WO2000075302A2 - Isolation of nucleic acid - Google Patents
Isolation of nucleic acid Download PDFInfo
- Publication number
- WO2000075302A2 WO2000075302A2 PCT/GB2000/001684 GB0001684W WO0075302A2 WO 2000075302 A2 WO2000075302 A2 WO 2000075302A2 GB 0001684 W GB0001684 W GB 0001684W WO 0075302 A2 WO0075302 A2 WO 0075302A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rna
- substituent
- hydrophobic
- solid phase
- sample
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Definitions
- the present invention relates to a method for isolating RNA from a sample and to a kit for use in such a method.
- RNA is separated from other molecules, in particular other cellular components such as proteins, carbohydrates, lipids and DNA. It is a key process in the understanding of gene function and structure and drug development. Furthermore nucleic acid based diagnostic procedures for detecting RNA viruses such as HCV and HIV absolutely require the viral genomic RNA to be isolated in an intact and relatively pure form. In order to separate RNA in an intact and pure form from other biological material it is necessary to rapidly inactivate all ribonucleases that are present and separate the RNA based on a biophysical property unique to the RNA. However, due to the similar physical characteristics of RNA and DNA, RNA preparations are frequently if not always contaminated with DNA, leading to major difficulties in the analysis of results .
- mRNA is separated from genomic D ⁇ A by using a method based on oligo (dT) interacting with the poly A tail (Aviv and eder., Proc . ⁇ atl . Acad. Sci . USA. 69, 1408-1412 (1972) .
- A-rich D ⁇ A sequences are co-purified with this method leading to mR ⁇ A contaminated with A-rich D ⁇ A.
- nucleases that are specific for either RNA or DNA can be employed.
- Such highly purified enzymes are costly to use and frequently require removal before the nucleic acid can be used.
- RNase free DNase must be removed by phenol extraction or heat inactivation otherwise it will destroy for example PCR primers or other DNA based reagents in all post-nuclease reactions.
- Another method is to use a mixture of phenol, chloroform, isoamyl alcohol (50:49:1); whereby DNA preferentially partitions into the organic phase whilst RNA remains in the aqueous phase. This method at best still leaves a significant amount of DNA contaminating the RNA and hence is of limited practical use.
- RNA Isolation and Analysis are described in general texts (Jones et al . , (1994) in RNA Isolation and Analysis. Bios. Oxford., Sambrook et al . , (1989) Molecular Cloning: A Laboratory Manual, CSH.) Summary of the Invention
- the present invention provides a preparative method for isolating RNA comprising an oligo-or polynucleotide from a sample, which method comprises:
- the RNA may be mRNA, tRNA, rRNA, viral RNA, viroid RNA, synthetic RNA such as chemically synthesised or in vi tro transcribed forms, or any other form of RNA, such as hnRNA.
- the RNA may be a mixture of different types of RNA and may be in single- or double-stranded form, linear or circular and contain internal regions of secondary and tertiary structure such as is commonly found in tRNA.
- an oligonucleotide generally has a sequence of up to about 80 bases and a polynucleotide generally has a sequence length of more than about 80, preferably more than about 100 bases. A preferred length for a polynucleotide is at least 1000 bases.
- the mRNA may or may not have a cap and/or poly A tail.
- the RNA used in the present invention is preferably naturally- occurring.
- a naturally-occurring RNA according to the present invention typically comprises a nucleotide sequence which is found in nature and which has a structural function or generally encodes a polypeptide having biological activity, or such a nucleotide sequence which is modified, for example to alter in some way the biological activity of the polypeptide encoded thereby.
- the naturally-occurring RNA is preferably obtained by transcription from a suitable RNA or DNA template, itself usually naturally-occurring, in some cases the naturally- occurring RNA can be obtained synthetically.
- RNA according to the present - invention does not encompass simple homopolynucleotides (poly A, poly U, poly G and poly C) which can be generated synthetically but are biologically non- functional .
- RNA can be derived from a biological material such as bacteria, viruses such as those causing infection in humans, animals or plants, viroids, or cells such as fungal, animal and plant cells.
- An important aspect of this invention is modification of mRNA, rR ⁇ A and viral R ⁇ A since they are of major scientific and clinical interest and serve as a good example of the problems encountered when manipulating R ⁇ A.
- the invention further provides methods for obtaining intact full-length copies of mR ⁇ A, rRNA, viral R ⁇ A and other types of R ⁇ A isolated from cellular sources or extracellular fluids that demonstrate increased stability in conditions that would otherwise destroy a major fraction of the unmodified RNA .
- RNA up to 142 nucleotides (Nordhoff et al . , (1993) Nucleic Acids Res. 21:3347; Gruic-Sovulj et al . , (1997) Nucleic Acids Res. 25:1859; Tolson and Nicholson (1998) Nucleic Acids Res. 26:446) and double stranded DNA up to 500 base- pairs (Bai et al . (1995) Rapid Comm. Mass Spectrom. 9:1172; Taranenko et al .
- the 2' -OH modification may inhibit degradation of the poynucleotide .
- sele ' ct conditions that are suitable for chain cleavage.
- acetylated RNA is readily cleaved by nuclease Bal 31. Whilst alkali cleaves acetylated RNA it also results in acetyl cleavage so unless the amount of cleaved acetyl groups is measured by mass spectrometry, acetylated nucleotides will not be detected.
- acid cleavage of the modified polynucleotide can be used for base sensitive modifications, whilst base cleavage can be used for acid sensitive modifications.
- other degradation products such as dinucleotides , trinucleotides etc will also be suitable for measuring the percentage modification of the polynucleotide. Whether it is the nucleotide, dinucleotide or larger fragments that are being measured, in each case it is the ratio of the number of fragments bearing a modification compared with the number of fragments not bearing a modification that provides the percentage modification.
- Denaturing gels are preferred to non- denaturing gels because they reduce conformational effects providing a means to measure the true molecular weight of the linear polynucleotide (Jones (1995) Gel Electrophoresis: Nucleic Acids Essential Techniques, page 47, Wiley) .
- denaturants that can be used such as DMSO (50-90%) , glyoxal (10-30%) , formaldehyde
- acetylated RNA runs approximately 20 mm apart from the non-modified form as a tight band. Therefore, measuring the amount of modification of smaller modifying groups than acetyl (42 daltons) should be feasible.
- the acetylated RNA also runs at a position predicted to be 100% modified as compared with RNA size markers.
- Measuring the percentage modification with other modifying groups may also be possible providing that the molecular mass increase as a result of the modification is sufficient.
- halogenation of the 2' -OH group should be readily measured for chlorine (35.4 daltons) and bromine (79.9 daltons) substitution of the 2 ' -OH group.
- Calculating the percentage modification may be carried out by measuring the migration of known RNA size markers in a gel such as a 6M urea-5% acrylamide sequencing gel and plotting migration (mm) versus molecular weight (daltons) to obtain a standard curve. Because the exact, molecular weights of all the markers are known, it is straight forward to graph the relationship between the mobility in the gel versus the known molecular weight of each marker. The percentage modification for an RNA of known length with a known mass for the modifying group can then be readily calculated by comparison with this standard curve.
- An alternative means to determine the percentage modification is to use a radioactively labelled reactant such as 14C or3H acetic anhydride to modify RNA and then determining the molar ratio of radioactive acetyl groups to nucleotides in a known amount of RNA sample. If the molar ratio is 1:1, then 100% of the 2' -OH groups are modified. It will be understood that radioactive isotopes can be incorporated into a wide variety of reagents .
- Regiospecificity of the reaction can be determined by subjecting an identical sequence of DNA (or preferably single stranded DNA bearing uracil as a replacement to thymine) , to identical reaction conditions as used for RNA. It is expected that the DNA is not substantially modified as measured by incorporation of radioactivity, gel electrophoresis mobility, mass spectrometry, HPLC or any other analytical means used if the reaction is regiospecific for the 2' -OH group.
- Modification at the 2'-OH position is preferably substantially regiospeci ic .
- the polynucleotide retains important properties of the RNA.
- the polynucleotide is preferably modified so that a single strand of the polynucleotide is replicable by a nucleic acid polymerase to generate a second strand of polynucleotide complementary to the single strand.
- the modification at the 2'-OH position may be such that the entire OH of the 2'C of the ribose ring is replaced by a reactant group R as in 2'-R or by OR having 2'-OR where the -0- group may or may not originate from the 2'-0H group. Accordingly, the substituent at the 2' -OH position in this case is R or OR respectively.
- the reactant comprises an acid anhydride, -an acid halide, an acyl cyanide, a carboxylic acid or an N-acylimidazole, an alkoxyalkyl halide, an alkylthioalkyl halide, an alkoxyalkoxyalkyl halide, a trialkylsilane halide or a trialkylsilane imidazole.
- a modification e.g. acylation, modification with an ether- containing group or with a silane
- the reactant is attached to a solid phase such as with benzoyl chloride polymer bound beads (BCPB) so that the modification reaction at the 2' -OH group covalently links the RNA to the solid phase.
- the reaction medium may further comprise an acylation catalyst.
- the reactant comprises an acid anhyride
- this may be reacted with the RNA in the presence of a catalyst such as a fluoride ion or amino pyridine .
- the reactant comprises an acid chloride or N-acylimidazole
- the reactant may be reacted with the RNA in the presence of an amino pyridine.
- the reactant comprises a carboxylic acid
- this may be reacted with the RNA in the presence of a dehydrating agent or a catalyst, such as an isocyanide catalyst.
- a preferred aminopyridine catalyst is dimethyl aminopyridine (DMAP) .
- the organic solvent used in the reaction medium of the present invention may comprise an organic base and may comprise an organic solvent in which is dissolved the organic base or, in another embodiment, may be the organic base itself. It is preferred that the reactant is soluble in the organic solvent .
- the reaction medium further comprises water. In this way RNA to be modified may be conveniently added to the organic solvent as an aqueous solution of R ⁇ A.
- Typical organic solvents include alkanes such as hexane and pentane, pyridine, acetonitrile, dimethylformamide, dichloromethane, acetone, diethyl ether, benzene, chloroform, ethyl acetate, light petroleum, tetrahydrofuran, carbon tetrachloride, dichloroethane, dioxane, carbon disulphide, nitromethane, dimethyl sulphoxide, hexamethylphosphoric triamide and toluene.
- Typical organic bases include pyridine, triethylamine, trimethylamine, diisopropylethylamine, N, N- diethylaniline, N, N-dimethylaniline , 1 , 5-diazabicyclo
- Triethylamine (CH 3 CH 2 ) 3 ⁇ is a stronger (non-aqueous base) amine base than pyridine, aniline, diethylamine or trimethylamine but less so than pyrrolidone. It is one of the strongest amine bases.
- a preferred organic base which acts as an solvent is triethylamine (TEA) .
- TAA triethylamine
- a catalyst it is convenient for the catalyst to be soluble in the organic solvent as well.
- the water and the organic solvent may form different phases in the reaction medium. For example, the water and the organic solvent may be immiscible with one another and form phases which will separate upon standing. Where there is more than one phase, the RNA may be reacted with the reactant under conditions of phase transfer catalysis.
- the amounts of water and organic solvent may be varied and will depend to some extent upon the particular organic solvent/base/catalyst system to be used.
- the reaction medium comprises at least 50% organic solvent, preferably at least 80%, more preferably at least 90% and more preferably at least 95% v/v.
- the ratio of water : organic solvent is in the range 1:50 to 1:10, preferably around 1:20.
- partial 2' -OH modification is desired because the RNA retains many of its original biophysical properties. Partial 2' -OH modification can be favoured over complete modification of the RNA by using large and bulky reactants, increasing the amount of RNA added, adding a competing reactive group, removing the catalyst, reducing the temperature and/or time of reaction or the amount of reactant present .
- RNA in an intact form can be immobilised on BCPB beads when non-basic solvents such as tetrahydrofuran or dimethyl sulphoxide are used.
- a second modifying reagent can be added during or subsequent to the first reaction thereby reacting and protecting the remaining 2' -OH groups.
- the secondary reactant could carry a label such as a fluorescent group (for example isatoic anhydride) allowing a simple means to quantitate the amount of RNA bound to the bead by measuring the amount of label subsequently attached to the RNA-beads .
- a fluorescent group for example isatoic anhydride
- reaction time is generally from 20 to 60 mins . In the presence of the catalyst, the reaction proceeds more quickly, the reaction time generally being completed within about 20 seconds.
- the ratio of reactant to reaction medium is preferably in the range 1:200 to 1:10, more preferably around 1:20. Too little reactant gives a partial reaction and too much makes the reaction difficult to control.
- RNA is isolated from the sample by separating material which contains the substituent which has been used to modify the 2' -OH position of the ribose rings. Accordingly, a substituent needs to be selected so as to confer upon the RNA a property which the unmodified RNA does not possess.
- the substituent comprises an affinant capable of being recognised or bound by a partner such as a partner immobilised to a solid phase, or a protein.
- the affinant may be a hapten such as biotin or fluorescein which could be recognised and bound by an antibody or another protein such as streptavidin.
- Another useful affinant comprises a primary amino group capable of chemically reacting with an immobilised partner such as succinimide .
- the substituent comprises a hydrophobic substituent so that the RNA may be modified to render it more hydrophobic for the purpose of isolation.
- DNA and RNA are relatively hydrophilic molecules. It is quite difficult to separate RNA from DNA because their physical characteristics are similar.
- By increasing the hydrophobicity of RNA relative to DNA it is possible to improve the separation of the two types of nucleic acid. This is useful for either removing contaminating RNA from a DNA sample or removing contaminating DNA from RNA. For example it is important to remove bacterial RNA from a plasmid preparation prior to restriction enzyme analysis so that small DNA fragments are not obscured by the co- migrating RNA during agarose gel electrophoresis. Alternatively it is important to remove traces of DNA such as genomic DNA or viral DNA from cellular or viral RNA. Such DNA contamination often leads to false positives following RT-PCR amplification.
- the hydrophobic substituent typically comprises a substituent, OR, wherein R comprises C ⁇ -C 36 alkyl; C ⁇ -C 36 alkenyl; C ⁇ -C 36 alkynyl; C;* . -C 3 s haloalkyl ; C ⁇ -C 36 aminoalkyl; C ⁇ -C 3S alkoxyalkyl; C x -C 36 alkylthioalkyl ; C ⁇ -C 36 alkoxyalkoxyalkyl; C** .
- R comprises C ⁇ -C 36 alkyl; C ⁇ -C 36 alkenyl; C ⁇ -C 36 alkynyl; C;* . -C 3 s haloalkyl ; C ⁇ -C 36 aminoalkyl; C ⁇ -C 3S alkoxyalkyl; C x -C 36 alkylthioalkyl ; C ⁇ -C 36 alkoxyalkoxyalkyl; C** .
- -C 36 haloalkoxyalkyl ; C ⁇ -C 3S aminoalkoxyalkyl ; C 3 -C 36 aryl ; C 6 -C 36 alkylaryl; C 6 -C 36 arylalkyl; C s *-C 36 arylalkenyl ; C ⁇ -C 3S alkanoyl; C ⁇ -C 3S alkenoyl; C ⁇ -C 3S haloalkenoyl ; C;-C 36 haloalkanoyl ; C 2 -C 36 haloformylalkanoyl ; C ! -C 3S C ⁇ -C 36 aminoalkanoyl ; C !
- C ⁇ -C 36 alkyl C ⁇ -C 36 alkenyl; C ⁇ -C 36 alkynyl; C ⁇ -C 36 haloalkyl; C ⁇ -C 36 aminoalkyl; halo; amino; C ⁇ -C 3S alkylamino; C 6 -C 36 aryl ; C ⁇ -C 36 alkylaryl or C ⁇ -C 36 arylalkyl .
- the hydrophobic substituent comprises a C -C 7 carbon chain or ring, preferably one which arises where the reactant comprises butyric anhydride, pentanoic anhydride, hexanoic anhydride or benzoic anhydride.
- the proportion of 2' -OH groups bearing the substituent is at least 10%.
- the hydrophobic substituent may comprise a C 8 -C ⁇ 2 carbon chain or ring in which case it is preferred that the proportion of 2 ' -OH positions bearing the substituent is in the range 1 to 10%.
- the hydrophobic substituent may comprise a C ⁇ -C 36 carbon chain or ring more preferably a C ⁇ 2 to C 24 carbon chain or ring. In this case, it is preferred that the proportion of 2' -OH positions bearing the substituent is up to 1%.
- substituents of lower carbon chain length require a higher percentage, perhaps in the range up to 95%, to be effective.
- the step (b) of separating material containing the substituent from the sample may comprise contacting the treated sample from step (a) with a hydrophobic solid phase so as to bind the material containing the hydrophobic substituent and optionally washing the material bound to the hydrophobic solid phase.
- the hydrophobic solid phase may comprise hydrophobic particles.
- This method may further comprise a step of eluting the material bound to the hydrophobic solid phase by treating with a detergent, a chaotrope or a solvent, by lowering the salt concentration or by cleaving the substituent from the 2' -OH position of the ribose rings .
- step (b) comprises treating the treated sample from step (a) with a lyotrophic salt to aggregate the material containing the hydrophobic substituent as an RNA precipitate, and isolating the precipitate.
- the lyotrophic salt preferably comprises ammonium sulphate, an alkali metal chloride, magnesium chloride or calcium chloride.
- step (b) may comprise treating the treated sample with a non-polar solvent to form the hydrophobic liquid phase which contains the material containing the hydrophobic substituent, and isolating the hydrophobic liquid phase.
- the non-polar solvent typically comprises pentane, cyclohexane, toluene, benzene, light petroleum, xylene or hexane .
- step (b) may comprise use of a membrane, such as a PVDF membrane, to separate the RNA.
- a membrane such as a PVDF membrane
- the addition of hydrocarbon chains to the 2' -OH position of RNA increases its hydrophobicity, that is its ability to interact with a hydrophobic surface.
- hydrophilic PVDF filters to purify RNA has already been described in U.S. Patent 5,958,677 (Sept. 99). However, this describes only the binding of RNA, which is in its unaltered form is a weakly hydrophobic molecule. Modified RNA molecules of increasing hydrophobicity can be created, as discussed above, by adding acyl groups of increasing chain length.
- Hydrophobicity increases in the order: 2' -OH ⁇ formyl (-C(O)H) ⁇ acetyl (-C(0)CH 3 ) ⁇ propanoyl (- C(0)CH 2 CH 3 ) ⁇ butanoyl (-C (0) CH 2 CH 2 CH 3 ) , i.e. according to the carbon chain length. Longer chain lengths than butanoyl were not tested but would be expected to follow the same trend.
- the increase in the strength of the hydrophobic interaction was tested by binding RNA and modified RNA to a polyvinylidene fluoride (PVDF) membrane and subjecting the bound material to increasingly stringent wash conditions (see Examples) .
- PVDF polyvinylidene fluoride
- the reagent modifying the RNA 2' -OH group may be either free in solution or attached to a solid phase.
- a solid phase is employed.
- the solid phase is not the same as the hydrophobic solid phase described above and is used as a reactant so that the solid phase itself is introduced as the substituent modifying the RNA (note the hydrophobic solid phase is employed only after the RNA is modified with a hydrophobic substituent) .
- the modification reaction will lead to the covalent attachment of the RNA to the solid phase. This provides a convenient means to immobilise RNA to a solid phase in order to purify or analyse it.
- RNA will be preferentially bound to the solid phase from a RNA, DNA and protein mixture such as a cell lysate or serum.
- Advantages of using RNA covalently bound to a solid phase include ease of manipulation, purification, automation and compatibility with many important life science applications such as diagnostics and detecting gene expression. It is also a convenient means to limit the amount of modification occurring on the RNA polynucleotide because the reactive groups are spatially restricted. RNA modified at only a few 2' -OH positions may retain important biological functions such as serving as a template for protein translation, hybridisation and serving as a template for a polymerase .
- Benzoyl chloride polymer bound (BCPB) beads are commercially available (Fluka, USA) with high densities of benzoyl chloride groups (approximately 2.1mmol/g of resin) .
- RNA can be covalently attached to the benzoyl chloride solid support via an ester linkage between the BCPB bead and the 2' -OH group. Under appropriate reaction conditions, the 2' -OH groups of the RNA will react with the benzoyl chloride and become covalently coupled to the solid phase.
- an asymmetric acid anhydride may be attached to the solid phase so that the half of the acid anhydride attached to the solid phase reacts preferentially with the 2' -OH group resulting in immobilised RNA.
- Other examples include the use of cyclic anhydrides such as isatoic anhydride polymer bound (Cat 17344, Fluka, USA).
- carboxylic acid derivatives such as the acid halides (e.g. benzoyl chloride polymer bound), acid cyanides (e.g. benzoyl cyanide polymer bound) or acid imidazoles (e.g. N- benzoyl imidazole polymer bound) because the outcome of the reaction will be an ester linkage between the solid phase and the polynucleotide.
- the solid phase reactant need not be limited to carboxylic acid derivatives, rather any reactant that reacts with the 2' -OH group in a regiospecific manner is suitable.
- the amount of particles required to immobilise a given amount of RNA will depend on several factors such as the density of the reactive groups and the proportion of the reactive groups that will react with the 2' -OH.
- Reactive groups that are buried, for example within the resin will be unable to react with a large molecule like RNA and they will therefore be effectively unreactive.
- the precise RNA binding capacity for a particular solid phase reactant will require empirical tests. If steric hindrance occurs between the polynucleotide and the reactive group due to the proximity of the solid phase a linker or spacer may be used between the solid phase and the reactive group such as - (CH 2 ) 1 2-16 ⁇
- the solid phase may consist of an inorganic particle, a polymeric linear, ' globular or cross-linked molecule or resin. It may be made of a variety of materials or material composites such as acrylamide, agarose, cellulose, polyamide, polycarbonate, polystyrene, latex, glass and silicon. It may also possess specific properties that aid in the manipulation of the particle such as paramagnetic or magnetic properties, a diameter allowing retention by a filter, an increased density that enhances sedimentation or separation by centrifugation or incorporate a tag aiding identification, capture or quantification of the particle.
- the tag may be coloured, fluorescent, an isotope, an epitope for an antibody or a ligand for a protein such as streptavidin, or a protein such as an enzyme or antibody or an oligonucleotide .
- One purpose of the tag is to aid identification of the particle when particles from several sources are combined. For example, if mRNA from tissue 1 is immobilised on particle type A, mRNA from tissue 2 is immobilised on particle type B and particles A and B are then mixed and added to a hybridisation reaction including for example a radioactive probe. Following hybridisation, particles of type A and B are separated by means of a property unique to the tag and the radioactivity associated with each particle analysed to provide a measure of the relative gene expression in tissues 1 and 2.
- Other uses of the tag could include the automated quantification and validation of the number of particles in a vessel such as a 96-well plate.
- the 'particle' or macromolecular structure may be incorporated into many forms such as a strip, a fibre, a matrix, a membrane, a filter, a column, a bead, a resin, a vessel wall, a pipette tip, a gel or a plate or an etched silicon device.
- the reactant may be covalently attached to the solid phase using for example divinyl benzene (DVB) or associated by another means such as ionic interaction or hydrogen bonding so that in any case the RNA is firmly held to the solid phase during washing and analysis.
- covalent attachment is preferred because there will be less tendency for the reactant to dissociate from the solid phase.
- the solid phase reactant may be incorporated into a microdevice or vessel such as those made from etched silicon and the solution containing the RNA passed over or through the region containing the reactant so that RNA immobilisation occurs in a specific region of the solid phase. This process may be automated in order to detect for example RNA viruses such as HCV and HIV in blood or body fluids.
- the immobilised sample might then be used for any number of down stream applications such as hybridisation, RT-PCR, TMA or NASBA.
- the solid phase reactant may be incorporated into a blood collection device such that the RNA components of the blood are immobilised during the blood collection process.
- the solid phase reactant may also be coated or attached to a glass slide in many small (preferably less than 1mm 2 ) discrete regions.
- a single RNA sample from, for example a tissue source may be added (in a suitable solvent and catalyst) to one of the discrete regions thereby localising the RNA to a discrete position of the glass slide. The process may then be repeated with other RNA samples until tens, hundreds or thousands of RNA samples are attached to as many discrete regions of the slide as necessary.
- microchip applications could have very broad applications such as diagnostic or gene expression analyses.
- RNA polynucleotides For certain applications it may be useful to restrict the size of the RNA that is immobilised. By using a macroporous resin with the reactant located within the pores, a size cut-off is established whereby only smaller RNA polynucleotides will be capable of accessing and therefore reacting with the reactant whilst longer RNA polynucleotides are lost . This could be useful for determining the size of the RNA polynucleotides being analysed. Alternatively it may provide a means to specifically remove short RNA polynucleotides allowing the separation of longer complete RNA polynucleotides that do not react with the solid phase.
- RNA based on size Separation of RNA based on size is currently carried out using either gel electrophoresis or column chromatography and this invention provides a simpler means to remove short polynucleotides from solution.
- Commercial sources of beads with defined pore sizes are available for oligonucleotide synthesis.
- the RNA may be further modified at the remaining 2 ' -OH positions in order to endow it with additional desired properties such as hydrophobicity, fluorescence, radioactivity or nuclease protection.
- the RNA may also be used for a variety of quantitative assays such as hybridisation with labelled probes or serve as a template for RT-PCR. In the latter case, it has been found that BCPB beads have the advantage of being compatible with both the components of the reverse transcription and PCR reactions. Other purification materials such as silica beads inhibit these reactions.
- BCPB beads A marked advantage of using BCPB beads compared with silica beads to purify RNA is that there is no elution step required to separate the RNA from the solid phase. If silica beads are added to the reverse transcription reaction they would bind both the template RNA, primers and a proportion of the enzyme leading to reduced or total inhibition of cDNA synthesis. It has been found that following RNA reaction, BCPB beads can be added directly into both the reverse transcription and PCR reactions with no such inhibition. BCPB beads may also find utility for other types of reactions such as LCR and NASBA. Adding the beads to the reaction simplifies manipulation and ensures that all the captured RNA is transferred into the reaction. The bead format could prove useful for automated systems in the diagnostic field. Thus BCPB beads are especially preferred in the present invention.
- RNA is modified using acetic anhydride in a basic solvent such as triethylamine with DMAP
- a basic solvent such as triethylamine with DMAP
- the modification of the 2' -OH groups proceeds so quickly that base catalysed cleavage of the RNA is insignificant.
- the reactant is attached to a solid phase such as the BCPB, it is unlikely that all the 2' -OH groups can be modified due to the physical immobilisation of the reactant. Therefore, even after extensive incubation times, the majority of the 2' -OH groups will not be modified and are therefore susceptible to cleavage by the basic solvent. It is very important that the solvent used does not lead to RNA polynucleotide cleavage.
- Preferred non-basic solvents include tetrahydrofuran and dimethyl sulphoxide . Neither of these solvents results in RNA cleavage yet both the RNA and catalysts such as DMAP readily dissolve in it.
- RNA bound to the BCPB For 50ng of RNA in l ⁇ l of water, added to 80 ⁇ l of THF/DMAP (5mg/ml) adding more than 1.5 mg of BCPB reduced the percentage of RNA bound from 74% to 48% (22mg BCPB) . It was found that during post-reaction purification of the BCPB beads that they tended to clump and stick together in aqueous solution making washing the beads difficult. This problem was overcome simply by stopping the reaction with 3 reaction volumes of 70% ethanol and briefly mixing before washing with aqueous solutions. Preferred bead sizes are those that provide a maximum surface area for reaction to occur with the RNA.
- Buried reactive groups will not be accessible to the RNA, therefore beads and particles with a small diameter (large surface area to volume) are preferred. However, in order to collect the beads from the liquid phase it is necessary that they are not so small that they cannot be easily pelleted by centrifugation, collected by filtration or selected by other means. Commercially available BCPB beads with a mesh size of 100- 300 are readily pelleted using a centrifugal force of 1500g for 5sec.
- RNA template Due to the physical separation of the reactive groups on the solid phase, a single RNA template may be linked to the solid phase via only one or a few 2' -sites. If the RNA template is relatively long and the sequence to be amplified relatively short, there will only be a small number of RNA templates that are attached within the sequence to be amplified. These templates will probably not be copied by the enzyme because the 2 ' -modification may block the passage of the enzyme.
- the HCV R ⁇ A genome is approximately 10,000 nucleotides long, if the PCR primers span a region of 100 bp, only 1% of the polynucleotides will not amplify due to the 2 ' -modification.
- the R ⁇ A template is shorter, for example 1000 nucleotides and the PCR primers span 1000 bp, then none of the R ⁇ A will serve as a template for RT-PCR. It is therefore preferable to PCR amplify only short regions of the R ⁇ A.
- the reverse transcriptase primer should be as close to the 3' PCR primer as possible, preferably being of identical sequence.
- PCR primers that amplify sequences close to the 3' end of the mRNA .
- the R ⁇ A may be released from the solid phase using chemical or enzymatic deprotection, for example by alkali or KC ⁇ cleavage of the ester linkage before RT-PCR.
- D ⁇ A will bind non- specifically to the beads probably through hydrophobic interactions with the BCPB bead. Such interactions can be reduced by using DMF, pyridine, ethyldiisopropylamine (EDPA) , triethylamine or DMSO as the reaction solvent instead of THF. Non-specific DNA binding can be removed by one or more washes in 10% SDS . However, DNA may react with BCPB beads covalently via either the 3' or 5' -OH groups. Less than 3% of a labelled DNA sample became covalently attached when DMSO was used as a solvent for the BCPB beads compared with 14% with THF as a solvent.
- RNA was purified from solutions containing high concentrations of protein, it was found that a proportion of the RNA tended to bind to the beads whilst complexed with protein in a non-specific manner. Such R ⁇ A could be readily removed by several washes in 10% SDS .
- a practical solution to non-specific protein binding to the BCPB beads may be the use of a protein removal step before the addition of the BCPB beads to the sample.
- a protein pre-binding step a serum sample containing the RNA analyte may be added to, or passed through a protein binding surface such as a hydrophobic bead, membrane, filter or other protein capture surface and then the solution containing the deproteinised RNA added to the reactant-solid phase such as BCPB beads.
- Suitable membranes that are known to capture proteins but not nucleic acids include 0.45 ⁇ m pore size Immobilon-P (hydrophobic polyvinylidene fluoride, Millipore, US) .
- proteins could be separated from an RNA virus by filtration whereby the proteins but not the virus particles pass through an ultrafiltration membrane with a nominal molecular weight cut-off of 30 000 -100 000 daltons such as Centricon -100, Centriplus-100 (Amicon, US) .
- Filters with pore sizes above O.Ol ⁇ m such as Isopore 0.05 ⁇ m polycarbonate membranes (Millipore, US) should generally capture most virus particles from blood serum whilst allowing most proteins to pass through. Such collected virus particles could then be added to the reactant-solid phase such as BCPB beads .
- the volume of a body fluid such as serum may be reduced prior to addition of the reactant-solid phase using a Centrifree filtration device.
- the retained sample containing protein and viral RNA could then be added to a solvent containing the reactant-solid phase such as BCPB beads .
- Blood contains approximately 70mg/ml of protein and a large component of this is albumin and immunoglobulins .
- Means to reduce serum proteins include the addition of immobilised S . aureus protein A or thiophilic resin (Sigma, US) which bind immunoglobulins, a major component of blood protein. Protein A linked to a solid phase such as a bead or thiophilic resin -would provide a facile means to reduce blood protein concentration.
- the RNA binding reaction may be enhanced by reducing the volume of the reaction to a minimum required to keep the RNA soluble and in contact with the beads . Approximately 10 ⁇ l of solvent is required to immerse 1-3 mg of BCPB. It was found that adding plasmid DNA to a final concentration of 25ng per microlitre enhanced RNA binding, possibly by increasing the apparent concentration of the RNA. Other volume excluding compounds such as polyethylene glycol may also enhance RNA binding.
- RNA is to be isolated intact from cells, blood or other biological material, it is necessary to inhibit ribonuclease activity.
- One way to do this is to use a slight excess of chaotrope and/or detergent and then add this to the solid phase reactant in a suitable solvent system thereby immobilising the RNA. The solid phase may then be washed to remove contaminating proteins and DNA.
- Suitable chaotropes may include guanidinium chloride, guanidinium thiocyanate, sodium iodide, sodium perchlorate and sodium t ⁇ chloroacetate .
- BCPB is thus sufficiently stable for the present applications. Water m excess of 7.5% vol/vol m THF reduces the reactivity of
- the preferred water content is 3 ⁇ l or less m 40 ⁇ l of THF with lmg of BCPB.
- the solid phase could include a particle, a bead, a membrane, a gel, a slide or cover slip, an etched silicon surface, a fibre, a filter, a capillary, a tube, a vessel or a multi- vessel plate such as a 96 well plate.
- a solid phase improves handling throughput and accuracy when the RNA immobilisation and analysis is automated. In this context, paramagnetic particles are favoured for their handling properties.
- Other preferred solid phases are those which comprise OH groups, e.g. compounds of silicon and oxygen, such as silica particles or a glass.
- Nucleic acid purification using silica beads is well known and widely practised both m diagnostic and life science research. Methods of purifying RNA have been described in US patent 5,234,809. Briefly the method involves binding the nucleic acid sample to silica beads in a chaotropic agent such as urea and then washing the beads in a high salt wash before it is eluted into water.
- the modified RNA used in the present invention has been tested for its ability to bind and be released from silica beads using a silica bead purification kit (Qiagen, Germany) and found to be particularly suited to this type of separation method (see Examples) .
- nucleic acids from biological samples involves mixing silica particles with a chaotropic salt containing the sample. Under these conditions the nucleic acid binds reversibly to the silica.
- modified RNA will readily bind to silica beads, e.g. in the presence of 95% organic solvent. This unexpected result suggests that silica particles are suitable to bind modified RNA from a variety of organic solvents.
- Bifunctional acid halides e.g. acid chlorides
- Reagents such as sebacoyl chloride (ClOC (CH 2 ) 8 COCl) , adipoyl chloride (C10C(CH 2 ) 4 C0C1) and glutaryl chloride (ClOC (CH 2 ) 3 C0C1) can be used to immobilise RNA by covalent modification of the 2' -OH group with consequent attachment to a solid phase.
- the bifunctional acid chloride can either be reacted with the RNA and then with a solid phase, or preferably with a solid phase and then the RNA sample.
- the solid phase is conveniently BCPB beads, or one which has hydroxyl groups such as glass and other silicon dioxide compounds. It is known that boiling concentrated JHCl exposes hydroxyl groups on the surface of glass. Such prepared glass can then be reacted with an excess of the bifunctional acid chloride, the unreacted acid chloride is removed by washing in solvent such as THF and then the RNA sample added and allowed to react with the immobilised acid chloride, thereby becoming immobilised via the acid chloride to the glass solid phase.
- Bifunctional acid chlorides are preferred that have an extended hydrocarbon spacer between each end of the molecule such as with sebacoyl chloride (Cat. No. 84848 Fluka, USA) because these are likely to reduce steric hindrance between the RNA and the solid phase and therefore improve the reaction.
- RNA becomes bound to the surface of silica beads, therefore tests were carried out to find out whether RNA can be modified whilst bound to the silica beads. Although it may be expected that some of the 2' -OH groups are protected from modification due to steric hindrance between the silica bead and the RNA, in practice, this effect was found to be undetectable leading to substantially modified RNA (see Examples) .
- modifying with acetic anhydride for example, compared with an RNA modification reaction with no acetic anhydride added, the modified RNA was substantially intact and migrated identically to an acetylated RNA modified by the standard procedure.
- RNA Modification, such as acetylation, of RNA can therefore occur whilst the RNA is bound or attached to a solid support or surface. This potentially offers advantages when high throughput of samples is required or when RNA is purified using silica beads for example for diagnostic purposes from blood. " This is therefore a preferred aspect of the present invention.
- the present invention provides a kit for isolating from a sample R ⁇ A comprising an oligo- or polynucleotide, which kit comprises:
- the reaction system comprises:
- a complex mixture of D ⁇ A and R A polynucleotides from a cellular source is treated with a lipophillic acid anhydride such as butyric anhydride (C s H ⁇ 4 0 3 ) , pentanoic anhydride (C ⁇ 0 H ⁇ 8 O 3 ) , hexanoic anhydride (C 12 H 22 0 3 ) , heptanoic anhydride (C ⁇ 4 H 26 0 3 ) or benzoic anhydride (C ⁇ H 10 O 3 ) as described.
- a lipophillic acid anhydride such as butyric anhydride (C s H ⁇ 4 0 3 ) , pentanoic anhydride (C ⁇ 0 H ⁇ 8 O 3 ) , hexanoic anhydride (C 12 H 22 0 3 ) , heptanoic anhydride (C ⁇ 4 H 26 0 3 ) or benzoic anhydride (C ⁇ H 10 O 3 ) as described.
- RNA modification Longer chain lengths than heptanoic anhydride are not preferred for complete (100%) RNA modification because incomplete modification of the RNA chain has been observed, possibly due to steric hindrance between the RNA chain and the long chain anhydrides.
- Such reagents will modify the single terminal 3 ' -OH group and possibly the single 5' -OH or phosphate group of the DNA or RNA chain but all or substantially all the 2' -OH groups of the RNA, thereby strongly altering the physical characteristics of the RNA towards lipophilicity .
- the DNA is modified at only one (3' -OH) or a maximum of two (one 5'- OH/phosphate and one 3 ' -OH) position (s) and therefore remains overall hydrophilic. This difference in lipophilicity then serves as the basis for separation of the DNA from RNA.
- the hydrophobic RNA is preferably manipulated with silanised plasticware and/or with detergents such as 0.01% Tween-20, 0.01% NP40 or 0.1 Triton X-100 so that sample loss is reduced.
- the capture surface or material for the modified RNA could be encapsulated within a centrifuge device such as a microcentrifuge spin-column or tube insert. Alternatively, it could be encapsulated in a pipette tip such as those commonly used to measure l ⁇ l, lO ⁇ l, 200 ⁇ l or 1 ml volumes. In either case, capture, washing and elution of the modified RNA is improved because the time required to separate the modified RNA from the contaminants is reduced. Multiple RNA samples could be purified in parallel by the use of devices bearing multiple capture surfaces. An example would be a 96 -well plate whereby each well is hydrophobic and suitable for capture, washing and elution of one modified RNA sample.
- a further example would be a vessel or chamber suitable for the modification reaction and in addition the capture, washing and elution of the RNA sample. In this way, both the modification and purification is carried out in the same vessel or chamber improving sample throughput and productivity.
- the modification, capture, washing and elution of the RNA sample could be automated and involve robots .
- Example 1 of each of these copending patent applications sets out a method of modifying a total cellular RNA population and selection of the mRNA fraction.
- a crude cellular or tissue lysate consisting of RNA, D ⁇ A, protein and lipids etc. may serve as the sample for the modification reaction.
- the reactant may modify not only the 2' -OH group of the R ⁇ A chain but also the hydroxyl bearing side chains of the amino acids tyrosine, serine or threonine of proteins. It will be apparent that such a reaction is beneficial because it will lead to the deactivation of cellular nucleases and therefore allow the selection of RNA in a more intact form.
- cells could be disrupted in the presence of the reactant so that nucleases are immediately inactivated on release from the cell and the R ⁇ A is immediately modified and therefore protected from any remaining nucleases.
- increased concentrations of the reactant in the reaction may be required in order to inactivate the nucleases fully as well as to modify fully the 2' -OH groups of the R ⁇ A sample.
- the treated D ⁇ A and R ⁇ A sample in a high salt buffer (e.g. 1-5 M ammonium sulphate, preferably 10 mM phosphate, pH 7.0, 1.5 M ammonium sulphate) is passed over a hydrophobic column as is commonly used for reverse phased liquid chromatography.
- a hydrophobic column as is commonly used for reverse phased liquid chromatography.
- reversed phase packings based on silica may have bonded hydrocarbon chains of C4 , C8 or C18 or others may be based on polystyrene (e.g. POROS® and Oligo R3 , PerSeptive Biosytems, USA) may be used under appropriate conditions.
- plastics such as polypropylene, polycarbonate, polyvinylidene fluoride (manufactured under the tradename Hydrophobic Durapore, (Millipore, USA) and PTFE . With all plastics those with a large surface area to volume are preferred in order to increase the effective hydrophobic binding surface. These types of surfaces exist as beads of cellulose covered with butyl, octyl or phenyl groups
- RNA can be released by several methods . Firstly and preferably, the RNA can be deprotected by cleavage of the modifying group with 50% ammonia treatment, 10-40mM KCN
- RNA can then be collected and purified further if required by, for example oligo (dT) selection of the mRNA .
- the RNA can be removed from the solid support in its modified form using detergents such as 0.1% SDS, 0.002M Triton X-100TM (Union Carbide Chemical and Plastics, Inc.), ⁇ onidet P-40TM (Shell Oil Co.) or 1% TWEE ⁇ TM (ICI Americas, Inc.) in aqueous solution. Or alternatively by lowering the salt concentration (preferably 10 mM phosphate, pH 7.0) in the binding buffer to a point where elution is brought about.
- a chaotropic agent such as ethylene glycol, urea, guanidine-HCl or thiocyanate salts.
- Solvents such as isopropanol, methanol, ethanol, DMSO or acetronitrile may also be used to elute the RNA up to a final concentration of 40% (v/v) in water.
- FIGURE 1 shows RNA attachment strength on a PVDF membrane, plotting the % of remaining RNA on filter against wash conditions
- FIGURE 2 shows data relating to the release of RNA and acylated RNA from silica beads, plotting the % RNA released from silica beads against RNA type.
- Separation can be brought about using such commonly used salts as ammonium sulphate or sodium chloride (known as « lyotrophic salts ») which are routinely used for separating proteins with varying hydrophobic properties from solution by a process known as 'salting out'. Proteins with the greatest hydrophobic tendencies aggregate and precipitate out of solution at the lowest lyotrophic salt concentration.
- a specific salt concentration can be selected that will cause modified RNA to aggregate whilst the hydrophilic DNA will remain in solution thereby providing the basis for separation.
- the specific salt concentration will depend on the particular modifying reagent used.
- RNA modified with longer carbon chains which are therefore more hydrophobic such as heptanoic anhydride will aggregate at a lower salt concentration than those modified by shorter chain lengths such as acetic or propionic anhydride.
- Other salts that may be used include RbCl, KCl , NaCl , CsCl, LiCl, MgCl 2 and CaCl 2 .
- Aggregates can be collected either by allowing precipitation to occur at unit gravity or by centrifugation at 1-5000 g in a bench top centrifuge.
- the modified RNA can then be collected and salts removed by washing with several washes of 70% ethanol .
- salts can be removed by using a Centricon-50 column (Amicon, MA, USA) and washing with a either water or 0.1% SDS. Following this purification procedure and, alternatively following the removal of the hydrophobic group, the RNA may be used as a template for RT-PCR or in northern blotting.
- modified RNA with increased hydrophobic properties could be simply purified from a complex mixture of proteins, DNA and other cellular components by mixing and agitating by use of a vortex etc. the mixture with appropriate solvents such as (in order of decreasing polar property) pentane, toluene, chloroform, THF, DMSO or methanol.
- solvents such as pentane, toluene, chloroform, THF, DMSO or methanol.
- Hydrophobic solid supports include ethyl-, propyl-, butyl-, pentyl-, hexyl-, octyl-, decyl and dodecyl-agarose affinity chromatography media (Catalogue ref . AAF-8, Sigma-Aldrich Chemicals). Interaction between the modified RNA and the media should be stronger with longer chain lengths attached to either the RNA or immobilised support. By careful choice of the binding solution it is possible to selectively bind RNA to the beads whilst the contaminants such as DNA are retained in the binding solution. The polarity of the solvent used for binding and washing, the type and concentration of detergent, temperature of interaction and carbon chain length used will all influence the effectiveness of the purification.
- RNA 60 ⁇ l of ethyl-agarose or dodecyl-agarose beads (Sigma, USA) were washed twice in 200 ⁇ l of 1.7M ammonium sulphate and collected by centrifugation at 3000g for 5 seconds between washes. 40 ⁇ l (20%) of the beads in of 1.7M ammonium sulphate were added to 300ng of isatoic anhydride labelled RNA. It was found that the fluorescent isatoic anhydride modification could be used to monitor binding to the hydrophobic beads under ultra-violet light. On addition to the beads, fluorescent RNA moved from the solvent to the beads within a few seconds demonstrating interaction between the modified RNA and the hydrophobic surface.
- RNA can be separated from other cellular components based on an initial modification reaction of the 2 ' -OH groups followed by selective hydrophobic binding to a hydrophobic surface, and where necessary subsequent release before use for hybridisation etc.
- This approach could be useful for purifying RNA from biological samples such as cells for gene expression studies or viral RNA from biological material such as body fluids such as serum and cerebral spinal fluid.
- a deprotecting agent such as alkali, ammonia or KCN that leads to acyl cleavage and therefore separation of the RNA from the hydrophobic groups
- a detergent such as SDS or TWEEN that is capable of disrupting the hydrophobic interaction with the solid support .
- BCPB beads were added to 40 ⁇ l of THF and then 512ng of BMV RNA (Promega, US) in 2 ⁇ l of water was added and briefly vortexed then incubated for lOmin at 22 °C.
- I ⁇ l (lO ⁇ mol) of acetic anhydride was then added in 20 ⁇ l of THF containing 180 ⁇ g of DMAP. The reaction was allowed to proceed for a further 5 min at 22 °C and then stopped with 200 ⁇ l of 70% ethanol and the beads collected by centrifugation at 3000rpm for 5sec and then washed a second time in 70% ethanol and twice in 200 ⁇ l of water before being resuspended in 20 ⁇ l of water.
- the secondary reactant such as acetic anhydride or acetic- formic anhydride could also carry various labels such as 14C or 3H allowing the amount of RNA to be determined using a scintillation measurement of the washed RNA-bead complex.
- the secondary reactant could be fluorescent such as isatoic or N-methylisatoic anhydrides or carry a label such as biotin permitting quantification of the amount of RNA bound to the bead.
- the secondary reactant would be expected to modify at least 75% or more of the 2' -OH groups so that the RNA is protected from degradation from for example ribonucleases .
- the secondary modification could also provide a means for a second purification step.
- the secondary reactant could contain a hydrophobic group or a ligand such as biotin for binding to a streptavidin bead.
- a hydrophobic group such as biotin for binding to a streptavidin bead.
- the RNA On release from the first solid phase such as BCPB beads the RNA would be specifically bound to a hydrophobic surface such as dodecyl-agarose beads.
- Example 5 Probe hybridisation to RNA immobilised on BCPB beads lOOng of BMV RNA (Promega, USA) m l ⁇ l of water was added to 40 ⁇ l of either THF or DMSO and then 3mg of BCPB beads added, mixed and incubated at 22 °C for 15mm, the beads were then washed once m lOO ⁇ l of 70% ethanol, once m lOO ⁇ l of 10% SDS and three times lOO ⁇ l of water.
- the beads were finally resuspended m 50 ⁇ l of Church hybridisation buffer (0.5M NaPi pH7.2 , 7% SDS and ImM EDTA) containing a 32P dCTP radiolabelled probe complementary to the BMV RNA sequence (RNA 2, nucleotides 1-321). Following incubation for 2 hrs at 55°C, the beads were washed twice 500 ⁇ l of 2 X SSC/0.1% SDS to remove non-hybridised probe and then the amount of radioactivity remaining on the beads was determined using a scintillation counter.
- Church hybridisation buffer 0.5M NaPi pH7.2 , 7% SDS and ImM EDTA
- the probe can be branched or linear and labelled with a radioactive, fluorescent, coloured, affinity or protein label m a manner identical to standard hybridisation procedures. In this way, the amount of RNA complementary to the probe can be quantitatively determined. This could be useful for example when determining the abundance of transcripts representing specific genes different tissues.
- purified RNA from the tissue of interest could be immobilised onto the BCBP beads and complementary labelled probes hybridised. Unlike a traditional dot blot (Sambrook et al . , (1989) Molecular Cloning: A Laboratory Manual, CSH) the RNA is attached to beads and not a membrane, therefore the kinetics of hybridisation are improved (see Wilkms Stevens et al .
- RNA virus from, for example a body fluid such as serum
- a probe representing a viral sequence hybridised to the RNA-bead complex is immobilised on the BCPB bead or other solid phase reactant and a probe representing a viral sequence hybridised to the RNA-bead complex. The amount of probe hybridised to the bead would indicate the amount of viral RNA in the starting material .
- RNA which is added to 20 ⁇ l of the particles in l ⁇ l of water.
- the reaction is allowed to proceed at 22 °C for 30 minutes and then the particles washed with 200 ⁇ l of 70% ethanol and twice in 200 ⁇ l of water.
- Non-basic solvents are preferred so that the RNA is not degraded during the course of the reaction.
- Suitable solvents include THF, dimethyl sulphoxide and dimethyl formamide.
- Catalysts such as DMAP, 4 -pyrrolidinopyridine, other aminopyridine catalysts, tetrabutylammonium fluoride or tributylphosphine may be used in catalytic quantities during the reaction.
- the covalently immobilised RNA can then be used for a variety of downstream applications such as RT-PCR amplification, hybridisation and NASBA,
- RNA transcript was produced using a Riboprobe kit (Promega, USA), T3 RNA polymerase, 32 P UTP and a plasmid DNA template (pGEMEX-1 linearised with Hind III). Approximately 10,000 cpm of radiolabelled RNA (10 ng) was modified in separate reactions with acetic formic anhydride, acetic anhydride, propionic anhydride or butyric anhydride as follows.
- Formylation 5 ⁇ l of acetic formic anhydride was added to a 100 ⁇ l reaction containing 95 ⁇ l THF, 16 mg (195 ⁇ mol) 1-methylimidazole, and 10 ng radiolabelled RNA and the reaction incubated at 22 °C for 10 min before purification by ethanol precipitation.
- Acetylation, propanoylation, butanoylation A 20 ⁇ l reaction containing 19 ⁇ l triethylamine, 100 ⁇ g DMAP, 2 ⁇ l of anhydride and 10 ng of radiolabelled RNA was mixed and incubated for 1 hr at 22 °C. All modified RNA samples were purified by ethanol precipitation. Approximately equal amounts of RNA or modified RNA (5,000 cpm) was spotted onto a hydrophobic PVDF membrane (Amersham Pharmacia, UK) that had been pre-wet with methanol.
- RNA ladder (Life Technologies) was mixed with 4 ⁇ l of silica beads (Qiaex, Qiagen, Germany) , mixed with 12 ⁇ l of saturated sodium iodide and incubated for 5 min at 22 °C. The sodium iodide was removed and the washed beads added to 19 ⁇ l of triethylamine, 100 ⁇ g of DMAP and 2 ⁇ l of acetic anhydride and the reaction incubated for 5 min at 22 °C. The beads were then washed two times in 500 ⁇ l PE buffer A and centrifuged for 5 min at 13,000 rpm. The RNA was eluted in 5 ⁇ l of water and analysed by agarose gel electrophoresis.
- RNA modification reaction with no acetic anhydride added, the modified RNA was substantially intact and migrated identically to a acetylated RNA modified by the standard procedure. Acetylation of RNA can therefore occur whilst the RNA is bound or attached to a solid support or surface. This potentially offers advantages when high throughput of samples is required or when RNA is purified using silica beads for example for diagnostic purposes from blood.
- BCPB beads 2mg of BCPB beads were added to 40 ⁇ l of THF and then 512ng of BMV RNA (Promega, US) in l ⁇ l of water was added and briefly vortexed then incubated for lOmin at 22 °C. The reaction was stopped with 200 ⁇ l of 70% ethanol and the beads collected by centrifugation at 3000rpm for 5sec and then washed a second time in 70% ethanol and twice in 200 ⁇ l of water before being resuspended in 20 ⁇ l of water.
- BMV RNA Promega, US
- RNA-BCPB beads were added to a 20 ⁇ l reverse transcription reaction containing the following final component concentrations: 200 mM Tris-HCl (pH 8.4 at 24°C) , 75 mM KCl , 2.5 mM MgCl 2 , 10 mM DTT, 1 mM dNTP's, 110 ng of BMV-R oligonucleotide primer (GAGCCCCAGCGCACTCGGTC) and 100 units of the reverse transcriptase MULV Point Mutant (Promega, USA) . The reaction was allowed to proceed for 20 min at 42°C and 10 min at 37°C.
- the cDNA/RNA BCPB bead complex was then washed four times in 200 ⁇ l lOOmM NaCl/ lOmM Tris HCl pH7.5 , once in 200 ⁇ l of water before resuspension in lO ⁇ l of water.
- the cDNA can then be used directly in a PCR reaction as follows.
- the PCR was carried out in a final volume of 25 ⁇ l with final concentrations of 15mM Tris-HCl pH 8.8, 60mM KCl, 2.5mM MgCl 2 , 400 ⁇ M each dNTP, 10 pmol of each primer BMV F (CTATCACCAAGATGTCTTCG) and BMV R (GAGCCCCAGCGCACTCGGTC) and 1 unit Tag DNA polymerase (Amersham Pharmacia Biotech, UK) . 1 ⁇ l of the bead complex was added per reaction. Cycle parameters were 94°C x 20 sec, 55°C x 20 sec and 72°C x 30 sec for 31 cycles. PCR products were visualised following agarose gel electrophoresis and staining with EtBr . Excellent amplification of a 150bp BMV sequence was obtained using this method with product yields similar to the same amount of RNA free in solution.
- RNA bound to BCPB can be cleaved using ribonucleases such as ribonuclease ONETM (Promega, US) and RNases A.
- ribonucleases such as ribonuclease ONETM (Promega, US) and RNases A.
- a BCPB-radioactive RNA (Riboprobe, Promega, USA) complex was mixed in a 20 ⁇ l reaction containing IX RNase ONE buffer (Promega, USA) and lng of enzyme for 30min at 37°C and the amount of radioactivity released was counted using a scintillation counter.
- RNase A or R ⁇ ase ONE 64-68% of the RNA was cleaved demonstrating that the RNA is attached to the BCPB bead in a conformation suitable for enzyme recognition.
- An identical reaction with DNase I resulted in less than 5% RNA release.
- Serum albumin is a major component of blood.
- BSA serum albumin
- the protein/RNA mixture was first reacted with acetyl chloride.
- acetyl chloride solution was added l ⁇ l of acetyl chloride solution, mixed and incubated at 22 °C for 5 minutes before the addition of 3mg BCPB beads.
- RNA binding efficiency compared with a parallel reaction with no acetyl chloride in two separate experiments indicated that 4.2 and 5.4 times more RNA bound to the beads when the serum had been pre-acetylated.
- RNA binding may be the result of amino-acids and carbohydrates in the serum becoming acetylated and therefore not competing with the 2' -OH groups of the RNA for the BCPB beads.
- Example 15 RT-PCR amplification of RNA purified from serum lOOng of BMV RNA (Promega, USA) in l ⁇ l of water was added to l ⁇ l of fresh human serum and then mixed with 40 ⁇ l of either THF or DMSO in the presence or absence of 150mM sodium perchlorate or 0.5% SDS (final concentrations) and then 3mg of BCPB beads added, mixed and incubated at 22 °C for l ⁇ min, the beads were then washed once in lOO ⁇ l of 70% ethanol, once in lOO ⁇ l of 10% SDS and three times lOO ⁇ l of water. The beads were finally resuspended in 8 ⁇ l of water before addition to the RT reaction.
- RNA-BCPB beads were added to a 20 ⁇ l reverse transcription reaction containing the following final component concentrations: 200 mM Tris-HCl (pH 8.4 at 24°C) , 75 mM KCl, 2.5 mM MgCl 2 , 10 mM DTT, 1 mM dNTP's, 110 ng of BMV-R oligonucleotide primer (GAGCCCCAGCGCACTCGGTC) and 100 units of MULV Point Mutant (Promega, USA) . The reaction was allowed to proceed for 40 min at 42 °C. The cDNA was then used directly in a PCR reaction as follows.
- the PCR was carried out in a final volume of 25 ⁇ l with final concentrations of 15mM Tris-HCl pH 8.8, 60mM KCl, 2.5mM MgCl 2 , 400 ⁇ M each dNTP, 10 pmol of each primer BMV F (CTATCACCAAGATGTCTTCG) and BMV R (GAGCCCCAGCGCACTCGGTC) and
- BCPB beads are therefore useful to purify RNA for RT-PCR analysis from serum.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Saccharide Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Turbine Rotor Nozzle Sealing (AREA)
- Window Of Vehicle (AREA)
- Materials For Medical Uses (AREA)
Abstract
Description
Claims
Priority Applications (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE60041442T DE60041442D1 (en) | 1999-04-30 | 2000-05-02 | ISOLATION OF NUCLEIC ACIDS |
US10/031,636 US6794140B1 (en) | 1999-04-30 | 2000-05-02 | Isolation of nucleic acid |
EP00929666A EP1177281B1 (en) | 1999-04-30 | 2000-05-02 | Isolation of nucleic acid |
AU47674/00A AU4767400A (en) | 1999-04-30 | 2000-05-02 | Isolation of nucleic acid |
US10/820,423 US7244568B2 (en) | 1999-04-30 | 2004-04-08 | Isolation of nucleic acid |
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GBGB9910158.6A GB9910158D0 (en) | 1999-04-30 | 1999-04-30 | Isolation of nucleic acid |
GB9910158.6 | 1999-04-30 | ||
GB9910156.0 | 1999-04-30 | ||
GBGB9910157.8A GB9910157D0 (en) | 1999-04-30 | 1999-04-30 | Polynucleotides |
GB9910157.8 | 1999-04-30 | ||
GB9910154.5 | 1999-04-30 | ||
GBGB9910154.5A GB9910154D0 (en) | 1999-04-30 | 1999-04-30 | Polynucleotides |
GBGB9910156.0A GB9910156D0 (en) | 1999-04-30 | 1999-04-30 | Polynucleotides |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10031636 A-371-Of-International | 2000-05-02 | ||
US10/820,423 Continuation US7244568B2 (en) | 1999-04-30 | 2004-04-08 | Isolation of nucleic acid |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000075302A2 true WO2000075302A2 (en) | 2000-12-14 |
WO2000075302A3 WO2000075302A3 (en) | 2001-04-26 |
Family
ID=27451902
Family Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB2000/001684 WO2000075302A2 (en) | 1999-04-30 | 2000-05-02 | Isolation of nucleic acid |
PCT/GB2000/001687 WO2000066605A2 (en) | 1999-04-30 | 2000-05-02 | Polynucleotides |
PCT/GB2000/001670 WO2000075306A2 (en) | 1999-04-30 | 2000-05-02 | Method for producing double stranded polynucleotides |
PCT/GB2000/001683 WO2001094626A1 (en) | 1999-04-30 | 2000-05-02 | Polynucleotides |
Family Applications After (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/GB2000/001687 WO2000066605A2 (en) | 1999-04-30 | 2000-05-02 | Polynucleotides |
PCT/GB2000/001670 WO2000075306A2 (en) | 1999-04-30 | 2000-05-02 | Method for producing double stranded polynucleotides |
PCT/GB2000/001683 WO2001094626A1 (en) | 1999-04-30 | 2000-05-02 | Polynucleotides |
Country Status (6)
Country | Link |
---|---|
US (4) | US6794140B1 (en) |
EP (2) | EP1196631B1 (en) |
AT (2) | ATE347616T1 (en) |
AU (4) | AU4588000A (en) |
DE (2) | DE60041442D1 (en) |
WO (4) | WO2000075302A2 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004013155A2 (en) | 2002-08-02 | 2004-02-12 | Cyclops Genome Sciences Limited | Stabilisation of nucleic acids |
WO2005012522A1 (en) * | 2003-07-23 | 2005-02-10 | Cyclops Genome Sciences Limited | Clean-up beads |
US6867290B2 (en) | 1999-04-30 | 2005-03-15 | Cyclops Genome Sciences, Ltd. | Modified polynucleotides and uses thereof |
US7790373B2 (en) | 2003-07-23 | 2010-09-07 | Cyclops Genome Sciences Limited | Clean-up beads |
WO2019175518A1 (en) * | 2018-03-16 | 2019-09-19 | bioMérieux | Method for extracting nucleic acids |
Families Citing this family (75)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6677120B2 (en) * | 2001-03-30 | 2004-01-13 | Isis Pharmaceuticals, Inc. | Building blocks for the solution phase synthesis of oligonucleotides |
US20060009409A1 (en) * | 2002-02-01 | 2006-01-12 | Woolf Tod M | Double-stranded oligonucleotides |
ATE443133T1 (en) | 2002-02-01 | 2009-10-15 | Life Technologies Corp | OLIGONUCLEOTIDE COMPOSITIONS WITH IMPROVED EFFICIENCY |
US20040005568A1 (en) * | 2002-07-03 | 2004-01-08 | Stojanovic Milan N. | Movement of multi-enzymatic nanoassemblies on recognition landscapes |
US20040072226A1 (en) * | 2002-07-03 | 2004-04-15 | Stojanovic Milan N. | Movement of multi-enzymatic nanoassemblies on recognition landscapes |
DE10315581B4 (en) * | 2003-04-05 | 2007-06-28 | Agilent Technologies, Inc. (n.d.Ges.d.Staates Delaware), Palo Alto | Method for quality determination of RNA samples |
DE10344819B4 (en) * | 2003-09-26 | 2017-06-29 | Sartorius Stedim Biotech Gmbh | Adsorption membranes, methods of making the same and devices comprising the adsorption membranes |
EP1809744B1 (en) | 2004-11-05 | 2018-06-06 | QIAGEN North American Holdings, Inc. | Compositions and methods for purifying nucleic acids from stabilization reagents |
WO2006138145A1 (en) | 2005-06-14 | 2006-12-28 | Northwestern University | Nucleic acid functionalized nanoparticles for therapeutic applications |
US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
US9424392B2 (en) | 2005-11-26 | 2016-08-23 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
WO2007145940A2 (en) * | 2006-06-05 | 2007-12-21 | The University Of North Carolina At Chapel Hill | High-throughput rna structure analysis |
CA2691066C (en) * | 2007-02-09 | 2018-07-31 | Northwestern University | Particles for detecting intracellular targets |
EP2142671A2 (en) * | 2007-03-30 | 2010-01-13 | Qiagen GmbH | Modified polynucleotides comprising ribose rings |
WO2008134077A1 (en) * | 2007-04-30 | 2008-11-06 | Archemix Corp. | Metabolic profile directed aptamer medicinal chemistry |
CA2689923A1 (en) * | 2007-05-30 | 2008-12-11 | Northwestern University | Nucleic acid functionalized nanoparticles for therapeutic applications |
US9551033B2 (en) | 2007-06-08 | 2017-01-24 | Genentech, Inc. | Gene expression markers of tumor resistance to HER2 inhibitor treatment |
CN102014919B (en) | 2008-03-03 | 2015-02-25 | 托斯克公司 | Methotrexate adjuvants to reduce toxicity and methods for using the same |
US20110053226A1 (en) * | 2008-06-13 | 2011-03-03 | Riboxx Gmbh | Method for enzymatic synthesis of chemically modified rna |
MX2011005429A (en) | 2008-11-24 | 2011-06-21 | Univ Northwestern | Polyvalent rna-nanoparticle compositions. |
US20100233270A1 (en) * | 2009-01-08 | 2010-09-16 | Northwestern University | Delivery of Oligonucleotide-Functionalized Nanoparticles |
SG2014011381A (en) | 2009-02-13 | 2014-06-27 | Chem Inc X | Methods of creating and screening dna-encoded libraries |
EP2272976A1 (en) * | 2009-07-06 | 2011-01-12 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for differentiation of polynucleotide strands |
US20120185176A1 (en) | 2009-09-30 | 2012-07-19 | Natera, Inc. | Methods for Non-Invasive Prenatal Ploidy Calling |
CA2779099C (en) | 2009-10-30 | 2021-08-10 | Northwestern University | Templated nanoconjugates |
EP2333102A1 (en) * | 2009-12-14 | 2011-06-15 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for identifying RNA ligands |
US20190010543A1 (en) | 2010-05-18 | 2019-01-10 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US9677118B2 (en) | 2014-04-21 | 2017-06-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US10316362B2 (en) | 2010-05-18 | 2019-06-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
EP2854058A3 (en) | 2010-05-18 | 2015-10-28 | Natera, Inc. | Methods for non-invasive pre-natal ploidy calling |
US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
EP2388324A1 (en) | 2010-05-20 | 2011-11-23 | Siemens Healthcare Diagnostics Inc. | Control material for nucleic acid tests |
FR2968302B1 (en) | 2010-12-06 | 2012-11-30 | Biomerieux Sa | METHODS OF FUNCTIONALIZATION AND REAGENTS USED IN SUCH METHODS USING ISATOIC ANHYDRIDE OR ONE OF ITS DERIVATIVES, BIOLOGIC MOLECULES SO TREATED AND KITS |
CN103608466B (en) | 2010-12-22 | 2020-09-18 | 纳特拉公司 | Non-invasive prenatal paternity testing method |
CN103608818B (en) | 2011-02-09 | 2017-12-08 | 纳特拉公司 | The antenatal ploidy identification device of Noninvasive |
SG10201605812YA (en) * | 2011-09-07 | 2016-09-29 | Chem Inc X | Methods for tagging dna-encoded libraries |
WO2013040499A1 (en) | 2011-09-14 | 2013-03-21 | Northwestern University | Nanoconjugates able to cross the blood-brain barrier |
US9040675B2 (en) | 2012-04-30 | 2015-05-26 | General Electric Company | Formulations for nucleic acid stabilization on solid substrates |
US9040679B2 (en) | 2012-04-30 | 2015-05-26 | General Electric Company | Methods and compositions for extraction and storage of nucleic acids |
US9044738B2 (en) | 2012-04-30 | 2015-06-02 | General Electric Company | Methods and compositions for extraction and storage of nucleic acids |
US9480966B2 (en) | 2012-04-30 | 2016-11-01 | General Electric Company | Substrates and methods for collection, stabilization and elution of biomolecules |
SG10201907347YA (en) | 2012-07-13 | 2019-09-27 | X Chem Inc | Dna-encoded libraries having encoding oligonucleotide linkages not readable by polymerases |
FR2994184B1 (en) | 2012-08-02 | 2017-12-08 | Biomerieux Sa | METHODS OF FUNCTIONALIZATION AND REAGENTS USED IN SUCH METHODS USING AN AZA-ISATOIC ANHYDRIDE OR ONE OF ITS DERIVATIVES, BIOLOGIC MOLECULES SO TREATED AND KITS |
WO2014093688A1 (en) * | 2012-12-12 | 2014-06-19 | 1Massachusetts Institute Of Technology | Compositions and methods for functional nucleic acid delivery |
US10577655B2 (en) | 2013-09-27 | 2020-03-03 | Natera, Inc. | Cell free DNA diagnostic testing standards |
EP3055413B1 (en) | 2013-10-07 | 2020-01-08 | The University of North Carolina at Chapel Hill | Detection of chemical modifications in nucleic acids |
EP3561075A1 (en) | 2014-04-21 | 2019-10-30 | Natera, Inc. | Detecting mutations in tumour biopsies and cell-free samples |
PT3134506T (en) | 2014-04-25 | 2019-10-31 | Translate Bio Inc | Methods for purification of messenger rna |
EP3209403A4 (en) * | 2014-10-24 | 2018-09-12 | Abbott Molecular Inc. | Enrichment of small nucleic acids |
EP3220895B1 (en) | 2014-11-21 | 2022-08-31 | Northwestern University | The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates |
EP3294885B1 (en) | 2015-05-08 | 2020-07-01 | CureVac Real Estate GmbH | Method for producing rna |
WO2016183106A1 (en) | 2015-05-11 | 2016-11-17 | Natera, Inc. | Methods and compositions for determining ploidy |
DE202016009003U1 (en) | 2015-05-29 | 2021-05-28 | Curevac Real Estate Gmbh | Composition comprising in vitro transcribed RNA obtainable by a method for the production and purification of RNA with at least one step with a tangential flow filtration |
EP3302784B1 (en) | 2015-06-05 | 2021-10-06 | W.R. Grace & Co.-Conn. | Adsorbent bioprocessing clarification agents and methods of making and using the same |
CN108473932B (en) | 2015-09-09 | 2022-07-15 | 集联健康有限公司 | Systems, methods, and devices for sample collection, stabilization, and preservation |
US10214739B2 (en) * | 2015-10-30 | 2019-02-26 | Axagarius Gmbh & Co. Kg | RNA binding solution |
US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
CA3037192A1 (en) * | 2016-11-07 | 2018-05-11 | nanoSUR LLC | Post-transcriptionally chemically modified double strand rnas |
US10011870B2 (en) | 2016-12-07 | 2018-07-03 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
JP2018134392A (en) | 2017-01-10 | 2018-08-30 | ドローブリッジ ヘルス,インコーポレイテッド | Device, system, and method for sample collection |
AU2018225348A1 (en) * | 2017-02-21 | 2019-07-18 | Natera, Inc. | Compositions, methods, and kits for isolating nucleic acids |
EA202090752A1 (en) * | 2017-06-16 | 2020-06-15 | Борис Славинович ФАРБЕР | COMBINATOR DERIVATIVES OF RNA OLIGONUCLEOTIDES |
MX2020003695A (en) | 2017-11-30 | 2020-08-03 | Arrakis Therapeutics Inc | Nucleic acid-binding photoprobes and uses thereof. |
WO2019200228A1 (en) | 2018-04-14 | 2019-10-17 | Natera, Inc. | Methods for cancer detection and monitoring by means of personalized detection of circulating tumor dna |
US11525159B2 (en) | 2018-07-03 | 2022-12-13 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
EP4396348A2 (en) * | 2021-08-31 | 2024-07-10 | Nanosur LLC | High molecular weight modified dsrna compositions |
WO2023101963A2 (en) * | 2021-11-30 | 2023-06-08 | Northwestern University | Compositions for inhibiting dipeptide repeat protein-ribosomal rna interaction and uses thereof |
WO2024167836A1 (en) * | 2023-02-06 | 2024-08-15 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and modifications for reducing innate immune responses to rna |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5660985A (en) * | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
Family Cites Families (21)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4588718A (en) * | 1984-03-28 | 1986-05-13 | The Upjohn Company | Carboxy containing ester prodrugs of corticosteroids |
US5681726A (en) * | 1988-09-19 | 1997-10-28 | Stratagene | Method of double stranded DNA synthesis |
US5859221A (en) * | 1990-01-11 | 1999-01-12 | Isis Pharmaceuticals, Inc. | 2'-modified oligonucleotides |
US5872232A (en) * | 1990-01-11 | 1999-02-16 | Isis Pharmaceuticals Inc. | 2'-O-modified oligonucleotides |
US5707796A (en) | 1990-06-11 | 1998-01-13 | Nexstar Pharmaceuticals, Inc. | Method for selecting nucleic acids on the basis of structure |
JPH0813274B2 (en) * | 1990-08-13 | 1996-02-14 | アイシス・ファーマシューティカルス・インコーポレーテッド | Sugar modified oligonucleotides for detecting and modulating gene expression |
US5426180A (en) | 1991-03-27 | 1995-06-20 | Research Corporation Technologies, Inc. | Methods of making single-stranded circular oligonucleotides |
US6235887B1 (en) * | 1991-11-26 | 2001-05-22 | Isis Pharmaceuticals, Inc. | Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines |
ATE181557T1 (en) | 1993-02-24 | 1999-07-15 | Jui H Wang | COMPOSITIONS AND METHODS OF APPLYING REACTIVE ANTIVIRAL POLYMERS |
AU8088694A (en) * | 1993-10-27 | 1995-05-22 | Ribozyme Pharmaceuticals, Inc. | 2'-amido and 2'-peptido modified oligonucleotides |
US5700642A (en) * | 1995-05-22 | 1997-12-23 | Sri International | Oligonucleotide sizing using immobilized cleavable primers |
US6008334A (en) * | 1996-07-24 | 1999-12-28 | The Board Of Regents Of The University Of Oklahoma | Base-protected nucleotide analogs with protected thiol groups |
US5849902A (en) * | 1996-09-26 | 1998-12-15 | Oligos Etc. Inc. | Three component chimeric antisense oligonucleotides |
WO1999014346A2 (en) * | 1997-09-19 | 1999-03-25 | Sequitur, Inc. | SENSE mRNA THERAPY |
DE19801153A1 (en) | 1998-01-14 | 1999-07-15 | Jenne Andreas | Selection of a ribozymes useful for, e.g. inhibiting gene expression and improving nuclease resistance |
JP2002512794A (en) | 1998-04-29 | 2002-05-08 | リボザイム・ファーマシューティカルズ・インコーポレーテッド | Nucleotide triphosphates and their incorporation into ribozymes |
DE69911793T2 (en) | 1998-07-28 | 2004-08-12 | Micromet Ag | HETERO MINI BODY |
EP1196631B1 (en) | 1999-04-30 | 2006-12-06 | Cyclops Genome Sciences Limited | Modifications of ribonucleic acids |
US6720144B1 (en) * | 2001-06-21 | 2004-04-13 | Quest Diagnostics | Detection of clonal T-cell receptor-γ gene rearrangement by PCR/temporal temperature gradient gel electrophoresis (TTGE) |
GB0217963D0 (en) | 2002-08-02 | 2002-09-11 | Cyclops Genome Sciences Ltd | Purification of nucleic acids |
JP2006527993A (en) | 2003-07-23 | 2006-12-14 | シクロプス ゲノム サイエンス リミテッド | Clean up beads |
-
2000
- 2000-05-02 EP EP00929665A patent/EP1196631B1/en not_active Expired - Lifetime
- 2000-05-02 AU AU45880/00A patent/AU4588000A/en not_active Abandoned
- 2000-05-02 DE DE60041442T patent/DE60041442D1/en not_active Expired - Fee Related
- 2000-05-02 WO PCT/GB2000/001684 patent/WO2000075302A2/en active Application Filing
- 2000-05-02 AT AT00929665T patent/ATE347616T1/en not_active IP Right Cessation
- 2000-05-02 US US10/031,636 patent/US6794140B1/en not_active Expired - Fee Related
- 2000-05-02 AT AT00929666T patent/ATE421583T1/en not_active IP Right Cessation
- 2000-05-02 AU AU47674/00A patent/AU4767400A/en not_active Abandoned
- 2000-05-02 DE DE60032235T patent/DE60032235T2/en not_active Expired - Lifetime
- 2000-05-02 WO PCT/GB2000/001687 patent/WO2000066605A2/en active Application Filing
- 2000-05-02 WO PCT/GB2000/001670 patent/WO2000075306A2/en active Application Filing
- 2000-05-02 WO PCT/GB2000/001683 patent/WO2001094626A1/en active IP Right Grant
- 2000-05-02 AU AU47673/00A patent/AU4767300A/en not_active Abandoned
- 2000-05-02 EP EP00929666A patent/EP1177281B1/en not_active Expired - Lifetime
- 2000-05-02 AU AU45890/00A patent/AU4589000A/en not_active Abandoned
-
2001
- 2001-10-26 US US10/011,495 patent/US6867290B2/en not_active Expired - Fee Related
-
2004
- 2004-04-08 US US10/820,423 patent/US7244568B2/en not_active Expired - Fee Related
-
2005
- 2005-02-14 US US11/057,808 patent/US20050272679A1/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5660985A (en) * | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
Non-Patent Citations (3)
Title |
---|
N C PAGRATIS ET AL: "Potent 2'-Amino- and 2'-Fluoro-2'-deoxyribonucleotide RNA Inhibitors of Keratinocyte Growth Factor" NATURE BIOTECHNOLOGY,US,NATURE PUBLISHING, vol. 15, no. 1, 1997, pages 68-73, XP002134081 ISSN: 1087-0156 * |
S YU OVODOV ET AL: "mRNA Acetylated at the 2'-OH Groups of Ribose Residues is Functionally Active in the cell-free Translation System from Wheat Embryos" FEBS LETTERS,ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM,NL, vol. 270, no. 1/2, September 1990 (1990-09), pages 111-114, XP002134079 ISSN: 0014-5793 * |
SPROAT B S: "Chemistry and applications of oligonucleotide analogues" JOURNAL OF BIOTECHNOLOGY,NL,ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, vol. 41, no. 2, 31 July 1995 (1995-07-31), pages 221-238, XP004036938 ISSN: 0168-1656 * |
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6867290B2 (en) | 1999-04-30 | 2005-03-15 | Cyclops Genome Sciences, Ltd. | Modified polynucleotides and uses thereof |
US7244568B2 (en) | 1999-04-30 | 2007-07-17 | Cyclops Genome Sciences Limited | Isolation of nucleic acid |
WO2004013155A2 (en) | 2002-08-02 | 2004-02-12 | Cyclops Genome Sciences Limited | Stabilisation of nucleic acids |
WO2004013155A3 (en) * | 2002-08-02 | 2004-04-08 | Cyclops Genome Sciences Ltd | Stabilisation of nucleic acids |
JP2005538116A (en) * | 2002-08-02 | 2005-12-15 | シクロプス ゲノム サイエンス リミテッド | Nucleic acid stabilization |
WO2005012522A1 (en) * | 2003-07-23 | 2005-02-10 | Cyclops Genome Sciences Limited | Clean-up beads |
US7790373B2 (en) | 2003-07-23 | 2010-09-07 | Cyclops Genome Sciences Limited | Clean-up beads |
WO2019175518A1 (en) * | 2018-03-16 | 2019-09-19 | bioMérieux | Method for extracting nucleic acids |
FR3078977A1 (en) * | 2018-03-16 | 2019-09-20 | Biomerieux | PROCESS FOR EXTRACTING NUCLEIC ACIDS |
JP2021518157A (en) * | 2018-03-16 | 2021-08-02 | ビオメリューBiomerieux | Method for extracting nucleic acid |
Also Published As
Publication number | Publication date |
---|---|
AU4767400A (en) | 2000-12-28 |
WO2000075306A3 (en) | 2001-05-17 |
US20050272679A1 (en) | 2005-12-08 |
DE60032235D1 (en) | 2007-01-18 |
AU4588000A (en) | 2000-12-28 |
DE60032235T2 (en) | 2007-11-15 |
US6794140B1 (en) | 2004-09-21 |
US7244568B2 (en) | 2007-07-17 |
WO2000066605A3 (en) | 2001-04-26 |
EP1196631A1 (en) | 2002-04-17 |
WO2000066605A2 (en) | 2000-11-09 |
WO2000075306A2 (en) | 2000-12-14 |
US6867290B2 (en) | 2005-03-15 |
US20030039985A1 (en) | 2003-02-27 |
AU4589000A (en) | 2000-11-17 |
ATE421583T1 (en) | 2009-02-15 |
WO2000075302A3 (en) | 2001-04-26 |
EP1196631B1 (en) | 2006-12-06 |
EP1177281B1 (en) | 2009-01-21 |
DE60041442D1 (en) | 2009-03-12 |
ATE347616T1 (en) | 2006-12-15 |
WO2001094626A1 (en) | 2001-12-13 |
US20050074753A1 (en) | 2005-04-07 |
AU4767300A (en) | 2001-12-17 |
EP1177281A2 (en) | 2002-02-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1177281B1 (en) | Isolation of nucleic acid | |
US20210230578A1 (en) | Removal of dna fragments in mrna production process | |
US9624252B2 (en) | Selective nucleic acid fragment recovery | |
JP3761573B2 (en) | A general method for the isolation and purification of nucleic acids from a very wide variety of starting materials that are extremely small and very strongly contaminated | |
EP1525309B1 (en) | Stabilisation of nucleic acids | |
JP2007500008A (en) | Methods and compositions for isolating small RNA molecules | |
EP0672173A1 (en) | Solid phase amplification process | |
JP6896620B2 (en) | Sequence conversion and signal amplification DNA with locked nucleic acid and detection method using it | |
EP3215620B1 (en) | Chaotrope- and volatile-free method for purifying nucleic acids from plasma | |
WO2014041093A1 (en) | Solid matrix for one step nucleic acid amplification | |
JP5427408B2 (en) | Method for labeling or processing a biological sample containing a target biomolecule, in particular nucleic acid | |
Chetverin et al. | Molecular colony technique: a new tool for biomedical research and clinical practice | |
JP2006527993A (en) | Clean up beads | |
RU2736789C1 (en) | Method of selecting single-stranded oligonucleotides with high affinity to molecular target | |
US7790373B2 (en) | Clean-up beads | |
Dupuis et al. | MiRNA editing | |
RU2513700C1 (en) | Method for specific selection of dna molecules (dna aptamers) with affinity for recombinant protein target | |
US20100120044A1 (en) | Modified polynucleotides comprising ribose rings | |
WO1996040994A1 (en) | Dna polymerase extension assay | |
CN116829713A (en) | Hairpin oligonucleotides and uses thereof | |
US20130288264A1 (en) | Development of a New Isolation Method with Higher Selectivity and Efficiency | |
WO2008027977A2 (en) | High speed, high fidelity, high sensitivity nucleic acid detection | |
AU2872392A (en) | Solid phase amplification process |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000929666 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2000929666 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10031636 Country of ref document: US |
|
NENP | Non-entry into the national phase |
Ref country code: JP |