WO2000001835A2

WO2000001835A2 - Targeted integration into chromosomes using retroviral vectors

Info

Publication number: WO2000001835A2
Application number: PCT/EP1999/004521
Authority: WO
Inventors: Walter GÜNZBURG; Brian Salmons; Sabine Goller; Dieter Klein
Original assignee: Austrian Nordic Biotherapeutics Ag
Priority date: 1998-07-01
Filing date: 1999-06-30
Publication date: 2000-01-13
Also published as: EP1092035B1; WO2000001835A3; US20010043921A1; US6656727B2; DE69930123T2; ATE318922T1; DE69930123D1; AU4903099A; JP2002519069A; EP1092035A2

Abstract

To achieve the foregoing and other objects, the present invention provides a retroviral vector comprising in its LTRs sequences, preferably sequences of an adeno-associated virus, for a targeted integration.

Description

TARGETED INTEGRATION INTO CHROMOSOMES USING RETROVIRAL VECTORS

Technical Field

The present invention relates to a retroviral vector encoding heterologous genes particularly for gene therapy of genetic defects or viral infections.

Background of the Invention

Retroviruses infect a wide variety of cells and are ideal tools for the delivery of genes to target cells. They are furthermore an ideal tool to stable integrate a heterologous sequence in the genome of a target cell, since the infecting retrovirus is able to integrate the DNA form of its RNA genome into the genome of the target cell. Thus, all daughter cells of a retroviral infected cell carry the retroviral vector DNA possibly comprising a heterologous gene.

A retroviral genome consists of a RNA molecule with the structure R-U5- gag-pol-env-U3-R. For the development of a retroviral vector (RV) said retroviral genome can be modified by replacing the genes gag-pol-env - encoding viral proteins - with one or more genes of interest such as marker genes or therapeutic genes. To generate a recombinant retroviral particle and a packaged RV, respectively, the principle of a retroviral vector system is used. This system consists of two components: the RV itself in which the genes encoding the viral proteins have been replaced, and a packaging cell which provides the modified RV with the missing viral proteins. This packaging cell has been transfected with one or more plasmids carrying the genes enabling the modified RV to be packaged, but lacks the ability to produce replication competent viruses. After introduction of the vector into the packaging cell line, the RV is transcribed into RNA. This RNA which represents the recombinant retroviral genome is packaged by the viral proteins produced by the packaging cell to form retroviral particles which bud from the packaging cell. These particles are further used to infect a target cell. In the target cell the RNA genome is released again from the particle, reverse transcribed and stably integrated into the cellular genome.

Therefore, RVs are currently the method of choice for a stable transfer of therapeutic genes into a target cell in a variety of approved protocols both in the USA and in Europe. However, most of the protocols ^"require that the infection of target cells with the RV carrying the therapeutic gene occurs in vitro. Subsequently, successful infected cells are returned to the affected individual. Advantageously, such ex vivo infection of target cells allows the administration of large quantities of concentrated virus which can be rigorously safety tested before use. Furthermore, the ex vivo gene therapy protocols are ideal for correction of medical conditions in which the target cell population can be easily isolated.

Unfortunately, only a fraction of the possible applications for gene therapy involve target cells that can be easily isolated, cultured and then reintroduced to a patient. Additionally, the complex technology and associated high costs of ex vivo gene therapy effectively preclude its disseminated use world-wide. Future facile and cost-effective gene therapy will require an in vivo approach in which the RV, or cells producing the RV, are directly administered to the patient in the form of an injection or simple implantation of RV producing cells. This kind of in vivo approach, of course, introduces a variety of new problems. First of all safety considerations have to be addressed. One serious safety risk is that virus will be produced, possibly from an implantation of virus producing cells. Thus, there will be no opportunity to precheck said produced virus. Another problem is that the proviral form of the retroviral genome integrates randomly in the genome of infected cells. This random integration can result in an integration directly into a cellular gene or into the vicinity of a cellular gene, leading to new genomic arrangements. As a result of this the function of the cellular gene can be altered or lost. In the case that the cellular gene is involved in the regulation of growth control, uncontrolled proliferation of the cell may result. Therefore, using RV in^* gene therapeutic applications there is a potential risk that simultaneously to the repair of one genetic defect with retroviral vectors, a second defect can be established resulting in uncontrolled proliferation, and thus, in tumor development.

Object of the Invention It is therefore an object of the invention to provide a safe retroviral vector which prevents random integration of the recombinant viral genome into genes or into the vicinity of genes of a target cell, thus, preventing genomic rearrangements of the target cell genome.

The Invention

The basic idea underlying the present invention is the provision of a retroviral vector which specifically integrates into a non-coding region of a target cell genome. Thus, to achieve the foregoing and other objects, the present invention provides a retroviral vector (RV) comprising one or more heterologous nucleic acid sequences as well as at least one sequence allowing site-specific integration of said heterologous sequence(s) into a non-coding region of a genome. Due to the sequence allowing site-specific integration the RV interacts with a genomic region which does not contain any coding or regulatory sequences. Accordingly, interaction and subsequent integration can be due to homologous recombination or to another, e.g. protein mediated, integration mechanism. Generally, the retroviral integration process is mediated by an integration-mediating enzyme, which is comprised in an infectious retroviral particle. The integration-mediating protein interacts with the sequence allowing site-specific integration encoded by the RV as well as with the site of integration within the non-coding region of the genomic sequence of the target cell. Thus, said target cell is infected by a retroviral particle comprising the RV and optionally an integration-mediating protein. Consequently, site- specific integration of the RV into a genomic non-coding region of a target cell occurs.

As a result of site-specific integration of the RV into a non-coding region the risk of new genomic arrangements, e.g. leading to disregulations of gene products or uncontrolled cellular proliferation, is avoided. Thus, the RV according to the present invention is highly adapted for future in vivo, but also in vitro transfer of heterologous nucleic acid sequences to target cells of mammals, including humans.

The term „heterologous" is used for any combination of DNA sequences that is not normally found intimately associated in nature. Accordingly, at least one of the heterologous nucleic acid sequences of RV as described above is a heterologous gene relevant for the treatment of a viral infection, a genetic, a metabolic, a proliferative or any other relevant disorder or disease. Therefore, heterologous genes which can be transferred to target cells by the RV according to the present invention are preferably, but not limited to one or more elements of the group consisting of marker genes, therapeutic genes, antiviral genes, anti tumor genes, cytokine genes and /or toxin genes. The marker and therapeutic genes are preferably selected from genes such as β- galactosidase gene, neomycin gene, Herpes Simplex Virus thymidine kinase gene, puromycin gene, cytosine deaminase gene, hygromycin gene, secreted alkaline phosphatase gene, guanine phosphoribosyl transferase (gpt) gene, alcohol dehydrogenase gene, hypoxanthine phosphoribosyl transferase (HPRT) gene, green fluorescent protein (gfp) gene, cytochrome P450 gene and/or toxin genes such as α subunit of diphtheria, pertussis toxin, tetanus toxoid.

To ensure that during the integration event the heterologous sequence(s) encoded by the RV integrates into a genomic non-coding region, said heterologous sequence(s) is flanked by one or more sequences allowing site- specific integration. Generally, it is possible to introduce the process of integration with a single copy of the sequence allowing site-specific integration, which in this case flanks only one end of the heterologous sequence to be integrated. However, in a preferred embodiment the sequences allowing site-specific integration flank - directly or at some distance - both sites of the heterologous sequences to be integrated. Thus, said sequences allowing site-specific integration are preferably inserted into the U3 region(s) and /or U5 region(s) of the retroviral LTR. Alternatively, said sequences allowing site-specific integration could be inserted joining the heterologous sequence to be integrated. In this case, only the heterologous sequence to be integrated without any further retroviral sequences will be site-specifically integrated. Therefore, in this case the RV serves only as a vehicle for the transport of the heterologous sequences to be integrated into the target cell. The RV according to the present invention is particularly useful for the site specific integration into a non-coding region of a mammalian, including a human chromosome, since it is known that more than 90% of the mammalian genome consist of non-coding regions. In a further embodiment of the present invention the RV integrates specifically in a non-coding region, which is located on human chromosome 19. Said specific non-coding DNA region on human chromosome 19 was first described as the target site for the integration of Adeno-associated virus (AAV). For an integration into said non-coding region on chromosome 19, in still a further embodiment of the present invention, the sequences allowing site-specific integration of the RV are the so called Inverted Terminal Repeats (ITRs) of the AA^*V.

When combining these features of phylogenetic different viruses it was found as particularly advantageous that the resulting RV according to the present invention, can still accommodate a capacity of about 8 kb of heterologous DNA sequences, which can be targeted to a non-coding region in the genome. In comparison, all existing AAV based vectors can accommodate a maximum of about 4,5 kb of heterologous DNA in the presence of all coding region required for targeted integration into chromosome 19 (Dong et al, 1996, "Quantitative analysis of the packaging capacity of recombinant adeno-associated virus", Hum Gene Ther Nov 10; 7(17): 2101-2112). Unfortunately, this is too little to be of practical use for most gene therapies.

In a further preferred embodiment of the present invention the AAV-Rep protein is used for the site-specific integration of the RV. It was surprisingly found that the AAV integration-mediating Rep Protein can be used for targeted integration of the RV into the same non coding region of the chromosome 19 which this protein normally uses for the AAV integration process. This was particularly unexpected, since a RV is based on a virus with RNA genome, while AAV belongs to the viruses with a DNA genome. According to these differences in genome structure also the regulation or integration mechanism is completely different. Whereas, the integration of the retroviral genome is normally dependent on the enzyme, integrase (IN), the site-specific integration of the AAV genome is mediated by the Rep protein. Since this protein is AAV-specific it was not expected that the integration of a foreign genome would be mediated by this protein. Additionally, it was not expected that a protein of a DNA virus - belonging to a completely different phylogenetic group when combined with a RNA virus - would mediate integration of a retroviral genome.

To provide a target cell with an integration-mediating protein, e.g. said AAV-Rep protein, one alternative is to directly incorporate the nucleic acid sequence encoding said protein in the RV. After infection of a target cell with the RV the integration-mediating protein, e.g. the AAV Rep protein, is directly synthesized in the target cell. Subsequently, the AAV Rep protein mediates site-specific integration of the RV.

Alternatively, the packaging cell provides the retroviral particle (RVP) with the integration-mediating protein, e.g. AAV Rep protein. In this case the integration-mediating protein is synthesized from the packaging cell and packaged into newly generated infectious retroviral particles (RVP). Subsequently, these particles were used to infect a target cell, and thereby, transferred said additional integration-mediating protein together with the

RV into the target cell.

It is known that the expression of an integration-mediating protein, particularly of the AAV Rep protein, induces at higher concentrations toxic effects in cells. Accordingly, in a further embodiment of the present invention the expression of the integration-mediating protein as well as of the AAV Rep protein is under the transcriptional control of an inducible and/or a very weak promoter. The inducible promoters and/or very weak promoters are selected preferably, but not limited, from one or more elements of the group consisting of promoters inducible by Tetracycline, promoters inducible by HIV Tat transactivator, promoters inducible by glucocorticoid hormones, such as the MMTV promoters or promoters inducible by X-ray.

For the generation of RVP in a further embodiment of 'the invention a retroviral vector system is provided, which comprises the RV as described above as a first component and a packaging cell providing the proteins required for the RV to be packaged. The packaging cell line is selected preferably, but not limited, from an element of the group consisting of psi-2, psi-Crypt, psi-AM, GP+E-86, PA317, GP+envAM-12, Fly A13, BOSC 23, BING, Fly RD 18, ProPak-X, -A.52 and -A.6, or of any of these supertransfected with recombinant constructs allowing expression of surface proteins from other enveloped viruses.

To ensure a high efficacy of site-specific integration of the RV the packaging cell according to a further embodiment of the present invention provides a Gag/Pol expression plasmid that does not encode a functional retroviral integrase (IN). Accordingly, the packaging cell is constructed in such a way that no functional retroviral IN which is encoded by the poZ-region can be synthesized. For this, the packaging cell is generated using a DNA construct encoding a retroviral po/-region which incorporates mutations and /or partially or complete deletions of the p>σ/-region. To introduce mutations or deletions in the po/-region leading to a non-functional IN preferably recombinant PCR technology is used.

The invention further provides retroviral particles comprising the RV of the invention as described above. These particles can be obtained by transfecting according to standard protocols the packaging cell as described above with RV as described above.

The invention includes also a retroviral provirus, mRNA of a retroviral provirus according to the invention, any RNA resulting from a retroviral vector according to the invention and cDNA thereof, as well as target cells infected with a retroviral particle according to the invention.

A further embodiment of the invention provides a method for introducing homologous and/or heterologous nucleotide sequences into target cells comprising infecting a target cell population in vivo and in vitro with recombinant retroviral particles as described above. Furthermore, the retroviral vector, the retroviral particle, the retroviral vector system and the retroviral provirus as well as RNA thereof is used in the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease.

The retroviral vector, the retroviral particle, the retroviral vector system and the retroviral provirus as well as RNA thereof is used for producing a pharmaceutical composition for in vivo and in vitro gene therapy in mammals including humans.

The invention further includes a method of treating a viral infection or a genetic, metabolic, proliferative or any other relevant disorder or disease comprising administering to a person in need thereof a therapeutically effective amount of the retroviral particle and /or the retroviral vector system and /or a pharmaceutical composition containing a therapeutically effective amount of the retroviral vector, vector system or particle.

Summary of the invention

The invention inter alia comprises the following, alone or in combination:

A retroviral vector comprising one or more heterologous nucleic acid sequence(s) as well as at least one sequence allowing site-specific integration of said heterologous sequence(s) into a non-coding region of a genome;

the retroviral vector as above, wherein the sequence(s) allowing site specific integration is inserted at the U3 region(s) and /or the U5 region(s) of the retroviral Long Terminal Repeat (LTR);

the retroviral vector as above, wherein the sequence allowing site specific integration is an Inverted Terminal Repeat (ITR) sequence of Adeno- associated virus (AAV);

the retroviral vector as any above, wherein the genome is a chromosome of a mammal, including human;

the retroviral vector as above, wherein the chromosome is chromosome 19;

the retroviral vector as any above, wherein at least one of the heterologous nucleic acid sequence(s) is a heterologous gene relevant for the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease;

the retroviral vector as any above, wherein at least one of the heterologous nucleic acid sequence(s) is a sequence encoding an integration-mediatirrg protein;

the retroviral vector as above, wherein the integration-mediating protein is the AAV Rep protein;

the retroviral vector as above, wherein the sequence encoding for the integration-mediating protein is under transcriptional control of an inducible promoter;

a retroviral vector system comprising the vector as any above as a first component, and a packaging cell harboring at least one DNA construct encoding for proteins required for said vector to be packaged;

the retroviral vector system as above, wherein the packaging cell synthesizes a mutated or a completely or partially deleted retroviral integrase (IN);

a retroviral particle comprising a retroviral vector as any above;

the retroviral particle as above obtainable by transfecting a packaging cell of a the retroviral vector system as above with the retroviral vector as above;

a retroviral provirus produced by infection of target cells with the retroviral particle as above; m RNA of a retroviral provirus as above;

RNA of the retroviral vector as any above;

cDNA of the RNA as above;

a host cell infected with the retroviral particle as above;

a method for introducing homologous and/or heterologous nucleotide sequences into target cells comprising infecting the target cells with retroviral particles as above;

the retroviral vector as any above and /or the retroviral particle as above and /or the retroviral vector system as above for the use in the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease;

use of the retroviral vector as any above and /or the retroviral particle as above and /or the retroviral vector system as above for producing a pharmaceutical composition for the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease;

a pharmaceutical composition containing a therapeutically effective amount of the retroviral vector as any above and /or the retroviral particle as above and /or the retroviral vector system as above;

a method of treating a viral infection or a genetic, metabolic, proliferative or any other relevant disorder or disease comprising administering to a subject in need thereof a therapeutically effective amount of the retroviral particle as above and /or the retroviral vector system as above.

Examples

The following examples will further illustrate the present invention. It will be well understood by any person skilled in the art that the provided examples in no way should be interpreted in a limiting manner and that the invention is only to be limited by the full scope of the appended claims.

Example 1 Targeted integration of a RV

1. Construction of a retroviral vector (RV) containing the inverted terminal repeat (ITR) motif of the AAV genome.

The RV vector pLESNUP was constructed by ligation of the fragment containing the ITR sequence obtained from plasmid pAVl (Laughlin et al, 1983, Cloning of infections adeno-associated vims genomes in bacterial plasmids. Gene 23: 65-73) and the backbone sequence of the RV vector pLESNMP

(identisch zu pLXSNPCEGPF aus Klein et. al. (1997) Gene Therapy 4: 1256- 1260).

For this, the plasmid, pLESNMP, was digested with the restriction enzymes SacII and Mlul eliminating the MMTV U3 region and yielding in a 7065 bp fragment. The digestion mixture was purified on a 0.8% agarose gel, the DNA band was excised and eluted using the Qiaquick protocol (Qiagen). After ethanol precipitation the DNA was resuspended in water.

The ITR sequence was isolated from the plasmid pAVl using the PCR method. Therefore, the left hand primer (SeqID No. 1) (5'- G ACTCC ACGCGTCC AGG AAC-3 ^') was specific to the beginning of the ITR also creating a new Mlul restriction site (underlined) and the right hand primer (SeqID No. 2) (5^'-GACCGCG_GATCATCGATAAG-3^') was specific to the end of the ^" ITR also creating a SacII restriction site (underlined). PCR resulted in a 198 bp fragment, which was digested with the restriction enzyme Mlul and SacII and subsequently, purified.

50 ng of the prepared pLESNMP backbone fragment and 300-400 ng of the Mlul /SacII digested PCR fragment were mixed together. For ligation the temperature was increased for 1°C per hour from 10°C to 22°C using the NEB ligase (New England Biolabs). The ligase was inactivated at 65°C for 10 min and DNA transfected into chemically competent TOP10 bacteria (Invitrogen). Ampicillin resistent colonies were selected, DNA prepared and test digested with the restriction enzyme Hindlll. The final correct plasmid was designated pLESNlIP.

2. Construction of two RV containing two ITR motifs of the AAV genome.

The RV pLESN2IPl and pLESN2IP6, which differ only in the location of a restriction site, were constructed by ligation of the fragment containing the ITR obtained from plasmid pAVl and the ProCon vector pLESNlIP backbone of item 1.

The pLESNlIP backbone was digested with the restriction enzyme Agel linearizing the vector. The digested DNA was dephosphorylated with alkaline phosphatase (Boehringer). After phenol and chloroform extraction the DNA was ethanol precipitated and resuspended in water.

The ITR motif was isolated from the plasmid pAVl using the PCR method as described under item 1, but with a different primer combination. In this case the left hand primer (SeqID No.: 3) (5^'- TCACGACTCCACCGGTCCAGGAAC-3^') was specific to the beginning of the ITR also creating a new Agel restriction site (underlined) and the right hand primer (SeqID No.: 4) (5 ^'-GTTTG ACCG GTTATCATCG ATAAG-3 ') was specific to the end of the ITR also creating a new Agel restriction site (underlined). PCR resulted in a 206 bp fragment, which was digested with the restriction enzyme Agel and purified. 50 ng of the linearized pLESNlIP backbone and 300-400 ng of the Agel digested PCR fragment were mixed together, ligated and transfected to bacteria as described under item 1. Ampicillin resistant colonies were selected, DNA prepared and test digested with the restriction enzymes EcoRI and Hindlll. The final correct RV were designated pLESN2IPl and pLESN2IP6.

3. Production of retroviral particles (RVP) using the RV pLESNlIP, _PLESN2IP1 or pLESN2IP6.

For the transfection of the packaging cell lines 5xl0⁵ cells (e.g. PA317) were seeded into 6-well dishes with a diameter of 35 mm. At the day of transfection 10 μg of pLESNlIP, pLESN2IPl or pLESN2IP6 were transfected using the calcium-phosphate protocol Cellfect Kit (Pharmacia) according to the manufacturers instructions.

18 h post transfection the medium was changed. After another 24 h the medium containing RVPs was removed and used for infection of target cells. Additionally, new medium containing G418-Geneticin was added to transfected packaging cells to select for stably transfected cells.

4. Infection of target cells with RVPs containing RV with one or two ITR motifs for targeted integration into chromosomes

For the infection of target cells (e.g. HeLa; NIH3T3) 2xl0⁶ cells in 10 ml medium were seeded in culture dishes with a diameter of 10 cm. At the day of infection, 2 ml of sterile filtered supernatant containing vector virus and 2 μl Polybrene (final concentration 8 μg/ml) were added to the cells. After 6h fresh culture medium was added to the cells. 24 h post infection new medium containing G418-Geneticin was added to select for stably infected cells. To test for targeted integration into a non-coding region on a chromosome the cellular genomic DNA was isolated and analyzed in a Southern blot. Several clones have been identified that showed homogenous integration pattern. To further identify the integration locus a FISH- Chromosome assay was performed on said clones.

Example 2

Targeted Integration of a RV using the AAV Rep protein

1. Production of RVP containing RV with one or two ITR motifs of AAV in a packaging cell line synthesizing the AAV Rep protein encoded on the plasmid pSVoriAAV (Chiorini et al, 1995, Human Gene Therapy 6: 1531 -

1541).

For lipofection of packaging cell lines 2xl0⁵ cells (e.g. PA317) were seeded into 6-well dishes with a diameter of 35 mm. At the day of transfection 2 μg of the RV as in example 1 and 0,1 - 0,2 μg of pSVoriAAV encoding the rep gene were cotransfected using the Lipofectin protocol

(Gibco) according to the manufacturers instructions.

5 h post transfection the medium was changed and 48 h post transfection the medium containing RVPs was removed and used for infection of target cells. Additionally, new medium containing G418-

Geneticin was added to the transfected cells to select for stably transfected cells.

Alternatively, the packaging cell line is transfected using the calcium- phosphate protocol (Cellfect Kit, Pharmacia) according to the manufactures instruction. In this case 10 μg of the RV as in example 1 and 0,5 - 1 μg of pSVoriAAV encoding the rep gene were cotransfected.

2. Infection of target cells with RVP as described in example 1 item 4. For infection the target cells (e.g. HeLa; NIH3T3) were infected and selected according the protocol described in example 2 item 2 with RVP containing the RV and AAV Rep protein. To test for targeted integration into the non-coding region on chromosomes after selection the cellular genome DNA was isolated, screened in a Southern blot and analyzed in a FISH- Chromosome assay.

Example 3 Construction of a Integrase deficient packaging cell line

1. Inactivation of the MLV integrase by single base pair mutation of the pol- region

The expression plasmid pGagPol.gpt (Markowitz et al. (1988) Virology

167 (2): 400-406) containing the MLV integrase gene was used for site- directed mutation. Using a polymerase chain reaction (PCR) method a site- directed mutation at amino acid 184 which is within the catalytic site of this enzyme was introduced. For this, recombinant primers were used which exchange one nucleotide (underlined) thereby replacing the aspartic acid within the catalytic site with an asparagine.

For this, in a first PCR the primer (SeqID No.: 5), (5'-ACA AGT CAA CGC CAG CAA GT-3^') and the primer (SeqID No.: 6) (5'-CCC ATT GTT AGT TCC CAA TAC CTG AG-3') comprising the nucleotide exchange from C to T (underlined) complementary to the sense DNA strain were used.

In the second PCR the primer (SeqID No.: 7) (5'-TGG GAA CTA ACA ATG GGC CTG CCT-3^') comprising the nucleotide exchange from G to A (underlined) and the primer (SeqID No.: 8) (5'-CGT TGA ACG CGC CAT GTC ACS^') complementary to the anti-sense DNA strain were used. The resulting PCR fragments from both reactions were purified and subsequently used as template in a third PCR. After three initial cycles at 45°C the temperature was increased to 55° C and the primers (SeqID No.: 5) and (SeqID No.: 8) added. After 32 cycles the PCR fragment was purified, digested with the restriction enzymes Ndel and SacII arising a 450 bp fragment and again purified.

The plasmid pGagPol.gpt containing two Ndel restriction sites (one within and one outside the integrase gene) and one SacII restriction site (within the integrase gene) was digested with the restriction enzymes Ndel and SacII resulting in a 9467 bp Ndel /SacII vector backbone, a 2948 bp

Ndel/Ndel and a 450 bp Ndel/SacII DNA fragment. The backbone fragment was isolated and purified.

20 ng of the pGagPol.gpt backbone and 20 ng of the mutated Ndel/SacII PCR fragment, respectively, were mixed together and ligated for 12 h at 4°C using T4-ligase (Boehringer). The ligase was inactivated at 65°C for 20 min and the DNA butanol precipitated with a 10 fold volume of butanol. The precipitated DNA was resuspended in water and electroporated into DH10B bacteria (Gibco). Ampicillin resistant colonies were selected, DNA prepared and test digested with the restriction enzymes Xhol and Ndel. Additional verification was obtained by sequencing resulting plasmids. The intermediate correct plasmid was designated pINl-264new.

In the intermediate plasmid pINl-264new one Ndel restriction site was lost. In order to recover the missing 2948 bp Ndel /Ndel fragment, pINl- 264new was digested with the restriction enzymes Xhol and Ndel resulting in a 3842 bp and a 6075 bp fragment (digest 1). The expression vector pGagPol.gpt was also digested with the restriction enzymes Xhol and Ndel resulting in a 2948 bp, a 3842 bp and a 6075 bp fragment (digest 2). All DNA fragments were purified. Subsequently, 40 ng of the 3842 bp Ndel /Xhol fragment of digest 1 and 30 ng of the 2948 bp Ndel /Ndel and 37.5 ng of the 6075 bp Ndel/Xhol fragments of digest 2 were mixed together and ligated at a temperature from 6°C to 16°C increasing one degree per hour using T4 ligase (Boehringer). The ligase was inactivated at 65°C for 20 min and the DNA butanol precipitated with a 10 fold volume of butanol. The precipitated DNA was resuspended in water and electroporated into DH10B bacteria

(Gibco). Ampicillin resistant colonies were selected, DNA prepared and test digested with the restriction enzymes Xhol, Ndel and Hindlll and sequenced. The final correct plasmid was designated pIND184N.

2. Inactivation of the MLV integrase by single base pair mutation, introduction of a frame shift mutation and an artificial stop codon in the pol- region

As described above the expression plasmid pGagPol.gpt is used in a different PCR set up. Thus, in the first PCR the primer (SeqID No.: 5) and the primer (SeqID No.: 9) (5^'-GGC CCA TTG TTA GTT CCC AAT ACC TGA G-3') comprising the nucleotide exchange from C to T (underlined) complementary to the sense DNA strain were used. For the second PCR the primer (SeqID No.: 10) (5^'-TGG GAA CTA_ACA ATG GGC CCT GC-3^') comprising the nucleotide exchange from G to A (underlined) and an additional C (bold) as well as the primer (SeqID No.: 8) complementary to the anti-sense DNA strain were used. The nucleotide exchange introduced with this primers replaces the aspartic acid within the catalytic site with an asparagine. Further the additional C was inserted to introduce a frame shift mutation. The PCR fragments were purified and used as templates in a third PCR which was performed as described under item 1 of example 3.

The resulting fragment was digested with the restriction enzymes Ndel and SacII arising a 451 bp fragment, which was purified. Subsequently, 5 ng of the mutated Ndel /SacII PCR fragment were ligated using T4-ligase (Boehringer) to 20 ng of the pGagPol.gpt backbone as prepared under item 1 of example 3. After 18 h at 12°C the ligase was inactivated at 65°C for 20 min, the DNA butanol precipitated with a 10 fold volume of butanol and the precipitated DNA electroporated into DH10B bacteria (Gibco). Ampicillin resistant colonies were selected, DNA prepared and test digested with the restriction enzymes Xhol and Ndel and sequenced. The intermediate plasmid was designated pINl-264M.

In order to recover the missing 2948 bp Ndel /Ndel fragment in the plasmid, pINl-264M, it was digested with the restriction enzymes Xhol and Ndel resulting in a 3843 bp and a 6075 bp fragment (digest 3). The expression vector pGagPol.gpt was digested with the restriction enzymes Xhol and partially digested with Ndel resulting in a 9023 bp and a 3842 bp fragment (digest 4). The fragments from both digests were purified as described above. 20 ng of the 3843 bp Ndel/Xhol fragment of digest 3 and 26 ng of the 9023 bp Ndel/Xhol backbone of digest 4 were ligated for 18 h at 12°C using T4 ligase

(Boehringer). After purification and electroporation - as described above - ampicillin resistant colonies were selected and test digested with the restriction enzyme PmaCI. Sequence analysis confirmed successful site- directed mutation of the amino acid 184 and a correctly introduced additional C at bp 6465 leading to a frame shift from AA 187 to AA 203 followed by an artificial stop codon. The final correct plasmid was designated pINl-203M15.

3. Inactivation of the MLV integrase by deletion mutagenesis of the polregion

The expression plasmid pGagPol.gpt was used for deletion mutagenesis at the C-terminus beyond the catalytic site of the integrase. Therefore, the nine different PCR primers (Table 1, SeqID No.: 11 - 19) which were specific to the integrase region within the pol gene were used in several PCR combined with the primer (SeqID No.: 20), (5^'-GTCAGCAACCAGGTGTGGAA-3') which is specific to the pol gene within the integrase region downstream the naturally occurring Sfil restriction site. Said primer introduce a new Sfil site (underlined) to the amplification product.

The different length of the resulting PCR amplification products using the nine different forward primers is also indicated in Table 1.

Table 1:

Primer Sequence PCR product primer 263 ATATAGGCCCCCATGGCCTCCCCTAATCCCCTTAATTCT 2246 bp

SeqID No.: 11 primer 277 ATATAGGCCCCCATGGCCTCCGCTCTCAAAACCCCTTAAA 2288 bp

SeqID No.: 12 primer 289 ATATAGGCCCCCATGGCCTCGGTGGACCATCCTCTAGAC 2324 bp

SeqID No.: 13 primer 306 ATATAGGCCCCCATGGCCTCGGCATCGCAGCTTGGATAC 2375 bp

SeqID No.: 14 primer 360 ATATAGGCCCCCATGGCCTCGCAGCCTACCAAGAACA 2533 bp

SeqID No.: 15 primer 364 ATATAGGCCCCCATGGCCTCTGGAGACCTCTGGCGGCA 2551 bp

SeqID No.: 16 primer 371 ATATAGGCCCCCATGGCCTCTTAGTCCAGCACGAAGTC 2568 bp

SeqID No.: 17 primer 381 ATATAGGCCCCCATGGCCTCTCTCTCCAAGCTCACTTA 2598 bp

SeqID No.: 18 primer 392 ATATAGGCCCCCATGGCCTCGACCCTGACATGACAAG 2630 bp SeqID No.: 19

The purified amplification products were digested with the restriction enzyme Sfil and purified again.

Accordingly, the cloning vector pGagPol.gpt was digested with the restriction enzyme Sfil resulting in a 10408 bp and a 2457 bp fragment. The purified 10408 bp backbone fragment was ligated to the different Sfil PCR generated fragments.

The following amount of the pGagPol.gpt backbone and Sfil PCR generated fragment was mixed for a Ligation reaction:

PCR fragment size pGagPol.gpt backbone Sfil fragment

2246 bp: 3 ng 5 ng

2288 bp: 3 ng 7.5 ⁿg

2324 bp: 3 ng 5 ⁿg

2375 bp: 4 g 10 ⁿg

2533 bp: 10 ng 60 ⁿ

2551 bp: 50 ng 25 ⁿ

2568 bp: 10 ng 30 ng

2598 bp: 10 ng 15 ng

2630 bp: 10 ng 45 ng

Ligation was carried out for 14 h at 12°C using T4-ligase (Boehringer). After inactivation, precipitation and electroporation as described above ampicillin resistant colonies were selected, test digested with the restriction enzyme Ndel and sequenced. The final plasmids representing different deletion mutations in the MLV integrase gene were designated: pIN263, pIN277, pIN289, pIN306, pIN360, pIN364, pIN371, pIN381 and pIN392.

4a. MoMLVenu expression vector for the construction of a MoMLVenz? expressing packaging cell

The expression vector pSV-Menv was constructed by ligation of the fragment containing the MoMLV env gene obtained from plasmid pGR102 (Salmons et al., (1985) Virol 144: 101-114) and the pSV2neo (Southern and Berg, 1982) backbone, respectively.

Therefore, the vector pSV2neo was digested witn the restriction enzymes Hindlll and BssHII. The 4831 bp backbone fragment was purified. Additionally, the MoMLV env gene was isolated from the plasmid pGR102 using the PCR method. Thus, the primer Menvf (SeqID No.: 21) (5'- GCGAAGCJTTCCACAGGATGCCGAATCACC-3^') specific to the beginning of the env gene also creating a new Hindlll restriction site (underlined), and the primer Menvr (SeqID No.: 22) (5^'-ATAGCGCGCCCAAGTTTGCAGCAGAGAATG-3') specific to the end of the env gene also introducing a new BssHII restriction site (underlined), were used. The amplification product resulted in a 2186 bp fragment, which was digested with the restriction enzymes Hindlll /BssHII and purified again.

Subsequently, 10 ng of the pSV2neo backbone and 10 ng of the Hindlll /BssHII fragment were ligated for 12 hours at 16°C using T4-Ligase (BRL). After ligation, electroporation, as described above, ampicillin resistant colonies were tested. The correct plasmids were designated pSV-Menv.

4b. Further MoMLVefrø expression vector. The expression vector pMOVenv was constructed by ligation of fragments containing the MoM Venv gene obtained from plasmid pMOVL (Mann et al. (1983) Cell 33: 153-159) and the backbone of pSV-Menv, as described under item 4a of example 3. For this, the vectors pMOVl" and pSV-Menv were digested with the restriction enzymes Hindlll and BssHII yielding in a 3318 bp and a 14535 bp and a 4831 bp and a 2186 bp fragment, respectively. The 3318 bp and 4831 bp fragments were purified.

Subsequently, 50 ng of the 3318 bp Hindlll /BssHII fragment of pMOVL containing the MoLVeπu gene were mixed together with 60 ng of the 4831 bp pSV-Menv backbone and ligated for 12 hours at 16°C using T4-Ligase (BRL). After ligation, electroporation, as described above, ampicillin resistant colonies tested with the restriction enzymes BamHI, Clal, Xbal, BssHII and Hindlll. The correct plasmids were designated pMOVenv.

5a. Construction of stable semi-packaging cell lines carrying the MLV gag- pol coding region including a mutated or partially deleted integrase gene.

For stable transfection of cell lines 5xl0⁵ cells (e.g. COS 7, HT 10080,

293T, 293) were seeded into dishes with a diameter of 100 mm. On the day of transfection lOμg of pGAGPOL.gpt, pIND184N, pINl-203M15, pIN263, pIN277, pIN289, pIN306, pIN360, pIN364, pIN371, pIN381 or pIN392 were transfected using the calcium-phosphate protocol Cellfect Kit (Pharmacia) according to the manufacturers instructions. 14 h post transfection medium was changed and 24 h post transfection cells were trypsinized and transferred into a 225 cm² flask and medium containing 15 μg/ml hypoxanthin, 250 μg/ml xanthin, 25 mg/ml mycophenolic acid was added to select for stably transfected cells. The stable semi-packaging cell lines were designated 29GAG, 29184, 29203, 29263, 29 277, 29289, 29306, 29360, 29364, 29371, 29381 and 29392 in the case of the 293. The names for the other cell were given analogous for 293T (2TGAG - 2T392), COS7 (COGAG - C0392) and HT 1080 (HTGAG - HT392).

5b. Construction of stable viral vector producing cell lines carrying the MLV gag-po I coding region including a mutated or partially deleted integrase gene, the MoMLVeitυ region and a MoMLV based viral vector.

For stable transfection of cell lines 5xl0⁵ cells (e.g. 29GAG, 29184,

29203, 29263, 29 277, 29289, 29306, 29360, 29364, 29371, 29381 and 2939) were seeded into dishes with a diameter of 100 mm. On the day of transfection lOμg of pLXSNEGFP (Klein et. al. (1997) Gene Therapy 4: 1256-1260) and lOμg of pALF (Cosset et. al. (1995) J. Virol. 69: 7430-7436) were transfected using the calcium-phosphate protocol Cellfect Kit (Pharmacia) according to the manufacturers instructions. 14 h post transfection medium was changed and 24 h post transfection cells were trypsinized and transferred into a 225 cm² flask and medium containing 50 μg/ml phleomycin was added to select for stably transfected cells. After this initial selection for two weeks the medium was changed into medium containing 400 μg/ml G418 for an additional two weeks of selection. The populations were named 29GAGVPC, 29184VPC, 29203VPC, 29263VPC, 29 277VPC, 29289VPC, 29306VPC, 29360VPC, 29364VPC, 29371 VPC, 29381VPC and 29392VPC.

5c. Construction of transiently viral vector producing cell lines carrying the

MLV gag-pol coding region including a mutated or partially deleted integrase gene, the VSV G protein gene and a MLV based viral vector. For stable transfection of cell lines 5xl0⁵ cells (e.g. 29GAG, 29184, 29203, 29263, 29277, 29289, 29306, 29360, 29364, 29371, 29381 and 2939) were seeded into dishes with a diameter of 100 mm. On the day of transfection lOμg of pLXSNEGFP (Klein et. al. (1997) Gene Therapy 4: 1256-1260) and lOμg of pHCMV-G (Burns et. al. (1993) Proc. Natl. Acad. Sci USA 90: 8033.- 8037) were transfected using the calcium-phosphate protocol Cellfect Kit (Pharmacia) according to the manufacturers instructions. 14 h post transfection medium was changed and 24 h post transfection supernatant from cells were collected.

Claims

C L A I M S

(1) A retroviral vector comprising one or more heterologous nucleic acid sequence(s) as well as at least one sequence allowing site-specific integration of said heterologous sequence(s) into a non- coding region of a genome.

(2) The retroviral vector according to claims 1, wherein the sequence(s) allowing site specific integration is inserted at the U3 region(s) and /or the U5 region(s) of the retroviral Long Terminal Repeat (LTR).

(3) The retroviral vector according to claim 1 or 2, wherein the sequence allowing site specific integration is an Inverted Terminal Repeat (ITR) sequence of Adeno-associated virus (AAV).

(4) The retroviral vector according to anyone of the preceding claims 1 to 3, wherein the genome is a chromosome of a mammal, including human.

(5) The retroviral vector according to claim 4, wherein the chromosome is chromosome 19.

(6) The retroviral vector according to anyone of the preceding claims 1 to 5, wherein at least one of the heterologous nucleic acid sequence(s) is a heterologous gene relevant for the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease.

(7) The retroviral vector according to anyone of the preceding claims 1 to 6, wherein at least one of the heterologous nucleic acid sequence(s) is a sequence encoding an integration-mediating protein^'

(8) The retroviral vector according to claim 7, wherein the integration-mediating protein is the AAV Rep protein.

(9) The retroviral vector according to claim 7 or 8, wherein the sequence encoding for the integration-mediating protein is under transcriptional control of an inducible promoter.

(10) A retroviral vector system comprising the vector according to any of the preceding claims 1 to 9 as a first component, and a packaging cell harboring at least one DNA construct encoding for proteins required for said vector to be packaged.

(11) A retroviral vector system according to claim 10, wherein the packaging cell synthesizes a mutated or a completely or partially deleted retroviral integrase (IN).

(12) A retroviral particle comprising a retroviral vector according to anyone of claims 1 to 9.

(13) The retroviral particle according to claim 12 obtainable by transfecting a packaging cell of a the retroviral vector system according of the preceding claims 10 or 11 with the retroviral vector according to anyone of the preceding claims 1 to 9.

(14) A retroviral provirus produced by infection of target cells with the retroviral particle according to claim 12 or 13.

(15) m RNA of a retroviral provirus according to claim 14.

(16) RNA of the retroviral vector according to anyone of the preceding claims 1 to 9.

(17) cDNA of the RNA according to claim 16.

(18) A host cell infected with the retroviral particle according to claim 12 or 13.

(19) A method for introducing homologous and /or heterologous nucleotide sequences into target cells comprising infecting the target cells with retroviral particles according to claims 12 or 13.

(20) The retroviral vector according to anyone of the claims 1 to 9 and/or the retroviral particle according to claims 12 or 13 and/or the retroviral vector system according to claims 10 or 11 for the use in the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease.

(21) Use of the retroviral vector according to anyone of the claims 1 to 9 and /or the retroviral particle according to claims 12 or 13 and/or the retroviral vector system according to claims 10 or 11 for producing a pharmaceutical composition for the treatment of a viral infection or the treatment of a genetic, metabolic, proliferative or any other relevant disorder or disease.

(22) A pharmaceutical composition containing a therapeutically effective amount of the retroviral vector according to anyone of the claims 1 to 9 and /or the retroviral particle according to claim 12 or 13 and/or the retroviral vector system according to claims 10 or 11.

(23) A method of treating a viral infection or a genetic, metabolic, proliferative or any other relevant disorder or disease comprising administering to a subject in need thereof a therapeutically effective amount of the retroviral particle according to claim 12 or 13 and /or the retroviral vector system according to claims 10 or 11.