WO2000075304A1 - Immunostimulant oligonucleotide - Google Patents

Immunostimulant oligonucleotide Download PDF

Info

Publication number
WO2000075304A1
WO2000075304A1 PCT/FR2000/001566 FR0001566W WO0075304A1 WO 2000075304 A1 WO2000075304 A1 WO 2000075304A1 FR 0001566 W FR0001566 W FR 0001566W WO 0075304 A1 WO0075304 A1 WO 0075304A1
Authority
WO
WIPO (PCT)
Prior art keywords
characterized
oligonucleotide according
oligonucleotide
tt
preceding
Prior art date
Application number
PCT/FR2000/001566
Other languages
French (fr)
Inventor
Monique Bachy
Régis SODOYER
Emmanuelle Trannoy
Original Assignee
Aventis Pasteur
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to FR99/07457 priority Critical
Priority to FR9907457 priority
Priority to FR9910378A priority patent/FR2797263B1/en
Priority to FR99/10378 priority
Application filed by Aventis Pasteur filed Critical Aventis Pasteur
Publication of WO2000075304A1 publication Critical patent/WO2000075304A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/18Type of nucleic acid acting by a non-sequence specific mechanism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates

Abstract

The invention relates to an oligonucleotide which can stimulate human cells of the immune system, characterized in that it comprises at least one nucleotide sequence of formula 5'TTN1N2TT3' wherein T represents thymine, and N1 and N2 can both represent adenine, thymine, cytosine or guanine. The invention is further characterized in that it is devoid of the CG dinucleotide in which cytosine C is not methylated. One oligonucleotide of particular interest has the following sequence: 5'TTAGTTCTTAGTTN3TTAGTT 3'. Said oligonucleotide can be used in a particularly advantageous manner as an adjuvant for vaccines.

Description

Oligonucleotide IMMUNE

The present invention relates to the field of immune boosters. More particularly, the invention relates to oligonucleotides capable of stimulating human cells involved in the immune system, and their use as a vaccine adjuvant.

A large number of oligonucleotides have been described in the prior art, in relation to their immonostimulantes properties. Thus, the EP0468520 application discloses immunostimulatory polynucleotides comprise a simple linear DNA strand comprising nucleotides 10 to 100 chaining according to one palindromic sequence.

According to WO 96/02555, the immunostimulatory activity of oligonucleotides is linked to the presence of a dinucléotique sequence 5 'CG 3' wherein C is not methylated, the immunostimulatory activity is stronger if the pattern CG is preceded 5 'GA dinucleotide and / or followed by 3' dinucleotide TC or TT.

By cons, according to the patent application WO 98/52962, it is not necessary that the oligonucleotides have at least 8 nucleotides as was described above, or their sequence is a palindrome, not even they understand CG dinucleotide; thus, this application describes the following 3 oligonucleotides for use as a vaccine adjuvant: 5 'GACGTT 3', 5 'GAGCTT 3' and 5 'TCCGGA 3'.

According to US Patent 5,663,153, the immunostimulatory activity of oligonucleotides is not linked to the nucleotide sequence, but in the nature of the linkage between nucleotides, the presence of at least one phosphorothioate linkage for inducing stimulation immune system.

Most prior art tests to evaluate the immunostimulatory activity of oligonucleotides proposed are carried out either in vitro animal cells (mostly murine cells) or in vivo in mice. However, the differences between the immune system of mice and of humans, led to differences between the results obtained from mouse cells and those obtained on human cells. It is not certain that all the oligonucleotides have been described as immunostimulatory in the prior art are effectively vis-à-vis the human being.

Yet the pharmaceutical industry has a great need for immuno can be administered to humans, especially in the field of vaccines.

The present invention therefore aims to provide oligonucleotides capable of stimulating the immune system cells of the human being.

To achieve this object, the invention relates to an oligonucleotide capable of stimulating human immune cells characterized in that it comprises at least one sequence 5 'TT TT Ni N 2 3' wherein T is thymine, and Ni and N 2 may each represent adenine, thymine, cytosine or guanine, and in that it is devoid of CG dinucleotide in which the C Cytosine would not be methylated.

The invention also relates to the use of such an oligonucleotide for the manufacture of a medicament.

According to one characteristic of the invention, the oligonucleotide comprises from 6 to 100 nucleotides.

According to a particular feature, the oligonuclétide according to the invention is characterized in that Ni represents Adenine and in that N 2 is guanine.

According to another characteristic, the oligonucleotide according to the invention is characterized in that the pattern 5 'TT TT Ni N 2 3' is repeated at least 1 time. According to another characteristic, the oligonucleotide according to the invention is characterized in that the ground pattern 5 'TT TT Ni N 2 3' is repeated 2 times.

According to another characteristic, the oligonucleotide according to the invention is characterized in that the repeat units 5 'TT N Ni 2 TT 3' are separated by one nucleotide N 3 which may in each case be identical or different and can represent A , C, T or G.

According to a particular characteristic, the oligonucleotide according to the invention is characterized in that the nucleotide N 3 separating the first two units TTNιN 2 TT read when the sequence is oriented 5 '-> 3' is cytosine.

According to another characteristic, the oligonucleotide according to the invention is characterized in that it comprises the sequence 5 'TTAGTTCTTAGTTN TTAGTT 3 3', wherein A represents adenine, T thymine, G guanine and C cytosine and wherein N 3 can mean A, T, C or G.

According to another characteristic, the oligonucleotide according to the invention is capable of inducing the proliferation of human lymphocytes.

According to another characteristic, the oligonucleotide according to the invention is capable of increasing the expression of the CD86 activation marker and CD25 receptor on human B lymphocytes.

According to another characteristic, the oligonucleotide according to the invention is capable of inducing the secretion of cytokines.

The invention also relates to a vaccine adjuvant characterized in that it comprises at least one oligonucleotide capable of stimulating human immune system cells having at least a 5 'sequence TT TT Ni N 2 3' wherein T is thymine and Ni and N 2 may each represent adenine, thymine, cytosine or guanine, the oligonucleotide being devoid of dinucleotide sequence CG wherein the C Cytosine would not methylated.

The invention also relates to a vaccine composition for human use comprising at least one vaccine antigen characterized in that it further comprises at least one oligonucleotide capable of stimulating human immune system cells having at least a 5 'sequence TT Ni TT N 2 3 'wherein T is thymine, and Ni, and N 2 may each represent adenine, thymine, cytosine or guanine, the oligonucleotide being devoid of CG dinucleotide sequence in which cytosine C would unmethylated .

The present invention will be better understood on reading the description which follows, with reference to Figures 1 to 11 which illustrate the results obtained during the tests described in Examples 2 to 7. In particular, Figures 1 and 2 indicate the number of strokes per minutes obtained in the test of example.

Figures 3 and 5 show the percentage of CD20 + cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 1.

Similarly, Figures 4 and 6 show the percentage of CD20 + cells expressing the CD86 marker.

Figure 7 shows the number of counts per minute obtained in the test of Example 4.

Figure 8 shows the percentage of CD20 + cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 4. Similarly, Figure 9 shows the percentage of CD20 + cells expressing the CD86 marker.

Figure 10 shows the number of spots measured for the secretion of γ interferon by cells stimulated in the presence of the oligonucleotides having the sequences 9-12 described in Example 4.

Figure 11 shows the number of spots measured for IL-10 secretion by cells stimulated in the presence of the oligonucleotides having the sequences 9-12 I described in Example 4. For oligonucleotide as defined in the present invention means a polynucleotide comprising at least 6 nucleotides. Contrary to the teaching of the article entitled "CpG DNA in bacteήal directly trigger B-cell activation," Krieg et al., Nature 1995, it was noticed that it was not necessary that the oligonucleotide is at least 8 nucleotides. For cons, the upper limit of the size of the oligonucleotides is not really determined. However, it is noted that more I oligonucleotide will be longer, its purification will be difficult to perform during the synthesis steps, and the cost will be high. On the other hand, it is likely that a large oligonucleotide length will have more difficulties to enter cells. Also, for purposes of the present invention, it is considered that limiting the size of the 100 nucleotide oligonucleotide is appropriate. This oligonucleotide is preferably a single-stranded oligonucleotide; it can be an oligodeoxyribonucleotide or an oligoribonucleotide. have been obtained particularly good results using an oligodeoxyribonucleotide. Oligonucleotides suitable for use in the invention may be in the form of phosphodiester or, to be more stable in the form of phosphorothioates or hybrids phosphodiester / phosphorothioate. The phosphorothioate oligonucleotides are those preferred.

The oligonucleotide according to the invention is capable of stimulating human immune cells such as B lymphocytes, T lymphocytes, monocytes and dendritic cells. This stimulation is assessed by lymphoproliferation or by expression of markers such as CD25 cytokine receptor or the activation marker CD86 on lymphocytes B. It is possible to select the interest oligonucleotides by tests different from those proposed in this application, provided, however, whether the tests assessing human cell stimulation capacity, and not as in most of the documents of the prior art, tests evaluating the ability stimulation of murine cells. It would be particularly possible to test the expression of other B cell activation markers such as CD69 marker, or the expression of proliferation markers such as Ki67 marker; tests relating to the increase of activation markers and maturation of dendritic cells could also be used. Similarly, tests for the assessment of the increase in production of certain cytokines can also be used.

According to one characteristic of the invention, the oligonucleotide comprises at least one nucleotide sequence 5 'TT TT Ni N 2 3' wherein T is thymine, and Ni, and N 2 may each represent adenine, thymine, cytosine or Guanine. This formula thus covers 16 opportunities. This sequence may be 5 'terminus, 3' terminus or be surrounded by other nucleotides. It can be single or repeated several times with identical within the same oligonucleotide. An oligonucleotide according to the invention may also comprise multiple different sequences each corresponding to the pattern 5 'TT TT Ni N 2 3'.

According to the invention, the oligonucleotide does not include a palindromic sequence. Despite this lack of palindromic sequence, such an oligonucleotide is capable of stimulating the human immune system cells.

According to one characteristic, the oligonucleotide according to the invention is devoid of CG dinucleotide in which cytosine is not methylated. This exclusion applies also to pattern N ^. The ability of the oligonucleotides of the prior art to be immunostimulatory has almost always been interpreted as related to the presence of unmethylated CpG motifs (see in particular Article Krieg et al in Nature in April 1995 cited above) this interpretation is consistent with the observation that the frequency of this dinucleotide was about 4 times higher in the genome of bacteria than for vertebrates. Surprisingly, it has now been found that completely lack this dinucleotide motif oligonucleotides, however, were perfectly capable of stimulating the cells of the human immune system.

According to a particular embodiment of the present invention, the NιN pattern 2 corresponds to the dinucleotide AG, wherein A stands for Adenine and Guanine G stands. According to an advantageous characteristic, the pattern 5 'TTAGTT 3' is repeated at least once in the oligonucleotide, and preferably at least 2 times. More preferably, the repeating units are separated by at least one nucleotide N 3, which represents Adenine, Cytosine, Guanine or Thymine. Inside of an oligonucleotide, the nucleotide separation can be always the same, or be different each time. Preferably, the nucleotide separating the first 2 TTAGTT units of the oligonucleotide, (when considering the direction of reading 5 '→ 3') consists of cytosine. In particular, oligonucleotides whose nucleotide sequences correspond to the formula 5 'TTAGTTCTTAGTTN TTAGTT 3 3', wherein N 3 is A, T, C or G, are those preferred for the purposes of the present invention.

According to a particular characteristic, the oligonucleotide according to the invention is devoid or depleted nucleotide sequence capable of inhibiting the cells of the human immune system. Indeed, to obtain an overall immunostimulatory effect, if inhibitors or neutralizing motifs such as, for example, those described in WO 98/52581 are present, it is necessary that their effect is eliminated or reduced, thanks to the presence an effect more pronounced immunostimulating sequence, or due to the presence of a larger number of sequences 5 'TT TT Ni N 2 3'.

The present invention also relates to a vaccine adjuvant comprising at least one immunostimulatory oligonucleotide having at least one unit 5 'TT N Ni 2 TT 3' as mentioned above. By vaccine adjuvant is defined as a product that can increase or modify the immune system response of an organism with respect to administration of an antigen. In particular, there may be an increase in humoral or cellular response. The action of a vaccine adjuvant may also be, not an increase in response which would occur in the absence of adjuvant, but a different orientation of the produced response: for example, referral to a cellular response rather than a humoral response, production of certain cytokines rather than others, producing certain types or subtypes of antibodies rather than others, stimulation of certain cells rather than others, etc .. the immunostimulatory oligonucleotide of present invention can be used as vaccine adjuvant whatever the nature of the antigen administered and regardless of the number of valences used. It can be the only adjuvant used or, alternatively, be an element of a combination adjuvant.

The adjuvant action of the oligonucleotide according to the invention can be obtained either when combined with the antigen or antigen upon administration, ie when part of the same vaccine composition, or when is administered separately from the antigen or antigens. however it is preferred to use it in the same vaccine composition that the antigen or antigens to be administered.

The oligonucleotide according to the invention may advantageously be administered by any route that could be used for a vaccine composition: mucosally or systemically.

It is an object of the invention is a vaccine composition comprising at least an immunostimulatory oligonucleotide having a sequence 5'-TT NιN Î 2 T 3 'as described above.

A vaccine composition according to the invention may be intended for immunization against a single disease, or for immunization against many diseases. It may be a liquid vaccine composition or a lyophilized composition. It may include, in addition to antigens, or all of the components usually present in a vaccine such as buffers, stabilizers, preservatives, etc .... It may also comprise one or more adjuvant (s) other (s) than objects of the present invention. It may also comprise several adjuvants objects of the present invention comprise either oligonucleotides all having the same motif 5 'TT Ni N 2 TT 3' but differing by the nucleotides 5 'and / or 3', or by oligonucleotides having units 5 'TT TT 3 Ni 2 N different, the sequences of 5' and 3 'are identical or different. The vaccine composition according to the invention may be for a prophylactic or therapeutic administration.

The vaccine composition according to the invention may be formulated so as to optimize the adjuvant action of the object oligonucleotide of the invention. Thus, the oligonucleotide may be coupled to a lipid, such as cholesterol; it may be incorporated into an oil-emulsion / water or formulated as liposomes.

The following examples illustrate particular embodiments of the present invention.

Example 1: Synthesis of oligonucleotides

15 was synthesized oligonucleotides each having one of the following units

5'TTAATT 3 '5'TTACTT 3'

Series 5'TTATTT 3 '5'TTAGTT 3'

5'-TTTTTT 3 '

5 'TTTATT 3'

T series

5 'TTTCTT 3'

5 'TTTGTT 3'

Figure imgf000010_0001

series C

Figure imgf000010_0002
G series

Figure imgf000011_0001

And with 4 adenine 5 'and 5 Adénine 3'.

The synthesis of these oligonucleotides is carried out using a synthesizer supplied by Applied Biosystems controller which implements the standard chemical phosphoramidite method and which comprises in each cycle an oxidation step, which is carried out using a solution tetraethylthiuram / acetonitrile to obtain a phosphorothioate linkage.

is further prepared, in the same way, an oligonucleotide A15 (S) that comprises only A and which is phosphorothioate throughout its length. This oligonucleotide is a negative control because it involves neither growth nor increased expression of activation markers on B cells

Was also prepared 3Db oligonucleotide (S) whose sequence is identified in the patent application WO96 / 02555 as SEQ ID NO: 15 (5'GAGAACGCTCGACCTTCGAT3 '); this oligonucleotide comprises phosphorothioate linkages throughout its length and is used as a positive control.

All oligonucleotides are maintained in solution in PBS buffer. Example 2 Test Lvmphoprolifération

Isolating lymphocytes from peripheral blood of a donor, by conducting a centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2x10 6 cells / ml in culture medium (RPMI 1640 + 10% Fetal Calf Serum as well as glutamine, streptomycin and penicillin).

The cells are distributed in 96-well plates (round bottom) at 100 .mu.l, 2.10 or 5 cells per well. a 4μM solution is then added 100 .mu.l of test oligonucleotides produced in Example 1 (1 single type of oligonucleotide per well) to obtain a final concentration 2 .mu.M.

The cells were incubated for 48 to 72 hours.

The tritiated thymidine (Amersham TRK 120) was diluted in culture medium and distributed in the plates at 1 .mu.Ci per well in 50 .mu.l. After 7-8 hours of incubation in an incubator (5% CO 2, 37 ° C), the plates can be frozen at -80 ° C and treated later. Using the "Harvester" is harvesting the contents of the wells on the plates Unifilter GF / C and is carried out 6 washes with distilled water followed by washing in 70% ethanol to precipitate the DNA.

After drying the plates, 25 .mu.l of scintillation fluid (Microscint-40, Packard) are dispensed into each well and used to quantify the radioactivity (radiation emitted by the tritium) by measuring the number of counts / minute (cpm) emitted by each well on the Top Count counter (Packard).

The results obtained for each of the test oligonucleotides are shown in Figures 1 and 2 which indicate, for each oligonucleotide tested the number of strokes per minute; it is noted that all the oligonucleotides of the invention have a significantly higher value to the result obtained with medium alone or negative control A15 (S), meaning that they are capable of stimulating the proliferation of lymphocytes. Example 3:

Test on activation markers

The test is performed from isolated lymphocytes from a donor as described in the previous example, and adjusted to 2x10 6 cells / ml in the same culture medium.

The cells were then distributed in 12-well plates in a volume of 2 ml, 4.10 6 cells / well. Was added to each well an amount of oligonucleotides to be tested prepared in Example 1 (1 oligonucleotide / well) sufficient to obtain an oligonucleotide concentration 2 .mu.M. The cells are then incubated for 72 hours at 37 ° C. The cells were then doubly labeled by CD25PE / or CD20FITC CD86PE / CD20FITC then analyzed on FACScan. The results obtained are illustrated in Figures 3, 4, 5 and 6 which represent for each test oligonucleotide, the percentage of B cells (CD20 +) which express the CD25 receptor (those which are CD25 +) or the CD86 marker (those that are CD86 + ). The results shown in Figures 3 and 4 were obtained in a test performed at a different time of the test whose results are illustrated in Figures 5 and 6, which explains the difference of order of magnitude of results obtained. Indeed, in this kind of manipulations, tests are highly variable from one dose to another, only the results obtained during the same test are comparable, hence the need to include in each test , an oligonucleotide and a metering-control medium alone.

It is noted that all the oligonucleotides objects of the invention activate the B cells that express CD86 activation marker and the cytokine receptor CD25. Example 4:

Is prepared in the same manner as in Example 1, a series of 16 oligonucleotides whose sequences are the following:

SEQ ID 1: 5 'TTAGTTATTAGTTATTAGTT 3'

Seq ID 2: 5 'TTAGTTATTAG IIIII AGTT 3'

SEQ ID 3: 5 'TTAGTTATTAGTTCTTAGTT 3' Seq ld 4: 5 'TTAGTTATTAGTTGTTAGTT 3'

Seq ID 5: 5 'TTAG IIIII AGTTATTAGTT 3'

Seq ld β: 5 'AG TTAG IIIII IIIII AGTT 3'

Seq ID 7: 5 'TTAG IIIII AGTTCTTAGTT 3'

SEQ ID 8: 5 'TTAG IIII IAGTTGTTAGTT 3' SEQ ID 9: 5 'TTAGTTCTTAGTTATTAGTT 3'

SEQ ID 10: 5'-AGTT TTAGTTCTTAG IIIII 3 '

SEQ ID 11: 5'TTAGTTCTTAGTTCTTAGTT 3 '

SEQ ID 12: 5'TTAGTTCTTAGTTGTTAGTT 3 '

SEQ ID 13: 5'TTAGTTGTTAGTTATTAGTT 3 'SEQ ID 14: 5'-AGTT TTAGTTGTTAG IIIII 3'

SEQ ID 15: 5'TTAGTTGTTAGTTCTTAGTT 3 '

SEQ ID 16: 5'TTAGTTGTTAGTTGTTAGTT 3 '

These oligonucleotides are phosphorothioate type over their entire length.

Example 5:

Assessing the ability of the oligonucleotides prepared in Example 4 to induce human lymphocyte proliferation by a lymphoproliferation assay as described in Example 2. In the same manner as in Example 2 the oligonucleotide concentration per well is 2 .mu.m, and controls consist of medium alone, oligonucleotide A15 (S) and the oligonucleotide 3Db (S).

The results obtained, expressed as counts per minute, are shown in Figure 7 which shows that all the oligonucleotides of the invention are capable of inducing cell proliferation and that particularly good results are obtained when the oligonucleotide sequences are those identified by Seq Id 9 to 12, ie when the Cytosine separates the first 2 TTNιN 2 TT units of the oligonucleotide.

example 6

It assesses the ability that have the oligonucleotides prepared in Example 4 to induce expression of the CD86 activation marker and CD25 receptor on B cells This evaluation is carried out using the test described in Example 3. the results obtained with the oligonucleotides prepared according to example 4 are shown in Figures 8 and 9 which illustrate the percentages of cells B (CD20 +), which also express the CD25 receptor (Figure 8) or the CD86 marker (Figure 9). The results obtained in this test confirm those obtained in the test lymphoproliferation All oligonucleotides according to the invention induce the expression of activation markers on human B lymphocytes; Particularly good results are obtained when the first 2 TTN units 1 2 N TT of the oligonucleotide are separated by a Cytosine.

Example 7:

the capacity is evaluated that have the oligonucleotides according to the present invention to induce the secretion of cytokines.

For this evaluation, isolating lymphocytes from peripheral blood of a donor, by conducting a centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2x10 6 cells / ml in culture medium (AIM V + streptomycin + penicillin).

96-well ELISPOT plates (flat bottom nitrocellulose) are preincubated the day before with a solution of cytokine capture antibody (IL-1O or IFN-g according to the test performed), then saturated with the culture medium.

Then distributes 100 .mu.l of cells in the ELISPOT plates or 2.10 5 cells per well, then a 4μM solution was added 100 .mu.l of oligonucleotides to be tested, produced according to Example 4 (only 1 type of oligonucleotide per well) to to obtain a final concentration 2 .mu.M. The test is performed with oligonucleotides having the sequences described under SEQ ID 9, SEQ ID 10, SEQ ID 11 and SEQ ID 12.

The plates were incubated at 37 ° C under atmosphere of 5% CO 2. After 72 hours incubation, cells are washed in the presence of detergent (Tween 1%) and cytokines attached to the capture antibodies are revealed by the successive addition of biotynylés detection antibody (anti-IL -10 or anti-IFN-g according to the test performed), streptavidin-HRP and AEC substrate.

Spots (1 spot corresponding to one secreting cell cytokine) are counted with an automatic counter. The results are expressed in number of spots (number of secreting cells) per million cells.

The results obtained for each of the test oligonucleotides are shown in Figures 10 and 11 which indicate, for each oligonucleotide tested the number of cells secreting cytokine per million total cells; it is noted that all the oligonucleotides of the invention have a significantly higher value to the result obtained with medium alone or negative control A15 (S), which means that they are all capable of inducing the secretion of cytokines, in particular of IL 10 and interferon γ.

Claims

claims
1. immunostimulatory oligonucleotide, characterized in that it comprises at least one nucleotide sequence having the following formula
5 'TTNιN 2 TT 3', wherein T is thymine, Ni, and N 2 may each represent adenine, thymine, cytosine or guanine, and in that it is devoid of CG dinucleotide in which the C Cytosine would not methylated.
2. Oligonucleotide according to claim 1, characterized in that it comprises from 6 to 100 nucleotides.
3. Oligonucleotide according to claim 1, characterized in that Ni represents Adenine and in that N 2 is guanine.
4. Oligonucleotide according to one of the preceding claims, characterized in that the pattern 5 'TT TT Ni N 2 3' is repeated at least 1 time.
5. Oligonucleotide according to the preceding claim characterized in that the pattern 5 'TT TT Ni N 2 3' is repeated 2 times.
6. Oligonucleotide according to one of claims 4 and 5, characterized in that the repeat units 5 'TT N Ni 2 TT 3' are separated by one nucleotide N 3 which may in each case be identical or different and can represent A, C T or G.
7. Oligonucleotide according to the preceding claim, characterized in that the nucleotide N 3 separating the two first patterns TT TT read Ni N 2 when the sequence is oriented 5 '→ 3' is cytosine.
8. Oligonucleotide according to one of the preceding claims, characterized in that it comprises the sequence 5 'TTAGTTCTTAGTTN TTAGTT 3 3', wherein A represents adenine, T thymine, G guanine and C cytosine, and wherein N 3 can mean A, T, C or G.
9. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of inducing the proliferation of human lymphocytes.
10. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of inducing the secretion of cytokines.
11. Oligonucleotide according to the preceding claim, characterized in that it is capable of inducing secretion of IL-10.
12. Oligonucleotide according to claim 10, characterized in that it is capable of inducing the interferon γ secretion.
13. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of increasing the expression of the CD86 activation marker on human B lymphocytes.
14. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of increasing the expression of CD25 cytokine receptor on human B lymphocytes.
15. Use of an oligonucleotide according to one of the preceding claims for the manufacture of a medicament.
16. Use of an oligonucleotide according to one of claims 1 to 10 for the manufacture of a human immunostimulant.
17. Use of an oligonucleotide according to one of claims 1 to 10 for the manufacture of a vaccine adjuvant.
18. Use of an oligonucleotide according to one of claims 1 to 10 for the manufacture of a vaccine composition.
19. A vaccine composition for human use, comprising at least one vaccine antigen, characterized in that it further comprises at least one oligonucleotide according to one of claims 1 to 10
PCT/FR2000/001566 1999-06-08 2000-06-08 Immunostimulant oligonucleotide WO2000075304A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
FR99/07457 1999-06-08
FR9907457 1999-06-08
FR9910378A FR2797263B1 (en) 1999-08-06 1999-08-06 immunostimulatory oligonucleotide
FR99/10378 1999-08-06

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
NZ51595700A NZ515957A (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide
CA 2376634 CA2376634A1 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide
EP20000940454 EP1196558A1 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide
AU55389/00A AU776268B2 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide

Publications (1)

Publication Number Publication Date
WO2000075304A1 true WO2000075304A1 (en) 2000-12-14

Family

ID=26234986

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2000/001566 WO2000075304A1 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide

Country Status (5)

Country Link
EP (1) EP1196558A1 (en)
AU (1) AU776268B2 (en)
CA (1) CA2376634A1 (en)
NZ (1) NZ515957A (en)
WO (1) WO2000075304A1 (en)

Cited By (52)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
WO2006071997A2 (en) 2004-12-30 2006-07-06 3M Innovative Properties Company Treatment for cutaneous metastases
US7179253B2 (en) 2003-03-13 2007-02-20 3M Innovative Properties Company Method of tattoo removal
DE102006007433A1 (en) * 2006-02-17 2007-08-23 Curevac Gmbh Immunostimulant adjuvant useful in vaccines against cancer or infectious diseases comprises a lipid-modified nucleic acid
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US7299453B2 (en) 2001-12-20 2007-11-20 International Business Machines Corporation Testing measurements
US7375180B2 (en) 2003-02-13 2008-05-20 3M Innovative Properties Company Methods and compositions related to IRM compounds and Toll-like receptor 8
US7387271B2 (en) 2002-12-30 2008-06-17 3M Innovative Properties Company Immunostimulatory combinations
US7427629B2 (en) 2002-08-15 2008-09-23 3M Innovative Properties Company Immunostimulatory compositions and methods of stimulating an immune response
US7485432B2 (en) 2003-02-27 2009-02-03 3M Innovative Properties Company Selective modulation of TLR-mediated biological activity
US7696159B2 (en) 2003-03-25 2010-04-13 Graceway Pharmaceuticals, Llc Treatment for basal cell carcinoma
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US7923560B2 (en) 2003-04-10 2011-04-12 3M Innovative Properties Company Delivery of immune response modifier compounds
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US8110582B2 (en) 2003-03-04 2012-02-07 3M Innovative Properties Company Prophylactic treatment of UV-induced epidermal neoplasia
US8217016B2 (en) 2001-12-19 2012-07-10 Curevac Gmbh Application of mRNA for use as a therapeutic agent for tumorous diseases
WO2013013055A1 (en) 2011-07-21 2013-01-24 Rubigo Therapeutics, Inc. System for drug delivery and monitoring
US8426457B2 (en) 2003-03-13 2013-04-23 Medicis Pharmaceutical Corporation Methods of improving skin quality
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8691837B2 (en) 2003-11-25 2014-04-08 3M Innovative Properties Company Substituted imidazo ring systems and methods
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US8871782B2 (en) 2003-10-03 2014-10-28 3M Innovative Properties Company Alkoxy substituted imidazoquinolines
US8940755B2 (en) 2003-12-02 2015-01-27 3M Innovative Properties Company Therapeutic combinations and methods including IRM compounds
US8951528B2 (en) 2006-02-22 2015-02-10 3M Innovative Properties Company Immune response modifier conjugates
US8961477B2 (en) 2003-08-25 2015-02-24 3M Innovative Properties Company Delivery of immune response modifier compounds
US8968746B2 (en) 2010-07-30 2015-03-03 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9107958B2 (en) 2011-06-03 2015-08-18 3M Innovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9226959B2 (en) 2008-01-31 2016-01-05 Curevac Ag Nucleic acids comprising formula (NuGlXmGnNv)a and derivatives thereof as immunostimulating agent/adjuvant
US9248127B2 (en) 2005-02-04 2016-02-02 3M Innovative Properties Company Aqueous gel formulations containing immune response modifiers
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9303079B2 (en) 2012-03-30 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
EP3001990A1 (en) 2004-05-28 2016-04-06 Oryxe A mixture for transdermal delivery of low& and high molecular weight compounds
US9314535B2 (en) 2009-09-03 2016-04-19 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9475804B2 (en) 2011-06-03 2016-10-25 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9572874B2 (en) 2008-09-30 2017-02-21 Curevac Ag Composition comprising a complexed (M)RNA and a naked mRNA for providing or enhancing an immunostimulatory response in a mammal and uses thereof
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US10111967B2 (en) 2007-09-04 2018-10-30 Curevac Ag Complexes of RNA and cationic peptides for transfection and for immunostimulation
US10188748B2 (en) 2001-06-05 2019-01-29 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
WO2019166946A1 (en) 2018-02-28 2019-09-06 Pfizer Inc. Il-15 variants and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995026204A1 (en) * 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1998037919A1 (en) * 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995026204A1 (en) * 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1998037919A1 (en) * 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BOGGS, R. ET AL.: "CHARACTERIZATION AND MODULATION OF IMMUNE STIMULATION BY MODIFIED OLIGONUCLEOTIDES.", ANTISENSE & NUCLEIC ACID DRUG DEVELOPMENT, vol. 7, October 1997 (1997-10-01), pages 461-471, XP002053418, ISSN: 1087-2906 *
KRIEG A M ET AL: "CPG MOTIFS IN BACTERIAL DNA TRIGGER DIRECT B-CELL ACTIVATION", NATURE, vol. 374, pages 546-549, XP000197060, ISSN: 0028-0836 *
LANG R ET AL: "GUANOSINE-RICH OLIGODEOXYNUCLEOTIDES INDUCE PROLIFERATION OF MACROPHAGE PROGENITORS IN CULTURES OF MURINE BONE MARROW CELLS", EUROPEAN JOURNAL OF IMMUNOLOGY, vol. 29, no. 11, November 1999 (1999-11-01), pages 3496 - 3506, XP000876859, ISSN: 0014-2980 *
LIANG, H. ET AL.: "Activation of human B cells by phosphorothioate oligodeoxynucleotides", J. CLIN. INVEST. (1996), 98(5), 1119-1129, XP002130608 *
PARRONCHI, P. ET AL.: "Phosphorothioate oligodeoxynucleotides promote the in vitro development of human allergen-specific CD4+ T cells into Th1 effectors", J. IMMUNOL. 163(11), 5946-5953, 1 December 1999 (1999-12-01), XP002130609 *

Cited By (106)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7879810B2 (en) 1994-07-15 2011-02-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US10188748B2 (en) 2001-06-05 2019-01-29 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US8217016B2 (en) 2001-12-19 2012-07-10 Curevac Gmbh Application of mRNA for use as a therapeutic agent for tumorous diseases
US9655955B2 (en) 2001-12-19 2017-05-23 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US9463228B2 (en) 2001-12-19 2016-10-11 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US9439956B2 (en) 2001-12-19 2016-09-13 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US9433670B2 (en) 2001-12-19 2016-09-06 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US9433669B2 (en) 2001-12-19 2016-09-06 Curevac Ag Application of mRNA for use as a therapeutic against tumor diseases
US9155788B2 (en) 2001-12-19 2015-10-13 Curevac Gmbh Application of mRNA for use as a therapeutic against tumour diseases
US7299453B2 (en) 2001-12-20 2007-11-20 International Business Machines Corporation Testing measurements
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7943316B2 (en) 2002-05-30 2011-05-17 David Horn, Llc Immunostimulatory oligonucleotides and uses thereof
US7381807B2 (en) 2002-05-30 2008-06-03 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7427629B2 (en) 2002-08-15 2008-09-23 3M Innovative Properties Company Immunostimulatory compositions and methods of stimulating an immune response
EP2269632A2 (en) 2002-08-15 2011-01-05 3M Innovative Properties Co. Immunostimulatory compositions and methods of stimulating an immune response
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
EP2572715A1 (en) 2002-12-30 2013-03-27 3M Innovative Properties Company Immunostimulatory Combinations
US7387271B2 (en) 2002-12-30 2008-06-17 3M Innovative Properties Company Immunostimulatory combinations
US8329197B2 (en) 2002-12-30 2012-12-11 3M Innovative Properties Company Ex vivo uses of immunostimulatory combinations
EP2572714A1 (en) 2002-12-30 2013-03-27 3M Innovative Properties Company Immunostimulatory Combinations
US10105426B2 (en) 2002-12-30 2018-10-23 Trustees Of Dartmouth College Immunostimulatory combinations
US7375180B2 (en) 2003-02-13 2008-05-20 3M Innovative Properties Company Methods and compositions related to IRM compounds and Toll-like receptor 8
US7485432B2 (en) 2003-02-27 2009-02-03 3M Innovative Properties Company Selective modulation of TLR-mediated biological activity
US8110582B2 (en) 2003-03-04 2012-02-07 3M Innovative Properties Company Prophylactic treatment of UV-induced epidermal neoplasia
US8426457B2 (en) 2003-03-13 2013-04-23 Medicis Pharmaceutical Corporation Methods of improving skin quality
US7179253B2 (en) 2003-03-13 2007-02-20 3M Innovative Properties Company Method of tattoo removal
US7696159B2 (en) 2003-03-25 2010-04-13 Graceway Pharmaceuticals, Llc Treatment for basal cell carcinoma
US8835394B2 (en) 2003-03-25 2014-09-16 Medicis Pharmaceutical Corporation Treatment for basal cell carcinoma
US7923560B2 (en) 2003-04-10 2011-04-12 3M Innovative Properties Company Delivery of immune response modifier compounds
US8961477B2 (en) 2003-08-25 2015-02-24 3M Innovative Properties Company Delivery of immune response modifier compounds
US8871782B2 (en) 2003-10-03 2014-10-28 3M Innovative Properties Company Alkoxy substituted imidazoquinolines
US8691837B2 (en) 2003-11-25 2014-04-08 3M Innovative Properties Company Substituted imidazo ring systems and methods
US8940755B2 (en) 2003-12-02 2015-01-27 3M Innovative Properties Company Therapeutic combinations and methods including IRM compounds
EP3001990A1 (en) 2004-05-28 2016-04-06 Oryxe A mixture for transdermal delivery of low& and high molecular weight compounds
WO2006071997A2 (en) 2004-12-30 2006-07-06 3M Innovative Properties Company Treatment for cutaneous metastases
EP2394650A1 (en) 2004-12-30 2011-12-14 3M Innovative Properties Co. Use of resiquimod for the treatment of cutaneous metastases
US10071156B2 (en) 2005-02-04 2018-09-11 3M Innovative Properties Company Aqueous gel formulations containing immune response modifiers
US9248127B2 (en) 2005-02-04 2016-02-02 3M Innovative Properties Company Aqueous gel formulations containing immune response modifiers
DE102006007433A1 (en) * 2006-02-17 2007-08-23 Curevac Gmbh Immunostimulant adjuvant useful in vaccines against cancer or infectious diseases comprises a lipid-modified nucleic acid
US8951528B2 (en) 2006-02-22 2015-02-10 3M Innovative Properties Company Immune response modifier conjugates
EP3085373A1 (en) 2006-02-22 2016-10-26 3M Innovative Properties Company Immune response modifier conjugates
US10111967B2 (en) 2007-09-04 2018-10-30 Curevac Ag Complexes of RNA and cationic peptides for transfection and for immunostimulation
US9226959B2 (en) 2008-01-31 2016-01-05 Curevac Ag Nucleic acids comprising formula (NuGlXmGnNv)a and derivatives thereof as immunostimulating agent/adjuvant
US9572874B2 (en) 2008-09-30 2017-02-21 Curevac Ag Composition comprising a complexed (M)RNA and a naked mRNA for providing or enhancing an immunostimulatory response in a mammal and uses thereof
US9314535B2 (en) 2009-09-03 2016-04-19 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US9907862B2 (en) 2009-09-03 2018-03-06 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US8968746B2 (en) 2010-07-30 2015-03-03 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
US9447164B2 (en) 2010-08-06 2016-09-20 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US10064959B2 (en) 2010-10-01 2018-09-04 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9475804B2 (en) 2011-06-03 2016-10-25 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US9107958B2 (en) 2011-06-03 2015-08-18 3M Innovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
EP3153180A1 (en) 2011-06-03 2017-04-12 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US10406142B2 (en) 2011-06-03 2019-09-10 3M Lnnovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
US9585968B2 (en) 2011-06-03 2017-03-07 3M Innovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
US9902724B2 (en) 2011-06-03 2018-02-27 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
WO2013013055A1 (en) 2011-07-21 2013-01-24 Rubigo Therapeutics, Inc. System for drug delivery and monitoring
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9295689B2 (en) 2011-12-16 2016-03-29 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9271996B2 (en) 2011-12-16 2016-03-01 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9303079B2 (en) 2012-03-30 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9221891B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. In vivo production of proteins
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9233141B2 (en) 2012-04-02 2016-01-12 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9220792B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides encoding aquaporin-5
US9220755B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US9216205B2 (en) 2012-04-02 2015-12-22 Moderna Therapeutics, Inc. Modified polynucleotides encoding granulysin
US9192651B2 (en) 2012-04-02 2015-11-24 Moderna Therapeutics, Inc. Modified polynucleotides for the production of secreted proteins
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9050297B2 (en) 2012-04-02 2015-06-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9149506B2 (en) 2012-04-02 2015-10-06 Moderna Therapeutics, Inc. Modified polynucleotides encoding septin-4
US9114113B2 (en) 2012-04-02 2015-08-25 Moderna Therapeutics, Inc. Modified polynucleotides encoding citeD4
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US9301993B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides encoding apoptosis inducing factor 1
US9089604B2 (en) 2012-04-02 2015-07-28 Moderna Therapeutics, Inc. Modified polynucleotides for treating galactosylceramidase protein deficiency
US9675668B2 (en) 2012-04-02 2017-06-13 Moderna Therapeutics, Inc. Modified polynucleotides encoding hepatitis A virus cellular receptor 2
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9061059B2 (en) 2012-04-02 2015-06-23 Moderna Therapeutics, Inc. Modified polynucleotides for treating protein deficiency
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
WO2019166946A1 (en) 2018-02-28 2019-09-06 Pfizer Inc. Il-15 variants and uses thereof

Also Published As

Publication number Publication date
NZ515957A (en) 2003-08-29
EP1196558A1 (en) 2002-04-17
CA2376634A1 (en) 2000-12-14
AU5538900A (en) 2000-12-28
AU776268B2 (en) 2004-09-02

Similar Documents

Publication Publication Date Title
Verthelyi et al. Human peripheral blood cells differentially recognize and respond to two distinct CPG motifs
Jørgensen et al. CpG oligodeoxynucleotides and plasmid DNA stimulate Atlantic salmon (Salmo salar L.) leucocytes to produce supernatants with antiviral activity
US8153608B2 (en) Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides
US7001890B1 (en) Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
Estes et al. Type 1 and type 2 responses in regulation of Ig isotype expression in cattle
AU775185B2 (en) Immunostimulatory nucleic acid molecules
CN102604957B (en) Stabilized immunomodulatory oligonucleotide
AU783687B2 (en) Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
US7943316B2 (en) Immunostimulatory oligonucleotides and uses thereof
CA2624755C (en) Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
Krieg et al. Mechanisms and therapeutic applications of immune stimulatory CpG DNA
DE69819150T3 (en) Immunostimulatory oligonucleotide, compositions thereof, and methods for use thereof
Cho et al. Immunostimulatory DNA-based vaccines induce cytotoxic lymphocyte activity by a T-helper cell-independent mechanism
US7935675B1 (en) Immunostimulatory nucleic acid molecules
US7223741B2 (en) Immunostimulatory nucleic acid molecules
US7148191B2 (en) Antigenic composition
ES2628744T3 (en) Methods and products to induce immunity in mucous membranes
ES2536103T3 (en) Immunostimulatory oligonucleotides
US20040058883A1 (en) Oligonucleotide compositions and their use for the modulation of immune responses
Lipford et al. Immunostimulatory DNA: sequence‐dependent production of potentially harmful or useful cytokines
US7276489B2 (en) Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
CN1309418C (en) Immunostimulatory oligodeoxynucleotides
US7405285B2 (en) Immunostimulatory oligonucleotide multimers
Agrawal et al. Medicinal chemistry and therapeutic potential of CpG DNA
US7713535B2 (en) Modulation of immunostimulatory properties by small oligonucleotide-based compounds

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000940454

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 55389/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 515957

Country of ref document: NZ

ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2376634

Kind code of ref document: A

Format of ref document f/p: F

Ref document number: 2376634

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 09980265

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 2000940454

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: JP

WWG Wipo information: grant in national office

Ref document number: 55389/00

Country of ref document: AU

WWR Wipo information: refused in national office

Ref document number: 2000940454

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000940454

Country of ref document: EP