WO2000075304A1 - Immunostimulant oligonucleotide - Google Patents

Immunostimulant oligonucleotide Download PDF

Info

Publication number
WO2000075304A1
WO2000075304A1 PCT/FR2000/001566 FR0001566W WO0075304A1 WO 2000075304 A1 WO2000075304 A1 WO 2000075304A1 FR 0001566 W FR0001566 W FR 0001566W WO 0075304 A1 WO0075304 A1 WO 0075304A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
oligonucleotide according
oligonucleotides
cytosine
cells
Prior art date
Application number
PCT/FR2000/001566
Other languages
French (fr)
Inventor
Monique Bachy
Régis SODOYER
Emmanuelle Trannoy
Original Assignee
Aventis Pasteur
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from FR9910378A external-priority patent/FR2797263B1/en
Application filed by Aventis Pasteur filed Critical Aventis Pasteur
Priority to EP00940454A priority Critical patent/EP1196558A1/en
Priority to CA002376634A priority patent/CA2376634A1/en
Priority to AU55389/00A priority patent/AU776268B2/en
Priority to NZ515957A priority patent/NZ515957A/en
Publication of WO2000075304A1 publication Critical patent/WO2000075304A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/18—Type of nucleic acid acting by a non-sequence specific mechanism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates

Definitions

  • the present invention relates to the field of immunostimulants. More particularly, the invention relates to oligonucleotides capable of stimulating human cells intervening in the immune system, and to their use as a vaccine adjuvant.
  • EP0468520 describes immunostimulatory polynucleotides consisting of a single strand of linear DNA comprising from 10 to 100 nucleotides linked together according to a palindromic sequence.
  • the immunostimulatory activity of oligonucleotides is linked to the presence of a dinucleotic sequence 5 'CG 3', in which C is not methylated, the immunostimulatory activity being stronger if the motif CG is preceded in 5 'by the dinucleotide GA and / or followed in 3' by the dinucleotide TC or also TT.
  • the immunostimulatory activity of oligonucleotides is not linked to the nucleotide sequence, but to the nature of the bond between nucleotides, the presence of at least one phosphorothioate bond making it possible to induce stimulation of the immune system.
  • the present invention therefore aims to provide oligonucleotides capable of stimulating cells of the human immune system.
  • the subject of the invention is an oligonucleotide capable of stimulating human cells of the immune system, characterized in that it comprises at least one 5 'TT Ni N 2 TT 3' sequence in which T is Thymine, and Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine, and in that it is devoid of CG dinucleotide in which Cytosine C is not methylated.
  • the invention also relates to the use of such an oligonucleotide for the manufacture of a medicament.
  • the oligonucleotide comprises from 6 to 100 nucleotides.
  • the oligonucleotide according to the invention is characterized in that Ni represents Adenine and in that N 2 represents Guanine.
  • the oligonucleotide according to the invention is characterized in that the motif 5 'TT Ni N 2 TT 3' is repeated at least 1 time. According to another characteristic, the oligonucleotide according to the invention is characterized in that the motif motif 5 'TT Ni N 2 TT 3' is repeated 2 times.
  • the oligonucleotide according to the invention is characterized in that the repeat units 5 'TT Ni N 2 TT 3' are separated by a nucleotide N 3 which can be identical or different each time and which can represent A , C, T or G.
  • the oligonucleotide according to the invention is characterized in that the nucleotide N 3 separating the first 2 motifs TTN ⁇ N 2 TT read when the sequence is oriented 5 '->3' represents Cytosine.
  • the oligonucleotide according to the invention is characterized in that it comprises the sequence 5 'TTAGTTCTTAGTTN 3 TTAGTT 3', in which A represents Adenine, T Thymine, G Guanine, and C Cytosine , and in which N 3 can signify A, T, C or G.
  • the oligonucleotide according to the invention is capable of inducing the proliferation of human lymphocytes.
  • the oligonucleotide according to the invention is capable of increasing the expression of the CD86 activation marker and of the CD25 receptor on human B lymphocytes.
  • the oligonucleotide according to the invention is capable of inducing the secretion of cytokines.
  • the subject of the invention is also a vaccine adjuvant, characterized in that it comprises at least one oligonucleotide capable of stimulating human cells of the immune system having at least one sequence 5 'TT Ni N 2 TT 3' in which T is Thymine and, Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine, the oligonucleotide being devoid of CG dinucleotide sequence in which Cytosine C is not methylated.
  • the subject of the invention is also a vaccine composition for human use comprising at least one vaccine antigen characterized in that it further comprises at least one oligonucleotide capable of stimulating human cells of the immune system having at least one 5 ′ sequence TT Ni N 2 TT 3 'in which T signifies Thymine and, Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine, the oligonucleotide being devoid of CG dinucleotide sequence in which Cytosine C would not be methylated .
  • FIGS. 1 to 11 illustrate the results obtained during the tests described in Examples 2 to 7.
  • FIGS. 1 and 2 indicate the number of Strokes per Minutes obtained in the example test.
  • Figures 3 and 5 indicate the percentage of CD20 + cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 1.
  • Figures 4 and 6 show the percentage of CD20 + cells expressing the CD86 marker.
  • Figure 7 shows the number of Strokes per Minute obtained in the test of Example 4.
  • Figure 8 indicates the percentage of CD20 + cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 4.
  • Figure 9 indicates the percentage of CD20 + cells expressing the CD86 marker.
  • FIG. 10 indicates the number of spots measured for the secretion of Interferon ⁇ by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
  • FIG. 11 indicates the number of spots measured for the secretion of IL10 by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
  • oligonucleotide within the meaning of the present invention means a polynucleotide comprising at least 6 nucleotides. Indeed, contrary to the teaching of the article entitled “CpG motifs in bacte ⁇ al DNA trigger direct B-cell activation", Krieg et al., Nature 1995, it was noted that the oligonucleotide was not necessary have at least 8 nucleotides. On the other hand, the upper limit of the size of the oligonucleotides is not really determined.
  • oligonucleotide the more difficult it will be to purify during the synthesis steps, and the higher the cost price.
  • a very long oligonucleotide will have more difficulty entering cells.
  • limiting the size of the oligonucleotide to 100 nucleotides is appropriate.
  • This oligonucleotide is preferably a single stranded oligonucleotide; it can be an oligodeoxyribonucleotide or an oligoribonucleotide. Particularly good results have been obtained using an oligodeoxyribonucleotide.
  • oligonucleotides suitable for the purposes of the invention may be in the form of phosphodiester or, in order to be more stable, in the form of phosphorothioates or of phosphodiester / phosphorothioate hybrids.
  • the phosphorothioate oligonucleotides are those preferred.
  • the oligonucleotide according to the invention is capable of stimulating human cells of the immune system, such as B lymphocytes, T lymphocytes, monocytes and dendritic cells. This stimulation is appreciated in particular by lymphoproliferation or by the expression of markers, such as the cytokine receptor CD25 or the activation marker CD86 on B lymphocytes. It is possible to select the oligonucleotides of interest by means of tests different from those proposed in the present application, provided however that these are tests evaluating the stimulation capacity of human cells, and not as in most documents of the prior art, tests evaluating the capacity of stimulation of murine cells.
  • the oligonucleotide comprises at least one nucleotide sequence 5 'TT Ni N 2 TT 3' in which T signifies Thymine and, Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine.
  • T signifies Thymine
  • Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine.
  • This formula thus covers 16 possibilities.
  • This sequence can be 5 'terminal, 3' terminal or be surrounded by other nucleotides. It can be unique or repeated several times identically within the same oligonucleotide.
  • An oligonucleotide according to the invention can also comprise several different sequences each corresponding to the 5 ′ TT Ni N 2 TT 3 ′ motif.
  • the oligonucleotide does not contain a palindromic sequence. Despite this absence of palindromic sequence, such an oligonucleotide is capable of stimulating human cells of the immune system.
  • the oligonucleotide according to the invention is devoid of CG dinucleotide in which the Cytosine is not methylated. This exclusion also applies to pattern N ⁇ .
  • the capacity of the oligonucleotides of the prior art to be immunostimulants has almost always been interpreted as linked to the presence of unmethylated CpG motifs (cf. in particular the article by Krieg et al in Nature of April 1995 cited above), this interpretation being consistent with the observation that the frequency of this dinucleotide was approximately 4 times greater in the genome of bacteria than in that of vertebrates.
  • oligonucleotides entirely devoid of this dinucleotide motif are however perfectly capable of stimulating cells of the human immune system.
  • the N ⁇ N 2 motif corresponds to the dinucleotide AG, in which A signifies Adenine and G signifies Guanine.
  • the 5 ′ TTAGTT 3 ′ motif is repeated at least once in the oligonucleotide, and preferably at least 2 times. More preferably, the repeating units are separated by at least one nucleotide N 3 , which represents Adenine, Cytosine, Guanine or Thymine. Inside an oligonucleotide, this separation nucleotide can always be the same, or be different each time.
  • the nucleotide separating the first 2 TTAGTT motifs from the oligonucleotide (when we consider the direction of reading 5 ' ⁇ 3') consists of Cytosine.
  • the oligonucleotides whose nucleotide sequences correspond to the formula 5 'TTAGTTCTTAGTTN 3 TTAGTT 3', in which N 3 represents A, T, C or G, are those preferred within the meaning of the present invention.
  • the oligonucleotide according to the invention is devoid or depleted in nucleotide sequence capable of inhibiting cells of the human immune system.
  • inhibiting or neutralizing motifs such as, for example, those described in application WO 98/52581 are present, their effect must be suppressed or reduced, thanks to the presence of a sequence with a more pronounced immunostimulatory effect, or thanks to the presence of a greater number of sequences 5 ′ TT Ni N 2 TT 3 ′.
  • the present invention also relates to a vaccine adjuvant comprising at least one immunostimulatory oligonucleotide having at least one 5 ′ TT Ni N 2 TT 3 ′ motif as mentioned above.
  • vaccine adjuvant is meant a product which makes it possible to increase or modify the response of the immune system of an organism with regard to the administration of an antigen. In particular, it may be an increase in the humoral response or the cellular response.
  • the action of a vaccine adjuvant can also be, not an increase in the response which would occur in the absence of an adjuvant, but a different orientation from the response produced: for example, orientation towards a cellular response rather than humoral response, production of certain cytokines rather than others, production of certain types or subtypes of antibodies rather than others, stimulation of certain cells rather than others, etc.
  • the immunostimulatory oligonucleotide of the present invention can be used as a vaccine adjuvant regardless of the nature of the antigen administered and regardless of the number of valences used. It can be the only adjuvant used or, on the contrary, be an element of an adjuvant combination.
  • the adjuvant action of the oligonucleotide according to the invention can be obtained, either when it is combined with the antigen or antigens during their administration, ie when they are part of the same vaccine composition, or when is administered separately from the antigen or antigens. However, it is preferred to use it in the same vaccine composition as the antigen or antigens to be administered.
  • oligonucleotide according to the invention can advantageously be administered by any route capable of being used for a vaccine composition: mucosal route or systemic route.
  • One of the objects of the invention is a vaccine composition
  • a vaccine composition comprising at least one immunostimulatory oligonucleotide having a sequence 5 ′ TT N ⁇ N 2 Î T 3 ′ as described above.
  • a vaccine composition according to the invention can be intended for immunization against a single disease, or intended for immunization against several diseases. It can be a liquid vaccine composition or a lyophilized composition. It can include, in addition to antigens, all or part of the components usually present in a vaccine such as buffers, stabilizers, preservatives, etc. It can also include one or more adjuvant (s) other than those which are the subject of the present invention.
  • the vaccine composition according to the invention may be intended for prophylactic administration or for therapeutic administration.
  • the vaccine composition according to the invention can be formulated so as to optimize the adjuvant action of the oligonucleotide which is the subject of the invention.
  • the oligonucleotide can be coupled to a lipid, such as cholesterol; it can be integrated into an oil / water type emulsion or formulated in the form of liposomes.
  • oligonucleotides are carried out by means of an automatic synthesizer supplied by Applied Biosystems which implements the standard chemical method with phosphoramidite and which comprises at each cycle an oxidation stage, which is carried out by means of a tetraethylthiuram solution / acetonitrile to obtain a phosphorothioate bond.
  • an automatic synthesizer supplied by Applied Biosystems which implements the standard chemical method with phosphoramidite and which comprises at each cycle an oxidation stage, which is carried out by means of a tetraethylthiuram solution / acetonitrile to obtain a phosphorothioate bond.
  • an A15 (S) oligonucleotide which comprises only A and which is phosphorothioate over its entire length is likewise prepared.
  • This oligonucleotide is a negative control because it does not cause proliferation or increase in the expression of activation markers on B lymphocytes.
  • oligonucleotide 3Db (S) is also prepared, the sequence of which is identified in patent application WO96 / 02555 under SEQ ID No. 15 (5'GAGAACGCTCGACCTTCGAT3 '); this oligonucleotide has phosphorothioate bonds over its entire length and is used as a positive control.
  • Lymphocytes are isolated from the peripheral blood of a donor, by centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2.10 6 cells / ml in culture medium (RPMI 1640 + 10% Fetal Calf Serum as well as Glutamine, Streptomycin and Penicillin).
  • the cells are distributed in 96-well plates (round bottom) under 100 ⁇ l, or 2.10 5 cells per well. Then added 100 ⁇ l of a 4 ⁇ M solution of oligonucleotides to be tested produced in Example 1 (only 1 type of oligonucleotide per well) in order to obtain a final concentration 2 ⁇ M.
  • the cells are incubated for 48 to 72 hours.
  • Tritiated thymidine (Amersham TRK 120) is diluted in culture medium and then distributed in the plates at a rate of 1 ⁇ Ci per well under 50 ⁇ l. After 7 to 8 hours of incubation in an oven (5% CO 2 , 37 ° C), the plates can be frozen at -80 ° C and processed later. Using the "Harvester", the contents of the wells are collected on Unifilter GF / C plates and 6 washes are carried out in distilled water and then washed in 70% ethanol in order to precipitate the DNA.
  • FIGS. 1 and 2 The results obtained for each of the oligonucleotides tested are represented in FIGS. 1 and 2, which indicate, for each oligonucleotide tested, the number of counts per minute; it is noted that all the oligonucleotides according to the invention have a result clearly superior to the result obtained with the medium alone or the negative control A15 (S), which means that they are all capable of stimulating the proliferation of lymphocytes.
  • S negative control A15
  • the test is carried out using lymphocytes isolated from a donor as described in the previous example, and adjusted to 2.10 6 cells / ml in the same culture medium.
  • the cells are then distributed in 12-well plates in a volume of 2 ml, ie 4.10 6 cells / well.
  • a quantity of oligonucleotides to be tested prepared in Example 1 (1 oligonucleotide / well) sufficient to obtain a concentration of oligonucleotide 2 ⁇ M is added to each well.
  • the cells are then incubated for 72 hours at 37 ° C.
  • the cells are then doubly labeled using CD25PE / CD20FITC or CD86PE / CD20FITC and then analyzed on FACScan. The results obtained are illustrated in FIGS.
  • Seq Id 3 5 'TTAGTTATTAGTTCTTAGTT 3'
  • Seq ld 4 5 'TTAGTTATTAGTTGTTAGTT 3'
  • Seq Id 8 5 'TTAG I I I I IAGTTGTTAGTT 3'
  • Seq Id 9 5 'TTAGTTCTTAGTTATTAGTT 3'
  • Seq Id 12 5 'TTAGTTCTTAGTTGTTAGTT 3'
  • Seq Id 13 5 'TTAGTTGTTAGTTATTAGTT 3'
  • Seq Id 14 5 'TTAGTTGTTAG I I I I AGTT 3'
  • oligonucleotides are of phosphorothiate type over their entire length.
  • the capacity of the oligonucleotides prepared in Example 4 to induce the proliferation of human lymphocytes is evaluated by means of a lymphoproliferation test such as that described in Example 2.
  • the concentration in oligonucleotide per well is 2 ⁇ M, and the controls consist of the medium alone, the oligonucleotide A15 (S) as well as the oligonucleotide 3Db (S).
  • Figure 7 shows that all the oligonucleotides according to the invention are capable of inducing the proliferation of lymphocytes and that particularly good results are obtained when the sequences of the oligonucleotides are those identified by Seq Id 9 to 12, ie when Cytosine separates the first 2 TTN ⁇ N 2 TT motifs from the oligonucleotide.
  • the capacity of the oligonucleotides prepared in Example 4 to evaluate the expression of the activation marker CD86 and of the CD25 receptor on B lymphocytes is evaluated. This evaluation is carried out using the test described in Example 3. The results obtained with the oligonucleotides prepared according to Example 4 are shown in Figures 8 and 9 which illustrate the percentages of B cells (CD20 +) which also express the CD25 receptor ( Figure 8) or the CD86 marker ( Figure 9).
  • results obtained in this test confirm those obtained in the lymphoproliferation test: all the oligonucleotides according to the invention induce the expression of activation markers on human B lymphocytes; particularly good results are obtained when the first 2 TTN 1 N 2 TT motifs of the oligonucleotide are separated by a Cytosine.
  • the capacity of the oligonucleotides according to the present invention to induce the secretion of cytokines is evaluated.
  • lymphocytes are isolated from the peripheral blood of a donor, by centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2.10 6 cells / ml in culture medium (AIM V medium + streptomycin + penicillin).
  • 96-well ELISPOT plates flat nitrocellulose bottom
  • IL-1O or IFN ⁇ cytokine capture antibodies
  • oligonucleotides 100 ⁇ l of cells are then distributed in the ELISPOT plates, ie 2.10 5 cells per well, then 100 ⁇ l of a 4 ⁇ M solution of oligonucleotides to be tested, products according to Example 4 (1 single type of oligonucleotide per well) are added in order to to obtain a final concentration of 2 ⁇ M.
  • the test is carried out with the oligonucleotides having the sequences described under Seq Id 9, Seq Id 10, Seq Id 11 and Seq Id 12.
  • the plates are incubated at 37 ° C., under an atmosphere containing 5% CO 2 . After 72 hours of incubation, the cells are eliminated by washing in the presence of detergent (Tween 1%) and the cytokines fixed on the capture antibodies are revealed by the successive addition of biotynylated detection antibodies (anti-IL -10 or anti-IFN ⁇ according to the test carried out), streptavidin-HRP, and the AEC substrate.
  • biotynylated detection antibodies anti-IL -10 or anti-IFN ⁇ according to the test carried out
  • streptavidin-HRP streptavidin-HRP
  • the spots (1 spot corresponding to 1 cytokine secreting cell) are counted using an automatic counter. The results are expressed in number of spots (number of secretory cells) per million cells.
  • FIGS. 10 and 11 The results obtained for each of the oligonucleotides tested are shown in FIGS. 10 and 11, which indicate, for each oligonucleotide tested, the number of cytokine-secreting cells per million total cells; we note that all the oligonucleotides according to the invention have a result clearly superior to the result obtained with the medium alone or the negative control A15 (S), which means that they are all capable of inducing the secretion of cytokines, in particular d 'IL 10 and Interferon ⁇ .

Abstract

The invention relates to an oligonucleotide which can stimulate human cells of the immune system, characterized in that it comprises at least one nucleotide sequence of formula 5'TTN1N2TT3' wherein T represents thymine, and N1 and N2 can both represent adenine, thymine, cytosine or guanine. The invention is further characterized in that it is devoid of the CG dinucleotide in which cytosine C is not methylated. One oligonucleotide of particular interest has the following sequence: 5'TTAGTTCTTAGTTN3TTAGTT 3'. Said oligonucleotide can be used in a particularly advantageous manner as an adjuvant for vaccines.

Description

OLIGONUCLEOTIDE IMMUNOSTIMULANT IMMUNOSTIMULANT OLIGONUCLEOTIDE
La présente invention est relative au domaine des immunostimulants. Plus particulièrement, l'invention concerne des oligonucléotides capables de stimuler des cellules humaines intervenant dans le système immunitaire, et à leur utilisation comme adjuvant vaccinal.The present invention relates to the field of immunostimulants. More particularly, the invention relates to oligonucleotides capable of stimulating human cells intervening in the immune system, and to their use as a vaccine adjuvant.
Un grand nombre d'oligonucléotides ont déjà été décrits dans l'art antérieur, en relation avec leurs propriétés immonostimulantes. Ainsi, la demande EP0468520 décrit des polynucléotides immunostimulants constitués par un simple brin d'ADN linéaire comprenant de 10 à 100 nucléotides s'enchaînant selon une séquence palindromique.A large number of oligonucleotides have already been described in the prior art, in relation to their immunostimulatory properties. Thus, application EP0468520 describes immunostimulatory polynucleotides consisting of a single strand of linear DNA comprising from 10 to 100 nucleotides linked together according to a palindromic sequence.
Selon la demande WO 96/02555, l'activité immunostimulatrice d'oligonucléotides est liée à la présence d'une séquence dinucléotique 5' CG 3', dans laquelle C n'est pas méthylé, l'activité immunostimulante étant plus forte si le motif CG est précédé en 5' du dinucléotide GA et / ou suivi en 3' du dinucléotide TC ou encore TT.According to application WO 96/02555, the immunostimulatory activity of oligonucleotides is linked to the presence of a dinucleotic sequence 5 'CG 3', in which C is not methylated, the immunostimulatory activity being stronger if the motif CG is preceded in 5 'by the dinucleotide GA and / or followed in 3' by the dinucleotide TC or also TT.
Par contre, selon la demande de brevet WO 98/52962, il n'est pas nécessaire que les oligonucléotides aient un minimum de 8 nucléotides comme cela avait été décrit précédemment, ni que leur séquence soit un palindrome, ni même qu'ils comprennent le dinucléotide CG; ainsi, cette demande décrit les 3 oligonucléotides suivants pour leur utilisation en tant qu'adjuvant vaccinal: 5' GACGTT 3', 5' GAGCTT 3', ainsi que 5' TCCGGA 3'.On the other hand, according to patent application WO 98/52962, it is not necessary that the oligonucleotides have a minimum of 8 nucleotides as had been described previously, nor that their sequence is a palindrome, or even that they include the dinucleotide CG; thus, this application describes the following 3 oligonucleotides for their use as a vaccine adjuvant: 5 'GACGTT 3', 5 'GAGCTT 3', as well as 5 'TCCGGA 3'.
Selon le brevet US 5,663,153, l'activité immunostimulante d'oligonucléotides n'est pas liée à la séquence des nucléotides, mais à la nature de la liaison entre nucléotides, la présence d'au moins une liaison phosphorothioate permettant d'induire une stimulation du système immunitaire.According to US Pat. No. 5,663,153, the immunostimulatory activity of oligonucleotides is not linked to the nucleotide sequence, but to the nature of the bond between nucleotides, the presence of at least one phosphorothioate bond making it possible to induce stimulation of the immune system.
La plupart des tests de l'art antérieur pour évaluer l'activité immunostimulante des oligonucléotides proposés, sont effectués soit in vitro sur des cellules animales (essentiellement des cellules murines), soit in vivo sur des souris. Cependant, les différences existant entre le système immunitaire de la souris et celui de l'être humain, ont conduit à des différences entre les résultats obtenus sur des cellules murines et ceux obtenus sur des cellules humaines. Il n'est donc pas certain que tous les oligonucléotides ayant été décrits comme immunostimulants dans l'art antérieur le soient réellement vis-à-vis de l'être humain.Most of the prior art tests for evaluating the immunostimulatory activity of the proposed oligonucleotides are carried out either in vitro on animal cells (mainly murine cells), or in vivo in mice. However, the differences existing between the immune system of the mouse and that of the human being, have led to differences between the results obtained on murine cells and those obtained on human cells. It is therefore not certain that all the oligonucleotides which have been described as immunostimulants in the prior art are actually so vis-à-vis human beings.
Or l'industrie pharmaceutique a un grand besoin d'immunostimulants pouvant être administrés à l'homme, notamment dans le domaine des vaccins.However, the pharmaceutical industry has a great need for immunostimulants which can be administered to humans, in particular in the field of vaccines.
La présente invention a donc pour but de proposer des oligonucléotides capables de stimuler des cellules du système immunitaire de l'être humain.The present invention therefore aims to provide oligonucleotides capable of stimulating cells of the human immune system.
Pour atteindre ce but, l'invention a pour objet un oligonucleotide capable de stimuler des cellules humaines du système immunitaire caractérisé en ce qu'il comprend au moins une séquence 5' T T Ni N2 T T 3' dans laquelle T est la Thymine, et Ni et N2 peuvent chacun représenter l'Adénine, la Thymine, la Cytosine ou la Guanine, et en ce qu'il est dépourvu de dinucléotide CG dans lequel la Cytosine C ne serait pas méthylée.To achieve this object, the subject of the invention is an oligonucleotide capable of stimulating human cells of the immune system, characterized in that it comprises at least one 5 'TT Ni N 2 TT 3' sequence in which T is Thymine, and Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine, and in that it is devoid of CG dinucleotide in which Cytosine C is not methylated.
L'invention a également pour objet l'utilisation d'un tel oligonucleotide pour la fabrication d'un médicament.The invention also relates to the use of such an oligonucleotide for the manufacture of a medicament.
Selon une caractéristique de l'invention, l'oligonucléotide comprend de 6 à 100 nucléotides.According to a characteristic of the invention, the oligonucleotide comprises from 6 to 100 nucleotides.
Selon une caractéristique particulière, l'oligonuclétide selon l'invention est caractérisé en ce que Ni représente l'Adénine et en ce que N2 réprésente la Guanine.According to a particular characteristic, the oligonucleotide according to the invention is characterized in that Ni represents Adenine and in that N 2 represents Guanine.
Selon une autre caractéristique, l'oligonucléotide selon l'invention est caractérisé en ce que le motif 5' T T Ni N2 T T 3' est répété au moins 1 fois. Selon une autre caractéristique, l'oligonucléotide selon l'invention est caractérisé en ce que le motif motif 5' T T Ni N2 T T 3' est répété 2 fois.According to another characteristic, the oligonucleotide according to the invention is characterized in that the motif 5 'TT Ni N 2 TT 3' is repeated at least 1 time. According to another characteristic, the oligonucleotide according to the invention is characterized in that the motif motif 5 'TT Ni N 2 TT 3' is repeated 2 times.
Selon une autre caractéristique, l'oligonucléotide selon l'invention est caractérisé en ce que les motifs répétés 5' T T Ni N2 T T 3' sont séparés par un nucleotide N3 qui peut être à chaque fois identique ou différent et qui peut représenter A, C, T ou G.According to another characteristic, the oligonucleotide according to the invention is characterized in that the repeat units 5 'TT Ni N 2 TT 3' are separated by a nucleotide N 3 which can be identical or different each time and which can represent A , C, T or G.
Selon une caractéristique particulière, l'oligonucléotide selon l'invention est caractérisé en ce que le nucleotide N3 séparant les 2 premiers motifs TTNιN2TT lus lorsque la séquence est orientée 5'->3' représente la Cytosine.According to a particular characteristic, the oligonucleotide according to the invention is characterized in that the nucleotide N 3 separating the first 2 motifs TTNιN 2 TT read when the sequence is oriented 5 '->3' represents Cytosine.
Selon une autre caractéristique, l'oligonucléotide selon l'invention est caractérisé en ce qu'il comprend la séquence 5' TTAGTTCTTAGTTN3TTAGTT 3', dans laquelle A représente l'Adénine, T la Thymine, G la Guanine, et C la Cytosine, et dans laquelle N3 peut signifier A, T, C ou G.According to another characteristic, the oligonucleotide according to the invention is characterized in that it comprises the sequence 5 'TTAGTTCTTAGTTN 3 TTAGTT 3', in which A represents Adenine, T Thymine, G Guanine, and C Cytosine , and in which N 3 can signify A, T, C or G.
Selon une autre caractéristique, l'oligonucléotide selon l'invention est capable d'induire la prolifération des lymphocytes humains.According to another characteristic, the oligonucleotide according to the invention is capable of inducing the proliferation of human lymphocytes.
Selon une autre caractéristique, l'oligonucléotide selon l'invention est capable d'accroître l'expression du marqueur d'activation CD86 et du récepteur CD25 sur les lymphocytes B humains.According to another characteristic, the oligonucleotide according to the invention is capable of increasing the expression of the CD86 activation marker and of the CD25 receptor on human B lymphocytes.
Selon une autre caractéristique, l'oligonucléotide selon l'invention est capable d'induire la sécrétion de cytokines.According to another characteristic, the oligonucleotide according to the invention is capable of inducing the secretion of cytokines.
L'invention a également pour objet un adjuvant vaccinal caractérisé en ce qu'il comprend au moins un oligonucleotide capable de stimuler des cellules humaines du système immunitaire possédant au moins une séquence 5' T T Ni N2 T T 3' dans laquelle T est la Thymine et, Ni et N2 peuvent chacun représenter l'Adénine, la Thymine, la Cytosine ou la Guanine, l'oligonucléotide étant dépourvu de séquence dinucléotidique CG dans laquelle la Cytosine C ne serait pas méthylée.The subject of the invention is also a vaccine adjuvant, characterized in that it comprises at least one oligonucleotide capable of stimulating human cells of the immune system having at least one sequence 5 'TT Ni N 2 TT 3' in which T is Thymine and, Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine, the oligonucleotide being devoid of CG dinucleotide sequence in which Cytosine C is not methylated.
L'invention a également pour objet une composition vaccinale à usage humain comprenant au moins un antigène vaccinal caractérisée en ce qu'elle comprend en outre au moins un oligonucleotide capable de stimuler des cellules humaines du système immunitaire possédant au moins une séquence 5' T T Ni N2 T T 3' dans laquelle T signifie Thymine et, Ni et N2 peuvent chacun représenter l'Adénine, la Thymine, la Cytosine ou la Guanine, l'oligonucléotide étant dépourvu de séquence dinucléotidique CG dans laquelle la Cytosine C ne serait pas méthylée.The subject of the invention is also a vaccine composition for human use comprising at least one vaccine antigen characterized in that it further comprises at least one oligonucleotide capable of stimulating human cells of the immune system having at least one 5 ′ sequence TT Ni N 2 TT 3 'in which T signifies Thymine and, Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine, the oligonucleotide being devoid of CG dinucleotide sequence in which Cytosine C would not be methylated .
La présente invention sera mieux comprise à la lecture de la description qui va suivre, en référence aux figures 1 à 11 qui illustrent les résultats obtenus lors des tests décrits aux exemples 2 à 7. En particulier, les Figures 1 et 2 indiquent le nombre de Coups par Minutes obtenus dans le test de l'Exemple .The present invention will be better understood on reading the description which follows, with reference to FIGS. 1 to 11 which illustrate the results obtained during the tests described in Examples 2 to 7. In particular, FIGS. 1 and 2 indicate the number of Strokes per Minutes obtained in the example test.
Les Figures 3 et 5 indiquent le pourcentage de cellules CD20+ exprimant le récepteur CD25, pour les oligonucléotides obtenus selon l'exemple 1.Figures 3 and 5 indicate the percentage of CD20 + cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 1.
De même, les Figures 4 et 6 indiquent le pourcentage de cellules CD20+ exprimant le marqueur CD86.Likewise, Figures 4 and 6 show the percentage of CD20 + cells expressing the CD86 marker.
La Figure 7 indique le nombre de Coups par Minute obtenus dans le test de l'exemple 4.Figure 7 shows the number of Strokes per Minute obtained in the test of Example 4.
La Figure 8 indique le pourcentage de cellules CD20+ exprimant le récepteur CD25, pour les oligonucléotides obtenus selon l'exemple 4. De même, la Figure 9 indique le pourcentage de cellules CD20+ exprimant le marqueur CD86.Figure 8 indicates the percentage of CD20 + cells expressing the CD25 receptor, for the oligonucleotides obtained according to Example 4. Similarly, Figure 9 indicates the percentage of CD20 + cells expressing the CD86 marker.
La Figure 10 indique le nombre de spots mesurés pour la sécrétion d'Interféron γ par des cellules stimulées en présence des oligonucléotides ayant les séquences 9 à 12 décrites à l'exemple 4.FIG. 10 indicates the number of spots measured for the secretion of Interferon γ by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4.
La Figure 11 indique le nombre de spots mesurés pour la sécrétion d'IL10 par des cellules stimulées en présence des oligonucléotides ayant les séquences 9 à 12 décrites à I' Exemple 4. Par oligonucleotide au sens de la présente invention, on entend un polynucléotide comprenant au moins 6 nucléotides. En effet, contrairement à l'enseignement de l'article intitulé "CpG motifs in bacteήal DNA trigger direct B-cell activation", Krieg et al., Nature 1995, on a remarqué qu'il n'était pas nécessaire que l'oligonucléotide ait au moins 8 nucléotides. Par contre, la limite supérieure de la taille des oligonucléotides n'est pas vraiment déterminée. On peut cependant noter que, plus I' oligonucleotide sera long, plus sa purification sera difficile à effectuer lors des étapes de synthèse , et plus le prix de revient en sera élevé. D'autre part, il est probable qu'un oligonucleotide de grande longueur aura plus de difficultés à pénétrer dans les cellules. Aussi, pour les besoins de la présente invention, on considère qu'une limitation de la taille de l'oligonucléotide à 100 nucléotides est appropriée. Cet oligonucleotide est de préférence un oligonucleotide simple brin; il peut s'agir d'un oligodésoxyribonucléotide ou d'un oligoribonucléotide. On a obtenu de particulièrement bons résultats en utilisant un oligodésoxyribonucléotide. Les oligonucléotides convenant aux fins de l'invention peuvent se présenter sous forme de phosphodiester ou, afin d'être plus stables, sous forme de phosphorothioates ou d'hybrides phosphodiester / phosphorothioates. Les oligonucléotides phosphorothioates sont ceux préférés.FIG. 11 indicates the number of spots measured for the secretion of IL10 by cells stimulated in the presence of the oligonucleotides having the sequences 9 to 12 described in Example 4. By oligonucleotide within the meaning of the present invention means a polynucleotide comprising at least 6 nucleotides. Indeed, contrary to the teaching of the article entitled "CpG motifs in bacteήal DNA trigger direct B-cell activation", Krieg et al., Nature 1995, it was noted that the oligonucleotide was not necessary have at least 8 nucleotides. On the other hand, the upper limit of the size of the oligonucleotides is not really determined. It may however be noted that the longer the oligonucleotide, the more difficult it will be to purify during the synthesis steps, and the higher the cost price. On the other hand, it is likely that a very long oligonucleotide will have more difficulty entering cells. Also, for the purposes of the present invention, it is considered that limiting the size of the oligonucleotide to 100 nucleotides is appropriate. This oligonucleotide is preferably a single stranded oligonucleotide; it can be an oligodeoxyribonucleotide or an oligoribonucleotide. Particularly good results have been obtained using an oligodeoxyribonucleotide. The oligonucleotides suitable for the purposes of the invention may be in the form of phosphodiester or, in order to be more stable, in the form of phosphorothioates or of phosphodiester / phosphorothioate hybrids. The phosphorothioate oligonucleotides are those preferred.
L'oligonucléotide selon l'invention est capable de stimuler des cellules humaines du système immunitaire, telles que les lymphocytes B, les lymphocytes T, les monocytes et les cellules dendritiques. Cette stimulation est appréciée notamment par la lymphoprolifération ou par l'expression de marqueurs, tel que le récepteur de cytokine CD25 ou encore le marqueur d'activation CD86 sur les lymphocytes B. Il est possible de sélectionner les oligonucléotides d'intérêt au moyen de tests différents de ceux proposés dans la présente demande, à condition cependant qu'il s'agisse de tests évaluant la capacité de stimulation de cellules humaines, et non pas comme dans la plupart des documents de l'art antérieur, de tests évaluant la capacité de la stimulation de cellules murines. Il serait notamment possible de tester l'expression d'autres marqueurs d'activation des lymphocytes B tels que les marqueurs CD69, ou l'expression de marqueurs de prolifération tels que le marqueur KI67; des tests relatifs à l'augmentation des marqueurs d'activation et de maturation des cellules dendritiques pourraient également être utilisés. De même, des tests permettant l'appréciation de l'augmentation de production de certaines cytokines peuvent également être utilisés.The oligonucleotide according to the invention is capable of stimulating human cells of the immune system, such as B lymphocytes, T lymphocytes, monocytes and dendritic cells. This stimulation is appreciated in particular by lymphoproliferation or by the expression of markers, such as the cytokine receptor CD25 or the activation marker CD86 on B lymphocytes. It is possible to select the oligonucleotides of interest by means of tests different from those proposed in the present application, provided however that these are tests evaluating the stimulation capacity of human cells, and not as in most documents of the prior art, tests evaluating the capacity of stimulation of murine cells. It would in particular be possible to test the expression of other markers for activating B lymphocytes such as the CD69 markers, or the expression of proliferation markers such as the KI67 marker; tests relating to the increase in activation markers and cell maturation dendritics could also be used. Likewise, tests allowing the appreciation of the increase in production of certain cytokines can also be used.
Selon une caractéristique de l'invention, l'oligonucléotide comprend au moins une séquence nucléotidique 5' T T Ni N2 T T 3' dans laquelle T signifie Thymine et, Ni et N2 peuvent représenter chacun l'Adénine, la Thymine, la Cytosine ou la Guanine. Cette formule couvre ainsi 16 possibilités. Cette séquence peut être 5' terminale, 3' terminale ou être entourée par d'autres nucléotides. Elle peut être unique ou répétée plusieurs fois à l'identique à l'intérieur d'un même oligonucleotide. Un oligonucleotide selon l'invention peut également comprendre plusieurs séquences différentes correspondant chacune au motif 5' T T Ni N2 T T 3'.According to a characteristic of the invention, the oligonucleotide comprises at least one nucleotide sequence 5 'TT Ni N 2 TT 3' in which T signifies Thymine and, Ni and N 2 can each represent Adenine, Thymine, Cytosine or Guanine. This formula thus covers 16 possibilities. This sequence can be 5 'terminal, 3' terminal or be surrounded by other nucleotides. It can be unique or repeated several times identically within the same oligonucleotide. An oligonucleotide according to the invention can also comprise several different sequences each corresponding to the 5 ′ TT Ni N 2 TT 3 ′ motif.
Selon l'invention, l'oligonucléotide ne comporte pas de séquence palindromique. Malgré cette absence de séquence palindromique, un tel oligonucleotide est capable de stimuler des cellules humaines du système immunitaire.According to the invention, the oligonucleotide does not contain a palindromic sequence. Despite this absence of palindromic sequence, such an oligonucleotide is capable of stimulating human cells of the immune system.
Selon une caractéristique, l'oligonucléotide selon l'invention est dépourvu de dinucléotide CG dans lequel la Cytosine ne serait pas méthylée. Cette exclusion s'applique également au motif N^. La capacité des oligonucléotides de l'art antérieur à être immunostimulants a presque toujours été interprétée comme liée à la présence de motifs CpG non méthylés (Cf. notamment l'article de Krieg et al dans Nature d'avril 1995 cité ci-dessus), cette interprétation étant en cohérence avec l'observation selon laquelle la fréquence de ce dinucléotide était environ 4 fois plus importante dans le génome des bactéries que dans celui des vertébrés. De façon surprenante, on a maintenant trouvé que des oligonucléotides entièrement dépourvus de ce motif dinucléotidique étaient cependant parfaitement capables de stimuler les cellules du système immunitaire humain.According to one characteristic, the oligonucleotide according to the invention is devoid of CG dinucleotide in which the Cytosine is not methylated. This exclusion also applies to pattern N ^. The capacity of the oligonucleotides of the prior art to be immunostimulants has almost always been interpreted as linked to the presence of unmethylated CpG motifs (cf. in particular the article by Krieg et al in Nature of April 1995 cited above), this interpretation being consistent with the observation that the frequency of this dinucleotide was approximately 4 times greater in the genome of bacteria than in that of vertebrates. Surprisingly, it has now been found that oligonucleotides entirely devoid of this dinucleotide motif are however perfectly capable of stimulating cells of the human immune system.
Selon un mode de réalisation particulier de la présente invention, le motif NιN2 correspond au dinucléotide AG, dans lequel A signifie Adénine et G signifie Guanine. Selon une caractéristique avantageuse, le motif 5' TTAGTT 3' est répété au moins une fois dans l'oligonucléotide, et de préférence au moins 2 fois. De préférence encore, les motifs répétés sont séparés par au moins un nucleotide N3, qui représente l'Adénine, la Cytosine, la Guanine ou la Thymine. A l'intérieur d'un oligonucleotide, ce nucleotide de séparation peut être toujours le même, ou être différent à chaque fois. De préférence, le nucleotide séparant les 2 premiers motifs TTAGTT de l'oligonucléotide, (lorsque l'on considère le sens de lecture 5'→3') est constitué par la Cytosine. De façon particulière, les oligonucléotides dont les séquences nucléotidiques répondent à la formule 5' TTAGTTCTTAGTTN3TTAGTT 3', dans laquelle N3 représente A, T, C ou G, sont ceux préférés au sens de la présente invention.According to a particular embodiment of the present invention, the NιN 2 motif corresponds to the dinucleotide AG, in which A signifies Adenine and G signifies Guanine. According to an advantageous characteristic, the 5 ′ TTAGTT 3 ′ motif is repeated at least once in the oligonucleotide, and preferably at least 2 times. More preferably, the repeating units are separated by at least one nucleotide N 3 , which represents Adenine, Cytosine, Guanine or Thymine. Inside an oligonucleotide, this separation nucleotide can always be the same, or be different each time. Preferably, the nucleotide separating the first 2 TTAGTT motifs from the oligonucleotide, (when we consider the direction of reading 5 '→ 3') consists of Cytosine. In particular, the oligonucleotides whose nucleotide sequences correspond to the formula 5 'TTAGTTCTTAGTTN 3 TTAGTT 3', in which N 3 represents A, T, C or G, are those preferred within the meaning of the present invention.
Selon une caractéristique particulière, l'oligonucléotide selon l'invention est dépourvu ou appauvri en séquence nucléotidique capable d'inhiber les cellules du système immunitaire humain. En effet, afin d'obtenir un effet global immunostimulant, si des motifs inhibiteurs ou neutralisants tels que, par exemple, ceux décrits dans la demande WO 98/52581 sont présents, il faut que leur effet soit supprimé ou réduit, grâce à la présence d'une séquence à effet immunostimulant plus prononcé, ou grâce à la présence d'un plus grand nombre de séquences 5' T T Ni N2 T T 3'.According to a particular characteristic, the oligonucleotide according to the invention is devoid or depleted in nucleotide sequence capable of inhibiting cells of the human immune system. In fact, in order to obtain an overall immunostimulating effect, if inhibiting or neutralizing motifs such as, for example, those described in application WO 98/52581 are present, their effect must be suppressed or reduced, thanks to the presence of a sequence with a more pronounced immunostimulatory effect, or thanks to the presence of a greater number of sequences 5 ′ TT Ni N 2 TT 3 ′.
La présente invention a également pour objet un adjuvant vaccinal comprenant au moins un oligonucleotide immunostimulant ayant au moins un motif 5' T T Ni N2 T T 3' tel que mentionné ci-dessus. Par adjuvant vaccinal, on entend un produit qui permet d'accroître ou de modifier la réponse du système immunitaire d'un organisme vis à vis de l'administration d'un antigène. En particulier, il peut s'agir d'une augmentation de la réponse humorale ou de la réponse cellulaire. L'action d'un adjuvant vaccinal peut également être, non pas une augmentation de la réponse qui se produirait en l'absence d'adjuvant, mais une orientation différente de la réponse produite : par exemple, orientation vers une réponse cellulaire plutôt qu'une réponse humorale, production de certaines cytokines plutôt que d'autres, production de certains types ou sous-types d'anticorps plutôt que d'autres, stimulation de certaines cellules plutôt que d'autres, etc.. L'oligonucléotide immunostimulant de la présente invention peut être utilisé comme adjuvant vaccinal quelle que soit la nature de l'antigène administré et quel que soit le nombre de valences utilisées. Il peut être le seul adjuvant utilisé ou, au contraire, être un élément d'une combinaison adjuvante.The present invention also relates to a vaccine adjuvant comprising at least one immunostimulatory oligonucleotide having at least one 5 ′ TT Ni N 2 TT 3 ′ motif as mentioned above. By vaccine adjuvant is meant a product which makes it possible to increase or modify the response of the immune system of an organism with regard to the administration of an antigen. In particular, it may be an increase in the humoral response or the cellular response. The action of a vaccine adjuvant can also be, not an increase in the response which would occur in the absence of an adjuvant, but a different orientation from the response produced: for example, orientation towards a cellular response rather than humoral response, production of certain cytokines rather than others, production of certain types or subtypes of antibodies rather than others, stimulation of certain cells rather than others, etc. The immunostimulatory oligonucleotide of the present invention can be used as a vaccine adjuvant regardless of the nature of the antigen administered and regardless of the number of valences used. It can be the only adjuvant used or, on the contrary, be an element of an adjuvant combination.
L'action adjuvante de l'oligonucléotide selon l'invention peut être obtenue, soit lorsqu'il est associé à l'antigène ou aux antigènes lors de leur administration, i.e. lorsqu'ils font partie de la même composition vaccinale, soit lorsqu'il est administré séparément de l'antigène ou des antigènes. On préfère cependant l'utiliser dans la même composition vaccinale que l'antigène ou les antigènes à administrer.The adjuvant action of the oligonucleotide according to the invention can be obtained, either when it is combined with the antigen or antigens during their administration, ie when they are part of the same vaccine composition, or when is administered separately from the antigen or antigens. However, it is preferred to use it in the same vaccine composition as the antigen or antigens to be administered.
L'oligonucléotide selon l'invention peut avantageusement être administré par toutes les voies susceptibles d'être utilisées pour une composition vaccinale: voie muqueuse ou voie systémique.The oligonucleotide according to the invention can advantageously be administered by any route capable of being used for a vaccine composition: mucosal route or systemic route.
L'un des objets de l'invention est une composition vaccinale comprenant au moins un oligonucleotide immunostimulant ayant une séquence 5' T T NιN2 Î T 3' telle que décrite ci-dessus.One of the objects of the invention is a vaccine composition comprising at least one immunostimulatory oligonucleotide having a sequence 5 ′ TT NιN 2 Î T 3 ′ as described above.
Une composition vaccinale selon l'invention peut être destinée à l'immunisation contre une seule maladie, ou destinée à l'immunisation contre plusieurs maladies. Il peut s'agir d'une composition vaccinale liquide ou d'une composition lyophilisée. Elle peut comprendre, outre les antigènes, tout ou partie des composants habituellement présents dans un vaccin tels que tampons, stabilisants, conservateurs, ...etc. Elle peut également comprendre un ou plusieurs adjuvant(s) autre(s) que ceux objets de la présente invention. Elle peut également comprendre plusieurs adjuvants objets de la présente invention, constitués soit par des oligonucléotides ayant tous le même motif 5' T T Ni N2 TT 3' mais se différenciant par les nucléotides en 5' et/ou en 3', soit par des oligonucléotides ayant des motifs 5' T T Ni N2 T T 3' différents, dont les séquences en 5' et en 3' sont identiques ou différentes. La composition vaccinale selon l'invention peut être destinée à une administration prophylactique ou à une administration thérapeutique.A vaccine composition according to the invention can be intended for immunization against a single disease, or intended for immunization against several diseases. It can be a liquid vaccine composition or a lyophilized composition. It can include, in addition to antigens, all or part of the components usually present in a vaccine such as buffers, stabilizers, preservatives, etc. It can also include one or more adjuvant (s) other than those which are the subject of the present invention. It can also include several adjuvants which are the subject of the present invention, constituted either by oligonucleotides all having the same motif 5 'TT Ni N 2 TT 3' but differentiating by nucleotides in 5 'and / or 3', or by oligonucleotides having different 5 'TT Ni N 2 TT 3' motifs, the sequences of 5 'and 3' of which are identical or different. The vaccine composition according to the invention may be intended for prophylactic administration or for therapeutic administration.
La composition vaccinale selon l'invention peut être formulée de manière à optimiser l'action adjuvante de l'oligonucléotide objet de l'invention. Ainsi, l'oligonucléotide peut être couplé à un lipide, tel que le cholestérol ; il peut être intégré dans une émulsion de type huile / eau ou formulé sous forme de liposomes.The vaccine composition according to the invention can be formulated so as to optimize the adjuvant action of the oligonucleotide which is the subject of the invention. Thus, the oligonucleotide can be coupled to a lipid, such as cholesterol; it can be integrated into an oil / water type emulsion or formulated in the form of liposomes.
Les exemples qui suivent illustrent des modes de réalisation particuliers de la présente invention.The following examples illustrate particular embodiments of the present invention.
Exemple 1 :Svnthèse des oligonucléotidesExample 1: Summary of the oligonucleotides
On synthétise 15 oligonucléotides ayant chacun un des motifs suivants15 oligonucleotides are synthesized, each having one of the following motifs
5'TTAATT 3' 5'TTACTT 3'5'TTAATT 3 '5'TTACTT 3'
Série A 5'TTATTT 3' 5'TTAGTT 3'Series A 5'TTATTT 3 '5'TTAGTT 3'
5' TTTTTT 3'5 'TTTTTT 3'
5' TTTATT 3'5 'TTTATT 3'
Série TT series
5' TTTCTT 3'5 'TTTCTT 3'
5' TTTGTT 3'
Figure imgf000010_0001
5 'TTTGTT 3'
Figure imgf000010_0001
Série C
Figure imgf000010_0002
Série G C series
Figure imgf000010_0002
G Series
Figure imgf000011_0001
Figure imgf000011_0001
Et ayant 4 Adénine en 5' et 5 Adénine en 3'.And having 4 Adenine in 5 'and 5 Adenine in 3'.
La synthèse de ces oligonucléotides est réalisée au moyen d'un automate synthétiseur fourni par Applied Biosystems qui met en œuvre la méthode chimique standard au phosphoramidite et qui comporte à chaque cycle une étape d'oxydation, qui est réalisée au moyen d'une solution tétraéthylthiuram / acétonitrile pour obtenir une liaison phosphorothioate.The synthesis of these oligonucleotides is carried out by means of an automatic synthesizer supplied by Applied Biosystems which implements the standard chemical method with phosphoramidite and which comprises at each cycle an oxidation stage, which is carried out by means of a tetraethylthiuram solution / acetonitrile to obtain a phosphorothioate bond.
On prépare en outre, de la même façon, un oligonucleotide A15(S) qui ne comprend que des A et qui est phosphorothioate sur toute sa longueur. Cet oligonucleotide est un témoin négatif car il n'entraîne ni prolifération ni augmentation de l'expression des marqueurs d'activation sur les lymphocytes B.In addition, an A15 (S) oligonucleotide which comprises only A and which is phosphorothioate over its entire length is likewise prepared. This oligonucleotide is a negative control because it does not cause proliferation or increase in the expression of activation markers on B lymphocytes.
On prépare également un oligonucleotide 3Db(S) dont la séquence est identifiée dans la demande de brevet WO96/02555 sous SEQ ID N°15 (5'GAGAACGCTCGACCTTCGAT3' ); cet oligonucleotide comporte des liaisons phosphorothioates sur toute sa longueur et est utilisé comme témoin positif.An oligonucleotide 3Db (S) is also prepared, the sequence of which is identified in patent application WO96 / 02555 under SEQ ID No. 15 (5'GAGAACGCTCGACCTTCGAT3 '); this oligonucleotide has phosphorothioate bonds over its entire length and is used as a positive control.
Tous les oligonucléotides sont maintenus en solution dans du tampon PBS. Exemple 2 Test de LvmphoproliférationAll the oligonucleotides are kept in solution in PBS buffer. EXAMPLE 2 Lphmphrolysis
On isole des lymphocytes à partir du sang périphérique d'un donneur, en procédant à une centrifugation sur un gradient de Ficoll. Ces lymphocytes sont ajustés à 2.106 cellules / ml dans du milieu de culture (RPMI 1640 + 10% de Sérum de Veau Fœtal ainsi que de la Glutamine, de la Streptomycine et de la Pénicilline).Lymphocytes are isolated from the peripheral blood of a donor, by centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2.10 6 cells / ml in culture medium (RPMI 1640 + 10% Fetal Calf Serum as well as Glutamine, Streptomycin and Penicillin).
Les cellules sont distribuées en plaques 96 puits (fond rond) sous 100 μl, soit 2.105 cellules par puits. On ajoute ensuite 100μl d'une solution 4μM d'oligonucléotides à tester produites à l'exemple 1 (1 seul type d'oligonucléotide par puits) afin d'obtenir une concentration finale 2 μM.The cells are distributed in 96-well plates (round bottom) under 100 μl, or 2.10 5 cells per well. Then added 100 μl of a 4 μM solution of oligonucleotides to be tested produced in Example 1 (only 1 type of oligonucleotide per well) in order to obtain a final concentration 2 μM.
Les cellules sont incubées pendant 48 à 72 heures.The cells are incubated for 48 to 72 hours.
La Thymidine tritiée (Amersham TRK 120) est diluée dans du milieu de culture puis distribuée dans les plaques à raison de 1 μCi par puits sous 50 μl. Après 7 à 8 heures d'incubation à l'étuve (5% CO2, 37°C), les plaques peuvent être congelées à -80°C et traitées plus tard. A l'aide du "Harvester", on récolte le contenu des puits sur des plaques Unifilter GF/C et on réalise 6 lavages en eau distillée puis un lavage en éthanol 70% afin de précipiter l'ADN.Tritiated thymidine (Amersham TRK 120) is diluted in culture medium and then distributed in the plates at a rate of 1 μCi per well under 50 μl. After 7 to 8 hours of incubation in an oven (5% CO 2 , 37 ° C), the plates can be frozen at -80 ° C and processed later. Using the "Harvester", the contents of the wells are collected on Unifilter GF / C plates and 6 washes are carried out in distilled water and then washed in 70% ethanol in order to precipitate the DNA.
Après séchage des plaques, 25 μl de liquide scintillant (Microscint-40, Packard) sont distribués dans chaque puits et permettent de quantifier la radioactivité (rayonnements émis par le tritium) en mesurant le nombre de coups / minute (cpm) émis par chaque puits sur le compteur Top Count (Packard).After the plates have dried, 25 μl of scintillating liquid (Microscint-40, Packard) are distributed in each well and make it possible to quantify the radioactivity (radiation emitted by tritium) by measuring the number of strokes / minute (cpm) emitted by each well on the Top Count counter (Packard).
Les résultats obtenus pour chacun des oligonucléotides testés sont représentés sur les figures 1 et 2, qui indiquent, pour chaque oligonucleotide testé le nombre de coups par minute; on remarque que tous les oligonucléotides selon l'invention ont un résultat nettement supérieur au résultat obtenu avec le milieu seul ou le témoin négatif A15(S), ce qui signifie qu'ils sont tous capables de stimuler la prolifération des lymphocytes. Exemple 3 :The results obtained for each of the oligonucleotides tested are represented in FIGS. 1 and 2, which indicate, for each oligonucleotide tested, the number of counts per minute; it is noted that all the oligonucleotides according to the invention have a result clearly superior to the result obtained with the medium alone or the negative control A15 (S), which means that they are all capable of stimulating the proliferation of lymphocytes. Example 3:
Test relatif aux marqueurs d'activationActivation markers test
Le test est effectué à partir de lymphocytes isolés d 'un donneur comme décrit à l'exemple précédent, et ajustés à 2.106 cellules/ml dans le même milieu de culture.The test is carried out using lymphocytes isolated from a donor as described in the previous example, and adjusted to 2.10 6 cells / ml in the same culture medium.
Les cellules sont ensuite distribuées en plaques 12 puits sous un volume de 2 ml, soit 4.106 cellules / puits. On ajoute dans chaque puits une quantité d'oligonucléotides à tester préparées à l'exemple 1 (1 oligonucleotide / puits) suffisante pour obtenir une concentration en oligonucleotide 2 μM. Puis les cellules sont incubées pendant 72 heures à 37°C. Les cellules sont ensuite doublement marquées au moyen de CD25PE / CD20FITC ou CD86PE / CD20FITC puis analysées sur FACScan. Les résultats obtenus sont illustrés sur les figures 3, 4, 5 et 6 qui représentent pour chaque oligonucleotide testé, le pourcentage de cellules B (CD20+) qui expriment le récepteur CD25 ( celles qui sont CD25+)ou le marqueur CD86(celles qui sont CD86+). Les résultats représentés sur les figures 3 et 4 ont été obtenus lors d'un test réalisé à un moment différent du test dont les résultats sont illustrés sur les figures 5 et 6, ce qui explique la différence d'ordre de grandeur des résultats obtenus. En effet, dans ce genre de manipulations, les tests sont très variables d'un dosage à l'autre, seuls les résultats obtenus lors d'un même test sont comparables entre eux, d'où la nécessité d'inclure lors de chaque test, un oligonucléotide-témoin ainsi qu'un dosage du milieu seul.The cells are then distributed in 12-well plates in a volume of 2 ml, ie 4.10 6 cells / well. A quantity of oligonucleotides to be tested prepared in Example 1 (1 oligonucleotide / well) sufficient to obtain a concentration of oligonucleotide 2 μM is added to each well. The cells are then incubated for 72 hours at 37 ° C. The cells are then doubly labeled using CD25PE / CD20FITC or CD86PE / CD20FITC and then analyzed on FACScan. The results obtained are illustrated in FIGS. 3, 4, 5 and 6 which represent for each oligonucleotide tested, the percentage of B cells (CD20 +) which express the CD25 receptor (those which are CD25 +) or the marker CD86 (those which are CD86 + ). The results represented in FIGS. 3 and 4 were obtained during a test carried out at a time different from the test, the results of which are illustrated in FIGS. 5 and 6, which explains the difference in order of magnitude of the results obtained. Indeed, in this kind of manipulations, the tests are very variable from one assay to another, only the results obtained during the same test are comparable to each other, hence the need to include during each test , a control oligonucleotide and an assay of the medium alone.
On remarque que tous les oligonucléotides objets de l'invention activent les lymphocytes B qui expriment leur marqueur d'activation CD86, ainsi que le récepteur de cytokine CD25. Exemple 4 :It is noted that all the oligonucleotides which are the subject of the invention activate the B lymphocytes which express their activation marker CD86, as well as the cytokine receptor CD25. Example 4:
On prépare, de la même manière qu'à l'exemple 1 , une série de 16 oligonucléotides dont les séquences sont les suivantes:A series of 16 oligonucleotides, the sequences of which are as follows, are prepared, in the same manner as in Example 1:
Seq Id 1 : 5' TTAGTTATTAGTTATTAGTT 3'Seq Id 1: 5 'TTAGTTATTAGTTATTAGTT 3'
Seq Id 2 : 5' TTAGTTATTAG I I I I I AGTT 3'Seq Id 2: 5 'TTAGTTATTAG I I I I I AGTT 3'
Seq Id 3 : 5' TTAGTTATTAGTTCTTAGTT 3' Seq ld 4 : 5' TTAGTTATTAGTTGTTAGTT 3'Seq Id 3: 5 'TTAGTTATTAGTTCTTAGTT 3' Seq ld 4: 5 'TTAGTTATTAGTTGTTAGTT 3'
Seq Id 5 : 5' TTAG I I I I I AGTTATTAGTT 3'Seq Id 5: 5 'TTAG I I I I I AGTTATTAGTT 3'
Seq ld β : 5' TTAG I I I I I AG I I I I I AGTT 3'Seq ld β: 5 'TTAG I I I I I AG I I I I I AGTT 3'
Seq Id 7 : 5' TTAG I I I I I AGTTCTTAGTT 3'Seq Id 7: 5 'TTAG I I I I I AGTTCTTAGTT 3'
Seq Id 8 : 5' TTAG I I I I IAGTTGTTAGTT 3' Seq Id 9 : 5' TTAGTTCTTAGTTATTAGTT 3'Seq Id 8: 5 'TTAG I I I I IAGTTGTTAGTT 3' Seq Id 9: 5 'TTAGTTCTTAGTTATTAGTT 3'
Seq Id 10 : 5' TTAGTTCTTAG I I I I I AGTT 3'Seq Id 10: 5 'TTAGTTCTTAG I I I I I AGTT 3'
Seq Id 11 : 5' TTAGTTCTTAGTTCTTAGTT 3'Seq Id 11: 5 'TTAGTTCTTAGTTCTTAGTT 3'
Seq Id 12 : 5' TTAGTTCTTAGTTGTTAGTT 3'Seq Id 12: 5 'TTAGTTCTTAGTTGTTAGTT 3'
Seq Id 13 : 5' TTAGTTGTTAGTTATTAGTT 3' Seq Id 14 : 5' TTAGTTGTTAG I I I I I AGTT 3'Seq Id 13: 5 'TTAGTTGTTAGTTATTAGTT 3' Seq Id 14: 5 'TTAGTTGTTAG I I I I I AGTT 3'
Seq Id 15 : 5' TTAGTTGTTAGTTCTTAGTT 3'Seq Id 15: 5 'TTAGTTGTTAGTTCTTAGTT 3'
Seq Id 16 : 5' TTAGTTGTTAGTTGTTAGTT 3'Seq Id 16: 5 'TTAGTTGTTAGTTGTTAGTT 3'
Ces oligonucléotides sont de type phosphorothiate sur toute leur longueur.These oligonucleotides are of phosphorothiate type over their entire length.
Exemple 5 :Example 5:
On évalue la capacité qu'ont les oligonucléotides préparés à l'exemple 4 d'induire la prolifération des lymphocytes humains grâce à un test de lymphoprolifération tel que celui décrit à l'exemple 2. De la même façon qu'à l'exemple 2, la concentration en oligonucléotide par puits est 2μM, et les témoins sont constitués par le milieu seul, l'oligonucléotide A15(S) ainsi que l'oligonucléotide 3Db(S).The capacity of the oligonucleotides prepared in Example 4 to induce the proliferation of human lymphocytes is evaluated by means of a lymphoproliferation test such as that described in Example 2. In the same way as in Example 2 , the concentration in oligonucleotide per well is 2 μM, and the controls consist of the medium alone, the oligonucleotide A15 (S) as well as the oligonucleotide 3Db (S).
Les résultats obtenus, exprimés en Coups par Minute, sont représentés à la Figure 7 qui montre que tous les oligonucléotides selon l'invention sont capables d'induire la prolifération des lymphocytes et que de particulièrement bons résultats sont obtenus lorsque les séquences des oligonucléotides sont celles identifiées par les Seq Id 9 à 12, i.e. lorsque la Cytosine sépare les 2 premiers motifs TTNιN2TT de l'oligonucléotide.The results obtained, expressed in counts per minute, are shown in Figure 7 which shows that all the oligonucleotides according to the invention are capable of inducing the proliferation of lymphocytes and that particularly good results are obtained when the sequences of the oligonucleotides are those identified by Seq Id 9 to 12, ie when Cytosine separates the first 2 TTNιN 2 TT motifs from the oligonucleotide.
Exemple 6Example 6
On évalue la capacité qu' ont les oligonucléotides préparés à l'exemple 4 d'induire l'expression du marqueur d'activation CD86 et du récepteur CD25 sur les lymphocytes B. Cette évaluation est effectuée grâce au test décrit à l'exemple 3. Les résultats obtenus avec les oligonucléotides préparés selon l'exemple 4 sont représentés sur les Figures 8 et 9 qui illustrent les pourcentages de cellules B (CD20+) qui expriment également le récepteur CD25 (Figure 8) ou le marqueur CD86 (Figure 9). Les résultats obtenus dans ce test confirment ceux obtenus dans le test de lymphoprolifération: tous les oligonucléotides selon l'invention induisent l'expression de marqueurs d'activation sur les lymphocytes B humains; de particulièrement bons résultats sont obtenus lorsque les 2 premiers motifs TTN1N2TT de l'oligonucléotide sont séparés par une Cytosine.The capacity of the oligonucleotides prepared in Example 4 to evaluate the expression of the activation marker CD86 and of the CD25 receptor on B lymphocytes is evaluated. This evaluation is carried out using the test described in Example 3. The results obtained with the oligonucleotides prepared according to Example 4 are shown in Figures 8 and 9 which illustrate the percentages of B cells (CD20 +) which also express the CD25 receptor (Figure 8) or the CD86 marker (Figure 9). The results obtained in this test confirm those obtained in the lymphoproliferation test: all the oligonucleotides according to the invention induce the expression of activation markers on human B lymphocytes; particularly good results are obtained when the first 2 TTN 1 N 2 TT motifs of the oligonucleotide are separated by a Cytosine.
Exemple 7 :Example 7:
On évalue la capacité qu' ont les oligonucléotides selon la présente invention à induire la sécrétion de cytokines.The capacity of the oligonucleotides according to the present invention to induce the secretion of cytokines is evaluated.
Pour cette évaluation, on isole des lymphocytes à partir du sang périphérique d'un donneur, en procédant à une centrifugation sur un gradient de Ficoll. Ces lymphocytes sont ajustés à 2.106 cellules / ml dans du milieu de culture (milieu AIM V + streptomycine + pénicilline).For this evaluation, lymphocytes are isolated from the peripheral blood of a donor, by centrifugation on a Ficoll gradient. These lymphocytes are adjusted to 2.10 6 cells / ml in culture medium (AIM V medium + streptomycin + penicillin).
Les plaques 96 puits ELISPOT (fond plat en nitrocellulose) sont pré-incubées la veille avec une solution d'anticorps de capture de cytokines (IL-1O ou IFNγ suivant le test réalisé ), puis saturées avec du milieu de culture.The 96-well ELISPOT plates (flat nitrocellulose bottom) are pre-incubated the day before with a solution of cytokine capture antibodies (IL-1O or IFNγ according to the test carried out), then saturated with culture medium.
On distribue ensuite 100 μl de cellules dans les plaques ELISPOT, soit 2.105 cellules par puits, puis on ajoute 100μl d'une solution 4μM en oligonucléotides à tester, produits selon l'exemple 4 (1 seul type d'oligonucléotide par puits) afin d'obtenir une concentration finale 2 μM. Le test est réalisé avec les oligonucléotides ayant les séquences décrites sous Seq Id 9, Seq Id 10, Seq Id 11 et Seq Id 12.100 μl of cells are then distributed in the ELISPOT plates, ie 2.10 5 cells per well, then 100 μl of a 4 μM solution of oligonucleotides to be tested, products according to Example 4 (1 single type of oligonucleotide per well) are added in order to to obtain a final concentration of 2 μM. The test is carried out with the oligonucleotides having the sequences described under Seq Id 9, Seq Id 10, Seq Id 11 and Seq Id 12.
Les plaques sont incubées à 37°C, sous atmosphère à 5% de CO2. Au bout de 72 heures d'incubation, les cellules sont éliminées par lavage en présence de détergent (Tween 1%) et les cytokines fixées sur les anticorps de capture sont révélées par l'addition successive d'anticorps de détection biotynylés (anti-IL-10 ou anti-IFNγ suivant le test réalisé), de streptavidine-HRP, et du substrat AEC.The plates are incubated at 37 ° C., under an atmosphere containing 5% CO 2 . After 72 hours of incubation, the cells are eliminated by washing in the presence of detergent (Tween 1%) and the cytokines fixed on the capture antibodies are revealed by the successive addition of biotynylated detection antibodies (anti-IL -10 or anti-IFNγ according to the test carried out), streptavidin-HRP, and the AEC substrate.
Les spots (1 spot correspondant à 1 cellule sécrétrice de cytokine) sont compté à l'aide d'un compteur automatique. Les résultats sont exprimés en nombre de spots (nombre de cellules sécrétrices) par million de cellules.The spots (1 spot corresponding to 1 cytokine secreting cell) are counted using an automatic counter. The results are expressed in number of spots (number of secretory cells) per million cells.
Les résultats obtenus pour chacun des oligonucléotides testés sont représentés sur les figures 10 et 11 , qui indiquent, pour chaque oligonucleotide testé le nombre de cellules sécrétrices de cytokines par million de cellules totales ; on remarque que tous les oligonucléotides selon l'invention ont un résultat nettement supérieur au résultat obtenu avec le milieu seul ou le témoin négatif A15(S), ce qui signifie qu'ils sont tous capables d'induire la sécrétion de cytokines, notamment d'IL 10 et d'Interféron γ. The results obtained for each of the oligonucleotides tested are shown in FIGS. 10 and 11, which indicate, for each oligonucleotide tested, the number of cytokine-secreting cells per million total cells; we note that all the oligonucleotides according to the invention have a result clearly superior to the result obtained with the medium alone or the negative control A15 (S), which means that they are all capable of inducing the secretion of cytokines, in particular d 'IL 10 and Interferon γ.

Claims

Revendications claims
1. Oligonucleotide immunostimulant , caractérisé en ce qu'il comprend au moins une séquence nucléotidique ayant la formule suivante1. Immunostimulating oligonucleotide, characterized in that it comprises at least one nucleotide sequence having the following formula
5' TTNιN2TT 3', dans laquelle T signifie Thymine, Ni et N2 peuvent chacun représenter l'Adénine, la Thymine, la Cytosine ou la Guanine, et en ce qu'il est dépourvu de dinucléotide CG dans lequel la Cytosine C ne serait pas méthylée.5 'TTNιN 2 TT 3', in which T signifies Thymine, Ni and N 2 may each represent Adenine, Thymine, Cytosine or Guanine, and in that it is devoid of CG dinucleotide in which Cytosine C would not be methylated.
2. Oligonucleotide selon la revendication 1 , caractérisé en ce qu'il comprend de 6 à 100 nucléotides.2. Oligonucleotide according to claim 1, characterized in that it comprises from 6 to 100 nucleotides.
3. Oligonucleotide selon la revendication 1 , caractérisé en ce que N-i représente l'Adénine et en ce que N2 réprésente la Guanine.3. Oligonucleotide according to claim 1, characterized in that Ni represents Adenine and in that N 2 represents Guanine.
4. Oligonucleotide selon une des revendications précédentes, caractérisé en ce que le motif 5' T T Ni N2 T T 3' est répété au moins 1 fois.4. Oligonucleotide according to one of the preceding claims, characterized in that the motif 5 'TT Ni N 2 TT 3' is repeated at least 1 time.
5. Oligonucleotide selon la revendication précédente caractérisé en ce que le motif 5' T T Ni N2 T T 3' est répété 2 fois.5. Oligonucleotide according to the preceding claim characterized in that the motif 5 'TT Ni N 2 TT 3' is repeated 2 times.
6. Oligonucleotide selon une des revendications 4 et 5, caractérisé en ce que les motifs répétés 5' T T Ni N2 T T 3' sont séparés par un nucleotide N3 qui peut être à chaque fois identique ou différent et qui peut représenter A, C, T ou G.6. Oligonucleotide according to one of claims 4 and 5, characterized in that the repeat units 5 'TT Ni N 2 TT 3' are separated by a nucleotide N 3 which can be each time identical or different and which can represent A, C , T or G.
7. Oligonucleotide selon la revendication précédente, caractérisée en ce que le nucleotide N3 séparant les 2 premiers motifs T T Ni N2 T T lus lorsque la séquence est orientée 5'→3' représente la Cytosine. 7. Oligonucleotide according to the preceding claim, characterized in that the nucleotide N 3 separating the first 2 TT Ni N 2 TT motifs read when the sequence is oriented 5 ′ → 3 ′ represents Cytosine.
8. Oligonucleotide selon une des revendications précédentes, caractérisée en ce qu'il comprend la séquence 5' TTAGTTCTTAGTTN3TTAGTT 3', dans laquelle A représente l'Adénine, T la Thymine, G la Guanine, et C la Cytosine, et dans laquelle N3 peut signifier A, T, C ou G.8. Oligonucleotide according to one of the preceding claims, characterized in that it comprises the sequence 5 'TTAGTTCTTAGTTN 3 TTAGTT 3', in which A represents Adenine, T Thymine, G Guanine, and C Cytosine, and in which N 3 can mean A, T, C or G.
9. Oligonucleotide selon une des revendications précédentes, caractérisé en ce qu'il est capable d'induire la prolifération des lymphocytes humains.9. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of inducing the proliferation of human lymphocytes.
10. Oligonucleotide selon une des revendications précédentes, caractérisé en ce qu'il est capable d'induire la sécrétion de cytokines.10. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of inducing the secretion of cytokines.
11. Oligonucleotide selon la revendication précédente, caractérisé en ce qu'il est capable d'induire la sécrétion d'IL 10.11. Oligonucleotide according to the preceding claim, characterized in that it is capable of inducing the secretion of IL 10.
12. Oligonucleotide selon la revendication 10, caractérisé en ce qu'il est capable d'induire la sécrétion d'Interféron γ.12. Oligonucleotide according to claim 10, characterized in that it is capable of inducing the secretion of Interferon γ.
13. Oligonucleotide selon une des revendications précédentes, caractérisé en ce qu'il est capable d'accroître l'expression du marqueur d'activation CD86 sur les lymphocytes B humains.13. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of increasing the expression of the activation marker CD86 on human B lymphocytes.
14. Oligonucleotide selon une des revendications précédentes, caractérisé en ce qu'il est capable d'accroître l'expression du récepteur de cytokine CD25 sur les lymphocytes B humains.14. Oligonucleotide according to one of the preceding claims, characterized in that it is capable of increasing the expression of the cytokine CD25 receptor on human B lymphocytes.
15. Utilisation d'un oligonucleotide selon une des revendications précédentes pour la fabrication d'un médicament.15. Use of an oligonucleotide according to one of the preceding claims for the manufacture of a medicament.
16. Utilisation d'un oligonucleotide selon une des revendications 1 à 10, pour la fabrication d'un immunostimulant humain. 16. Use of an oligonucleotide according to one of claims 1 to 10, for the manufacture of a human immunostimulant.
17. Utilisation d'un oligonucleotide selon une des revendications 1 à 10, pour la fabrication d'un adjuvant vaccinal.17. Use of an oligonucleotide according to one of claims 1 to 10, for the manufacture of a vaccine adjuvant.
18. Utilisation d'un oligonucleotide selon une des revendications 1 à 10, pour la fabrication d'une composition vaccinale.18. Use of an oligonucleotide according to one of claims 1 to 10, for the manufacture of a vaccine composition.
19. Composition vaccinale à usage humain, comprenant au moins un antigène vaccinal, caractérisée en ce qu'elle comprend en outre au moins un oligonucleotide selon une des revendications 1 à 10 19. A vaccine composition for human use, comprising at least one vaccine antigen, characterized in that it also comprises at least one oligonucleotide according to one of claims 1 to 10
PCT/FR2000/001566 1999-06-08 2000-06-08 Immunostimulant oligonucleotide WO2000075304A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP00940454A EP1196558A1 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide
CA002376634A CA2376634A1 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide
AU55389/00A AU776268B2 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide
NZ515957A NZ515957A (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
FR99/07457 1999-06-08
FR9907457 1999-06-08
FR9910378A FR2797263B1 (en) 1999-08-06 1999-08-06 IMMUNOSTIMULANT OLIGONUCLEOTIDE
FR99/10378 1999-08-06

Publications (1)

Publication Number Publication Date
WO2000075304A1 true WO2000075304A1 (en) 2000-12-14

Family

ID=26234986

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2000/001566 WO2000075304A1 (en) 1999-06-08 2000-06-08 Immunostimulant oligonucleotide

Country Status (5)

Country Link
EP (1) EP1196558A1 (en)
AU (1) AU776268B2 (en)
CA (1) CA2376634A1 (en)
NZ (1) NZ515957A (en)
WO (1) WO2000075304A1 (en)

Cited By (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
WO2006071997A2 (en) 2004-12-30 2006-07-06 3M Innovative Properties Company Treatment for cutaneous metastases
US7179253B2 (en) 2003-03-13 2007-02-20 3M Innovative Properties Company Method of tattoo removal
DE102006007433A1 (en) * 2006-02-17 2007-08-23 Curevac Gmbh Immunostimulant adjuvant useful in vaccines against cancer or infectious diseases comprises a lipid-modified nucleic acid
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US7299453B2 (en) 2001-12-20 2007-11-20 International Business Machines Corporation Testing measurements
US7375180B2 (en) 2003-02-13 2008-05-20 3M Innovative Properties Company Methods and compositions related to IRM compounds and Toll-like receptor 8
US7387271B2 (en) 2002-12-30 2008-06-17 3M Innovative Properties Company Immunostimulatory combinations
US7427629B2 (en) 2002-08-15 2008-09-23 3M Innovative Properties Company Immunostimulatory compositions and methods of stimulating an immune response
US7485432B2 (en) 2003-02-27 2009-02-03 3M Innovative Properties Company Selective modulation of TLR-mediated biological activity
US7696159B2 (en) 2003-03-25 2010-04-13 Graceway Pharmaceuticals, Llc Treatment for basal cell carcinoma
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US7923560B2 (en) 2003-04-10 2011-04-12 3M Innovative Properties Company Delivery of immune response modifier compounds
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US8110582B2 (en) 2003-03-04 2012-02-07 3M Innovative Properties Company Prophylactic treatment of UV-induced epidermal neoplasia
US8217016B2 (en) 2001-12-19 2012-07-10 Curevac Gmbh Application of mRNA for use as a therapeutic agent for tumorous diseases
WO2013013055A1 (en) 2011-07-21 2013-01-24 Rubigo Therapeutics, Inc. System for drug delivery and monitoring
US8426457B2 (en) 2003-03-13 2013-04-23 Medicis Pharmaceutical Corporation Methods of improving skin quality
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8691837B2 (en) 2003-11-25 2014-04-08 3M Innovative Properties Company Substituted imidazo ring systems and methods
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US8871782B2 (en) 2003-10-03 2014-10-28 3M Innovative Properties Company Alkoxy substituted imidazoquinolines
US8940755B2 (en) 2003-12-02 2015-01-27 3M Innovative Properties Company Therapeutic combinations and methods including IRM compounds
US8951528B2 (en) 2006-02-22 2015-02-10 3M Innovative Properties Company Immune response modifier conjugates
US8961477B2 (en) 2003-08-25 2015-02-24 3M Innovative Properties Company Delivery of immune response modifier compounds
US8968746B2 (en) 2010-07-30 2015-03-03 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9107958B2 (en) 2011-06-03 2015-08-18 3M Innovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9226959B2 (en) 2008-01-31 2016-01-05 Curevac Ag Nucleic acids comprising formula (NuGlXmGnNv)a and derivatives thereof as immunostimulating agent/adjuvant
US9248127B2 (en) 2005-02-04 2016-02-02 3M Innovative Properties Company Aqueous gel formulations containing immune response modifiers
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
EP3001990A1 (en) 2004-05-28 2016-04-06 Oryxe A mixture for transdermal delivery of low& and high molecular weight compounds
US9314535B2 (en) 2009-09-03 2016-04-19 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9475804B2 (en) 2011-06-03 2016-10-25 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9572874B2 (en) 2008-09-30 2017-02-21 Curevac Ag Composition comprising a complexed (M)RNA and a naked mRNA for providing or enhancing an immunostimulatory response in a mammal and uses thereof
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US10111967B2 (en) 2007-09-04 2018-10-30 Curevac Ag Complexes of RNA and cationic peptides for transfection and for immunostimulation
US10188748B2 (en) 2001-06-05 2019-01-29 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
WO2019166946A1 (en) 2018-02-28 2019-09-06 Pfizer Inc. Il-15 variants and uses thereof
US10441653B2 (en) 2006-07-31 2019-10-15 Curevac Ag Nucleic acid comprising GlXmGn as an immune-stimulating agent/adjuvant
WO2019224715A1 (en) 2018-05-23 2019-11-28 Pfizer Inc. Antibodies specific for cd3 and uses thereof
WO2019224716A2 (en) 2018-05-23 2019-11-28 Pfizer Inc. Antibodies specific for gucy2c and uses thereof
WO2020128893A1 (en) 2018-12-21 2020-06-25 Pfizer Inc. Combination treatments of cancer comprising a tlr agonist
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10898584B2 (en) 2013-11-01 2021-01-26 Curevac Ag Modified RNA with decreased immunostimulatory properties
WO2021124073A1 (en) 2019-12-17 2021-06-24 Pfizer Inc. Antibodies specific for cd47, pd-l1, and uses thereof
WO2022013775A1 (en) 2020-07-17 2022-01-20 Pfizer Inc. Therapeutic antibodies and their uses
US11260018B2 (en) 2015-09-17 2022-03-01 Jrx Biotechnology, Inc. Approaches for improving skin hydration and moisturization
US11690910B2 (en) 2012-01-31 2023-07-04 CureVac SE Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen
US11739125B2 (en) 2013-08-21 2023-08-29 Cure Vac SE Respiratory syncytial virus (RSV) vaccine

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995026204A1 (en) * 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1998037919A1 (en) * 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995026204A1 (en) * 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
WO1998037919A1 (en) * 1997-02-28 1998-09-03 University Of Iowa Research Foundation USE OF NUCLEIC ACIDS CONTAINING UNMETHYLATED CpG DINUCLEOTIDE IN THE TREATMENT OF LPS-ASSOCIATED DISORDERS

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BOGGS, R. ET AL.: "CHARACTERIZATION AND MODULATION OF IMMUNE STIMULATION BY MODIFIED OLIGONUCLEOTIDES.", ANTISENSE & NUCLEIC ACID DRUG DEVELOPMENT, vol. 7, October 1997 (1997-10-01), pages 461-471, XP002053418, ISSN: 1087-2906 *
KRIEG A M ET AL: "CPG MOTIFS IN BACTERIAL DNA TRIGGER DIRECT B-CELL ACTIVATION", NATURE, vol. 374, pages 546-549, XP000197060, ISSN: 0028-0836 *
LANG R ET AL: "GUANOSINE-RICH OLIGODEOXYNUCLEOTIDES INDUCE PROLIFERATION OF MACROPHAGE PROGENITORS IN CULTURES OF MURINE BONE MARROW CELLS", EUROPEAN JOURNAL OF IMMUNOLOGY, vol. 29, no. 11, November 1999 (1999-11-01), pages 3496 - 3506, XP000876859, ISSN: 0014-2980 *
LIANG, H. ET AL.: "Activation of human B cells by phosphorothioate oligodeoxynucleotides", J. CLIN. INVEST. (1996), 98(5), 1119-1129, XP002130608 *
PARRONCHI, P. ET AL.: "Phosphorothioate oligodeoxynucleotides promote the in vitro development of human allergen-specific CD4+ T cells into Th1 effectors", J. IMMUNOL. 163(11), 5946-5953, 1 December 1999 (1999-12-01), XP002130609 *

Cited By (126)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7879810B2 (en) 1994-07-15 2011-02-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US11369691B2 (en) 2001-06-05 2022-06-28 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US11135312B2 (en) 2001-06-05 2021-10-05 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US10568972B2 (en) 2001-06-05 2020-02-25 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US10188748B2 (en) 2001-06-05 2019-01-29 Curevac Ag Pharmaceutical composition containing a stabilised mRNA optimised for translation in its coding regions
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US9463228B2 (en) 2001-12-19 2016-10-11 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US8217016B2 (en) 2001-12-19 2012-07-10 Curevac Gmbh Application of mRNA for use as a therapeutic agent for tumorous diseases
US9155788B2 (en) 2001-12-19 2015-10-13 Curevac Gmbh Application of mRNA for use as a therapeutic against tumour diseases
US9433669B2 (en) 2001-12-19 2016-09-06 Curevac Ag Application of mRNA for use as a therapeutic against tumor diseases
US9655955B2 (en) 2001-12-19 2017-05-23 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US9433670B2 (en) 2001-12-19 2016-09-06 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US9439956B2 (en) 2001-12-19 2016-09-13 Curevac Ag Application of mRNA for use as a therapeutic against tumour diseases
US7299453B2 (en) 2001-12-20 2007-11-20 International Business Machines Corporation Testing measurements
US7038029B2 (en) 2002-05-30 2006-05-02 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7943316B2 (en) 2002-05-30 2011-05-17 David Horn, Llc Immunostimulatory oligonucleotides and uses thereof
US7381807B2 (en) 2002-05-30 2008-06-03 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7427629B2 (en) 2002-08-15 2008-09-23 3M Innovative Properties Company Immunostimulatory compositions and methods of stimulating an immune response
EP2269632A2 (en) 2002-08-15 2011-01-05 3M Innovative Properties Co. Immunostimulatory compositions and methods of stimulating an immune response
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US10105426B2 (en) 2002-12-30 2018-10-23 Trustees Of Dartmouth College Immunostimulatory combinations
EP2572714A1 (en) 2002-12-30 2013-03-27 3M Innovative Properties Company Immunostimulatory Combinations
US8329197B2 (en) 2002-12-30 2012-12-11 3M Innovative Properties Company Ex vivo uses of immunostimulatory combinations
EP2572715A1 (en) 2002-12-30 2013-03-27 3M Innovative Properties Company Immunostimulatory Combinations
US7387271B2 (en) 2002-12-30 2008-06-17 3M Innovative Properties Company Immunostimulatory combinations
US7375180B2 (en) 2003-02-13 2008-05-20 3M Innovative Properties Company Methods and compositions related to IRM compounds and Toll-like receptor 8
US7485432B2 (en) 2003-02-27 2009-02-03 3M Innovative Properties Company Selective modulation of TLR-mediated biological activity
US8110582B2 (en) 2003-03-04 2012-02-07 3M Innovative Properties Company Prophylactic treatment of UV-induced epidermal neoplasia
US8426457B2 (en) 2003-03-13 2013-04-23 Medicis Pharmaceutical Corporation Methods of improving skin quality
US7179253B2 (en) 2003-03-13 2007-02-20 3M Innovative Properties Company Method of tattoo removal
US8835394B2 (en) 2003-03-25 2014-09-16 Medicis Pharmaceutical Corporation Treatment for basal cell carcinoma
US7696159B2 (en) 2003-03-25 2010-04-13 Graceway Pharmaceuticals, Llc Treatment for basal cell carcinoma
US7923560B2 (en) 2003-04-10 2011-04-12 3M Innovative Properties Company Delivery of immune response modifier compounds
US8961477B2 (en) 2003-08-25 2015-02-24 3M Innovative Properties Company Delivery of immune response modifier compounds
US8871782B2 (en) 2003-10-03 2014-10-28 3M Innovative Properties Company Alkoxy substituted imidazoquinolines
US8691837B2 (en) 2003-11-25 2014-04-08 3M Innovative Properties Company Substituted imidazo ring systems and methods
US8940755B2 (en) 2003-12-02 2015-01-27 3M Innovative Properties Company Therapeutic combinations and methods including IRM compounds
EP3001990A1 (en) 2004-05-28 2016-04-06 Oryxe A mixture for transdermal delivery of low& and high molecular weight compounds
WO2006071997A2 (en) 2004-12-30 2006-07-06 3M Innovative Properties Company Treatment for cutaneous metastases
EP2394650A1 (en) 2004-12-30 2011-12-14 3M Innovative Properties Co. Use of resiquimod for the treatment of cutaneous metastases
US9248127B2 (en) 2005-02-04 2016-02-02 3M Innovative Properties Company Aqueous gel formulations containing immune response modifiers
US10071156B2 (en) 2005-02-04 2018-09-11 3M Innovative Properties Company Aqueous gel formulations containing immune response modifiers
DE102006007433A1 (en) * 2006-02-17 2007-08-23 Curevac Gmbh Immunostimulant adjuvant useful in vaccines against cancer or infectious diseases comprises a lipid-modified nucleic acid
EP3085373A1 (en) 2006-02-22 2016-10-26 3M Innovative Properties Company Immune response modifier conjugates
US8951528B2 (en) 2006-02-22 2015-02-10 3M Innovative Properties Company Immune response modifier conjugates
US10441653B2 (en) 2006-07-31 2019-10-15 Curevac Ag Nucleic acid comprising GlXmGn as an immune-stimulating agent/adjuvant
US10111967B2 (en) 2007-09-04 2018-10-30 Curevac Ag Complexes of RNA and cationic peptides for transfection and for immunostimulation
US9226959B2 (en) 2008-01-31 2016-01-05 Curevac Ag Nucleic acids comprising formula (NuGlXmGnNv)a and derivatives thereof as immunostimulating agent/adjuvant
US9572874B2 (en) 2008-09-30 2017-02-21 Curevac Ag Composition comprising a complexed (M)RNA and a naked mRNA for providing or enhancing an immunostimulatory response in a mammal and uses thereof
US9907862B2 (en) 2009-09-03 2018-03-06 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US10751424B2 (en) 2009-09-03 2020-08-25 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US9314535B2 (en) 2009-09-03 2016-04-19 Curevac Ag Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
US8968746B2 (en) 2010-07-30 2015-03-03 Curevac Gmbh Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
US9937233B2 (en) 2010-08-06 2018-04-10 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9181319B2 (en) 2010-08-06 2015-11-10 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9447164B2 (en) 2010-08-06 2016-09-20 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US9334328B2 (en) 2010-10-01 2016-05-10 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9657295B2 (en) 2010-10-01 2017-05-23 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US10064959B2 (en) 2010-10-01 2018-09-04 Modernatx, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9533047B2 (en) 2011-03-31 2017-01-03 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9950068B2 (en) 2011-03-31 2018-04-24 Modernatx, Inc. Delivery and formulation of engineered nucleic acids
US9107958B2 (en) 2011-06-03 2015-08-18 3M Innovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
US9902724B2 (en) 2011-06-03 2018-02-27 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US9585968B2 (en) 2011-06-03 2017-03-07 3M Innovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
EP3153180A1 (en) 2011-06-03 2017-04-12 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US10723731B2 (en) 2011-06-03 2020-07-28 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
US10406142B2 (en) 2011-06-03 2019-09-10 3M Lnnovative Properties Company Hydrazino 1H-imidazoquinolin-4-amines and conjugates made therefrom
US9475804B2 (en) 2011-06-03 2016-10-25 3M Innovative Properties Company Heterobifunctional linkers with polyethylene glycol segments and immune response modifier conjugates made therefrom
WO2013013055A1 (en) 2011-07-21 2013-01-24 Rubigo Therapeutics, Inc. System for drug delivery and monitoring
US9464124B2 (en) 2011-09-12 2016-10-11 Moderna Therapeutics, Inc. Engineered nucleic acids and methods of use thereof
US10751386B2 (en) 2011-09-12 2020-08-25 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US10022425B2 (en) 2011-09-12 2018-07-17 Modernatx, Inc. Engineered nucleic acids and methods of use thereof
US9428535B2 (en) 2011-10-03 2016-08-30 Moderna Therapeutics, Inc. Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US9295689B2 (en) 2011-12-16 2016-03-29 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US9186372B2 (en) 2011-12-16 2015-11-17 Moderna Therapeutics, Inc. Split dose administration
US9271996B2 (en) 2011-12-16 2016-03-01 Moderna Therapeutics, Inc. Formulation and delivery of PLGA microspheres
US11690910B2 (en) 2012-01-31 2023-07-04 CureVac SE Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen
US9827332B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of proteins
US8999380B2 (en) 2012-04-02 2015-04-07 Moderna Therapeutics, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9587003B2 (en) 2012-04-02 2017-03-07 Modernatx, Inc. Modified polynucleotides for the production of oncology-related proteins and peptides
US9572897B2 (en) 2012-04-02 2017-02-21 Modernatx, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9675668B2 (en) 2012-04-02 2017-06-13 Moderna Therapeutics, Inc. Modified polynucleotides encoding hepatitis A virus cellular receptor 2
US9782462B2 (en) 2012-04-02 2017-10-10 Modernatx, Inc. Modified polynucleotides for the production of proteins associated with human disease
US9814760B2 (en) 2012-04-02 2017-11-14 Modernatx, Inc. Modified polynucleotides for the production of biologics and proteins associated with human disease
US9828416B2 (en) 2012-04-02 2017-11-28 Modernatx, Inc. Modified polynucleotides for the production of secreted proteins
US9254311B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins
US9878056B2 (en) 2012-04-02 2018-01-30 Modernatx, Inc. Modified polynucleotides for the production of cosmetic proteins and peptides
US9192651B2 (en) 2012-04-02 2015-11-24 Moderna Therapeutics, Inc. Modified polynucleotides for the production of secreted proteins
US9149506B2 (en) 2012-04-02 2015-10-06 Moderna Therapeutics, Inc. Modified polynucleotides encoding septin-4
US9114113B2 (en) 2012-04-02 2015-08-25 Moderna Therapeutics, Inc. Modified polynucleotides encoding citeD4
US9216205B2 (en) 2012-04-02 2015-12-22 Moderna Therapeutics, Inc. Modified polynucleotides encoding granulysin
US9220755B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9220792B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. Modified polynucleotides encoding aquaporin-5
US9221891B2 (en) 2012-04-02 2015-12-29 Moderna Therapeutics, Inc. In vivo production of proteins
US9107886B2 (en) 2012-04-02 2015-08-18 Moderna Therapeutics, Inc. Modified polynucleotides encoding basic helix-loop-helix family member E41
US9095552B2 (en) 2012-04-02 2015-08-04 Moderna Therapeutics, Inc. Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1
US9089604B2 (en) 2012-04-02 2015-07-28 Moderna Therapeutics, Inc. Modified polynucleotides for treating galactosylceramidase protein deficiency
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
US9303079B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins
US9301993B2 (en) 2012-04-02 2016-04-05 Moderna Therapeutics, Inc. Modified polynucleotides encoding apoptosis inducing factor 1
US9233141B2 (en) 2012-04-02 2016-01-12 Moderna Therapeutics, Inc. Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders
US9061059B2 (en) 2012-04-02 2015-06-23 Moderna Therapeutics, Inc. Modified polynucleotides for treating protein deficiency
US9255129B2 (en) 2012-04-02 2016-02-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
US9050297B2 (en) 2012-04-02 2015-06-09 Moderna Therapeutics, Inc. Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator
US10501512B2 (en) 2012-04-02 2019-12-10 Modernatx, Inc. Modified polynucleotides
US9597380B2 (en) 2012-11-26 2017-03-21 Modernatx, Inc. Terminally modified RNA
US8980864B2 (en) 2013-03-15 2015-03-17 Moderna Therapeutics, Inc. Compositions and methods of altering cholesterol levels
US11739125B2 (en) 2013-08-21 2023-08-29 Cure Vac SE Respiratory syncytial virus (RSV) vaccine
US10815291B2 (en) 2013-09-30 2020-10-27 Modernatx, Inc. Polynucleotides encoding immune modulating polypeptides
US10323076B2 (en) 2013-10-03 2019-06-18 Modernatx, Inc. Polynucleotides encoding low density lipoprotein receptor
US10898584B2 (en) 2013-11-01 2021-01-26 Curevac Ag Modified RNA with decreased immunostimulatory properties
US10369216B2 (en) 2014-04-01 2019-08-06 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
US11110166B2 (en) 2014-04-01 2021-09-07 Curevac Ag Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant
US11260018B2 (en) 2015-09-17 2022-03-01 Jrx Biotechnology, Inc. Approaches for improving skin hydration and moisturization
WO2019166946A1 (en) 2018-02-28 2019-09-06 Pfizer Inc. Il-15 variants and uses thereof
WO2019224716A2 (en) 2018-05-23 2019-11-28 Pfizer Inc. Antibodies specific for gucy2c and uses thereof
US11434292B2 (en) 2018-05-23 2022-09-06 Pfizer Inc. Antibodies specific for CD3 and uses thereof
WO2019224715A1 (en) 2018-05-23 2019-11-28 Pfizer Inc. Antibodies specific for cd3 and uses thereof
WO2020128893A1 (en) 2018-12-21 2020-06-25 Pfizer Inc. Combination treatments of cancer comprising a tlr agonist
WO2021124073A1 (en) 2019-12-17 2021-06-24 Pfizer Inc. Antibodies specific for cd47, pd-l1, and uses thereof
WO2022013775A1 (en) 2020-07-17 2022-01-20 Pfizer Inc. Therapeutic antibodies and their uses

Also Published As

Publication number Publication date
EP1196558A1 (en) 2002-04-17
NZ515957A (en) 2003-08-29
AU776268B2 (en) 2004-09-02
CA2376634A1 (en) 2000-12-14
AU5538900A (en) 2000-12-28

Similar Documents

Publication Publication Date Title
EP1196558A1 (en) Immunostimulant oligonucleotide
Hartmann et al. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo
Schellack et al. IC31, a novel adjuvant signaling via TLR9, induces potent cellular and humoral immune responses
Krieg et al. Causing a commotion in the blood: immunotherapy progresses from bacteria to bacterial DNA
Schulz et al. CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal
Krieg Therapeutic potential of Toll-like receptor 9 activation
Dalpke et al. Phosphodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo
Kamstrup et al. Response of porcine peripheral blood mononuclear cells to CpG-containing oligodeoxynucleotides
CN102517292B (en) Immunostimulatory oligoribonucleotides
AU2001281812B2 (en) Immunostimulatory oligodeoxynucleotides
Coban et al. Effect of plasmid backbone modification by different human CpG motifs on the immunogenicity of DNA vaccine vectors
CN101460620B (en) Immunostimulatory oligonucleotide and pharmaceutical application thereof
Van Uden et al. Immunostimulatory DNA and applications to allergic disease
EP1326636A2 (en) Vaccine composition
JP2004530428A (en) Immunostimulatory oligodeoxynucleic acid molecule
JP2003510282A (en) Immunostimulatory nucleic acids
Buckland et al. Aspirin-treated human DCs up-regulate ILT-3 and induce hyporesponsiveness and regulatory activity in responder T cells
JP2008502713A (en) Therapeutic uses of CpG oligodeoxynucleotides for skin diseases
Goeckeritz et al. Multivalent cross-linking of membrane Ig sensitizes murine B cells to a broader spectrum of CpG-containing oligodeoxynucleotide motifs, including their methylated counterparts, for stimulation of proliferation and Ig secretion
WO2006053861A1 (en) Oligonucleotides that induce the secretion of gm-csf
Carrington et al. CpG oligodeoxynucleotides stimulate immune cell proliferation but not specific antibody production in rainbow trout (Oncorhynchus mykiss)
Gerner et al. Local and systemic T cell immunity in fighting pig viral and bacterial infections
WO2001062909A1 (en) Immunostimulatory oligonucleotides
Xiao et al. Mucosal SARS-CoV-2 nanoparticle vaccine based on mucosal adjuvants and its immune effectiveness by intranasal administration
Charoenvit et al. CEL-1000—a peptide with adjuvant activity for Th1 immune responses

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000940454

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 55389/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 515957

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2376634

Country of ref document: CA

Ref country code: CA

Ref document number: 2376634

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09980265

Country of ref document: US

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 2000940454

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

WWG Wipo information: grant in national office

Ref document number: 55389/00

Country of ref document: AU

WWR Wipo information: refused in national office

Ref document number: 2000940454

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000940454

Country of ref document: EP