WO2001042436A2 - Genes involved in cyclododecanone degradation pathway - Google Patents
Genes involved in cyclododecanone degradation pathway Download PDFInfo
- Publication number
- WO2001042436A2 WO2001042436A2 PCT/US2000/033426 US0033426W WO0142436A2 WO 2001042436 A2 WO2001042436 A2 WO 2001042436A2 US 0033426 W US0033426 W US 0033426W WO 0142436 A2 WO0142436 A2 WO 0142436A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- nucleic acid
- sequence
- host cell
- acid fragment
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/08—Oxygen as only ring hetero atoms containing a hetero ring of at least seven ring members, e.g. zearalenone, macrolide aglycons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/44—Polycarboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
Definitions
- the present invention relates to the field of molecular biology and microbiology. More particularly, the invention relates to bioproduction of dodecanoic diacid from cyclododecannone by microbiological means. The cyclododecanone degradation is mediated by a set of enzymes resident on a 10 kb gene cluster, isolated from Rhodococcus ruber SCI. The invention also relates to the bioproduction of lactones, hydroxy acids and diacids from cyclic compounds. BACKGROUND OF THE INVENTION Dodecanedioic acid (DDDA) and other diacids of different chain length are used in nylon manufacturing for production of different variants of nylon fibers.
- DDDA Dodecanedioic acid
- other diacids of different chain length are used in nylon manufacturing for production of different variants of nylon fibers.
- Nylon 6, 12 is a polymer condensed from monomers of hexamethylenediamine (HMD) and DDDA (C12 diacid), which has some different properties from Nylon 6,6 condensed from HMD and adipic acid (C6 diacid).
- HMD hexamethylenediamine
- DDDA DDDA
- C12 diacid DDDA
- the toughness of the Nylon 6,12 polymer allows it to be used in applications such as toothbrush bristles.
- Mixed diacids of different chain length (Cl 1, C12 and C13) can also be used as soft segments in Lycra® or as corrosion inhibitors in automotive coatings.
- DDDA 1,12-dodecanoic diacid
- ketone cyclododecanone
- alcohol cyclododecanol
- Rhodococcus ruber CD j -411 metabolizes the alicyclic compound, cyclododecane, in a way similar to the degradation of cyclohexane. It is suggested that cyclododecane is first hydroxylated to cyclododecanol which is then dehydrogenated to cyclododecanone (J. D. Schumacher, et al , Appl. Microbiol. Biotechnol, 1999, 52:85-90).
- this alicylic ketone is then subject to a Baeyer-Villiger oxidation yielding the lactone oxacyclotridecan-2-one (lauryl lactone), which is hydrolyzed to 12-hydroxy dodecanoic acid (12-hydroxy lauric acid). Only 12-hydroxy dodecanoic acid was detected by this method, under these conditions
- Cyclododecanone monooxygenase has been purified. This enzyme is responsible for the oxidation of cycloketone to the corresponding lactone. In spite of these findings there are no reports which describe other enzymes necessary in the cyclododecane degradation pathway. Additionally, the literature is silent with respect to genes encoding this cyclododecanone monooxygenase and isolation of the gene cluster responsible for the whole metabolic pathway. The problem to be solved therefore is to provide a facile, environmentally responsible method for the production of dodecanoic diacid and other useful intermediates.
- Applicants have solved the stated problem by identifying, isolating and cloning a 10 kb nucleic acid fragment from Rhodococcus ruber SCI which mediates the conversion of cyclododecanone and other cyclic compounds to dodecanoic diacid.
- Recombinant Escherichia coli hosts with the DNA containing the 10 kb gene cluster conveys on the host the ability to convert cyclododecanone to dodecanoic diacid.
- the present invention provides an isolated nucleic acid fragment encoding a dodecanoic diacid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid fragment encoding all or a substantial portion of the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (b) an isolated nucleic acid fragment that is substantially similar to an isolated nucleic acid fragment encoding all or a substantial portion of the amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12; (c) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6X SSC (1 M NaCl), 50% formamide, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C; and (d) an isolated nucleic acid fragment that is complementary to
- the invention provides an isolated nucleic acid fragment having about 80% to about 90% identity to the nucleic acid fragment selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:l 1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37.
- the invention further provides polypeptides encoded by the nucleic acid sequences of the present invention. Additionally the invention provides chimeric genes comprising the instant nucleic acid sequences operably linked to suitable regulatory elements and transformed host cells comprising the chimeric genes.
- the invention provides a method of obtaining a nucleic acid fragment encoding all or a substantial portion of a dodecanoic diacid synthesizing enzyme comprising: (a) probing a genomic library with the nucleic acid fragment of the present invention; (b) identifying a DNA clone that hybridizes with the nucleic acid fragment of the present invention under the following conditions; 6X SSC (1 M NaCl), 50% formamide, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C; and (c) optionally sequencing the genomic fragment that comprises the clone identified in step (b), wherein the sequenced genomic fragment encodes all or substantially all of an amino acid sequence encoding a dodecanoic diacid synthesizing enzyme.
- the invention provides a method of obtaining a nucleic acid fragment encoding all or a substantial portion a dodecanoic diacid synthesizing enzyme comprising: (a) synthesizing at least one oligonucleotide primer corresponding to a portion of the sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:l 1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, and SEQ ID NO:37; and (b) amplifying an insert present in a cloning vector using the oligonucleotide primer of step (a); wherein the amplified insert encodes a portion of an amino acid sequence encoding a dodecanoic dia
- the invention further provides a method for the production of dodecanedioic acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of cyclododecanone whereby dodecanedioic acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10, and SEQ ID NO: 12 under the control of suitable regulatory sequences.
- the invention provides a method for the production of lauryl lactone comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of cyclododecanone whereby lauryl lactone is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, under the control of suitable regulatory sequences.
- the invention provides a method for the production of 12-hydroxy lauric acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of lauryl lactone whereby 12-hydroxy lauric acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:4, under the control of suitable regulatory sequences.
- the invention provides a method for the production of 12-oxo lauric acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount 12-hydroxy lauric acid whereby 12-oxo lauric acid acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO: 10, under the control of suitable regulatory sequences.
- the invention provides a method for the production of dodecanedioic acid comprising: contacting a transformed host cell under suitable growth conditions with an effective amount 12-oxo lauric acid whereby dodecanedioic acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO: 12, under the control of suitable regulatory sequences.
- the invention further provides an isolated nucleic acid fragment encoding a dodecanedioic acid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid molecule as set forth in SEQ ID NO: 13; (b) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6X SSC (1 M NaCl), 50% formamide, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C; and (c) an isolated nucleic acid molecule that is completely complementary to (a) or (b).
- a dodecanedioic acid synthesizing enzyme selected from the group consisting of: (a) an isolated nucleic acid molecule as set forth in SEQ ID NO: 13; (b) an isolated nucleic acid molecule that hybridizes with (a) under the following hybridization conditions: 6X SSC (1 M NaCl), 50% formamide, 1% SDS at 37°C, and a wash in 0.1
- Rhodococcus ruber comprising endogenous genes encoding the proteins as set forth by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO:12, said Rhodococcus ruber SCI having the ability to convert cyclododecanone to dodecanedioic acid under suitable growth conditions.
- the invention provides a method for the production of hydroxy acids comprising: contacting a transformed host cell under suitable growth conditions with an effective amount of a cyclic ketone selected from the group consisting of C6, CIO, Cl 1, C12, C13, and C15 cyclic ketones whereby the corresponding hydroxy acid is produced, said transformed host cell comprising a nucleic acid fragment encoding SEQ ID NO:2, and SEQ ID NO:4 under the control of suitable regulatory sequences.
- Figure 1 is a diagram showing the pathway for the conversion of cyclododecane to dodecanoic diacid.
- Figure 2 is a diagram showing the organization of ORF's 1-6 on the 10 kb gene cluster.
- Figure 3 is a diagram showing the amount of 12-hydroxy lauric acid and dodecanoic diacid produced from the recombinant E. coli cosmid clones.
- SEQ ID NO:l is the nucleotide sequence of ORF 1 encoding a cyclododecanone monooxygenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO:2 is the deduced amino acid sequence of ORF 1 encoding a cyclododecanone monooxygenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 3 is the nucleotide sequence of ORF 2 encoding a lauryl lactone esterase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO:4 is the deduced amino acid sequence of ORF 2 encoding a lauryl lactone esterase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 5 is the nucleotide sequence of ORF 3 encoding a putative protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 6 is the deduced amino acid sequence of ORF 3 encoding a putative protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI .
- SEQ ID NO:7 is the nucleotide sequence of ORF 4 encoding a protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 8 is the deduced amino acid sequence of ORF 4 encoding a conserved hypothetical protein with unknown function isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SC 1.
- SEQ ID NO:9 is the nucleotide sequence of ORF 5 encoding a 12-hydroxy lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 10 is the deduced amino acid sequence of ORF 5 encoding a 12-hydroxy lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI .
- SEQ ID NO:l 1 is the nucleotide sequence of ORF 6 encoding a 12-oxo lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 12 is the deduced amino acid sequence of ORF 6 encoding a
- 12-oxo lauric acid dehydrogenase enzyme isolated from a 10 kb nucleic acid fragment from Rhodococccus ruber SCI.
- SEQ ID NO: 13 is the nucleotide sequence of the 10 kb gene cluster isolated from a Rhodococccus ruber SCI, encoding all the enzymes relevant to the biocoversion of cyclododecanone to dodecanoic diacid.
- SEQ ID NO: 14 is the N-terminal amino acid sequence of cycolododecanone monooxygenase from Rhodococccus ruber SCI.
- SEQ ID NO: 15 is the internal peptide amino acid sequence of cycolododecanone monooxygenase from Rhodococccus ruber SCI.
- SEQ ID NO:16 is the nucleotide sequence of a JCR14 primer used to sequence 16s rDNA for typing the isolated bacterium.
- SEQ ID NO: 17 is the nucleotide sequence of a JCR15 primer used to sequence 16s rDNA for typing the isolated bacterium.
- SEQ ID NO: 18 is the nucleotide sequence of a CDDK4 primer which was derived from the N terminal sequence of cyclododecanone monooxygenase enzyme and was used for cloning of this enzyme from Rhodococcus ruber SCI .
- SEQ ID NO: 19 is the nucleotide sequence of a CDDK10 primer which was derived from the internal sequence of cyclododecanone monooxygenase enzyme and was used for cloning of this enzyme from Rhodococcus ruber SCI .
- SEQ ID NO:20 is the nucleotide sequence of a C12 MO TOP primer which was used to screen the cosmid library.
- SEQ ID NO:21 is the nucleotide sequence of a C12 MO BOTTOM primer which was used to screen the cosmid library.
- SEQ ID NO:22 is the nucleotide sequence of a KK1 primer used to construct a subclone pDCQ5 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.
- SEQ ID NO:23 is the nucleotide sequence of a KK2 primer used to construct a subclone pDCQ5 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.
- SEQ ID NO:24 is the nucleotide sequence of a KK3 primer used to construct a subclone pDCQ6 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.
- SEQ ID NO:25 is the nucleotide sequence of a KK4 primer used to construct a subclone pDCQ6 containing only cyclododecanone monooxygenase gene and lauric acid esterase gene.
- SEQ ID NOs:26-28 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 1 (SEQ ID NO:l) encoding a cyclododecanone monooxygenase enzyme.
- SEQ ID NOs:29-31 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 2 (SEQ ID NO:3) encoding a lauryl lactone esterase enzyme.
- SEQ ID NOs:32-34 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 5 (SEQ ID NO: 9) encoding a 12-hydroxy lauric acid dehydrogenase enzyme.
- SEQ ID NOs:35-37 are nucleic acid sequences which will hybridize under stringent conditions to the nucleic acid sequence for ORF 6 (SEQ ID NO: 11) encoding a 12-oxo lauric acid dehydrogenase enzyme.
- SEQ ID NOs:38-39 are primers used to amplify the cddA gene.
- the present invention provides new sequences encoding key enzymes in the synthesis of dodecanoic diacid from cyclododecanone.
- the genes and their expression products are useful for the creation of recombinant organisms that have the ability to produce dodecanoic diacid while growing on cyclododecanone, and for the identification of new species of bacteria having the ability to produce dodecanoic diacid.
- Dodecanedioic acid (DDDA) and other diacids have utility as monomers in the manufacture of various polymers such as Nylon.
- Other intermediates such as lactones have utilities as automotive coatings or flavors and fragrances.
- hydroxy acids of C6, C10 C11, C12, C13, and C15 were produced from their corresponding cyclic ketones.
- the hydroxy acids of the present invention have use as monomers in the synthesis of polymers such as polyester.
- ORF Open reading frame
- PCR Polymerase chain reaction
- HPLC High performance liquid chromatography
- MS Mass spectrometry
- “Baeyer-Villiger oxidation” refers to a reaction of oxidizing carbonyl compounds by peroxy compounds which involves formal insertion of an oxygen atom into one of the carbon-carbon bonds at the carbonyl group. This insertion is accomplished by a sequence of steps involving addition of the carbonyl group and migration to oxygen.
- Cyclododecanone monooxygenase refers to the enzyme required in the oxidation of cycloketone to the corresponding lactone. This enzyme is encoded by ORF 1 (designated as cddA) and is resident on the 10 kb Rhodococcus ruber SCI gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.
- ORF 1 designated as cddA
- Lauryl lactone esterase or “lauryl lactone hydrolase” refers to an enzyme that is involved in the conversion of lauryl lactone to 12-hydroxy lauric acid. This enzyme is encoded by ORF 2 (designated as cddB) and is resident on the 10 kb Rhodococcus ruber SCI gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.
- 12-hydroxy lauric acid dehydrogenase refers to an alcohol dehydrogenase enzyme that catalyzes oxidation of 12-hydroxy lauric acid to 12-oxo lauric acid. This enzyme is encoded by ORF 5 (designated as cddC) and is resident on the 10 kb Rhodococcus ruber SCI gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.
- 12-oxo lauric acid dehydrogenase refers to an aldehyde dehydrogenase which catalyzes conversion of 12-oxo lauric acid to dodecanoic diacid.
- This enzyme is encoded by ORF 6 (designated as cddD) and is resident on the 10 kb Rhodococcus ruber SCI gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.
- cddX and ⁇ Y refers to two unknown proteins encoded by ORF 3 and ORF 4, respectively, both of which are resident on the 10 kb Rhodococcus ruber SCI gene cluster, necessary for the conversion of cyclododecanone to dodecanoic diacid.
- gene cluster will mean genes organized in a single expression unit or physically associated with each other.
- 10 kb nucleic acid fragment refers to the 10 kb gene cluster comprising ORFs 1-6 sufficient for the conversion of cyclododecanone to dodecanoic diacid.
- dodecanoic diacid and “dodecanedioic acid” will be used interchangeably and abbreviated as DDDA.
- diacid synthesizing enzyme means the gene product of any of ORF 1, ORF 2, ORF 5 and ORF 6 encoding SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 10 and SEQ ID NO: 12, respectively.
- knockout construct means a DNA sequence which has been altered via any known means, for example, insertion, deletion, point mutation or rearrangement, so as to eliminate the function of one or more of the naturally occurring gene products.
- knockout mutants refer to cells, microorganisms in which one or more of the naturally occurring genes have been replaced through genetic engineering with a knockout construct.
- an "isolated nucleic acid fragment” is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non- natural or altered nucleotide bases.
- An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.
- substantially similar refers to nucleic acid fragments wherein changes in one or more nucleotide bases results in substitution of one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence.
- substantially similar also refers to nucleic acid fragments wherein changes in one or more nucleotide bases does not affect the ability of the nucleic acid fragment to mediate alteration of gene expression by antisense or co-suppression technology.
- Substantially similar also refers to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotide bases that do not substantially affect the functional properties of the resulting transcript. It is therefore understood that the invention encompasses more than the specific exemplary sequences.
- a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue (such as glycine) or a more hydrophobic residue (such as valine, leucine, or isoleucine).
- a codon encoding another less hydrophobic residue such as glycine
- a more hydrophobic residue such as valine, leucine, or isoleucine
- changes which result in substitution of one negatively charged residue for another such as aspartic acid for glutamic acid
- one positively charged residue for another such as lysine for arginine
- substantially similar sequences encompassed by this invention are also defined by their ability to hybridize, under stringent conditions, (0.1X SSC, 0.1% SDS, 65°C and washed with 2X SSC, 0.1% SDS followed by 0.1X SSC, 0.1% SDS), with the sequences exemplified herein.
- Preferred substantially similar nucleic acid fragments of the instant invention are those nucleic acid fragments whose DNA sequences are at least 80% identical to the DNA sequence of the nucleic acid fragments reported herein. More preferred nucleic acid fragments are at least 90% identical to the DNA sequence of the nucleic acid fragments reported herein. Most preferred are nucleic acid fragments that are at least 95% identical to the DNA sequence of the nucleic acid fragments reported herein.
- a nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to the other nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength.
- Hybridization and washing conditions are well known and exemplified in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly Chapter 11 and Table 11.1 therein (entirely incorporated herein by reference). The conditions of temperature and ionic strength determine the "stringency" of the hybridization.
- stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary moderate stringency conditions include hybridization in 6X SSC (1 M NaCl), 40 to 45% formamide, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
- Exemplary high stringency conditions include hybridization in 6X SSC (1 M NaCl), 50% formamide, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
- T m melting temperature
- T m 81.5 °C + 16.6 (log M) + 0.41 (%G+C) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %G+C is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
- T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- sequences that will hybridize to the nucleic acid sequence of ORF 1 (SEQ ID NO:l) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:26-28.
- sequences that will hybridize to the nucleic acid sequence of ORF 2 (SEQ ID NO:3) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:29-31.
- sequences that will hybridize to the nucleic acid sequence of ORF 5 (SEQ ID NO:9) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:32-34.
- sequences that will hybridize to the nucleic acid sequence of ORF 6 (SEQ ID NO: 11) under stringent conditions will include but are not limited to those sequences set forth in SEQ ID NOs:35-37.
- a "substantial portion" of an amino acid or nucleotide sequence comprising enough of the amino acid sequence of a polypeptide or the nucleotide sequence of a gene to putatively identify that polypeptide or gene, either by manual evaluation of the sequence by one skilled in the art, or by computer- automated sequence comparison and identification using algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul, S. F., et al., (1993) J Mol. Biol. 215:403-410; see also www.ncbi.nlm.nih.gov/BLAST/).
- BLAST Basic Local Alignment Search Tool
- a sequence often or more contiguous amino acids or thirty or more nucleotides is necessary in order to putatively identify a polypeptide or nucleic acid sequence as homologous to a known protein or gene.
- gene specific oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in sequence-dependent methods of gene identification (e.g., Southern hybridization) and isolation (e.g., in situ hybridization of bacterial colonies or bacteriophage plaques).
- short ohgonucleotides of 12-15 bases may be used as amplification primers in PCR in order to obtain a particular nucleic acid fragment comprising the primers. Accordingly, a
- nucleotide sequence comprises enough of the sequence to specifically identify and/or isolate a nucleic acid fragment comprising the sequence.
- the instant specification teaches partial or complete amino acid and nucleotide sequences encoding one or more particular fungal proteins. The skilled artisan, having the benefit of the sequences as reported herein, may now use all or a substantial portion of the disclosed sequences for purposes known to those skilled in this art. Accordingly, the instant invention comprises the complete sequences as reported in the accompanying Sequence Listing, as well as substantial portions of those sequences as defined above.
- the term "complementary" is used to describe the relationship between nucleotide bases that are capable to hybridizing to one another.
- adenosine is complementary to thymine and cytosine is complementary to guanine.
- the instant invention also includes isolated nucleic acid fragments that are complementary to the complete sequences as reported in the accompanying Sequence Listing as well as those substantially similar nucleic acid sequences.
- identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
- identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
- Identity and similarity can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.
- nucleic acid fragments encode polypeptides that are at least about 70% identical, preferably at least about 80% identical to the amino acid sequences reported herein.
- Preferred nucleic acid fragments encode amino acid sequences that are about 85% identical to the amino acid sequences reported herein. More preferred nucleic acid fragments encode amino acid sequences that are at least about 90%) identical to the amino acid sequences reported herein. Most preferred are nucleic acid fragments that encode amino acid sequences that are at least about 95% identical to the amino acid sequences reported herein.
- Suitable nucleic acid fragments not only have the above homologies but typically encode a polypeptide having at least 50 amino acids, preferably at least 100 amino acids, more preferably at least 150 amino acids, still more preferably at least 200 amino acids, and most preferably at least 250 amino acids.
- sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences.
- Sequence analysis software may be commercially available or independently developed. Typical sequence analysis software will include but is not limited to the GCG suite of programs (Wisconsin Package Version 9.0,
- GCG Genetics Computer Group
- BLASTP BLASTN
- BLASTN BLASTN
- BLASTX Altschul et al., J. Mol. Biol. 215:403-410 (1990)
- DNASTAR DNASTAR, Inc. 1228 S. Park St. Madison, WI 53715 USA
- FASTA program incorporating the Smith- Waterman algorithm (W. R. Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20.
- Codon degeneracy refers to divergence in the genetic code permitting variation of the nucleotide sequence without effecting the amino acid sequence of an encoded polypeptide. Accordingly, the instant invention relates to any nucleic acid fragment that encodes all or a substantial portion of the amino acid sequence encoding the bacterial dodecanoic diacid synthesizing enzymes as set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:10, and SEQ ID NO: 12. The skilled artisan is well aware of the "codon-bias" exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid.
- Synthetic genes can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those skilled in the art. These building blocks are ligated and annealed to form gene segments which are then enzymatically assembled to construct the entire gene.
- “Chemically synthesized”, as related to a sequence of DNA, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well established procedures, or automated chemical synthesis can be performed using one of a number of commercially available machines.
- the genes can be tailored for optimal gene expression based on optimization of nucleotide sequence to reflect the codon bias of the host cell.
- the skilled artisan appreciates the likelihood of successful gene expression if codon usage is biased towards those codons favored by the host. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.
- Gene refers to a nucleic acid fragment that expresses a specific protein, including regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) the coding sequence.
- Native gene refers to a gene as found in nature with its own regulatory sequences.
- Chimeric gene refers any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
- Endogenous gene refers to a native gene in its natural location in the genome of an organism.
- a “foreign” gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes.
- a “transgene” is a gene that has been introduced into the genome by a transformation procedure.
- Coding sequence refers to a DNA sequence that codes for a specific amino acid sequence.
- Suitable regulatory sequences refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, and polyadenylation recognition sequences.
- Promoter refers to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
- a coding sequence is located 3' to a promoter sequence. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”.
- DNA fragments of different lengths may have identical promoter activity.
- the "3' non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
- RNA transcript refers to the product resulting from RNA polymerase- catalyzed transcription of a DNA sequence.
- the primary transcript When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA.
- RNA essential RNA
- cDNA double-stranded DNA that is complementary to and derived from mRNA.
- Sense RNA refers to RNA transcript that includes the mRNA and so can be translated into protein by the cell.
- Antisense RNA refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA that blocks the expression of a target gene (U.S. Patent No. 5,107,065).
- the complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.
- “Functional RNA” refers to antisense RNA, ribozyme RNA, or other RNA that is not translated yet has an effect on cellular processes.
- operably linked refers to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other.
- a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).
- Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation.
- expression refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. Expression may also refer to translation of mRNA into a polypeptide.
- “Mature” protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or propeptides present in the primary translation product have been removed.
- Precursor protein refers to the primary product of translation of mRNA; i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to intracellular localization signals.
- Transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as “transgenic” or “recombinant” or “transformed” organisms.
- Plasmid refers to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell, and usually in the form of circular double-stranded DNA molecules.
- Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequence into a cell.
- Transformation cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that facilitate transformation of a particular host cell.
- Expression cassette refers to a specific vector containing a foreign gene and having elements in addition to the foreign gene that allow for enhanced expression of that gene in a foreign host.
- Standard recombinant DNA and molecular cloning techniques used here are well known in the art as described by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) (hereinafter "Maniatis”); and by Silhavy, T. J., Bennan, M. L. and Enquist, L.
- the invention provides new sequences encoding key enzymes in the synthesis of dodecanoic diacid from cyclododecanone. These seqeunces comprising six open reading frames residing on a 10 kb gene cluster isolated from Rhodococcus ruber SCI. ORF's 1, 2, 5 and 6 all encode identifiable enzymes known to be useful in the synthesis of DDDA. The present genes were identified both on the basis of expression data as well as comparison of the nucleic acid and deduced amino acid sequences to public databases using algorithms well known in the art.
- polypeptides of the instant invention are those active proteins which are at least 80% identical to the amino acid sequence of reported herein. More preferred amino acid fragments are at least 90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the amino acid fragments reported herein. Similarly, preferred nucleic acid sequences corresponding to the instant ORF's are those encoding active proteins and which are at least 80% identical to the nucleic acid sequences of reported herein.
- nucleic acid fragments are at least 90% identical to the sequences herein. Most preferred are nucleic acid fragments that are at least 95% identical to the nucleic acid fragments reported herein.
- the nucleic acid fragments of the instant invention may be used to isolate cDNAs and genes encoding homologous enzymes from the same or other bacterial species. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to, methods of nucleic acid hybridization, and methods of DNA and RNA amplification as exemplified by various uses of nucleic acid amplification technologies (e.g., polymerase chain reaction, ligase chain reaction).
- genes encoding similar enzymes to those of the instant dodecanoic diacid pathway could be isolated directly by using all or a portion of the instant nucleic acid fragments as DNA hybridization probes to screen libraries from any desired bacteria using methodology well known to those skilled in the art.
- Specific oligonucleotide probes based upon the instant nucleic acid sequences can be designed and synthesized by methods known in the art (Maniatis).
- the entire sequences can be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primers DNA labeling, nick translation, or end- labeling techniques, or RNA probes using available in vitro transcription systems.
- primers can be designed and used to amplify a part of or full- length of the instant sequences.
- the resulting amplification products can be labeled directly during amplification reactions or labeled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency.
- two short segments of the instant ORF's 1-6 may be used in polymerase chain reaction protocols to amplify longer nucleic acid fragments encoding homologous genes from DNA or RNA.
- the polymerase chain reaction may also be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the instant nucleic acid fragments, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3' end of the mRNA precursor encoding bacterial genes.
- the second primer sequence may be based upon sequences derived from the cloning vector.
- the skilled artisan can follow the RACE protocol (Frohman et al., PNAS USA 85:8998 (1988)) to generate cDNAs by using PCR to amplify copies of the region between a single point in the transcript and the 3' or 5' end.
- Primers oriented in the 3' and 5' directions can be designed from the instant sequences.
- specific 3' or 5' cDNA fragments can be isolated (Ohara et al., PNAS USA 86:5673 (1989); Loh et al., Science 243:217 (1989)).
- the primers typically, in PCR-type amplification techniques, the primers have different sequences and are not complementary to each other.
- the sequences of the primers should be designed to provide for both efficient and faithful replication of the target nucleic acid.
- Methods of PCR primer design are common and well known in the art. (Thein and Wallace, "The use of oligonucleotide as specific hybridization probes in the Diagnosis of Genetic Disorders", in Human Genetic Diseases: A Practical Approach, K. E. Davis Ed., (1986) pp. 33-50 IRL Press, Herndon, Virginia); Rychlik, W. (1993) In White, B. A. (ed Methods in Molecular Biology. Vol. 15, pages 31-39, PCR Protocols: Current Methods and Applications. Humania Press, Inc., Totowa, NJ.)
- the instant sequences may be employed as hybridization reagents for the identification of homologs.
- the basic components of a nucleic acid hybridization test include a probe, a sample suspected of containing the gene or gene fragment of interest, and a specific hybridization method.
- Probes of the present invention are typically single stranded nucleic acid sequences which are complementary to the nucleic acid sequences to be detected. Probes are "hybridizable" to the nucleic acid sequence to be detected.
- the probe length can vary from 5 bases to tens of thousands of bases, and will depend upon the specific test to be done. Only part of the probe molecule need be complementary to the nucleic acid sequence to be detected. In addition, the complementarily between the probe and the target sequence need not be perfect. Hybridization does occur between imperfectly complementary molecules with the result that a certain fraction of the bases in the hybridized region are not paired with the proper complementary base.
- Hybridization methods are well defined.
- the probe and sample must be mixed under conditions which will permit nucleic acid hybridization. This involves contacting the probe and sample in the presence of an inorganic or organic salt under the proper concentration and temperature conditions.
- the probe and sample nucleic acids must be in contact for a long enough time that any possible hybridization between the probe and sample nucleic acid may occur.
- the concentration of probe or target in the mixture will determine the time necessary for hybridization to occur. The higher the probe or target concentration the shorter the hybridization incubation time needed.
- a chaotropic agent may be added. The chaotropic agent stabilizes nucleic acids by inhibiting nuclease activity.
- chaotropic agent allows sensitive and stringent hybridization of short oligonucleotide probes at room temperature [Nan ⁇ ess and Chen (1991) Nucl. Acids Res. 19:5143-5151].
- Suitable chaotropic agents include guanidinium chloride, guanidinium thiocyanate, sodium thiocyanate, lithium tetrachloroacetate, sodium perchlorate, rubidium tetrachloroacetate, potassium iodide, and cesium trifluoroacetate, among others.
- the chaotropic agent will be present at a final concentration of about 3M. If desired, one can add formamide to the hybridization mixture, typically 30-50% (v/v).
- hybridization solutions can be employed. Typically, these comprise from about 20 to 60% volume, preferably 30%, of a polar organic solvent.
- a common hybridization solution employs about 30-50% v/v formamide, about 0.15 to IM sodium chloride, about 0.05 to 0.1 M buffers, such as sodium citrate, Tris-HCl, PIPES or HEPES (pH range about 6-9), about 0.05 to 0.2% detergent, such as sodium dodecylsulfate, or between 0.5-20 mM EDTA, FICOLL (Pharmacia Inc.) (about 300-500 kilodaltons), polyvinylpyrrolidone (about 250-500 kilodaltons), and serum albumin.
- unlabeled carrier nucleic acids from about 0.1 to 5 mg/mL, fragmented nucleic DNA, e.g., calf thymus or salmon sperm DNA, or yeast RNA, and optionally from about 0.5 to 2% wt./vol. glycine.
- Other additives may also be included, such as volume exclusion agents which include a variety of polar water-soluble or swellable agents, such as polyethylene glycol, anionic polymers such as polyacrylate or polymethylacrylate, and anionic saccharidic polymers, such as dextran sulfate.
- Nucleic acid hybridization is adaptable to a variety of assay formats. One of the most suitable is the sandwich assay format. The sandwich assay is particularly adaptable to hybridization under non-denaturing conditions.
- a primary component of a sandwich-type assay is a solid support. The solid support has adsorbed to it or covalentiy coupled to it immobilized nucleic acid probe that is unlabeled and complementary to one portion of the sequence.
- Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides can be used to immunize animals to produce polyclonal or monoclonal antibodies with specificity for peptides or proteins comprising the amino acid sequences. These antibodies can be then be used to screen cDNA expression libraries to isolate full-length cDNA clones of interest (Lerner, R. A. Adv. Immunol. 36:1 (1984); Maniatis).
- the enzymes and gene products of the instant 10 kb nucleic acid fragment may be produced in heterologous host cells, particularly in the cells of microbial hosts, and can be used to prepare antibodies to the resulting proteins by methods well known to those skilled in the art.
- the antibodies are useful for detecting the proteins in situ in cells or in vitro in cell extracts.
- Preferred heterologous host cells for production of the instant enzymes are microbial hosts.
- Specific suitable hosts include but are not limited Aspergillus, Saccharomyces, Pichia, Candida, Hansenula, Salmonella, Bacillus, Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Corynebacterium, and Pseudomonas.
- Microbial expression systems and expression vectors containing regulatory sequences that direct high level expression of foreign proteins are well known to those skilled in the art. Any of these could be used to construct chimeric genes for production of the any of the gene products of the 10 kb fragment. These chimeric genes could then be introduced into appropriate microorganisms via transformation to provide high level expression of the enzymes.
- chimeric genes will be effective in altering the properties of the host bacteria. It is expected, for example, that introduction of chimeric genes encoding one or more of the ORF's 1-6 under the control of the appropriate promoters, into a host cell comprising at least one copy of these genes will demonstrate the ability to convert cyclododecanone to lauryl lactone; lauryl lactone to 12-hydroxy lauric acid; and 12-hydroxy lauric acid to 12-oxo lauric acid and 12-oxo lauric acid to DDDA respectively. Additionally expression of ORF's 1-6, either separately or together may facilitate the mediation of cyclododecanone to dodecanoic diacid, or any of the intermediate steps depending on the presence or absence of these proteins in the host.
- the instant dodecanoic diacid synthesizing enzymes have a broad substrate specificity and are able to act on cyclic ketones and esters ranging from C6 to C18 where a range of C6 to C15 is preferred. Accordingly it is contemplated that microbial hosts transformed with genes encoding the instant enzymes will demonstrate the ability to convert C6 - C18 cyclic ketones and preferably C6, C10-C13 and C15 cyclic ketones and esters to their corresponding hydroxy acids.
- cyclohexanone (C6), cyclodecanone (CIO), cycloundecanone (Cl 1), cyclododecanone (C12), cyclotridecanone (C13) and cyclopentadecanone (Cl 5) may each be converted to their corresponding hydroxy acids in the presence of the instant dodecanoic diacid synthesizing enzymes. Additionally it will be appreciated by the skilled person that, given the broad substrate range of the present enzymes it is contemplated that these proteins will convert cyclic ketones to macrolactones of CIO or greater. Vectors or cassettes useful for the transformation of suitable host cells are well known in the art.
- the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration.
- Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. It is most preferred when both control regions are derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.
- Initiation control regions or promoters which are useful to drive expression of the instant ORF's in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genes is suitable for the present invention including but not limited to CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI (useful for expression in Saccharomyces); AOX1 (useful for expression in Pichia); and lac, trp, 1P L , IPR, T7, tac, and trc (useful for expression in Escherichia coli).
- Termination control regions may also be derived from various genes native to the preferred hosts. Optionally, a termination site may be unnecessary however; it is most preferred if included.
- secretion of desired proteins into the growth media has the advantages of simplified and less costly purification procedures. It is well known in the art that secretion signal sequences are often useful in facilitating the active transport of expressible proteins across cell membranes.
- the creation of a transformed host capable of secretion may be accomplished by the incorporation of a DNA sequence that codes for a secretion signal which is functional in the host production host. Methods for choosing appropriate signal sequences are well known in the art (see for example EP 546049; WO 9324631).
- the secretion signal DNA may be between the expression-controlling DNA and the instant gene or gene fragment, and in reading frame with the latter.
- Fed-Batch fermentation processes are also suitable in the present invention and comprise a typical batch system with the exception that the substrate is added in increments as the fermentation progresses.
- Fed-Batch systems are useful when catabolite repression is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2.
- Batch and Fed-Batch fermentations are common and well known in the art and examples may be found in Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology. Second Edition (1989) Sinauer Associates, Inc., Sunderland, M. A., or Deshpande, Mukund V., Appl. Biochem. Biotechnol, 36, 227, (1992), herein incorporated by reference.
- Continuous fermentation is an open system where a defined fermentation media is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.
- Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration.
- one method will maintain a limiting nutrient such as the carbon source or nitrogen level at a fixed rate and allow all other parameters to moderate.
- a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant.
- Continuous systems strive to maintain steady state growth conditions and thus the cell loss due to media being drawn off must be balanced against the cell growth rate in the fermentation.
- the present nucleotides may be used to produce gene products having enhanced or altered activity.
- Various methods are known for mutating a native gene sequence to produce a gene product with altered or enhanced activity including but not limited to error prone PCR (Melnikov et al., Nucleic Acids Research, (February 15, 1999) Vol. 27, No. 4, pp. 1056-1062); site directed mutagenesis (Coombs et al., Proteins (1998), 259-311, 1 plate. Editor(s): Angeletti, Ruth Hogue. Publisher: Academic, San Diego, CA) and "gene shuffling" (U.S. 5,605,793; U.S. 5,811,238; U.S.
- the method of gene shuffling is particularly attractive due to its facile implementation, and high rate of mutagenesis and ease of screening.
- the process of gene shuffling involves the restriction of a gene of interest into fragments of specific size in the presence of additional populations of DNA regions of both similarity to or difference to the gene of interest. This pool of fragments was then denatured and then reannealed to create a mutate gene. The mutated gene is then screened for altered activity.
- the instant bacterial sequences of the present invention may be mutated and screened for altered or enhanced activity by this method.
- the sequences should be double stranded and can be of various lengths ranging form 50 bp to 10 kb.
- the sequences may be randomly digested into fragments ranging from about 10 bp to 1000 bp, using restriction endonucleases well known in the art (Maniatis supra).
- populations of fragments that are hybridizable to all or portions of the bacterial sequence may added.
- a population of fragments which are not hybridizable to the instant sequence may also be added. Typically these additional fragment populations are added in about 10 to 20 fold excess by weight as compared to the total nucleic acid.
- the number of different specific nucleic acid fragments in the mixture will be about 100 to about 1000.
- the mixed population of random nucleic acid fragments are denatured to form single-stranded nucleic acid fragments and then reannealed. Only those single- stranded nucleic acid fragments having regions of homology with other single- stranded nucleic acid fragments will reanneal.
- the random nucleic acid fragments may be denatured by heating. One skilled in the art could determine the conditions necessary to completely denature the double stranded nucleic acid.
- the temperature is from 80°C to 100°C.
- Nucleic acid fragments may be reannealed by cooling.
- the temperature is from 20°C to 75°C.
- Renaturation can be accelerated by the addition of polyethylene glycol ("PEG”) or salt.
- PEG polyethylene glycol
- the salt concentration is preferably from 0 mM to 200 mM.
- the annealed nucleic acid fragments are next incubated in the presence of a nucleic acid polymerase and dNTP's (i.e. dATP, dCTP, dGTP and dTTP).
- the nucleic acid polymerase may be the Klenow fragment, the Taq polymerase or any other DNA polymerase known in the art.
- the polymerase may be added to the random nucleic acid fragments prior to annealing, simultaneously with annealing or after annealing.
- the cycle of denaturation, renaturation and incubation in the presence of polymerase is repeated for a desired number of times.
- the cycle is repeated from 2 to 50 times, more preferably the sequence is repeated from 10 to 40 times.
- the resulting nucleic acid is a larger double-stranded polynucleotide of from about 50 bp to about 100 kb and may be screened for expression and altered activity by standard cloning and expression protocol. (Manatis supra). Description of the Preferred Embodiments
- the present invention relates to the isolation of genes encoding enzymes useful for the conversion of cyclododecanone to dodecanoic diacid.
- the relevant genes were isolated from a Rhodococcus ruber SCI which was cultured from an industrial waste stream. Colonies that had the ability to grow on cyclododecanone as a sole carbon source were selected for further study.
- the clyclododecanone monooxygenase was isolated and purified from the Rhodococcus ruber SCI strain on the basis of a substrate-dependent NADPH oxidation assay. Following purification the N-terminal sequence of the protein was determined by standard peptide sequencing methods.
- the gene was recovered from the isolated Rhodococcus ruber SCI genome in a cosmid. Sequencing of the cosmid revealed the gene sequence of the monooxygenase and the other associated ORF's encoding the remaining dodecanoic diacid synthesizing enzymes (ORF's 2-6). All the relevant ORF's resided on a 10 kb portion of the cosmid and the entire 10 kb region was sequenced.
- BLAST family of programs which can be used for database similarity searches.
- the family includes BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences.
- BLASTN for nucleotide query sequences against nucleotide database sequences
- BLASTP protein query sequences against protein database sequences
- TBLASTN protein query sequences against nucleotide database sequences
- TBLASTX for nucleotide query sequences against nucleotide database sequences.
- Rhodococcus ruber SCI was isolated from enrichment of activated sludge obtained from an industrial wastewater treatment facility.
- Escherichia coli XLl-BlueMR and SuperCos 1 cosmid vector were purchased as part of the SuperCos 1 Cosmid Vector Kit from Stratagene (La Jolla, CA).
- pBluescript SK(+) vector was also purchased from Stratagene.
- Shot-gun cloning vector pUC18 treated with Smal/BAP was purchased from GIBCO/BRL. Growth Conditions:
- Bacterial cells were usually grown in Luria-Bertani medium containing 1% of bacto-tryptone, 0.5% of bacto-yeast extract and 1% of NaCl unless otherwise indicated below.
- Synthetic S12 medium was used to establish enrichment.
- S12 medium contains the following: 10 mM ammonium sulfate, 50 mM potassium phosphate buffer (pH 7.0), 2 mM MgCl 2 , 0.7 mM CaCl 2 , 50 ⁇ M MnCl 2 , 1 ⁇ M FeCl 3 , 1 ⁇ M ZnCl 3 , 1.72 ⁇ M CuSO 4 , 2.53 ⁇ M CoCl 2 , 2.42 ⁇ M Na 2 MoO 2 , and 0.0001% FeSO
- the carbon sources were added directly to the S 12 medium and the bacteria were grown in sealed culture flasks.
- S12 agar was used to test isolates that utilize compounds as the sole source of carbon and energy.
- S12 agar was prepared by adding 1.5% Noble agar (DIFCO) to S12 medium. Bacteria growing on S12 agar were supplied with volatile compounds such as cyclododecanone by sprinkling solids of the volatile compound on the interior of the petri dish lid or 5 ⁇ l of other volatile liquid as vapor. The petri dish was sealed with parafilm and incubated with the lid on the bottom.
- DIFCO Noble agar
- the standard M9 minimal medium was used to assay for dodecanoic diacid and/or intermediates production from recombinant E. coli clones.
- the M9 medium consisted of 42.3 mM Na 2 HPO 4 , 22.1 mM KH 2 PO 4 , 8.6 mM NaCl, 18.7 mM NH 4 C1, 2 mM MgSO 4 , 0.1 mM CaCl 2 . 0.4% of glucose was used as the carbon source. 250 mg/1 of cyclododecanone was added as the substrate for bioconversion. Construction of Rhodococcusr Cosmid Library:
- Rhodococcus ruber SCI was grown in 25 mL LB medium till mid-log phase at 37°C with aeration. Bacterial cells were centrifuged at 6,000 rpm for 10 min in a Sorvall RC5C centrifuge at 4°C. Supernatant was decanted and cell pellet was frozen at -80°C. Chromosomal DNA was prepared as outlined below with special care taken to avoid shearing of DNA. The cell pellet was gently resuspended in 5 mL of 50 mM Tris- 10 mM EDTA (pH 8) and lysozyme was added to a final concentration of 2 mg/mL. The suspension was incubated at 37°C overnight.
- Sodium dodecyl sulfate was then added to a final concentration of 1% and proteinase K was added at 100 ⁇ g/mL final concentration.
- the suspension was incubated at 55°C for 5 h. The suspension became clear and the clear lysate was extracted with equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). After centrifuging at 17,000g for 20 min, the aqueous phase was carefully removed and transfered to a new tube. Two volumes of ethanol were added and the DNA was gently spooled with a sealed glass pasteur pipet. The DNA was dipped into a tube containing 70% ethanol.
- DNA was resuspended in 400 ⁇ l of TE (10 mMTris-1 mM EDTA, pH 8) with RNaseA (100 ⁇ g/mL) and store at 4°C. The concentration and purity of DNA was determined spectrophotometrically by OD260/OD280. A diluted aliquot of DNA was run on a 0.5% agarose gel to determine the intact nature of DNA. Chromosomal DNA was partially digested with Sau3 Al (GIBRO/BRL,
- DNA (10 ⁇ g) was digested with 0.5 unit of Sau3AI at room temperature in 100 ⁇ l of reaction volume. Aliquotes of 20 ⁇ l were withdrawn at various time points of the digestion: e.g., 0, 3, 6, 9, 12 min. DNA loading buffer was added and samples were analyzed on a 0.5% agarose gel to determine the extent of digestion. A decrease in size of chromosomal DNA corresponded to an increase in the length of time for Sau3AI digestion. The larger scale preparative reaction was performed using 50 ⁇ g of DNA digested with 1 unit of Sau3AI for 3 min. at room temperature.
- the digestion was terminated by addition of EDTA to 8mM final concentration.
- the DNA was extracted once with phenol: chloroform ⁇ soamyl alcohol and once with chloroform. The aqueous phase was adjusted to 0.3 M NaOAc and ethanol precipitated.
- the partially digested DNA was dephosphorylated with calf intestinal alkaline phosphatase (Gibco/BRL) and ligated to SuperCos 1 vector, which had been treated according to the instructions in the SuperCos 1 Cosmid Vector Kit.
- the ligated DNA was packaged into lambda phage using Gigapack III XL packaging extract recommended by Stratagene. Manufacturer's instructions were followed.
- the packaged Rhodococcus genomic DNA library contained a phage titer of 1 x 10 5 colony forming units per ⁇ g of DNA as determined by transfecting E. coli XL 1 -Blue MR (Stratagene). Cosmid DNA was isolated from twelve randomly chosen E. coli transformants and found to contain large insert of DNA (30-40kb). Construction of Shot-gun Sequencing Library: Cosmid DNA with large DNA insert was sheared in a nebulizer (Inhalation
- Bacterial strains that could grow on cyclododecanone as the sole source of carbon and energy were isolated. Analysis of 16s rRNA gene sequences indicated that the collection of isolates belong to the the bacterial genus Rhodococcus. Bacterial strains that grew on cyclododecanone were isolated from an enrichment culture. The enrichment culture was established by inoculating 1 mL of activated sludge into 20 mL of S12 medium in a 125 mL screw-cap Erlenmeyer flask. The activated sludge was obtained from a wastewater treatment facility.
- the enrichment culture was supplemented with flakes of cyclododecanone, added directly to the culture medium and was incubated at 35°C with reciprocal shaking.
- the enrichment culture was maintained by adding cyclododecanone flakes every 4-6 days.
- the culture was diluted every 5-11 days by replacing 18 mL of the culture with the same volume of S12 medium. After 24 days of incubation, 100 ⁇ l of the enrichment culture was spread onto S12 plates with cyclododecanone as the carbon source.
- Bacteria that grew on the S12/cyclododecanone plates were purified by streaking onto R2A agar media (DIFCO Laboratory, Detroit, MI). A single colony, designated as SCI, was isolated and it was able to grow on S12 liquid with cyclododecanone as the sole carbon and energy source.
- Strain SCI was typed using 16s rRNA gene sequence analysis as follows. SCI was grown on R2A agar. Several colonies from the plate were suspended in 200 ⁇ l of TE+ RNase and 0.1 mg/mL of lysozyme, and incubated 37°C for 4 hrs. To this mixture Proteinase K and SDS were added to final concentration of 50 ⁇ g/mL of and 0.5%, respectively. The mixture was extracted with phenol/chloroform and precipitated with sodium acetate and ethanol.
- the 16s rRNA gene sequences in the suspension were amplified by PCR by using a commercial kit according to the manufacturer's instructions (Perkin Elmer, Norfolk, CT) with JCR14 primer ACGGGCGGTGTGTAC (SEQ ID NO: 16) and JCR15 primer GCCAGCAGCCGCGGTA (SEQ ID NO: 17).
- PCR was performed in a Perkin Elmer GeneAmp 9600. The samples were incubated for 5 min at 94°C and then cycled 35 times at 94°C for 30 sec, 55°C for 1 min and 72°C for 1 min.
- the amplified 16s rRNA genes were purified using a QIAquick PCR Purification Kit according to the manufacturer's instructions (Qiagen, Valencia, CA) and sequenced on an automated ABI sequencer.
- the 16s rRNA gene sequence of strain SCI was used as the query sequence for a BLASTN search (Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI- BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.
- the isolate has close homology to Rhodococcus ruber, and designated as R. ruber strain SC 1.
- Rhodococcus ruber SCI isolated from cyclododecanone (C12 cyclic ketone) enrichment culture was also tested for growth on cyclic ketones of different carbon numbers as sole carbon and energy source (Table 3). It grows well on cyclopentadecanone (C15 cyclic ketone), cyclotridecanone (C13 cyclic ketone), cyclododecanone (C12 cyclic ketone) and cycloundecanone (Cl 1 cyclic ketone). It grows moderately well on cyclodecanone (CIO cyclic ketone). It does not grow on cyclooctanone (C8 cyclic ketone), cycloheptanone (C7 cyclic ketone) and cyclohexanone (C6 cyclic ketone).
- the above cell paste was suspended in 40 mL of 50 mM Na-HEPES buffer (N-2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid, pH 7.5). About two mg of lysozyme was added, and the suspension was kept at 0°C for 0.5 to 2 h. 0.2 mL of PMSF stock solution (phenylmethylsulfonyl fluoride, 0.1 M in ethanol) was added and the suspension was passed seven times through a French press at 16000 psi. PMSF was added again as before, and the extract was centrifuged (9000 x g, 20 min). The supernatant was set aside as the crude cell extract.
- Na-HEPES buffer N-2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid, pH 7.5.
- the pellet was suspended in 20 mL of HB buffer (50 mM Na-HEPES, pH 7.5, + 10 mM 2-mercaptoethanol), and centrifuged as before.
- HB buffer 50 mM Na-HEPES, pH 7.5, + 10 mM 2-mercaptoethanol
- the crude cell extracts were combined, diluted with HB to 250 mL, and applied to Pharmacia Q-Sepharose fast flow column (column volume: 100 mL in HB, run at 4°C).
- the column was washed with HB (100 mL) and eluted with a linear NaCl gradient (0 to 0.7 M NaCl in HB, 500 mL each with 2.4 mL/min flow rate).
- Activity of fractions were determined by NADPH oxidation assay.
- Active fractions were pooled (typically -40 mL) and diluted with HB (total volume -200 mL), and applied to an Amicon Matrex Red A agarose column (column volume: 5 mL in HB, run at 4°C, Beverly, MA).
- the red agarose affinity column is designed for enzymes requiring NADPH as cofactor [Branchaud and Walsh, J. Am. Chem. Soc. 107, 2153-2161 (1985)].
- the column was washed with 15 mL of HB, and monoxygenase was eluted with 25 mL of NADPH (0.1 mM).
- NADPH oxidation (340 nm, 6.22 mM)in a mixture of 0.2 mL of enzyme + buffer (0.1 M glycine-NaOH, pH 8.8) without substrate was recorded using a spectrophotometer.
- the cyclododecanone monooxygenase enzyme was usually assayed by cyclododecanone-dependent NADPH oxidation as described previously.
- the product of the reaction which is the lauryl lactone converted from cyclododecanone by the purified enzyme was also confirmed by GC/MS, as follows. Enzyme purified from the red agarose column was depleted of NADPH by repeated concentration and dilution cycles, using HB buffer and a Centricon-30 (Amicon).
- Cyclododecanone (800 nmol, 146 ⁇ g) in n-propanol was taken close to dryness in a 1 mL cuvette, diluted with 0.94 mL HB buffer, and supplemented with NADPH (36 ⁇ l of 11 mM stock). Twenty microliter of enzyme was added (5.8 mg/mL stock, determined using the Bio-Rad protein assay). After 20 min, the A 4 ⁇ had decreased to about 1/4 of its initial value. Additional NADPH (18 ⁇ l of 1 ImM stock) was added at 20 min and at 1 h. At 90 min, the pH was adjusted to -3 using the color of added bromophenol blue as a guide, and octadecane
- SEQ ID: 14 was obtained.
- protein was further purified by Reverse Phase-HPLC and 1 mg of protein was recovered from the HPLC purification. The recovered protein was dried, dissolved in 100 ⁇ l 10% formic acid containing 3 mg CNBr, and digested overnight.
- SDS gel loading buffer 50 ⁇ l was added, plus enough 0.1 M Tris-Cl, pH 8, to bring the pH above 6. The volume was then reduced in a Centricon-10 concentrator (Amicon), and used for SDS-PAGE and electroblotting for N-terminal sequencing of one of the most prominent CNBr fragment bands.
- the internal amino acid sequence of the ERIRARVDEIG (SEQ ID: 15) was obtained and used to design degenerate primer for PCR amplification of portion of the cyclododecanone monooxygenase gene.
- EXAMPLE 3 Cloning Of Cyclododecanone Monooxygenase Gene From Rhodococcus Ruber SCI Reverse genetics strategy was employed for the cloning of cyclododecanone monooxygenase gene. Partial amino acid sequences were obtained from the purified enzyme as described above.
- TTSIDREALRRKYAEERDKR SEQ ID NO: 14
- ERIRARVDEIG SEQ ID NO: 15
- PCR was carried out as follows: one cycle of 94°C for 5 min, 35 cycles of 94°C for 1 min, 30°C for 1 min and 72°C for 30 sec followed by 1 cycle of
- the PCR products obtained ranged from about 300 bp to 800 bp.
- the mixture of PCR products was cloned into the pCR2.1-TOPO cloning vector following manufacturer's instruction (Invitrogen, Carlsbad, CA). About 20 clones were sequenced using the standard Ml 3 forward (-20) primer and the Ml 3 reverse primer from the vector.
- Ml 3 forward (-20) primer primer and the Ml 3 reverse primer from the vector.
- One of the clones containing a insert of 556 bp had significant homology to cyclohexanone monooxygenase from Acinetobacter sp. NCIB9871 [Chen et al., J. Bacteriol.
- the cosmid library of Rhodococcus SCI was screened using specific primers designed based on the sequence of the amplified N terminal DNA fragment of cyclododecanone monooxygenase gene from degenerate PCR.
- Two primers, C12 MO TOP: ATGCAGAGGAGCGGGACAAG (SEQ ID NO:20) and C12 MO BOTTOM: ACTTCGGTGTGGAACAGCGC (SEQ ID NO:21) amplified the 430 bp of N terminal fragment of cyclododecanone monooxygenase gene.
- the cosmid library was screened by PCR using C12 MO TOP and C12 MO BOTTOM primers.
- a %Identity is defined as percentage of amino acids that are identical between the two proteins.
- %Similarity is defined as percentage of amino acids that are identical or conserved between the two proteins.
- the Expect value estimates the statistical significance of the match, specifying the number of matches, with a given score, that is expected in a search of a database of this size absolutely by chance.
- EXAMPLE 5 Production Of 12-Hydroxyl Lauric Acid And 1,12 Dodecanoic Diacid By E. Coli Cosmid Clones
- Six E. coli cosmid clones containing the 10 kb fragment including 25 cyclododecanone monooxygenase gene were grown in M9 minimal medium supplemented with 0.4% glucose as the carbon source. Cells were grown at 30°C with shaking to OD6 ⁇ o of 0.2 and cyclododecanone dissolved in ethanol was added to each culture to a concentration of 250 mg/L. Cells were further incubated at 30°C for 20 h. Control culture consisted of the host strain 30 transformed with the SuperCos vector only was grown under the same conditions.
- Quantitation experiment was performed by GC analysis with three representatives of the cosmid clones S8C, D12D O8E and the vector control using a DB-5 column (30 m x 0.32 mm i.d. with a 1 ⁇ m coating, J &W Scientific). The temperature was programmed to begin at 50°C for 5 min, ramp to 310°C at 10°C/min and hold at 310°C for 5 min. The injector was at 125°C and the flame ionization detector was at 320°C. The retention time of the peaks was compared to that of the 12-hydroxy lauric acid or DDDA authentic standard. The quantitation result based on the peak area calculation was summarized in Table 2.
- Primer KKl CCCCAAGCTTGAACCCAGCCCCTGCAAGAT (SEQ ID NO:22) and primer KK2: GGACTAGTTCAGTTCGAGCATCAGCCGCGG (SEQ ID NO:23) was used to amplify a 4243 bp fragment containing the cddA and cddB genes plus 1072 bp upstream and 101 bp downstream region.
- PCR product was digested with H dIII and Spel and cloned into H dIII and Spel sites of pBluescript SK(+) to construct pDCQ5.
- pDCQ5 the cddAB genes was in the opposite orientation as the lacZ gene on the vector.
- a similar construct pDCQ6 was made using primer KK3: GGACTAGTGAACCCAGCCCCTGCAAGAT (SEQ ID NO:24) and primer KK4: CCCCAAGCTTGTAGGAGAGTGCACCCTGGA (SEQ ID NO:25), which placed cddA and B genes in the same orientation as the lacL gene.
- cosmid S8C produced 12-hydroxy lauric acid in E.
- coli suggested that either the promoter for cddA and cddB genes functions in E. coli or there is a fortuitous E. coli promoter present upstream of the cddA and B genes that drives the expression of the cdd AB genes.
- the 1 kb upstream region on pDCQ5 or pDCQ6 presumably contains the promoter needed to express cddA and B genes in E. coli.
- pDCQ5 and pDCQ6 were transformed into E. coli XLlBlueMR cells for bioconversion analysis. Two clones of each construct were chosen to grow in M9+glucose medium with cyclododecanone as substrate.
- EXAMPLE 7 Production Of Lauryl Lactone By Hydrolase Deletion Mutant Conversion of cyclododecanone to lauryl lactone by cyclododecanone monooxygenase was demonstrated in vitro using purified enzyme as illustrated in Example 2. To demonstrate lauryl lactone could be produced and accumulated as an intermediate in vivo, E. coli strains containing only cyclododecanone monooxygenase gene cddA by deleting the downstream hydrolase gene cddB were constructed.
- the cddB hydrolase gene was deleted from pDCQ5 by isolating and self-ligating the 5.9 kb Klenow filled BgKl-Xbal fragment containing the vector and cddA gene away from the 1.3 kb fragment containing cddB gene.
- the cddB esterase gene was deleted from pDCQ6 by isolating and self-ligating the 5.9 kb Klenow filled Z?g/II-H dIII fragment containing the vector and cddA gene away from the 1.3 kb fragment containing cddB gene.
- pDCQ7 and pDCQ8 were verified by restriction digests and retransformed into XLlBlueMR cells (Stratagene) for intermediates analysis by HPLC and GC/MS.
- Two isolates of each construct pDCQ7 or pDCQ8 were grown in the presence of cyclododecanone as described previously. 100 uL of unconcentrated supernatants were taken for HPLC analysis.
- the pellets were extracted with 10 mL of acetonitrile and 100 uL of the pellet extracts were also analyzed by HPLC.
- the HPLC system used was a Hewlett-Packard 1100 series with a Photodiode array detector. Wavelength of 220 nm was used for detection.
- a Zorbax reverse phase C18 column (4.6 mm x 25.0 cm) was purchased from Agilent Technologies (Palo Alto, CA). The column temperature was 30.0°C and the flow rate was 1.0 mL/min. The isocratic mobile phase was 75% acetonitrile and 25%» water. The retention time of the experimental samples were compared to that of the lauryl lactone authentic standard (Aldrich). Lauryl lactone was detected in the pellet extracts for both pDCQ8 clones, but not in any pDCQ7 clones, consistent with the expression interference observed in pDCQ5 (Example 6), from which pDCQ7 was derived. No lauryl lactone was detected in any supernatant.
- Example 8 explores whether the cyclic substrates could be expanded to cyclic ketones of different chain length and whether corresponding hydroxy acids could be produced.
- S8C was grown as described above except that different cyclic ketones were added.
- Cyclohexanone (C6), cycloheptanone (C7), cyclooctanone (C8), cyclodecanone (CIO), cycloundecanone (Cl 1), cyclododecanone (C12), cyclotridecanone (C13) and cyclopentadecanone (C15) were added as substrates at 250 mg/L concentration. Identification of the corresponding hydroxy acids produced was performed by GC/MS analysis as described above.
- Rhodococcus .ruber SC 1 to grow on cyclic ketones of C 11 -C 15 was likely due to the relatively broad substrate specificity of the single set of monooxygenase and esterase encoded on S8C clone (Table 3). It is possible that mixture of the large cyclic ketones may be used as substrates in a biotransformation to produce a mixture of long chain hydroxy acids or diacids for certain applications.
- cddA-N ATGACGACGAGCATCGACCG (SEQ ID NO:38)and cddA-C: TCAGCGGAAGGTGAGGCCGTCG (SEQ ID NO:39 ) were designed to amplify the 1812 bp full length of cddA gene from ATG start codon to TGA stop codon.
- the amplified cddA gene was cloned into pTrcHis2 TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and transformed into TOP 10 competent cells (Invitrogen).
- the ampicillin resistant transformants were first screened for the presence of the insert. They were also digested with EcoRI to check the insert orientation. Three clones designated pDCQ9, two of them (#2 and #5) in the forward orientation and the other one (#3) in the reverse orientation, were chosen for further protein expression analysis.
- the cells were diluted from fresh overnight culture and growing in LB with ampicillin at 37°C for about 3 hours. Each culture was divided into two tubes, one induced with 1 mM IPTG and one not induced. They were further incubated for 2 hours at 37°C. Cells from 1 mL of each sample were pelleted and resuspended in SDS sample buffer (BIO-RAD, Hercules, CA). The samples were boiled for 5 min and spun at 14,000 g for 10 min. The supernatants were loaded onto 8-16%) gradient Tris-Glycine polyacrylamide gel (FMC BioProducts, Rockland, ME). Overexpression of a protein at the expected molecular weight
- Phenylmethanesulfonyl fluoride (PMSF, 200 ⁇ l of 0.1 M in ethanol stock) was added, and the cells were passed through a French press at 16,000 psi. A second portion of PMSF was added, and cell debris was removed by centrifugation. The extract was applied to a 25 mL column of Q-Sepharose fast flow (Pharmacia) in HB, and the column was washed with 40 mL HB. The column was eluted with a gradient (250 mL total volume) from 0 to 0.7 M NaCl in HB. Active fractions, which were bright yellow in color, were pooled and diluted to 200 mL in HB.
- PMSF Phenylmethanesulfonyl fluoride
- the pool was applied to a 60 mL column of Amicon Matrex Red A agarose, and followed with 60 mL of HB. Approximately 30 mg of homogeneous enzyme was eluted from the column with 200 mL 100 ⁇ M NADPH in HB.
- the yield of purified enzyme from the recombinant E: coli strain (6 mg of enzyme/g of cell paste) was much higher than the 20 ⁇ g of enzyme/g of cells yield from the native Rhodococcus strain.
- Activity of the enzyme purified from E. coli was also demonstrated using the cyclododecanone-dependent NADPH oxidation assay as described previously.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP00986303A EP1235911A2 (en) | 1999-12-10 | 2000-12-08 | Genes involved in cyclododecanone degradation pathway |
US10/129,518 US20030215930A1 (en) | 2000-12-08 | 2000-12-08 | Genes involved in cyclododecanone degradation pathway |
CA002389789A CA2389789A1 (en) | 1999-12-10 | 2000-12-08 | Genes involved in cyclododecanone degradation pathway |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US17021499P | 1999-12-10 | 1999-12-10 | |
US60/170,214 | 1999-12-10 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001042436A2 true WO2001042436A2 (en) | 2001-06-14 |
WO2001042436A3 WO2001042436A3 (en) | 2001-11-01 |
Family
ID=22619017
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/033426 WO2001042436A2 (en) | 1999-12-10 | 2000-12-08 | Genes involved in cyclododecanone degradation pathway |
Country Status (4)
Country | Link |
---|---|
US (2) | US6632650B1 (en) |
EP (1) | EP1235911A2 (en) |
CA (1) | CA2389789A1 (en) |
WO (1) | WO2001042436A2 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003025164A2 (en) * | 2001-09-19 | 2003-03-27 | National Research Council Of Canada | A gene encoding cyclododecanone monooxygenase |
WO2007128496A3 (en) * | 2006-05-09 | 2008-02-21 | B R A I N Ag | A group of esterases for the enantioselective production of fine and speciality chemicals |
WO2016070206A3 (en) * | 2014-11-07 | 2016-07-21 | Erber Aktiengesellschaft | Polypeptide for the enzymatic detoxification of zearalenone, isolated polynucleotide, and associated additive, use and method |
EP3878953A4 (en) * | 2018-11-05 | 2022-08-10 | Asymchem Laboratories (Tianjin) Co., Ltd. | Monooxygenase mutant and application thereof |
US12098394B2 (en) | 2018-11-05 | 2024-09-24 | Asymchem Laboratories (Tianjin) Co., Ltd. | Monooxygenase mutant and use thereof |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7481940B2 (en) * | 2005-08-18 | 2009-01-27 | Newbio E-Systems, Incorporated | Biomass treatment of organic waste or water waste |
JP5291367B2 (en) * | 2008-03-26 | 2013-09-18 | 第一ファインケミカル株式会社 | New hydrolase |
CA2765849A1 (en) | 2009-07-02 | 2011-01-06 | Verdezyne, Inc. | Biological methods for preparing adipic acid |
US8343752B2 (en) | 2011-05-03 | 2013-01-01 | Verdezyne, Inc. | Biological methods for preparing adipic acid |
US8728798B2 (en) | 2011-05-03 | 2014-05-20 | Verdezyne, Inc. | Biological methods for preparing adipic acid |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5238816A (en) * | 1989-07-24 | 1993-08-24 | Asahi Kasei Kogyo Kabushiki Kaisha | Omega carboxyalcohol oxidase enzyme |
US5851810A (en) * | 1995-06-05 | 1998-12-22 | Albert Einstein College Of Medicine Of Yeshiva University, A Division Of Yeshiva University | Nucleic acid encoding rhodococcus phenylalanine dehydrogenase |
-
2000
- 2000-12-08 US US09/732,615 patent/US6632650B1/en not_active Expired - Fee Related
- 2000-12-08 EP EP00986303A patent/EP1235911A2/en not_active Withdrawn
- 2000-12-08 CA CA002389789A patent/CA2389789A1/en not_active Abandoned
- 2000-12-08 WO PCT/US2000/033426 patent/WO2001042436A2/en not_active Application Discontinuation
-
2002
- 2002-10-17 US US10/273,051 patent/US6797500B2/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5238816A (en) * | 1989-07-24 | 1993-08-24 | Asahi Kasei Kogyo Kabushiki Kaisha | Omega carboxyalcohol oxidase enzyme |
US5851810A (en) * | 1995-06-05 | 1998-12-22 | Albert Einstein College Of Medicine Of Yeshiva University, A Division Of Yeshiva University | Nucleic acid encoding rhodococcus phenylalanine dehydrogenase |
Non-Patent Citations (4)
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003025164A2 (en) * | 2001-09-19 | 2003-03-27 | National Research Council Of Canada | A gene encoding cyclododecanone monooxygenase |
WO2003025164A3 (en) * | 2001-09-19 | 2003-05-30 | Ca Nat Research Council | A gene encoding cyclododecanone monooxygenase |
US7217559B2 (en) | 2001-09-19 | 2007-05-15 | National Research Council Of Canada | Gene encoding cyclododecanone monooxygenase |
US7425434B2 (en) | 2001-09-19 | 2008-09-16 | National Research Council Of Canada | Gene encoding cyclododecanone monooxygenase |
WO2007128496A3 (en) * | 2006-05-09 | 2008-02-21 | B R A I N Ag | A group of esterases for the enantioselective production of fine and speciality chemicals |
US9193961B2 (en) | 2006-05-09 | 2015-11-24 | B.R.A.I.N. Ag | Polynucleotides encoding enantioselective carboxylesterases and methods of making same |
WO2016070206A3 (en) * | 2014-11-07 | 2016-07-21 | Erber Aktiengesellschaft | Polypeptide for the enzymatic detoxification of zearalenone, isolated polynucleotide, and associated additive, use and method |
US11136561B2 (en) | 2014-11-07 | 2021-10-05 | Erber Aktiengesellschaft | Polypeptide for the enzymatic detoxification of zearalenone, isolated polynucleotide, and associated additive, use and method |
EP3878953A4 (en) * | 2018-11-05 | 2022-08-10 | Asymchem Laboratories (Tianjin) Co., Ltd. | Monooxygenase mutant and application thereof |
US12098394B2 (en) | 2018-11-05 | 2024-09-24 | Asymchem Laboratories (Tianjin) Co., Ltd. | Monooxygenase mutant and use thereof |
Also Published As
Publication number | Publication date |
---|---|
WO2001042436A3 (en) | 2001-11-01 |
US6632650B1 (en) | 2003-10-14 |
US20030157673A1 (en) | 2003-08-21 |
US6797500B2 (en) | 2004-09-28 |
EP1235911A2 (en) | 2002-09-04 |
CA2389789A1 (en) | 2001-06-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7105296B2 (en) | Genes encoding Baeyer-Villiger monooxygenases | |
US7049115B2 (en) | Genes encoding denitrification enzymes | |
US7195898B2 (en) | Method for the production of p-hydroxybenzoate in species of pseudomonas and agrobacterium | |
EP2024501B1 (en) | Improved production of sphingoid bases using genetically engineered microbial strains | |
US7785837B2 (en) | Production of 3-hydroxypropionic acid using beta-alanine/pyruvate aminotransferase | |
US20070031951A1 (en) | Method for the production of resveratrol in a recombinant bacterial host cell | |
US6908992B2 (en) | Methanotrophic carbon metabolism pathway genes and enzymes | |
US6797500B2 (en) | Genes involved in cyclododecanone degradation pathway | |
EP1358333B1 (en) | Gene encoding the gumd polypeptide from methylomonas sp. involved in exopolysaccharide production | |
US20030215930A1 (en) | Genes involved in cyclododecanone degradation pathway | |
US7057030B2 (en) | Rhodococcus gene encoding aldoxime dehydratase | |
JP2003502021A (en) | Epoxide hydrolase of Aspergillus origin | |
US20030077768A1 (en) | Use of xylene monooxygenase for the oxidation of substituted polycyclic aromatic compounds | |
US20030073206A1 (en) | Use of xylene monooxygenase for the oxidation of substituted monocyclic aromatic compounds | |
US6429003B1 (en) | Genes encoding denitrification enzymes | |
AU2002324821A1 (en) | Genes encoding baeyer-villiger monooxygenases | |
KR20100088820A (en) | A novel nitrilase and cyano carboxylic acid production using the said enzyme | |
JPH1075782A (en) | Gene encoding new delta 9 unsaturation forming enzyme and yeast containing the same gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): CA US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): CA US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2389789 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000986303 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000986303 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10129518 Country of ref document: US |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000986303 Country of ref document: EP |