WO2001007602A2 - Oligonukleotide zur inhibierung der expression von humanem eg5 - Google Patents

Oligonukleotide zur inhibierung der expression von humanem eg5 Download PDF

Info

Publication number
WO2001007602A2
WO2001007602A2 PCT/EP2000/007345 EP0007345W WO0107602A2 WO 2001007602 A2 WO2001007602 A2 WO 2001007602A2 EP 0007345 W EP0007345 W EP 0007345W WO 0107602 A2 WO0107602 A2 WO 0107602A2
Authority
WO
Grant status
Application
Patent type
Prior art keywords
seq id
oligonucleotide
derivative
eg5
according
Prior art date
Application number
PCT/EP2000/007345
Other languages
English (en)
French (fr)
Other versions
WO2001007602A3 (de )
Inventor
Eugen Uhlmann
Beate Greiner
Eberhard Unger
Gislinde Gothe
Marc Schwerdel
Original Assignee
Aventis Pharma Deutschland Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07BGENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00Indexing scheme relating to specific properties of organic compounds
    • C07B2200/11Compounds covalently bound to a solid support
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/317Chemical structure of the backbone with an inverted bond, e.g. a cap structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/318Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
    • Y02A50/38Medical treatment of vector-borne diseases characterised by the agent
    • Y02A50/408Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa
    • Y02A50/411Medical treatment of vector-borne diseases characterised by the agent the vector-borne disease being caused by a protozoa of the genus Plasmodium, i.e. Malaria

Abstract

Die vorliegende Erfindung betrifft ein Oligonukleotid oder eines seiner Derivate, dadurch gekennzeichnet, dass es eine Sequenz aufweist, die einem bestimmten Teil einer humanen eg5 oder einer davon mutierten Form kodierenden Nukleinsäuresequenz entspricht; darüberhinaus betrifft die Erfindung ein Verfahren zur Herstellung des Oligonukleotids und dessen Verwendung.

Description

Beschreibung

Oligonukleotide zur Inhibierung der Expression von humanem eg5

Die vorliegende Erfindung betrifft ein Oligonukleotid oder eines seiner Derivate mit einer Sequenz, die einem bestimmten Teil einer Nukleinsäuresequenz, die humanes eg5 oder eine mutierte Form davon kodiert, entspricht, und die Erfindung betrifft weiterhin eine Methode zur Herstellung des Oligonukleotids und dessen Verwendung.

Während der Mitose hilft ein auf Mikrotubuli basierender Spindelapparat, die duplizierten Chromosomen gleichmäßig auf die Tochterzellen zu verteilen. Dem Kinesin verwandte Motorproteine machen einen Teil der Kräfte aus, die zum Zusammenbau der Spindel und der Aufteilung der Chromosomen erforderlich sind. Die Bildung einer bipolaren mitotischen Spindel erfordert die Aktivität vieler verschiedener Motorproteine. Eines der menschlichen, mit Kinesin verwandten Motorproteine ist humanes eg5, das mit den mitotischen Centrosomen wechselwirkt und von dem gezeigt wurde, daß es für die Bildung der bipolaren Spindel essentiell ist (Blangy et al., Celi (1995) 83, 1159). Die Mikroinjektion von spezifischen anti- human-eg5 Antikörpern blockiert die Centrosomenwanderung und bringt Zellen dazu, in der Mitose anzuhalten.

Eine andere Möglichkeit zur Blockierung der Bildung einer bipolaren Spindel wäre die Inhibierung der eg5-Expression. Ein Weg, eg5-Expression spezifisch zu inhibieren, ist die Verwendung von Antisense-Oligonukleotiden, die gegebenenfalls zur Verbesserung ihrer Eigenschaften modifiziert sein können (E. Uhimann und A. Peyman, Chemical Reviews 90, 543 (1990); S. Agrawal, TIBTECH 1996, 376). Man nimmt an, daß Antisense-Oligonukleotide sich an spezifische Sequenzen der mRNA binden, was zu einem Abbau der mRNA und/oder der Hemmung der Proteinsynthese führt.

Gegenstand der vorliegenden Erfindung ist ein Oligonukleotid oder eines seiner Derivate, das einem Teil der eg5 kodierenden Sequenz entspricht - vorzugsweise humanem eg5 oder dem eg5 eines Krankheitserregers, z.B. Plasmodium falciparum (Malaria). Vorzugsweise entspricht das Oligonukleotid 8 bis 100 Nukleotiden, besonders bevorzugt 8 bis 20 Nukleotiden der eg5 Sequenz. Das Oligonukleotid oder das Derivat davon bindet sich an die besagte Sequenz und hemmt die Bildung des eg5-Proteins. Die humane eg5-Sequenz ist veröffentlicht worden (Blangy et al., Cell (1995) 83, 1159). SEQ ID NO.: 20 zeigt ein Beispiel einer Sequenz, die humanes eg5 kodiert. SEQ ID NO.: 21 zeigt ein Beispiel einer Plasmodium falciparum eg 5-Sequenz.

Das Oligonukleotid weist vorzugsweise eine Sequenz auf, die einem Teil einer

Nukleinsäure, die humanes eg5 oder Plasmodium falciparum eg5 kodiert, entspricht. Der Begriff "entspricht" bedeutet, daß die Basensequenz des Oligonukleotids zu einem Teil einer Nukleinsäuresequenz, die eg5 kodiert (z.B. Gen, cDNA, mRNA), komplementär ist, was dem Oligonukleotid erlaubt, mit dem "Sense-Teil" der das egδ kodierenden Nukleinsäure zu hybridisieren (sich daran zu binden). Aus diesem

Grund wird es "Antisense-Oligonukleotid" genannt. In einer bevorzugten Ausführung der Erfindung ist deshalb das Oligonukleotid ein Antisense-Oligonukleotid. In einer weiteren bevorzugten Ausführung der Erfindung ist das Oligonukleotid ein Ribozym. Ein Ribozym ist eine katalytische Nukleinsäure, die mRNA spaltet. Das Ribozym ist vorzugsweise ausgewählt aus der Gruppe der Hammerhead-Ribozyme (Vaish et al., Nucleic Acids Res. (1998) 26, 5237).

Ein erfindungsgemäßes Oligonukleotid bindet an einen für die Hybridisierung geeigneten Teil der eg5-mRNA und hemmt die Bildung des eg5-Proteins. Zur Bindung an eg5-mRNA und zur Inhibierung der Expression geeignete

Oligonukleotide sind z.B. auf die Translations-Starterregion von eg5 gerichtet.

Der dem Oligonukleotid entsprechende Teil der eg5 kodierenden Nukleinsäuresequenz hat eine Länge von 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 oder mehr Nukleotiden, und das Oligonukleotid entspricht vorzugsweise einer Länge von 12 Nukleotiden oder 19 Nukleotiden einer eg5 kodierenden Sequenz. Ein erfindungsgemäßes Oligonukleotid hat also eine Länge von 10 (10mer), 11 (11 mer), 12 (12mer), 13 (13mer), 14 (14mer), 15 (15mer), 16 (16mer), 17 (17mer), 18 (18mer) oder 19 (19mer) Nukleotiden.

In einer bevorzugten Ausführung der Erfindung hat das Oligonukleotid eine Länge von 12 oder 19 Nukleotiden; solche Oligonukleotide können zum Beispiel eine der Sequenzen SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9 oder einen Teil davon aufweisen, wobei SEQ ID NO. 1 : 3-'CTTAAGGCAGTACCGCAGC-5'; 5'CGACGCCATGACGGAATTC-3' SEQ ID NO. 2: 3'-ACCACTCTACGTCTGGTAA-5'; 5'-AATGGTCTGCATCTCACCA-3' SEQ ID NO. 3: 3'-GGCAGTACCGCAGCGTCGG-5'; 5'-GGCTGCGACGCCATGACGG-3' SEQ ID NO. 4: 3'-CTTAAGGCAGTA-5'; 5'-ATGACGGAATTC-3' SEQ ID NO. 5: 3'-TAAGGCAGTACC-5'; 5'-CCATGACGGAAT-3' SEQ ID NO. 6: 3'-GGCAGTACCGCA-5'; 5'-ACGCCATGACGG-3' SEQ ID NO. 7: 3'-AGTACCGCAGCG-5'; S'-GCGACGCCATGA-S" SEQ ID NO. 8: 3'-CCGCAGCGTCGG-5'; 5'-GGCTGCGACGCC-3' SEQ ID NO. 9: 3'-GCAGCGTCGGTT-5'; 5'-TTGGCTGCGACG-3' ist.

Ganz besonders bevorzugt ist, daß das Oligonukleotid zur Verbesserung seiner Eigenschaften modifiziert ist; z.B. zur Erhöhung seiner Resistenz gegen Nukleasen bzw. um es gegen Nukleasen resistent zu machen, zur Verbesserung seiner Bindungsaffinität zu einer komplementären eg5 kodierenden Nukleinsäure, z.B. mRNA, oder um seine Aufnahme in die Zelle zu erhöhen.

Die vorliegende Erfindung betrifft deshalb vorzugsweise ein Oligonukleotid, welches eine wie oben angegebene spezifische Sequenz aufweist und welches darüber hinaus im Vergleich zu einer "natürlichen" DNA, die aus den "natürlichen" Nukleosiden Desoxyadenosin (Adenin + ß-D-2'-Desoxyribose), Desoxyguanosin (Guanin + ß-D-2'-Desoxyribose), Desoxycytidin (Cytosin + ß-D-2'-Desoxyribose) und Thymidin (Thymin + ß-D-2'-Desoxyribose ), die durch Phosphodiesterbrücken zwischen den Nukleosiden verbunden sind, besteht, eine oder mehrere chemische Modifikationen aufweist. Die Oligonukleotide können eine oder mehrere Modifikationen des gleichen Typs und/oder Modifikationen eines verschiedenen Typs enthalten; jeder Modifikationstyp kann unabhängig von den anderen aus den für die Modifizierung von Oligonukleotiden bekannten Modifikationstypen ausgewählt sein.

Die Erfindung betrifft auch Derivate der Oligonukleotide, zum Beispiel ihre Salze, insbesondere ihre physiologisch verträglichen Salze. Salze und physiologisch verträgliche Salze sind z.B. beschrieben in Remingtons Pharmaceuticals Science (1985) Mack Publishing Company, Easton, PA (Seite 1418). Derivate bezieht sich auch auf modifizierte Oligonukleotide, die eine oder mehrere Modifikationen enthalten (z.B an bestimmten Nukleotidpositionen und/oder an bestimmten Internukleosidbrücken), Oligonukleotidanaloge (z.B. Polyamid-Nukleinsäuren

(PNAs), Phosphomonoester-Nukleinsäuren (PHONAs = PMENAs), Oligonukleotid- Chimere (z.B. bestehend aus einem DNA- und einem PNA-Teil oder bestehend aus einem DNA- und einem PHONA-Teil)). Derivate bezieht sich auch auf Oligonukleotide, die Allelen und/oder mutierten Formen (Mutanten), von normalem oder natürlichem eg5 entsprechen, z.B. Allelen und/oder Mutanten von humanem eg5 (z.B. bezüglich SEQ ID NO. 20) und Allelen und/oder Mutanten von Plasmodium falciparum eg5 (z.B. in bezug auf SEQ ID NO. 21 ).

Beispiele chemischer Modifikationen sind dem Fachmann bekannt und zum Beispiel in E. Uhlmann und A. Peyman, Chemical Reviews 90 (1990) 543 und "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Hrsg., Humana Press, Totowa, USA 1993 und S.T. Crooke, F. Bennet, Ann. Rev. Pharmacol. Toxicol. 36 (1996) 107-129; J. Hunziker und C. Leuman (1995) Mod. Synt. Methods, 7, 331-417 beschrieben.

Im Vergleich zu natürlicher DNA kann zum Beispiel eine Phosphodiesterbrücke zwischen Nukleosiden, eine ß-D-2'-Desoxyriboseeinheit und/oder eine natürliche Nukleosidbase (Adenin, Guanin, Cytosin, Thymin) modifiziert bzw. ausgetauscht sein. Ein erfindungsgemäßes Oligonukleotid kann eine oder mehrere dieser Modifikationen aufweisen, wobei sich jede Modifikation im Vergleich zu einem aus natürlicher DNA bestehenden Oligonukleotid der gleichen Sequenz an einer bestimmten Phosphodiester-Internukleosidbrücke und/oder an einer bestimmten ß- D-2'-Desoxyriboseeinheit und/oder an einer bestimmten natürlichen Nukieosidbasenposition befindet.

Die Erfindung betrifft zum Beispiel ein Oligonukleotid, das eine oder mehrere Modifikationen enthält, wobei jede Modifikation unabhängig aus der folgenden Liste ausgewählt ist: a) der Austausch einer Phosphodiesterbrücke zwischen Nukleosiden, die sich am 3'- und/oder am 5'-Ende eines Nukleosids befindet, durch eine modifizierte Internukleosidbrücke, b) der Austausch einer sich an dem 3'- und/oder dem 5'-Ende eines Nukleosids befindenden Phosphodiesterbrücke durch eine Dephosphobrücke, c) der Austausch einer Zuckerphosphateinheit aus dem Zuckerphosphatgerüst durch eine andere Einheit, d) der Austausch einer ß-D-2'-Desoxyriboseeinheit durch eine modifizierte Zuckereinheit, e) der Austausch einer natürlichen Nukleosidbase durch eine modifizierte Nukleosidbase, f) die Anbindung an ein Molekül, das die Eigenschaften des Oligonukleotids beeinflußt, g) die Anbindung an ein 2'5'-verbundenes Oligoadenylat oder ein Derivativ davon, gegebenenfalls über einen geeigneten Linker, und h) die Einführung einer 3'-3' und/oder einer 5'-5'-lnversion am 3'- und/oder am 5'-Ende des Oligonukleotids.

Genauere Beispiele für die chemischen Modifikationen eines Oligonukleotids sind a) der Austausch einer Phosphodiesterbrücke zwischen Nukleosiden, die sich am 3'- und/oder am 5 '-Ende eines Nukleosids befindet, durch eine modifizierte Internukleosidbrücke, wobei die modifizierte Internukleosidbrücke zum Beispiel aus Phosphorothioat-, Phosphorodithioat-, NR1Rr-Phosphoramidat-, Boranophosphat-, Phosphat-(Cι-C2ι)-0-Alkylester-, Phosphat-[(C6-Cι2)-aryl-((C1-C2ι)-0-alkyl]ester, (CrC8)-Alkylphosphonat- und/oder (C6-C 2)-Arylphosphonatbrücken und (C7-C-ι2)-α- Hydroxymethylaryl (bekannt z.B. aus WO 95/01363) ausgewählt ist, wobei (C6-Cι2)- Aryl, (C6-C2o)-Aryl und (C6-Cι4)-Aryl gegebenenfalls durch Halogen, Alkyl, Alkoxy,

Nitro, Cyano substituiert sind, und wobei R1 und R1 unabhängig voneinander Wasserstoff, (C Cι8)-Alkyl, (C6-C2o)-Aryl,

(C6-Cι4)-Aryl-(Cι-C8)-Alkyl sind, vorzugsweise Wasserstoff, (C C8)-Alkyl, vorzugsweise (C-ι-C4)-Alkyl und/oder Methoxyethyl, oder

R1 und R1 zusammen mit dem sie tragenden Stickstoffatom einen 5- bis 6-glιedrιgen heterocyclischen Ring bilden, der zusatzlich ein weiteres Heteroatom aus der

Gruppe O, S und N enthalten kann,

b) der Austausch einer sich an dem 3'- und/oder dem 5'-Ende eines Nukleosids befindlichen Phosphodiesterbrücke durch eine Dephosphobrucke (Dephosphobrucken sind zum Beispiel in Uhlmann, E und Peyman, A in "Methods in Molecular Biology", Band 20, "Protocols for Oligonucleotides and Analogs", S Agrawal, Hrsg , Humana Press, Totowa 1993, Kapitel 16, 355ff beschrieben), wobei eine Dephosphobrucke zum Beispiel Formacetal, 3'-Thιoformacetal, Methylhydroxylamin, Oxim, Methylendimethyl-hydrazo, Dimethylensulfon und/oder eine Silylgruppe ist,

c) der Austausch einer Zuckerphosphateinheit (ß-D-2'-Desoxyπbose und die Phosphodiesterbrücke zwischen den Nukleosiden bilden zusammen eine Zuckerphosphateinheit) aus dem Zuckerphosphatgerust (das Zuckerphosphatgerust besteht aus Zuckerphosphateinheiten) durch eine andere Einheit, wobei die andere Einheit zum Beispiel zum Aufbau - eines "Morpholιnodeπvatιv"-Olιgomeren geeignet ist (wie zum Beispiel in E P

Stirchak et al., Nucleic Aαds Res 17 (1989) 6129 beschrieben ist), das heißt z.B der Austausch durch eine Morpho no-Derivativ-Einheit, einer Polyamid-Nukleinsaure ("PNA") (wie zum Beispiel in P E Nielsen et al , Bioconj Chem 5 (1994) 3 und in EP 0672677 A2 beschrieben) geeignet ist, das heißt z B der Austausch durch eine PNA-Gerusteιnheιt, z.B durch

2-Amιnoethylglycιn, einer Phosphonsauremonoester-Nukleinsaure ("PHONA") (wie z B in Peyman et al , Angew Chem Int Ed Eπgl 35 (1996) 2632-2638 und in EP 0739898 A2 beschrieben) geeignet ist; das heißt z.B. der Austausch durch eine PHONA-Gerüsteinheit; d) der Austausch einer ß-D-2'-Desoxyriboseeinheit durch eine modifizierte Zuckereinheit, wobei die modifizierte Zuckereinheit zum Beispiel aus ß-Dribose, α-D- 2'-Desoxyribose, L-2'-Desoxyribose, 2'-F-2'-Desoxyribose, 2'-0-(Cι-C6)-Alkylribose, wobei die bevorzugte 2'-0-(Cι-C6)-Alkylribose 2'-0-Methylribose ist, 2'-0-(C2-C6)- Alkenylribose, 2'-[0-(C1-C6)-Alkyl-0-(C1-C6)-alkyl]ribose, 2'-NH2-2'-Desoxyribose, ß-D-Xylo-furanose, α-Arabinofuranose, 2,4-Didesoxy-ß-D-erythro-hexo-pyranose und carbocyclischen (zum Beispiel in Froehler, J. Am. Chem. Soc. 114 (1992) 8320 beschrieben) und/oder offenkettigen Zuckeranalogen (zum Beispiel in

Vandendriessche et al., Tetrahedron 49 (1993) 7223 beschrieben) und/oder Bicydozuckeranalogen (zum Beispiel in M. Tarkov et al., Helv. Chim. Acta 76 (1993) 481 beschrieben) ausgewählt wird;

e) der Austausch einer natürlichen Nukleosidbase durch eine modifizierte Nukleosidbase, wobei die modifizierte Nukleosidbase zum Beispiel aus Uracil, Hypoxanthin, 5-(Hydroxymethyl)uracil, N2-Dimethylguanosin, Pseudouracil, 5-(Hydroxymethyl)uracil, 5-Aminouracil, Dihydrouracil, 5-Fluoruracil, 5-Fluorcytosin, 5-Chloruracil, 5-Chlorcytosin, 5-Bromuracil, 5-Bromcytosin, 2,4-Diaminopurin, 8-Azapurin, einem substituierten 7-Deazapurin, vorzugsweise 7-Deaza-7- substitutiertem und/oder 7-Deaza-8-substituiertem Purin oder anderen Modifikationen natürlicher Nukleosidbasen ausgewählt wird (modifizierte Nukleosidbasen sind z.B. in EP 0 710 667 A2 und EP 0 680 969 A2 beschrieben);

f) die Anbindung an ein Molekül, das die Eigenschaften des Oligonukleotids beeinflußt, wobei die Anbindung des Oligonukleotids an ein oder mehrere Moleküle, die die Eigenschaften des Oligonukleotids (günstig) beeinflussen (zum Beispiel die Fähigkeit des Oligonukleotids, die Zellmembran zu durchdringen bzw. in eine Zelle einzudringen, die Stabilität gegenüber Nukleasen, die Affinität für eine eg5 kodierende Targetsequenz, die Pharmakokinetik des Oligonukleotids, die Fähigkeit eines Antisense-Oligonukleotids/Ribozyms bzw. eines mit dem Oligonukleotid konjugierten Moleküls, die jeweilige eg5 kodierende Targetsequenz anzugreifen, z.B. die Fähigkeit zur Bindung und/oder zur Quervernetzung, wenn das Oligonukleotid mit der eg5 kodierenden Targetsequenz hybridisiert), wobei als Beispiele für Moleküle, die an ein Oligonukleotid angebunden werden können, Polyiysin, interkalierende Mittel wie Pyren, Acridin, Phenazin oder Phenanthridin, Fluoreszeπzmittel wie Fluorescein, Crosslinker wie Psoralen oder Azidoproflavin, lipophile Moleküle wie (Cι2-C2o)-Alkyl, Lipide wie 1 ,2-Dihexadecyl-rac-glycerin, Steroide wie Cholesterin oder Testosteron, Vitamine wie Vitamin E, Poly- oder Oligoethylenglykol, vorzugsweise über eine Phosphatgruppe (z.B. Triethylenglykolphosphat, Hexaethylenglykolphosphat) an das Oligonukleotid gebunden, (Cι2-C18)-Alkylphosphatdiester und/oder 0-CH2-CH(OH)-0-(C12-Cι8)- Alkyl in Frage kommen, diese Moleküle können am 5'-Ende und/oder am 3'-Ende und/oder innerhalb der Sequenz eingefügt werden, z.B. an einer Nukleosidbase zur Bildung eines Oligonukleotidkonjugats; Verfahren zur Herstellung eines Oligonukleotidkonjugats sind dem Fachmann bekannt und zum Beispiel in Uhlmann, E. & Peyman, A., Chem. Rev. 90 (1990) 543, M. Manoharan in "Antisense Research and Applications", Crooke and Lebleu, Hrsg., CRC Press, Boca Raton, 1993, Kapitel 17, S. 303ff. und EP-A 0 552 766 beschrieben;

g) die Anbindung an ein 2'5'-gebundenes Oligoadenylat, vorzugsweise über ein geeignetes Linkermolekül, wobei das 2'-5'-gebundene Oligoadenylat zum Beispiel aus 2'5'-gebundenem Triadenylat-, 2'5'-gebundenem Tetraadenylat-,

2'5'-gebundenem Pentaadenylat-, 2'5'-gebundenem Hexaadenyltat- oder 2'5'- gebundenem Heptaadenylatmolekülen und deren Derivativen ausgewählt ist, wobei ein 2'5'-gebundenes Oligoadenylat-Derivat zum Beispiel Cordycepin (2'5'-gebundenes 3'-Desoxyadenylat) ist und wobei zum Beispiel Triethylenglykol ein geeigneter Linker ist und wobei das 5'-Ende des 2'5'-gebundenen Oligoadenylats einen Phosphat-, Diphosphat- oder Triphosphatrest tragen muß, in dem eines oder mehrere Sauerstoffatome zum Beispiel durch Schwefelatome ersetzt sein können, wobei die Substitution durch einen Phosphat- oder Thiophosphatrest bevorzugt ist; und

h) die Einführung einer 3'-3'- und/oder einer 5'-5'-lnversion am 3'- und/oder am 5'-Ende des Oligonukleotids, wobei diese Art der chemischen Modifikation dem Fachmann bekannt und zum Beispiel in M. Koga et al., J. Org. Chem. 56 (1991 ) 3757, EP 0 464 638 und EP 0 593 901 beschrieben ist.

Der Austausch einer Zuckerphosphateinheit aus dem Zuckerphosphatgerust durch eine andere Einheit, die z.B. eine PNA-Gerüsteinheit oder eine PHONA-

Gerüsteinheit sein kann, ist vorzugsweise der Austausch eines Nukleotids durch z.B. eine PNA-Einheit oder eine PHONA-Einheit, die bereits natürliche Nukleosidbasen und/oder modifizierte Nukleosidbasen enthält, z.B. eine der modifizierten Nukleosidbasen aus der Gruppe Uracil, Hypoxanthin, 5-(Hydroxymethyl)uracil, N2- Dimethylguanosin, Pseudouracil, 5-(Hydroxymethyl)uracii, 5-Aminouracil, Pseudouracil, Dihydrouracil, 5-Fluoruracil, 5-Fluorcytosin, 5-Chloruracil, 5-Chlorcytosin, 5-Bromuracil, 5-Bromcytosin, 2,4-Diaminopurin, 8-Azapurin, einem substituierten 7-Deazapurin, vorzugsweise 7-Deaza-7-substituiertem und/oder 7-Deaza-8-substituiertem Purin oder anderen Modifikationen einer natürlichen Nukleosidbase (modifizierte Nukleotidbasen sind z.B. beschrieben in EP 0 710 667 A2 und EP 0 680 969 A2).

Auf die Oligonukleotidmodifikationen, die in EP 0 710 667 A2, EP 0 680 969 A2, EP 0 464 638, EP 0 593 901 , WO 95/01363, EP 0 672 677 A2, EP 0 739 898 A2 und EP 0 552 766 beschrieben werden, wird hiermit ausdrücklich Bezug genommen.

In einer besonderen Ausführungsform der Erfindung sind eine oder mehrere Phosphodiesterbrücken zwischen den Nukleosiden innerhalb der Oligonukleotidsequenz modifiziert; vorzugsweise sind eine oder mehrere Phosphodiesterbrücken zwischen den Nukleosiden durch Phosphorothioatbrücken zwischen den Nukleosiden und/oder (C6-Ci2)-Arylphosphonatbrücken zwischen den Nukleosiden, vorzugsweise durch α-Hydroxybenzylphosphonatbrücken, in denen die Benzylgruppe vorzugsweise substituiert ist, z.B. durch Nitro, Methyl, Halogen, ersetzt. In einem Nur-Phosphorothioat-Oligonukleotid sind alle Phosphodiesterbrücken zwischen den Nukleosiden durch Phosphorothioat modifiziert. Vorzugsweise betrifft die Erfindung ein Oligonukleotid, in dem nicht alle Phosphodiesterbrücken zwischen den Nukleosiden einheitlich mit Phosphorothioat (Phosphorothioatbrücken zwischen den Nukleosiden) modifiziert sind. Vorzugsweise weist wenigstens eine Internukleosidbrücke eine andere Modifikationsart auf, oder sie ist nicht modifiziert. Die Erfindung betrifft insbesondere ein Oligonukleotid, welches zusätzlich wenigstens eine andere Modifikationsart enthält. In einer weiteren besonderen Ausführungsform der Erfindung sind eine oder mehrere Nukleoside (ß-D-2 '-Desoxyribose und/oder Nukleosidbase) innerhalb der Oligonukleotidsequenz modifiziert; vorzugsweise ist die ß-D-2 '-Desoxyribose gegen 2'-0-(CrC6)-Alkylribose, vorzugsweise durch 2'-0-Methylribose, ausgetauscht und/oder die Nukleosidbase ist gegen 8-Azapurin, 7-Deaza-7-substituiertes Purin und/oder 7-Deaza-8-substitutiertes Purin ausgetauscht (Purin: Adenin, Guanin).Vorzugsweise betrifft die Erfindung ein Olignonukieotid, in dem nicht alle Nukleoside einheitlich modifiziert sind. Vorzugsweise betrifft die Erfindung ein Oligonukleotid, das zusätzlich wenigstens eine andere Modifikationsart enthält.

In einer weiteren besonderen Ausführungsform der Erfindung sind ein oder mehrere Zuckerphoshateinheiten aus dem Zucker-Phosphat-Gerüst durch PNA-

Gerüsteinheiten, vorzugsweise durch 2-Aminoethylglycineinheiten, ausgetauscht. Vorzugsweise sind die ausgetauschen Zuckerphosphateinheiten zumindest zu einem gewissen Grad miteinander verbunden. Vorzugsweise betrifft die Erfindung ein Oligonukleotid, in dem nicht alle Zuckerphosphateinheiten einheitlich ausgetauscht sind. Die Erfindung betrifft insbesondere chimere Oligonukleotide, z.B. solche, die aus einem oder mehreren PNA-Teilen und einem oder mehreren DNA-Teilen zusammengesetzt sind. Mögliche Beispiele für solche chimeren Oligonukleotide sind die folgenden Modifikationsmuster, die nicht dazu dienen, die Erfindung einzuschränken: DNA-PNA, PNA-DNA, DNA-PNA-DNA, PNA-DNA-PNA, DNA-PNA-DNA-PNA, PNA-DNA-PNA-DNA. Ähnliche Muster wären für aus

DNA-Teilen und PHONA-Teilen zusammengesetzte chimere Moleküle möglich, z.B. DNA-PHONA, PHONA -DNA, DNA- PHONA -DNA, PHONA -DNA- PHONA, DNA- PHONA -DNA- PHONA, PHONA -DNA- PHONA -DNA. Zusätzlich sind natürlich auch chimere Moleküle aus drei verschiedenen Teilen wie DNA-Teil(en), PHONA-Teil(en) und PNA-Teil(en) möglich. Vorzugsweise betrifft die Erfindung ein Oligonukleotid, das zusätzlich wenigstens eine andere Modifikationsart enthält. In einer weiteren besonderen Ausführungsform der Erfindung ist das 3'-Ende und/oder das 5'-Ende des Oligonukleotids mit einem (Cι2-C18)-Ali'ylrest, vorzugsweise einem Cι6-Alkylrest, einem Triethylenglykolrest oder einem Hexaethylenglykolrest verbunden - diese Reste sind vorzugsweise über eine Phosphatgruppe an das Oligonukleotid gebunden. Die Erfindung betrifft vorzugsweise ein Oligonukleotid, in dem nicht beide Enden (das 3'- und das 5 '-Ende) (gleichermaßen) modifiziert sind. Vorzugsweise betrifft die Erfindung ein Oligonukleotid, das zusätzlich wenigstens eine andere Modifikationsart enthält.

In einer bevorzugten Ausführungsform der Erfindung sind nur bestimmte Positionen innerhalb einer Oligonukleotidsequenz modifiziert (z.B. teilweise modifiziertes Oligonukleotid). Teilweise modifizierte Oligonukleotide werden in einigen Schriften auch als minimal modifizierte Oligonukleotide bezeichnet. Innerhalb der Sequenz kann eine Modifikation in bestimmten Positionen lokalisiert sein (bei bestimmten Nukleotiden, bei bestimmten Nukleosiden, bei bestimmten Nukleosidbasen, bei bestimmten Internukleosidbrücken).

In einer besonderen Ausführungsform der Erfindung wird ein teilweise modifiziertes Oligonukleotid hergestellt, indem nur einige der Phosphodiesterbrücken durch modifizierte Internukleosidbrücken, z.B. Phosphorothioatbrücken und/oder α-Hydroxybenzylphosphonatbrücken, ersetzt werden. Die Erfindung beinhaltet insbesondere solche Oligonukleotide, die nur zu einem gewissen Grad modifiziert sind.

Insbesondere betrifft die Erfindung ein Oligonukleotid, bei dem 1 bis 5 terminale Nukleotideinheiten am δ'-Ende und/oder am 3'-Ende durch die Modifikation von Internukleosidbrücken, die sich am 5'- und/oder am 3'-Ende des entsprechenden Nukleosids befinden, geschützt sind, vorzugsweise durch Austausch der Phosphodiesterbrücken zwischen den Nukleosiden durch Phosphorothioatbrücken und/oder α-Hydroxybenzylphosphonatbrücken. Ganz besonders bevorzugt sind die 1 bis 5 terminalen Nukleotideinheiten am 3'-Ende des Oligonukleotids durch modifizierte Internukleosidbrücken, die sich am 5'- und/oder am 3'-Ende der entsprechenden Nukleoside befinden, geschützt. Gegebenenfalls sind die 1 bis 5 terminalen Nukleotideinheiten am 5'-Ende des Oligonukleotids zusätzlich geschützt durch modifizierte Internukleosidbrücken, die sich am 5'- und/oder am 3'-Ende des entsprechenden Nukleosids befinden. Gegebenenfalls kann das Oligonukleotid zusätzliche Modifikationen an anderen Positionen enthalten. Darüber hinaus betrifft die Erfindung ein Oligonukleotid, bei dem wenigstens ein internes Pyrimidinnukleosid und/oder eine sich am 5'-Ende und/oder am 3'-Ende dieses Pyrimidinnukleosids (ein Nukleosid mit einer Pyrimidinbase wie Cytosin, Uracil, Thymin) befindliche Internukleosidbrücke modifiziert ist, vorzugsweise durch Austausch der Phosphodiesterbrücke(n) zwischen den Nukleosiden durch eine/mehrere Phosphorothioatbrücke(n) und/oder eine/mehrere α- Hydroxybenzylphosphonatbrücke(n).

In einer bevorzugten Ausführungsform der Erfindung sind 1 bis 5 terminale Nukleotideinheiten am 5'-Ende und/oder am 3'-Ende des Oligonukleotids durch modifizierende Internukleosidbrücken, die sich am 5'- und/oder am 3'-Ende des entsprechenden Nukleosids befinden, geschützt, wobei zusätzlich wenigstens ein internes Pyrimidinnukleosid und/oder eine sich am 5'-Ende dieses Pyrimidinnukleosids und/oder am 3'-Ende dieses Pyrimidinnukleosids befindende Internukleosidbrücke modifiziert ist.

Das Prinzip von teilweise modifizierten Oligonukleotiden ist z.B. in A. Peyman, E. Uhlmann, Biol. Chem. Hoppe-Seyler, 377 (1996) 67-70 und in EP 0 653 439 beschrieben. Auf diese Schriften wird hiermit ausdrücklich Bezug genommen. In diesem Fall sind 1-5 terminale Nukleotideinheiten am 5'-Ende und/oder am 3'-Ende geschützt, z.B. sind die Phosphodiesterbrücken zwischen den Nukleosiden, die sich am 3'- und/oder am 5'-Ende der entsprechenden Nukleoside befinden, zum Beispiel gegen Phosphorothioatbrücken zwischen Nukleosiden ausgetauscht. Zusätzlich ist vorzugsweise wenigstens eine interne Pyrimidinnukleosidposition (bzw. Nukleotidposition) modifiziert; vorzugsweise ist/sind die 3'- und/oder die 5'-lnternukleosidbrücke(n) eines Pyrimidinnukleosids modifiziert/ausgetauscht, zum Beispiel durch eine/mehrere Phosphorothioatbrücke(n) zwischen den Nukleosiden. Teilweise modifizierte Oligonukleotide weisen besonders vorteilhafte Eigenschaften auf; zum Beispiel sind sie in besonders hohem Grade stabil gegenüber Nukleasen, und dabei nur minimal modifiziert. Auch haben sie eine beträchtlich reduzierte Neigung zu non-antisense effects, die häufig mit der Verwendung von Nur- Phosphorothioat-Oligonukleotiden verbunden sind (Stein und Krieg (1994) Antisense Res. Dev. 4, 67). Teilweise modifizierte Oligonukleotide zeigen auch eine höhere Bindungsaffinität als Nur-Phosphorothioate.

Die Erfindung betrifft insbesondere teilweise/minimal modifizierte Oligonukleotide.

SEQ ID NO. 10: 3-'C*T*T*A A G G C*A G T*A C*C G*C A G*C~5\ (K3) 5'-C G A C*G*C*C*A*T G A*C G G A A*T*T*C-3';

SEQ ID NO. 11 : 3'-A*C*C*A C*T C*T A C*G T*C*T G G*T A*A-5', (K4)

5'-A*AT*GGT*C*TG*CAT*CT*CA*C*C*A-3'; SEQ ID NO. 12: 3'-G*G*C*A G*T A C*C G C*A G*C G T*C G*G-5', (K6) 5'-G*G C*T G C*G A*C G C*C A T*G A*C*G*G-3"; SEQ ID NO. 13: 3*-C*T*T*A A G G*C A G*T*A-5',

5'-A*T*G A C*G G A A*T*T*C-3'; SEQ ID NO. 14: 3'-T*A*A G G C*A G*T A*C*C-5', 5'-C*C*A T*G A*C G G A*A*T-3'; SEQ ID NO. 15: 3'-G*G*C A G*T A C*C*G C*A-5', 5'-A*C G*C*C A T*G A C*G*G-3';

SEQ ID NO. 16: 3'-A*G*T A C*C G*C A G*C*G-5*, 5'-G*C*G A C*G C*C A T*G*A-3'; SEQ ID NO. 17: 3'-C*C*G*C A G*C G T*C G*G-5', 5'-G*G C*T G C*G A C*G*C*C-3"; SEQ ID NO. 18 3'-G*C*A G C*G T*C G G*T*T-5',

5'-T*T*G G C*T G C*G A*C*G-3\

wobei " * " die Stelle einer Internukleosidbrücken-Modifikation bezeichnet; " * " ist vorzugsweise eine Phosphorothioat-Internukleosidbrücke.

Ein weiteres Beispiel einer besonderen Ausführungsform der Erfindung betrifft ein teilweise modifiziertes Oligonukleotid, bei dem ein Nukleosid modifiziert ist, z.B. eine Modifikation einer Nukleosidbase und/oder eine Modifikation einer ß-D-2 '- Desoxyriboseeinheit. Vorzugsweise ist eine ß-D-2 '-Desoxyribose gegen 2'-O-(Cι- C6)-Alkyiribose ausgetauscht, ganz besonders bevorzugt ist der Austausch gegen 2'-0-Methylribose (Austausch eines ß-D-2'-Desoxyribonukleosids gegen ein 2'-0-Methylribonukleosid).

Zusätzlich zu einer Modifikationsart kann das Oligonukleotid erfindungsgemäß auch andere Modifikationsarten aufweisen.

In einer weiteren Ausführungsform der Erfindung enthält das Oligonukleotid daher modifizierte Internukleosidbrücken an bestimmten Positionen und zusätzlich Modifikationen eines Nukleosids an bestimmten Positionen, vorzugsweise Austausch von ß-D-2 '-Desoxyribose. In einer bevorzugten Ausführungsform der Erfindung ist die Internukleosidmodifikation der Austausch einer Phosphodiesterbrücke gegen eine Phosphorothioatbrücke, und die Modifikation der ß-D-2 "-Desoxyribose ist der Austausch gegen 2'-0-Methylribose; in diesem Fall ist das Oligonukleotid ein chimeres Oligonukleotid, das aus modifizierten und nicht modifizierten DNA- und RNA-Teilen zusammengesetzt ist - welche die

2'-0-Methylribonukleoside und ß-D-2'-Desoxyribonukleoside sowie Phosphor- diester- und Phosphorothioatbrücken zwischen Nukleosiden enthalten.

Eine weitere bevorzugte Ausführungsform der Erfindung betrifft ein Oligonukleotid, das einen oder mehrere (Cι2-C-ι8)-Alkylreste aufweist, vorzugsweise einen

C16-Alkylrest an seinem 3'- und/oder seinem 5'-Ende. Ein (Cι2-C18)-Alkyirest kann z.B. als Phosphodiester gebunden sein, wie in EP 0 552 766 A2 beschrieben ist (auf EP 0 552 766 A2 wird hiermit ausdrücklich Bezug genommen), oder als 3'-Phosphodiester von 0-CH2-CH(OH)-0-(Cι2-C18)-Alkyl. Bevorzugt ist ein Oligonukleotid, bei dem ein Cι6-Alkylrest an das 3'- und/oder 5'-Ende gebunden ist.

Die Erfindung betrifft auch ein Oligonukleotid, in dem das 3'- und/oder das 5'-Ende mit einem Oligoethylenglykolrest verbunden ist, vorzugsweise einem Triethylenglykol oder einem Hexaethylenglykol, ganz besonders bevorzugt über einen Phosphodiester (Tri- oder Hexaethylenglykolphosphatester). Natürlich kann ein solches Oligonukleotid auch noch weitere Modifikationen enthalten. In einer weiteren besonderen Ausführungsform der Erfindung ist das Oligonukleotid über einen Linker mit einem 2'5'-gebundenen Oligoadenylat-5'-(thio)phosphat verbunden. Bei dem Linker kann es sich z.B. um einen Oligoethylenglykolphosphat-, vorzugsweise einen Triethylenglykolphosphat-, Tetraethylenglykolphosphat- oder Hexaethylenglykolphosphatrest, handeln. Das 2'5'-gebundene Oligoadenylat ist vorzugsweise über sein 2'-Ende als Tetra- oder als Pentaadenylat gebunden, dessen 5'-Hydroxyfunktion durch einen Phosphat- oder Thiophosphatrest substituiert ist. Es ist bekannt, daß 2'5'-Oligoadenylat RNase L induziert, die Target-mRNA zu spalten (Torrence et al., Proc. Natl. Acad. Sei. U.S.A. (1993) 90, 1300). Das 2'5'- Oligoadenylat dient dazu, Ribonuklease L (RNase L) zu aktivieren, die dann die eg5 mRNA abbaut. Anstelle eines 2'5'-gebundenen Adenylats ist es auch möglich, z.B. ein 2'5'-gebundenes 3'-Desoxyadenylat, abgeleitet von dem Nukleosidanalog Cordycepin, einzuführen. In diesem Fall ist der Oligonukleotidteil, der zur Targetnukleinsäure komplementär ist, vorzugsweise an bestimmten Positionen durch 2'-0-(Cι-C6)-Alkylribonukleosid (vorzugsweise 2'-0-Methylribonukleosid) oder durch PNA modifiziert.

Eine weitere bevorzugte Ausführungsform der Erfindung betrifft den Austausch einer oder mehrerer natürlicher Nukleosidbase(n) durch nichtnatürliche bzw. modifizierte Nukleosidbasen, vorzugsweise durch 8-Azapurine und/oder 7-Deaza-7-substituierte Purine und/oder 7-Deaza-8-substituierte Purine, wie z.B. in EP 0 171 066 und EP 0 680 969 beschrieben.

In einer weiteren bevorzugten Ausführungsform der Erfindung kann das Nukleosid 3'3'- und/oder 5'5'-lnversionen am 3'- und/oder 5'-Ende aufweisen, wie zum Beispiel in EP 0 464 638 und EP 0 593 901 beschrieben.

Eine weitere bevorzugte Ausführungsform der Erfindung betrifft den Austausch einer oder mehrerer Phosphodiesterbrücken gegen α-Hydroxybenzylphosphonatbrücken, wie in WO 95/01363 beschrieben. In einer weiteren bevorzugten Ausführungsform der Erfindung enthält das Oligonukleotid eine Modifikation des Zuckerphosphatgerüstes, vorzugsweise durch PNA-Einheiten.

Es sind auch andere Modifikationsmuster möglich, z.B. DNA-PNA-DNA, PNA-DNA. Vergleichbare Modifikationsmuster sind auch für PHONA/DNA-Chimeren möglich. Diese Modifikationsmuster können mit jeder anderen Modifikationsart kombiniert werden, und ähnliche Modifikationsmuster sind natürlich auch für andere erfindungsgemäße Oligonukleotide möglich.

Die obengenannten konkreten Oligonukleotide - bestimmte Sequenz, bestimmter Modifikationstyp/bestimmte Modifikationstypen an bestimmten Positionen (spezifisches "Modifikationsmuster") stellen nur Beispiele für verschiedene Ausführungsformen der Erfindung dar. Die Erfindung wird durch diese konkreten Oligonukleotide nicht eingeschränkt. Andere Kombinationen von Sequenz und Modifikationsmuster sind gleichfalls möglich.

Ein erfindungsgemäßes Oligonukleotid inhibiert spezifisch die Expression des Targetproteins (d.h. eg5) bzw. der Targetsequenz (einer Nukleinsäure, die eg5 kodiert, vorzugsweise eg5 mRNA). Ein erfindungsgemäßes Oligonukleotid hemmt vorzugsweise spezifisch die Expression von eg5. Dies hat eine Absenkung der eg5-Proteinkonzentration im Vergleich zu einer unbehandelten Expression zur Folge. Die Spezifität kann zum Beispiel durch die Bestimmung der Wirkung eines erfindungsgemäßen Oligonukleotids auf die eg5-Expression im Vergleich zur Wirkung desselben Oligonukleotids auf die beta-Actin-Expression auf der mRNA- und/oder der Proteinebene demonstriert werden. Nach Behandlung mit einem erfindungsgemäßen Oligonukleotid war nur die eg5-mRNA- und/oder die eg5-Proteinkonzentration reduziert, während z.B. beta-Actin-(ein Haushaltsprotein)mRNA- und/oder beta-Actin-Proteinkonzentration unverändert blieb.

Ein erfindungsgemäßes Oligonukleotid ist vorzugsweise dazu in der Lage, die Expression von eg5 in Humanzellen effektiv zu inhibieren, und/oder hat die Fähigkeit, das Wachstum von Tumoren in Wirbeltieren zu inhibieren. Ein erfindungsgemäßes Oligonukleotid reduziert vorzugsweise die eg5-mRNA- und/oder -Proteinkonzentration in Tumoren von behandelten Individuen im Vergleich zu unbehandelten Individuen. Ein erfindungsgemäßes Oligonukleotid verringert vorzugsweise die Größe eines Tumors in einem Wirbeltier, z.B. in Mäusen, im Vergleich zu unbehandelten Mäusen bzw. im Vergleich zu der vor der Behandlung bestimmten Größe des Tumors in demselben Tier.

Die Erfindung betrifft auch ein Verfahren zur Herstellung eines erfindungsgemäßen Nukleotides. Ein Herstellungsverfahren beinhaltet die chemische Synthese des Oligonukleotids. Die chemische Synthese wird vorzugsweise mittels einer für die Verwendung für die Synthese von Oligonukleotiden bekannten Standardmethode durchgeführt, z.B. der Phosphoramiditmethode nach Caruthers (1983) Tetrahedron Letters 24, 245, der H-Phosphonatmethode (Todd et al. (1957) J. Chem. Soc. 3291 ) oder der Phosphotriestermethode (Sonveaux (1986) Bioorg. Chem. 14, 274; Gait, M.J. Oligonucleotide Synthesis, A practical Approach", IRL Press, Oxford, 1984) oder verbesserten oder veränderten Methoden, die sich von diesen Standardverfahren ableiten. Ein erfindungsgemäßes Oligonukleotid kann zum Beispiel wie in Beispiel 1 beschrieben hergestellt werden. Ein erfindungsgemäßes Oligonukleotid wird vorzugsweise an einer Festphase synthetisiert, indem in geeigneterWeise geschützte Monomere (z.B. Nukleoside) kondensiert werden, um Internukleosidbrücken zwischen diesen Monomeren zu bilden. Die Erfindung betrifft z.B. ein Verfahren zur Herstellung eines Oligonukleotids oder eines Derivates davon, wobei eine Nukleotideinheit mit einer 3'- oder einer 2'-terminalen Phosphor (V)- Gruppe und einer freien 5'-Hydroxyl- oder Mercaptogruppierung mit einer weiteren Nukleotideinheit mit einer Phosphor (III)- oder einer Phosphor (V)-Gruppierung in der 3'-Position, oder deren aktivierten Derivaten, umgesetzt wird, und wobei gegebenenfalls Schutzgruppen verwendet werden, die vorübergehend in das Oligonukleotid eingeführt werden können, um andere Funktionen zu schützen, und die nach der Synthese entfernt werden, und das von der Festphase abgespaltene Oligonukleotid gegebenenfalls in ein physiologisch unbedenkliches Salz umgewandelt werden kann. Zur Synthese eines modifizierten Oligonukleotids werden die Standardmethoden in gewissem Grade variiert. Diese Variationen sind dem Fachmann bekannt, und sie sind z.B. in Agrawal S. "Protocols for oligonucieotides and analogs" (1993, Human Press Inc., Totowa, New Jersey) beschrieben. Die Herstellung modifizierter Oligonukleotide ist ebenfalls in EP 0 710 667, EP 0 680 969, EP 0464 638, EP 0 593 901 , WO 95/01363, EP 0 672 677, EP 0 739 898 und EP 0 552 766 beschrieben. Auf die in den obengenannten Schriften beschriebenen Methoden zur Herstellung modifizierter Oligonukleotide wird hiermit ausdrücklich Bezug genommen.

Die Erfindung betrifft weiterhin ein Verfahren zur Inhibierung der Expression von eg5 und/oder zur Modulation der Expression einer eg5 kodierenden Nukleinsäure, wobei ein erfindungsgemäßes Oligonukleotid mit einer eg5 kodierenden Nukleinsäure (z.B. mRNA, cDNA) in Kontakt gebracht wird und das Oligonukleotid mit dieser eg5 kodierenden Nukleinsäure hybridisiert wird.

Daher betrifft die Erfindung auch ein Verfahren, bei dem das Oligonukleotid mit einer eg5 kodierenden Nukleinsäure (z.B. mRNA; cDNA) in Kontakt gebracht wird, zum Beispiel indem das Oligonukleotid mittels bekannter Methoden in eine Zelle eingefügt wird, zum Beispiel durch Inkubation von Zellen mit dem obengenannten Oligonukleotid oder einer Formulierung desselben - solch eine Formulierung kann Aufnahmeverbesserer, wie Lipofectin, Lipofectamin, Cellfectin oder Polykationen (z.B. Polylysin) enthalten.

So wird zum Beispiel ein Oligonukleotid, das zuvor mit Cellfectin z.B. für 30 Minuten bei Raumtemperatur inkubiert wurde, dann für ungefähr 5 Stunden oder weniger mit einer Zelle inkubiert, um das Oligonukleotid in die Zelle einzuschleusen. Die Erfindung betrifft weiterhin die Verwendung des Oligonukleotids, vorzugsweise als Antisense-Oligonukleotid (Bindung des Oligonukleotids an eine eg5 kodierende mRNA) oder als Ribozym (Bindung an eine eg5 kodierende mRNA und Spaltung dieser mRNA). In einer weiteren besonderen Ausführungsform der Erfindung kann das Oligonukleotid verwendet werden, um die Spaltung der eg5 kodierenden mRNA durch RNase H zu induzieren, was zu einer verminderten eg5-Expression führt. Die Erfindung betrifft die Verwendung eines Oligonukleotids zur Inhibierung der Bildung einer bipolaren mitotischen Spindel und somit zur Inhibierung von Zellproliferation, insbesondere Tumorwachstum.

Die Erfindung betrifft weiterhin die Verwendung des Oligonukleotids als Arzneimittel, und die Verwendung des Oligonukleotids zur Herstellung einer pharmazeutischen Zubereitung. Insbesondere kann das Oligonukleotid in einer pharmazeutischen Zubereitung verwendet werden, die zur Prävention und/oder zur Behandlung von Krankheiten, die mit der Expression von eg5 assoziiert sind, oder die durch die Inhibierung von eg5-Expression geheilt werden können, eingesetzt wird.

Die Erfindung betrifft weiterhin eine pharmazeutische Zubereitung, die ein Oligonukleotid und/oder dessen physiologisch unbedenkliche Salze zusammen mit pharmazeutisch unbedenklichen Trägerstoffen oder Hilfsmitteln enthält.

Die Erfindung betrifft eine pharmazeutische Zubereitung, die wenigstens ein erfindungsgemäßes Nukleotid enthält, welches zur Behandlung von Krankheiten, die durch die Inhibierung von eg5-Expression geheilt werden können, wie Restenosis und Krebs, verwendet werden kann.

Die Erfindung betrifft weiterhin ein Verfahren zur Herstellung einer pharmazeutischen Zubereitung, wobei ein oder mehrere erfindungsgemäße Oligonukleotide mit physiologisch unbedenklichen Trägerstoffen und gegebenenfalls zusätzlichen Substanzen, z.B. gegebenenfalls mit geeigneten Additiven und/oder Hilfsstoffen, gemischt werden.

Die Erfindung betrifft insbesondere die Verwendung eines Oligonukleotids oder einer daraus hergestellten pharmazeutischen Zubereitung zur Behandlung von Krebs, z.B. zur Inhibierung von Tumorwachstum und Tumormetastase. Das Oligonukleotid oder eine daraus hergestellte pharmazeutische Zubereitung kann zum Beispiel zur Behandlung von festen Tumoren, wie Brustkrebs, Lungenkrebs, Kopf- und Halskrebs, Hirnkrebs, Bauchkrebs, Dickdarmkrebs, kolorektales Karzinom, Speiseröhrenkrebs, Magen-Darm-Krebs, Gliatumor, Leberkrebs, Zungenkrebs, Neuroblastom, Osteosarkom, Eierstockkrebs, Bauchspeicheldrüsenkrebs, Prostatakrebs, Retinoblastom, Wilms-T umor, multiples Myelom verwendet werden, und zur Behandlung von Hautkrebs, wie Melanom, zur Behandlung von Lymphknotentumoren und Blutkrebs. Die Erfindung betrifft weiterhin die Verwendung eines erfindunggemäßen Oligonukleotids oder einer daraus hergestellten pharmazeutischen Zubereitung zur Inhibierung der eg5-Expression und/oder zur Inhibierung der Akkumulation von Ascitenflüssigkeit und Pleuraergüssen bei verschiedenen Krebsarten, z.B. Brustkrebs, Lungenkrebs, Kopfkrebs, Halskrebs, Hirnkrebs, Bauchkrebs, Dickdarmkrebs, kolorektalem Karzinom, Speiseröhrenkrebs, Magen-Darm-Krebs, Gliatumor, Leberkrebs, Zungenkrebs, Neuroblastom, Osteosarkom, Eierstockkrebs, Bauchspeicheldrüsenkrebs, Prostatakrebs, Retinoblastom, Wilms-Tumor, multiples Myelom, Hautkrebs, Melanom, Lymphknotenkrebs und Blutkrebs. Aufgrund der hemmenden Wirkung auf die eg5-Expression kann ein erfindungsgemäßes Oligonukleotid bzw. eine daraus hergestellte pharmazeutische Zusammensetzung die Lebensqualität verbessern.

Die Erfindung betrifft weiterhin die Verwendung eines Oligonukleotids oder einer pharmazeutischen Zubereitung davon, z.B. zur Behandlung von Krebs oder zur Verhinderung von Tumormetastase, in Verbindung mit anderen Arzneimitteln und/oder anderen Therapiemaßnahmen, z.B. mit bekannten Arzneimitteln und/oder bekannten Therapiemaßnahmen, wie zum Beispiel denen, die gegenwärtig zur Behandlung von Krebs und/oder zur Verhinderung von Tumormetastase angewandt werden. Bevozugt ist eine Kombination mit Bestrahlungstherapie und chemotherapeutischen Mitteln wie Cisplatin, Cyclophosphamid, 5-Fluoruracil, Adriamycin, Daunorubicin oderTamoxifen.

Das Oligonukleotid und/oder sein physiologisch unbedenkliches Salz kann einem Tier, vorzugsweise einem Säugetier und insbesondere einem Menschen allein, in einer Mischung mit einem anderen Oligonukleotid (oder seinem physiologisch unbedenklichen Salz) oder in Form einer pharmazeutischen Zubereitung verabreicht werden, die die topische, perkutane, parenterale oder enterale Verwendung zuläßt und die als aktiven Bestandteil eine wirksame Dosis wenigstens eines Oligonukleotids, zusätzlich zu üblichen pharmazeutisch unbedenklichen Trägerstoffen und Hiifsstoffen, enthält. Solch eine pharmazeutische Zubereitung enthält normalerweise ungefähr 0,1 bis 90 Gew.-% des/der therapeutisch aktiven Oligonukleotids/Oligonukleotide. Die Dosis kann in weiten Bereichen variiert werden und muß jeweils auf die individuellen Umstände angepaßt werden. Zur Behandlung von Schuppenflechte wird ein topischer Gebrauch bevorzugt. Im Fall von Krebs sind Infusionen, orale und rektale Verabreichung oder nasale Verabreichung in einem Aerosol, vorzugsweise im Fall von Lungenkrebs, bevorzugt, während im Fall von diabetischer Retinopathie eine topische, intravitreale und orale Verabreichung bevorzugt ist.

Eine pharmazeutische Zubereitung kann in an sich bekannter Weise hergestellt werden (z.B. Remingtons Pharmaceutical Sciences, Mack Publ. Co., Easton, PA (1985)), unter Verwendung von pharmazeutisch inerten anorganischen und/oder organischen Trägerstoffen. Lactose, Maisstärke und/oder deren Derivate, Talk, Stearinsäure und/oder deren Salze, usw., können zum Beispiel zur Herstellung von Pillen, Tabletten, Filmtabletten und Hartgelatinekapseln verwendet werden. Beispiele für Trägerstoffe für Weichgelatinekapseln und/oder Zäpfchen sind Fette, Wachse, halbfeste und flüssige Polyole, natürliche und/oder gehärtete Öle, usw. Beispiele für geeignete Trägerstoffe zur Herstellung von Lösungen und/oder Sirupen sind Wasser, Saccharose, Invertzucker, Glukose, Polyole, usw. Geeignete Trägerstoffe zur Herstellung von Injektionslösungen sind Wasser, Alkohole, Glycerin, Polyole, Pflanzenöle, usw. Geeignete Trägerstoffe für Mikrokapseln, Implantate und/oder Stäbe sind Mischpolymere von Glykolsäure und Milchsäure. Zusätzlich gibt es Liposomformulierungen, die z.B. in N. Weiner (Drug Develop Ind Pharm 15 (1989) 1523), "Liposome Dermatics" (Springer Verlag 1992) und Hayashi (Gene Therapy 3 (1996) 878) beschrieben sind. Die pharmazeutische Zusammensetzung kann gleichfalls eine Formulierung umfassen, die die orale Verfügbarkeit des Oligonukleotids erhöht, wie Stoffe zur Verbesserung der Aufnahme über den Darm, z.B. Mannit, Harnstoff, Salze der Gallensäure, wie CDCA (Chenodesoxycholat) (2 %).

Auch eine dermale Applikation ist möglich, zum Beispiel unter Verwendung von ionophoretischen Methoden und/oder mit Hilfe von Elektroporation. Darüberhinaus können Lipofectine und andere Trägersysteme, zum Beispiel die in der Gentherapie verwendeten, eingesetzt werden. Besonders geeignet sind Systeme, die in hocheffizienter Weise die Einschleusung von Oligonukleotiden in eukaryontische Zellen oder in den Kern von eukaryontischen Zellen ermöglichen. Eine pharmazeutische Zubereitung kann auch aus zwei oder mehr verschiedenen Oligonukleotiden und/oder ihren physiologisch unbedenklichen Salzen und darüberhinaus, zusätzlich zu wenigstens einem Oligonukleotid, aus einem oder mehreren verschiedenen therapeutischen Wirkstoffen bestehen. Zusätzlich zu den Wirk- und Trägerstoffen kann eine pharmazeutische Zubereitung auch Zusatzstoffe wie Füllstoffe, Streckmittel, Sprengmittel, Bindemittel, Gleitmittel, Netzmittel, Stabilisatoren, Emulgiermittel, Konservierungsstoffe, Süßstoffe,

Farbstoffe, Geschmacksstoffe oder Aromen, Verdickungsmittel, Verdünnungsmittel oder Puffersubstanzen enthalten, und zusätzlich Lösungsmittel und/oder lösungsvermittelnde Mittel und/oder Mittel zum Erzielen einer Retardwirkung, und auch Salze zur Änderung des osmotischen Drucks, Beschichtungsmittel und/oder Antioxidantien.

Beispiele:

Beispiel 1 : Oligonukleotidsynthese

Oligonukleotide (ON s) wurden mit Hilfe eines Applied Biosystems 394 DNA-Synthesizers (Perkin Eimer Applied Biosystems, Inc., Foster City, USA) und Standardphosphoramiditchemie synthetisiert. Nach der Kopplung wurden durch Schwefelung unter Verwendung des Beaucage-Reagens und anschließender Verkappung mit Acetanhydrid und N-Methylimidazol Phosphorothioatbindungen eingeführt. Nach Abspaltung von der Festphase und abschließender Entschützung durch Behandlung mit konzentriertem Ammoniak wurden die ON s durch Polyacrylamidgelelektrophorese gereinigt. Die 2'-O-Mef 7y/-modifizierten ON s wurden hergestellt, indem die Standardphosphoramidite in dem entsprechenden Zyklus gegen 2'-0-Methylribonukieosid-Phosphoramidite ausgetauscht wurden. Alle ON s wurden durch Elektrospray-Massenspektroskopie mit negativen Ionen (Fisons Bio-Q) analysiert, die in allen Fällen die berechnete Masse bestätigte. Die C16-modifizierten Oligonukleotide wurden unter Verwendung von Hexadecyioxy- (cyanoethoxy)-N,N-diisopropyl-aminophosphan anstelle eines Standardamidits als Phosphitylierungsreagens im letzten Schritt der Oligonukleotidsynthese oder ausgehend von einer entsprechend derivatisierten Festphase synthetisiert. Der Triethylenglykol-Linker ist im Handel von der Glen Research Corporation erhältlich. Die 2'-Phosphoramidite von Adenosin und Cordycepin wurden von der Chem. Genes Corporation bzw. Chemogen Corporation bezogen. Die Einführung von 5'-Phosphaten oder Thiophosphatresten wurde wie zuvor beschrieben ausgeführt (Uhlmann und Engels (1986) Tetrahedron Lett. 27, 1023). Die PNA-DNA-Chimeren wurden wie in EP 0 672 677 beschrieben hergestellt.

Die Oligonukleotide wurden mittels a) Analytischer Gelelektrophorese in 20%igem Acrylamid, 8M Harnstoff, 45μM Trisboratpuffer, pH 7,0 und/oder b) HPLC-Analyse: Waters GenPak FAX-Säule, Gradient CH3CN (400ml), H2O (1 ,61), NaH2P0 (3,1g), NaCI (11 ,7g), pH6,8 (0,1 M an NaCI) nach CH3CN

(400ml), H20 (1 ,61), NaH2P04 (3,1g), NaCI (17,53g), pH6,8 (1 ,5M an NaCI) und/oder c) Kapillarelektrophorese unter Verwendung einer Beckmann eCApT U100P Gel-Kapillarsäule, 65 cm Länge, 100 mm innerer Durchmesser, wobei sich das Fenster 15 cm von dem einen Ende befindet, Puffer 140 μM Tris, 360mM

Borat, 7M Harnstoff und/oder d) Elektrospray-Massenspektrometrie mit negativen Ionen, die in allen Fällen die erwarteten Massenwerte bestätigte, analysiert.

Die Methoden zur Analyse-von Oligonukleotiden gemäß a), b), c) und d) sind dem Fachmann bekannt. Diese Methoden werden zum Beispiel in Schweitzer und Engels "Analysis of oligonucleotides" (in "Antisense - from technology to therapy", ein Labor-Handbuch und Lehrbuch, Schlingensiepen et al. Hrsg., Biol. Science Vol. 6 (1997) S. 78 - 103) beschrieben.

Die folgenden Oligonukleotide wurden hergestellt (siehe Beschreibung) und getestet: ON1:3-'C*T*T*AAGGC*AGT*AC*CG*CAG*C (K3) SEQ ID NO.10

ON2: 3'-A*C*C*A C*T C*T A C*G T*C*T G G*T A*A (K4) SEQ ID NO.11

ON3: 3'-A*A*G*A G*T C*A C*T C*T C*C*T A G G*C (K5) SEQ. ID NO.19

ON4: 3-'C*T*T*A A G G C*A G T*A C*C G*C A G*C-FITC-5' (K6) SEQ ID NO.10

ON5: 3'-G*G*C A G*T A C*C G*C A G C*G SEQ ID NO.22

ON6: 3'-C*T*T*A A G G*C A G*T*A SEQ ID NO.13

ON7: 3'-T*A*A G G C*A G*T A*C*C SEQIDNO.14

ON8: 3'-G*G*C A G*T A C*C*G C*A SEQIDNO.15

ON9: 3'-C*A*G*T A C*C G*C A G*C SEQ ID NO.23

ON10: 3'-A*G*T A C*C G*C A G*C*G SEQIDNO.16

ON11 : 3'-C*C*G*C A G*C G T*C G*G SEQIDNO.17

ON12: 3'-G*C*A G C*G T*C G G*T*T SEQIDNO.18

ON 13: 3'-A*A*G*A G*T C*A C*T C*T C*C*T A G G*C-Flu-5' (Vergleich 1 )

SEQIDNO . \9 ON14: 3"-G*G*C*A G*T A C*C G C*A G*C G T*C G*G SEQ ID NO.12

ON15: 3'-C*TTAAG G*C A G*T*A-FITC SEQ ID NO.13

wobei

"*" eine Phosphorothioat-Internukleosidbrücke, und FITC einen Fluoreszenzmarker darstellen.

ON1 bis ON 12 wurden in einem auf Zellen basierenden Assay auf ihre Wirksamkeit, die Proliferation von REH-Leukämiezellen zu inhibieren, getestet. ON1, ON2, ON64- ON71 sind Antisense-Oligonukleotide, die gegen die translationale Startregion von eg5-mRNA gerichtet sind. ON4 ist das 5'-Fluorescein-markierte Analog von ON1. ON3 ist ein Vergleichsoligonukleotid.

Die Ergebnisse des Proliferationsinhibitionsexperiments sind in Abbildung 1 gezeigt.

Beispiel 2: Bestimmung der antiproliferativen Wirksamkeit der eg5-Antisense- Oligonukleotide

Die REH-Zellen (humane Prä-B-Leukämiezellen, DSM ACC 22) bzw. die A549- Tumorzellen wurden in OptiMEM (Gibco BRL) mit 10% fötalem Kälberserum (FCS, GIBCO-BRL) bei 37°C unter 5% C02 kultiviert. Die Zelldichte für den Assay war ungefähr 1 x 106/ml. Die Oligonukleotide (0,17mM ) wurden zur Komplexbiidung mit Cellfectin (0,83 mg/ml; Gibco-BRL) gemischt, um die Aufnahme durch die Zellen zu verbessern. Der Oligonukleotid/Cellfectin-Komplex wurde mit den Zellen in Abwesenheit von Serum in Platten mit 24 Vertiefungen 4 Stunden lang inkubiert. Der Oligonukleotid/Cellfectin-Komplex wurde dann entfernt, und Serum wurde zugegeben, so daß die Endkonzentration 10% betrug. Nach 96stündiger Inkubation bei 37°C unter 5% C02 wurde die Zelldichte mit Casy 1 (Fa. Schärfe) gemessen. Hierzu wurden die Zellen in jeder Vertiefung gut gemischt und sofort 1:100 mit Casyton verdünnt. Die Mittelwerte der Zelldichte wurden jeweils aus 3 einzelnen Vertiefungen mit derselben Oligonukleotidkonzentration bestimmt. Die Ergebnisse der antiproliferativen Wirksamkeit sind in Abbildung 1 gezeigt.

Tabelle 1 : Nukleotidsequenz von humanem eg5 (SEQ ID NO. 20)

1 GAATTCCGTC ATGGCGTCGC AGCCAAATTC GTCTGCGAAG AAGAAAGAGG

51 AGAAGGGGAA GAACATCCAG GTGGTGGTGA GATGCAGACC ATTTAATTTG 301 GCAGAGCGGA AAGCTAGCGC CCATTCAATA GTAGAATGTG ATCCTGTACG

151 AAAAGAAGTT AGTGTACGAA CTGGAGGATT GGCTGACAAG AGCTCAAGGA

201 AAACATACAC TTTTGATATG GTGTTTGGAG CATCTACTAA ACAGATTGAT

251 GTTTACCGAA GTGTTGTTTG TCCAATTCTG GATGAAGTTA TTATGGGCTA

301 TAATTGCACT ATCTTTGCGT ATGGCCAAAC TGGCACTGGA AAAACTTTTA 351 CAATGGAAGG TGAAAGGTCA CCTAATGAAG AGTATACCTG GGAAGAGGAT 401 CCCTTGGCTG GTATAATTCC ACGTACCCTT CATCAAATTT TTGAGAAACT

451 TACTGATAAT GGTACTGAAT TTTCAGTCAA AGTGTCTCTG TTGGAGATCT 501 ATAATGAAGA GCTTTTTGAT CTTCTTAATC CATCATCTGA TGTTTCTGAG

551 AGACTACAGA TGTTTGATGA TCCCCGTAAC AAGAGAGGAG TGATAATTAA

601 AGGTTTAGAA GAAATTACAG TACACAACAA GGATGAAGTC TATCAAATTT 651 TAGAAAAGGG GGCAGCAAAA AGGACAACTG CAGCTACTCT GATGAATGCA

701 TACTCTAGTC GTTCCCACTC AGTTTTCTCT GTTACAATAC ATATGAAAGA

751 AACTACGATT GATGGAGAAG AGCTTGTTAA AATCGGAAAG TTGAACTTGG

801 TTGATCTTGC AGGAAGTGAA AACATTGGCC GTTCTGGAGC TGTTGATAAG

851 AGAGCTCGGG AAGCTGGAAA TATAAATCAA TCCCTGTTGA CTTTGGGAAG 901 GGTCATTACT GCCCTTGTAG AAAGAACACC TCATGTTCCT TATCGAGAAT

951 CTAAACTAAC TAGAATCCTC CAGGATTCTC TTGGAGGGCG TACAAGAACA

1001 TCTATAATTG CAACAATTTC TCCTGCATCT CTCAATCTTG AGGAAACTCT

1051 GAGTACATTG GAATATGCTC ATAGAGCAAA GAACATATTG AATAAGCCTG

1101 AAGTGAATCA GAAACTCACC AAAAAAGCTC TTATTAAGGA GTATΛCGGAG 1151 GAGATAGAAC GTTTAAAACG AGATCTTGCT GCAGCCCGTG AGAAAAATGG

1201 AGTGTATATT TCTGAAGAAA ATTTTAGAGT CATGAGTGGA AAATTAACTG 1251 TTCAAGAAGA GCAGATTGTA GAATTGATTG AAAAAATTGG TGCTGTTGAG

1301 GAGGAGCTGA ATAGGGTTAC AGAGTTGTTT ATGGATAATA AAAATGAACT

1351 TGACCAGTGT AAATCTGACC TGCAAAATAA AACACAAGAA CTTGAAACCA 1401 CTCAAAAACA TTTGCAAGAA ACTAAATTAC AACTTGTTAA AGAAGAATAT

1451 ATCACATCAG CTTTGGAAAG TACTGAGGAG AAACTTCATG ATGCTGCCAG

1501 CAAGCTGCTT AACACAGTTG AAGAAACTAC AAAAGATGTA TCTGGTCTCC

1551 ATTCCAAACT GGATCGTAAG AAGGCAGTTG ACCAACACAA TGCAGAAGCT

1601 CAGGATATTT TTGGCAAAAA CCTGAATAGT CTGTTTAATA ATATGGAAGA 1651 ATTAATTAAG GATGGCAGCT CAAAGCAAAA GGCCATGCTA GAAGTACATA

1701 AGACCTTATT TGGTAATCTG CTGTCTTCCA GTGTCTCTGC ATTAGATACC

1751 ATTACTACAG TAGCACTTGG ATCTCTCACA TCTATTCCAG AAAATGTGTC

1801 TACTCATGTT TCTCAGATTT TTAATATGAT ACTAAAAGAA CAATCATTAG 1851 CAGCAGAAAG TAAAACTGTA CTACAGGAAT TGATTAATGT ACTCAAGACT 1901 GATCTTCTAA GTTCACTGGA AATGATTTTA TCCCCAACTG TGGTGTCTAT 1951 ACTGAAAATC AATAGTCAAC TAAAGCATAT TTTCAAGACT TCATTGACAG

2001 TGGCCGATAA GATAGAAGAT CAAAAAAAAA GGAACTCAGA TGGCTTTCTC 2051 AGTATACTGT GTAACAATCT ACATGAACTA CAAGAAAATA CCATTTGTTC

2101 CTTGGTTGAG TCACAAAAGC AATGTGGAAA CCTAACTGAA GACCTGAAGA

2151 CAATAAAGCA GACCCATTCC CAGGAACTTT GCAAGTTAAT GAATCTTTGG 2201 ACAGAGAGAT TCTGTGCTTT GGAGGAAAAG TGTGAAAATA TACAGAAACC

2251 ACTTAGTAGT GTCCAGGAAA ATATACAGCA GAAATCTAAG GATATAGTCA

2301 ACAAAATGAC TTTTCACAGT CAAAAATTTT GTGCTGATTC TGATGGCTTC

2351 TCACAGGAAC TCAGAAATTT TAACCAAGAA GGTACAAAAT TGGTTGAAGA

2401 ATCTGTGAAA CACTCTGATA AACTCAATGG CAACCTGGAA AAAATATCTC 2451 AAGAGACTGA ACAGAGATGT GAATCTCTGA ACACAAGAAC AGTTTATTTT

2501 TCTGAACAGT GGGTATCTTC CTTAAATGAA AGGGAACAGG AACTTCACAA

2551 CTTATTGGAG GTTGTAAGCC AATGTTGTGA GGCTTCAAGT TCAGACATCA

2601 CTGAGAAATC AGATGGACGT AAGGCAGCTC ATGAGAAACA GCATAACATT

2651 TTTCTTGATC AGATGACTAT TGATGAAGAT AAATTGATAG CACAAAATCT 2701 AGAACTTAAT GAAACCATAA AAATTGGTTT GACTAAGCTT AATTGCTTTC

2751 TGGAACAGGA TCTGAAACTG GATATCCCAA CAGGTACGAC ACCACAGAGG

2801 AAAAGTTATT TATACCCATC AACACTGGTA AGAACTGAAC CACGTGAACA

2851 TCTCCTTGAT CAGCTGAAAA GGAAACAGCC TGAGCTGTTA ATGATGCTAA

2901 ACTGTTCAGA AAACAACAAA GAAGAGACAA TTCCGGATGT GGATGTAGAA 2951 GAGGCAGTTC TGGGGCAGTA TACTGAAGAA CCTCTAAGTC AAGAGCCATC

3001 TGTAGATGCT GGTGTGGATT GTTCATCAAT TGGCGGGGTT CCATTTTTCC 3051 AGCATAAAAA ATCACATGGA AAAGACAAAG AAAACAGAGG CATTAACACA

3101 CTGGAGAGGT CTAAAGTGGA AGAAACTACA GAGCACTTGG TTACAAAGAG

3151 CAGATTACCT CTGCGAGCCC AGATCAACCT TTAATTCACT TGGGGGTTGG 3201 CAATTTTATT TTTAAAGAAA AACTTAAAAA TAAAACCTGA AACCCCAGAA

3251 CTTGAGCCTT GTGTATAGAT TTTAAAAGAA TATATATATC AGCCGGGCGC

3301 GTGGCTCTAG CTGTAATCCC AGCTAACTTT GGAGGCTGAG GCGGGTGGAT

3351 TGCTTGAGCC CAGGAGTTTG AGACCAGCCT GGCCAACGTG CGCTAAAACC

3401 TTCGTCTCTG TTAAAAATTA GCCGGGCGTG GTGGGCACAC TCCTGTAATC 3451 CCAGCTACTG GGGAGGCTGA GGCACGAGAA TCACTTGAAC CCAGAAGCGG 3501 GGTTGCAGTG AGCCAAAGGT ACACCACTAC ACTCCAGCCT GGGCAACAGA

3551 GCAAGACTCG GTCTCAAAAA TAAAATTTAA AAAAGATATA AGGCAGTACT

3601 GTAAATTCAG TTGAATTTTG ATATCTACCC ATTTTTCTGT CATCCCTATA

3651 GTTCACTTTG TATTAAATTG GGTTTCATTT GGGATTTGCA ATGTAAATAC

3701 GTATTTCTAG TTTTCATATA AAGTAGTTCT TTTAGGAATT C

Tabelle 2: SEQ ID NO. 21 : P. falciparum-Sequenz (Teilsequenz; Genbank, ID Z98551 ).

TTTTTTTTTTTTTATTCCTTGGATGTTCTTGGTAGTTTAAATTTTTTATTTTTGTAGTTTTC TTCTTTTATACGTTTTAAAGCAGGGGATGCCTTTTTAGGAAATGCCCTATTTTCAATAGCTT TAATTTTTGTAGATTGAAATTTATTATTATTATTATTATTATTGTTGTTGTTGTTGTTGTTG TTGTTGTTGTTATTATTTGAATAATTATTTGTTATATGAACATTTTGAACATTTATATTTCT CTTTCTTTCATATTCTTTTAAACTTGTTACACTCATATTTTCTGTATTTACATCAAATCTTT TATTATGTTGATTGTTATTTAAATAATTTAATTCTTGATATGTTTCATCTATTGGTTGTATA GGATTATCCGTTGTATTCTTATTATATAGCATATATTCATTTAAGGGTAGATTATTGTGATT AGTTTTTACATTTAATTTATTTTTATCACCTTTATTATTTATATTATGAGGTATACTACTAT TCGTTGTATGATCATTTAAACTATTGTAACGAGAGTAATTATTTTCATGCGCTACAATTTTA TCATCTTGAATAAGAAATTGGAAGTTTTCATCGATTTGTTCAAATACTTTACTTAAATCTAT ATCATGTGTTGTTGTAATTTGTTCTATCTCTTTCATCAAGGTATTTTTAACTTCCAAGTATA AATTTTGTCTTATGATATCATCATTATAAAGATAATAATTATGATGATCACCTTGATCTATT TTATTATCATCATTATAAAGATAATAATTATGATGATCACCTTGATCCATTTTATTATCATC ATTATAAAGATAATTATTATGATCATGACCTTGATCCATTTTATTATCATCATTATAAAGAT AATTATTATGATCATGACCTTGATCCATTTTATTATCATCATTATAAAGATAATTATTATGA TCATGACCTTGATCCATTTTATTATCATCATAATTATTATTGTCACCATTTTTATTATTGTC ATGATCATTTTTATTATTGTCACCATTTTTATTATTATCATGATTATTTTTATTATTATCAT GATTATTTTTATTATTATCATGATTATTTTTATTATTATCATCATTTTTATTATTATCATAA TTCGTGTCGTAAGTCGAATCCCTATTTAGTGATGTGATTTTCATCGGAGTAAACATATCTAT GACATTCACAAACGTTTCCCTTATCCTTTGTACATCATCCTTTATATTTAGATAAAATTCAT CATCCATATTTTCCATGAGATCATAACTTGATGTACTTGGAATGTCTTGTAAGTAATCTTTT TTTTTTAATATATCTATTAATTCTGCTATATACATATTACATTTGTTTAAATTTTGTTCAAA TATATTATTAAAAAGTTTTATATTTTCATTAGACTTTAACATATGTATACGACGTCCCCCTT TTTGTTCTTGTGATTCTTTATTTTTATTTTGTAAAATCTTTTCAGATATAACGTTATATAAC TTTCGTTTCTCTATTTTGTTTATATTAGTTTGACTTGTAAAGTTATTTATGATTTTATCAAT ATTTAGATTATTTGTATATAATAAATTATTATAAATATTTAAAGTATCATTTAAACATTTGC TGTGTTCCTTTTCTTCAATATAACTTTTTCTTTTTAAATAAGATAATATGTTATATAAAACA GTATGATAATTTGTTATCTTCCTTTTAATATCATTATTAATATTATTATATTCCTTTTCATC ATTAATATTGCATTCAGAAAAATGTTGTATAGTATCATCTATCTTTTTTACAGAATTCATAA AAACAGATTTATAATTTTTTTTTGACTTATCATATAATTCTTTATTTAATAAATCGAACTTG TTATTCATTTTTTCATAAATATCTTCCACATTTTTATTTATAAGTAATTCAATATCTTTCAA AATATTTTCTTTAAATTCTTGTATATCTTCATTTATCATTTTTTTATAATTATTAATTATAA TATTATCCTCCTTTTCAAAAACATCATATTTTTTATAAATATATTCAATGTTGTCATTCATA ATCTTCTTGTCCTTATCCCAATGTATATATTTTTCATGACATTTTTTTTCTAGTAACATAAA TGATTCGTTTAAAAAAATATGAAATATATTACATATACTTTTAATATATTGTATTAATGATT TTGCATTATATAACTTTTTTTCAGATTCGTGATTATCTAAA TTTGTATAATATCTTCACCT TGTCTATTTAATAATAAATCTTTTATAAATTCTTTATTCTCAGGATAATTAAATGATTCCTC TATATGGTCAAATGGCATCTCATTATTTTCTTCTTTACCATATTGTTTTTGACATGTTTTTC CTTCACCATTTTGTTTTTCACATATTATTCCTTCACCGTTTTGTTTTTCACATATTATCTCG TCACCGTTTTGTTTTTCACATATTATCTTT CACCACTTTGTTTTTCACATATTATCTCTTC ACCGTTTTGTTTTTCACATATTATCTTTTCACCACTTTGTTTTTCACATATTATCTTTTCAC CACTTTGTTTTTCACATATTATCTTTTCACCACTTTGTTTTTCTTTTTTTAATCCGTTTGTA TTATATACACCAATAATTGCTGGCATTTTCTGCTTGGCTTCATCACTTATATGTGGTATGTT TATTTTACATTGTGATATTTCCTTTTTAATATTTTCGGAGAGAGAAAAGTAATCATGATCAT ATTTTTGTAAAATATCCATATGGTCCAGTATAAAATTCAGAGTATCATTATATTTAAAATTA ATGTTACTATTGAGTTCTTCAAAATGGTTAATATAATCATTGTATGATTTTTTATTTTGTAC TAGATAATTTTTGGTATCATCTAAAATGAATAAGATGGTTTTACATATATCGTTTAAAAGAT GATTTTCTTGATGAATATTTTTTTTTATATTTAATAGATTATCATGCATTATATTAGACATA TTTGTTTTAATTTGTTGAAAAGATTTTTTTTGATTTATAAAATTTTCTTCTAAAGAATGATA TTTATTTAATAAGAATTGTGTAATATATTTTTCTTCTATTATTTTTTTAATTAATATTTGAT GAAATGCTTGTATATTTTTATATTTTTGAATAGTATCTTTTAAAAAGAAAAATATTTTATTT TGTAGATCATCTGTATTATCCATTTTATTTAATAAATTTTTTATTTTTTTACTTTTTTCAAA TAAAATTTTTTCTTTTTCTAATAATATTTCTTTATTTTTCTTTAGACTATTTTGTATATTAT TATATTCTTCTGTATCAAGATAAACACCTCTCTTTTCTCTGCTTAAATTCAGTGCATTTCTT AACTTTTCGATTTCATTATTTAAATCCTTTATTTTTAATTGTTTCGTTGTTTTTATATTTAT CTCGGGTCTATTCTTAATATTCTTAGCTCGAAAGACATAATCTAAAGTGCTTAAAGTCTCAT CAATACATAAAGAGGAGGGTGATATAGTGGCGACAATAAAAGTCTTCGTTTTCCCACCTAAC GAATCTTGTAATAATCTGGTTAATTTAGAATCTCTGTAAGGAATATAAGATGAATTCTCAAT CAACGAATTAATAACTCTACCTAAGGTTAATAAAGATTGATTTATATTACAACTTTCTTGTT GTCTAATTTTTAAAGAACCATAAGAGCTTTTCAAAGCATTTTCACTACCCGCTAAATCAACT AAATTTAATTTTCCTATTTTTGTTATACTTTCTCCTACATTATTTATATCTTTTATAATTAA TGTTATAGTAAAAATCGAATGACTTCTACTCGATTTTTTATTATAAGCCGTTTCAGCTGTCC TTCTTTTTTTAATAGCTGAACATATAATATAATATATTTCTTCAAAAGAATTAATACTTTTT TCTTCTAACTTATCAACATTTAATCCTTTACTTTTATTATTACTATCTTCATATATTCGAAG TTTCATATTTTCATTTGTTGAACTTAATAAATCACATAATTCTTCATTATATATTTCTAGAT AGCTAATTTTTATATTAAAATCGTACATATTCTTATCATCAAATGTTTGATACATATCATTA TTCCTATTTTTATCTACACTACATTTTTGTACAACATCACAAGTAATATCTCTACTCTTTTC GTTAACTAACAAATTGTTAGGTTCTTTATTAATTTTTAAATTATTATAAATATCATTTTTAT CAATATTTATTTTGTTACATAATAAATTATTATAATTATTATTAATAATATTATTATTGTTA CCATTAGTTTCCTTATTTATTACATTTATATGTTCGTTATCCTTTTCATCAAATATATTCTT TTTTCCTTTAAAATGTCGAATCTTTTCTTCTTTCCTTTTATTTAATATATCGAATATTCTTT TCGTAACTCGAAATATAAGTCCAGTATCCTCATTCTCACAAAGTTCATAGCAATAGCTGATG TCGCTATTAATACTTTCATTCAAATCCACCTTTTTATTATTATCATATTGTTTCAGGTGTTC

TAGTATTTTCCCTTCCATAGTATAGGTCTTACCCGTCCCGGTCTGTCCATAGCAGAACAGCG

TACAATTGAATCCTTGCAAAACCTGAAGCGGCGAACAAAAAAAAAAAAAAAAAAAAATATAT

ATATATATGTACATGTATATTTATATGTATATGTATATATATATGTATAGTTATATGTATTT

TTATTTTTATTTTTATTTTTATATTTATTTTTATTTTTATATTTATTTTTATTTTTATATTT ATTTTTATTTTTATATTTATATTTATATA

CCATATATTTTTTTTTTTTAATCTATTTAATAAAACATTATTATGATATACGCAGAGGTGAT

ATATACATGGTATTTATTTATTTTTTTTTATATATTTTTCAT

TTGTTTCGTAGGAATATTCTTTTTTTTTCTGCACATATATTTCACTATCCATATAATATCAT

AATACATCATGGAATAATTTATATATATATATATATATATGTATATTTTATTTTTACCTCAT

CTACTATTTGGTAAATATAATTATTGAACAAAGTTTTCTGATCCACATCTTTATCACATGCA

TAATCAAAACTATATTTTTTTTCGTATATTTCATTGTTTCTATTAATTGTTAATATAACCTC

ATTATTATTAATTCGAACTACCTCTTCATTATTTATATCGTTTTTTTCTTTTTCATTTAATG

GTCTACACCTTACGATAACTTTTATATTTACGCAACTTGATTTATCATTATTATAAGAATTT

CTGAGCATTTTACTTTTATTCAAATAAT

Tabelle 3:

Sequenzhomologie: Vergleich der humanen eg5-Sequenz mit der Plasmodium falciparum-eg5-Sequenz

1 60 human . SEQ GAATTCCGTCAT GGCGTC .... GCAGCC .AAATTC ... GTCTGCGAAGAAG P ASMO . SEQ TTTTTTTTTTTTTATTCCTTGGATGTTCTTGGTAGTTTAAATTTTTTATTTTTGTAGTTT

61 120 human . SEQ AAAGA....GGAGAAGGGGAAGAACATCCAGGTGGTGGTGAGATGCAGACC PLASMO . SEQ TCTTCTTTTATACGTTTTAAAGCAGGGGATGCCTTTTTAGGAAATGCCCTATTTTCAATA

121 180 human. SEQ A. TTTAATTTGGCAGAGCGGAAAGCTAGCGCCCAT . TCAATAGTAGAATGTGATCCTGTA

PLASMO . SEQ GCTTTAATTTTTGTAGATTGAAATTTATTATTATTATTATTATTATTGT . TGTTGTTGTT

181 240 human .SEQ CGAAAAGAAGTTAGTGT .ACGAACTGGAGGATTGGCTG .. ACAAGAGCTCAAGGAAAACA PLASMO . SEQ GTTGTTGTTGTTGTTGTTATTATTTGAATAATTATTTGTTATATGAACATTTTGAACATT

241 300 human . SEQ TACACTTTTGAT ATGGTGTTTGGAGC ATCTACTAAAC .. AG

PLASMO . SEQ TATATTTCTCTTTCTTTCATATTCTTTTAAACTTGTTACACTCATATTTTCTGTATTTAC

301 360 human. SEQ ATTGA.. TGTTTACCG ....AAGTGTTGTTTG TCCAATTCTGGATGAAGT . AT .

PLASMO . SEQ ATCAAATCTTTTATTATGTTGATTGTTATTTAAATAATTTAATTCTTGATATGTTTCATC 361 420 human. SEQ TATGGGCTATA.... ATTGCAC .... TATCTTTGC . GTATGGC . CAAACT GG

PLASMO . SEQ TATTGGTTGTATAGGATTATCCGTTGTATTCTTATTATATAGCATATATTCATTTAAGGG

421 480 human. SEQ CA. CTG . GAAAAACTTTTACAATGGA... AGGTGAAAGGTC ACCTA....

PLASMO . SEQ TAGATTATTGTGATTAGTTTTTACATTTAATTTATTTTTATCACCTTTATTATTTATATT

Abbildung 1 :

Diese Abbildung faßt die Ergebnisse von Beispielen 1 + 2 zusammen:

Gezeigt ist die Wirkung von Oligonukleotiden ON1 bis ON12 (eg5-Antisense) auf die

Inhibierung der Proliferation von REH-Zellen (in Prozent).

■ 1. Experiment ♦ 2. Experiment CF : Cellfectin-Vergleich

Claims

Ansprüche:
1. Antisense-Oligonukleotid oder eines seiner Derivate, dadurch gekennzeichnet, daß es einem Teil einer eg5 kodierenden Sequenz entspricht.
2. Antisense-Oligonukleotid oder eines seiner Derivate nach Anspruch 1 , dadurch gekennzeichnet, daß es 8-100 Nukleotiden einer eg5 kodierenden Sequenz entspricht.
3. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem der Ansprüche 1 oder 2, dadurch gekennzeichnet, daß es eine Länge von 8 bis 20 Nukleotiden hat.
4. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 3, dadurch gekennzeichnet, daß es einem Teil einer humanen eg5 und/oder einer Plasmodium falciparum eg5 kodierenden Sequenz entspricht.
5. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 4, dadurch gekennzeichnet, daß es eine der Sequenzen SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3 , SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8 oder SEQ ID NO. 9 hat, wobei
SEQ ID NO. 1 ' 5'-CGACGCCATGACGGAATTC-3'
SEQ ID NO. 2 5'-AATGGTCTGCATCTCACCA-3'
SEQ ID NO. 3 5'-GGCTGCGACGCCATGACGG-3'
SEQ ID NO. 4 5'-ATGACGGAATTC-3' SEQ ID NO. 5 5'-CCATGACGGAAT-3'
SEQ ID NO. 6 5'-ACGCCATGACGG-3'
SEQ ID NO. 7 5'-GCGACGCCATGA-3'
SEQ ID NO. 8 5'-GGCTGCGACGCC-3' und SEQ ID NO. 9 5'-TTGGCTGCGACG-3' ist.
6. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 5, dadurch gekennzeichnet, daß das Oligonukleotid eine oder mehrere Modifikationen aufweist, wobei sich jede
Modifikation, im Vergleich zu einem aus natürlicher DNA aufgebautem Oligonukleotid mit der gleichen Sequenz, an einer bestimmten Phosphodiester Internukleosidbrücke und/oder an einer bestimmten ß-D-2'- Desoxyriboseeinheit und/oder an einer bestimmten natürlichen Nukleosidbasenposition befindet.
7. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 6, dadurch gekennzeichnet, daß 1 bis 5 terminale Nukleotideinheiten am 5'-Ende und/oder am 3'-Ende des Oligonukleotids durch modifizierte Internukleosidbrücken die am 5'- und/oder am 3'-Ende des bzw. der entsprechenden Nukleoside lokalisiert sind, geschützt ist.
8. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 7, dadurch gekennzeichnet, daß wenigstens ein internes Pyrimidinnukleosid und/oder eine am 5'-Ende und/oder am 3'-Ende dieses Pyrimidinnukleosids lokalisierte Internukleosidbrücke modifiziert ist.
9. Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 8, dadurch gekennzeichnet, daß jede Modifikation unabhängig voneinander ausgewählt ist aus a) dem Austausch der Phosphodiesterbrücke am 3'- und/oder 5'-Ende eines Nukleosids durch eine modifizierte Internukleosidbrücke, b) dem Austausch der Phosphodiesterbrücke am 3'- und/oder 5'- Ende eines Nukleosids durch eine Dephosphobrucke, c) der Austausch eines Zuckerphosphatrests aus dem Zuckerphosphatgerust durch einen anderen Rest, d) dem Austausch einer ß-D-2'-Desoxyriboseeinheit durch eine modifizierte Zuckereinheit, e) dem Austausch einer natürlichen Nukleosidbase durch eine modifizierte Nukleosidbase, f) der Anbindung an ein Molekül, das die Eigenschaften des Oligonukleotids beeinflußt, g) der Anbindung an ein 2'5'-verbundenes Oligoadenylatmolekül oder ein Derivat davon, gegebenenfalls über ein geeignetes Linkermolekül, und h) der Einführung einer 3'-3'- und/oder einer 5'-5'-lnversion am 3'- und/oder am 5'- Ende des Oligonukleotids.
10. Verfahren zur Herstellung eines Antisense-Oligonukleotids oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 9, wobei in geeigneter weise geschützte Monomere an einer Festphase kondensiert werden.
11. Verwendung eines Antisense-Oligonukleotids oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 9 zur Inhibition der Expression von eg5.
12. Verfahren zur Inhibition der Expression von eg5, dadurch gekennzeichnet, daß ein Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 9 mit einer eg5-kodierenden Nukleinsäure in Kontakt gebracht wird und an diese bindet.
13. Verfahren zur Herstellung einer pharmazeutischen Zubereitung, dadurch gekennzeichnet, daß ein oder mehrere Antisense-Oligonukleotide oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 9 mit einem physiologisch unbedenklichen Trägerstoff und gegebenenfalls zusätzlichen Substanzen gemischt werden.
4. Pharmazeutische Zubereitung, dadurch gekennzeichnet, daß sie wenigstens ein Antisense-Oligonukleotid oder eines seiner Derivate gemäß einem oder mehreren der Ansprüche 1 bis 9 enthält.
PCT/EP2000/007345 1999-07-28 2000-07-21 Oligonukleotide zur inhibierung der expression von humanem eg5 WO2001007602A3 (de)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DE19935303.4 1999-07-28
DE1999135303 DE19935303A1 (de) 1999-07-28 1999-07-28 Oligonukleotide zur Inhibierung der Expression von humanem eg5

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP20000953119 EP1204742A2 (de) 1999-07-28 2000-07-21 Oligonukleotide zur inhibierung der expression von humanem eg5
JP2001512871A JP2003505080A (ja) 1999-07-28 2000-07-21 ヒトeg5の発現を阻害するためのオリゴヌクレオチド
CA 2380192 CA2380192A1 (en) 1999-07-28 2000-07-21 Oligonucleotides for inhibiting the expression of human eg5

Publications (2)

Publication Number Publication Date
WO2001007602A2 true true WO2001007602A2 (de) 2001-02-01
WO2001007602A3 true WO2001007602A3 (de) 2001-05-17

Family

ID=7916259

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2000/007345 WO2001007602A3 (de) 1999-07-28 2000-07-21 Oligonukleotide zur inhibierung der expression von humanem eg5

Country Status (8)

Country Link
US (1) US6472521B1 (de)
EP (1) EP1204742A2 (de)
JP (1) JP2003505080A (de)
CN (1) CN1165617C (de)
CA (1) CA2380192A1 (de)
DE (1) DE19935303A1 (de)
RU (1) RU2249458C2 (de)
WO (1) WO2001007602A3 (de)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001031335A2 (en) * 1999-10-27 2001-05-03 Cytokinetics, Inc. Cell proliferation diagnosis and screening for modulators
US6440686B1 (en) 2000-06-15 2002-08-27 Cytokinetics, Inc. Methods for screening and therapeutic applications of kinesin modulators
WO2003030832A2 (en) * 2001-10-12 2003-04-17 Chiron Corporation Antisense therapy using oligonucleotides that target human kinesin genes for treatment of cancer
US6809102B2 (en) 2001-03-29 2004-10-26 Bristol-Myers Squibb Company Cyano-substituted dihydropyrimidine compounds and their use to treat diseases
EP1506216A2 (de) * 2002-05-23 2005-02-16 Isis Pharmaceuticals, Inc. Antisense-modulierung der kinesin-like-1-expression
US6900214B2 (en) 2001-03-29 2005-05-31 Bristol-Myers Squibb Company Cyano-substituted dihydropyrimidine compounds and their use to treat diseases
EP1687449A2 (de) * 2003-11-17 2006-08-09 Isis Pharmaceuticals, Inc. Antisense-modulation der expression von kinesin-like 1
US9498540B2 (en) 2013-03-15 2016-11-22 Novartis Ag Cell proliferation inhibitors and conjugates thereof

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1620449A4 (de) * 2003-02-14 2008-10-01 Smithkline Beecham Corp Differenziell exprimierte nukleinsäuren, die mit der ksp-expression in wechselwirkung stehen
US7662581B1 (en) 2003-12-18 2010-02-16 Novartis Vaccines And Diagnostics, Inc. Eg5 co-crystals
ES2360073T3 (es) * 2004-03-23 2011-05-31 Oncotherapy Science, Inc. Método para diagnosticar cáncer de pulmón de células no pequeñas.
US7700567B2 (en) 2005-09-29 2010-04-20 Supergen, Inc. Oligonucleotide analogues incorporating 5-aza-cytosine therein
CN101448849B (zh) 2006-03-31 2013-08-21 阿尔尼拉姆医药品有限公司 抑制Eg5基因表达的组合物和方法
RU2464030C2 (ru) * 2006-05-26 2012-10-20 Регадо Байосайенсиз, Инк. Введение противосвертывающей системы reg1
KR20090015118A (ko) * 2006-05-26 2009-02-11 레가도 바이오사이언스, 인코포레이티드 Reg1 항응고계의 투여
CA2704853C (en) * 2007-11-06 2017-08-15 Eugen Uhlmann Immune stimulatory oligoribonucleotide analogs containing modified oligophosphate moieties
DE102010007562A1 (de) 2010-02-10 2011-08-11 sterna biologicals GmbH & Co KG, 35043 Dermatologische, pharmazeutische Zusammensetzung geeignet für Oligonukleotide
CA2845585A1 (en) 2011-08-30 2013-03-07 Astex Pharmaceuticals, Inc. Decitabine derivative formulations

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0726274A2 (de) * 1995-01-31 1996-08-14 Hoechst Aktiengesellschaft G-Cap stabilisierte Oligonucleotide

Family Cites Families (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0171066A3 (de) 1984-08-09 1989-02-01 Siemens Aktiengesellschaft Verfahren und Schaltungsanordnung zum Adressieren von Signalabgabe-/Signalaufnahmeeinrichtungen von einer zentralen Verarbeitungseinrichtung her
EP0464638B1 (de) 1990-07-02 1997-04-02 Hoechst Aktiengesellschaft Oligonucleotid-analoge mit terminalen 3'-3'-bzw. 5'-5'-Internucleotidverknüpfungen
FI115214B (fi) 1992-01-22 2005-03-31 Hoechst Ag Menetelmä oligonukleotidianalogien valmistamiseksi ja niiden käyttö
US6033909A (en) 1992-01-22 2000-03-07 Hoechst Aktiengesellschaft Oligonucleotide analogs, their preparation and use
EP0593901B2 (de) 1992-09-24 2008-04-09 Sanofi-Aventis Deutschland GmbH Oligoribonucleotid- und Ribozym-Analoga mit terminalen 3'-3'-bzw.5'-5'-Verknüpfungen
GB9311113D0 (en) * 1993-05-28 1993-07-14 Medical Res Council Probes
DE4321946A1 (de) 1993-07-01 1995-01-12 Hoechst Ag Methylphosphonsäureester, Verfahren zu deren Herstellung und deren Verwendung
US5801154A (en) * 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
DE4338704A1 (de) 1993-11-12 1995-05-18 Hoechst Ag Stabilisierte Oligonucleotide und deren Verwendung
DE4408528A1 (de) 1994-03-14 1995-09-28 Hoechst Ag Peptid-Oligonucleotid-Derivate, deren Herstellung und Verwendung
DE4415370A1 (de) 1994-05-02 1995-11-09 Hoechst Ag Modifizierte Oligonukleotide, deren Herstellung sowie deren Verwendung
DE4438918A1 (de) 1994-11-04 1996-05-09 Hoechst Ag Modifizierte Oligonukleotide, deren Herstellung sowie deren Verwendung
EP0739898B1 (de) 1995-03-13 2001-09-26 Aventis Pharma Deutschland GmbH Phosphonomonoesternnukleinsäuren, Verfahren zu ihrer Herstellung und ihre Verwendung
US6309821B1 (en) * 1996-05-16 2001-10-30 Incyte Genomics, Inc. DNA encoding a PAC10 human homolog
EP1066382A1 (de) * 1997-07-23 2001-01-10 BRIGHAM & WOMEN'S HOSPITAL, INC. Lensepithelzellen erhältlicher wachstumsfaktor
WO1999038972A9 (en) * 1998-01-28 2001-05-17 Chiron Corp Human genes and gene expression products ii

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0726274A2 (de) * 1995-01-31 1996-08-14 Hoechst Aktiengesellschaft G-Cap stabilisierte Oligonucleotide

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KAISER ASTRID ET AL: "All-trans-retinoic acid-mediated growth inhibition involves inhibition of human kinesin-related protein HsEg5." JOURNAL OF BIOLOGICAL CHEMISTRY, Bd. 274, Nr. 27, 2. Juli 1999 (1999-07-02), Seiten 18925-18931, XP002162883 ISSN: 0021-9258 *
PEYMAN A ET AL: "MINIMALLY MODIFIED OLIGONUCLEOTIDES-COMBINATION OF END-CAPPING AND PYRIMIDINE-PROTECTION" BIOLOGICAL CHEMISTRY HOPPE-SEYLER,DE,WALTER DE GRUYTER, BERLIN, Bd. 377, Nr. 1, 1996, Seiten 67-70, XP002041771 ISSN: 0177-3593 in der Anmeldung erw{hnt *
WALCZAK CLAIRE E ET AL: "A model for the proposed roles of different microtubule-based motor proteins in establishing spindle bipolarity." CURRENT BIOLOGY, Bd. 8, Nr. 16, 30. Juli 1998 (1998-07-30), Seiten 903-913, XP000990308 ISSN: 0960-9822 *

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6617115B1 (en) 1999-10-27 2003-09-09 Cytokinetics, Inc. Methods of screening for modulators of cell proliferation
WO2001031335A3 (en) * 1999-10-27 2001-11-01 Christophe Beraud Cell proliferation diagnosis and screening for modulators
WO2001031335A2 (en) * 1999-10-27 2001-05-03 Cytokinetics, Inc. Cell proliferation diagnosis and screening for modulators
EP1726954A3 (de) * 1999-10-27 2007-06-13 Cytokinetics, Inc. Screening-Verfahren für Zellproliferationsmodulatoren und Verfahren zur Diagnose von Zellproliferationsstadien
EP1726954A2 (de) * 1999-10-27 2006-11-29 Cytokinetics, Inc. Screening-Verfahren für Zellproliferationsmodulatoren und Verfahren zur Diagnose von Zellproliferationsstadien
US6613540B1 (en) 2000-06-15 2003-09-02 Cytokinetics, Inc. Methods for screening and therapeutic applications of kinesin modulators
US7341845B2 (en) 2000-06-15 2008-03-11 Cytokinetics, Inc. Method for identifying kinesin inhibitors
US7005272B2 (en) 2000-06-15 2006-02-28 Cytokinetics, Inc. Methods for screening and therapeutic applications of kinesin modulators
US6440686B1 (en) 2000-06-15 2002-08-27 Cytokinetics, Inc. Methods for screening and therapeutic applications of kinesin modulators
US6809102B2 (en) 2001-03-29 2004-10-26 Bristol-Myers Squibb Company Cyano-substituted dihydropyrimidine compounds and their use to treat diseases
US6900214B2 (en) 2001-03-29 2005-05-31 Bristol-Myers Squibb Company Cyano-substituted dihydropyrimidine compounds and their use to treat diseases
WO2003030832A2 (en) * 2001-10-12 2003-04-17 Chiron Corporation Antisense therapy using oligonucleotides that target human kinesin genes for treatment of cancer
WO2003030832A3 (en) * 2001-10-12 2003-11-27 Chiron Corp Antisense therapy using oligonucleotides that target human kinesin genes for treatment of cancer
US8470795B2 (en) 2002-05-23 2013-06-25 Isis Pharmaceuticals, Inc. Antisense modulation of kinesin-like 1 expression
US8865884B2 (en) 2002-05-23 2014-10-21 Isis Pharmaceuticals, Inc. Antisense modulation of kinesin-like 1 expression
EP1506216A4 (de) * 2002-05-23 2007-08-29 Isis Pharmaceuticals Inc Antisense-modulierung der kinesin-like-1-expression
EP1506216A2 (de) * 2002-05-23 2005-02-16 Isis Pharmaceuticals, Inc. Antisense-modulierung der kinesin-like-1-expression
US7718628B2 (en) 2002-05-23 2010-05-18 Isis Pharmaceuticals, Inc. Antisense modulation of kinesin-like 1 expression
EP1687449A2 (de) * 2003-11-17 2006-08-09 Isis Pharmaceuticals, Inc. Antisense-modulation der expression von kinesin-like 1
EP2253706A3 (de) * 2003-11-17 2012-10-31 Isis Pharmaceuticals, Inc. Antisense-Modulation von Kinesin-1-Expression
EP1687449A4 (de) * 2003-11-17 2007-08-22 Isis Pharmaceuticals Inc Antisense-modulation der expression von kinesin-like 1
US9498540B2 (en) 2013-03-15 2016-11-22 Novartis Ag Cell proliferation inhibitors and conjugates thereof

Also Published As

Publication number Publication date Type
CN1165617C (zh) 2004-09-08 grant
DE19935303A1 (de) 2001-02-08 application
CN1367828A (zh) 2002-09-04 application
CA2380192A1 (en) 2001-02-01 application
EP1204742A2 (de) 2002-05-15 application
WO2001007602A3 (de) 2001-05-17 application
RU2249458C2 (ru) 2005-04-10 grant
US6472521B1 (en) 2002-10-29 grant
JP2003505080A (ja) 2003-02-12 application

Similar Documents

Publication Publication Date Title
Shea et al. Synthesis, hybridization properties and antiviral activity of lipid-oligodeoxynucleotide conjugates
US6184212B1 (en) Antisense modulation of human mdm2 expression
Manoharan Oligonucleotide conjugates as potential antisense drugs with improved uptake, biodistribution, targeted delivery, and mechanism of action
US5886165A (en) Mixed backbone antisense oligonucleotides containing 2'-5'-ribonucleotide- and 3'-5'-deoxyribonucleotides segments
US5985558A (en) Antisense oligonucleotide compositions and methods for the inibition of c-Jun and c-Fos
US5877309A (en) Antisense oligonucleotides against JNK
US6096720A (en) Liposomal oligonucleotide compositions
US6133031A (en) Antisense inhibition of focal adhesion kinase expression
US5929226A (en) Antisense oligonucleotide alkylphosphonothioates and arylphospohonothioates
US6013639A (en) G cap-stabilized oligonucleotides
US6043352A (en) 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides
Micklefield Backbone modification of nucleic acids: synthesis, structure and therapeutic applications
AGRAWAL et al. Mixed backbone oligonucleotides: improvement in oligonucleotide-induced toxicity in vivo
US5532130A (en) Methods and compositions for sequence-specific hybridization of RNA by 2'-5' oligonucleotides
US6111094A (en) Enhanced antisense modulation of ICAM-1
US5801154A (en) Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5693773A (en) Triplex-forming antisense oligonucleotides having abasic linkers targeting nucleic acids comprising mixed sequences of purines and pyrimidines
US5643890A (en) Synthetic oligonucleotides which mimic telomeric sequences for use in treatment of cancer and other diseases
US6677445B1 (en) Chimeric antisense oligonucleotides and cell transfecting formulations thereof
US6080580A (en) Antisense oligonucleotide modulation of tumor necrosis factor-α (TNF-α) expression
US20050176018A1 (en) Chemically modified double stranded nucleic acid molecules
US6410323B1 (en) Antisense modulation of human Rho family gene expression
US6007995A (en) Antisense inhibition of TNFR1 expression
Agrawal Importance of nucleotide sequence and chemical modifications of antisense oligonucleotides
US7176296B2 (en) Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 147541

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2000953119

Country of ref document: EP

ENP Entry into the national phase in:

Ref document number: 1162002

Country of ref document: SK

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2002/000817

Country of ref document: MX

Ref document number: 1162002

Country of ref document: SK

WWE Wipo information: entry into national phase

Ref document number: 008108293

Country of ref document: CN

Ref document number: 200200655

Country of ref document: ZA

Ref document number: 2002/00655

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: P20020075A

Country of ref document: HR

Ref document number: PV2002-324

Country of ref document: CZ

Ref document number: 516839

Country of ref document: NZ

Ref document number: 65682/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1020027001188

Country of ref document: KR

Ref document number: 2380192

Country of ref document: CA

ENP Entry into the national phase in:

Ref country code: RU

Ref document number: 2002 2002105021

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1020027001188

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: PV2002-324

Country of ref document: CZ

Ref document number: 2000953119

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 516839

Country of ref document: NZ

WWG Wipo information: grant in national office

Ref document number: 516839

Country of ref document: NZ

WWW Wipo information: withdrawn in national office

Ref document number: 2000953119

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: PV2002-324

Country of ref document: CZ