WO2000017392A1 - Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases - Google Patents

Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases Download PDF

Info

Publication number
WO2000017392A1
WO2000017392A1 PCT/GB1999/003057 GB9903057W WO0017392A1 WO 2000017392 A1 WO2000017392 A1 WO 2000017392A1 GB 9903057 W GB9903057 W GB 9903057W WO 0017392 A1 WO0017392 A1 WO 0017392A1
Authority
WO
WIPO (PCT)
Prior art keywords
vcam
embl accession
gene
nucleic acid
positions
Prior art date
Application number
PCT/GB1999/003057
Other languages
French (fr)
Inventor
John Edward Norris Morten
Original Assignee
Astrazeneca Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Astrazeneca Ab filed Critical Astrazeneca Ab
Priority to EP99946341A priority Critical patent/EP1114182A1/en
Priority to JP2000574291A priority patent/JP2002526089A/en
Priority to AU58755/99A priority patent/AU5875599A/en
Publication of WO2000017392A1 publication Critical patent/WO2000017392A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/06Antigout agents, e.g. antihyperuricemic or uricosuric agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • VCAM-1 VCAM-1 gene has been cloned and published as a EMBL Accession number: M92431 (2396 bp) and all positions herein relate to the position therein unless stated otherwise or apparent from the context.
  • the invention further provides nucleotide primers which can detect the polymorphisms of the invention.
  • an allele-specific oligonucleotide probe capable of detecting a VCAM-1 gene polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431.
  • the allele-specific oligonucleotide probe is preferably 17- 50 nucleotides, more preferably about 17-35 nucleotides, more preferably about 17-30 nucleotides.
  • VCAM- 1 ligand antagonist drug in preparation of a medicament for treating a VCAM-1 ligand mediated disease in a human diagnosed as having a single nucleotide polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 (as defined by the position in EMBL accession number M92431).
  • a pharmaceutical pack comprising VCAM-1 ligand antagonist drug and instructions for administration of the drug to humans diagnostically tested for a single nucleotide polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 (as defined by the position in EMBL accession number M92431).
  • AMPLITAQTM available from Perkin-Elmer Cetus, is used as the source of thermostable DNA polymerase.
  • General molecular biology procedures can be followed from any of the methods described in "Molecular Cloning - A Laboratory Manual” Second Edition, Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory, 1989).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Neurosurgery (AREA)
  • Genetics & Genomics (AREA)
  • Pulmonology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Psychiatry (AREA)
  • Molecular Biology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Vascular Medicine (AREA)
  • Hospice & Palliative Care (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cardiology (AREA)
  • Pain & Pain Management (AREA)

Abstract

This invention relates to polymorphisms in the human Vascular Cell Adhesion Molecule-1 (VCAM-1) gene, in particular at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431. The invention also relates to methods and materials for analysing allelic variation in the VCAM-1 gene, and to the use of VCAM-1 polymorphism in the diagnosis and treatment of VCAM-1 ligand mediated diseases such as multiple sclerosis, rheumatoid arthritis, atherosclerosis and allergic asthma.

Description

POLYMORPHISMS IN THE HUMAN VCAM-1 GENE, SUITABLE FOR DIAGNOSIS AND TREATMENT OF VCAM- LIGAND MEDIATED DISEASES
This invention relates to polymorphisms in the human Vascular Cell Adhesion Molecule-1 (VCAM-1) gene. The invention also relates to methods and materials for
5 analysing allelic variation in the VCAM-1 gene, and to the use of VCAM-1 polymorphism in the diagnosis and treatment of VCAM-1 ligand mediated diseases such as multiple sclerosis, rheumatoid arthritis, atherosclerosis and allergic asthma.
VCAM-1, also known as CD 106, is a 90-110 kDa glycoprotein member of the immunoglobulin superfamily expressed mainly on the surface of activated vascular endothelial
10 cells. Two forms of human VCAM-1 have been identified, a predominant form containing seven immunoglobulin domains and an alternatively-spliced form missing the fourth immunoglobulin domain. VCAM-1 is also found as a soluble form in serum, probably as a result of proteolytic cleavage of endothelial cell surface VCAM-1. Cell adhesion molecules have been reviewed in Mousa et al. (1997), DDT, 2, 187-199.
15 VCAM-1 is a ligand for the α integrins, α4βι, also known as Very Late Antigen-4
(VLA-4) or CD49d/CD29, and α β7. These integrins are members of a family of heterodimeric cell surface receptors that are composed of non-covalently associated glycoprotein subunits (α and β) and are involved in the adhesion of cells to other cells or to extracellular matrix. Integrin α4βι is expressed on numerous haematopoietic cells, including
20 haematopoietic precursors, peripheral and cytotoxic T lymphocytes, B lymphocytes, monocytes, thymocytes and eosinophils. Integrin α β7 is expressed on lymphocytes that preferentially home to gastrointestinal mucosa and gut-associated lymphoid tissue. The α integrins recognise a short amino acid sequence, glutamine-isoleucine-aspartic acid-serine- proline (QIDSP), exposed on the C-D loop of immunoglobulin domains 1 and 4. An accessory
25 binding site may also be located in the adjacent immunoglobulin domain.
Expression of VCAM-1 on unactivated vascular endothelial cells is low or absent but is upregulated in human inflammatory diseases such as rheumatoid arthritis, multiple sclerosis, allergic asthma and atherosclerosis. Soluble VCAM-1 is elevated in serum and cerebrospinal fluid of multiple sclerosis patients and in serum during inflammatory bowel disease and after
30 cardiac transplantation. In vitro, endothelial cells can be induced to express VCAM-1 by inflammatory cytokines such as tumour necrosis factor and interleukin-1 or by oxidative stress. VCAM-1 gene expression in vascular endothelial cells during inflammation is regulated by transcriptional activation, thought to involve the dimeric transcription factor, nuclear factor-κB (N -κB).
The activation and extravasation of blood leukocytes plays a major role in the development and progression of inflammatory diseases. Cell adhesion to the vascular endothelium is required before cells migrate from the blood into inflammed tissue and is mediated by specific interactions between cell adhesion molecules on the surface of vascular endothelial cells and circulating leukocytes. α integrin/VCAM-l binding is believed to have an important role in the recruitment of lymphocytes, monocytes and eosinophils during inflammation. Monoclonal antibodies directed against the α4 integrin subunit have been shown to be effective in a number of animal models of human inflammatory diseases including multiple sclerosis, rheumatoid arthritis, allergic asthma, contact dermatitis, transplant rejection, insulin-dependent diabetes, inflammatory bowel disease, and glomerulonephritis. α4βι /VCAM-1 binding has also been implicated in T-cell proliferation, B-cell localisation to germinal centres, haematopoietic progenitor cell localisation in the bone marrow, angiogenesis, placental development, muscle development and tumour cell metastasis. Small molecule inhibitors of VCAM-1 binding to α integrins have been designed based on the QIDSP motif in VCAM-1 and similar motifs in other α4 integrin ligands fibronectin and mucosal addressin cell adhesion molecule- 1 (MAdCAM-1). Small molecule and monoclonal antibody inhibitors of VCAM-1 binding to α integrins and inhibitors of VCAM-1 expression may have utility in the treatment of autoimmune, allergic and vascular inflammatory diseases, the prevention of tumour metastasis and in mobilisation of haematopoietic progenitor cells from bone marrow prior to tumour chemotherapy.
Exon 1 of the VCAM-1 gene has been cloned and published as a EMBL Accession number: M92431 (2396 bp) and all positions herein relate to the position therein unless stated otherwise or apparent from the context.
One approach is to use knowledge of polymorphisms to help identify patients most suited to therapy with particular pharmaceutical agents (this is often termed "pharmacogenetics") . Pharmacogenetics can also be used in pharmaceutical research to assist the drug selection process. Polymorphisms are used in mapping the human genome and to elucidate the genetic component of diseases. The reader is directed to the following references for background details on pharmacogenetics and other uses of polymorphism detection: Linder et al. (1997)rClinical Chemistry, 43, 254; Marshall (1997), Nature Biotechnology, 15, 1249; International Patent Application WO 97/40462, Spectra Biomedical; and Schafer et al. (1998), Nature Biotechnology, 16, 33.
Clinical trials have shown that patient response to treatment with pharmaceuticals is often heterogeneous. Thus there is a need for improved approaches to pharmaceutical agent design and therapy.
The present invention is based on the discovery of six single nucleotide polymorphisms (SNPs) in the VCAM-1 gene.
According to one aspect of the present invention there is provided a method for the diagnosis of a single nucleotide polymorphism in VCAM-1 in a human, which method comprises determining the sequence of the nucleic acid of the human at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431, and determining the status of the human by reference to polymorphism in the VCAM-1 gene.
The term human includes both a human having or suspected of having a VCAM-1 ligand mediated disease and an asymptomatic human who may be tested for predisposition or susceptibility to such disease. At each position the human may be homozygous for an allele or the human may be a heterozygote.
In one embodiment of the invention preferably the method for diagnosis described herein is one in which the single nucleotide polymorphism at position 278 is presence of T and/or C.
In another embodiment of the invention preferably the method for diagnosis described herein is one in which the single nucleotide polymorphism at position 647 is presence of A and/or G.
In another embodiment of the invention preferably the method for diagnosis described herein is one in which the single nucleotide polymorphism at position 707 is presence of T and/or C.
In another embodiment of the invention preferably the method for diagnosis described herein is one in which the single nucleotide polymorphism at position 748 is presence of T and/or C. In another embodiment of the invention preferably the method for diagnosis described herein is one in which the single nucleotide polymorphism at position 829 is presence of G and/or A. In another embodiment of the invention preferably the method for diagnosis described herein is one in which the single nucleotide polymorphism at position 1467 is presence of T and/or C.
The method for diagnosis is preferably one in which the sequence is determined by a method selected from amplification refractory mutation system and restriction fragment length polymorphism.
In another aspect of the invention we provide a method for the diagnosis of VCAM-1 ligand-mediated disease, which method comprises: i) obtaining sample nucleic acid from an individual, ii) detecting the presence or absence of a variant nucleotide at one or more of positions 278, 647, 707, 748, 829 and 1467 (as defined by the position in EMBL accession number M92431), in the VCAM-1 gene and iii) determining the status of the individual by reference to polymorphism in the VCAM-1 gene. Allelic variation at position 278 consists of a single base substitution from T (the published base), preferably to C. Allelic variation at position 647 consists of a single base substitution from A (the published base), preferably to G. Allelic variation at position 707 consists of a single base substitution from T (the published base), preferably to C. Allelic variation at position 748 consists of a single base substitution from T (the published base), preferably to C. Allelic variation at position 829 consists of a single base substitution from G (the published base), preferably to A. Allelic variation at position 1467 consists of a single base substitution from T (the published base), preferably to C. The status of the individual may be determined by reference to allelic variation at any one, two, three, four, five or all six positions.
The test sample of nucleic acid is conveniently a sample of blood, bronchoalveolar lavage fluid, sputum, or other body fluid or tissue obtained from an individual. It will be appreciated that the test sample may equally be a nucleic acid sequence corresponding to the sequence in the test sample, that is to say that all or a part of the region in the sample nucleic acid may firstly be amplified using any convenient technique e.g. PCR, before analysis of allelic variation.
It will be apparent to the person skilled in the art that there are a large number of analytical procedures which may be used to detect the presence or absence of variant nucleotides at one or more polymorphic positions of the invention. In general, the detection of allelic variation requires a mutation discrimination technique, optionally an amplification reaction and optionally a signal generation system. Table 1 lists a number of mutation detection techniques, some based on the PCR. These may be used in combination with a number of signal generation systems, a selection of which is listed in Table 2. Further amplification techniques are listed in Table 3. Many current methods for the detection of allelic variation are reviewed by Nollau et al, Clin. Chem. 43, 1114-1120, 1997; and in standard textbooks, for example "Laboratory Protocols for Mutation Detection", Ed. by U. Landegren, Oxford University Press, 1996 and "PCR", 2nd Edition by Newton & Graham, BIOS Scientific Publishers Limited, 1997. Abbreviations:
Figure imgf000007_0001
Table 1 - Mutation Detection Techniques
General: DNA sequencing, Sequencing by hybridisation
Scanning: PTT*, SSCP, DGGE, TGGE, Cleavase, Heteroduplex analysis, CMC, Enzymatic mismatch cleavage
* Note: not useful for detection of promoter polymorphisms. Hybridisation Based Solid phase hybridisation: Dot blots, MASDA, Reverse dot blots, Oligonucleotide arrays (DNA Chips)
Solution phase hybridisation: Taqman™ - US-5210015 & US-5487972 (Hoffmann-La
Roche), Molecular Beacons - Tyagi et al (1996), Nature Biotechnology, 14, 303; WO 95/13399 (Public Health Inst, New York)
Extension Based: ARMS™, ALEX™ - European Patent No. EP 332435 Bl (Zeneca
Limited), COPS - Gibbs et al (1989), Nucleic Acids Research, 17, 2347.
Incorporation Based: Mini-sequencing, APEX
Restriction Enzyme Based: RFLP, Restriction site generating PCR Ligation Based: OLA
Other: Invader assay
Table 2 - Signal Generation or Detection Systems
Fluorescence: FRET, Fluorescence quenching, Fluorescence polarisation - United Kingdom
Patent No. 2228998 (Zeneca Limited) Other: Chemiluminescence, Electrochemiluminescence, Raman, Radioactivity, Colorimetric,
Hybridisation protection assay, Mass spectrometry
Table 3 - Further Amplification Methods
SSR, NASBA, LCR, SDA, b-DNA
Preferred mutation detection techniques include ARMS™, ALEX™, COPS, Taqman, Molecular Beacons, RFLP, and restriction site based PCR and FRET techniques.
Particularly preferred methods include ARMS™ and RFLP based methods. ARMS™ is an especially preferred method.
In a further aspect, the diagnostic methods of the invention are used to assess the efficacy of therapeutic compounds in the treatment of VCAM-1 ligand mediated diseases such as autoimmune, allergic and vascular inflammatory diseases. The polymoφhisms identified in the present invention occur in the promoter region of the VCAM-1 gene. The changes are not expected to alter the amino acid sequence of VCAM-1, but several of the polymorphisms affect transcription sites within the promoter region and thus may affect the transcription of the
VCAM-1 gene. For example the changing of the nucleotide at position 748 (as defined by the position in EMBL ACCESSION NO. M92431) from T to C results in the gain of a Ela-F rev site and the loss of a TATA box. Assays, for example reporter-based assays, may be devised to detect whether one or more of the above polymorphisms affect transcription levels and/or message stability.
Individuals who carry particular allelic variants of the VCAM-1 gene may therefore exhibit differences in their ability to regulate protein biosynthesis under different physiological conditions and will display altered abilities to react to different diseases. In addition, differences in protein regulation arising as a result of allelic variation may have a direct effect on the response of an individual to drug therapy. The diagnostic methods of the invention may be useful both to predict the clinical response to such agents and to determine therapeutic dose. In a further aspect, the diagnostic methods of the invention, are used to assess the predisposition and/or susceptibility of an individual to diseases mediated by VCAM-1 ligands. This may be particularly relevant in the development of autoimmune, allergic and vascular inflammatory diseases and other diseases which are modulated by VCAM-1 interactions. The present invention may be used to recognise individuals who are particularly at risk from developing these conditions.
In a further aspect, the diagnostic methods of the invention are used in the development of new drug therapies which selectively target one or more allelic variants of the VCAM-1 gene. Identification of a link between a particular allelic variant and predisposition to disease development or response to drug therapy may have a significant impact on the design of new drugs. Drugs may be designed to regulate the biological activity of variants implicated in the disease process whilst minimising effects on other variants.
In a further diagnostic aspect of the invention the presence or absence of variant nucleotides is detected by reference to the loss or gain of, optionally engineered, sites recognised by restriction enzymes. In the accompanying Example 1 we provide details of convenient engineered restriction enzyme sites that are lost or gained as a result of a polymorphism of the invention.
According to another aspect of the present invention there is provided a nucleic acid comprising any one of the following polymorphisms: the nucleic acid of EMBL ACCESSION No. M92431 with C at position 278 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; the nucleic acid of EMBL ACCESSION No. M92431 with G at position 647 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; the nucleic acid of EMBL ACCESSION No. M92431 with C at position 707 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; the nucleic acid of EMBL ACCESSION No. M92431 with C at position 748 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; the nucleic acid of EMBL ACCESSION No. M92431 with A at position 829 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431 ; the nucleic acid of EMBL ACCESSION No. M92431 with C at position 1467 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; or a complementary strand thereof or a fragment thereof of at least 20 bases comprising at least one polymorphism.
Fragments are at least 17 bases, more preferably at least 20 bases, more preferably at least 30 bases. The nucleic acid of the invention does not encompass naturally occuring nucleic acid as it occurs in nature, for example, the nucleic acid is at least partially purified from at least one component with which it occurs naturally. Preferably the nucleic acid is at least 30% pure, more preferably at least 60% pure, more preferably at least 90% pure, more preferably at least 95% pure, and more preferably at least 99% pure.
According to another aspect of the invention there is provided use of a nucleic acid sequence comprising at least one of the polymorphisms in the promoter disclosed herein to identify compounds that modify expression of the VCAM-1 gene. Modification of expression includes inhibition or enhancement of expression. This is conveniently done by measuring expression levels of a reporter gene (for example beta-galactosidase) under the control of the promoter in transfected host cells in the presence or absence of test compounds. Suitable test compounds include polynucleotides capable of binding to the promoter through triplex strand formation. Accordingly suitable compounds can be identified for therapeutic use which alter native gene expression either up or down as appropriate for the relevant disease to be treated. The reader is directed to the following references on nucleic acid triplex formation and uses: Progress in developments of Triplex-Based strategies: Giovannangeli C; Helene C: Antisense and Nucleic Acid Drug Development / 7/4 (413-421) /1997; Recent developments in triple- helix regulation of gene expression: Neidle S: Anti-Cancer Drug Design / 12/5 (433-442) /1997; Triplex DNA: Fundamentals, advances, and potential applications for gene therapy: Chan PP; Glazer PM: Journal of Molecular Medicine / 75/4 (267-282) /1997; Oligonucleotide directed triple helix formation: Sun J-S; Garestier T; Helene C: Current Opinion in Structural Biology / 6/3 (327-333) /1996; C Mayfield, M Squibb, D Miller (1994) Inhibition of nuclear protein binding to the human Ki-ras promoter by triplex-forming oligonucleotides Biochemistry" 33,3358-3363; WM Olivas, LJ Maher (1996) Binding of DNA oligonucleotides to sequences in the promoter of the human bcl-2 gene Nucleic Acids Research 24, 1758-1764; C Mayfield, S Ebinghaus, J Gees, D Jones, B Rodu, M Squibb, D Miller (1994) Triplex formation by the human HA-ras promoter inhibits Spl binding and in vitro transcription J Biol Chem 269,18232-18238; and JE Gee, GR Revankar, TS Rao, ME Hogan (1995) Triplex formation at the rat neu gene utilizing imidazole and 2'-deoxy-6-thioguanosine base substitutions Biochemistry 34,2042-2048. According to another aspect of the present invention there is provided a computer readable medium comprising at least one novel polynucleotide sequence of the invention stored on the medium. The computer readable medium may be used, for example, in homology searching, mapping, haplotyping, genotyping or pharmacogenetic analysis or any other bioinformatic analysis. The reader is referred to Bioinformatics, A practical guide to the analysis of genes and proteins, Edited by A D Baxevanis & B F F Ouellette, John Wiley & Sons, 1988. Any computer readable medium may be used, for example, compact disk, tape, floppy disk, hard drive or computer chips.
The polynucleotide sequences of the invention, or parts thereof, particularly those relating to and identifying the single nucleotide polymorphisms identified herein represent a valuable information source, for example, to characterise individuals in terms of haplotype and other sub-groupings, such as investigation of susceptibility to treatment with particular drugs. These approaches are most easily facilitated by storing the sequence information in a computer readable medium and then using the information in standard bioinformatics programs or to search sequence databases using state of the art searching tools such as "GCC". Thus, the polynucleotide sequences of the invention are particularly useful as components in databases useful for sequence identity and other search analyses. As used herein, storage of the sequence information in a computer readable medium and use in sequence databases in relation to 'polynucleotide or polynucleotide sequence of the invention' covers any detectable chemical or physical characteristic of a polynucleotide of the invention that may be reduced to, converted into or stored in a tangible medium, such as a computer disk, preferably in a computer readable form. For example, chromatographic scan data or peak data, photographic scan or peak data, mass spectrographic data, sequence gel (or other) data. The invention provides a computer readable medium having stored thereon one or a more polynucleotide sequences of the invention. For example, a computer readable medium is provided comprising and having stored thereon a member selected from the group consisting of: a polynucleotide comprising the sequence of a polynucleotide of the invention, a
5 polynucleotide consisting of a polynucleotide of the invention, a polynucleotide which comprises part of a polynucleotide of the invention, which part includes at least one of the polymorphisms of the invention, a set of polynucleotide sequences wherein the set includes at least one polynucleotide sequence of the invention, a data set comprising or consisting of a polynucleotide sequence of the invention or a part thereof comprising at least one of the
10 polymorphisms identified herein. A computer based method is also provided for performing sequence identification, said method comprising the steps of providing a polynucleotide sequence comprising a polymoφhism of the invention in a computer readable medium; and comparing said polymorphism containing polynucleotide sequence to at least one other polynucleotide or polypeptide sequence to identify identity (homology), i.e. screen for the
15 presence of a polymorphism.
The invention further provides nucleotide primers which can detect the polymorphisms of the invention.
According to another aspect of the present invention there is provided an allele specific primer capable of detecting a VCAM-1 gene polymorphism at one or more of positions 278,
20 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431.
An allele specific primer is used, generally together with a constant primer, in an amplification reaction such as a PCR reaction, which provides the discrimination between alleles through selective amplification of one allele at a particular sequence position e.g. as
25 used for ARMS™ assays. The allele specific primer is preferably 17- 50 nucleotides, more preferably about 17-35 nucleotides, more preferably about 17-30 nucleotides.
An allele specific primer preferably corresponds exactly with the allele to be detected but derivatives thereof are also contemplated wherein about 6-8 of the nucleotides at the 3' terminus correspond with the allele to be detected and wherein up to 10, such as up to 8, 6, 4,
30 2, or 1 of the remaining nucleotides may be varied without significantly affecting the properties of the primer. Primers may be manufactured using any convenient method of synthesis. Examples of such methods may be found in standard textbooks, for example "Protocols for Oligonucleotides and Analogues; Synthesis and Properties," Methods in Molecular Biology Series; Volume 20; Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7; 1993; 1st Edition. If required the primer(s) may be labelled to facilitate detection.
According to another aspect of the present invention there is provided an allele-specific oligonucleotide probe capable of detecting a VCAM-1 gene polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431. The allele-specific oligonucleotide probe is preferably 17- 50 nucleotides, more preferably about 17-35 nucleotides, more preferably about 17-30 nucleotides.
The design of such probes will be apparent to the molecular biologist of ordinary skill. Such probes are of any convenient length such as up to 50 bases, up to 40 bases, more conveniently up to 30 bases in length, such as for example 8-25 or 8-15 bases in length. In general such probes will comprise base sequences entirely complementary to the corresponding wild type or variant locus in the gene. However, if required one or more mismatches may be introduced, provided that the discriminatory power of the oligonucleotide probe is not unduly affected. The probes of the invention may carry one or more labels to facilitate detection.
According to another aspect of the present invention there is provided a diagnostic kit comprising an allele specific oligonucleotide probe of the invention and/or an allele-specific primer of the invention.
The diagnostic kits may comprise appropriate packaging and instructions for use in the methods of the invention. Such kits may further comprise appropriate buffer(s) and polymerase(s) such as thermostable polymerases, for example taq polymerase. In another aspect of the invention, the single nucleotide polymorphisms of this invention may be used as genetic markers in linkage studies. This particularly applies to the polymorphism at 278 (as defined by the position in EMBL ACCESSION NO. M92431) because of its relatively high frequency (see below). The VCAM-1 gene has been mapped to chromosome lp31-32 (Cybulsky et al Proc. Natl. Acad. Sci. USA 88, 7859-7863, 1991). Low frequency polymorphisms may be particularly useful for haplotyping as described below. A haplotype is a set of alleles found at linked polymorphic sites (such as within a gene) on a single (paternal or maternal) chromosome. If recombination within the gene is random, there may be as many as 2n haplotypes, where 2 is the number of alleles at each SNP and n is the number of SNPs. One approach to identifying mutations or polymorphisms which are correlated with clinical response is to carry out an association study using all the haplotypes that can be identified in the population of interest. The frequency of each haplotype is limited by the frequency of its rarest allele, so that SNPs with low frequency alleles are particularly useful as markers of low frequency haplotypes. As particular mutations or polymoφhisms associated with certain clinical features, such as adverse or abnormal events, are likely to be of low frequency within the population, low frequency SNPs may be particularly useful in identifying these mutations (for examples see: Linkage disequilibrium at the cystathionine beta synthase (CBS) locus and the association between genetic variation at the CBS locus and plasma levels of homocysteine. Ann Hum Genet (1998) 62:481-90, De Stefano V, Dekou V, Nicaud V, Chasse JF, London J, Stansbie D, Humphries SE, and Gudnason V; and Variation at the von willebrand factor (vWF) gene locus is associated with plasma vWF:Ag levels: identification of three novel single nucleotide polymorphisms in the vWF gene promoter. Blood (1999) 93:4277-83, Keightley AM, Lam YM, Brady JN, Cameron CL, Lillicrap D).
According to another aspect of the present invention there is provided a method of treating a human in need of treatment with a VCAM-1 ligand antagonist drug in which the method comprises: i) diagnosis of a single nucleotide polymorphism in VCAM-1 gene in the human, which diagnosis comprises determining the sequence of the nucleic acid at one or more of positions 278, 647, 707, 748, 829 and 1467 (as defined by the position in EMBL accession number M92431), and determining the status of the human by reference to polymorphism in the VCAM-1 gene; and ii) administering an effective amount of a VCAM-1 ligand antagonist . Preferably determination of the status of the human is clinically useful. Examples of clinical usefulness include deciding which antagonist drug or drugs to administer and/or in deciding on the effective amount of the drug or drugs.
VCAM-1 ligand antagonist drugs have been disclosed in the following publications: international patent application WO 97/49731, Zeneca Limited; international patent application WO 97/02289, Zeneca Limited; international patent application WO 96/20216, Zeneca Limited; US patent 5510332, Texas Biotechnology; international patent application WO 96/01644, Athena Neurosciences; international patent application WO 96/01644, Athena Neurosciences and; international patent application WO 96/00581, Zeneca Limited. A
VCAM-1 ligand antagonist drug may act directly at VCAM-1 and/or at a ligand, such as VLA-
4, which binds to VCAM-1.
According to another aspect of the present invention there is provided use of a VCAM- 1 ligand antagonist drug in preparation of a medicament for treating a VCAM-1 ligand mediated disease in a human diagnosed as having a single nucleotide polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 (as defined by the position in EMBL accession number M92431).
According to another aspect of the present invention there is provided a pharmaceutical pack comprising VCAM-1 ligand antagonist drug and instructions for administration of the drug to humans diagnostically tested for a single nucleotide polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 (as defined by the position in EMBL accession number M92431).
The invention will now be illustrated but not limited by reference to the following Examples. All temperatures are in degrees Celsius.
In the Examples below, unless otherwise stated, the following methodology and materials have been applied.
AMPLITAQ™ , available from Perkin-Elmer Cetus, is used as the source of thermostable DNA polymerase. General molecular biology procedures can be followed from any of the methods described in "Molecular Cloning - A Laboratory Manual" Second Edition, Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory, 1989).
Electropherograms were obtained in a standard manner: data was collected by ABI377 data collection software and the wave form generated by ABI Prism sequencing analysis (2.1.2).
Example 1
Identification of Polymorphisms
1. Methods
DNA Preparation DNA was prepared from frozen blood samples collected in EDTA following protocol I
(Molecular Cloning: A Laboratory Manual, p392, Sambrook, Fritsch and Maniatis, 2nd Edition,
Cold Spring Harbor Press, 1989) with the following modifications. The thawed blood was diluted in an equal volume of standard saline citrate instead of phosphate buffered saline to remove lysed red blood cells. Samples were extracted with phenol, then phenol/chloroform and then chloroform rather than with three phenol extractions. The DNA was dissolved in deionised water. Template Preparation
Templates were prepared by PCR using the oligonucleotide primers and annealing temperatures set out below. The extension temperature was 72° and denaturation temperature 94°, each step was 1 minute. All reactions contained 1 mM MgCl2. Generally 50 ng of genomic DNA was used in each reaction and subjected to 35 cycles of PCR.
Figure imgf000016_0001
For dye-primer sequencing the forward primers were modified to include Ml 3 forward sequence (ABI protocol P/N 402114, Applied Biosystems) at the 5' end of the oligonucleotide. DNA polymerase (Amplitaq Gold™ , Perkin Elmer Cetus) was used to generate products 595-1151 and 1264-1804. Dye Primer Sequencing
Dye-primer sequencing using Ml 3 forward and reverse primers was as described in the ABI protocol P/N 402114 for the ABI Prism™ dye primer cycle sequencing core kit with "AmpliTaq FS"™ DNA polymerase, modified in that the annealing temperature was 45° and DMSO was added to the cycle sequencing mix to a final concentration of 5 %. The extension reactions for each base were pooled, ethanol/sodium acetate precipitated, washed and resuspended in formamide loading buffer.
4.25 % Acrylamide gels were run on an automated sequencer (ABI 377, Applied Biosystems). 2. Results Novel Polymorphisms
Figure imgf000016_0002
Figure imgf000017_0001
1 As defined by the position in EMBL ACCESSION NO. M92431
2Iadermarco et al. J. Biol. Chem, 267, 16323-16329, 1992. 3TF = transcription factor
Allele frequency was determined in a European control population.
Example 2 Engineered restriction sites for detection of polymorphisms
Standard methodology can be used to detect the polymorphism at positions 647 (as defined by the position in EMBL ACCESSION NO. M92431) based on the materials set out below.
Figure imgf000017_0002
Reverse primer sequence CCCAGAGGTCCTTTACAGCGAT (SEQ ID NO:l). The product generated by these primers will include a Pvu I site, only if the diagnostic fragment contained a G allele at position 647.
Sequence Listing Free Text <223> Description of Artificial Sequence:PCR primer

Claims

1 A method for the diagnosis of a single nucleotide polymorphism in VCAM-1 in a human, which method comprises determining the sequence of the nucleic acid of the human at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431, and determining the status of the human by reference to polymorphism in the VCAM-1 gene.
2 A method for diagnosis according to claim 1 in which the single nucleotide polymorphisms are further defined as: the single nucleotide polymorphism at position 278 is presence of T and/or C; the single nucleotide polymorphism at position 647 is presence of A and/or G; the single nucleotide polymorphism at position 707 is presence of T and/or C; the single nucleotide polymorphism at position 748 is presence of T and/or C; the single nucleotide polymorphism at position 829 is presence of G and/or A; and the single nucleotide polymorphism at position 1467 is presence of T and/or C. 3 A method for diagnosis according to claim 1 or 2 in which the sequence is determined by a method selected from amplification refractory mutation system and restriction fragment length polymoφhism.
4 A nucleic acid comprising any one of the following polymorphisms: the nucleic acid of EMBL ACCESSION No. M92431 with C at position 278 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431 ; the nucleic acid of EMBL ACCESSION No. M92431 with G at position 647 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431 ; the nucleic acid of EMBL ACCESSION No. M92431 with C at position 707 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431 ; the nucleic acid of EMBL ACCESSION No. M92431 with C at position 748 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; the nucleic acid of EMBL ACCESSION No. M92431 with A at position 829 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431 ; the nucleic acid of EMBL ACCESSION No. M92431 with C at position 1467 in the promoter sequence as defined by the position in EMBL ACCESSION No. M92431; or a complementary strand thereof or a fragment thereof of at least 20 bases comprising at least one polymorphism. 5 A computer readable medium comprising at least one nucleic acid sequence as defined in claim 4 stored on the medium.
6 An allele specific primer capable of detecting a VCAM-1 gene polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431.
7 An allele-specific oligonucleotide probe capable of detecting a VCAM-1 gene polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 in the VCAM-1 gene as defined by the positions in EMBL ACCESSION NO. M92431.
8 Use of a VCAM-1 ligand antagonist drug in preparation of a medicament for treating a VCAM-1 ligand mediated disease in a human diagnosed as having a single nucleotide polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 as defined by the position in EMBL accession number M92431.
9 A method of treating a human in need of treatment with a VCAM-1 ligand antagonist drug in which the method comprises: i) diagnosis of a single nucleotide polymorphism in VCAM-1 gene in the human, which diagnosis comprises determining the sequence of the nucleic acid at one or more of positions 278, 647, 707, 748, 829 and 1467 as defined by the position in EMBL accession number M92431, and determining the status of the human by reference to polymoφhism in the VCAM-1 gene; and ii) administering an effective amount of a VCAM-1 ligand antagonist .
10 A pharmaceutical pack comprising VCAM-1 ligand antagonist drug and instructions for administration of the drug to humans diagnostically tested for a single nucleotide polymorphism at one or more of positions 278, 647, 707, 748, 829 and 1467 as defined by the position in EMBL accession number M92431. 11 Use of a nucleic acid sequence comprising at least one of the polymorphisms in the promoter at one or more of positions 278, 647, 707, 748, 829 and 1467 as defined by the position in EMBL accession number M92431 to identify compounds that modify expression of the VCAM-1 gene.
PCT/GB1999/003057 1998-09-19 1999-09-15 Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases WO2000017392A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP99946341A EP1114182A1 (en) 1998-09-19 1999-09-15 Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases
JP2000574291A JP2002526089A (en) 1998-09-19 1999-09-15 Polymorphisms in the VCAM-1 gene suitable for diagnosis and treatment of VCAM-1 ligand-mediated diseases
AU58755/99A AU5875599A (en) 1998-09-19 1999-09-15 Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB9820338.3 1998-09-19
GBGB9820338.3A GB9820338D0 (en) 1998-09-19 1998-09-19 Chemical compounds

Publications (1)

Publication Number Publication Date
WO2000017392A1 true WO2000017392A1 (en) 2000-03-30

Family

ID=10839071

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB1999/003057 WO2000017392A1 (en) 1998-09-19 1999-09-15 Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases

Country Status (5)

Country Link
EP (1) EP1114182A1 (en)
JP (1) JP2002526089A (en)
AU (1) AU5875599A (en)
GB (1) GB9820338D0 (en)
WO (1) WO2000017392A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8133859B2 (en) 2006-09-27 2012-03-13 The United States Of America As Represented By The Department Of Health And Human Services SCGB3A2 as a growth factor and anti-apoptotic agent
US10947311B2 (en) 2015-11-20 2021-03-16 The Board Of Trustees Of The Leland Stanford Junior University VCAM-1 mediated methods and compositions for treating aging-associated impairments

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992000751A1 (en) * 1990-07-06 1992-01-23 Novo Nordisk A/S A pharmaceutical composition comprising a cell adhesion molecule
WO1997040462A2 (en) * 1996-04-19 1997-10-30 Spectra Biomedical, Inc. Correlating polymorphic forms with multiple phenotypes
WO1997049731A1 (en) * 1996-06-21 1997-12-31 Zeneca Limited Cell adhesion inhibiting compounds

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992000751A1 (en) * 1990-07-06 1992-01-23 Novo Nordisk A/S A pharmaceutical composition comprising a cell adhesion molecule
WO1997040462A2 (en) * 1996-04-19 1997-10-30 Spectra Biomedical, Inc. Correlating polymorphic forms with multiple phenotypes
WO1997049731A1 (en) * 1996-06-21 1997-12-31 Zeneca Limited Cell adhesion inhibiting compounds

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
IADEMARCO M F ET AL.: "Characterization of the promotor for vascular cell adhesion molecule-1 (VCAM-1)", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, no. 23, 1992, pages 16323 - 16329, XP002128420 *
LIN K-C AND CASTRO A C: "Very late antigen 4 (VLA4) antagonists as anti-inflammatory agents", CURRENT OPINION IN CHEMICAL BIOLOGY, vol. 2, 1998, pages 453 - 457, XP000869619 *
NEWTON C R ET AL: "ANALYSIS OF ANY POINT MUTATION IN DNA. THE AMPLIFICATION REFRACTORY MUTATION SYSTEM (ARMS)", NUCLEIC ACIDS RESEARCH,GB,OXFORD UNIVERSITY PRESS, SURREY, vol. 17, no. 7, pages 2503-2516, XP000141596, ISSN: 0305-1048 *
WENZEL K ET AL.: "DNA polymorphisms in adhesion molecule genes - a new risk factor for early atherosclerosis", HUMAN GENETICS, vol. 97, 1996, pages 15 - 20, XP000867269 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8133859B2 (en) 2006-09-27 2012-03-13 The United States Of America As Represented By The Department Of Health And Human Services SCGB3A2 as a growth factor and anti-apoptotic agent
US8501688B2 (en) 2006-09-27 2013-08-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services SCGB3A2 as a growth factor and anti-apoptotic agent
US8828936B2 (en) 2006-09-27 2014-09-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Therapeutic use of SCGB3A2
US10947311B2 (en) 2015-11-20 2021-03-16 The Board Of Trustees Of The Leland Stanford Junior University VCAM-1 mediated methods and compositions for treating aging-associated impairments

Also Published As

Publication number Publication date
AU5875599A (en) 2000-04-10
GB9820338D0 (en) 1998-11-11
EP1114182A1 (en) 2001-07-11
JP2002526089A (en) 2002-08-20

Similar Documents

Publication Publication Date Title
JP2001514013A (en) Method for analyzing LTC4 synthase polymorphism and use for diagnosis
ES2252159T3 (en) POLYMORPHISMS IN THE HUMAN GENE OF THE ORGANIC ANION TRANSPORTER C (OATP-C).
EP1203827B1 (en) Polymorphisms in the human KDR gene
EP1130123A2 (en) Diagnostic method
EP1194595A1 (en) Polymorphisms in the human hmg-coa reductase gene
WO2000017394A1 (en) Polymorphisms in the human alpha4 integrin subunit gene, suitable for diagnosis and treatment of integrin ligand mediated diseases
JP2003530844A (en) Drug response assay in respiratory diseases
EP1114182A1 (en) Polymorphisms in the human vcam-1 gene, suitable for diagnosis and treatment of vcam-1 ligand mediated diseases
WO2000006769A2 (en) Human ccr-2 gene polymorphisms
US20030008301A1 (en) Association between schizophrenia and a two-marker haplotype near PILB gene
EP1100962A1 (en) Genetic polymorphisms in the human neurokinin 1 receptor gene and their uses in diagnosis and treatment of diseases
EP1114183A1 (en) Polymorphisms in the human beta1 integrin subunit gene, suitable for diagnosis and treatment of integrin ligand mediated diseases
EP1130122A2 (en) Methods for the diagnosis of polymorphisms in the human EP1-R gene
EP1118680A1 (en) Method for the diagnosis of polymorphisms in the human PDH E1alpha gene
US20020160362A1 (en) Diagnostic method
WO2000006767A1 (en) Genetic polymorphisms in the human neurokinin 2 receptor gene and their use in diagnosis and treatment of diseases
WO2005117859A2 (en) Methods of diagnosing cardiovascular disease
EP1141395A1 (en) Single nucleotide polymorphism in a pyruvate dehydrogenase kinase isoenzyme 2 (pdk2) in humans
US20030157484A1 (en) Chemical compounds
EP1135534A1 (en) Use of factor x polymorphism in the diagnosis and treatment of factor x and/or factor xa mediated diseases
EP1184465A2 (en) Method for diagnosing polymorphisms in human MCT-1 and drugs related to such polymorphisms
WO2006073183A1 (en) Method of judging inflammatory disease by using single nucleotdie polymorphism
US20050118579A1 (en) Chemical compounds

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1999946341

Country of ref document: EP

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 574291

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 09787371

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999946341

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 1999946341

Country of ref document: EP