WO2001097847A1 - Icp27-binding polynucleotides - Google Patents

Icp27-binding polynucleotides Download PDF

Info

Publication number
WO2001097847A1
WO2001097847A1 PCT/US2001/019278 US0119278W WO0197847A1 WO 2001097847 A1 WO2001097847 A1 WO 2001097847A1 US 0119278 W US0119278 W US 0119278W WO 0197847 A1 WO0197847 A1 WO 0197847A1
Authority
WO
WIPO (PCT)
Prior art keywords
icp27
rna
seq id
binding
polynucleotide
Prior art date
Application number
PCT/US2001/019278
Other languages
French (fr)
Inventor
Richard R. Gontarek
Kathleen M. Herold
Courtney A. Gilles
Original Assignee
Smithkline Beecham Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US21244400P priority Critical
Priority to US60/212,444 priority
Application filed by Smithkline Beecham Corporation filed Critical Smithkline Beecham Corporation
Publication of WO2001097847A1 publication Critical patent/WO2001097847A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material

Abstract

A GST-ICP27 fusion protein has been cloned and expressed and shown to interact specifically with ICP27 mRNA in vitro. RNase T1-protection studies have identified several small RNA fragments which appear to be specifically protected by the protein. The sequence of the fragments has been determined.

Description

ICP27-BINDING POLYNUCLEOTIDES

Background of the Invention The Herpes simplex virus type 1 regulatory protein ICP27 is a multifunctional

63 kDa immediate-early phosphoprotein which is essential for viral replication (Sacks, W.R., Greene, C.C., Ashman, D.P., and Schaffer, P.A. (1985) /. Virol. 55, 796-805; Rice, S. A., Su L., and Knipe D.M., (1989) J. Virol. 63, 3399-3407; Rice, S. A. and Knipe D.M., (1990) I. Virol. 64, 1704-1715; McMahan L., and Schaffer P.A. (1990) J. Virol. 64, 3471-3485). ICP27 has been shown to shuttle between the nucleus and cytoplasm of infected cells, acting predominantly at the post-transcriptional level by influencing RNA processing and export (Sandri-Goldin R.M. (1998) Genes Dev. 12, 868-879; Sandri-Goldin R.M., and Mendoza, G.E. (1992) Genes Dev. 6, 848-863; McLauchlan J., Phelan A., Loney, C, Sandri-Golden R.M., (1992) J. Virol. 66, 6939- 6945; Mears W.E., and Rice S.A. (1998) Virology 242, 128-137), and it contributes to the shutoff of host cell gene expression by inhibiting host-cell splicing (Sandri-Goldin R.M., and Mendoza, G.E. (1992) Genes Dev. 6, 848-863; Hardy W.R. and Sandri- Goldin R.M. (1994) J. Virol. 68, 7790-7799). It has also been shown to contribute to the efficient expression of HSV-1 early and late gene products by affecting 3 -RNA processing (McGregor, F., Phelan A. , Dunlop J., and Clements J. B., (1996) /. Virol. 70, 1931-1940; McLauchlan J., Phelan A., Loney, C, Sandri-Golden R.M., (1992) /. Virol. 66, 6939-6945) and viral RNA export (Phelan A., Dunlop J., and Clements JB (1996) J. Virol. 70,5255-5265; Sandri-Goldin R.M. (1998) Genes Dev. 12, 868-879).

The amino acid sequence of ICP27 contains a leucine-rich nuclear export signal (NES) (Sandri-Goldin R.M. (1998) Genes Dev. 12, 868-879), a nuclear localization signal (NLS) (Mears W.E., Lam V., and Rice, S.A. (1995) J.Virol. 69, 935-947), an arginine-rich region resembling an RGG-box motif found in some RNA-binding proteins (Mears W.E., and Rice S.A. (1996) J.Virol. 70, 7445-7453), as well as a CCHC zinc-finger-like domain at the C-terminus (Vaughan P.J., Thibault K.I., Hardwicke M.A., and Sandri-Goldin RM (1992) Virology 189, 377-384). ICP27 has also been shown to interact with RNA in vitro by virtue of an RGG box (Mears W.E., and Rice S.A. (1996) J.Virol. 70, 7445-7453) and in vivo it binds to at least seven RNAs including its own intronless transcript (Sandri-Goldin R.M. (1998) Genes Dev. 12, 868-879). In the absence of ICP27 expression, export of intronless RNAs is dramatically decreased (Sandri-Goldin R.M. (1998) Genes Dev. 12, 868-879), indicating that it is an important viral export factor that promotes the transport of HS V- 1 intronless RNAs. In addition, Soliman and Silverstein ((2000) J. Virol. 74, 2814- 2825) recently showed that mutations in putative RNA-binding KH domains within ICP27 resulted in lethal phenotypes. This compelling evidence further supports the notion that the interaction between ICP27 and viral RNAs is absolutely required for viral replication.

Although ICP27 has been shown to bind to RNA, an interaction with specific viral RNAs has not yet been convincingly demonstrated in vitro. In addition, the RNA sequence element(s) required for binding by ICP27 have not been defined.

Summary of the Invention The instant invention concerns an isolated polynucleotide that binds to ICP27. More particularly, a polynucleotide that is an RNA that bind to ICP27 comprises the nucleotide sequence set forth in SEQ ID NO:6 and SEQ ID NO:7 or a variant thereof. In another embodiment, the instant invention pertains to a polynucleotide that is a DNA sequence encoding an RNA that binds to ICP27 wherein the DNA sequence comprises the the nucleotide sequence set forth in SEQ ID NO:8 and SEQ ID NO:9 or a variant thereof. Preferred is an RNA polynucleotide that comprises the nucleotide sequence set forth in SEQ ID NO: 10 and a DNA polynucleotide that comprises the nucleotide sequence set forth in SEQ ID NO: 11.

In another embodiment, the instant invention pertains to a method for identifying a compound that alters the binding of ICP27 to an RNA comprising: a) preparing a compound to be tested; b) admixing the compound to be tested with ICP27 and an RNA that binds to ICP27; and c) measuring the binding of ICP27 to the RNA wherein an alteration in the binding of ICP27 to the RNA in the presence of the compound to be tested compared to the binding of ICP27 to the RNA in the absence of the compound to be tested is indicative of the ability of the compound to be tested to alter the binding of ICP27 to the RNA. Another useful embodiment of the instant invention is a method for altering the binding of ICP27 to an RNA in an animal comprising: a) preparing a compound that alters the binding of ICP27 to an RNA; and b) administering the compound of (a) to an animal.

In yet another embodiment, the instant invention pertains to a method for treating or preventing a disease in a mammal caused by a virus comprising administering an effective dose of a compound that alters the binding of ICP27 to an RNA.

Brief Description of the Drawings Figure 1 A demostrates that via UN cross-linking experiments, ICP27 from HSN-1 infected cell lysates interacts specifically with ICP27 mRΝA. Radiolabeled ICP27 mRΝA was incubated with cytoplasmic lysates prepared from uninfected (lane 1) or HSN-infected (lanes 2-11) Nero cells in the absence or presence of the indicated competitor RΝAs. Competitions were performed with 100-, 250-, and 500-fold molar excess of unlabeled HSV-1 ICP27 mRΝA, S. cerevisiae 18S rRΝA, or HSV-1 UL15 mRΝA. The positions of the molecular weight markers are indicated to the left. Figure IB depicts the results of UN cross-linking and immunoprecipitation performed using an ICP27-specific monoclonal antibody.

Figure 2 depicts the results of filter-binding analysis, revealing that recombinant, purified ICP27 protein binds to full-length ICP27 mRΝA with an apparent Kd of approximately 20 nM. The maximal binding activity was normalized to 1.0 in this experiment.

Figure 3 depicts the results of UV cross-linking studies performed using unlabeled competitor RΝAs. Lane 1 shows the cross-linking observed between purified

GST-ICP27 and ICP27 mRΝA in the absence of any competitor RΝA. Lanes 2-4 show cross-linking in the presence of a 50-fold excess of the indicated competitor RΝAs. SP RΝA = S. aureus RΝase P RΝA.

Figure 4 represents the results of filter-binding assays, revealing that recombinant HSN-1 ICP27 protein interacts specifically with ICP27 mRΝA. Binding reactions using radiolabled ICP27 mRNA and purified ICP27 protein were incubated in the absence or presence of unlabeled HSV-1 ICP27 mRNA, S. cerevisiae 18S rRNA, or Xenopus EF-1 mRNA. Binding reactions were filtered on nitrocellulose filters and washed with binding buffer prior to scintillation counting. Figure 5 demonstrates that GST-ICP27 specifically protects nucleotides within the 3'-UTR of ICP27 mRNA from RNase Tl digestion.

Figure 6 presents data from filter binding experiments using 27 -Tl RNA to inhibit binding of GST-ICP27 to labeled substrate. FD657, FD 643, bTub and UlhpII RNA represent unrelated non-specific control RNAs.

Detailed Description of the Invention

ICP27 expressed in HSN-infected cells is able to specifically interact with a viral intronless RΝA transcript. Described herein is the cloning and expression in a recombinant baculovirus of a GST-tagged ICP27. Using filter-binding and UN cross- linking studies, a specific interaction between viral RΝA and recombinant ICP27 in vitro is convincingly demonstrated for the first time, and a small RΝA element that interacts specifically with the protein is identified. These studies represent an important first step in elucidating the sequence and structural specificity of RΝA-binding by ICP27, and may help to shed light into the complex regulatory roles that it participates in during infection. In addition, because the interaction between ICP27 and viral RΝAs is absolutely required for viral replication, this specific interaction may represent a target for antiviral drug discovery.

The following definitions are used herein to describe the instant invention and all of its embodiments.

"Isolated" means altered "by the hand of man" from the natural state. If an "isolated" composition or substance occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.

"Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RΝA or DΝA or modified RΝA or DΝA. "Polynucleotides" include, without limitation, single- and double-stranded DΝA, DΝA that is a mixture of single- and double-stranded regions, single- and double-stranded RΝA, and RΝA that is mixture of single- and double-stranded regions, hybrid molecules comprising DΝA and RΝA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term "polynucleotide" also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications may be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.

"Polypeptide" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications may occur anywhere in a polypeptide, including the peptide backbone, the amino acid side- chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present to the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination (see, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993; Wold, F., Post-translational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al. (1990) Meth Enzymol 182, 626-646 and Rattan et al. (1992) Ann NY Acad Sci 663, 48-62). Polynucleotides and polypeptides may be modified by adding detectable moieties such as enzymes, fluorophores, radioisotopes and the like. These modified polynucleotides and polypeptides are useful for detection and quantitation of the presence or absence of the polynucleotide or polypeptide from a sample, or the loss or maintenance of function under certain experimental conditions. Moreover, the availability of such modified polynucleotides and polypeptides could facilitate design, synthesis and/or identification of compounds that bind to, or inhibit or interfere with binding of a molecular moiety to, or otherwise modify the activity of the instant polynucleotides and polypeptides.

"Variant" refers to a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide, or may or may not alter the secondary and/or tertiary structure of the polynucleotide and thus alter the functional properties of that polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by a reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. Likewise, a variant polypeptide may differ from a reference polynucleotide by one or a few nucleotides wherein such differences do not result in significant alteration of function. A variant of a polynucleotide or polypeptide may be a naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.

Recombinant polynucleotides and polypeptides of the present invention may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, in a further aspect, the present invention relates to expression systems which comprise a polynucleotide or polynucleotides of the present invention, to host cells which are genetically engineered with such expression systems and to the production of polynucleotides and polypeptides of the invention by recombinant techniques. Cell-free transcription and translation systems can also be employed to produce such polynucleotides and proteins using RNAs derived from the DNA constructs of the present invention.

For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention. Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al., Basic Methods in Molecular Biology (1986) and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). Preferred such methods include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid- mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection.

Representative examples of appropriate hosts include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells; and plant cells.

A great variety of expression systems can be used, for instance, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculo viruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retro viruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector which is able to maintain, propagate or express a polynucleotide to produce a polynucleotide or polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL (supra). Appropriate secretion signals may be incorporated into the desired polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the polypeptide or they may be heterologous signals. In a further aspect, the present invention provides for a method of screening compounds to identify those which alter the interaction of ICP27 with an RNA to which it normally binds. The compounds may be employed for therapeutic and prophylactic purposes for such diseases as hereinbefore mentioned. For example, since ICP27 is believed to be involved in RNA transport and therefore transiently binds, transports and subsequently releases the transported RNAs, compounds which alter the interaction of ICP27 with its target RNAs, either by reducing or preventing the binding of ICP27 to its target RNAs or reducing or preventing release of bound RNAs from ICP27 may be therapeutically useful. Compounds may be identified from a variety of sources, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. Such compounds so-identified may be natural or modified substrates, ligands, receptors, enzymes, etc., as the case may be, for ICP27 or its target RNAs; or may be structural or functional mimetics thereof (see Coligan et al., Current Protocols in Immunology 1(2): Chapter 5 (1991)).

Examples of potential compounds include antibodies or, in some cases, oligonucleotides, proteins or small molecules which bind ICP27 or its target RNA and alter binding of ICP27 to a target RNA. Either effect may prove therapeutically useful.

It will be readily appreciated by the skilled artisan that characterization of the molecular aspects of ICP27 binding to target RNA may facilitate the structure-based design of useful, therapeutically beneficial compounds by:

(a) determining in the first instance the three-dimensional structure of the regions of ICP27 and its target RNA that are involved in binding;

(b) deducing the three-dimensional structure for the likely or binding site(s) of a candidate compound;

(c) synthesing a candidate compound that is predicted to bind to ICP27 or its target RNA; and (d) testing whether the candidate compound is indeed therapeutically beneficial.

It will be further appreciated that this will normally be an interative process. In a further aspect, the present invention provides methods of treating viral infections and the diseases thereby caused. Accordingly, in a further aspect, the present invention provides for pharmaceutical compositions comprising a therapeutically effective amount of a compound, in combination with a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention. Such compounds may be employed alone or in conjunction with other compounds, such as therapeutic compounds.

The composition will be adapted to the route of administration, for instance by a systemic or an oral route. Preferred forms of systemic administration include injection, typically by intravenous injection. Other injection routes, such as subcutaneous, intramuscular, or intraperitoneal, can be used. Alternative means for systemic administration include transmucosal and transdermal administration using penetrants such as bile salts or fusidic acids or other detergents. In addition, if a polypeptide or other compounds of the present invention can be formulated in an enteric or an encapsulated formulation, oral administration may also be possible. Administration of these compounds may also be topical and/or localized, in the form of salves, pastes, gels, and the like.

The dosage range required depends on the choice of compound, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.1-100 μg/kg of subject. Wide variations in the needed dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization, as is well understood in the art. The instant invention may be embodied in other specific forms, without departing from the spirit or essential attributes thereof, and, accordingly, reference should be made to the appended claims, rather than to the foregoing specification or following examples, as indicating the scope of the invention.

All publications including, but not limited to, patents and patent applications, cited in this specification or to which this patent application claims priority, are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.

Examples The instant invention will now be described with reference to the following specific, non-limiting examples.

Example 1 Preparation of Materials and Experimental Methods Cloning andplasmid constructions For the production of the ICP27 protein, a DNA plasmid construct (pGST- ICP27) encoding a glutathione-S-transferase (GST)-ICP27 fusion protein (GST-ICP27; SEQ ID NO: 1) was made by cloning a PCR fragment containing the coding region of HSV-1 ICP27 from pSG130 (Hardwicke M.A., Vaughan P ., Sekulovich R.E., O'Conner R., and Sandri-Goldin, R.M. (1989) J. Virol 63, 4590-4602) into the baculo virus transfer vector pAcGHLT-A (Pharmingen, San Diego CA).

The plasmid p4Z-ICP27 was prepared for use in in vitro production of ICP27 RNA. p4Z-ICP27 comprises a 2.4kb nucleotide BamHI-Sstl fragment (SEQ ID NO:2; the corresponding mRNA is set forth in SEQ ID NO:3) from pSG130 (Hardwicke M.A., Vaughan P.J., Sekulovich R.E., O'Conner R., and Sandri-Goldin, R.M. (1989) /. Virol 63, 4590-4602), containing the entire open reading frame of the HSV-1 ICP27 protein flanked by several hundred nucleotides of 5 - and 3 -untranslated region DNA, inserted downstream of the T7 promoter in the commercially available plasmid vector pGem4Z (Promega). The plasmid p3Z-27Tl comprises a portion of the 3' untranslated region of the

ICP27 mRNA shown to be protected by the ICP27 protein in RNAse Tl experiments. This plasmid was prepared by inserting into the EcoRI/BamHI sites of the commercially available plasmid vector pGem3Z a nucleotide fragment formed by annealing the following two synthetic oligonucleotides:

5'-AATTCTTCCAAGGCCGGTGTCATAGTGCCCTTAGGAGCTTCCCGCCC GGGCGCATCCCCCCTTTTGCACTATGACAGCGACCCCCCTCACCAACCG-3' (SEQ ID NO:4); and

5 '-GATCCGGTTGGTGAGGGGGGTCGCTGTC ATAGTGC AAA AGGGGGGA

TGCGCCCGGGCGGGAAGCTCCTAAGGGCACTATGACACCGGCCTTGGAAG- 3' (SEQ ID NO:5).

Production of recombinant GST-ICP27 in Sf9 cells Recombinant baculovirus was produced in Sf9 cells by co-transfection (of 5 ug of the ICP27-containing transfer vector (pGST-ICP27) and 0.5 ug linearized BaculoGold® wildtype baculovirus DNA using the protocol provided in the Baculovirus Expression Vector System Instruction Manual by Pharmingen. Viral titers were determined using the Bac-Pac™ Rapid Titer Kit (Clontech, Palo Alto, CA) and fresh Sf9 cells were infected at an M.O.I, of 0.05 for viral amplification. Recombinant virus was plaque purified using a standard plaque assay and then further amplified to produce high titer stocks. For production of recombinant proteins, Sf9 cells in log phase growth were diluted to 1 x 10^ cells/ml and infected with recombinant baculovirus at an M.O.I, of 5. Expression was confirmed by Western Blot using an anti-ICP27 monoclonal (kindly provided by Goodwin Institute for Cancer Research; see Ackermann M., Braun D.K., Pereira L., and Roizman, B. (1984). J. Virol. 52, 108- 118). Cells were harvested at 72-hours post-infection, washed with PBS, resuspended in Insect Cell Lysis Buffer (Pharmingen) with Protease Inhibitor Cocktail (Pharmingen) and allowed to lyse on ice for 1 hour. Cell debris was removed by centrifugation at 25,000 x g for 10 minutes. Protein (GST-ICP27) was purified from the cleared supernatant using glutathione-sepharose as described below.

Purification of recombinant ICP27 from Sf9 lysates:

Ten volumes of cleared insect cell lysate was bound in-batch to 1 volume of glutathione-sepharose beads (Amersham Pharmacia, Upsala, Sweden) pre-equilibrated with lysis buffer at 4°C for 1-3 hours. Beads were washed in-batch with 20 bead volumes of PBS twice followed by a 10 bead volume wash in 1M NaCl and a final wash in PBS. Protein-loaded beads were poured in to a chromatography column, and bound protein was eluted (by gravity flow) in buffer comprising 10 mM reduced glutathione, 50 mM Tris Cl pH 8.0 with 0.1% Triton X-100. Glycerol was added to the protein eluate to a final concentration of 10% (v/v) and the eluate was stored in aliquots at -80°C. Protein was quantitated by densitometry (Eagle Eye™ II system (Stratagene, La Jolla, CA)) of electrophoetically separated proteins on a colloidal blue-stained SDS- PAGE gel, utilizing a standard curve of a marker with similar molecular weight (phosphorylase B, 97.4 kD).

Viruses and cells African green monkey kidney cells (4.7 x 10^ ) were either mock-infected or infected at a multiplicity of infection of 10 plaque forming units per cell with HSV-1 strain Kos 1.1. Eighteen hours post-infection, cells were harvested by scrapping the cells into the media. Cell pellets were prepared by centrifugation oc culture media containing cells at 2000 rpm for 5 minutes at 4°C. Cell pellets were stored frozen at - 20°C.

Preparation of infected cell lysates

Lysates from HSV-1 infected cells were prepared as described in Lee and Green (1990) Methods. Enz. 181, 20-30.

Footprinting and RNA sequencing

Unlabeled RNAs were incubated in the presence or absence of GST-ICP27 in Ix binding buffer (50 mM Tris-Cl pH 7.6, 2 mM MgC12, 100 mM KC1) in the presence of an approximately 70-fold excess of tRNA. After 20 minutes at 3°C, 10 units of RNase Tl (GIBCO BRL) were added, and incubation was continued for another 30 minutes at 37°C. The mixtures were then filtered on .45 micron nitrocellulose filters and washed with 5 mL of cold lx binding buffer. RNA was recovered from the filters by incubating with 500 uL of phenol:chloroform:isoamyl alcohol (25:24:1) and 500 uL of 7M urea for three hours at room temperature. Recovered RNAs were then ethanol- precipitated, phosphatased, and 5'-end-labeled with γ-32P and T4 polynucleotide kinase. Labeled RNAs were then run on a 12% polyacrylamide-7M urea gel. Protected bands were identified and eluted from the wet gel and partial sequence information was obtained using an RNA Sequencing Kit (Pharmacia).

Synthesis of labeled RNA

Radiolabeled RNAs were synthesized by in vitro transcription of linearized plasmid DNAs using T7 RNA polymerase and γ-32P-UTP. For RNA transcription of the full length ICP27 message, p4Z-ICP27 was linearized with Sstl. For RNA transcription of the protected portion of the ICP27 message, p3Z-27Tl was linearized with BamHI. Nonspecific competitor RNAs were synthesized from pKS-18S (18S rRNA; see Gontarek R.R., Li H., Nurse K., and Prescott, CD. (1988) J Biol Chem. 273, 10249-10252) and pXef-1 (Ambion Inc., Austin, TX) using either MEGAScript or MEGAshortscript kit (Ambion Inc., Austin, TX).

UV cross-linking and filter-binding assays

In vitro binding reactions were carried out using 200 ng of purified GST-ICP27 in a reaction volume of 30 uL in a buffer comprising 50 mM Tris-HCl pH 7.6, 2 mM MgCl , 100 mM KC1, and 0.1% Triton X-100. Reaction mixtures containing 5 fmol of radiolabeled RNA (with or without unlabeled competitor RNAs) were incubated at 30°C for 20 minutes, then transferred to Parafilm on ice and exposed to UV light (254 nm) at a distance of 4 cm for 10 min. Following treatment with RNase A (final concentration 1 mg/ml) at 37°C for 15 min, the samples were resolved by SDS-PAGE on 10% gels. For filter-binding experiments, binding reactions were incubated for the indicated times at 30°C, filtered immediately on 0.45 micron nitrocellulose filters (Whatman), washed with 1.0 ml of binding buffer, and counted in a scintillation counter.

Example 2 ICP27 from HSV-1-infected cells interacts specifically with viral mRNA in vitro Lysates were prepared from HSV-1 -infected and uninfected Vero cells and used in UV cross-linking studies in order to determine whether ICP27 protein expressed during HSV-1 infection was capable of interacting specifically with its own mRNA (SEQ ID NO:3) in vitro. ICP27 is detected as a 63-kDa protein in both nuclear and cytoplasmic fractions from prepared infected cell lysates (data not shown). Equal amounts of total cytoplasmic protein were incubated with radiolabeled ICP27 mRNA in the absence or presence of indicated competitor RNAs (Fig. 1 A). Although at least six different proteins cross-link to the RNA, comparing lanes 1 and 2 shows that only one RNA-protein adduct (migrating at approximately 63 kDa and denoted with an asterisk) is detected in the infected cytoplasmic lysate and not in the uninfected sample. Addition of an excess of unlabeled intronless ICP27 RNA (lanes 3-5) significantly competes for binding to the 63-kDa protein while addition of an excess of unlabeled intron- containing viral RNA (UL15, lanes 9-11) or non-specific RNA (18S rRNA, lanes 6-8) does not. Also note that several additional bands (between 42-50 kDa) are also specifically competed by ICP27 mRNA.

Because the size and expected binding specificity of the 63 kDa protein is consistent with it being ICP27, an experiment was performed to verify its identity. After UV cross-linking and RNase Tl -digestion of RNA-protein complexes, the reactions were incubated with a monoclonal antibody specific for ICP27. The antigen- antibody complexes were then bound to protein-A-sepharose and washed extensively. SDS-PAGE sample buffer was then used to elute the RNA-protein complexes, which were then analyzed by SDS-PAGE. The results of this experiment, shown in Fig. IB, confirm that the 63 kDa protein in the infected cell lysate that was seen specifically interacting with ICP27 RNA is, in fact, ICP27 protein. This is the first demonstration of a specific interaction between HSV-1 ICP27 and viral RNA in vitro. Further, that the HSV-1 UL15 intron-containing mRNA is unable to compete for ICP27 binding suggests that this protein may only bind specifically to intronless viral RNAs, consistent with previous observations in vivo (Sandri-Goldin R.M. (1998) Genes Dev. 12, 868-879).

Example 3 Interaction of GST-ICP27 with viral RNA

Using a baculovirus expression vector system, ICP27 was expressed as a fusion protein with glutathione-S-transferase (GST). Insect cells were infected with the recombinant baculovirus and cell pellets were lysed in the presence of 0.1% Triton X- 100. Purification of the lysates using GST-sepharose resulted in a highly pure, full- length fusion protein of approximately 94kDa. MALDI-TOF analysis confirmed the identity of the 94 kDa protein as GST-ICP27, and the fusion protein reacts with an anti- ICP27 antibody and anti-GST antibodies (data not shown) in Western blot analysis.

In order to examine the binding affinity of GST-ICP27 for RNA, filter binding experiments using labeled ICP27 mRNA and increasing amounts of GST-ICP27 were performed. A representative experiment, shown in Fig. 2, shows the Kd to be approximately 20 nM with 95% of the input RNA being bound by protein. Binding studies using a variety of other unrelated RNAs showed the Kjs to be as much as tenfold less (data not shown), indicating a probable specific interaction between the GST- ICP27 and the ICP27 mRNA.

To characterize the specificity of the interaction between GST-ICP27 and the ICP27 mRNA, UV crosslinking experiments were performed. When labeled ICP27 mRNA was incubated with purified GST-ICP27 and exposed to UV light, a single strong band of approximately 95 kDa was detected (Fig. 3), consistent with the size of the GST-ICP27. No band was seen when labeled ICP27 mRNA was incubated with different amounts of purified GST protein alone (data not shown), indicating that the determinants for binding do not reside within the GST-tag. Next, unlabeled ICP27 mRNA or two different non-specific RNAs were used as competitors in UV crosslinking experiments. Comparing the cross-linking signals in lanes 2-4 to lane 1 of Fig. 3, it is apparent that only the unlabeled ICP27 mRNA is able to efficiently compete at a 50-fold excess, while two unrelated RNAs (HCV 3NTR and S. aureus RNase P RNA) do not.

To confirm these observations, an RNA filter-binding assay was performed. Consistent with the cross-linking results, this analysis also shows that an excess of unlabeled ICP27 mRNA is able to efficiently compete for ICP27 binding to the labeled ICP27 mRNA while two nonspecific RNAs (18S rRNA and Xef-1 RNA) do not (see Fig. 4). Both of these independent RNA-binding assays strongly suggest that GST- ICP27 specifically recognizes ICP27 mRNA over other unrelated RNAs, and provides the first demonstration of a specific RNA substrate for ICP27 in vitro.

To map the binding determinants within the full-length ICP27 mRNA required for specific binding by GST-ICP27, we employed RNase Tl-protection experiments. Briefly, unlabeled ICP27 mRNA was incubated with GST-ICP27 protein in the presence of competitor yeast tRNA for 20 minutes, after which RNase Tl was added and allowed to partially degrade any nucleotide sequences not protected by the protein. The mixture was then filtered on a nitrocellulose filter and washed extensively. Any protected RNA remaining on the filter was recovered and 5'-end labeled with γ- P- ATP and examined by denaturing gel electrophoresis. Such an experiment is shown in Fig. 5. The bands seen in lane 1 represent RNase Tl -resistant fragments that were protected by the GST-ICP27 protein (lane 2 is a control in which no protein was added). This reproducible pattern of fragments was also seen when the full-length ICP27 mRNA was used as the substrate in the initial binding reaction (data not shown). The three largest fragments, hereinafter A, B and C, were isolated from the gel and subjected to enzymatic sequencing using RNases Tl, PhyM, and B. cereus. Partial nucleotide sequences were obtained from each of the three fragments. Interestingly, two of the fragments, denoted A and C, are overlapping RNase Tl -resistant RNA fragments (i.e., they are different RNase Tl fragments of the same sequence because the Tl digest was a partial digest). Fragment B (SEQ ID NO:6) was also identified as being protected, and it lies just upsteam of A/C (SEQ ID NO:7). The corresponding DNA sequences are set forth in SEQ ID NOs:8 and 9, respectively. Since these experiments identified essentially two nearby RNA sequences, we cloned a single, 90 nucleotide DNA fragment encoding the RNA containing both of these elements. This 90 nucleotide RNA sequence representing the protected region of the ICP27 mRNA is set forth in SEQ ID NO: 10; the corresponding DNA sequence is set forth in SEQ ID NO: 11. From these results we conclude that the sequence of RNase Tl -resistant nucleotide fragments corresponds to a high-affinity, stable binding site for GST-ICP27.

In order to further characterize the specificity of the interaction of GST-ICP27 with this protected region, a DNA fragment encoding the 90 nucleotide fragment (SEQ ID NO: 10) of the ICP27 mRNA 3 -UTR containing these sequences was cloned downstream of a T7 promoter for in vitro transcription. This RNA, called 27-T1, was then used in filter-binding studies with GST-ICP27. The result of this analysis is shown in Fig. 6. Clearly, unlabeled 27 -Tl RNA is able to efficiently abrogate the binding of GST-ICP27 to the labeled substrate. Using a 2- to 10-fold excess of four different and unrelated RNAs, the same steep competition is not observed. This indicates that the 27-T1 RNA is specifically recognized by GST-ICP27. These results taken together suggest that at least one specific, high-affinity binding site for GST- ICP27 exists within the 3 -UTR of the ICP27 mRNA transcript.

Claims

What is claimed is:
1. An isolated polynucleotide that binds to ICP27 wherein the nucleotide sequence of the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 6 and SEQ ID NO:7, or a variant thereof.
2. The isolated polynucleotide of Claim 1 wherein the nucleotide sequence of the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 10.
3. The isolated polynucleotide of Claim 2 wherein the nucleotide sequence of the polynucleotide is set forth in SEQ ID NO: 10.
4. The isolated polynucleotide of Claim 2 wherein the nucleotide sequence of the polynucleotide is set forth in SEQ ID NO:3.
5. An isolated polynucleotide wherein the nucleotide sequence of the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO: 8 and SEQ ID NO:9, or a variant thereof.
6. The isolated polynucleotide of Claim 5 wherein the nucleotide sequence of the polynucleotide comprises the nucleotide sequences set forth in SEQ ID NO: 11.
7. The isolated polynucleotide of Claim 6 wherein the nucleotide sequence of the polynucleotide is set forth in SEQ ID NO: 11.
8. The isolated polynucleotide of Claim 6 wherein the nucleotide sequence of the polynucleotide is set forth in SEQ ID NO:2.
9. A method for identifying a compound that alters the binding of ICP27 to an RNA comprising: a) preparing a compound to be tested; b) admixing the compound to be tested with ICP27 and an RNA that binds to ICP27; c) measuring the binding of ICP27 to the RNA wherein an alteration of the binding of ICP27 to the RNA in the presence of the compound to be tested compared to the binding of ICP27 to the RNA in the absence of the compound to be tested is indicative of the ability of the compound to be tested to alter the binding of ICP27 to the RNA.
10. The method of Claim 9 wherein the RNA to be tested is an isolated polynucleotide wherein the nucleotide sequence of the polynucleotide comprises the nucleotide sequence set forth in SEQ ID NO:6 and SEQ ID NO:7, or a variant thereof.
11. The method of Claim 10 wherein the nucleotide sequence of the polynucleotide is set forth in SEQ ID NO: 10.
12. A method for altering the binding of ICP27 to an RNA in an animal comprising: a) preparing a compound that inhibits the binding of ICP27 to an RNA; and b) administering the compound of (a) to an animal.
13. The method of Claim 12 wherein the RNA comprises the nucleotide sequence set forth in SEQ ID NO:6 and SEQ ID NO:7 or a variant thereof.
14. A method for treating or preventing a disease in a mammal caused by a virus comprising administering an effective dose of a compound that alters the binding of ICP27 to an RNA.
15. The method of Claim 14 wherein the virus is a herpesvirus.
16. The method of Claim 14 wherein the RNA comprises the nucleotide sequence set forth in SEQ ID NO:6 and SEQ ID NO:7 or a variant thereof.
PCT/US2001/019278 2000-06-16 2001-06-15 Icp27-binding polynucleotides WO2001097847A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US21244400P true 2000-06-16 2000-06-16
US60/212,444 2000-06-16

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
AU6847201A AU6847201A (en) 2000-06-16 2001-06-15 Icp27-binding polynucleotides

Publications (1)

Publication Number Publication Date
WO2001097847A1 true WO2001097847A1 (en) 2001-12-27

Family

ID=22791039

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/019278 WO2001097847A1 (en) 2000-06-16 2001-06-15 Icp27-binding polynucleotides

Country Status (2)

Country Link
AU (1) AU6847201A (en)
WO (1) WO2001097847A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6146632A (en) * 1993-12-23 2000-11-14 Smithkline Beecham Biologicals S.A. Vaccines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6146632A (en) * 1993-12-23 2000-11-14 Smithkline Beecham Biologicals S.A. Vaccines

Also Published As

Publication number Publication date
AU6847201A (en) 2002-01-02

Similar Documents

Publication Publication Date Title
Harel et al. Removal of a single pore subcomplex results in vertebrate nuclei devoid of nuclear pores
Tang et al. Mad2-Independent inhibition of APCCdc20 by the mitotic checkpoint protein BubR1
Leskov et al. Synthesis and functional analyses of nuclear clusterin, a cell death protein
Verreault et al. Nucleosomal DNA regulates the core-histone-binding subunit of the human Hat1 acetyltransferase
Jensen et al. BAP1: a novel ubiquitin hydrolase which binds to the BRCA1 RING finger and enhances BRCA1-mediated cell growth suppression
Krugmann et al. Cdc42 induces filopodia by promoting the formation of an IRSp53: Mena complex
Wilson et al. Differential subcellular localization, expression and biological toxicity of BRCA1 and the splice variant BRCA1-Δ11b
Matsuoka et al. p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene.
Nakamura et al. The vesicle docking protein p115 binds GM130, a cis-Golgi matrix protein, in a mitotically regulated manner
Li et al. Identification of human Rap1: implications for telomere evolution
Timchenko et al. CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice.
Venteicher et al. Identification of ATPases pontin and reptin as telomerase components essential for holoenzyme assembly
LI et al. The 3′-end-processing factor CPSF is required for the splicing of single-intron pre-mRNAs in vivo
Baillat et al. Integrator, a multiprotein mediator of small nuclear RNA processing, associates with the C-terminal repeat of RNA polymerase II
Verhagen et al. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins
Adams et al. Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS, and adult testis.
Vucic et al. ML-IAP, a novel inhibitor of apoptosis that is preferentially expressed in human melanomas
Finlay et al. The p53 proto-oncogene can act as a suppressor of transformation
Bengal et al. Functional antagonism between c-Jun and MyoD proteins: a direct physical association
Xiao et al. Interaction between the retinoblastoma protein and the oncoprotein MDM2
Gu et al. Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation
Senger et al. Mtr10p functions as a nuclear import receptor for the mRNA‐binding protein Npl3p
Wang et al. C/EBPα arrests cell proliferation through direct inhibition of Cdk2 and Cdk4
Selivanova et al. Restoration of the growth suppression function of mutant p53 by a synthetic peptide derived from the p53 C-terminal domain
Li et al. The Epstein-Barr virus (EBV) BZLF2 gene product associates with the gH and gL homologs of EBV and carries an epitope critical to infection of B cells but not of epithelial cells.

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP