WO1999045121A1 - EPITOPE PEPTIDES IMMUNOGENIC AGAINST $i(STREPTOCOCCUS PNEUMONIAE) - Google Patents

Abstract

The invention provides a nucleic acid encoding the 37-kDa pneumococcal surface adhesion A protein (PsaA) from Streptococcus pneumoniae. Also provided are isolated nucleic acids comprising a unique fragment of at least 10 nucleotides of the 37-kDa protein. The invention also provides purified polypeptides encoded by the nucleic acid encoding the 37-kDa protein from and the nucleic acids comprising a unique fragment of at least 10 nucleotides of the 37-kDa protein. The invention further provides monoclonal antibodies which selectively bind PsaA. In addition peptides are provide that immunospecifically bind to the monoclonal antibodies of the invention, and that are immunogenic against Streptococcus pneumoniae infection. Also provided are vaccines comprising such immunogenic polypeptides, and methods of conferring protective immunity against Streptococcus pneumoniae infection by administering therapeutic compositions comprising the immunogenic peptides of the invention. Also provided are methods of detecting the presence of Streptococcus pneumoniae in a sample using antibodies or antigens, and methods of preventing and treating Streptococcus pneumoniae infection in a subject. In addition a method of identifying the sequence of a peptide potentially capable of eliciting protective immunity against a pathogenic microorganism is provided.

Description

EPITOPE PEPTIDES IMMUNOGENIC AGAINST STREPTOCOCCUS PNEUMONIAE

FIELD OF THE INVENTION

This invention relates to preventing infection by Streptococcus pneumoniae 5 More specifically, the invention relates to peptides derived from a peptide brar ' that are related to the S pneumoniae pneumococcal surface adhesion A protein (Psa ) and that are immunogenic in a subject The invention also relates to pharmaceutical and therapeutic compositions containing these peptide fragments and methods of conferring protection against infection b> S pneumoniae

if BACKGROUND OF THE INVENTION

Pneumococcal disease continues to be a leading cause of sickness and death in the bnited States and throughout the world The currenth used poK sacchaπde vaccines have limited efficacv in children under 2 years of age and exhibit variable serotype-specific efficacy among vaccinated individuals For these

15 reasons alternative vaccine formulations have been investigated that do not require the use of multiple capsular polvsacchaπdes One current approach under consideration is the use of immunogenic species-common proteins as vaccine candidates These protein^ could be used in combination with other immunogenic proteins or as protein carriers in a protein, polysacchaπde. or oligosacchaπde

2d conjugate vaccine An effective vaccine that includes a common protein could eliminate the need for formulations based on multiple capsular polysacchaπdes (as in the current 23-valent polysacchaπde vaccine) by offering a broader range of protection against a greater number of serotypes Additionally, a protein-based vaccine v»ould be T-cell dependent and provide a memory response, thereb>

25 resulting in a more efficacious vaccine

An immunogenic species-common protein has been identified from Streptococcus pneumoniae (Russell el al 1990. "Monoclonal antibody recognizing a species-specific protein from Streptococcus pneumoniae " J Chn Microbiol 28 21 ^Q 1 -2195. and U S Patent No 5.422,427) A 37-kDa S pneumoniae protein has πι been the focus of several studies and is now designated pneumococcal surface adhesin protein A (PsaA ) (This 37-kDa protein was referred to as pneumococcal fimbπal protein A in U S Patent No 5,422.427. the terms are used interchangeabK in the present specification ) Immunoblot analysis studies using anti-PsaA monoclonal antibody showed that PsaA is common to all 23 pneumococcal vaccine serotypes (Russell et al 1990) Enzyme-linked-immunosorbent assay studies have indicated that patients with pneumococcal disease show an antibody increase in 5 convalescent-phase serum to PsaA compared with acute-phase serum antibody levels (Thaiγe et al 1995. "Purification and seroreactivity of pneumococcal surface adhesin A (PsaA)," Clin Diagn Lab Immunol 3 227-229, and Tharpe et al 1994. "The utility of a recombinant protein in an enzyme immunoassay for antibodies against Streptococcus pneumoniae." Abstr V-2, p 617 1994 American Society for

10 Microbiology, Washington, D C ) Additionally, a limited in vivo protection study showed that antibodies to the 37-kDa protein protect mice from lethal challenge (Talkwgton et al 1996. "Protection of mice against fatal pneumococcal challenge by immunization with pneumococcal surface adhesin A (PsaA)," Microbial Pathogenesis 21 1 7-22) The gene encoding PsaA from S pneumoniae strain R36A

15 (an un encapsulated strain) has been cloned in Eschenchia coh and sequenced. but this strain does not contain a 37-kDa protein encoding nucleic acid that is highly conserved among the various serotypes (Sampson et al 1994, "Cloning and nucleotide sequence analysis of psaA the Streptococcus pneumoniae gene encoding a 37-kιlodalton protein homologous to previously reported Streptococcus sp

2ι adhesins." Infect Immun 62 319-324) This particular nucleic acid and the corresponding polypeptide therefore, are of limited value for use as diagnostic reagents, in preventing infection, in treating infection, or in vaccine development In United States Patent Application Serial No 08/715, 13 1 , filed Sept 1 7, 199b which is a continuation-in-part of United States Patent Application Serial No

25 08 '222,1 79, filed April 4, 1994, which is a continuation-in-part of United States

Patent Application Serial No 07/791 ,377, filed September 17, 1991 (now U S Patent No 5.422.427). all of which are hereby incorporated by reference in their entirety , an isolated nucleic acid encoding the 37-kDa protein of Streptococcus pneumoniae unique fragments of at least 10 nucleotides of this nucleic acid which

^⁽' can be used in methods to detect the presence of Streptococcus pneumoniae in a sample and as immunogenic \ accines have been disclosed Furthermore, a purified polypeptide encoded by this nucleic acid, encoding the 37-kDa protein of Streptococcus pneumoniae, which can be used in immunogenic vaccines, has been disclosed Additionally , purified antibodies which bind to the 37-kDa protein of Streptococcus pneumoniae or fragments thereof, which can be used in methods to detect the presence of Streptococcus pneumoniae, and in therapeutic and prophylactic methods, have been disclosed Sequence conservation is a necessary requirement for a candidate species-common vaccine The sequence conservation

5 of the psaA gene among pneumococcal types, and specifically among encapsulated pneumococci which cause the vast majority of cases of serious disease, remains under investigation There exists a need to identify characteristic epitopes related to S pneumoniae PsaA in order to provide polypeptides which can serve as a vaccine for multiple strains of Streptococcus pneumoniae The present invention id addresses this need by determining effective epitopic peptides related to S pneumoniae PsaA, and employing those peptides in therapeutic compositions directed against Streptococcus pneumoniae infection

SUMMARY OF THE INVENTION

The present invention describes novel immunogenic peptides obtained from a random library by selecting for high affinity binding to monoclonal antibodies specific for PsaA epitopes In addition, the peptides of the invention have the capability of serving as immunogens in a subject, thereby effectively eliciting the production of antibodies by the subject and additionally conferring protective immunity against infection by S pneumoniae on the subject The invention also

2ιi relates to a selection method employ ed to obtain such peptides

The invention furthermore provides a therapeutic composition in which the immunogenic peptides are combined with an immunostimulatory carrier to be administered to a subject in order to elicit an immune response which confers protective immunity against infection by S pneumoniae on the subject

25 The invention additionally provides a therapeutic composition in which the immunogenic peptides are combined with an adjuvant to be administered to a subject in order to elicit an immune response which confers protective immunity against infection by S pneumoniae on the subject

The invention still further describes a method of conferring protective

^"Hi immunity against infection by S pneumoniae on a subject in which the therapeutic compositions of the invention are administered to the subject A further aspect of the invention presents a method for identifying a peptide incorporating PsaA or a fragment thereof (1 e , an immunogenic peptide) that elicits an immunogenic response in a subject directed against S pneumoniae The method entails preparing a random peptide library, screening the peptide 5 library in order to identify immunogenic peptides, and obtaining the ammo acid sequence of the immunogenic peptide

The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims It is to be understood that both the foregoing general description and the following 10 detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed Throughout this application, various publications are referenced The disclosures of these publications in their entireties are hereb\ incorporated by reference into this application in order more fully to describe the state of the art to which this application pertains

15 DETAILED DESCRIPTION OF THE INVENTION

As used herein, "immunogenic peptide" refers to a peptide which, upon being administered to a subject, or taken up by the subject in other ways, elicits an immune response The immune response includes at least the generation of antibodies which specificalK bind the immunogenic substance (l e a humoral

2< > response) An immunogenic substance may in addition elicit a cellular immunological response Such an immunogen is any of the immunogenic peptide-- obtained by screening a library of random peptides using monoclonal antibodies that immunospecifically react with PsaA from S pneumoniae

As used herein, "immune response" and "immunogenic response" may

2^ include at least a humoral response, that is, the generation of antibodies which specifically bind the immunogenic substance An immunogenic response may, either alternatively or in addition, refer to a cellular immunological response

As used herein, "protective immunity" refers to a state in which a subject has generated antibodies, at least some of which are neutralizing antibodies, in

X⁾ response to exposure to a pathogen-related immunogen Neutralizing antibodies bind the immunogenic component of the pathogen in such a way that proliferative infection b\ the pathogen is inhibited or abrogated, such that the subject remains

- 4 - essentially free of symptomatic disease Protective immunity may also arise from an alternative immunogenic response which leads to inactivation, loss, or destruction of the pathogenic agent

As used herein, "immunostimulatory carrier" relates to any of a variety of immunogenic biological polymers which themselves elicit immune responses when introduced into a subject Immunostimulatory carriers, when employed in conjunction with an immunogen of interest, such as the peptides of the present invention, provide enhanced immunogenic response in the subject to the immunogen of interest Furthermore, as used herein, "adjuvant" relates to a composition that enhances the immunogenic activity of an immunogenic substance when administered in conjunction with that substance

As used herein, a "library " refers to a set of fragments derived from a biological macromolecule, wherein each member of the set is a candidate for possessing a desired biological activity expressing a desired biological function A library is either a peptide library or a library of ohgonucleotide fragments each member of which contains a nucleotide sequence which encodes a particular member oi he peptide library In the present invention, the peptide library is a set of peptides which are coded for b\ a random ohgonucleotide library The desired activity for a given peptide is that the peptide be immunogenic in a subject against S pneumoniaL

As used herein, a "subject" is a mammal in whom it is desired to elicit an immune response to the pathogenic organism S pneumoniae A principal class of subjects of the present invention is human beings, especially infants and elderly people, in whom S pneumoniae is in fact pathogenic In human subjects, therefore, the immune response is intended to be a protective immune response For non-human mammals, S pneumoniae may or may not be inherently pathogenic Such non-human subjects employed as experimental animals which provide an immune response can be useful in characterizing and optimizing the compositions and methods of the invention Such mammals include, by way of non-limiting example, mice, rats, and non-human primates An additional class of subjects includes animals served in veterinary practice, including pets and livestock animals If S pneumoniae is pathogenic in such subjects, eliciting protective immunity is desirable PC17US99/04326 WO 99/45121

"Purified protein" as used herein means that the protein or fragment is sufficiently free of contaminants or cell components with which the protein normally occurs as to distinguish the protein from the contaminants or cell components It is not contemplated that "purified" necessitates having a * preparation that is technically totally pure (homogeneous), but purified as used herein means the protein or polypeptide fragment is sufficiently separated from contaminants or cell components with which it normally occurs to provide the protein in a state where it can be used in an assay, such as immunoprecipitation or ELISA For example, the purified protein can be in an electrophoretic gel

10 As used herein, "stringent conditions" refers to the washing conditions used in a nucleic acid hy bridization protocol In general, the washing conditions should be a combination of temperature and salt concentration chosen so that the denaturation temperature is approximately 5-20°C below the calculated T_m of the nucleic acid hybrid under study The temperature and salt conditions are readily

15 determined empirically in preliminary experiments in which samples of reference

DNA immobilized on filters are hybridized to the probe or protein coding nucleic acid of interest and i .n washed under conditions of different stringencies The T_. of such an ohgonucleotide can be estimated by allowing about 2°C for each A or T nucleotide. and about 4°C for each G or C For example, an 18 nucleotide probe

2" of 50° o G—C would, therefore, have an estimated T_. of 54°C

As used herein a "therapeutic composition" relates to a composition which may be administered to a subject in order to elicit a protective immune response and which contains one or more of the immunogenic peptides of the present invention in conjunction with an immunostimulatory carrier or an adjuvant The

25 therapeutic compositions contain the peptide and the carrier in either a mixture or as a chemical conjugate Together these constitute the active agent If more than one peptide is employed and the composition is a conjugate, each peptide is conjugated to an immunostimulatory carrier In addition, the therapeutic composition generally contains the components of a pharmaceutical formulation in i⁽> which the active agent is suspended or dissolved The components of pharmaceutical formulations are well known to those who are skilled in immunology or pharmaceutical science The formulation should be suitable to administer the active agent to a subject in order to elicit an immune response and

- 6 confer protective immunity against the pathogen related to the immunogenic peptide

As used herein, the term "allehc variation" or "allelic variant" refers to an immunogenic PsaA peptide or protein obtained from a serotype of S pneumoniae other than that of a reference serotype such as serotype 2 An alle c variant describes the same 37-kDa pneumococcal surface adhesin protein, or a similar protein that is diverged from the 37-kDa Streptococcus pneumoniae protein set forth in the Sequence Listing as SEQ ID NO 2 by less than 15% in its corresponding amino acid identity Preferably, this allehc variant is less than 10% divergent in its corresponding amino acid identity, more preferably less than 7% divergent, more preferabh less than 5% divergent, more preferably less than 3% divergent, more preferably less than 2% divergent, and most preferably less than 1 % divergent in their corresponding amino acid identity These amino acids can be substitutions within the amino acid sequence set forth in the Sequence Listing as SEQ ID NO 2, or the variants can be either deletions from or additions to the amino acid sequence set forth in the Sequence Listing as SEQ ID NO 2

Nucleic Acids

In one aspect, the invention provides an isolated nucleic acid encoding the 37-kDa protein of Streptococc us pneumoniae whose amino acid sequence' is set forth in the Sequence Listing as SEQ ID NO 2 The term "isolated" refers to a nucleic acid which is essentialh separated from other genes that naturallv occur in S pneumoniae In one embodiment, the present invention provides an isolated nucleic acid encoding the 37-kDa protein of Streptococcus pneumoniae wherein the nucleic acid is the nucleic acid whose nucleotide sequence is set forth in the Sequence Listing as SEQ ID NO 1 An isolated nucleic acid comprising a unique fragment of at least 10 nucleotides of the nucleic acid set forth in the Sequence Listing as SEQ ID NO 1 is also provided "Unique fragments," as used herein, means a nucleic acid of at least 10 nucleotides that is not identical to any other known nucleic acid sequence at the time the invention was made Examples of the sequences of at least 10 nucleotides that are unique to the nucleic acid set forth in the Sequence Listing as SEQ ID NO 1 can be readily ascertained by comparing the sequence of the nucleic acid in question to sequences catalogued in GenBank. or other sequence database, using computer programs such as DNASIS (Hitachi

- 7 O 99/45121

engineering, mc j, or worα -search or A A ot the Genetics Computer Group (GCG) (Madison, WI), which search the catalogued nucleotide sequences for similarities to the nucleic acid in question If the sequence does not match any of the known sequences, it is unique For example, the sequence of nucleotides 1 -10 can be used to search the databases for an identical match If no matches are found, then nucleotides 1 -10 represent a unique fragment Next, the sequence of nucleotides 2-1 1 can be used to search the databases, then the sequence of nucleotides 3- 12, and so on up to nucleotides 1321 to 1330 of the sequence set forth in the Sequence Listing as SEQ ID NO 1 The same type of search can be performed for sequences of 1 1 nucleotides, 12 nucleotides, 13 nucleotides, etc

The possible fragments range from 10 nucleotides in length to 1 nucleotide less than the sequence set forth in the Sequence Listing as SEQ ID NO 1 These unique nucleic acids, as well as degenerate nucleic acids can be used, for example as primers for amplifying nucleic acids from other strains of Streptococcus pneumoniae in order to isolate alle c variants of the 37-kDa protein, or as primers for reverse transcription of 37-kDa protein RNA, or as probes for use in detection techniques such as nucleic acid hybridization One skilled in the art will appreciate that even though a nucleic acid of at lea 10 nucleotides is unique to a specific gene, that nucleic acid fragment can still hybridize to many other nucleic acids and therefore be used in techniques such as amplification and nucleic acid detection

Also provided are nucleic acids which encode alle c variants of the 37-kDa protein of S pneumoniae set forth in the Sequence Listing as SEQ ID NO 2 The homologN between the protein coding region of the nucleic acid encoding the allehc variant of the 37-kDa protein is preferably less than 20% divergent from the region of the nucleic acid set forth in the Sequence Listing as SEQ ID NO 1 encoding the 37-kDa protein Preferably, the corresponding nucleic acids are less than 15% divergent in their sequence identity In another embodiment, the corresponding nucleic acids are less than 10% divergent in their sequence identity , more preferably less than 7% divergent, more preferably less than 5% divergent, more preferably less than 4% divergent, more preferably less than 3% divergent, more preferably less than 2% divergent, and most preferably less than 1 % divergent in their corresponding nucleotide identity In particular, the nucleic acid variations can create up to about 15% amino acid sequence variation from the protein set forth in the Sequence Listing as SEQ ID NO 2 O 99/45121

One skilled in the art w ll appreciate that nucleic acids encoding homologs or allehc variants of the 37-kDa protein set forth in the Sequence Listing as SEQ ID NO 2 can be isolated from related gram-positive bacteria The nucleic acid encoding a 37-kDa protein may be obtained by any number of techniques known to one skilled in the art Methods of isolating nucleic acids of the invention, including probes and primers that may be used, are set forth in United States Patent Application Serial No 08/715,13 1. filed Sept 17, 1996. which is a continuation-in- part of United States Patent Application Serial No 08/222,179, filed April 4, 1994, which is a continuation-in-part of United States Patent Application Serial No 07791.377, filed September 1 7. 1991 (now U S Patent No 5.422.427) General methods that may be employed for these purposes are set forth in Sambrook et al "Molecular Cloning, a Laboratory Manual," Cold Spring Harbor Laboratory Press ( 1989). and Ausubel et al , "Current Protocols in Molecular Biology", John Wiley and Sons, New York 1987 (updated quarterly ) Amplification procedures that may be employed in the nucleic acid isolation protocols are well known to those skilled in the art (see, for example, Inms et al 1990 "PCP Protocols A Guide to Methods and Applications" Academic Press. Inc ) An exar pie of amplification of a nucleic acid encoding the 37-kDa protein of Streptococcus pneumon oe serotype 6B is discussed in the Example contained herein

37-kDa Protein

The present invention also provides a purified polypeptide as set forth in the Sequence Listing as SEQ ID NO 2 and a purified polypeptide encoded by a nucleic acid comprising a unique fragment of at least 10 nucleotides of SEQ ID NO 1 The protein can be used as a vaccine component as well as a reagent for identifying subject antibodies raised against Streptococcus pneumoniae during infection The purified protein can also be used in methods for detecting the presence of Streptococcus pneumoniae

Unique fragments of the 37-kDa protein can be identified in the same manner as that used to identify unique nucleic acids For example, a sequence of 3 amino acids or more, derived from the sequence of the 37-kDa protein, as set forth in the Sequence Listing as SEQ ID NO 2 can be used to search the protein sequence databases Those that do not match a known sequence are therefore unique Methods of preparing these proteins and protein fragments are set forth in United States Patent Application Serial No 08/715,131 , filed Sept 17, 1996, which is a continuation-in-part of United States Patent Application Serial No 08/222,179, filed April 4, 1994, which is a continuation-in-part of United States Patent Application Serial No 07/791 ,377, filed September 17, 1991 (now U S Patent No 5 5,422,427

The present invention provides peptide fragments related to the 37-kDa pneumococcal surface adhesin protein The polypeptide fragments of the present invention can be recombinant polypeptides obtained by cloning nucleic acids encoding fragments of the polypeptide in an expression system capable of

10 producing the polypeptide fragments thereof, as described above for the 37-kDa protein For example, one can identify an immunoreactive peptide related to the 37-kDa pneumococcal surface adhesin protein which can cause a significant immune response by using antibodies raised against the adhesin protein, cloning the nucleic acid encoding that polypeptide into an expression vector, and isolating that

X particular polypeptide for further uses, such as diagnostics, therapy, and vaccination Amino acids which do not contribute to the immunoreactivity and or specificity can be deleted without a loss in the respective ac ity For example, amino or carboxy-terminal amino acids can be sequentially removed from any peptide identified using the procedure outlined above, and the immunoreactivirs 0 tested in one of many available assays Alternatively, internal amino acids can be sequentialh removed and the immunoreactivity tested for each of the deletions

In another example, a peptide fragment related to a 37-kDa pneumococcal surface adhesin protein can comprise a modified polypeptide wherein at least one amino acid has been substituted for the amino acid residue originally occupying a

25 specific position, or a portion of either amino terminal or carboxy terminal amino acids, or even an internal region of the polypeptide, can be replaced with a polypeptide fragment or other moiety, such as biotin, which can facilitate in the purification of the modified 37-kDa pneumococcal surface adhesin protein

Immunoreactive peptide fragments related to a 37-kDa pneumococcal

!• ' surface adhesin protein can include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the immunoreactivity of the peptide is not significantly impaired compared to the 37-kDa pneumococcal surface adhesin protein These modifications can prov ide for some additional property, such as to remox e'add

- 10 O 99/45121

amino acids capable of disulfide bonding, to increase its bio-longevity, and the like In any case, the peptide must possess a bioactive property, such as immunoreactivity. comparable to t! 37-kDa pneumococcal surface adhesin protein

Antibodies The present invention employs a purified antibody which selectively binds with the polypeptide encoded by the nucleic acid set forth in the sequence listing as SEQ ID NO 1 , or a polypeptide encoded by a unique fragment of at least 10 nucleotides of SEQ ID NO 1 The antibody (either polyclonal or monoclonal) can be raised to the 37-kDa pneumococcal surface adhesin protein or a unique fragment thereof, in its naturally occurring form or in its recombinant form The antιbod\ can be used in a variety of techniques or procedures such as diagnostics, treatment, oτ immunization Antibodies can be prepared by many well-known methods (see. e g Harlo and Lane "Antibodies A Laboratory Manual", Cold Spring Harbor Laboratory . Cold Spring Harbor. New York, (1988)) Briefly, purified antigen can be injected into an animal in amount and at intervals sufficient to elicit an immune response Antibodies can be purified directly, to yield polyclonal anti idies Alternatively, spleen cells can be obtained from the animal The cells can then fused with an immortal cell line and screened for antibody secretion to yield monoclonal antibodies The antibodies can be used to screen nucleic acid clone libraries for cells secreting the antigen Those positive clones can then be sequenced (see for example. Kelly ei al Bio Technology 1992 10 163-167, Bebbmgion et al 1992 Bio Technology . 10 169- 175)

The phrase "selectively binds" with the polypeptide refers to a binding reaction which is determinative of the presence of the protein in a heterogeneous population of proteins and other biologies Thus, under designated immunoassay conditions, the specified antibodies bound to a particular protein do not bind in a significant amount to other proteins present in the sample Selective binding to an antibody under such conditions may require an antibody that is selected for its specificm for a particular protein A variety of immunoassay formats may be used to select antibodies which selectively bind with a particular protein For example, solid-phase ELISA immunoassavs are routinely used to select antibodies selectively immunoreactive w ith a protein See HarloM and Lane "Antibodies A Laboratory Manual" Cold Spring Harbor Publications, New York, (1988), for a description of O 99/45121

immunoassay formats and conditions that could be used to determine selective binding In some instances, it is desirable to prepare monoclonal antibodies from various subjects A description of techniques for preparing such monoclonal antibodies may be found in Stites et al , editors, "Basic and Clinical Immunology," (Lange Medical Publications, Los Altos, Calif, Fourth Edition) and references cited therein, and in Harlow and Lane ("Antibodies A Laboratory Manual" Cold Spring Harbor Publications, New York. (1988))

The monoclonal antibodies (MAbs) employed in the present invention (disclosed in United States Patent Application Serial No 08/715,131 , filed Sept 17, 1996, incorporated herein by reference) are MAb 1E7A3D7C2, or a fragment thereof which retains the characteristics of antibody 1 E7A3D7C2, such as its binding specificity and its binding affinity, MAb 1B6E12H9, or a fragment thereof which retains the characteristics of antibody 1 B6E12H9. MAb 3C4D5C7, or a fragment thereof which retains the characteristics of antibody 3C4D5C7. MAb 4E9G9D3, or a fragment thereof which retains the characteristics of antibody

4E9G9D3 , MAb 4H5C 10F3. or a fragment thereof which retains the characterises of antibody 4H5C10F3, MAb 6F6F9C8, or a fragment thereof which retains th characteristics of antibody 6F6F9C8, and MAb 8G12G1 1B 10, or a fragment thereof which retains the characteristics of antibody 8G12G1 1B 1 0 The hybπdomas used to produce the respective monoclonal antibodies employed in the present invention (disclosed in United States Patent Application Serial No 08 71 5.13 1 , filed Sept 17, 1996, incorporated herein by reference) are hybπdoma 1E7A3D7C2, hybπdoma 1B6E12H9, hybπdoma 3C4D5C7, hybπdoma 4E9G9D3, hybπdoma 4H5C 1 0F3, hybπdoma 6F6F9C8, and hybπdoma 8G12G1 1B 10

Therapeutic Compositions

Also provided by the present invention is a therapeutic composition comprising an immunogenic polypeptide encoded by the nucleic acid as set forth in the Sequence Listing as SEQ ID NO 1. or a unique fragment of at least 10 nucleotides of SEQ ID NO 3 The invention also provides therapeutic compositions comprising at least one immunogenic polypeptide that lmmunospecifically binds to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA The therapeutic

n . PC17US99/04326 O 99/45121

composition is preferably combined with an immunostimulatory carrier The therapeutic composition confers protective immunity against S pneumoniae infection when administered to a subject

The polypeptides provided by the present invention can be used to vaccinate a subject for protection from a particular disease, infection, or condition caused by the organism from which the 37-kDa pneumococcal surface adhesin protein (oi a unique fragment thereof) was derived Polypeptides of a 37-kDa pneumococcal surface adhesin protein of serotype 6B, or a unique fragment thereof, can be used to inoculate a subject organism such that the subject generates an active immune response to the presence of the polypeptide or polypeptide fragment which can later protect the subject from infection by organism from which the polypeptide was derived One skilled in the art will appreciate that an immune response, especially a cell-mediated immune response, to a 37-kDa pneumococcal surface adhesin protein from a specific strain can provide later protection from reinfection or from infection from a closely related strain The 37-kDa protein provided by the present invention, however, is relatively conserved among the 90 serotypes of S pneumoniae and can. therefore, serve as a multivalent vaccine Immunization with the 37-kDa pneumococcal surface adhesin protein or with the immunogenic peptides of the invention can be achieved by administering to subjects the 37-kDa pneumococcal surface adhesin protein either alone or with a pharmaceuticalh acceptable carrier (Kuby J 1992 "Immunology " W H Freeman and Co New York) Immunogenic amounts of the 37-kDa pneumococcal surface adhesin protein or of the immunogenic peptides of the invention can be determined using standard procedures Briefly, various concentrations of the present polypeptide are prepared, administered to subjects, and the immunogenic response

(e g , the production of antibodies to the polypeptide or cell mediated immunity) to each concentration is determined Techniques for monitoring the immunogenic response, both cellular and humoral, of patients after inoculation with the polypeptide, are well known in the art For example, samples can be assayed using enzyme-linked immunosorbent assays (ELISA) to detect the presence of specific antibodies, such as serum IgG fHjelt et al J Med Virol 21 39-47, ( 1987)). lymphocyte or cytokine production can also be monitored The specificity of a putative immunogenic antigen of any particular polypeptide can be ascertained by testing sera, other fluids, or lymphocytes from the inoculated patient for cross-

- 13 O 99/45121

reactivity with other closely related 37-kDa pneumococcal surface adhesin proteins The amount of a polypeptide of the 37-kDa pneumococcal surface adhesin protein or of the immunogenic peptides of the invention to be administered will depend on the subject, the condition of the subject, the size of the subject, and the like, but will be at least an immunogenic amount The polypeptide can be formulated with adjuvants and with additional compounds, including cytokines, with a pharmaceutically acceptable carrier

The pharmaceutically acceptable carrier or adjuvant in the therapeutic composition of the present invention can be selected by standard criteria (Arnon R (Ed ) "Synthetic Vaccines" I 83-92, CRC Press, Inc , Boca Raton, Florida, 1987)

By "pharmaceutically acceptable" is meant a material that is not biologicalK or otherwise undesirable (I e , the material may be administered to an individual along with the selected compound without causing any undesirable biological effects or interacting in an undesirable manner with any of the other components of the pharmaceutical composition in which it is contained) The carrier or adjuvant ma\ depend on the method of administration and the particular patient Methods of administration can be parenteral, oral, subhngual, mucosal, inhaled, absorbed, or injection Actual methods of preparing the appropriate dosage forms are known, or will be apparent, to those skilled in this art, see, for example, Remington 's Pharmaceutical Sciences (Martin, E W (ed ) latest edition Mack Publishing Co

Easton PA) Parenteral administration if used, is generally characterized b\ injection Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions Another approach for parenteral administration involves use of a slow release or sustained release system, such that a constant level of dosage is maintained (see, e g , U S Patent No 3,710,795) In addition, powders or aerosols may be formulated for administration by inhalation

Detection Methods

The present invention provides methods of detecting the presence of Streptococcus pneumoniae in a subject, based on several variations of immunoassavs using either a purified polypeptide encoded b\ the nucleic acid set forth in the Sequence Listing as SEQ ID NO 1 , a purified polypeptide encoded b\ a nucleic acid comprising a unique fragment of at least 10 nucleotides of SEQ ID

- 14 O 99/45121

NO 1 , an antibody which selectively binds the purified polypeptide encoded by the nucleic acid set forth in the Sequence Listing as SEQ ID NO 1 , or an antibody which selectively binds a purified polypeptide encoded by a nucleic acid comprising a unique fragment of at least 10 nucleotides of SEQ ID NO 1 , and detecting the binding of the antibody with the polypeptide, the binding indicating the presence of Streptococcus pneumoniae in the subject There are numerous lmmunodiagnostic methods that can be used to detect antigen or antibody as the following non-inclusive examples illustrate These methods, as well as others, can not only detect the presence of antigen or antibody, but quantitate antigen or antibody as well These methods are set forth in United States Patent Application

Serial No 08715, 13 1 , filed Sept 17, 1996, which is a continuation-in-part of United States Patent Application Serial No 08/222,179, filed April 4, 1994, which is a continuation-in-part of United States Patent Application Serial No 07/791 ,377, filed September 17, 1991 (now U S Patent No 5,422,427) In general, the detection methods that may be employed in practicing the present invention are described in, for example, Ha' fou et al "Antibodies A Laboratory Manual" Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1988)

Methods of Treating and Preventing Infection The present invention also provides a method of preventing Streptococcus pneumoniae infection in a subject at risk of infection by S pneumoniae. comprising administering to the subject an effective amount of a therapeutic composition comprising an immunogenic polypeptide encoded by the nucleic acid encoding the 37-kDa protein of Streptococcus pneumoniae as set forth in the Sequence Listing as SEQ ID NO 1 , or an immunogenic polypeptide encoded by a nucleic acid comprising a unique fragment of at least 10 nucleotides of SEQ ID NO 1 , or the immunogenic peptides of the invention either alone or with ?• pharmaceutically acceptable carrier

The present invention further provides a method of treating a Streptococcus pneumoniae infection in a subject, comprising administering to the subject an effective amount of an antibody to the polypeptide encoded by the nucleic acid asset forth in the Sequence Listing as SEQ ID NO 1 , or a polypeptide encoded by a nucleic acid comprising a unique fragment of at least 10 nucleotides of SEQ ID NO 1. either alone or with a pharmaceutically acceptable carrier Treating a

15 - subject already infected with a particular organism by administering to the subject an antibody against the organism is well known in the art For example, immune globulin isolated from animals or humans previously exposed to rabies virus is currently a therapy for rabies virus infection Better treatment of infected 5 individuals can be achieved by administering to those individuals monoclonal antibodies since those monoclonals react or bind more specifically than the polyclonals (See, e g Kaplan et al "Rabies" Sci Am 242 120-134 ( 1980))

Epitopic Immunogenic Peptides

The present invention discloses novel epitopic immunogenic peptides l (ι obtained as the peptides ceded in a random ohgonucleotide library by selecting for high affinity binding of the epitopes to monoclonal antibodies specific for epitopes on the PsaA antigen

In an additional method, a procedure known as "biopan ng" or "panning", a target protein or peptide is selected from a library expressed as a heterologous

1 insert on an external surface of a microorganism A bacterium or virus, for example, may have a nucleotide sequence encoding a heterologous peptide or protein sequence incorporated into its chromosomal nucleic acid in such a wav that a fusion or chimera is created The fusion represents a natural protein of the microorganism directly linked with the heterologous peptide or protein Once " expressed on the surface of the microorganism, it can be probed by a hgand specific for the sought peptide or protein, such as an antibody Once identified by capture, the heterologous sequence, either the nucleic acid or the protein, can be obtained and identified

A common implementation of this procedure is well-known to those of skill 5 in the fields of protein chemistry, immunology, and virology A filamentous bacteπophage such as Ml 3, fl , or fd is employed These bacteπophages have two well-known structural proteins on their surfaces the gene III protein and the gene VIII protein The nucleic acid of the phage is altered by incorporating a fusion sequence of the heterologous peptide in frame with the gene for one or the other of n these structural proteins When one is seeking a target peptide from among a large set. or library, of such peptides. the corresponding library of heterologous nucleotide sequences coding for the members of the peptide library is incorporated into the structural protein gene The resulting bacteπophage population (termed a

- 16 O 99/45121

phage display library) is subjected to procedures which optimize selection of only those virus particles expressing members of the peptide library for which the PsaA- specific hgand such as an MAb. has a high affinity The bacteriophage particles so selected may then be amplified by further culture, or their nucleic acids may be amplified by methods such as polymerase chain reaction In this way the nucleic acid of the captured particle may be isolated and sequenced to provide the coding sequence for the high affinity epitope bound to the MAb or other hgand Biopan ng is described for example, in Smith, G P and K K Scott (1993, "Libraries of Peptides and Proteins Displayed on Filamentous Phage", Meth Enzymol 217 228-257)

The immunogenic peptides of the invention were obtained using a biopanmng procedure that has general applicability for identifying the sequence of a peptide potentialK capable of eliciting protective immunity against a pathogenic microorganism The method includes the steps of (a) prov iding a library comprised of random ohgonucleotides, wherein the ohgonucleotides are about 30-45 nucleotides in length,

(b) splicing the ohgonucleotides of a library into the gene for a coat protein of a filamentous bacteriophage in frame with the codons for the amino acid residues of the coat protein, such that the gene for the coat protein is contained within the complete nucleic acid that is the genome for the bacteriophage. thereby creating a bacteriophage library , and further positioning the ohgonucleotides within the gene such that when the coat protein is expressed and incorporated into a complete bacteriophage particle the peptide is available, by exposure on the surface, as an epitope to which an antibody can bind, (c) expanding the bacteriophage library harboring the ohgonucleotide library by cultuπng the bacteriophage library in a host which the bacteriophage infects,

(d) screening the expanded bacteπophage library for any bacteriophage particle that lmmunospecifically reacts with a monoclonal antibody obtained in response to immunizing an animal with an immunogen of the microorganism, and

(e) sequencing the gene for the coat protein of any bacteriophage particle obtained in step (d) therebv yielding the nucleotide sequence of that member of the ohgonucleotide library whose translation product has the sequence of a peptide potentialK capable of eliciting protective immunity against Streptococcus

- 17 pneumoniae

In the particular application employed in obtaining the immunogenic peptides of the invention, the method described above is directed against S pneumoniae. the coat protein is the gene III protein which is the tail protein of a 5 filamentous bacteπophage such as Ml 3, fl , or fd, and the monoclonal antibody is obtained in response to immunizing an animal with Streptococcus pneumoniae pneumococcal surface adhesion A protein (PsaA) The peptides are isolated using a procedure that emphasizes capturing only those peptides that have a high affinity for the antibodies This assures that any protective effect based on humoral in immunity will be highly effective

The sequences of the peptides which bind to the antibodies may be identified by sequencing the gene III fusion of the bacteriophage particle obtained in the biopanmng process The actual immunogenic peptides may then be synthesized in conventional peptide synthesizers These peptides are then

15 incorporated into a therapeutic composition in which the immunogenic peptides are combined with an immunostimulatory carrier to be administered to a subject Upon being administered in effective amounts, the subject elicits the production of antibodies against S pneumoniae This results in conferring protective immunity against infection by S pneumoniae on the subject <ι PsaA is a 37-kDa species-common protein from S pneumoniae

(pneumococcus) which is effectively immunogenic It is common to all the seroty pes whose polysacchaπdes are components of the pneumococcal vaccine currently in use (Russell et al . 1990. "Monoclonal antibody recognizing a species- specific protein from Streptococcus pneumoniae". J C n Microbiol 28 2191 - 5 2195) The sequence of the PsaA gene cloned from serotype R36A has been described (U S Patent 5,422,427, to Russell et al ), and the sequence of PsaA protein was deduced In addition, the nucleotide sequence of cloned PsaA from serotypes 2 and 6B, and their corresponding amino acid sequences, have been determined (Berry et al . 1996, "Sequence heterogeneity of PsaA, a 37-kιlodalton o putative adhesin essential for virulence of Streptococcus pneumoniae", Infect

Immun 64 5255-5262. Sampson el al , 1997, "Limited Diversity of Streptococcu pneumoniae psaA among Pneumococcal Vaccine Serotypes". Infect Immun 65 1967- 1971 ) Excluding the putative leader sequence, there are 6 amino acid differences between PsaA's from serotype 6B versus serotype 2. out of a total of O 99/45121

290 residues overall, there are 45 amino acid differences between 6B and 36A (Sampson et al . ibid) This result led Sampson et al to suggest that serotypes 2 and 6B represent the prototypical sequences among pneumococcal PsaA proteins PsaA from serotype 3 (disclosed in United States Patent Application Ser No 0871 5, 13 1 , incorporated herein by reference) and serotype 22 (Talktngton et al ,

1996, "Protection of mice against fatal pneumococcal challenge by immunization with pneumococcal surface adhesin A (PsaA)", Microb Pathog 21 17-22) effectively provide protective immunity in mice against challenge doses of S pneumoniae The peptides of the present invention contain immunogenic epitopes selected by binding to PsaA-specific monoclonal antibodies Preferably the peptide is about 10-25 residues in length More preferably, the peptide is about 12-22 residues in length and most preferably about 1 5 residues in length In the embodiments presented in the Examples below, the peptides are given in SEQ ID NO 5. SEQ ID NO 6, SEQ ID NO 7, and SEQ ID NO 8 In addition, the invention encompasses immunogenic peptides which may be shorter than these sequences Thus, for example, immunogenic fragments of SEQ ID NO 5, immunogenic fragments of SEQ ID NO 6, immunogenic fragments of SEQ ID NO 7, and immunogenic fragments of SEQ ID NO 8 are also encompassed by the present invention

Currently appro\ιmatel\ 90 serotypes of S pneumoniae have been identified, these ma\ have PsaA antigens which are allehc variants of the PsaA sequences already identified The invention therefore encompasses an allehc immunogenic peptide which, for example, was obtained by a biopanmng procedure in which the monoclonal antibodies were raised by immunizing with an allehc variant, or in other ways known to those skilled in the relevant arts The sequence of such a peptide is at least 80% identical to any of the following sequences SEQ ID NO 5. SEQ ID NO 6. SEQ ID NO 7. SEQ ID NO 8. immunogenic fragments of SEQ ID NO 5. immunogenic fragments of SEQ ID NO 6, immunogenic fragments of SEQ ID NO 7. and immunogenic fragments of SEQ ID NO 8

The monoclonal antibodies (MAbs) disclosed above were used further in procedures of the present invention The specific MAbs that were used are designated 1 E7 ( 1 E7A3D7C2 ). 6F6 (6F6F9C8), 4E9 (4E9G9D3 ). 8G12 (8G12G 1 1 B 10). and 1B6 ( 1 B6E12H9) These MAbs were obtained as a result of

19 immunization of an animal with PsaA. such antibodies therefore represent molecules whose antigen-binding domains bind immunogenic epitopes of the invention

Identification of immunogenic epitopes related to PsaA may be achieved in 5 any of a number of ways Methods to identify immunogenic epitopes may employ any MAb obtained in response to primary immunization with PsaA Any procedure which narrows down the overall molecular structure of PsaA to moieties or fragments thereof may be employed in identifying immunogenic epitopes thereof In one method, chemical modification of specific residues of PsaA yields

10 modified products whose reactivity with a hgand such as an anti-PsaA MAb ma\ be impaired Knowledge of which residue or residues were modified in products with impaired binding may be used to identify those residues as potentially being a portion of the eptiope Additionally, biopan ng, described above, may be used In another method, fragments of PsaA may be synthesized chemically by

15 peptide synthesis In general, a set of peptides are synthesized which represents a sy stematic progression along the entire sequence of the protein from its N-terminus to li C-terminus Windows of predetermined lengths may be "walked" along the protein sequence generating a set of peptides which encompasses most or all of the original sequence Methods of peptide synthesis are well-known to workers of skill

~>( in the fields of peptide chemistry, protein chemistry, and immunology Commercial instruments are av ailable for the automated synthesis of peptides once their sequences are specified A set of peptides obtained in this way may be subjected to assays which establish whether they bind to PsaA-specific gands, such as anti-PsaA MAbs Immunoassay methods are preferred for such determinations, and are well-known to workers of skill in immunology They include procedures such as enzyme-linked immunosorbent assays (ELISA). using, for example, competitive formats or direct heterogeneous formats Peptides found to bind with high affinity to the PsaA-specific hgands are presumed to contain or encompass an immunogenic epitope of PsaA

The immunogenic peptides of the invention are identified in the selection or screening procedures described in the preceding paragraphs The sequences of the peptides positively selected next need to be obtained In the case of chemical modification, the location of inhibitory modifications in the sequence yields peptides centered on, or containing, that modified residue In the case of the

20 screening of synthesized peptides, the sequence is immediately available from the identity of the positive sample In the case of biopanmng, the positive bacteπophages are isolated and the nucleic acid is amplified, either by expansion of the phage particles in culture or by amplification of the nucleic acid itself The 5 nucleic acid is then isolated and sequenced to identify the coding sequence for the heterologous peptide and the coding sequence translated to yield the peptide sequence

Once the sequences are known, the corresponding peptides are synthesized in order to serve as immunogenic peptides in a subject In general, the peptides

10 will be combined with an immunostimulatory carrier and/or with an adjuvant prior to being administered to a subject In common practice, immunostimulatory carriers are proteins such as keyhole limpet hemocyanin, bovine serum albumin thyroglobuhn. diphtheria toxoid. and the like The immunogenic peptides and the carrier may be combined either noncovalently or covalently When combined

15 noncovalently, they are mixed together so that they comprise components in a therapeutic composition to be administered to a subject An adjuvant useful in the such a compo ion. by way of nonhmiting example, is alum When covalently combined, the immunogen is conjugated with the immunostimulatory carrier using chemical reagents and chemical procedures well known to workers of skill in the

2" fields of protein chemistry and immunology If a mixture of immunogenic peptides is emplo\ ed. each is conjugated to an immunostimulatory ca πer In the present invention, it is preferred to employ conjugated adducts of the immunogenic peptide with the carrier

In preparing the therapeutic composition of the invention, the combination

25 of the immunogenic peptide and the immunostimulatory carrier is formulated with a pharmaceutically acceptable vehicle for administration to a subject As already described, such vehicles are well known to those of skill in the pharmaceutical sciences and include preparations in liquid, gel, or solid forms, for administration by oral, subhngual. mucosal, and parenteral routes, including inhalation These it' dosage forms may be conventional preparations such as solutions or suspensions having immediate bioavailabi ty, or they may be controlled release formulations or devices having the property of releasing the active immunogenic peptide slowly over an extended time period The therapeutic composition confers protective immunity against S pneumoniae in a subject to whom it is administered

21 O 99/45121

In addition to peptides discovered by the methods herein described, immunogenic fragments of such peptides are also encompassed within the present invention An immunogenic fragment is any peptide shorter than the peptide from which it is derived (the parent) whose sequence is identical to the sequence of a portion of the parent peptide and which retains lmmunogenicity It is generally understood in the field of immunochemistry that such peptides must be at least about six residues long in order to be antigenic Thus any fragment should be at least six residues in length and may have a maximum length one residue less than the parent peptide Identifying immunogenic fragments can be accomplished using any method which will identify lmmunogenicity These methods include, for example, the biopanmng procedure described above, as well as direct demonstration of lmmunogenicity by combining the candidate peptide with an immunostimulatory carrier to form the active component of a pharmaceutical composition, administering the pharmaceutical composition to a subject and assessing whether an immunogenic response has occurred

A peptide fragment which has been positively identified as being immunogenic may also . assessed for its ability to elicit protective immunity in a subject This is carried out using methods described herein for determining whether an experimental subject animal exhibiting an immunogenic response to a PsaA peptide fragment resists a challenge by S pneumoniae

In addition to therapeutic compositions in which the active agent is a single immunogenic peptide of the invention, the compositions may also include activ e agents constituted to contain mixtures of peptides having the sequences given by SEQ ID NO 5 or an immunogenic fragment thereof, SEQ ID NO 6 or an immunogenic fragment thereof, SEQ ID NO 7 or an immunogenic fragment thereof, SEQ ID NO 8 or an immunogenic fragment thereof, or a fragment of SEQ ID NO 2 whose length is 10-25 residues, preferably 12-22 residues, or more preferably about 1 5 residues

Additional peptides which are immunogenic and comprise the active agent in therapeutic compositions of the invention are peptides containing an immunogenic peptide related to an allehc variant of PsaA Such peptides are obtained by a procedure in which monoclonal antibodies were raised by immunizing with an allehc variant, and are at least 80%, preferably at least 90%, and most preferably at least 95%, identical to peptides whose sequences have been

22 - O 99/45121

set forth above

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of the present invention They are intended to be purely exemplary of the invention and not to limit the scope of what the inventors regard as their invention Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric

EXAMPLES

Bacterial strains The S pneumoniae strain R36A was kindly provided by

D E Bπles (University of Alabama at Birmingham) Twenty-four serotypes of S pneumoniae w ere provided by K Facklam. Centers for Disease Control (CDC), Atlanta, Ga These serotypes are 1 , 2, 3, 4, 5. 6A, 6B. 7F, 8, 9N, 9V. IOA. 1 IF. 1 1 A. 12F, 14. 15B. 18C, 19A. 19F, 20, 22F. 23F. and 33F Enterococcus avium L cassehflavus and E galhnarum were also provided by R Facklam Anaerobic bacteria were obtained from V R _ owell, CDC These included Bacteroidcs asaccharolyticus B fragihs B intermedius. B thetaiotaomicron. Eubacteπum lentum Fusobactcrnim necrophorum F nucleatum Peptostreptococcus anaerobius P asaccharolyticus Propiombacteπum acnes and Staphylococcus saccharolyticus Branhamclla caiarrhahs and Bordetella parapertussis were obtained from R

Weaver. CDC My cobactenum tuberculosis was provided by R C Good. CDC R Barnes. CDC, provided Chlamydia pneumoniae The following remaining bacteria were from the stock collection of the Immunology Laboratory, CDC Bordetella pertussis Enterobacter aerogenes. E agglomerans. E cloacae. E gergoviac Escherichia coll. Klebsiella pneumoniae. Haemophdus inβuenzae (types a-f),

Legionella micdadci L pneumophila. Mycoplasma pneumoniae Pseudomonas aerugmosa Serratia marcescens Staphylococcus aureus. Streptococcus agalactiae S equtsimili S py ogenes and group G streptococci

Production of MAbs Female BALB^/c mice were immunized with whole cell suspensions of S pneumoniae R36A. a rough derivative of the capsular type 2 strain D39 (Aven et al ( 1944) J Exp Med 79 137-157) The mice were immunized by intravenous injection three times and once by intrapeπtoneal injection The maximum number of cells injected at any time was about I O*¹

23 O 99/45121

Fusion was done on day 25 by using standard procedures (Clafin et al ( 1978) Curr Top Microbiol Immunol 81 107-109) Spleen cells of 4 mice were fused with Sp2/0-Agl 4 myeloma cells (Schulman et al (1978) Nature (London) 276 269- 270) Culture fluids of the growing hybπdomas were tested for antibodies to S pneumoniae whole cells in an ELISA A clone designated 1E7A3D7C2 was one of

10 selected for further study

ELISA Screening of hybπdoma culture supernatants was done by ELISA U-bottom microtitration plates (Costar, Cambridge, Mass ) were sensitized with 50 μl of S pneumoniae whole cell suspension (10⁹ CFU/ml) diluted 1 4,000 in 0 1 M carbonate buffer. pH 9 6, and kept for 16 h at 4°C The plates were washed 5 times with 0 9% NaCl containing 0 05% Tween 20 (NaCl-T; Culture supernatants (50 μl ) from the fusion plates were added to 50 μl of a solution containing 2% bovine serum albumin (BSA). 10% normal rabbit serum, 0 3% Tween-20. and 0 02% Merthiolate in phosphate buffered saline (PBS), pH 7 2, (ELISA diluent, Wells et al (1987) J Chn Microbiol 25 516-521) in the plates and were incubated for 30 min at 37°C The plates were washed 5 times with NaCl-T Fifty microhters of goat anti-mouse lmmunoglobi n horseradish peroxidase conjugate in ELISA diluent was added to each well The plates were incubated for 30 min at 37°C The plates were washed, and 50 μl of 3,3',5,5'-tetramethvlbenzιdιne (0 1 mg/ l in 0 1 M sodium acetate. 0 1 M citric acid (pH 5 7) with 0 005% hydrogen peroxide) w as added to each well and incubated for 30 min at 37°C The reaction was stopped by adding 1 ml of 4 M H_;S0₄ and the optical density was read on a Dynatech ELISA Reader (Dynatech Laboratories, Inc . Alexandria, Va ) at 450 nm An optical density of greater than 0 200 was considered positive SDS-PAGE and immunoblot analysis Sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) was performed by the method of Tsang et al (( 1983) Methods Enzymol 92 377-391 ). using an 8% acrylamide resolving gel Equal volumes of sample buffer (5% SDS-10% 2-mercaptoethanol- 20% glvcerol in 0 01 M Tπs HC1, pH 8 0) and cell suspension containing 2 4 μg protein per μl were mixed, heated at 100°C for 5 min. and a 5-μ] sample was applied to 1 of 1 5 wells If the final protein content of the portion of sample to be tested was <1 2 μg/μl, a volume up to 10 μl of sample was applied to achieve a final concentration of 6 μl of protein per well Protein concentrations were determined by the method of Mark well et al (( 1978) Anal Biochem 87 206-21 0)

24 - O 99/45121

with BSA as the standard Proteins separated by SDS-PAGE were either silver stained by the method of Morπssey ((1981 ) Anal Biochem 1 17 307-3 10) or electroblotted onto nitrocellulose (Schleicher & Schuell, Inc , Keene, N H ) The immunoblot procedure was done according to the method of Tsang et al (1983) with slight modifications The blots were given three 5-mιn washes with PBS, pH

7 2, containing 0 3% Tween-20 and were gently agitated overnight (16 h) at 25°C The blots were blocked for 1 h with casein-thimerosal buffer (CTB) (Kenna et al ( 1985) J Immunol Meth 85 409-419) After three rinses with CTB, the blots were exposed to goat anti-mouse immunoglobuhn horseradish peroxidase conjugate (Bio-Rad Laboratories. Richmond, Calif) for 2 h at 25°C Conjugate dilutions

( 1 2.000) were made in CTB The blots were again rinsed three times with CTB and exposed to 3,3'-dιamιnobenzιdιne-4-hγdrochloπde in PBS, pH 7 2 (0 5 mg ml ), with 0 003% H_;0_; for 5 mm at 25^CC Reactivity was expressed as a visible colored band on the nitrocellulose paper Low molecular-mass protein standards (Bio-Rad) were used in PAGE and lmmunoblotting Rabbit antisera to the protein standards were used to develop the standards (Car/one (1986) Anal Biochem 155 89-91 ) Molecular masses were calculated by the method of f ville et al (( 1974) Methods Enzymol 32 92- 102) using appropriate molecular mass standards

Immunofluorescence Assays A bacterial suspension containing approximatelv 400-500 CFU per field ( 10 μl) was allowed to dry at room temperature on each w ell of acetone-resistant. 12-well (5 mm diameter), glass slides (25 x 75 mm) (Cel-Line Associates, Newfield. N J ) The slides were then immersed in acetone for 10 m and air dried at room temperature MAbs were added to the slides, which were incubated for 30 min at 37°C After incubation. the slides were gently rinsed with PBS and soaked twice at 5-mιn intervals, blotted on filter paper, and air dried at room temperature Fluorescein-labeled rabbit anti- mouse immunoglobuhn (courtesy of W F Bibb. CDC) was then added, and the slides were incubated for 30 min at 37°C They were then washed twice with PBS and gently blotted on filter paper Slides were covered with carbonate-buffered mounting fluid. pH 9 0, and cover slips and were then read with a Leitz Dialux 20 fluorescence microscope equipped with a HBO-100 mercury incident light source an I cube filter svstem. a 40x dry objective lens, and 6 3x binoculars (Leitz. Inc . Rockleigh, N J )

Immunoelectron-microscopy Pneumococcal cells were washed two times

25 O 99/45121

with PBS and fixed in a freshly made mixture of 1 % paraformaldehyde-0 1 % glutaraldehyde for 20 min at 4°C The cells were dehydrated in a graded alcohol series and then in a 1 1 mixture of absolute ethanol and Lowicryl K4M (Ladd Research Industries, Inc , Burlington. Vt ) for 1 h at 4°C The cells were pelleted and suspended in a 1 2 mixture of absolute ethanol and Lowicryl K4M for 1 h at

4°C They were again pelleted and suspended in Lowicryl K4M (undiluted) for 16 h at 4°C The cells were transferred to fresh and undiluted Lowicryl K4M two times during the next 24-hour period The Lowicryl K4M-treated cells were imbedded in gelatin capsules and placed in a box lined with aluminum foil The capsules were hardened using a short-wave UN light source (35 cm distance for 72 h at -20°C) The box was brought to room temperature, and the capsules were allowed to continue hardening for up to 14 days Samples of the capsule were cut into 1 00-μm thin sections and picked up on nickel grids Gπds containing the sample were placed on a droplet of ovalbumin solution in PBS containing sodium azide (E Y Laboratories. Inc . San Mateo. Calif) for 5 min The gπds (wet) were transferred to a solution of primary MAbs diluted in a solution of BSA reagent ( 1 % BSA in PBS containing 0 1 % Triton X- 100, Tween 20, and so> um azide) (E Y Laboratories) and incubated for 1 h at room temperature or 18 to 48 h at 4°C in a moist chamber For antibody binding controls, other grids were wetted with MAbs against Legionella pneu ophila The grids were rinsed two times with PBS and incubated on droplets of goat anti-mouse IgG-labeled colloidal gold particles (20 μm)(E Y Laboratories) for 1 h at room temperature The grids were rinsed two times and post-stained with osmium tetroxide. uranyi acetate, and lead citrate The grids were examined with a Philips 410 transmission electron microscope CBA/CaHΝ/J Mice X-hnked immune deficiency (xid) CBA 'Ν mice as described by Wicker et al , Curr Top Microbiol Immunol 124 86-101 were used to study the protection afforded by the 37-kDa protein

Example 1 Monoclonal Antibodies

MAbs were produced by the method of Kohler et al (1975 "Continuous cultures of fused cells secreting antibody of predefined specificity ," Nature 256

495-497) as modified by the method of Zola et al ( 1982, "Techniques for production and characterization of monoclonal hybπdoma antibodies," in J G Hurrell (ed ), Monoclonal hybπdoma antibodies techniques and applications, CRC

26 O 99/45121

Press Inc . Boca Raton, FL. pp 1 -57 ) The 37-kDa purified PsaA used for immunization of mice was from S pneumoniae serotype 22F, and had been purified according the method of Tharpe et al (1996. "Purification and seroreactivity of pneumococcal surface adhesin A (PsaA)," Clin Diagn Lab Immunol 3 227-229) All the MAbs were produced by immunizing with purified

PsaA from serotype 22F except for 1E7 (1E7A3D7C2), which was produced by immunizing with a nonencapsulated strain of S pneumoniae, R36A (Russell et al , 1990, "Monoclonal antibody recognizing a species-specific protein from Streptococcus pneumoniae." J Chn Microbiol 28 2191 -2195) The PsaA was isolated using procedures set forth in Examples 3 and 5 below BALB/c mice were initially immunized lntrapeπtoneally with purified protein at a final concentration of 1 80 μg/ml in a 1 1 emulsion with Freund's incomplete adjuvant (Sigma Chemical Co . St Louis, MO) and phosphate buffered saline pH 7 2 One month later, the mice were boosted with 1 10 μg/ml purified PsaA without adjuvant The hybπdoma fusion was performed using standard procedures (Clafin et al 1978.

"Mouse myeloma-spleen cell hybrids enhanced hybridization frequencies and rapid screening procedures." Curr Top Microbiol Immunol 81 107-109) Sp en cells from two mice were fused with Sp 2/0-Agl 4 myeloma cells (Schulman et al , 1978, "A better cell line for making hybπdomas secreting specific antibodies." Nature 276 269-270) Sera from immunized mice and tissue culture supernatant from hybridized cells were screened for reactivity against PsaA. by ELISA using a goat anti-mouse immunoglobuhn-horseradish peroxidase conjugate, and by SDS-PAGE combined with Western blotting to standard PsaA, in conventional procedures Hybπdomas yielding positive results in the screen were expanded and used in the identification of the peptides, these were 6F6 (6F6F9C8), 4E9 (4E9G9D3), 8G12

(8G12G1 1B 10), and 1B6 (1B6E12H9) These MAbs, along with 1E7, were used in this investigation

By means of dot immunoblot and Western blot assays, these MAbs reacted with clinical isolates of S pneumoniae representing the 23 type-specific serotypes present in the licensed pneumococcal polvsacchaπde vaccine The Western blots confirmed that the antigen detected had a molecular mass of 37-kDa In an extended study of 90 serotypes of S pneumoniae. the five MAbs listed in the previous paragraph (but not including 1E7) reacted with 89 of the 90 serotypes (only 1 B6 failed to react with serotype 16F) These listed MAbs failed to react

- 27 with E coh, respiratory pathogens, oτ nonpathogens representing 22 genera and 29 species MAb 1E7 correspondingly reacted with all pneumococcal strains tested (24 serotypes) to yield a sensitivity of 100% For specificity, none of 55 different nonpneumococcal strains of bacteria (representing 19 genera and 36 species) 5 reacted, thus yielding a specificity of 100%

When required for use in the experiments described in Example 1 1 , the MAbs were biotinylated by incubating 1 mg of the protein in 0 1 M NaHC0₃, pH 8 4, with 100 μg of N-hydroxysuccinimidyl-biotin ester (initially dissolved in DMSO)

10 Example 2 Cloning of the Pneumococcal Surface Adhesin A Gene

Streptococcus pneumoniae DNA digested with restriction enzyme Sau3 Al was hgated to BamHI digested pUC 13 and transformed into E co TB 1 Recombinant clones were identified by colony immunoblot U ing the 37-kDa monoclonal antibody The plasmid pSTR3- l is an example of the pneumococcal

15 surface adhesin A gene cloned into pUC13

Example 3 Preparation of Purified 37-kDa Protein Antigen

Two methods for preparing the 37-kDa protein are to be used (1 ) Streptococcus pneumoniae is to be conventionally cultured and the cells harvested Purified 37-kDa protein antigen (pneumococcal surface adhesin A) is to be isolated

2 from the Streptococcus pneumoniae cell mass by extraction with a non-ionic detergent and further purified by ammonium sulfate fractionation and lsoelectπc focusing (Tharpe et al , 1996. "Purification and seroreactivity of pneumococcal surface adhesin A (PsaA)," Chn Diagn Lab Immunol 3 227-229) (2) £ colt TB 1 strains containing plasmid pSTR3- l is to be cultured conventionally and the

25 cells harvested For improved yields, E coh strains, transformed with an expression vector that carries a strong, regulated prokaryotic promoter and which contains the gene coding for the 37-kDa protein, is to be used Suitable expression vectors are those that contain a bacteπophage λPL Promoter (e g , pKK1773-3). a hybrid trp-lac promoter (e g , pET-3a) or a bacteriophage T7 promoter The 37- i ⁾ kDa protein (PsaA) is then to be extracted from the separated cell mass

28 - O 99/45121

PROTECTION EXPERIMENTS WITH 37-kDa PROTEIN

Example 4

Twenty CBA^aH /J mice carrying the x d mutation (x-hnked immunodeficiency) were used in this protection study They were tested for protection against challenge with a virulent capsulan type 3 Streptococcus pneumoniae strain, WU2 Mice were anesthetized with Ketamine/Rompun and bled infraorbitally to obtain pre-immumzation sera 37-kDa protein (pneumococcal surface adhesin A) was emulsified in complete Freund's adjuvant (CFA) to a protein concentration of 54 μg per ml Ten mice were injected subcutaneously into 2 axillary and 2 inguinal sites at 0 1 ml per site, delivering approximately 22 μg protein/mouse Ten control mice were treated identically with CFA and buffer substituting for protein Fourteen days later, the ten test mice were injected intrapeπtoneally (IP) with 100 μg of the 37-kDa protein, controls were injected IP with buffer Eight days following the IP immunizations, all mice were bled infraorbitally to obtain post-immunization sera, and challenged intravenously (IV) with 60 CFU of a log phase culture of S pneumoniae strain WU2 Mice were observed for 21 days, and deaths were recorded Sera were collected prior to immunizations to establish baseline exposures, and also following the full immunization protocol (but before challenge) in order to correlate circulating antibody to the 37-kDa protein with protection The results obtained were as follows

- 29 PC17US99/04326

WO 99/45121

Days post challenge 1 no deaths

2 three control mice dead

3 two control mice dead

4 two control mice dead, one control mouse sick

5 one control mouse dead

6-21 no mouse deaths

Immunized with 37-kDa protein 10 '10 survived Controls with no protein 2/10 survived (8 '10 died) Difference statistically significant (p> - 0 0008) Rank sum test

Example 5

Twenty CBA/CaHN/J mice carrying the xid mutation were injected according to the following protocol

I ? 1 All mice were bled prior to immunization to establish baseline immunity Ten test mice were immunized subcutaneously in four sites with a total of 21 μg of 37- kDa protein antigen (pneumococcal fimbrial protein A) emulsified in Complete Freund's adjuvant (CFA) Ten control mice were immunized identically with CFA and buffer substituting for the antigen o 2 Fourteen days later, the mice were boosted lntrapeπtoneally (IP) with 100 μg of the 37-kDa protein antigen (test mice) or with buffer (controls) No adjuvant was used with this booster immunization

3 Eight days later, all mice were bled via the infraorbital sinus and the were collected and pooled into the two groups (immunized and controls) At the same 5 time, blood was collected from individual mice to assay for antibody responses

4 One day later, two additional mice were injected intraocularly with 0 1 ml of pooled immune sera to attempt to passively transfer immunity Three additional mice were injected lntrapeπtoneally (IP) with 0 1 ml of pooled control mouse sera (Only five mice were injected at this step because of the small amount of sera 0 obtained from the immunized mice )

- 30 - 5 One hour after the IP injections, these five mice were challenged intravenously (I V ) with 140 colony-forming units (CFU) of a mid-log phase S pneumoniae type 3 strain, WU2

6 At the same time, the eighteen (8 test and 10 control) mice were challenged I V with the same culture of WU2

7 Deaths were tallied daily

RESULTS No Dead/Total No Challenged

Immunized with the 37-kDa protein 0/8

Control mice 10- 10

Passive Protection

Mice receiving immune sera 0/2

Mice receiving control sera 3 '3

Mice immunized with the 37-kDa protein were protected from fatal challenge with strain WU2. this immunity could be passively transferred with sera from immunized mice (Originally 10 test mice were used However, two of these mice died of other causes prior to being challenged with WU2 )

Example 6

An enzyme-linked immunosorbent assay (ELISA) was developed using purified S pneumoniae 37-kDa protein antigen as a capture for human antibodies Paired sera were tested from children, less than 24 months of age, known to hav e pneumococcal pneumonia Disease confirmation was determined by blood culture or antigen in the urine It was found that 35% (9/26) had antibody titers greater than sera from non-ill children of the same age group, p=0 06 This illustrates that some of the children responded to the 37-kDa protein antigen after natural infection

Example 7 Preparation of the 37-kDa Protein or Polypeptide Conjugate

Conjugates can be prepared by use of a carrier protein bound to the 37-kDa protein or polypeptides derived from the 37-kDa protein via a linker, to elicit a T cell dependent response Such carrier proteins could be any immunogenic protein

3 1 99/45121

such as, for example, keyhole limpet hemocyanin, bovine serum albumin, tetanus toxoid, diphtheria toxoid, or bacterial outer membrane proteins Examples of bacterial outer membrane proteins, useful as conjugates, include outer membrane proteins of Neissena menmgitides and Haemophtlus mfluenzae Netssena menmgitides can be selected from Neissena menmgitides. group A, B, or C In addition, the 37-kDa protein or polypeptides thereof can be used in a conjugate where the 37-kDa protein or polypeptides thereof are the T-cell dependent immunogenic carrier for polysacchaπde antigens that are B-cell stimulators This is based on the theory that polysacchaπde antigens are B-cell stimulators and that protective immunity is usually generated by a combination of B-cell and T-cell stimulation Protein antigens exhibit T-cell dependent properties (1 e , booster and carrier priming) T-cell dependent stimulation is important because most children less than two years of age do not respond to T-cell independent antigens The attachment or conjugation of antigens can be accomplished by conventional processes, such as those described in U S Patent No 4,808,700, involving the addition of chemicals that enable the formation of covalent chemical bonds between the carrier immunogen and the immunogen In use, the 37-kDa protein antigen of this invention can be administered to mammals, especially humans, in a variety of ways Exemplary methods include parenteral (subcutaneous) administration given with a nontoxic adjuvant, such as an alum precipitate or peroral administration given after reduction or ablation of gastric activity, or in a pharmaceutical form that protects the antigen against inactivation by gastric juice (e g . a protectiv e capsule or microsphere) The dose and dosage regimen will depend mainly upon whether the antigen is being administered for therapeutic or prophylactic purposes, the patient, and the patient's history The total pharmaceutically effective amount of antigen administered per dose will typically be in the range of about 2 μg to 50 μg per patient For parenteral administration, the antigen will generally be formulated in a unit dosage mjectable form (solution, suspension, emulsion) in association with a pharmaceutically acceptable parenteral vehicle Such vehicles are inherently nontoxic and nontherapeutic Examples of such vehicles include water, saline. Ringer's solution, dextrose solution, and 5% human serum albumin Non aqueous vehicles, such as fixed oils and ethyl oleate, may also be used Liposomes may be used as vehicles The vehicle may contain

- 32 O 99/45121

minor amounts of additives, such as substances which enhance isotonicity and chemical stability (e g , buffers and preservatives)

Example 8

Bacterial strains. All isolates of S pneumoniae were provided and serotyped by the Streptococcal Reference Laboratory, Division of Bacterial and

Mycotic Diseases. National Center for Infectious Diseases, Centers for Disease Control and Prevention (CDC) The pneumococcal serotype 6B strain used for cloning and sequencing was a CDC reference strain (SP-86) E coh DH5α (Bethesda Research Laboratories, Gaithersburg, MD) was used as the recipient host for plasmids (pUC19 and its derivatives) S pneumoniae strains were grown on

Trypticase soy agar plates with 5% sheep blood cells or, where indicated, in Todd- Hewitt broth containing 0 5% yeast extract E coh cultures were grown in Luna broth which, when required, was supplemented with 100 μg/ml of ampicilhn (Sigma Chemical Co , St Louis, Mo ) Cloning and sequencing of the psaA gene from S. pneumoniae, serotj pe

6B A chromosomal library from S pneumoniae serotype 6B was prepared as previously described (Sampson et al 1994. "Cloning and nucleotide sequence analysis of psaA the Streptococcus pneumoniae gene encoding a 37-kιlodalton protein homologous to previously reported Streptococcus sp adhesins." Infect Immun 62 3 19-324), except that pLJC 1 8 was used as the cloning vector instead of pUC 13 Recombinants were screened by colony immunoblot using monoclonal antibody 1E7 (Russell et al 1990, "Monoclonal antibody recognizing a species- specific protein from Streptococcus pneumoniae. " J Chn Microbiol 28 2191 - 2195 ) This procedure and plasmid purification from positive clones (Ish-Horo iez et al 1981 , "Rapid and efficient cosmid cloning," Nucleic Acids Res 9 2989-2998) and restriction endonuclease analysis, have all been previously described (Sampson et al 1990, "Nucleotide sequence of htpB. the Legionella pneumophila gene encoding the 58-kιlodalton (kDa) common antigen, formerly designated the 60-kDa common antigen." Infect Immun 58 3154-3157, and Sampson at al 1994) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and

Western blot analysis were done as before (Sampson et al 1990) All other DN A manipulations were done according to methods described in Sambrook et al DN A sequencing was performed using the ABI PRISM Dye Terminator Cycle

• 33 - 99/45121

Sequencing kit and procedure (Perkin-Elmer, Cetus, Foster City, Calif) Sequence data were analyzed with the DNASTAR software program (DNASTAR Inc , Madison, Wis ) and the Wisconsin Genetics Computer Group sequence analysis software program (Fenno et al 1989, "Nucleotide sequence analysis of a type 1 fimbπal gene of Streptococcus sanguis FW213," Infect Immun 57 3527-3533)

Preparation of geno ic DNA for PCR-RFLP analysis High molecular weight pneumococcal DNA was prepared by the procedure of Graves et al , 1993, "Universal bacterial DNA isolation procedure," p 617-621 , w D H Pershing et al (ed). Diagnostic molecular biology American Society for Microbiology, Washington, D C ) with modifications Sixteen-hour cultures of type specific S pneumoniae were grown in 50 ml of Todd-Hewitt broth containing 0 5% yeast extract in screw cap flasks at 37°C without shaking Cultures were pelleted at 8000 x g for 15 min at room temperature and washed with phosphate-buffered saline ( 1 0 mM, pH 7 2) The cell pellet was solubihzed in 2 5 ml of buffer composed of 10 M Tπs. 1 0 mM EDTA, pH 8 0, and 0 4% SDS Fifteen microhters of proteinase K (20 mg'ml ) was added, and the lysate was incubated at 37°C for 1 h The mixture was adjusted to 0 48 M NaCl with the addition of 500 μl of 5M NaCl and. after mixing by inversion, 400 μl of 10% hexadecyltrimethylammonium bromide in 0 7% NaCl was added This suspension was mixed as before, incubated for 30 mm at 65°C, and extracted with an equal volume of phenol-chloroform-isoamyl alcohol The upper aqueous phase was separated by centπfugation at 1500 x g and extracted with chloroform-isoamyl alcohol DNA was precipitated from the upper aqueous phase with 2 5 volumes of ethanol at -70°C for 30 min It was pelleted and dried in a desiccator, resuspended in water and quantitated by measuring absorbance at 260 nm

PCR-RFLP Restriction enzymes EcoRI, H7_.fi, Maelll. Mboll MnU. and Nhel were obtained from Boehπnger Mannheim Biochemicals (Indianapolis, Id ), Rsal. Tsp509\ Eco5Α. and Xmnl were purchased from New England Biolabs (Beverly , Mass ) Primer sequences for the amplification reaction were selected from the N-terminal (nucleotides 181 -201 ) and C-terminal (nucleotides 1 106-1 126) sequences of the S pneumoniae serotype 6B gene (PI , AGGATCTAATGAAAAAATTAG (SEQ ID NO 3 ). P2. TCAGAGGCTTATTTTGCCAAT (SEQ ID NO 4)) and flanking regions The primers were synthesized using standard procedures

- 34 - 99/45121

(i) DNA amplification The reactions were performed with the Perkin- Elmer PCR amplification kit Reaction volumes were 100 μl and contained the standard lx reaction buffer without Mg, 1 μM of each primer, 2 0 mM MgCK, 0 2 mM dNTPs, template DNA, and 2 5 U of Taq DNA polymerase The source of the template DNA was either extracted purified chromosomal DNA or a bacterial colony Conditions for amplification were as follows 30 cycles of denaturation 94°C, 1 mm , annealing 52°C, 0 5 min , and extension 72°C, 1 5 min Amplified products were separated on a 1 % agarose gel and visualized with ethidium bromide A direct colony amplification procedure was adapted, which shortened template preparation by eliminating the necessity of extracting chromosomal DNA

The procedure consisted of adding a single bacterial colony directly from the plate into the PCR reaction mixture and heating at 95°C for 10 minutes The remaining PCR steps were performed as outlined for extracted chromosomal DNA and are given above (ii) Enzyme digestion. Digestion of amplified products was performed as directed by the manufacturer for the designated enzymes in volumes of 20 μl Digestion products were analyzed by agarose (2% Metaphor agarose, FMC Corp , Rockland, Me ) gel electrophoresis and visualized after being stained with ethidium bromide Analysis of type 6B PsaA. Genomic DNA was partially digested by

SaiAAl was hgated to _9α/?.HI-dιgested pUCI S and used to transform E coh DH5α Recombinant colonies were selected for resistance to ampicilhn and the formation of white colonies in the presence of isopropyl-β-D-galactopyranoside (IPTG) and 5-bromo-4-chloro-3-ιndolyl-β-D-galactopyranosιde Colony immunoblot screening (using anti-PsaA MAb) of approximately 2,500 colonies yielded two positive clones, which were selected, purified, and rescreened by Western blot analysis using the same MAb They both expressed a protein reactive with MAb to PsaA and which migrated in SDS-PAGE with the expected molecular mass of approximately 37-kDa One was selected for continued study and was designated pSTR6 Limited restriction enzyme analysis of DNA from the recombinant plasmid showed that the positive clone contained an insert that was 3 5 kb with sites for enzymes Clal EcoRl. and H.«dHI To localize the PsaA coding region, the insert was double digested with Ss/l (multiple cloning site in vector) and Hinάlll The resultant fragments were hgated into pUC 18 and

35 99/45121

transformed into £ coh DH5 This generated a recombinant containing an insert of about 1 3 kb in size The resultant subclone pSTRόy, when analyzed by SDS- PAGE and Western blot using anti-PsaA MAb, was shown to express full length PsaA immuno-reactive protein The complete nucleotide sequence on both strands of the 1 3-kb insert was determined by cycle sequencing of the plasmid subclone using ohgonucleotide primers complementary to the sequence These were made as sequence information became available The nucleotide sequence of the entire streptococcal insert is set forth in the Sequence Listing as SEQ ID NO 1 The single open reading frame (ORF) present, beginning at nucleotide 189 and ending at nucleotide 1 1 17, encodes the psaA gene sequence This ORF is 930 nucleotide long and when amplified and subcloned into vector systems such as pGEM (Promega, Madison, Wis ) and BAC-to-BAC™ expression system (Bethesda Research Laboratories, Gaithersburg, Md ) expresses full-length PsaA, reactive with anti-PsaA MAb antibodies This ORF encodes a peptide of 309 amino acids with a deduced molecular weight of 34,598 and an isoelectπc point of 5 23 Analysis of the peptide using the algorithm of Ky te et a . 1982, ("A simple method for display g the hydropathic character of a protein " J Mol Biol 157 105-132) shows that the peptide contains a major hydrophobic region of 20 amino acids which encodes a putative leader sequence This leader contains the consensus sequence for signal peptidase cleavage (LXXC) Removal of this leader would result in a peptide of molecular mass 32.465 with a predicted lsoelectπc point of 4 97 A consensus sequence for a πbosomal binding site (Shine et al 1974. "The 3'-termιnal sequence of E coh 16S πbosoma! RNA complementarity to nonsense triplets and πbosomal binding sites " Proc Natl Acad Sc USA 71 1324- 1346) is located 5 nucleotides upstream of the ATG start codon

Comparison of the serotype 6B sequence with streptococcal homologs. Comparison of the serotype 6B PsaA nucleotide sequence (Bilofsky et al 1988 A GenBank genetic sequence database Nucleic Acids Res 16 1861-1864) (GenBank accession number U53509) and its flanking regions with the previously published strain R36A psaA sequence (Sampson et al 1994 "Cloning and nucleotide sequence analysis of psaA the Streptococcus pneumoniae gene encoding a 37- kilodalton protein homologous to previously reported Streptococcus sp adhesins " Infect Immun 62 3 3 9-324) shows the differences between the nucleotide sequences The computed homology between the two sequences is 74% Major

- 36 O 99/45121

areas of discord are in regions upstream and downstream of the ORF and in the initial 60 nucleotide which encode the putative signal peptide When the two PsaA coding sequences are compared, the sequence homology increases to 78% Serotype 6B sequence was also compared to the psaA DNA sequence for another vaccine serotype, serotype 2, which was recently submitted to GenBank (Accession number U40786) Computer analysis of these two sequences shows that they are very similar, with computed DNA homology percentages of 99% between the two psaA DNA sequences There are eight single base differences between the two sequences A comparison of serotype 2 and 6B PsaAs shows almost complete identity the computed similarity value is 99 3 The eight base difference at the nucleotide level translated into a difference at the peptide level of six amino acids with two of the changes resulting in conservative substitutions Further analyses and comparisons of the serotype 6B sequence to the other five GenBank PsaA homologues from viπdans Streptococci and £ faecahs (Fenno et al 1989 "Nucleotide sequence analysis of a type I fimbπal gene of Streptococcus sanguis

FW213 " Infect Immun, 57 3527-3533. Sampson et al 1994 "Cloning and nucleotide sequen analysis of psaA, the Streptococcus pneumoniae gene encoding a 37-kιlodalton protein homologous to previously reported Streptococcus sp adhesins " Infect Immun 62 319-324. Ganeshkumar et al 1991. "Nucleotide sequence of a gene coding for a saliva-binding protein (SsaB) from Streptococcus sanguis 12 and possible role of the protein in coaggregation with actinomyces " Infect Immun 59 1093-1099, Kolenbrander et al 1994 "Nucleotide sequence of the Streptococcus gordoml PK488 coaggregation adhesin gene scaA and ATP- binding cassette " Infect Immun 62 4469-4480, and Lov e et al 1995 "Cloning of an Entcrococcus fa cahs endocarditis antigen homology with some adhesins from oral streptococci " Infect Immun 63 703-706) revealed significant sequence similarity between them Sequence identities were 81%, 81%, 77%, 82%, and 57%, respectively , for PsaA (S pneumoniae strain R36A), SsaB (S sanguis). FimA (S parasanguis). ScaA (S gordonu) and EfaA (E faecahs) Additionally, all six sequences showed great similarity in organization They have a hydrophobic leader peptide containing the prohpoprotein consensus sequence LXXC (for signal peptidase II cleavage) within the first 1 7-20 amino acids This N-terminal leader sequence appears to represent the area of greatest variability It is followed by a

37 - region of high similarity from amino acids 36 to 150 The region from 150 to 198 is a variable region and is followed by another conserved region (198 to 309)

PCR-RFLP analysis of chromosomal DNA from the 23 serotype strains in a 23-valent vaccine. PCR-RFLP was used to examine the degree of 5 conservation of the gene among 23 S pneumoniae serotypes, representing the 23 serotypes in a 23-valent vaccine Since previous attempts to amplify pneumococcal type strains with primers corresponding to strain R36A were unsuccessful, primers for PCR were selected from N-terminal and C-terminal sequences of serotype 6B Using primers complementary to serotype 6B, the psaA gene from all 23 serotypes lo and subtypes represented in the 23-valent vaccine was amplified from chromosomal

DN A A total of 10 enzymes were chosen that had restriction endonuclease digestion sites throughout the entire length of the serotype 6B psaA gene Nine of the 10 enzymes give identical patterns for all 23 psaA genes analyzed

The one exception, restriction enzyme Tsp5091, had six sites within the gene

15 and generated seven fragments upon digestion with sizes of 7, 30, 68, 146. 151 ,

1 66. and 362 bp When these fragments are separated on 2% metaphor agarose gel, a five-band pattern car )e seen (7- and 30-bp fragments are not seen on these gels because of their small size) For 21 of 23 serotypes this five-fragment enzyme pattern was obtained, but for strains of serotype 4 and 33F, the 146-bp fragment is

2o absent and two new fragments appear flanking the 68-bp fragment making a total of seven bands This increase in fragment number results from the presence of an extra Tsp^09] site within the 146-bp fragment To ascertain the prevalence of this extra site, the Tsp509l patterns of 3 to 4 additional strains of each of 23 serotype strains (additional strains of serotype 2 and serotype 25 were not available) were

25 analyzed All strains analyzed were random clinical isolates from the United States that had been submitted to CDC for serotyping The majority of the 80 strains were blood isolates, exceptions were 2 from cerebrospmal fluid, 2 from pleural fluid, and 1 each from the eye and nose Of the strains analyzed, 10% had the extra Tsp509l site, resulting in the altered RFLP pattern This modification was i^p seen only in types 4. 8, 1 I F, and 33F In an attempt to determine the prevalence of this altered pattern, the psaA gene from 8 additional strain:, of these 4 types was analyzed for the Tsp509l variation (bringing the total to 1 1 - 12 for these 4 types) Table 1 summarizes the analyses of serotypes 4, 8, 11A, and 33F The modified pattern is sporadically present in serotypes 4 and 8, but is essentially always

38 - O 99/45121

present in 1 1 of 12 strains of 11A and all strains of 33F The occurrence of this pattern could not be correlated with geographic location or region of the United States since strains that showed variation came from diverse regions of the country All strains of types 4, 8, UA, and 33F were blood isolates except one 33F strain, which was a nasal isolate, thus the relevance of the site of isolation on prevalence of this modification could not be assessed

TABLE 1. Screening of selected serotypes for additional Tsp5091 restriction site

Ratio of serotypes with Total serotypes with additional site to total unique patterns no. of serotypes tested

Seroty pe Expt. #1" Expt. #2^b % Unique pattern

4 1/3 3/9 33 (4/12)^{^}

8 3 4 4 '9 44 (7/13)

1 1 A 2/3 p '9 92(1 1/12)

33F 3/3 < ; 100(12/12)

^a Initial Tsp509] analysis which included survey of 2-3 strains each of all 23 vaccine ty pes ^b Tsp509l analv sis of more strains of types showing additional £5 75091 site

' Shown in parenthesis is ratio of number with additional site to number tested

This analysis discloses the cloning and sequencing of the gene encoding PsaA from S pneumoniae serotype 6B and a subsequent analysis of the gene in the 23 pneumococcal polysacchaπde vaccine serotypes Sequence analysis revealed that the serotype 6B sequence and the previously published strain R36A were less similar than expected The nucleotide sequence and its flanking regions were only 73% homologous to the original strain R36 A psaA with the actual PsaA coding sequences had a computed homology of 78% Protein sequeiice similarity between the two sequences was onlv 81 % A comparison of the serotype 6B sequence with the newly submitted serotype 2 pneumococcal psaA (a vaccine serotype) gave computed DNA homology values of 99% and 98% protein sequence similarity These values are evidence of the high sequence conservation for the gene within the vaccine serotvpes Moreover, when the deduced amino acid sequences of these

- 39 two sequences were compared with other published sequences for PsaA homologues within the genus, large areas of similarity were evident for all five proteins Similarity values within the group ranged from 57% to 82%

The need for a Streptococcus pneumoniae vaccine candidate prompted us 5 to clone and sequence the psaA gene from S pneumoniae serotype 6B The heterogeneity between the two pneumococcal psaA genes (6B and R36A) led us to examine the vaccine serotypes to determine the degree of diversity among strains Primers homologous with the N terminus and C terminus of the serotype 6B sequence amplified all 23 of the vaccine serotypes PCR-RFLP analysis using 10 l(' different restriction enzymes representing 21 sites within the serotype 6B gene and shows only one area of diversity, which resulted in an additional Tsp5Q9\ site for a small number of strains This study demonstrates that the serotype 6B gene sequence is representative of the sequence found among the vaccine serotypes Evidence for this includes the 99% DNA sequence identity between serotype 2 and

15 serotype 6B and the uniform and identical restriction patterns covering the 21 sites examined in this study It is clear that the earlier strain R36 A psaA sequence represents a variant sequence seemingly not pn ent in the serotypes that were analyzed here since we were unable to amplify them using primers to strain R36A psaA The more important aspect of this study, however, is that there is limited '¹ diversity among the vaccine serotypes analyzed These are the serotypes that cause disease and thus, the ones against which prophylactic measures are needed The lack of genetic diversity of psaA among these serotypes suggests that gene is highlv conserv ed and is an excellent candidate for vaccine development

Example 9. Monoclonal Antibodies 5 The 37-kDa protein from serotype 22F was used to generate monoclonal antibodies 1 B6E12H9, 3C4D5C7. 4E9G9D3, 4H5C10F3, 6F6F9C8, and 8G12G1 1B 10 (disclosed in United States Patent Application Ser No 08715,13 1 , incorporated herein by reference) The MAbs were analyzed for their ability to confer protection from infection by Streptococcus pneumoniae Table 2 shows that

10 of 5 monoclonal antibodies tested, one in particular gave efficient protection from subsequent S pneumoniae challenge (8G12G1 1B 10) The protection from S pneumoniae was dose-responsive, demonstrating that the monoclonal antibody was responsible for the protection (Table 3)

40 O 99/45121

TABLE 2. Passive protection of five Anti-37-kDa monoclonal antibodies in an infant mouse model to Streptococcus pneumoniae serotype 6B.

Death

37-kDa MAb Bacteremia @ 48 h @ 14 d

Cell Line" @ 48 h (%) (%) (%)

1E7A3D7C2 100 100 100

8G12G1 1B 10 100 0 20

4E9G9D3 100 80 100

6F6F9C8 100 60 100

1B6E12H9 100

80 100 ^a Challenge dose (1 7 X 10' cfu) or lOx bacteremic dose 100% (BD_U10) Fιve,mιce group given 50 μg total antibody All MAbs are IgG

TABLE 3. Effect of a Second Dose on the Passive Protective Potential of the Anti-37-kDa Monoclonal Antibody 8G12G11B10.

MAb Dose Level Bacteremia Death

(μg) @48 h @48 h @10 d

Pre Pos % Avg cfu 'mi % %

50 ___ 100 1 2 X 1 0⁴ 0 30

50 50 80 1 0 X 10⁴ 0 50

5 — 100 4 7 X 10⁴ 70 100

5 5 100 3 0 X 10⁴ 50 80

— -- 100 > 1 (T 80 100

"All infant mice were challenged with 10 X BC_{I OO} (2 X 10³ cfu) MAb given 24 h prior to and 24 h after (post-) challenge 10 mice/group

- 41 O 99/45121

Example 10 Phage Display Library

A phage display library containing inserts of 15 ammo acid residues located at the N-terminal part of the pill coat protein (Parmley and Smith, 1988) was constructed in the phage FUSE 5 as vector The library was made by hgating a synthetic 33 bp Bgll fragment into FUSE 5 and transfecting E coh Kql/kan+ cells by electroporation The phage progeny contain the display library

Example 11. Screening b\ Biopanning

Four cycles of biopanmng were carried out for each of the MAbs employed in order to screen the phage library of the PsaA peptides prepared in Example 10 (Smith and Scott 1993 Meth Enzymol 217 228-257) The substrate of a Petπ dish was coated with streptavidin and ten μg of biotinylated anti-PsaA MAb as prepared in Example 1 The remaining biotin binding sites were blocked with 1 5 mL of D- biotin (10 mM) The phage library (10" to 10^ι: transforming units) was then incubated with the immobilized MAb Bound phage were eluted from the streptavidin coated plates with 0 1 N HC1, pH 2 2 The eluted pha e were titrated and amplified, and then subjected to two further rounds of selectio.. performed as above The amount of biotinylated MAb used was 1 nM and 1 pM, respectively, in the second and third rounds, so that only high affinity peptides were bound by the end of the last cycle

Example 12 Amino Acid Sequences of Immunogenic Peptides

High affinity specimens from the library obtained using the procedures of Example 1 1 were propagated and sequenced For each MAb, ten phage specimens resulting from the selection process were sequenced Approximately 1 μg of single-stranded DNA was purified by phenol and chloroform extraction, ethanol precipitated and resuspended in 7 μL water Sequencing reactions were performed using a 27-mer primer complementary to the FUSE 5 vector sequence derived from a region in wild-type pill common to all fd-tet derived vectors and ^3SS Sequenase version 2 (L S Biochemicals, Cleveland OH) The sequences obtained are shown in Table 4 Thev were compared to known sequences of PsaA strains 2 and 6B using ClustalV and tFasta programs to identify the epitope on the PsaA with which each peptide is aligned most closely These epitope positions are also given in Table 4 The peptide obtained using MAb's 8G12, 6F6. and 1E7 align to PsaA

- 42 - O 99/45121

best when an additional residue is present on the protein where the gap appears after residue 13 of the peptide (SEQ ID NO 7 and SEQ ID NO 8)

Table . Peptide Sequences Obtained by Biopanning with MAbs

MAb Sequence SEQ ID NO: PsaA Res. Nos.

4E9 TVSPVPWTAWAFHGY 5 132-136

1B6 RSY HDLRAYGF RL 6 206-22C

8GI2 LVRRFVHRRPHVE-SQ 7 252-26" ere LVRRFVHHRPHVE-SQ 8 252-267

IE^"7 8 252-26^"

Example 14. Immunization of Mice with Immunogenic Peptides of PsaA

Peptides having the sequences set out in SEQ ID NOs 5, 6, 7, and 8 are to be synthesized in an automated peptide synthesizer The peptides are to be purified bv reversed phase HPLC. and the principal peak is to be collected Their sequences are to be v erified by automated peptide sequencing, using an automated sequencing apparatus such as that manufactured by Beckman Instruments, Inc . Mountain View, CA Each peptide is to be conjugated to keyhole limpet hemocyanin using coupling mediated by water-soluble carbodπmide reagent The resulting conjugate is to be dissolved at a final concentration of about 180 μg/ml in phosphate buffered saline pH 7 2 and combined at an approximate 1 1 ratio in emulsion with Freund's incomplete adjuvant (Sigma Chemical Co , St Louis, MO) BALB c mice are to be initially immunized lntrapeπtoneally with this suspension, and one month later, the mice are to be boosted with about 1 10 μg/ml conjugate without adjuv nt

43 -

Claims

O 99/45121

We claim

1 A peptide that lmmunospecifically binds to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA

2 The peptide described in claim 1 wherein the monoclonal antibody is chosen from the group consisting of 1B6E12H9, 3C4D5C7. 4E9G9D3, 4H5C10F3. 6F6F9C8, 8G12G1 1B10, and 1E7A3D7C2

3 The peptide described in claim 1 wherein the peptide is 10-25 residues in length

4 The peptide described in claim 1 wherein the peptide is 12-22 residues in length

5 The peptide described in claim 1 wherein the peptide is 15 residues in length

6 The peptide described in claim 1 which is immunogenic against S pneumoniae comprising residues whose sequence is chosen from the group consisting of SEQ ID NO 5, SEQ ID NO 6. SEQ ID NO 7, SEQ ID NO 8, a fragment of SEQ ID NO 5. a fragment of SEQ ID NO 6. a fragment of SEQ ID NO 7. and a fragment of SEQ ID NO 8

7 A peptide whose sequence results from the method comprising the steps of

(a) providing a library comprised of random ohgonucleotides, wherein the ohgonucleotides are about 30-45 nucleotides in length,

(b) splicing the ohgonucleotides of the library into the gene for the gene III coat protein of a filamentous bacteriophage in frame with the codons for the amino acid residues of the coat protein, wherein the gene for the gene III coat protein is contained within the bacteriophage genome, thereby creating a bacteriophage library , and wherein the ohgonucleotides are positioned within the gene such that.

44 PC17US99/04326 O 99/45121

when the coat protein is expressed and incorporated into a complete bacteriophage particle, the peptide is available as an epitope to which an antibody can bind.

(c) expanding the bacteriophage library harboring the ohgonucleotide library by cultuπng the bacteriophage library in a host which the bacteriophage infects,

(d) screening the expanded bacteπophage library for a specific bacteriophage particle that lmmunospecifically reacts with a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae pneumococcal surface adhesion A protein (PsaA) , and

(e) sequencing the gene for the coat protein of the specific bacteriophage particle obtained in step (d) thereby yielding the nucleotide sequence of that member of the ohgonucleotide library whose translation product has the sequence of the peptide potentially capable of eliciting protective immunity against Streptococcus pneumoniae

8 A therapeutic composition comprising one or more peptides that l munospecifically bind to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA, and an immunostimulatory carrier, wherein the therapeutic composition confers protective immunity against S pneumoniae infection when administered to a subject

9 The therapeutic composition described in claim 8, wherein at least one peptide is 10-25 residues in length

10 The therapeutic composition described in claim 8 wherein at least one peptide is 12-22 residues in length

1 1 The therapeutic composition described in claim 8 wherein at least one peptide is 15 residues in length

12 A therapeutic composition comprising one or more peptides that lmmunospecifically bind to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA and that are immunogenic against S pneumoniae. the peptides comprising residues whose

- 45 sequences are chosen from the group consisting of SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, a fragment of SEQ ID NO 5, a fragment of SEQ ID NO 6, a fragment of SEQ ID NO 7, and a fragment of SEQ ID NO 8, and an immunostimulatory carrier, wherein the therapeutic composition confers protective immunity against S pneumoniae infection when administered to a subject

13 A method for conferring protective immunity in a subject against S pneumoniae infection, said method comprising the step of administering to the subject a therapeutic composition comprising one or more peptides that lmmunospecifically bind to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA and that are immunogenic against S pneumoniae, the therapeutic composition further comprising an immunostimulatory carrier

14 The method described in claim 13, wherein the peptides comprise residues whose sequences are chosen from the group consisting of SEQ ID NO 5, SEQ ID N 6, SEQ ID NO 7, SEQ ID NO 8. a fragment of SEQ ID NO 5, a fragment of SEQ ID NO 6, a fragment of SEQ ID NO 7, and a fragment of SEQ ID NO 8

15 A peptide comprising a sequence which is at least 80% identical to a peptide whose sequence is chosen from the group consisting of SEQ ID NO 5 or an immunogenic fragment thereof. SEQ ID NO 6 or an immunogenic fragment thereof. SEQ ID NO 7 or an immunogenic fragment thereof, and SEQ ID NO 8 or an immunogenic fragment thereof

16 A therapeutic composition comprising one or more of the peptides described in claim 15 and an immunostimulatory carrier, wherein the therapeutic composition confers protective immunity against S pneumoniae infection when administered to a subject

17 A method for conferring protective immunity in a subject against S pneumoniae infection, comprising the step of administering to the subject the therapeutic composition described in claim 16

46 O 99/45121

18 A therapeutic composition comprising one or more of the peptides described in claim 15 and an adjuvant, wherein the therapeutic composition confers protective immunity against S pneumoniae infection when administered to a subject

19 A method for conferring protective immunity in a subject against S pneumoniae infection, comprising the step of administering to the subject the therapeutic composition described in claim 18

20 A therapeutic composition comprising one or more peptides that lmmunospecifically bind to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA and that are immunogenic against S pneumoniae, the peptides comprising residues whose sequences are chosen from the group consisting of SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8. a fragment of SEQ ID NO 5, a fragment of SEQ ID NO 6. a fragment of SEQ ID NO 7. and a fragment of SEQ ID NO 8, and an adjuvant, wherein the nerapeutic composition confers protective immunity against S pneumoniae infection when administered to a subject

21 A method for conferring protective immunity in a subject against S pneumoniae infection, said method comprising the step of administering to the subject a therapeutic composition comprising one or more peptides that lmmunospecifically bind to a monoclonal antibody obtained in response to immunizing an animal with Streptococcus pneumoniae PsaA and that are immunogenic against S pneumoniae, the therapeutic composition further comprising an adjuvant

22 The method described in claim 19, wherein the peptides comprise residues whose sequences are chosen from the group consisting of SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8, a fragment of SEQ ID NO 5, a fragment of SEQ ID NO 6. a fragment of SEQ ID NO 7, and a fragment of SEQ ID NO 8

47