WO2000037667A1 - Method for producing ascorbic acid intermediates - Google Patents
Method for producing ascorbic acid intermediates Download PDFInfo
- Publication number
- WO2000037667A1 WO2000037667A1 PCT/US1999/030918 US9930918W WO0037667A1 WO 2000037667 A1 WO2000037667 A1 WO 2000037667A1 US 9930918 W US9930918 W US 9930918W WO 0037667 A1 WO0037667 A1 WO 0037667A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- activity
- enzymatic
- host cell
- oxidative
- factor
- Prior art date
Links
- GDOPTJXRTPNYNR-UHFFFAOYSA-N CC1CCCC1 Chemical compound CC1CCCC1 GDOPTJXRTPNYNR-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/58—Aldonic, ketoaldonic or saccharic acids
- C12P7/60—2-Ketogulonic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/58—Aldonic, ketoaldonic or saccharic acids
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
Definitions
- the present invention relates to pathway engineering and in particular to biocatalytic methods for the production of ascorbic acid intermediates.
- the invention provides methods for the production of ascorbic acid intermediates in non- fermentative systems.
- L-Ascorbic acid finds use in the pharmaceutical and food industry as a vitamin and antioxidant.
- the synthesis of ASA has received considerable attention over many years due to its relatively large market volume and high value as a specialty chemical.
- the Reichstein-Grussner method a chemical route from glucose to ASA, was first disclosed in 1934 (Helv. Chim. Acta 17:311-328).
- Lazarus et al. (1989, "Vitamin C: Bioconversion via a Recombinant DNA Approach", Genetics and Molecular Biology of Industrial Microorganisms , American Society for Microbiology, Washington D.C. Edited by C.L.
- Hershberger disclosed a bioconversion method for production of an intermediate of ASA, 2-keto-L-gulonic acid (2-KLG, KLG) which can be chemically converted to ASA.
- This bioconversion of carbon source to KLG involves a variety of intermediates, the enzymatic process being associated with co-factor dependent reductase activity.
- Enzymatic co-factor regeneration involves the use of enzymes to regenerate co-factors such as NAD+ to NADH or NADP+ to NADPH at the expense of another substrate that is then oxidized.
- the present invention relates to the non-fermentative production of ASA intermediates, e.g., KDG, DKG and KLG, and ultimately their conversion to desired end products, e.g., erythorbate and ascorbic acid, from a carbon source in a biocatalytic environment, said environment referred to herein as a bioreactor.
- the biocatalytic environment may comprise viable or non-viable host cells that contain at least one enzymatic activity capable of processing the carbon source to the desired intermediate.
- the desired intermediate is purified from the bioreactor via electrodialysis prior to conversion to the desired end product. See Figure 2 for a schematic representation of the production of these intermediates and products.
- the present invention also relates to a non-fermentative process for the production of ASA intermediates wherein required co-factor is regenerated.
- the present invention is based, in part, upon the discovery that catalytic amounts of co-factor can be regenerated in a non-fermentative, or in vitro, method for the production of KLG from a carbon source.
- the required co-factor is purified from the bioreactor via nanofiltration and reused.
- the bioreactor is provided with a carbon source which is biocatalytically converted through at least one oxidative step to KDG.
- the host cell may comprise a mutation(s) in a gene encoding an oxidative enzymatic activity specific to oxidizing the KDG such that the KDG is not further converted to other intermediates or products.
- DKG is the desired ASA intermediate
- the bioreactor is provided with a carbon source which is biocatalytically converted through at least one oxidative step to DKG.
- the host cell may comprise a mutation(s) in a gene encoding an oxidizing or reducing enzymatic activity such that DKG is not further converted to other intermediates.
- the bioreactor is provided with a carbon source which is biocatalytically converted through at least one oxidative step and at least one reducing step to KLG.
- the host cell may comprise a mutation(s) in a gene(s) encoding an oxidizing or reducing enzymatic activity such that KLG is not further converted to other intermediates.
- the method provides a means for co-factor regeneration.
- the host cells are recombinant and comprise at least one heterologous enzymatic activity.
- the enzymatic activity is bound to host cell membranes; in another embodiment, the enzymatic activity is in solution; in another embodiment, the enzymatic activity is soluble inside the cell; and in another embodiment, the enzymatic activity is immobilized.
- the process may be performed as a batch process or a continuous process.
- the host cells are preferably members of the family Enterobacteriacea and in one embodiment, the member is a Pantoea species and in particular, Pantoea citrea. Pantoea citrea can be obtained from ATCC having ATCC accession number 39140, for example.
- the host cells may be lyophilized, permeabilized, or otherwise treated to reduce viability or mutated to eliminate glucose utilization for cell growth or metabolism as long as the enzymatic activity is available to convert the carbon source to the desired intermediate.
- the intermediates may be further processed to the end products of erythorbate or ASA. Accordingly, in one aspect, the present invention provides a method for the production of DKG or KDG from a carbon source comprising enzymatically oxidizing the carbon source by at least one oxidative enzymatic activity to yield DKG or KDG.
- the process comprises oxidizing the carbon source by a first oxidative enzymatic activity to yield a first oxidative product and oxidizing said first oxidative product by a second oxidative enzymatic activity to yield KDG.
- the first oxidative enzymatic activity is a GDH activity and the second oxidative enzymatic activity is a GADH activity.
- the host cell may further comprise a mutation in the naturally occurring nucleic acid encoding a KDGDH activity, such that the KDG is not further oxidized.
- the KDG may be further converted to erythorbate.
- the process may further comprise oxidizing KDG by a third oxidative enzymatic activity to yield DKG.
- the method comprises the steps of enzymatically oxidizing the KDG by at least one oxidative enzymatic activity to an oxidation product; and enzymatically reducing said oxidation product by at least one reducing enzymatic activity to 2-KLG.
- DKG is the carbon source or if a carbon source is converted to DKG
- DKG is converted to KLG by a reducing enzymatic activity.
- the present invention provides a process for the non-fermentative production of 2- KLG from a carbon source, wherein said process comprises the following steps in any order, enzymatically oxidizing the carbon source by at least one oxidative enzymatic activity to an oxidation product; and enzymatically reducing said oxidation product by at least one reducing enzymatic activity to 2-KLG.
- said oxidative enzymatic activity requires an oxidized form of an enzymatic co-factor and said reducing enzymatic activity requires a reduced form of said enzymatic co-factor and said oxidized form of said co-factor and said reduced form of said co-factor are recycled between at least one oxidizing step and at least one reducing step.
- the oxidized form of the enzymatic cofactor is NADP+ and the reduced form of said enzymatic cofactor is NADPH. In another embodiment, the oxidized form of said enzymatic cofactor is NAD+ and the reduced form is NADH.
- Other co-factors useful in the process of the present invention include ATP, ADP, FAD and FMN.
- the process comprises the following steps in any order and the steps may be occurring simultaneously and/or continuously during the process: enzymatically oxidizing the carbon source by a first oxidative enzymatic activity to a first oxidation product; enzymatically oxidizing the first oxidation product by a second oxidative enzymatic activity to a second oxidation product; enzymatically oxidizing the second oxidation product by a third oxidative enzymatic activity to a third oxidation product; and enzymatically reducing the third oxidation product by a reducing enzymatic activity to 2-KLG.
- At least one of said first, second and third oxidative enzymatic activities requires an oxidized form of an enzymatic co-factor and said reducing enzymatic activity requires a reduced form of said enzymatic co-factor and wherein said oxidized form of said co-factor and said reduced form of said co-factor are recycled between at least one oxidizing step and the reducing step.
- the process proceeds in an environment comprising organic solvents and in another, the process proceeds in an environment comprising long polymers. In yet another embodiment, the process proceeds in an environment comprising a salt and within a range of salt concentrations.
- the present invention also provides vectors and recombinant host cells comprising enzymatic activities which are used in the methods for producing the ASA intermediates.
- the host cell comprises heterologous nucleic acid encoding GDH obtainable from species including T. acidophilum, Cryptococcus uniguttalatus and Bacillus species and/or DKG reductase obtainable from Corynebacterium or Erwinia.
- Figure 1 is a schematic representation of an in vitro process wherein NADP+ and NADPH are recycled between oxidation and reduction steps.
- FIG. 2 is a schematic representation of a pathway to ASA intermediates. Steps labeled A are enzymatic; steps labeled B are either enzymatic or chemical conversions.
- the enzyme that converts glucose (Glc) to GA is a GDH activity
- the oxidative enzyme that converts GA to KDG is a GADH activity
- the oxidative enzyme that converts KDG to DKG is a KDGDH activity
- the reducing enzyme that converts DKG to KLG is DKGR activity.
- Figure 3 illustrates the activity of reductase in the presence of 0-40% methanol at pH 7 and 30 °C.
- Figure 4 illustrates Reductase activity in the presence of 0-50% ethanol at pH 7, 22 °C.
- Figure 5 illustrates reductase activity at pH 7 in the presence of NaCI, KCI, CaCI2, K 2 SO 4 , or potassium phosphate (KPi). Initial rates were measured over 1 min.
- Figure 6 illustrates the activity of reductase remaining after incubation at pH 7 and 45 °C in the presence and absence of up to 500 mM 2-KLG.
- Figure 7 shows the spectrophotometric measurement of NADPH in an in vitro cofactor recycling reaction. Absorbance was measured at 340nm. The initial absorbance reading was 0.7 before the enzymes were added. Additional aliquots of GDH were added at approximately 12 and 23 minutes.
- Figure 8 shows the spectrophotometric measurement of NADPH in an in vitro cofactor recycling reaction. Absorbance was measured at 340mn. Enough NACL was added at approximately 5 minutes to bring the final concentration to 0.5M.
- Figure 9 shows the reductase Km and relative Vmax for 2,5-DKG in the presence of increasing amounts of 2-KLG.
- G glucose
- G D-gluconate
- KDG 2-keto-D-gluconate
- 2,5-diketo-D-gluconate 2,5DKG or DKG
- 2-keto-L-gulonic acid 2KLG, or KLG
- IA L-idonic acid
- ASA ascorbic acid
- GDH glucose dehydrogenase
- GDH gluconic acid dehydrogenase
- DKGR 2,5-diketo-D-gluconate reductase
- KDGDH 2-keto-D-gluconate reductase
- non-fermentative or “in vitro” refers to a biocatalytic process which exploits a cell's enzymatic activity.
- the cells may be non-viable or viable and not significantly growing.
- the cells may be genetically altered to eliminate their consumption of glucose and/or any intermediates produced.
- the in vitro process of the present invention encompasses the use of cell membranes which comprise enzymatic activity associated with the biocatalytic process, the use of permeabilized cells or lyophilized cells comprising the enzymatic activity associated with the biocatalytic process and the use of a host cell or host cell membranes or fragments in any form which provides the necessary enzymatic activity for the biocatalytic conversion of a carbon source to any of the ASA intermediates including but not limited to GA, KDG, DKG and KLG.
- the cell may be a recombinant cell which comprises heterologous nucleic acid encoding a desired enzymatic activity or a naturally occurring cell which comprises the desired enzymatic activity.
- bioreactor refers to the environment within which the non-fermentative or in-vitro process proceeds. Many enzymes are only active in the presence of a co-factor, such as for example, NAD+ or NADP+.
- co-factor refers to a substrate secondary in nature to the enzymatic reaction, but vital to the enzymatic reaction.
- co-factor includes, but is not limited to NAD+/NADH; NADP+/NADPH; ATP; ADP, FAD/FADH 2 and FMN/FMNH 2 .
- regeneration of co-factor refers to the phenomenon of continual oxidation and reduction of the required co-factor through biocatalysis, such that the required co-factor is present in the appropriate form for enzyme catalysis to take place.
- regeneration of co-factor provides an environment wherein a reduced form of a co-factor is available for a reducing enzyme and an oxidative form of the co-factor is available for an oxidizing enzyme.
- the present invention encompasses regeneration of co-factor between any enzymatic oxidation step and any enzymatic reducing step in the biocatalytic pathway from carbon source to the ASA intermediate, e.g. KLG.
- the required co-factor may be present in catalytic amounts provided by the host cell environment or may be provided exogenously at the beginning of the bioreactor process in stochiometric quantities in either an oxidized or reduced form.
- carbon source encompasses suitable carbon sources ordinarily used by Enterobacteriaceae strains, such as 6 carbon sugars, including but not limited to glucose, gulose, sorbose, fructose, idose, galactose and mannose all in either D or L form, or a combination of 6 carbon sugars, such as sucrose, or 6 carbon sugar acids including but not limited to 2-keto-L-gulonic acid, idonic acid, gluconic acid, 6- phosphogluconate, 2-keto-D-gluconic acid, 5-keto-D-gluconic acid, 2- ketogluconatephosphate, 2, 5-diketo-L-gulonic acid, 2,3-L-diketogulonic acid, dehydroascorbic acid, erythroascorbic acid and D-mannonic acid or the enzymatic derivatives of such as long as the carbon source is capable of being converted to an ASA intermediate such as, KDG, DKG and KLG, for example.
- 6 carbon sugars including but not limited
- Enterobacteriaceae refers to bacterial strains having the general characteristics of being gram negative and being facultatively anaerobic.
- Preferred Enterobacteriaceae strains are those that are able to produce 2,5-diketo-D- gluconic acid from D-glucose solutions.
- Included in the family of Enterobacteriaceae which are able to produce 2,5-diketo-D-gluconic acid from D-glucose solutions are the genus Erwinia, Enterobacter, Gluconobacter and Pantoea, for example.
- Intermediates in the microbial carbohydrate pathway from a carbon source to ASA include but are not limited to GA, 2KDG, 2,5DKG, 5DKG, 2KLG and IA.
- a preferred Enterobacteriaceae fermentation strain is a Pantoea species and in particular, Pantoea citrea.
- Four stereoisomers of ascorbic acid are possible: L-ascorbic acid, D-araboascorbic - - ⁇ *" .. 7 _
- ASA intermediate encompasses any product in the pathway to ASA including but not limited to KDG, DKG and KLG.
- the term “recombinant” refers to a host cell that contains nucleic acid not naturally occurring in the organism and/or to host cells having additional copies of endogenous nucleic acid recombinantly introduced.
- heterologous refers to nucleic acid or amino acid sequences not naturally occurring in the host cell.
- endogenous refers to a nucleic acid naturally occurring in the host.
- nucleic acid refers to a nucleotide or polynucleotide sequence, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be double-stranded or single-stranded, whether representing the sense or antisense strand.
- amino acid refers to peptide or protein sequences or portions thereof.
- mutation refers to any alteration in a nucleic acid such that the product of that nucleic acid is inactivated or eliminated.
- mutations include but are not limited to point mutations, frame shift mutations and deletions of part or all of a gene encoding an enzymatic activity, such as an oxidative enzyme activity or a reducing activity.
- nucleic acid encoding a membrane bound GDH activity is mutated thereby inactivating the endogenous GDH activity.
- the 2-keto-D- gluconate dehydrogenase activity is inactivated thereby allowing for optimized production of the intermediate KDG.
- oxidative enzyme refers to an enzyme or enzyme system which can catalyze conversion of a substrate of a given oxidation state to a product of a higher oxidation state than substrate.
- reducing enzyme refers to an enzyme or enzyme system which can catalyze conversion of a substrate of a given oxidation state to a product of a lower oxidation state than substrate.
- Oxidative enzymes associated with the biocatalysis of D-glucose to KLG include among others D-glucose dehydrogenase, D-gluconate dehydrogenase and 2-keto-D-gluconate dehydrogenase.
- Reducing enzymes associated with the biocatalysis of pathway intermediates of ASA into KLG include among others 2,5-diketo-D-gluconate reductase (DKGR), 2-keto reductase (2- KR) and 5-keto reductase (5-KR).
- DKGR 2,5-diketo-D-gluconate reductase
- 2-keto reductase (2- KR) 2-keto reductase
- 5-KR 5-keto reductase
- Such enzymes include those produced naturally by the host strain or those introduced via recombinant means.
- the process proceeds in a Pantoea citrea host cell having the naturally occurring membrane bound, non-NADP+ dependent GDH activity eliminated and a cytosolic NADP+ dependent GDH recombinantly introduced.
- a heterologous nucleic acid encoding a reductase activity is introduced into the host cell.
- the reductase activity is obtainable from a Coryneform species or an Erwinia species.
- pathway enzyme refers to any enzyme involved in the 5 biocatalytic conversion of a carbon source to an ASA intermediate, e.g., KDG, DKG and KLG.
- an isolated nucleic acid can include a vector o comprising the nucleic acid.
- the acidic derivatives of sacchahdes may exist in a variety of ionization states depending upon their surrounding media, if in solution, or out of solution from which they are prepared if in solid form.
- a term such as, for example, idonic acid
- idonic acid to designate such molecules is intended to include all ionization s states of the organic molecule referred to.
- idonic acid its cyclized form “idonolactone”, and “idonate” refer to the same organic moiety, and are not intended to specify particular ionization states or chemical forms.
- the present invention relates to the biocatalytic production of ASA intermediates, e.g., KDG, DKG and KLG, from a carbon source in an in vitro or non-fermentative environment.
- ASA intermediates e.g., KDG, DKG and KLG
- the process may require the presence of enzymatic co-factor.
- the enzymatic co-factor is regenerated. Due to the cost of co-factor, it is highly advantageous 5 to employ an in vitro process which allows for the regeneration of catalytic amounts of co- factor provided by the host cell environment or provided exogenously.
- the present invention provides a means for the production of ASA intermediates.
- Such intermediates can be further processed to ASA, ASA stereoisomers or other products such as erythorbate.
- KDG is the desired ASA intermediate produced
- the bioreactor is provided with viable or non-viable Pantoea citrea host cells having a mutation in a gene encoding 2-keto-D-gluconate dehydrogenase activity as described herein in Example II.
- the carbon source is biocatalytically 5 converted through at two oxidative steps, see Figure 2, to KDG. In this embodiment, there is no need for co-factor regeneration.
- the bioreactor When DKG is the desired ASA intermediate, the bioreactor is provided with viable or non-viable Pantoea citrea host cells and a carbon source which is biocatalytically converted through three oxidative steps, see Figure 2, to DKG. In this embodiment, there is no need for co-factor regeneration.
- KLG is the desired ASA intermediate
- the bioreactor is provided with viable or non-viable Pantoea citrea host cells and a carbon source, such as glucose, which is biocatalytically converted through three oxidative steps, as shown in Figure 2 and one reducing step to KLG.
- the reductase activity may be encoded by nucleic acid contained within the Pantoea citrea host cell or provided exogenously.
- the first oxidative enzymatic activity requires an oxidized form of the co-factor and the reducing enzymatic activity requires a reduced form of co-factor.
- the Pantoea citrea cell is modified to eliminate the naturally occurring GDH activity and a heterologous GDH obtainable from T. acidophilum, Cryptococcus uniguttalatus or Bacillus species and having a specificity for NADPH+ is introduced into the Pantoea cell in order to provide a co-factor recycling system which requires and regenerates one co-factor.
- This embodiment provides a means for co-factor regeneration, thereby eliminating the cost of continuously adding exogenous co-factor to the bioreactor for the production of KLG in Pantoea cells.
- the host cell further comprises nucleic acid encoding a 2,5-DKG reductase activity or the 2,5-DKG reductase is added exogenously to the bioreactor.
- the bioreactor is charged with Pantoea citrea cells comprising nucleic acid encoding membrane-bound GDH, appropriate enzymes and cofactor, and gluconic acid is added which is converted to DKG.
- the reaction mixture is then made anaerobic and glucose is added.
- the GDH converts the glucose to GA, and the reductase converts DKG to KLG, while cofactor is recycled.
- oxygen is added to convert GA to DKG, and the cycles continue.
- a biocatalytic process of converting a carbon source to an ASA intermediate begins with a suitable carbon source used by Enterobacteriaceae strains, such as a 6 carbon sugar, including for example, glucose, or a 6 carbon sugar acid, such as for example, KDG.
- a suitable carbon source used by Enterobacteriaceae strains such as a 6 carbon sugar, including for example, glucose, or a 6 carbon sugar acid, such as for example, KDG.
- Other metabolite sources include, but are not limited to galactose, lactose, fructose, or the enzymatic derivatives of such.
- media must contain suitable minerals, salts, cofactors, buffers and other components known to those of skill in the art for sustaining cultures and promoting the enzymatic pathway necessary for production of desired end-products.
- Preferred salts for the bioreactor are Na+, K+, NH4+, S04- -, and acetate.
- the cells are first grown and for the non-fermentative process the carbon source utilized for growth is eliminated, the pH is maintained at between about pH 4 and about pH 9 and oxygen is present.
- the carbon source and metabolites thereof proceed through enzymatic oxidation steps or enzymatic oxidation and enzymatic reducing steps which may take place outside of the host cell intracellular environment and which exploit the enzymatic activity associated with the host cell and proceed through a pathway to produce the desired ASA intermediate.
- the enzymatic steps may proceed sequentially or simultaneously within the bioreactor and some have a co-factor requirement in order to produce the desired ASA intermediate.
- the present invention encompasses an in vitro process wherein the host cells are treated with an organic substance, as described in Example V, such that the cells are non-viable, yet enzymes remain available for oxidation and reduction of the desired carbon source and/or metabolites thereof in the biocatalysis of carbon source to ASA intermediate.
- the present invention also encompasses an in vitro process wherein the host cells are lyophilized, permeabilized by any means, spray-dried, fractured or otherwise treated such that the enzymes are available for the conversion of carbon source to ASA intermediate.
- the oxidative or reducing enzymatic activities may be bound to a host cell membrane, immobilized, such as to a resin, for example AminoLink coupling gel (from Pierce Chemical Co), to a polymer, or soluble in the bioreactor environment.
- a resin for example AminoLink coupling gel (from Pierce Chemical Co)
- at least one oxidative enzyme is membrane bound.
- the environment may proceed in an organic or aqueous system or a combination of both, and may proceed in one vessel or more. In one embodiment, the process proceeds in two vessels, one which utilizes oxygen and one which is anaerobic.
- the membrane bound enzymes that require oxygen may be isolated from those enzymes that do not require oxygen (cofactor dependent GDH, cofactor dependent DKGR) allowing the use of a smaller volume containment vessel that requires oxygen, thereby reducing cost.
- the bioreactor may be performed in batch or in a continuous process. In a batch system, regardless of what is added, all of the broth is harvested at the same time. In a continuous system, the broth is regularly removed for downstream processing while fresh substrate is added.
- the intermediates produced may be recovered from the fermentation broth by a variety of methods including ion exchange resins, absorption or ion retardation resins, activated carbon, concentration-crystallization, passage through a membrane, etc.
- the bioreactor process may also involve more than one cell type, e.g., one cell may comprise the oxidative activities and a second cell may comprise the reducing activities.
- the host cell is permeabilized or lyophilized (Izumi et al., J. Ferment. Technol. 61 (1983) 135-142) as long as the necessary enzymatic activities remain available to convert the carbon source or derivatives thereof.
- the bioreactor may proceed with some enzymatic activities being provided exogenous and in an environment wherein solvents or long polymers are provided which stabilize or increase the enzymatic activities.
- methanol or ethanol is used to increase reductase activity.
- Gafquat is used to stabilise the reductase (see Gibson et al., US Patent 5,240,843).
- the host cell is a permeabilized Pantoea citrea cell provided D-glucose as a carbon source which undergoes a series of oxidative steps through enzymatic conversions.
- the oxidizing enzymes include GDH, GADH and DGDH and a reducing step which involves 2 DKGR (see United States Patent 3,790,444) to yield KLG.
- the KLG produced by a process of the present invention may be further converted to ascorbic acid and the KDG to erythorbate by means known to those of skill in the art, see for example, Reichstein and Grussner, Helv. Chim. Acta., 17, 311-328 (1934).
- cofactor required by pathway enzymes.
- cofactor which can be used in the current process include but are not limited to NAD+/NADH; NADP+/NADPH; ATP; ADP, FAD/FADH 2 and FMN/FMNH 2 .
- a carbon source is converted to KLG in a process which involves co-factor regeneration, as shown in Figure 1.
- this enzymatic cofactor regeneration process one equivalent of D-glucose is oxidized to one equivalent of D-gluconate, and one equivalent of NADP+ is reduced to one equivalent of NADPH by the catalytic action of GDH.
- the one equivalent D-gluconate produced by the GDH is then oxidized to one equivalent of 2-KDG, and then to one equivalent of 2,5-DKG by the action of membrane bound dehydrogenases GADH and KDGDH, respectively.
- the one equivalent 2,5-DKG produced is then reduced to one equivalent of 2-KLG, and the NADPH is oxidized back to one equivalent of NADP+ by the action of 2,5-DKG reductase, effectively recycling the equivalent cofactor to be available for a second equivalent of D- glucose oxidation.
- Other methods of cofactor regeneration can include chemical, photochemical, and electrochemical means, where the equivalent oxidized NADP+ is directly reduced to one equivalent of NADPH by either chemical, photochemical, or electrochemical means.
- the amount of co-factor added exogenously to the bioreactor is between about 1 ⁇ M to about 5mM and in a preferred embodiment, between about 5 ⁇ M to about 1mM.
- NaCI affects the Km for NADPH while KLG, a charged species, does not affect the Km. Therefore if NaCI is present in the bioreactor, more NADPH would be required to maintain an optimum rate. Furthermore, as disclosed in the Examples, most salts tested had an affect on thermal stability of the reductase. As will be appreciated by the skilled artisan, depending upon the conditions of the bioreactor, such as the temperature, the salt levels can be adjusted to provide a balance between thermal stability and acceptable rates.
- a co-factor added exogenously to an in vitro system may be added alone or in combination with other substances associated with biocatalytic conversion of a carbon source to an ASA intermediate.
- the present process encompasses the use of co-factor immobilized to a carrier, co-factor chemically altered, such as in attachment to a long polymer, and to the use of co-factor in an isolated or purified form.
- the required co-factor may also be purified from the biocatalytic environment via nanofiltration and reused.
- Methods for using nanofiltration membranes for cofactor retention are described in, for example, Seelbach et al. (1997, Enzyme and Microbial Techhology, vol 20, pages 389-392).
- oxidative or reducing enzymes necessary for directing a host cell carbohydrate pathway into ASA intermediates can be introduced via recombinant DNA techniques known to those of skill in the art if such enzymes are not naturally occurring in the host cell.
- enzymes that would hinder a desired pathway can be mutated by recombinant DNA methods.
- the present invention encompasses the recombinant introduction or mutation of any enzyme or intermediate necessary to achieve a desired pathway.
- a carbon source such as glucose
- KLG is converted to KLG through multiple oxidation steps and a reducing step.
- the first oxidation step and the reducing step requires co-factor.
- the host cell is Pantoea citrea, the naturally occurring nucleic acid encoding glucose dehydrogenase (GDH) is mutated such that the dehydrogenase activity is eliminated and a heteologous GDH is introduced into the cell.
- GDH glucose dehydrogenase
- the present invention encompasses a host cell having additional mutation of enzymes in the carbon flow pathway which affect production.
- nucleic acid encoding DKG reductase is recombinantly introduced into the Pantoea fermentation strain.
- DKGR DKG reductase
- Many species have been found to contain DKGR, particularly members of the Coryneform group, including the genera Corynebacterium, Brevibacterium, and Arthrobacter.
- 2,5-DKGR obtainable from Corynebacterium sp. strain SHS752001 (Grindley et al., 1988, Applied and Environmental Microbiology 54: 1770-1775) is recombinantly introduced into a Pantoea citrea.
- 2,5 DKG reductase obtainable by Erwinia herbicola disclosed in United States Patent No. 5,008,193 to Anderson et al., is recombinantly introduced into Pantoea citrea.
- Sources for nucleic acid encoding oxidative or reducing enzymes include the following:
- Expression vectors used in expressing the pathway enzymes, e.g., a dehydrogenase or reductase, of the present process in host microorganisms comprise at least one promoter associated with the enzyme, which promoter is functional in the host cell.
- the promoter is the wild-type promoter for the selected enzyme and in another embodiment of the present invention, the promoter is heterologous to the enzyme, but still functional in the host cell.
- nucleic acid encoding the enzyme is stably integrated into the microorganism genome.
- the expression vector contains a multiple cloning site cassette which preferably comprises at least one restriction endonuclease site unique to the vector, to facilitate ease of nucleic acid manipulation.
- the vector also comprises one or more selectable markers.
- selectable marker refers to a gene capable of expression in the host microorganism which allows for ease of selection of those hosts containing the vector. Examples of such selectable markers include but are not limited to antibiotics, such as, erythromycin, actinomycin, chloramphenicol and tetracycline.
- a preferred plasmid for the recombinant introduction of non-naturally occurring enzymes or intermediates into a strain of Enterobacteriaceae is RSF1010, a mobilizable, but not self transmissible plasmid which has the capability to replicate in a broad range of bacterial hosts, including Gram - and Gram+ bacteria.
- RSF1010 a mobilizable, but not self transmissible plasmid which has the capability to replicate in a broad range of bacterial hosts, including Gram - and Gram+ bacteria.
- a variety of host cells can be used for recombinantly producing the pathway enzymes to be added exogenously, including bacterial, fungal, mammalian, insect and plant cells. Plant transformation methods are taught in Rodriquez (WO 95/14099, published 26 May 1995).
- the host cell is an Enterobacteriaceae. Included in the group of Enterobacteriaceae are Erwinia, Enterobacter, Gluconobacter and Pantoea species.
- a preferred Enterobacteriaceae fermentation strain is a Pantoea species and in particular, Pantoea citrea.
- the host cell is Pantoea citrea comprising pathway enzymes capable of converting a carbon source to KLG.
- the present invention encompasses pathways from carbon source to KLG through any intermediate in the microbial carbohydrate pathway capable of using a carbon source to produce KLG, going through intermediates including but not limited to GA, 2KDG, 2,5DKG, 5DKG, and IA.
- nucleic acid encoding the pathway enzyme is introduced via a plasmid vector and in another embodiment, nucleic acid encoding a pathway enzyme is stably integrated into the host cell genome.
- Whether a host cell has been transformed can be detected by the presence/absence of marker gene expression which can suggest whether the nucleic acid of interest is present However, its expression should be confirmed.
- marker gene expression can be confirmed if the nucleic acid encoding a pathway enzyme is inserted within a marker gene sequence. recombinant cells containing the insert can be identified by the absence of marker gene function.
- a marker gene can be placed in tandem with nucleic acid encoding the pathway enzyme under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the enzyme as well.
- host cells which contain the coding sequence for a pathway enzyme and express the enzyme may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridization and protein bioassay or immunoassay techniques which include membrane- based, solution-based, or chip-based technologies for the detection and/or quantification of the nucleic acid or protein.
- the presence of the enzyme polynucleotide sequence in a host microorganism can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes, portions or fragments of the enzyme polynucleotide sequences.
- Methods for detection of ASA intermediates, ASA and ASA sterioisomers include the use of redox-titration with 2,6 dichloroindophenol (Burton et al. 1979, J. Assoc. Pub. Analysts 17:105) or other suitable reagents; high-performance liquid chromatography (HPLC) using anion exchange (J. Chrom. 1980, 196:163); and electro-redox procedures (Pachia, 1976, Anal. Chem. 48:364).
- HPLC high-performance liquid chromatography
- electro-redox procedures Pachia, 1976, Anal. Chem. 48:364
- the ASA intermediates can be recovered and/or purified by any means known to those of skill in the art, including, lyophilization, crystallization, spray- drying, and electrodialysis, etc. Electrodialysis methods for purifying ASA and ASA intermediates such as KLG are described in for example, United States patent number 5747306 issued May 5, 1998 and United States patent number 4767870, issued August 30, 1998. Alternatively, the intermediates can also be formulated directly from the bioreactor and granulated or put in a liquid formulation.
- This example describes the method for producing a Pantoea citrea host cell having a mutation in the naturally occurring GDH.
- GDH glucose dehydrogenase gene
- Pantoea citrea The glucose dehydrogenase gene was cloned by polymerase chain reaction (PCR). Two primers were used in the PCR: 5 ⁇ GGGAGTGCTTACTACCTTATCTGCGGTATA3' and
- 5OGCTAGCTGTGCAATCCATTGATTTTGCACA3' After the PCR, a DNA product of about 2 kb was cloned in the vector, pGEM-T (Promega), and the recombinant E. coli with the correct DNA insert was identified and the clone was designated as pRL
- the DNA insert was analyzed by DNA sequencing and its sequence was found to be 60-70% identical to the published DNA sequences of a GDH of a strain of Pantoea citrea.
- a recombinant copy of the gene to be deleted was first generated by the introduction of a selectable marker, chloramphenicol resistance gene (CAT).
- CAT chloramphenicol resistance gene
- the in vitro generated copy was introduced into the Pantoea citrea and allowed to recombine with the wild-type copy through homologous recombination.
- the pRL DNA was then analyzed by digestion with various restriction enzymes. Two Smal cleavage sites located about 700bp apart within the GDH encoding DNA were found.
- the pRL was digested with Smal to remove the 700 bp fragment which was then replaced with a Smal digested 1.05 kb DNA containing the chloramphenicol resistance gene to generate the recombinant plasmid, designated as pRLcm4.
- the method used to generate pRLcm4 were standard techniques used by those of skill in the art.
- the GDH-CAT encoding sequence from pRLcm4 was further transferred - - "" .. 17 ..
- pGP740 a plasmid, pGP704.
- the DNA encoding the GDH-CAT cassette was removed from pRLcm4 by the combined digestion of restriction enzymes Aatll and Spel. The cohesive ends of the digested DNA were removed by the treatment of T4 DNA polymerase in the presence of deoxynucleotide triphosphate mixtures.
- the GDH-CAT cassette was then ligated with the EcoRV digested pGP704. Recombinant plasmid of pGP704 containing the GDH-CAT cassette was identified and designated as p704RLcm.
- Plasmid p704RLcm was introduced into wild-type Pantoea citrea by electroporation. The transformed cell was first plated in agar plates containing 12.5 ug/ml of chloramphenicol and resistant colonies were observed. To differentiate the true deletion mutant (which should display chloramphenicol resistant phenotype) from cells which simply harbors the plasmid p704RLcm, the chloramphenicol resistant colonies were screened against ampicillin, another antibiotic resistance marker carrier by p704RLcm. Ampicillin sensitive clones were identified.
- Example II describes the method for producing a host cell having a mutation in the naturally occurring 2-Keto-D-gluconate dehydrogenase (E3).
- 2-Keto-D-gluconate dehydrogenase (EC1.1.99.4) from Gluconobacter melanogenus is purified according to the procedure of Mclntire et al., (Mclntire, W., Singer, T.P., Ameyama, M., Adachi, O., Matsushita, K., and Shinagawa, E. Biochem. J. (1985) 231, 651-654) and references therein.
- the purified protein is digested with trypsin and chymotrypsin or other proteases to produce peptide fragments which are separated by HPLC or other techniques. Individual peptides are collected and sequenced.
- DNA probes are synthesized which will anneal to the corresponding sequence in the host organism or a related organism's genome. Using standard PCR techniques, larger fragments of the desired gene are amplified, purified and sequenced. These fragments are used to hybridize to the gene and allow for cloning and sequencing of the entire gene. Once the sequence is known, the gene is deleted as described for D- gluconate dehydrogenase (GDH) in Example 1
- the enzyme can be assayed for activity or loss of activity using the assays described in Shinagawa and Ameyama.
- Example III illustrates a method for producing KLG in Bioreactor where co-factor is regenerated.
- the mixture was allowed to react until all the gluconate had been converted to DKG.
- the glucose level was maintained above 20 g/L. Due to the cell permeabilization, minimal amounts of glucose entered into non-productive cellular metabolism. pH was maintained at 7 by the controlled addition of 50% NaOH throughout.
- GDH and DKG reductase for DKGR, one unit is equal to one OD absorbance change per minute when measured at 340nm
- the reactor was stirred, fed air, and maintained at 28 C as above. Periodic additions of glucose were made throughout the run to ensure constant substrate supply for both of the cofactor dependent enzymes.
- Example V illustrates the production of KDG in an in-vitro bioreactor.
- Cells containing membrane-bound D-glucose dehydrogenase and D-gluconic acid dehydrogenase activities but not 2-keto-D-gluconate dehydrogenase activity are grown and harvested.
- One example of such a cell is Pantoea citrea which has a mutation in the 2- keto-D-gluconate dehydrogenase enzyme, and is grown and treated as in Example III.
- the cells are permeabilized as described in Example III.
- Glucose (crystalline or in solution) is added in aliquots or continuously.
- the pH is maintained by controlled addition of a concentrated NaOH solution.
- the glucose is converted to D-gluconic acid and then KDG.
- Product formation is monitored by analyzing aliquots on a suitable HPLC system.
- Product is recovered by removing the cells by centrifugation and concentrating or removing the remaining liquid.
- Example V Example V
- reductase activity is increased in the presence of certain amounts of methanol or ethanol.
- Optimal concentrations range between 10 and 25% of the organic solvent.
- GDH from T. acidophilum has a small decrease in activity when it is incubated with
- Example VI illustrates the reductase activity in the presence of Gafquat and PEG8000.
- Reductase was incubated with 250 uM NADPH, 1-2 mg/ml DKG, and 0, 0.7% and 2.8% Gafquat (ISP Technologies, Inc.) or 0.5% PEG8000 in 1 ml (50 mM bis-tris buffer, pH 7) at 30 °C. Reductase activity was measured as in Example VI. As shown in Table 1 , the addition of Gafquat increases reductase activity by 80% compared to activity without Gafquat. PEG8000 increases reductase activity approximately 15%.
- Example VII illustrates the reductase activity in the presence of salt.
- Reductase A F22Y/A272G activity was measured in the presence of varying amounts of different salts.
- the assay consisted of adding reductase to a solution (1 ml final volume) containing 250 uM NADPH, DKG (1-1.5 mg/ml), 50 mM bis-tris buffer, pH 7.0, and varying amounts of potassium phosphate, NaCI, KCI, K 2 So 4 or CaCI2. All reactions were done at 30 °C. The results are shown in Figure 5.
- reductase activity stays the same or slightly increases when incubated with up to 100 mM NaCI or KCI. Activity then drops as salt concentrations are increased to 250 mM. Reductase activity drops in concentrations of CaCI2 or potassium phosphate of 20 mM or more.
- the reductase binding constant (Km) for NADPH in the presence of 200 mM NaCI was determined using standard biochemical techniques (Fersht, A. "Enzyme Structure and Mechanism” (1977) W. H. Freeman and Company). The reactions were done in pH 7 bis- tris buffer containing approximately 1.5 mg/ml DKG at 30 °C and varying amounts of NADPH. The Km for NADPH in the presence of 200 mM NaCI was found to increase 10- 40 fold over the Km determined without NaCI. The maximal rate (Vmax) in salt was similar or slightly increased over the no-salt Vmax.
- One way to reduce the effect of salt on reductase activity is to increase the concentration of NADPH until it is at or above the Km under those conditions. Alternatively, charged species including KLG could be removed.
- Example VIII illustrates the stability of reductase A F22Y/A272G in presence of salts/product.
- the reductase thermal stability was greatly increased in the presence of salts.
- Reductase was tested in one of the following ways.
- reductase was added to buffer (50 mM bis-tris, pH 7) in the presence and absence of varying amounts of 2-KLG (0-500 mM). These solutions were then aliquoted (40 ul) into 1.5 ml eppendorf tubes. The tubes were then placed in a 45 °C water bath and removed at set intervals. The reductase was then assayed for remaining activity using the standard reductase activity assay. The results are shown in Figure 6.
- reductase does not significantly lose any activity under these conditions in the presence of 500 mM 2-KLG. However, reductase incubated with only buffer loses approximately half of its activity in 10 min. Intermediate 2-KLG concentrations give partial stabilization.
- Reductase was incubated for 10 min in the presence of buffer (50 mM bis-tris, pH 7, or 25 mM MOPS, pH 7), 0.5M NaCI, 0.5M KCI, 0.5M NH 4 CI, 0.5M K 2 SO 4 and 0.1M NaCI at pH 7 and 45 °C. As shown in Table 2, below, little activity is lost in the presence of these compounds, while reductase with buffer alone lost almost half of its activity. These compounds clearly stabilize the reductase. Lower and higher levels of these compounds should also stabilize the reductase.
- Buffer 25-40 0.5 M NaCI 100 0.5 M KCI 100 0.5 M NH 4 CI 100 0.5 M K 2 SO 4 100 0.1 M Nal 80-85 100 mM NADPH 80-90 200 mM K2PO4 65-78 100 mM K2SO4 90-100
- the half-lifes for reductase in the presence of 0-400 mM NaKLG have been determined. This temperature was selected in order to determine all of the half- lifes at the same temperature.
- the buffer is 25 mM MOPS, pH 7.0. Aliquots are removed and assayed for remaining activity.
- the thermostability half-life measurements were performed as follows: a 450 ⁇ l sample containing buffer, reductase and 2KLG (where used) was placed in an eppendorf tube and heated in a water bath. Eight or nine aliquots were removed over the time course, which varied from 10 to 30 minutes. Each aliquot was put on ice and assayed in duplicate at the end of the experiment.
- NaKLG cone 0 mM 100 mM 200 mM 300 mM 400 mM
- Suitable salts which may be used in the bioreactor include ammonium sulfate, sodium acetate, ammonium acetate, ammonium cloride, sodium sulfate, potassium phosphate, sodium phosphate, sodium cloride, KCI, NH CI, K 2 SO 4 and Nal.
- Suitable salts include ammonium sulfate, sodium acetate, ammonium acetate, ammonium cloride, sodium sulfate, potassium phosphate, sodium phosphate, sodium cloride, KCI, NH CI, K 2 SO 4 and Nal.
- the temperature or salt concentration or both could be modified to achieve the desired stability of the reductase. At lower temperatures under which a typical bioreactor would be run, less salt would have to be used to provide the same amount of stabilization of the reductase as shown in Table 4.
- Example IX illustrates a method for measuring NADPH/NADP+ ratio and reaction equilibrium.
- NADPH Reduced cofactor
- NADP+ oxidized cofactor
- This method can be used to measure how the addition of various components to a reaction, such as a cofactor recycling reaction, affects the reaction equilibrium. A 1 ml reaction was set up in a cuvette at room temperature.
- the reaction consisted of buffer (50 mM bis-tris, pH 7), 5 mg glucose, 5 mg 2,5-DKG, 100 uM NADPH, 100 uM NADP+, reductase and glucose dehydrogenase (GDH).
- the enzymes were added last to initiate the reaction, and the cofactor levels were monitored at 340 nm. After equilibrium was reached ( Figure 7), an additional aliquot of GDH was added. Very quickly the equilibrium shifted to favor more NADPH being present. Addition of more GDH gave the same response.
- Example X illustrates cofactor recycle reactions
- Cofactor recycling reactions were performed by adding reductase, GDH, glucose, 2,5-DKG and NADP+ into a reaction vessel. Additionally, purified 2-KLG was added to some reactions to assess the reaction in the presence of product. These reactions were sustained to produce gluconic acid and 2-KLG. Cofactor was recycled between NADP+ and NADPH by the action of the two enzymes. Aliquots were periodically removed and analyzed by HPLC for the presence of substrates and products. The reaction was sustained for at least 20 hours at room temperature.
- reactions as small as 3 ml were done.
- reductase, GDH, 10 mg/ml glucose and 10 mg/ml lyophilized 2,5-DKG were added to 50 mM bis-tris buffer.
- 2-KLG was added to some incubations at a concentration of 75 mg/ml.
- the reaction was initiated at room temperature by the addition of NADP+ (400 uM).
- the solution pH was maintained between pH 6-7.5 by the addition of small amount of NaOH. Aliquots of glucose and 2,5- DKG were added periodically.
- the reaction was placed at 4 °C overnight. The following morning it was warmed to room temperature, the pH adjusted, and the reaction continued. Small aliquots were removed and injected on HPLC.
- the amounts of gluconate and 2-KLG made could be calculated.
- at least 60% of the glucose was converted to gluconate, and at least 60% of the 2,5-DKG converted to 2-KLG.
- Example XI illustrates NaCI kinetics.
- NaCI 100 mM or greater
- a standard reductase assay containing 250 uM NADPH and 10-20 mM DKG
- the reductase rate decreased.
- sodium chloride increases the Km of the reductase for the cofactor NADPH.
- the Km increases.
- a subsaturating amount of NADPH is used, the reductase appears to be inhibited by NaCI.
- more NADPH was added to the reaction, such that it is several-fold above the Km.
- the mode of inhibition appears to be competitive.
- the Km for DKG in the presence of NaCI was determined using standard techniques. The NADPH concentration used for each measurement was adjusted to at least 3 times above its Km at each NaCI concentration.
- Example XII shows 2-KLG kinetics.
- the Km for DKG in the presence of 2-KLG was determined using standard biochemical techniques.
- the amount of 2-KLG was varied from 0 to 150 mM in pH 7 buffer.
- the Km for DKG under pH 7 conditions was 10-12 mM.
- the Km for 2,5-DKG decreases.
- the Km for DKG at 150 mM 2-KLG is 2-4 mM.
- the reaction rate also decreases, and experiences a 2-4-fold decrease when KLG concentration increased from 0 to 150 mM. This behavior is consistent with uncompetitive inhibition.
- the Km for NADPH in the presence of 100 mM 2-KLG was determined to be 4-9 mM. This was done using standard biochemical techniques at pH 7, with a concentration of 2,5-DKG greater than 14 mM, and NADPH concentrations bracketing the Km value.
- KLG recovery e.g. by electrodialysis, or alternatively by adding more reductase to the bioreactor.
- Example XIII illustrates the synthesis of 2,5-DKG.
- P. citrea cells are incubated with 150 mM sodium gluconate in an appropriate buffer: 25 mM bis-tris or 25 mM MOPS is used at pH 6. 25 mis of the cells, buffer and substrate are added to a 125 ml Erlenmeyer flask with baffles and incubated at 28 °C with approximately 250 rpm shaking. After 16-24 hours, the flask is monitored for formation of 2,5-DKG by HPLC analysis and activity assay. The cells are spun down and the supernatant removed. The material is sterile filtered, and can be stored at 4 °C or frozen. Alternatively, the material can be lyophilized to a solid.
Abstract
Description
Claims
Priority Applications (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE69931394T DE69931394T2 (en) | 1998-12-22 | 1999-12-22 | PROCESS FOR PRODUCING ASCORBIC ACID INTERMEDIATE PRODUCTS |
PL99351711A PL351711A1 (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediates |
CA2371534A CA2371534C (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediates |
AU24855/00A AU2485500A (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediates |
MXPA01006337A MXPA01006337A (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediates. |
BR9916848-0A BR9916848A (en) | 1998-12-22 | 1999-12-22 | Process for producing ascorbic acid intermediates |
JP2000589720A JP2003517278A (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediate |
EP99968182A EP1141368B1 (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediates |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/218,700 | 1998-12-22 | ||
US09/218,700 US6599722B2 (en) | 1998-12-22 | 1998-12-22 | Method for producing ascorbic acid intermediates |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000037667A1 true WO2000037667A1 (en) | 2000-06-29 |
Family
ID=22816130
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1999/030918 WO2000037667A1 (en) | 1998-12-22 | 1999-12-22 | Method for producing ascorbic acid intermediates |
Country Status (15)
Country | Link |
---|---|
US (4) | US6599722B2 (en) |
EP (1) | EP1141368B1 (en) |
JP (1) | JP2003517278A (en) |
KR (1) | KR100750363B1 (en) |
CN (1) | CN1247790C (en) |
AT (1) | ATE326542T1 (en) |
AU (1) | AU2485500A (en) |
BR (1) | BR9916848A (en) |
CA (2) | CA2776920A1 (en) |
CZ (1) | CZ298605B6 (en) |
DE (1) | DE69931394T2 (en) |
DK (1) | DK1141368T3 (en) |
MX (1) | MXPA01006337A (en) |
PL (1) | PL351711A1 (en) |
WO (1) | WO2000037667A1 (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1373480A2 (en) * | 2001-04-04 | 2004-01-02 | Genencor International, Inc. | Uncoupled productive and catabolic host cell pathways |
EP1383903A2 (en) * | 2001-04-04 | 2004-01-28 | Genencor International, Inc. | Methods for the production of products in host cells |
WO2007028611A2 (en) * | 2005-09-09 | 2007-03-15 | Dsm Ip Assets B.V. | Process for biomass production using a microorganism with a disrupted glucose-dehydrogenase gene (gms 01) |
US7195792B2 (en) | 2002-02-22 | 2007-03-27 | Genencor International, Inc. | Browning agent |
WO2019222226A3 (en) * | 2018-05-17 | 2020-01-23 | Bp Corporation North America Inc. | Production of 2-keto-3-deoxy-d-gluconic acid in filamentous fungi |
Families Citing this family (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE10024314A1 (en) * | 2000-05-17 | 2001-11-22 | Basf Ag | Regeneration of NAD(P)H from NAD(P)+ formed in an oxidative enzymatic reaction comprises indirect electrochemical reduction |
FI20020592A (en) * | 2002-03-27 | 2003-09-28 | Danisco Sweeteners Oy | Method for separating sugars, sugar alcohols, carbohydrates and mixtures thereof from solutions containing them |
DK2322607T3 (en) * | 2002-08-16 | 2015-12-14 | Danisco Us Inc | NOVEL HYPROCREA JECORINA CBH1 cellulase WITH INCREASED THERMAL STABILITY COMPREHENSIVE SUBSTITUTION OR DELETION FOR POSITION S113 |
DK1625211T3 (en) * | 2003-05-22 | 2015-02-23 | Danisco Us Inc | Metabolic MANIPULATED BACTERIA STRAINS THAT ARE NON-FUNCTIONAL endogenous GLUCONATTRANSPORTERE |
JPWO2005001066A1 (en) * | 2003-06-18 | 2006-11-02 | 住友ベークライト株式会社 | Novel degrading bacterium and method for degrading organic compound using the same |
CN1829800B (en) * | 2003-07-30 | 2010-06-09 | 金克克国际有限公司 | Metabolically engineered bacterial strains having enhanced 2-keto-D-gluconate accumulation |
ES2554467T3 (en) | 2004-12-30 | 2015-12-21 | Danisco Us Inc. | Variants of CBH2 cellulases from Hypocrea jecorina |
WO2006084664A1 (en) * | 2005-02-11 | 2006-08-17 | Dsm Ip Assets B.V. | Novel gene rcs 09 |
JP4966189B2 (en) * | 2005-02-25 | 2012-07-04 | 株式会社カネカ | Method for producing optically active secondary alcohol |
PT2164975E (en) | 2007-07-06 | 2012-03-08 | Basf Se | Process for preparing a concentrated aqueous glucose solution from corn |
WO2009149202A2 (en) | 2008-06-06 | 2009-12-10 | Danisco Us Inc., Genencor Division | Compositions and methods comprising cellulase variants with reduced affinity to non-cellulosic materials |
WO2010066411A2 (en) | 2008-12-10 | 2010-06-17 | Direvo Industrial Biotechnology Gmbh | Polypeptides having cellobiohydrolase ii activity |
KR20120062643A (en) | 2009-06-03 | 2012-06-14 | 다니스코 유에스 인크. | Cellulase variants with improved expression, activity and/or stability, and use thereof |
BR112015013647A2 (en) | 2012-12-12 | 2017-11-14 | Danisco Us Inc | isolated variant of a parental cellobiohydrolase (cbh) enzyme, isolated polynucleotide, vector, host cell, detergent composition, food additive, method for hydrolyzing a cellulosic substrate, cell culture supernatant, methods of producing a variant cbh polypeptide and supernatant cell culture |
EP3192866A1 (en) | 2016-01-15 | 2017-07-19 | CIC nanoGUNE - Asociación Centro de Investigación Cooperativa en Nanociencias | Endocellulases and uses thereof |
EP3502126A1 (en) | 2017-12-19 | 2019-06-26 | CIC nanoGUNE - Asociación Centro de Investigación Cooperativa en Nanociencias | Ancestral cellulases and uses thereof |
CN109055292B (en) * | 2018-08-20 | 2020-08-04 | 上海凌凯医药科技有限公司 | Recombinant pseudomonas proteus for producing L-xylose and application thereof |
CN112430560B (en) * | 2019-08-26 | 2024-01-05 | 中国科学院分子植物科学卓越创新中心 | 2-keto-L-gulonic acid production strain and construction method thereof |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0046284A2 (en) * | 1980-08-14 | 1982-02-24 | Shionogi & Co., Ltd. | Method for preparing 2,5-diketo-D-gluconic acid and microorganisms for carrying out the method |
EP0088409A2 (en) * | 1982-03-05 | 1983-09-14 | Shionogi & Co., Ltd. | Process for preparing 2-keto-L-gulonic acid |
EP0292303A1 (en) * | 1987-05-21 | 1988-11-23 | Genentech, Inc. | Ascorbic acid intermediates and process enzymes |
US4945052A (en) * | 1985-08-02 | 1990-07-31 | Biogen, Inc. | Production of a Vitamin C precursor using genetically modified organisms |
US5032514A (en) * | 1988-08-08 | 1991-07-16 | Genentech, Inc. | Metabolic pathway engineering to increase production of ascorbic acid intermediates |
WO1994005772A1 (en) * | 1992-09-08 | 1994-03-17 | Rutgers, The State University Of New Jersey | Improved enzymes for the production of 2-keto-l-gulonic acid |
Family Cites Families (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3790444A (en) | 1971-03-09 | 1974-02-05 | Daiichi Seiyaku Co | Process for preparing diketogluconic acid |
US5004690A (en) | 1983-06-28 | 1991-04-02 | Genetech, Inc. | Ascorbic acid intermediates and process enzymes |
US4758514A (en) * | 1983-06-28 | 1988-07-19 | Genentech, Inc. | Ascorbic acid intermediates and process enzymes |
US4757012A (en) | 1983-06-28 | 1988-07-12 | Genentech, Inc. | Ascorbic acid intermediates and process enzymes |
DE3326546A1 (en) | 1983-07-22 | 1985-02-07 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V., 8000 München | METHOD FOR THE CONTINUOUS ENZYMATIC PRODUCTION OF GLUCONIC ACID OR ITS DERIVATIVES AND SORBITE AND / OR MANNITE |
GB8826429D0 (en) | 1988-11-11 | 1988-12-14 | Univ Leeds Ind Service Ltd | Enzyme stabilisation systems |
US5795761A (en) * | 1996-01-11 | 1998-08-18 | Rutgers, The State University Of New Jersey | Mutants of 2,5-diketo-D-gluconic acid (2,5-DKG) reductase A |
-
1998
- 1998-12-22 US US09/218,700 patent/US6599722B2/en not_active Expired - Lifetime
-
1999
- 1999-12-22 MX MXPA01006337A patent/MXPA01006337A/en active IP Right Grant
- 1999-12-22 AU AU24855/00A patent/AU2485500A/en not_active Abandoned
- 1999-12-22 US US09/470,168 patent/US20020177198A1/en not_active Abandoned
- 1999-12-22 JP JP2000589720A patent/JP2003517278A/en active Pending
- 1999-12-22 WO PCT/US1999/030918 patent/WO2000037667A1/en active IP Right Grant
- 1999-12-22 EP EP99968182A patent/EP1141368B1/en not_active Expired - Lifetime
- 1999-12-22 AT AT99968182T patent/ATE326542T1/en not_active IP Right Cessation
- 1999-12-22 BR BR9916848-0A patent/BR9916848A/en not_active IP Right Cessation
- 1999-12-22 PL PL99351711A patent/PL351711A1/en unknown
- 1999-12-22 CA CA2776920A patent/CA2776920A1/en not_active Abandoned
- 1999-12-22 CA CA2371534A patent/CA2371534C/en not_active Expired - Fee Related
- 1999-12-22 CZ CZ20012285A patent/CZ298605B6/en not_active IP Right Cessation
- 1999-12-22 DK DK99968182T patent/DK1141368T3/en active
- 1999-12-22 DE DE69931394T patent/DE69931394T2/en not_active Expired - Lifetime
- 1999-12-22 KR KR1020017007144A patent/KR100750363B1/en not_active IP Right Cessation
- 1999-12-22 CN CNB998149500A patent/CN1247790C/en not_active Expired - Fee Related
-
2003
- 2003-07-23 US US10/626,033 patent/US20040180413A1/en not_active Abandoned
- 2003-11-20 US US10/470,649 patent/US20050227337A1/en not_active Abandoned
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0046284A2 (en) * | 1980-08-14 | 1982-02-24 | Shionogi & Co., Ltd. | Method for preparing 2,5-diketo-D-gluconic acid and microorganisms for carrying out the method |
EP0088409A2 (en) * | 1982-03-05 | 1983-09-14 | Shionogi & Co., Ltd. | Process for preparing 2-keto-L-gulonic acid |
US4945052A (en) * | 1985-08-02 | 1990-07-31 | Biogen, Inc. | Production of a Vitamin C precursor using genetically modified organisms |
EP0292303A1 (en) * | 1987-05-21 | 1988-11-23 | Genentech, Inc. | Ascorbic acid intermediates and process enzymes |
US5032514A (en) * | 1988-08-08 | 1991-07-16 | Genentech, Inc. | Metabolic pathway engineering to increase production of ascorbic acid intermediates |
WO1994005772A1 (en) * | 1992-09-08 | 1994-03-17 | Rutgers, The State University Of New Jersey | Improved enzymes for the production of 2-keto-l-gulonic acid |
Cited By (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7407780B2 (en) | 2001-04-04 | 2008-08-05 | Genencor International, Inc. | Process for producing glycerol in recombinant bacterial host cells |
EP2039774A1 (en) * | 2001-04-04 | 2009-03-25 | Genencor International, Inc. | Methods for the production of products in host cells |
EP1383903A4 (en) * | 2001-04-04 | 2004-12-15 | Genencor Int | Methods for the production of products in host cells |
EP1373480A4 (en) * | 2001-04-04 | 2005-02-02 | Genencor Int | Uncoupled productive and catabolic host cell pathways |
CN1298855C (en) * | 2001-04-04 | 2007-02-07 | 金克克国际有限公司 | Methods for prodn. of products in host cells |
JP2010057499A (en) * | 2001-04-04 | 2010-03-18 | Genencor Internatl Inc | Uncoupled productive and catabolic pathway of host cell |
EP1383903A2 (en) * | 2001-04-04 | 2004-01-28 | Genencor International, Inc. | Methods for the production of products in host cells |
US7241587B2 (en) | 2001-04-04 | 2007-07-10 | Genencor International, Inc. | Method of uncoupling the catabolic pathway of glycolysis from the oxidative membrane bound pathway of glucose conversion |
EP1373480A2 (en) * | 2001-04-04 | 2004-01-02 | Genencor International, Inc. | Uncoupled productive and catabolic host cell pathways |
US7195792B2 (en) | 2002-02-22 | 2007-03-27 | Genencor International, Inc. | Browning agent |
WO2007028611A3 (en) * | 2005-09-09 | 2007-07-19 | Dsm Ip Assets Bv | Process for biomass production using a microorganism with a disrupted glucose-dehydrogenase gene (gms 01) |
WO2007028611A2 (en) * | 2005-09-09 | 2007-03-15 | Dsm Ip Assets B.V. | Process for biomass production using a microorganism with a disrupted glucose-dehydrogenase gene (gms 01) |
US8940503B2 (en) | 2005-09-09 | 2015-01-27 | Dsm Ip Assets B.V. | Gene GMS 01 |
WO2019222226A3 (en) * | 2018-05-17 | 2020-01-23 | Bp Corporation North America Inc. | Production of 2-keto-3-deoxy-d-gluconic acid in filamentous fungi |
US11708571B2 (en) | 2018-05-17 | 2023-07-25 | Bp Corporation North America Inc. | Production of 2-keto-3-deoxy-d-gluconic acid in filamentous fungi |
Also Published As
Publication number | Publication date |
---|---|
KR100750363B1 (en) | 2007-08-17 |
CN1247790C (en) | 2006-03-29 |
US20020177197A1 (en) | 2002-11-28 |
BR9916848A (en) | 2002-11-05 |
PL351711A1 (en) | 2003-06-02 |
ATE326542T1 (en) | 2006-06-15 |
DE69931394D1 (en) | 2006-06-22 |
US20040180413A1 (en) | 2004-09-16 |
CA2371534C (en) | 2012-07-17 |
CZ20012285A3 (en) | 2001-10-17 |
DK1141368T3 (en) | 2006-09-18 |
DE69931394T2 (en) | 2007-05-03 |
US20050227337A1 (en) | 2005-10-13 |
US6599722B2 (en) | 2003-07-29 |
CN1331749A (en) | 2002-01-16 |
CA2776920A1 (en) | 2000-06-29 |
JP2003517278A (en) | 2003-05-27 |
CA2371534A1 (en) | 2000-06-29 |
CZ298605B6 (en) | 2007-11-21 |
EP1141368B1 (en) | 2006-05-17 |
AU2485500A (en) | 2000-07-12 |
EP1141368A1 (en) | 2001-10-10 |
KR20010093149A (en) | 2001-10-27 |
MXPA01006337A (en) | 2002-04-24 |
US20020177198A1 (en) | 2002-11-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2371534C (en) | Method for producing ascorbic acid intermediates | |
US7407780B2 (en) | Process for producing glycerol in recombinant bacterial host cells | |
US7229805B2 (en) | Methods for the synthesis of lactic acid using crabtree-negative yeast transformed with the lactate dehydrogenase gene | |
US20080254523A1 (en) | Methods for the Production of Products in Host Cells | |
CA2794446C (en) | Uncoupled productive and catabolic host cell pathways |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 99814950.0 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ CZ DE DE DK DK DM EE EE ES FI FI GB GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 1200100496 Country of ref document: VN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999968182 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1020017007144 Country of ref document: KR |
|
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/006337 Country of ref document: MX Ref document number: PV2001-2285 Country of ref document: CZ |
|
ENP | Entry into the national phase |
Ref document number: 2371534 Country of ref document: CA Ref document number: 2371534 Country of ref document: CA Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2000 589720 Country of ref document: JP Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 1999968182 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: PV2001-2285 Country of ref document: CZ |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1020017007144 Country of ref document: KR |
|
WWG | Wipo information: grant in national office |
Ref document number: 1999968182 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: PV2001-2285 Country of ref document: CZ |