of about 1 gram (g), depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature and is generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, and the like. Assavs and Diagnostics
- antibodies which specifically bind to the RET16 polypeptide can be used for the diagnosis of conditions or diseases characterized by expression (or overexpression) of the RET16 polynucleotide or polypeptide, or in assays to monitor patients being treated with RET16 polypeptide, or its agonists, antagonists, or inhibitors.
- the antibodies useful for diagnostic purposes can be prepared in the same manner as those described above for use in therapeutic methods. Diagnostic assays for the RET16 polypeptide include methods which utilize the antibody and a label to detect the protein in human body fluids or extracts of cells or tissues.
- the antibodies can be used with or without modification, and can be labeled by joining them, either covalently or non- covalently, with a reporter molecule.
- a wide variety of reporter molecules which are known in the art can be used, several of which are described above.
- RET16 polypeptide expression Normal or standard values for RET16 polypeptide expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably human, with antibody to the RET16 polypeptide under conditions suitable for complex formation. The amount of standard complex formation can be quantified by various methods; photometric means are preferred. Quantities of the RET16 polypeptide expressed in subject sample, control sample, and disease samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
- the polynucleotides encoding RET16 polypeptide can be used for diagnostic purposes.
- the polynucleotides which can be used include oligonucleotide sequences, complementary RNA and DNA molecules, and PNAs.
- the polynucleotides can be used to detect and quantify RET16-encoding nucleic acid expression in biopsied tissues in which expression (or under- or overexpression) of RET16 polynucleotide can be correlated with disease.
- the diagnostic assay can be used to distinguish between the absence, presence, and excess expression of RET16, and to monitor regulation of RET16 polynucleotide levels during therapeutic treatment or intervention.
- hybridization with PCR probes which are capable of detecting polynucleotide sequences, including genomic sequences, encoding RET16 polypeptide, or closely related molecules, can be used to identify nucleic acid sequences which encode the RET16 polypeptide.
- the specificity of the probe whether it is made from a highly specific region, e.g., about 8 to 10 or 12 or 15 contiguous nucleotides in the 5' regulatory region, or a less specific region, e.g., especially in the 3' coding region, and the stringency of the hybridization or amplification (maximal, high, intermediate, or low) will determine whether the probe identifies only naturally occurring sequences encoding the RET16 polypeptide, alleles thereof, or related sequences.
- Probes can also be used for the detection of related sequences, and should preferably contain at least 50%, preferably greater than 80%, of the nucleotides encoding RET16 polypeptide.
- the hybridization probes of this invention can be DNA or RNA and can be derived from the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:3, or from genomic sequence including promoter, enhancer elements, and introns of the naturally occurring RET16 protein.
- Methods for producing specific hybridization probes for DNA encoding the RET16 polypeptide include the cloning of nucleic acid sequence that encodes the RET16 polypeptide, or RET16 derivatives, into vectors for the production of mRNA probes.
- vectors are known in the art, commercially available, and can be used to synthesize RNA probes in vitro by means of the addition of the appropriate RNA polymerases and the appropriate labeled nucleotides.
- Hybridization probes can be labeled by a variety of detector/reporter groups, e.g., radionuclides such as 32 P or 35 S, or enzymatic labels, such as alkaline phosphatase coupled to the probe via avidin/ biotin coupling systems, and the like.
- detector/reporter groups e.g., radionuclides such as 32 P or 35 S
- enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/ biotin coupling systems, and the like.
- the polynucleotide sequence encoding the RET16 polypeptide can be used in Southern or Northern analysis, dot blot, or other membrane- based technologies; in PCR technologies; or in dip stick, pin, ELISA or chip assays utilizing fluids or tissues from patient biopsies to detect the status of, e.g., levels or overexpression of RET16, or to detect altered RET16 expression. Such qualitative or quantitative methods are well known in the art.
- the nucleotide sequence encoding the RET16 polypeptide can be useful in assays that detect activation or induction of various inflammatory disease, neoplasms or cancers, particularly those mentioned supra.
- the nucleotide sequence encoding the RET16 polypeptide can be labeled by standard methods, and added to a fluid or tissue sample from a patient under conditions suitable for the formation of hybridization complexes. After a suitable incubation period, the sample is washed and the signal is quantified and compared with a standard value.
- nucleotide sequence has hybridized with nucleotide sequence present in the sample, and the presence of altered levels of nucleotide sequence encoding the RET16 polypeptide in the sample indicates the presence of the associated disease.
- assays can also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials, or in monitoring the treatment of an individual patient.
- a normal or standard profile for expression is established. This can be accomplished by combining body fluids or cell extracts taken from normal subjects, either animal or human, with a sequence, or a fragment thereof, which encodes the RET16 polypeptide, under conditions suitable for hybridization or amplification. Standard hybridization can be quantified by comparing the values obtained from normal subjects with those from an experiment where a known amount of a substantially purified polynucleotide is used. Standard values obtained from normal samples can be compared with values obtained from samples from patients who are symptomatic for disease. Deviation between standard and subject (patient) values is used to establish the presence of disease.
- hybridization assays can be repeated on a regular basis to evaluate whether the level of expression in the patient begins to approximate that which is observed in a normal individual.
- the results obtained from successive assays can be used to show the efficacy of treatment over a period ranging from several days to months.
- the presence of an abnormal amount of transcript in biopsied tissue from an individual can indicate a predisposition for the development of the disease, or can provide a means for detecting the disease prior to the appearance of actual clinical symptoms.
- a more definitive diagnosis of this type can allow health professionals to employ preventative measures or aggressive treatment earlier, thereby preventing the development or further progression of the cancer.
- Additional diagnostic uses for oligonucleotides designed from the nucleic acid sequence encoding the RET16 polypeptide can involve the use of PCR. Such oligomers can be chemically synthesized, generated enzymatically, or produced from a recombinant source.
- Oligomers will preferably comprise two nucleotide sequences, one with sense orientation (5 A3') and another with antisense (3A5 1 ), employed under optimized conditions for identification of a specific gene or condition.
- the same two oligomers, nested sets of oligomers, or even a degenerate pool of oligomers can be employed under less stringent conditions for detection and/or quantification of closely related DNA or RNA sequences.
- Methods suitable for quantifying the expression of RET16 include radiolabeling or biotinylating nucleotides, co-amplification of a control nucleic acid, and standard curves onto which the experimental results are interpolated (P.C Melby et al., 1993, J. Immunol.
- oligonucleotides, or longer fragments derived from the RET16 polynucleotide sequence described herein can be used as targets in a microarray.
- the microarray can be used to monitor the expression level of large numbers of genes simultaneously (to produce a transcript image), and to identify genetic variants, mutations and polymorphisms.
- microarray is prepared and used according to the methods described in WO 95/11995 (Chee et al.); D.J.
- the nucleic acid sequence which encodes the RET16 polypeptide can also be used to generate hybridization probes which are useful for mapping the naturally occurring genomic sequence.
- the sequences can be mapped to a particular chromosome, to a specific region of a chromosome, or to artificial chromosome constructions (HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial PI constructions, or single chromosome cDNA libraries, as reviewed by CM. Price, 1993, Blood Rev., 7:127-134 and by B.J. Trask, 1991 , Trends Genet, 7:149-154.
- the RET16 polypeptide, its catalytic or immunogenic fragments or oligopeptides thereof can be used for screening libraries of compounds in any of a variety of drug screening techniques.
- the fragment employed in such screening can be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly.
- the formation of binding complexes, between the RET16 polypeptide, or portion thereof, and the agent being tested, can be measured utilizing techniques commonly practiced in the art and as described above.
- Another technique for drug screening which can be used provides for high throughput screening of compounds having suitable binding affinity to the protein of interest as described in WO 84/03564.
- RET16 polypeptide As applied to the RET16 protein, large numbers of different small test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The test compounds are reacted with the RET16 polypeptide, or fragments thereof, and washed. Bound RET16 polypeptide is then detected by methods well known in the art. Purified RET16 polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques. Alternatively, non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
- screening and small molecule detection assays which involve the detection or identification of small molecules that can bind to a given protein, i.e., the RET16 protein, are encompassed by the present invention.
- Particularly preferred are assays suitable for high throughput screening methodologies.
- a functional assay is not typically required. All that is needed is a target protein, preferably substantially purified, and a library or panel of compounds (e.g., ligands, drugs, small molecules) to be screened or assayed for binding to the protein target.
- a library or panel of compounds e.g., ligands, drugs, small molecules
- most small molecules that bind to the target protein will modulate activity in some manner, due to preferential, higher affinity binding to functional areas or sites on the protein.
- an assay is the fluorescence based thermal shift assay (3-Dimensional Pharmaceuticals, Inc., 3DP, Exton, PA) as described in U.S. Patent Nos. 6,020,141 and 6,036,920 to Pantoliano et al.; see also, J. Zimmerman, 2000, Gen. Eng. News, 20(8)).
- the assay allows the detection of small molecules (e.g., drugs, ligands) that bind to expressed, and preferably purified, RET16 polypeptide based on affinity of binding determinations by analyzing thermal unfolding curves of protein-drug or ligand complexes.
- the drugs or binding molecules determined by this technique can be further assayed, if desired, by methods, such as those described herein, to determine if the molecules affect or modulate function or activity of the target protein.
- competitive drug screening assays can be used in which neutralizing antibodies capable of binding RET16 polypeptide specifically compete with a test compound for binding to RET16 polypeptide. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants with the RET16 polypeptide.
- the present invention further encompasses transgenic non-human mammals, preferably mice, that comprise a recombinant expression vector harboring a nucleic acid sequence that encodes human RET16 comprising the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:4.
- Transgenic non-human mammals useful to produce recombinant proteins are well known to the skilled practitioner, as are the expression vectors necessary and the techniques for generating transgenic animals.
- the transgenic animal comprises a recombinant expression vector in which the nucleotide sequence that encodes human RET16 is operably linked to a tissue specific promoter whereby the coding sequence is only expressed in that specific tissue.
- the tissue specific promoter can be a mammary cell specific promoter and the recombinant protein so expressed is recovered from the animal's milk.
- transgenic animals particularly transgenic mice, containing a nucleic acid molecule which encodes human RET16 can be used as animal models for studying in vivo the overexpression of RET16 and for use in drug evaluation and discovery efforts to find compounds effective to inhibit or modulate the activity of RET16, such as for example compounds for treating inflammatory disorders, diseases, or conditions.
- One having ordinary skill in the art using standard techniques, such as those taught in U.S. Patent No. 4,873,191 , issued Oct. 10, 1989 to Wagner and in U.S. Patent No. 4,736,866, issued April 12, 1988 to Leder, can produce transgenic animals which produce human RET16, and use the animals in drug evaluation and discovery projects.
- transgenic mice can be generated which are homozygous for a mutated, non-functional RET16 gene which is introduced into the animals using well known techniques.
- the knock-out mice produce no functional RET16 and thus are useful to study the function of RET16.
- the mice can be used in assays to study the effects of test compounds in RET16 deficient animals. For instance, RET16- deficient mice can be used to determine if, how and to what extent RET16 inhibitors will effect the animal and thus address concerns associated with inhibiting the activity of the molecule.
- mice Methods of generating genetically deficient "knock out" mice are well known and are disclosed in M.R. Capecchi, 1989, Science, 244:1288-1292 and P. Li et al., 1995, Cell, 80:401-41 1.
- the mouse (or human) RET16 cDNA clone can be used to isolate a murine RET16 genomic clone.
- the genomic clone can be used to prepare a RET16 targeting construct which can disrupt the RET16 gene in the mouse by homologous recombination.
- the targeting construct contains a non-functioning portion of the RET16 gene which inserts in place of the functioning portion of the native mouse gene.
- the non-functioning insert generally contains an insertion in the exon that encodes the active region of RET16.
- the targeting construct can contain markers for both positive and negative selection.
- the positive selection marker allows for the selective elimination of cells which do not carry the marker, while the negative selection marker allows for the elimination of cells that carry the marker.
- a first selectable marker is a positive marker that will allow for the survival of cells carrying it.
- the first selectable marker is an antibiotic resistance gene, such as the neomycin resistance gene, which can be placed within the coding sequence of the RET16 gene to render it non-functional, while at the same time rendering the construct selectable.
- the antibiotic resistance gene is within the homologous region which can recombine with native sequences. Thus, upon homologous recombination, the non-functional and antibiotic resistance selectable gene sequences will be taken up. Knock-out mice can be used as models for studying inflammation-related disorders and screening compounds for treating these disorders.
- the targeting construct also contains a second selectable marker which is a negative selectable marker. Cells with the negative selectable marker will be eliminated. The second selectable marker is outside the recombination region. Thus, if the entire construct is present in the cell, both markers will be present. If the construct has recombined with native sequences, the first selectable marker will be incorporated into the genome and the second will be lost.
- the herpes simplex virus thymidine kinase (HSV tk) gene is an example of a negative selectable marker which can be used as a second marker to eliminate cells that carry it. Cells with the HSV tk gene are selectively killed in the presence of gangcyclovir.
- Cells are transfected with targeting constructs and then selected for the presence of the first selection marker and the absence of the second.
- Constructs / DNA are then injected into the blastocyst stage and implanted into pseudopregnant females.
- Chimeric offspring which are capable of transferring the recombinant genes in their germline are selected, mated and their offspring examined for heterozygous carriers of the recombined genes. Mating of the heterozygous offspring can then be used to generate fully homozygous offspring which constitute RET16-deficient knock-out mice.
- RET16 polynucleotides and encoded polypeptides, fragments thereof, or antibodies thereto include a method of using a polynucleotide sequence to purify a molecule or compound in a sample, where the molecule or compound specifically binds to the polynucleotide.
- a method comprises combining a RET16 polynucleotide of this invention under conditions to allow specific binding; detecting specific binding between the RET16 polynucleotide and the molecule or compound in the sample; recovering the bound polynucleotide; and separating the polynucleotide from the molecule or compound, thereby obtaining a purified molecule or compound.
- RET16 cell signaling protein
- a test compound e.g., antagonists or agonists
- a cell or tissue that expresses a RET16 protein, or functional fragment thereof
- candidate modulating compounds those test compounds that modulate activity of the RET16 protein that is involved in the cell signaling cascade.
- the RET16 cell signaling cascade protein activity can be its binding to an interacting domain of a second intracellular cell signaling protein.
- Another method encompassed by the present invention involves screening for candidate compounds that are capable of binding to a RET16 cell signaling protein or fragment thereof, which includes contacting a test compound with (i) a cell or tissue expressing the RET16 cell signaling protein according to the present invention, or (ii) an isolated protein thereof; and selecting test compounds that bind to the RET16 cell signaling protein.
- An additional method of this invention is that of screening for compounds to identify those compounds which enhance, increase, or accelerate the binding of a RET16 protein with a second cell signaling protein.
- Such a method involves contacting the RET16 protein according to the present invention with a second cell signaling molecule with which it binds or associates in the presence or absence of a test compound under conditions which permit binding and determining if the level of binding of the RET16 protein to the second cell signaling molecule is enhanced, increased or accelerated by comparing the level of binding in the presence of the test compound with that in the absence of the test compound. It will be appreciated that the foregoing methods are particularly suited for performance by high throughput screening.
- RET16 A clone containing the predicted coding sequence of RET16 was isolated from human microvascular endothelial cells (HMVECs) treated with tumor necrosis factor alpha (TNF ⁇ ) for 6 hours using reverse transcription/polymerase chain reaction (RT/PCR).
- HMVECs human microvascular endothelial cells
- TNF ⁇ tumor necrosis factor alpha
- RT/PCR reverse transcription/polymerase chain reaction
- a triple primer set (each at 400 nM final concentration) was used to amplify a 1532 bp sequence using the following conditions:
- JNF 346 (5'-TCACCTGCGCGGCACGTGACCC-3'), (SEQ ID NO:17); JNF 493 (5'-TTTACTTTTGGTGTGTCTCCAGCC-3'), (SEQ ID NO:18); JNF 494 (5'-TTACTTTTGGTGTGTCTCCAGCCATCTATTGATGGC-3'), (SEQ ID NO:19) with 200 ⁇ M dNTP's, 1X Advantage 2 Polymerase PCR Buffer, 1X Advantage 2 Polymerase, and 2.0 ⁇ l DNA in 25.0 ⁇ l reaction. The experiment was cycled 35 times through 94°C for 30 seconds, 68°C for 30 seconds, and 72°C for 2 minutes.
- Ret16pTAdv_Endo_01 contains a 1532 bp sequence corresponding to the predicted Ret16 coding sequence.
- a nucleic acid sequence encoding the RET16 polypeptide was first identified in a subtraction library from TNF-alpha stimulated human lung microvascular endothelial cells (HMVEC). This subtraction clone sequence encoded a 630 bp partial cDNA sequence, SEQ ID NO:5, as shown in FIG. 4C
- the consensus sequence, SEQ ID NO:1 (FIGS. 1 and 3), was derived from the following overlapping and/or extended nucleic acid sequences: Incyte clones 2552523 (LUNGTUT06), 4632828 (GBLADIT02), 1687704 (PROSTUT10), 2674742 (KIDNNOT19), and public EST clone AI187875 (testis).
- HMVEC TNF-alpha stimulated human lung microvascular endothelial cells
- huRET16 The coding sequence of huRET16 was used to search against the mouse EST database as described hereinabove.
- Several murine EST's were identified. They are as follows: AU035693, AA118718, AA204608, W41056, AW146018, AI450495, AI875443, AI316544, AW494796, AW146018 and BE983890.
- the muRET16 nucleic acid sequence has 80% identity with huRET16.
- the muRET16 amino acid sequence is 82.5% identical to huRET16 (86.5% similarity).
- MuRET16 has 7 predicted WD repeats and 1 SAM domain, all with a score >10.
- RET16 is composed of 11 exon fragments. Exon 1 consists of nucleotides 1-123. Exon 2 consists of nucleotides 124-545. Exon 3 consists of nucleotides 546-730. Exon 4 consists of nucleotides 731-823. Exon 5 consists of nucleotides 824-917. Exon 6 consists of nucleotides 918-951. Exon 7 consists of nucleotides 952-992.
- Exon 8 consists of nucleotides 993-1099.
- Exon 9 consists of nucleotides 1100-1279.
- Exon 10 consists of nucleotides 1280-1420.
- Exon 11 consists of nucleotides 1421-1810. Exon 11 is followed by a poly A tail.
- a polyadenylation site (AATAA) is located from 1795-1799. According to AC006501 , intron 1 - intron 10 are 3489, 2755, 4123, 3750, 11859, 1824, 80, 1382, 7683, and 12181 nucleotides in length, respectively.
- T-225 flasks of HMVEC cells were adjusted to 40 ml of medium per flask by removing medium.
- Several of the flasks were treated with 10 ng/ml TNF-alpha for 1 hour, 6 hours and 24 hours; other flasks were not treated with TNF-alpha as controls.
- TNF-alpha- treated cells were compared with untreated cells. The medium was not changed at the time of TNF-alpha addition.
- the treated flasks of HMVEC cells were briefly trypsinized (10 ml of trypsin per flask). Trypsinization was terminated by the addition of fetal calf serum to 50% final volume and the flasks were rinsed with PBS, pH 7.4 (Gibco, Grand Island, NY). The pooled cells and the PBS rinse from the flasks were pooled and centrifuged (534 x g) for 10 minutes, and the cell pellet was resuspended in PBS and re-centrifuged. The supernatant was removed and the cell pellet used for RNA isolation. PoIyA+ RNA was isolated directly using Fast Track 2.0TM (Invitrogen, Carlsbad, CA). G. Construction of the subtraction library
- the PCR-select cDNA subtraction kitTM (Clontech, Palo Alto, CA) was used to generate a subtraction library from untreated HMVEC poly A+ RNA (tester) and 1 hour TNF-treated HMVEC poly A+ RNA (driver), according to the manufacturer's protocols.
- Ten secondary PCR reactions were combined and run on a 2% agarose gel. Fragments ranging from approximately 0.3 kb to 10 kb were gel purified using the QIAgen gel extraction kit (QIAgen Inc., Valencia, CA) and inserted into the TA cloning vector, pCR2.1 (Invitrogen). TOP10F' competent E.
- MTN Multiple Tissue Northern blots
- Clontech Clontech (Palo Alto, CA).
- the MTN's used were human MTN (#7760-1), human MTN II (#7759-1), human MTN III (#7767-1), and human cancer cell line MTN (#7757-1).
- Membranes were prehybridized with ExpressHyb hybridization solution (Clontech) for 1 hour at 68°C and then hybridized for 2 hours with a 32 P-labeled probe prepared as follows: The original isolated RET16 subtraction clone was digested using EcoRI restriction endonuclease (Life Technologies, Gaithersburg, MD). A 540 bp partial cDNA fragment was labeled with 32 P-dCTP using a random primed labeling kit (Roche
- Radioactive probe was added at a specific activity of 2x10 6 counts per minute per milliliter of hybridization solution.
- membranes were washed by continuous shaking for 30 minutes with low stringency solution (2 x SSC / 0.05% SDS) at room temperature with 2 changes of solution. Membranes were then washed for 30 minutes with high stringency solution (0.1 x SSC / 0.1 % SDS) at 50°C with 1 change of solution. The membranes were exposed with intensifying screens to X-ray film at -70°C for 10 days. (FIGS. 7A-7D).
- RET16.2 Two alternative splice forms of RET16 (also called RET16.1 herein), i.e., RET16.2 and RET16.3, have been identified.
- RET16.2 was identified from human microvascular endothelial cells treated with TNF- ⁇ using PCR amplification. Briefly, in an effort to clone the full-length coding sequence of RET16, a second band of lesser size was amplified, in addition to the 1500 bp RET16 amplimer. This second amplimer migrated slightly less than 1300 bp. Both fragments were cloned into pTAdv TA cloning vector and were sequenced.
- RET16.2 Exon fragments from RET16 were aligned with the second amplimer sequence, called RET16.2, a splice variant of RET16. Four exons were found to be deleted in RET16.2. These exons are exon 5-8 and correspond to WD repeats #6 and #7.
- the cDNA clone of the RET16.2 splice variant was deposited with the ATCC under Accession No. PTA-3161 on March 7, 2001 under the terms of the Budapest Treaty. Accordingly, the present invention provides the RET16.2 cDNA nucleic acid sequence comprising ATCC Deposit Accession No. PTA-3161.
- the second RET16 splice variant (RET16.3) was identified in Incyte clone identification number 3111127 (Incyte Genomics, Palo Alto, CA). Clone 3111127 was sequenced and found to contain an extra exon fragment (9X). This exon is inserted between exon 9 and exon 10. The amino acid sequence of this exon is extremely hydrophobic. An analysis of the RET16.3 variant's amino acid sequence with SEQ-WEB indicated the presence of a transmembrane domain. This extra exon also disrupts the SAM domain.
- the cDNA clone of the RET16.3 splice variant was deposited with the ATCC under Accession No. PTA-3161 on March 7, 2001 under the terms of the Budapest Treaty. Also in accordance with the present invention is the RET16.3 cDNA nucleic acid sequence comprising ATCC Deposit
- RET16 As described for human RET16 (RET21.1), a clone containing the predicted coding sequence of Ret16 was isolated from human microvascular endothelial cells (HMVECs) treated with tumor necrosis factor alpha (TNF ) for 6 hours using reverse transcription/polymerase chain reaction (RT/PCR).
- HMVECs human microvascular endothelial cells
- TNF tumor necrosis factor alpha
- a triple primer set (each at 400 nM final concentration) was used to amplify a 1532 bp sequence using the following conditions: JNF 346 (5'-TCACCTGCGCGGCACGTGACCC-3'), (SEQ ID NO:17); JNF 493 (5'-TTTACTTTTGGTGTGTCTCCAGCC-3'), (SEQ ID NO:18); JNF 494 (5'-TTACTTTTGGTGTGTCTCCAGCCATCTATTGATGGC-3'), (SEQ ID NO:19), 200 ⁇ M dNTP's, 1X Advantage 2 Polymerase PCR Buffer, 1X Advantage 2 Polymerase, and 2.0 ⁇ l DNA in 25.0 ⁇ l reaction.
- the experiment was cycled 35 times through 94°C for 30 seconds, 68°C for 30 seconds, and 72°C for 2 minutes.
- 6.0 ⁇ l of loading dye was added and the entire reaction was separated by gel electrophoresis in a 1.2% agarose gel containing ethidium bromide.
- a 1.3kb RET16.2 transcript was excised from the gel and purified using the QIAgen gel extraction kit (QIAgen, Valencia, CA). This fragment was ligated into the pTAdv cloning vector (Clontech, Palo Alto, CA) and sequenced using standard methods.
- RET16.2 (Ret16pTAdv_Endo_03), SEQ ID NO: 12, was found to contain a 1272 bp sequence corresponding to the predicted Ret16 coding sequence, however, analysis of the exon-intron structure revealed a deletion of exons 5-8.
- the deduced amino acid sequence of RET16.2 is presented in SEQ ID NO:13.
- tissue cDNA panels were purchased from Clontech Laboratories (Palo Alto, CA) and used in the polymerase chain reaction. Briefly, 1.0 microliter of cDNA from each tissue was added to a 24 microliter reaction mixture containing the following reagents: 0.4 uM of each primer, 200 uM dNTP, 1X Advantage Polymerase Buffer (Clontech), and 1X Advantage Polymerase (Clontech). Primer sequences were JNF 232 (5'- GGCAGATGCTAGTCTCAGGG -3'), (SEQ ID NO:20) and JNF 233 (5'- GGGATTTAACCTTGGTCCTG -3'), (SEQ ID NO:21).
- HMVEC cells were plated at 3.5 x 10 5 cells per well in 6-well plates. Cells were incubated in tissue culture flasks at 37°C, in 5% C0 2 . This seeding resulted in wells that were 85-95% confluent on the day of transfection. All centrifugations were performed in 15-ml polystyrene tubes (VWR, cat# 21008-212) or 50-ml polystyrene tubes (Costar-Corning, cat# 25339-50). A 10x stock of oligofectin G (Sequitur, Inc., Natick, MA) was first prepared by dilution in OptiMEM I to 25 ug/ml. Next, 12.5 ml of Oligofectin G per ml of OptiMEM I was added. The diluted stock of lipid was allowed to stand at room temperature for 15 minutes.
- a 10x stock (1 uM) of each oligomer (Sequitur, Inc.) in OptiMEM I was prepared by adding 10 ⁇ l of oligomer per ml of OptiMEM I. Equal volumes of oligomer and lipid 10x solutions were combined, resulting in a 5x mixture. The oligomer and lipid were allowed to complex by incubating at room temperature for 15 minutes. The oligomer/lipid complexes were then diluted to 1x by adding 4 volumes of HMVEC full growth medium (EGM bullet kit media from Clonetics, San Diego, CA), containing 5% FBS. The culture medium was then aspirated from the cells (low passage number HMVEC, Clonetics) and replaced with the appropriate oligomer/lipid complexes (for a 6-well plate, 1.5-2 ml of transfection medium was used per well).
- HMVEC full growth medium EMM bullet kit media from Clonetics, San Diego, CA
- the cells were incubated for 15-18 hours in transfection medium. The cells were then stimulated with 10 ng/ml of TNF-alpha (R&D systems, Minneapolis, MN) for 6 hours by adding the TNF directly to the growth medium. The uptake of oligomers was evaluated by the uptake of a fluorescent oligomer by microscopy. The cell viability was evaluated by performing dead stain analysis (Sequitur, Inc.). The cells were then harvested for RNA isolation and TaqMan analysis.
- TNF-alpha R&D systems, Minneapolis, MN
- antisense oligonucleotides oligomers or "oligos”
- Preferred antisense oligonucleotides are deoxyribonucleotide- or chimeric deoxyribonucleotide/ribonucleotide-based and are provided below.
- the oligonucleotides were synthesized using chemistry essentially as described in U.S. Patent No. 5,849,902, which is hereby incorporated herein by reference in its entirety.
- the antisense oligos were as follows:
- 11587 5'-UGCACAUGCCGCCAAGGAGCCAUCU-3' (SEQ ID NO:16) and 11590: 5'-GCACUUUACUACGCAGUCCUAGAGA-3'. (SEQ ID NO:22).
- the 11587 and 11590 antisense oligonucleotides hybridize not only to RET16 polynucleotide (SEQ ID NO:1), but also to the two RET16 splice variant polynucleotides, namely, RET16.2 (SEQ ID NO:12) and RET16.3 (SEQ ID NO:14).
- HMVEC cells were transfected with 100 nM (final concentration) of antisense oligomer (11587) or control oligomer (11591 : AGAGAUCCUGACGCAUCAUUUCACG), (SEQ ID NO:23) complexed with 2.5 ⁇ g/ml of oligofectin G.
- the transfection medium was aspirated from the cells and was replaced with full growth medium, as defined in Example 4.
- Eighteen hours after the start of transfection cells were stimulated with TNF-alpha (10 ng/ml) for six hours. After stimulation, the cells were lysed in guanidinium buffer and total RNA was isolated from the lysates.
- TNF-alpha stimulated HMVEC cells ELISA detection of E-selectin expression
- Cells transfected with antisense oligos were maintained by the above-described growth conditions (see Example 3) in 24-well plates.
- the cells were treated with TNF-alpha at 10 ng/ml for 6 hours without a change of medium.
- TMB peroxidase color reagent (Sigma T8540) was then added, and at the completion of color development, the reaction was terminated with 100 ⁇ l of 1 N H 2 S0 4 .
- the OD 450 was read on a multiwell plate reader.
- Antisense molecules or nucleic acid sequence complementary to the RET16 protein-encoding sequence, or any part thereof, is used to decrease or to inhibit the expression of naturally occurring RET16.
- antisense or complementary oligonucleotides comprising about 15 to 35 base-pairs is described, essentially the same procedure is used with smaller or larger nucleic acid sequence fragments.
- the complementary oligonucleotide is typically designed from the most unique 5' sequence and is used either to inhibit transcription by preventing promoter binding to the coding sequence, or to inhibit translation by preventing the ribosome from binding to the RET16 protein-encoding transcript.
- an effective antisense oligonucleotide includes any of about 15-35 nucleotides spanning the region which translates into the signal or 5' coding sequence of the polypeptide as shown in FIG. 2 or FIG. 4.
- Appropriate oligonucleotides are designed using OLIGO 4.06 software and the RET16 protein coding sequence (SEQ ID NOS:1 , 3, and 5).
- the murine RET16 nucleic acid sequence SEQ ID NO:6
- the rat RET16 nucleic acid sequence SEQ ID NO:8
- Northern analysis is used to detect the presence of a transcript of a gene and involves the hybridization of a labeled nucleotide sequence to a membrane on which RNA from a particular cell or tissue type has been bound (See, J. Sambrook et al., supra).
- Analogous computer techniques using BLAST S.F. Altschul, 1993, J. Mol. Evol., 36:290-300 and S.F. Altschul et al., 1990, J. Mol. Evol., 215:403-410) are used to search for identical or related molecules in nucleotide databases, such as GenBank or the LIFESEQ database (Incyte Pharmaceuticals). This analysis is much more rapid and less labor-intensive than performing multiple, membrane- based hybridizations.
- the sensitivity of the computer search can be modified to determine whether any particular match is categorized as being exact (identical) or homologous.
- the basis of the search is the product score, which is defined as follows: (% sequence identity x maximum BLAST score) / 100.
- the product score takes into account both the degree of similarity between two sequences and the length of the sequence match. For example, with a product score of 40, the match will be exact within a 1-2% error; at 70, the match will be exact. Homologous molecules are usually identified by selecting those which show product scores between 15 and 40, although lower scores can identify related molecules.
- the results of Northern analysis are reported as a list of libraries in which the transcript encoding RET16 occurs. Abundance and percent abundance are also reported. Abundance directly reflects the number of times that a particular transcript is represented in a cDNA library, and percent abundance is abundance divided by the total number of sequences that are examined in the cDNA library.
- oligonucleotides for a microarray For the production of oligonucleotides for a microarray, SEQ ID NO:1 or SEQ ID NO:2, for example, is examined using a computer algorithm which starts at the 3' end of the nucleotide sequence.
- the algorithm identifies oligomers of defined length that are unique to the gene, have a GC content within a range that is suitable for hybridization and lack predicted secondary structure that would interfere with hybridization.
- the algorithm identifies specific oligonucleotides of 20 nucleotides in length, i.e., 20-mers. A matched set of oligonucleotides is created in which one nucleotide in the center of each sequence is altered.
- a chemical coupling procedure and an ink jet device is used to synthesize oligomers on the surface of a substrate.
- a "gridded" array that is analogous to a dot (or slot) blot is used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using, for example, a vacuum system, or thermal, UV, mechanical, or chemical bonding techniques.
- a typical array can be produced by hand, or by using available materials and equipment, and can contain grids of 8 dots, 24 dots, 96 dots, 384 dots, 1536 dots, or 6144 dots.
- the microarray is washed to remove any non-hybridized probe, and a detection device is used to determine the levels and patterns of radioactivity or fluorescence.
- the detection device can be as simple as X-ray film, or as complicated as a light scanning apparatus. Scanned fluorescent images are examined to determine degree of complementarity and the relative abundance / expression level of each oligonucleotide sequence in the microarray.
- Naturally occurring or recombinant RET16 polypeptide is substantially purified by immunoaffinity chromatography using antibodies specific for the RET16 polypeptide, or a peptide derived therefrom.
- An immunoaffinity column is constructed by covalently coupling anti-RET16 polypeptide antibody to an activated chromatographic resin, such as CNBr-activated SEPHAROSE (Amersham Pharmacia Biotech). After the coupling, the resin is blocked and washed according to the manufacturer's instructions.
- RET16 polypeptide is passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of the RET16 polypeptide (e.g., high ionic strength buffers in the presence of detergent).
- the column is eluted under conditions that disrupt antibody/RET16 polypeptide binding (e.g., a buffer of pH 2-3, or a high concentration of a chaotrope, such as urea or thiocyanate ion), and RET16 polypeptide is collected.
- RET16 polypeptide or biologically active fragments thereof, are labeled with 125 l Bolton-Hunter reagent (Bolton et al., 1973, Biochem. J., 133:529).
- Candidate molecules previously arrayed in wells of a multi-welled plate are incubated with the labeled RET16 polypeptide, washed, and any wells having labeled RET16 polypeptide-candidate molecule complexes are assayed. Data obtained using different concentrations of the RET16 polypeptide are used to calculate values for the number, affinity and association of the RET16 polypeptide with the candidate molecules.
- Another method suitable for identifying proteins, peptides or other molecules that interact with the RET16 polypeptide include ligand binding assays such as the yeast-two hybrid system as described hereinabove.
- the present invention encompasses the creation of N- and C-terminal deletion mutants, in addition to any combination of N- and C-terminal deletions thereof, corresponding to the RET16.1 , RET16.2, or RET16.3 polypeptides of the present invention.
- a number of methods are available to one skilled in the art for creating such mutants. Such methods can include a combination of PCR amplification and gene cloning methodology.
- primers of about 15-25 nucleotides derived from the desired 5' and 3' positions of SEQ ID NO:1 , SEQ ID NO:12, or SEQ ID NO:14 can be designed to PCR amplify, and subsequently clone, the intended N- and/or C-terminal deletion mutant.
- Such primers can comprise, for example, an initiation and stop codon for the 5' and 3' primer, respectively.
- Such primers can also comprise restriction sites to facilitate cloning of the deletion mutant post amplification.
- the primers can comprise additional sequences, such as, for example, flag-tag sequences, kozac sequences, or other sequences as discussed and/or referenced herein.
- Representative PCR amplification conditions are provided below, although the skilled artisan will appreciate that other conditions can be required and can be employed for efficient amplification.
- a 100 ⁇ l PCR reaction mixture can be prepared using 10 ng of the template DNA (i.e., cDNA clone of RET16.1 , RET16.2, or RET16.3), 200 ⁇ M 4dNTPs, 1 ⁇ M primers, 0.25U Taq DNA polymerase (PE), and standard Taq DNA polymerase buffer.
- Typical PCR cycling condition are as follows:
- 5U Klenow Fragment can be added and incubated for 15 minutes at 30°C
- the fragment Upon digestion of the fragment with the Notl and Sail restriction enzymes, the fragment can be cloned into an appropriate expression and/or cloning vector which has been similarly digested (e.g., pSportl , among others).
- an appropriate expression and/or cloning vector which has been similarly digested (e.g., pSportl , among others).
- the skilled artisan will appreciate that other plasmids can be equally substituted, and also can be desirable in certain circumstances.
- the digested fragment and vector are ligated using a DNA ligase, and then used to transform competent E. coli cells using methods described herein and/or otherwise known in the art.
- the 5' primer sequence for amplifying any additional N-terminal deletion mutants can be determined by reference to the following formula:
- 'S' is equal to the nucleotide position of the initiating start codon of the RET16.1 , RET16.2, or RET16.3 gene (i.e., SEQ ID NO:1 , SEQ ID NO:12, or SEQ ID NO:14), and 'X' is equal to the most N-terminal amino acid of the intended N-terminal deletion mutant.
- the first term provides the start 5' nucleotide position of the 5' primer, while the second term provides the end 3' nucleotide position of the 5' primer corresponding to sense strand of SEQ ID NO:1 , SEQ ID NO:12, or SEQ ID NO:14.
- the final nucleotide sequence can be created by the addition of applicable restriction site sequences to the 5' end of the sequence, for example. As described herein, the addition of other sequences to the 5' primer may be desired and/or used in certain circumstances (e.g., kozac sequences, and the like).
- the 3' primer sequence for amplifying any additional N-terminal deletion mutants can be determined by reference to the following formula:
- 'S' is equal to the nucleotide position of the initiating start codon of the RET16.1 , RET16.2, or RET16.3 gene (SEQ ID NO:1 , 12, or 14), and 'X' is equal to the most C-terminal amino acid of the intended N-terminal deletion mutant.
- the first term provides the start 5' nucleotide position of the 3' primer, while the second term provides the end 3' nucleotide position of the 3' primer corresponding to the anti-sense strand of SEQ ID NO:1 , SEQ ID NO:12, or SEQ ID NO:14.
- the final nucleotide sequence can be created by the addition of applicable restriction site sequences to the 5' end of the sequence, for example. As described herein, the addition of other sequences to the 3' primer may be desired in certain circumstances (e.g., stop codon sequences, etc.). The skilled artisan will appreciate that modifications of the above nucleotide positions can be used for optimizing PCR amplification.
- preferred polypeptides of the present invention comprise polypeptide sequences corresponding to, for example, internal regions of the RET16.1 , RET16.2, or RET16.3 polypeptides (e.g., any combination of both N- and C- terminal RET16.1 , RET16.2, or RET16.3 polypeptides deletions) of SEQ ID NO:2, SEQ ID NO:13, or SEQ ID NO:15.
- internal regions could be defined by the equation: amino acid NX to amino acid CX, wherein NX refers to any N-terminal deletion polypeptide amino acid of RET16.1 , RET16.2, or RET16.3 (SEQ ID NO: 2, SEQ ID NO:13, or SEQ ID N0.15), and where CX refers to any C-terminal deletion polypeptide amino acid of RET16.1 , RET16.2, or RET16.3 (SEQ ID NO: 2, SEQ ID NO:13, or SEQ ID NO:15).
- Polynucleotides encoding these polypeptides are also provided.
- the present invention also encompasses the use of these polypeptides as an immunogenic and/or antigenic epitopes as described elsewhere herein.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Rheumatology (AREA)
- Physical Education & Sports Medicine (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Dermatology (AREA)
- Urology & Nephrology (AREA)
- Heart & Thoracic Surgery (AREA)
- Transplantation (AREA)
- Pain & Pain Management (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Vascular Medicine (AREA)
- Cardiology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (11)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IL15699002A IL156990A0 (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene ret16 |
JP2002566207A JP2004532619A (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene RET16 involved in intracellular signaling cascade |
CA002438369A CA2438369A1 (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene, ret16, involved in the intracellular signaling cascade |
MXPA03007275A MXPA03007275A (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene, ret16, involved in the intracellular signaling cascade. |
EP02719045A EP1575984A4 (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene, ret16, involved in the intracellular signaling cascade |
AU2002250151A AU2002250151B2 (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene, RET16, involved in the intracellular signaling cascade |
IL156990A IL156990A (en) | 2001-02-16 | 2003-07-17 | Identification and cloning of a novel human gene ret16 |
IL184513A IL184513A (en) | 2001-02-16 | 2007-07-10 | Purified cell signaling proteins and pharmaceutical compositions containing the same |
AU2007203415A AU2007203415B2 (en) | 2001-02-16 | 2007-07-23 | Identification and cloning of a novel human gene, RET16, involved in the intracellular signaling cascade |
IL190471A IL190471A (en) | 2001-02-16 | 2008-03-27 | Method of screening for compounds which inhibit binding of a human cell signaling protein with a second cell signaling protein |
IL190470A IL190470A0 (en) | 2001-02-16 | 2008-03-27 | A method of identifying compounds that inhibit the phosphorylation of a cell signaling cascade protein |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US26936601P | 2001-02-16 | 2001-02-16 | |
US60/269,366 | 2001-02-16 | ||
US29418101P | 2001-05-29 | 2001-05-29 | |
US60/294,181 | 2001-05-29 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2002066494A2 true WO2002066494A2 (en) | 2002-08-29 |
WO2002066494A8 WO2002066494A8 (en) | 2003-10-23 |
WO2002066494A3 WO2002066494A3 (en) | 2005-12-08 |
Family
ID=26953655
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2002/005162 WO2002066494A2 (en) | 2001-02-16 | 2002-02-15 | Identification and cloning of a novel human gene, ret16, involved in the intracellular signaling cascade |
Country Status (8)
Country | Link |
---|---|
US (2) | US7198911B2 (en) |
EP (1) | EP1575984A4 (en) |
JP (1) | JP2004532619A (en) |
AU (1) | AU2002250151B2 (en) |
CA (1) | CA2438369A1 (en) |
IL (5) | IL156990A0 (en) |
MX (1) | MXPA03007275A (en) |
WO (1) | WO2002066494A2 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10531655B2 (en) | 2011-12-02 | 2020-01-14 | The Regents Of The University Of California | Reperfusion protection solution and uses thereof |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6114517A (en) * | 1998-12-10 | 2000-09-05 | Isis Pharmaceuticals Inc. | Methods of modulating tumor necrosis factor α-induced expression of cell adhesion molecules |
AU6223700A (en) | 1999-07-19 | 2001-02-05 | Incyte Genomics, Inc. | Gtp-binding associated proteins |
CN1300734A (en) | 1999-12-21 | 2001-06-27 | 复旦大学 | Polypeptide-beta-transducin 41 and polynucleotide for coding this polypeptide |
WO2001053312A1 (en) | 1999-12-23 | 2001-07-26 | Hyseq, Inc. | Novel nucleic acids and polypeptides |
US6569662B1 (en) * | 2000-01-21 | 2003-05-27 | Hyseq, Inc. | Nucleic acids and polypeptides |
EP1319005A2 (en) * | 2000-09-20 | 2003-06-18 | PHARMACIA & UPJOHN COMPANY | Substituted azepino[4,5-b]indoline derivatives |
WO2003014118A1 (en) * | 2001-08-08 | 2003-02-20 | Pharmacia & Upjohn Company | THERAPEUTIC 1H-PYRIDO[4,3-b]INDOLES |
EP1581221B1 (en) * | 2002-12-19 | 2011-05-18 | Bristol-Myers Squibb Company | Substituted tricyclic gamma-carbolines as serotonin receptor agonists and antagonists |
-
2002
- 2002-02-15 JP JP2002566207A patent/JP2004532619A/en active Pending
- 2002-02-15 WO PCT/US2002/005162 patent/WO2002066494A2/en active Application Filing
- 2002-02-15 US US10/077,111 patent/US7198911B2/en not_active Expired - Fee Related
- 2002-02-15 CA CA002438369A patent/CA2438369A1/en not_active Abandoned
- 2002-02-15 EP EP02719045A patent/EP1575984A4/en not_active Withdrawn
- 2002-02-15 AU AU2002250151A patent/AU2002250151B2/en not_active Ceased
- 2002-02-15 MX MXPA03007275A patent/MXPA03007275A/en active IP Right Grant
- 2002-02-15 IL IL15699002A patent/IL156990A0/en unknown
-
2003
- 2003-07-17 IL IL156990A patent/IL156990A/en not_active IP Right Cessation
-
2007
- 2007-02-13 US US11/705,672 patent/US7678887B2/en not_active Expired - Fee Related
- 2007-07-10 IL IL184513A patent/IL184513A/en not_active IP Right Cessation
-
2008
- 2008-03-27 IL IL190470A patent/IL190470A0/en not_active IP Right Cessation
- 2008-03-27 IL IL190471A patent/IL190471A/en not_active IP Right Cessation
Non-Patent Citations (2)
Title |
---|
DATABASE GENESEQ [Online] 26 July 2001 TANG Y.T. ET AL: 'Novel Nucleic Acids and Polypeptides, Useful for Treating Disorders Such as Central Nervous System Injuries.', XP002991577 Database accession no. (AAI58876) * |
See also references of EP1575984A2 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10531655B2 (en) | 2011-12-02 | 2020-01-14 | The Regents Of The University Of California | Reperfusion protection solution and uses thereof |
Also Published As
Publication number | Publication date |
---|---|
US7198911B2 (en) | 2007-04-03 |
IL190470A0 (en) | 2008-11-03 |
EP1575984A4 (en) | 2006-09-06 |
IL190471A0 (en) | 2008-11-03 |
IL190471A (en) | 2010-12-30 |
AU2002250151B2 (en) | 2007-08-16 |
US7678887B2 (en) | 2010-03-16 |
WO2002066494A3 (en) | 2005-12-08 |
US20070142294A1 (en) | 2007-06-21 |
US20020187492A1 (en) | 2002-12-12 |
MXPA03007275A (en) | 2003-12-04 |
IL156990A0 (en) | 2004-02-08 |
EP1575984A2 (en) | 2005-09-21 |
IL184513A0 (en) | 2007-10-31 |
CA2438369A1 (en) | 2002-08-29 |
IL156990A (en) | 2008-12-29 |
IL184513A (en) | 2010-04-15 |
WO2002066494A8 (en) | 2003-10-23 |
JP2004532619A (en) | 2004-10-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5849528A (en) | Polynucleotides encoding a human S100 protein | |
US6313266B1 (en) | Human nucleolin-like protein | |
US5858719A (en) | Polynucleotides encoding human ATP binding-cassette transport protein and methods of use | |
US7517957B2 (en) | Human SLAP-2: a novel SH2/ SH3 domain-containing human SLAP homologue having immune cell-specific expression | |
EP1009828A1 (en) | New human g-protein coupled receptor | |
US7678887B2 (en) | Identification and cloning of a novel human gene, RET16, involved in the intracellular signaling cascade | |
CA2298766A1 (en) | Human longevity-assurance protein homologs | |
AU2007203415B2 (en) | Identification and cloning of a novel human gene, RET16, involved in the intracellular signaling cascade | |
US5871971A (en) | Human developmentally regulated GTP-binding protein | |
AU2002250151A1 (en) | Identification and cloning of a novel human gene, RET16, involved in the intracellular signaling cascade | |
US20020081604A1 (en) | Human reticulocalbin isoforms | |
US7141381B2 (en) | Human leucine-rich repeat-containing proteins specifically expressed in the nervous system | |
US5804419A (en) | Calcium-binding phosphoprotein | |
WO1999019487A1 (en) | Mammoglobin homolog | |
US5919659A (en) | Human phosphatidylinositol transfer protein gamma | |
US20020099011A1 (en) | Human membrane recycling proteins | |
US7101686B1 (en) | Polynucleotides encoding human SLAP-2:a novel SH2/SH3 domain-containing human SLAP homologue having immune cell-specific expression | |
AU2001283440A1 (en) | Novel imidazoline receptor homologs | |
US7667003B2 (en) | Antibody directed to human mist (mast cell immunoreceptor signal transducer) | |
US20030049786A1 (en) | Transducin beta-1 subunit |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 156990 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2003/007275 Country of ref document: MX Ref document number: 2438369 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2002250151 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2002566207 Country of ref document: JP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2002719045 Country of ref document: EP |
|
CFP | Corrected version of a pamphlet front page | ||
CR1 | Correction of entry in section i |
Free format text: IN PCT GAZETTE 35/2002 DUE TO A TECHNICAL PROBLEM AT THE TIME OF INTERNATIONAL PUBLICATION, SOME INFORMATION WAS MISSING (81). THE MISSING INFORMATION NOW APPEARS IN THE CORRECTED VERSION. |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 2002719045 Country of ref document: EP |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 184513 Country of ref document: IL |
|
WWE | Wipo information: entry into national phase |
Ref document number: 190470 Country of ref document: IL Ref document number: 190471 Country of ref document: IL |