WO1999038883A1 - Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method - Google Patents

Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method Download PDF

Info

Publication number
WO1999038883A1
WO1999038883A1 PCT/US1999/002387 US9902387W WO9938883A1 WO 1999038883 A1 WO1999038883 A1 WO 1999038883A1 US 9902387 W US9902387 W US 9902387W WO 9938883 A1 WO9938883 A1 WO 9938883A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
chromosome
specific
bovine
Prior art date
Application number
PCT/US1999/002387
Other languages
French (fr)
Inventor
Alan D. Dean
Original Assignee
Xy, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xy, Inc. filed Critical Xy, Inc.
Priority to EP99906729A priority Critical patent/EP1058688A4/en
Priority to US09/601,599 priority patent/US6617107B1/en
Publication of WO1999038883A1 publication Critical patent/WO1999038883A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6879Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination

Definitions

  • EE Estonia LR Liberia SG Singapore practically important to recognize the gender in some applications by detecting the presence of the unique Y chromosome in male cells or tissues.
  • the identification of the presence of any portion of a male chromosome can be important for a number of reasons.
  • One of the reasons is the identification of tissues or meat by gender after the tissues have been removed from the animal and disbursed through marketing channels. By identifying for instance the gender (bull or cow in this case), a determination of proper purchases, representations, and quality of the tissues may be made. Therefore, efforts of designing appropriate primers have been undertaken and a pair of primers specifically identifying a portion of bovine Ychromsome has been successfully designed by the present inventor.
  • Several aspects of the general bovine sequence had been previously identified prior to the present invention.
  • an object of this invention is a set of oligonucleotide primers [sequence 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l)] and [sequence 5' - TGGTCGCTGATCAGGATGGAA- 3* (SEQ ID No. 2)] for PCR amplification of a portion of bovine Y chromosome DNA sequence.
  • An additional object of this invention is the demonstration of the specificity of the above oligonucleotide primers for use in detecting the presence of a portion of bovine Y chromosome DNA sequence. This demonstration is specific only to a region of the Y chromosome sequences in bulls but not specific to other chromosome DNA sequences in bulls and chromosome sequences in cows.
  • oligonucleotide primers [5'- GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l) and 5' - TGGTCGCTGATCAGGATGGAA- 3' (SEQ ID No. 2)] to amplify a portion of the bovine Y chromosome DNA sequence.
  • the bovine species used in this invention in particular is Bos taurus but these primers might be used in other bovine species and, to some extent, even in species other than bovines.
  • Figure 1 shows the electrophoretic results of the amplification products obtained using Y-specific primers.
  • Figure 2 shows the electrophoretic results of the amplification products obtained using primers specific for the bovine prion gene as a control.
  • the first nucleotide sequence is a forward primer 5'
  • the second nucleotide sequence is a reverse primer 5 1
  • the present invention uses PCR technique to amplify a portion of a particular bovine sequence.
  • This sequence may be a portion the Bos taurus testis- specific protein, Y-encoded (TSPY) gene.
  • TSPY Y-encoded
  • other sequences than bovine sequences might be identified using these primers, and so the invention may not be restricted to just bovine sequences.
  • This invention has uniquely identified two primers that are complementary to this bovine sequence found only in the Y chromosome, the Bos taurus TSPY gene. While other sequences have been used to identify other aspects of the Y chromosome, apparently these primers are uniquely designed to identify this portion of the Y chromosome.
  • the preferred embodiment of this invention is a specific set of oligonucleotide primers ([SEQ. ID No. 1] and [SEQ. ID No.2]) for PCR amplification of a specific region of the bovine Y chromosome DNA sequence.
  • Any oligonucleotide probe may be used that is internal to the sequence amplified by the PCR primers ([SEQ. LD No. 1] and [SEQ. LD No. 2]).
  • the label can be any one of the art recognized labels commonly used in DNA blotting.
  • Reverse primer 100 ng/ ⁇ l 5'-TGG TCG CTG ATC AGG ATG GAA-3';
  • Bovine Test DNA (10-50 ng/reaction). Master mix for 50 ⁇ l reaction was prepared following the following recipe:
  • thermocycler parameter settings were as follows:
  • Both the forward (SEQ LD NO.l) and reverse primers (SEQ LD NO. 2) were evaluated for their ability to amplify a portion of Y chromosome sequence.
  • SEQ LD NO.l forward and reverse primers
  • SEQ LD NO. 2 reverse primers
  • the forward primer (SEQ NO. 1) is 5'-GTG ATC CGG CAT ATA GCT GAG A-3' and the reverse primer (SEQ NO. 2) is 5'-TGG TCG CTG ATC AGG ATG GAA-3'.
  • these primers may be varied in length or other alterations as long as the functional aspects were retained to hybridize with and to amplify the TSPY gene to indicate gender. This could include from 8-20 nucleotides of the sequences.
  • These primers amplify using the PCR method approximately 488 base pair product of the Y chromosome.
  • any buffering means or any buffering proportions which produce similar or acceptable results in conjunction with SEQ LD NO.l and SEQ LD NO.2 to identify a specific region of the Y chromosome should be considered included in this invention.
  • the present invention is also directed to a kit or reagent system useful for practicing the methods described herein.
  • a kit will contain a reagent combination comprising the essential elements required to conduct an assay according to the methods disclosed herein.
  • the reagent system is presented in a commercially packaged form, as a composition or admixture where the compatibility of the reagents will allow, in a test device configuration, or more typically as a test kit, i.e., a packaged combination of one or more containers, devices, or the like holding the necessary reagents, and usually including written instructions for the performance of assays.
  • the kit of the present invention may include any configurations and compositions for performing the various assay formats described herein.
  • the reagent system will comprise a pair of oligonucleotide primers that flank the DNA sequence of interest which is to be amplified and detected, as described herein.
  • those primers are (1) SEQ LD NO: 1 and (2) SEQ LD NO:2 and they may be detectably labeled.
  • the kit will also contain additional reagents useful in carrying out a PCR amplification.
  • a kit according to the present invention can additionally include ancillary chemicals such as the buffers and components of the solution in which binding of the oligonucleotide to the target DNA takes place.
  • buffering such a disclosure should be understood to encompass disclosure of a “buffer.” Such changes and alternative terms are to be imderstood to be explicitly included in the description.

Abstract

This invention is a specific set of oligonucleotide Polymerase chain reaction (PCR) primers [5' -GTGATCCGGCATATAGCTGAGA-3' (SEQ ID No. 1) and 5' - TGGTCGCTGATCAGGATGGAA- 3' (SEQ ID No. 2)] for specific polymerase chain reaction (PCR) amplification of a region of the bovine male-specific chromosome sequence.

Description

FOR THE PURPOSES OF INFORMATION ONLY
Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT.
AL Albania ES Spain LS Lesotho SI Slovenia
AM Armenia FI Finland LT Lithuania SK Slovakia
AT Austπa FR France LU Luxembourg SN Senegal
AU Australia GA Gabon LV Latvia sz Swaziland
AZ Azerbaijan GB United Kingdom MC Monaco TD Chad
BA Bosnia and Herzegovina GE Georgia MD Republic of Moldova TG Togo
BB Barbados GH Ghana MG Madagascar TJ Tajikistan
BE Belgium GN Guinea MK The former Yugoslav TM Turkmenistan
BF Burkina Faso GR Greece Republic of Macedonia TR Turkey
BG Bulgaria HU Hungary ML Mali TT Trinidad and Tobago
BJ Benin IE Ireland MN Mongolia UA Ukraine
BR Brazil IL Israel MR Mauritania UG Uganda
BY Belarus IS Iceland MW Malawi S United States of Ameπca
CA Canada IT Italy MX Mexico uz Uzbekistan
CF Central African Republic JP Japan NE Niger VN Viet Nam
CG Congo KE Kenya NL Netherlands YU Yugoslavia
CH Switzerland KG Kyrgyzstan NO Norway zw Zimbabwe
CI Cδte d'lvoire KP Democratic People's NZ New Zealand
CM Cameroon Republic of Korea PL Poland
CN China KR Republic of Korea PT Portugal
CU Cuba KZ Kazakstan RO Romania
CZ Czech Republic LC Saint Lucia RU Russian Federation
DE Germany LI Liechtenstein SD Sudan
DK Denmark LK Sri Lanka SE Sweden
EE Estonia LR Liberia SG Singapore
Figure imgf000003_0001
practically important to recognize the gender in some applications by detecting the presence of the unique Y chromosome in male cells or tissues. The identification of the presence of any portion of a male chromosome can be important for a number of reasons. One of the reasons is the identification of tissues or meat by gender after the tissues have been removed from the animal and disbursed through marketing channels. By identifying for instance the gender (bull or cow in this case), a determination of proper purchases, representations, and quality of the tissues may be made. Therefore, efforts of designing appropriate primers have been undertaken and a pair of primers specifically identifying a portion of bovine Ychromsome has been successfully designed by the present inventor. Several aspects of the general bovine sequence had been previously identified prior to the present invention. However, among the aspects unique to this invention are the particular and specific primers complementary to the particular sequence of the bovine male chromosome. Despite attempts by others in the art to test or probe for the Y chromosomes, apparently it escaped those in the field to create such primers uniquely designed to amplify the specific region of the sequence on the Y chromosome to indicate the gender. While other primers may exist in the marketplace, these primers are unique. By simply using these primers on the tissues, a ready identification of the gender may be made. The prior references do not teach effective or suitable primers to the extent now shown.
ffl. DISCLOSURE OF THE INVENTION
Accordingly, an object of this invention is a set of oligonucleotide primers [sequence 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l)] and [sequence 5' - TGGTCGCTGATCAGGATGGAA- 3* (SEQ ID No. 2)] for PCR amplification of a portion of bovine Y chromosome DNA sequence.
An additional object of this invention is the demonstration of the specificity of the above oligonucleotide primers for use in detecting the presence of a portion of bovine Y chromosome DNA sequence. This demonstration is specific only to a region of the Y chromosome sequences in bulls but not specific to other chromosome DNA sequences in bulls and chromosome sequences in cows.
These and additional objects of the invention are accomplished by application of standard PCR methodology employing the oligonucleotide primers [5'- GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l) and 5' - TGGTCGCTGATCAGGATGGAA- 3' (SEQ ID No. 2)] to amplify a portion of the bovine Y chromosome DNA sequence. The bovine species used in this invention in particular is Bos taurus but these primers might be used in other bovine species and, to some extent, even in species other than bovines.
IV. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the electrophoretic results of the amplification products obtained using Y-specific primers.
Figure 2 shows the electrophoretic results of the amplification products obtained using primers specific for the bovine prion gene as a control.
SEQUENCE LISTING FREE TEXT
The first nucleotide sequence is a forward primer 5'
GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l).
2. The second nucleotide sequence is a reverse primer 51
TGGTCGCTGATCAGGATGGAA - 3' (SEQ ID No.2).
VI. BEST MODE FOR CARRYING OUT THE INVENTION
As can be easily understood, the basic concepts of the present invention may be embodied in a variety of ways. It involves techniques as well as devices to accomplish the appropriate invention. In this application, the techniques are disclosed as part of the results shown to be achieved by the various sequences described and as steps which are inherent to utilization. They are simply the natural result of utilizing the sequences as intended and described. In addition, while the sequences are disclosed, it would be understood that these not only accomplish certain methods but also can be varied in a number of ways. Importantly, as to all of the foregoing, all of these facets should be understood to be encompassed by this disclosure.
In the preferred embodiment, the present invention uses PCR technique to amplify a portion of a particular bovine sequence. This sequence may be a portion the Bos taurus testis- specific protein, Y-encoded (TSPY) gene. However, other sequences than bovine sequences might be identified using these primers, and so the invention may not be restricted to just bovine sequences. This invention has uniquely identified two primers that are complementary to this bovine sequence found only in the Y chromosome, the Bos taurus TSPY gene. While other sequences have been used to identify other aspects of the Y chromosome, apparently these primers are uniquely designed to identify this portion of the Y chromosome.
The preferred embodiment of this invention is a specific set of oligonucleotide primers ([SEQ. ID No. 1] and [SEQ. ID No.2]) for PCR amplification of a specific region of the bovine Y chromosome DNA sequence. Any oligonucleotide probe may be used that is internal to the sequence amplified by the PCR primers ([SEQ. LD No. 1] and [SEQ. LD No. 2]). The label can be any one of the art recognized labels commonly used in DNA blotting.
Two oligonucleotides, [5'-GTGATCCGGCATATAGCTGAGA- 3' (SEQIDNo.l) and 5' -TGGTCGCTGATCAGGATGGAA- 3' (SEQ ID No. 2)], have been designed based on the
DNA sequence data of the bovine TSPY gene from GenBank. These two oligonucleotides function as specific primers for PCR amplification of the portion of the bovine TSPY gene. The PCR was performed following the protocol as disclosed herein in examples below. The results are described in detail below by the inventor.
Having described the invention in brief, the following examples are given to illustrate specific applications of the invention. These specific examples are not intended to limit the scope of the invention described in this application.
VII. EXAMPLES
The following were the amplification protocol, including the primer sequences, the reagents and the results.
1. PCR Amplification
The reagents used in this invention were listed as follows:
Molecular grade water (Sigma W-3500); dNTPs (10 mM mix of each deoxyribonucleoside-triphosphates); Taq DNA polymerase (5U/μl: Sigma D-1806. 10X reaction buffer is included);
10X reaction buffer (100 mM Tris-HCl, pH 8.3, 500 mM KC1, 15 mM MgCk);
Forward primer (100 ng/μl) 5'-GTG ATC CGG CAT ATA GCT GAG A-3';
Reverse primer (100 ng/μl) 5'-TGG TCG CTG ATC AGG ATG GAA-3'; and
Bovine Test DNA (10-50 ng/reaction). Master mix for 50 μl reaction was prepared following the following recipe:
Reagents Volume (u\)
Water 38.75
1 OX Buffer 5 dNTPs 1
Forward primer 2
Reverse primer 2
Taq polymerase 0.25
Figure imgf000007_0001
Bovine Test DNA 1
The amplification reaction parameters for the amplification cycles were denaturation for 1 min at 94 degree(s) C, annealing of primers for 1 rnin at 56 degree(s) C, and primer extension for 3 seconds at 72 degree(s) C. The thermocycler parameter settings were as follows:
Step Temperature Time
1 94°C 30 seconds
2 94°C 30 seconds
3 56°C 30 seconds
4 72°C 30 seconds (Repeat steps 2-4 for 30 cycles)
5 72°C 5 minutes
Figure imgf000008_0001
6 4 °C Soak
2. Demonstration of Specificity
Both the forward (SEQ LD NO.l) and reverse primers (SEQ LD NO. 2) were evaluated for their ability to amplify a portion of Y chromosome sequence. With a bull or steer DNA a 488 base pair product was amplified. The primers generated the appropriately-sized fragments from DNA preparations from blood samples of bulls when compared to the known standard DNA from bulls. The fact that the primers did not generate a detectable PCR product with DNA from cows suggests that the primers are Y-chromosome sequence specific.
The above example, incorporated as if fully set forth here in text, shows the procedure and results such that one with ordinary skill in the art could duplicate the efforts to produce the specific primers. As shown, the forward primer (SEQ NO. 1) is 5'-GTG ATC CGG CAT ATA GCT GAG A-3' and the reverse primer (SEQ NO. 2) is 5'-TGG TCG CTG ATC AGG ATG GAA-3'. Naturally, these primers may be varied in length or other alterations as long as the functional aspects were retained to hybridize with and to amplify the TSPY gene to indicate gender. This could include from 8-20 nucleotides of the sequences. These primers amplify using the PCR method approximately 488 base pair product of the Y chromosome. Naturally, as those with ordinary skill in the art would understand, the above primer sequences could vary to some degree such that the functional derivative would still be specific for a portion of the Y chromosome. Additionally, while specific reagents and buffers are described and while proportions are disclosed, a variety of buffers and reagents and varying proportions could be used in conjunction with the specific primers of SEQ LD NO.l and SEQ LD NO.2. Thus, for example any buffering means or any buffering proportions which produce similar or acceptable results in conjunction with SEQ LD NO.l and SEQ LD NO.2 to identify a specific region of the Y chromosome should be considered included in this invention. Similarly, any reagent means or any reagent proportions which produce similar or acceptable results in conjunction with SEQ LD
NO.l and SEQ LD NO.2 to identify a specific region of the Y chromosome should be considered included in this invention. Other parameters, such as the parameters of the thermocyler or other similar devices, could be varied to accomplish the goals and purposes of the invention.
The present invention is also directed to a kit or reagent system useful for practicing the methods described herein. Such a kit will contain a reagent combination comprising the essential elements required to conduct an assay according to the methods disclosed herein. The reagent system is presented in a commercially packaged form, as a composition or admixture where the compatibility of the reagents will allow, in a test device configuration, or more typically as a test kit, i.e., a packaged combination of one or more containers, devices, or the like holding the necessary reagents, and usually including written instructions for the performance of assays. The kit of the present invention may include any configurations and compositions for performing the various assay formats described herein.
In all cases, the reagent system will comprise a pair of oligonucleotide primers that flank the DNA sequence of interest which is to be amplified and detected, as described herein. Preferably, those primers are (1) SEQ LD NO: 1 and (2) SEQ LD NO:2 and they may be detectably labeled. Preferably, the kit will also contain additional reagents useful in carrying out a PCR amplification. A kit according to the present invention can additionally include ancillary chemicals such as the buffers and components of the solution in which binding of the oligonucleotide to the target DNA takes place.
Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.
7 The discussion included in this application is intended to serve as a basic description. The reader should be aware that the specific discussion may not explicitly describe all embodiments possible; many alternatives are implicit. The market place and manufacturing concerns may dictate the appropriate embodiments for the present invention. Particularly with respect to the discussion, it should be understood that a number of changes may be made without departing from the essence of the present invention. In this regard, it is intended that such changes — to the extent that they substantially achieve the same results in substantially the same way — will still fall within the scope of the present invention. It also may not fully explain the generic nature of the invention and may not explicitly show how each feature or element can actually be representative of a broader function or of a great variety of alternative or equivalent elements. Again, these are implicitly included in this disclosure. Where the invention is described in sequence-oriented terminology, each element of the sequence implicitly performs a function. Sequence discussions or claims may not only be included for the sequence described, but also method or process claims may be included to address the functions the invention and each element performs. Although the methods related to the system are being included in various detail, only an initial discussion directed toward the sequences have been included. Naturally, that discussion could have some application to the various other methods and aspects discussed throughout the disclosure. Neither the description nor the terminology is intended to limit the scope of the claims which will be included in a full patent application.
It should be understood that a variety of changes may be made without departing from the essence of the invention. Such changes are also implicitly included in the description. They still fall within the scope of this invention. A broad disclosure encompassing both the explicit embodiment(s) shown, the great variety of implicit alternative embodiments, and the broad methods or processes and the like are encompassed by this disclosure.
Each of the various elements of the invention and claims may also be achieved in a variety of manners. This disclosure should be understood to encompass each such variation, be it a functional derivative, such as under high stringency, a method or process embodiment of the sequences, or even merely a variation of any element of these. Particularly, it should be understood that as the disclosure relates to elements of the invention, the words for each element
8 may be expressed by equivalent terms or method terms — even if only the function or result is the same. Such equivalent, broader, or even more generic terms should be considered to be encompassed in the description of each element or action. Such terms can be substituted where desired to make explicit the implicitly broad coverage to which this invention is entitled. As but one example, it should be understood that all action may be expressed as a means for taking that action or as an element which causes that action. Similarly, each physical element or compositions disclosed should be understood to encompass a disclosure of the action which that physical element or composition facilitates. Regarding this last aspect, the disclosure of a "buffer" should be understood to encompass disclosure of the act of "buffering" — whether explicitly discussed or not — and, conversely, were there only disclosure of the act of
"buffering", such a disclosure should be understood to encompass disclosure of a "buffer." Such changes and alternative terms are to be imderstood to be explicitly included in the description.
In addition, it should be understood that, in the claims and in the application, the term
"comprising" is meant to have an inclusive meaning rather than an exclusive one. It should be interpreted in its most expansive form so as to afford the applicant the broadest coverage legally permissible. Therefore, in countries, such as Australia, this term is not intended to have an exclusive, or more limited, meaning.
Any references mentioned in the application for this patent are hereby incorporated by reference, however, to the extent statements might be considered inconsistent with the patenting of this invention such statements are expressly not to be considered as made by the applicant.

Claims

VIII. CLAIMSI claim:
1. A molecule which is a functional derivative of molecules having a sequence selected from the group comprising the sequences 5'-GTGATCCGGCATATAGCTGAGA-3' (SEQ LD NO: 1) and 5'-TGGTCGCTGATCAGGATGGAA-3' (SEQ LD NO:2), and which, in the presence of at least some bovine male chromosomal material from a sample, said functional derivative facilitates the priming of a chain reaction of repetitive reproduction of at least a portion of said bovine genetic material, and which facilitates an indication of the gender of the animal from which said sample was obtained.
2. A molecule according to claim 1 wherein said bovine genetic material comprises at least a portion of the bovine Y chromosome DNA sequence.
3. A molecule according to claim 2 wherein said at least a portion of the bovine Y chromosome DNA sequence comprises at least a portion of the bovine TSPY gene.
4. A molecule according to claim 1 wherein said functional derivative further facilitates the repetitive reproduction of a portion of said bovine genetic material which is approximately 488 base pairs long.
5. A molecule according to claim 1 wherein said molecule comprises DNA material.
6. A molecule according to claim 1 wherein said molecule comprises an oligonucleotide.
7. A molecule according to claim 1 wherein said molecule comprises a polymerase chain reaction primer.
8. A molecule according to claim 1, 2, 5, 6, or 7 wherein a complementary sequence of said molecule hybridizes with molecules having a sequence selected from the group
10 comprising the sequences 5'-GTGATCCGGCATATAGCTGAGA-3' (SEQ LD NO:l) and 5'- TGGTCGCTGATCAGGATGGAA-3' (SEQ ID NO:2).
9. A molecule according to claim 8 wherein said complementary sequence of said molecule hybridizes under high stringency conditions with molecules having a sequence selected from the group comprising the sequences 5'-
GTGATCCGGCATATAGCTGAGA-3' (SEQ LD NO:l) and 5'- TGGTCGCTGATCAGGATGGAA-3' (SEQ LD NO:2).
10. A molecule according to claim 1, 2, 5, 6, or 7 wherein said molecule comprises a sequence selected from the group comprising the sequences 5'- GTGATCCGGCATATAGCTGAGA-3' (SEQ ID NO: 1) and 5*-
TGGTCGCTGATCAGGATGGAA-3' (SEQ LD NO:2).
11. A molecule selected from the group comprising 5'- GTGATCCGGCATATAGCTGAGA-3' (SEQ LD NO.l) and 5'- TGGTCGCTGATCAGGATGGAA-3' (SEQ LD NO:2).
12. A molecule according to claim 11 wherein said molecule comprises a polymerase chain reaction primer.)
13. A composite molecule, comprising: a. a molecule according to claim 8; b. genetic material from said sample; and c. a polynucleotide chain created as a result of a polymerase chain reaction process.
14. A composite molecule according to claim 13, wherein said genetic material comprises genetic material indicative of the gender of the ariimal from which said sample was obtained.
15. A composite molecule according to claim 13 or 14 wherein said genetic material
11 indicative of the gender of the animal from which said sample was obtained comprises bovine genetic material.
16. A composite molecule according to claim 15 wherein said genetic material indicative of the gender of the animal from which said sample was obtained comprises bovine Y chromosome.
17. A composite molecule according to claim 13 or 14 wherein said genetic material comprises at least a portion of the bovine TSPY gene.
18. Meat determined as being from an animal of a particular sex through the use of a molecule according to claim 1.
19. Meat determined as being from an animal of a particular sex through the use of a molecule according to claim 8.
20. Meat determined as being from an animal of a particular sex through the use of a molecule according to claim 10.
21. Meat determined as being from an animal of a particular sex through the use of a molecule according to claim 11.
22. A meat gender identification kit comprising a molecule according claim 1.
23. A molecular fragment comprising from 8 to 20 oligonucleotides of a sequence selected from the group comprising the sequences 5'- GTGATCCGGCATATAGCTGAGA-3' (SEQ LD NO:l) and 5'- TGGTCGCTGATCAGGATGGAA-3' (SEQ LD NO:2).
24. A composition comprising a primer pair as used for amplifying DNA of the bovine TSPY gene by polymerase chain reaction wherein the primer pair comprises of 5'-
12 TGGTCGCTGATCAGGATGGAA-3' (SEQ ID No. 2).
25. A composition comprising a primer pair as used for amplifying DNA of the bovine TSPY gene by polymerase chain reaction as described in claim 56a wherein said bovine TSPY gene comprises Bos taurus TSPY gene.
26. A kit useful for detecting the presence of a portion of DNA sequence from Y chromosome, comprising:
a. a first container containing first oligonucleotide primer, 5'- GTGATCCGGCATATAGCTGAGA-3' (SEQ ID No.l), wherein said first oligonucleotide primer binds to a specific Y chromosome sequence. b. at least a second container containing a reagent useful in performance of a
Polymerase chain reaction amplification or detection.
27. A kit useful for detecting the presence of a portion of DNA sequence from Y chromosome, comprising:
a. a first container containing a second oligonucleotide primer, 5'- TGGTCGCTGATCAGGATGGAA-3' (SEQ ID No.2), wherein said second oligonucleotide primer binds to a specific Y chromosome sequence. b. at least a second container containing a reagent useful in performance of a Polymerase chain reaction amplification or detection.
28. A kit useful for detecting the presence of a portion of DNA sequence from Y chromosome as described in claim 26 or 27 wherein said first container contains both said first oligonucleotide primer (SEQ LD No.l) and said second oligonucleotide primer (SEQ LD No.2) wherein said first oligonucleotide primer (SEQ LD No.1) and said second oligonucleotide primer (SEQ LD No.2) each bind to a specific Y chromosome sequence.
29. A kit useful for detecting the presence of a portion of DNA sequence from Y
13 chromosome as described in claim 26 wherein said at least second container contains a DNA polymerase enzyme.
30. A kit useful for detecting the presence of a portion of DNA sequence from Y chromosome as described in claim 26 further comprises a third container containing a reagent for detecting said specific Y chromosome sequence after it has been amplified.
31. A method of detecting a specific Y chromosome sequence by Polymerase chain reaction, comprising the step of amplifying the specific Y chromosome sequence with a primer pair comprising of 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l) and 5' - TGGTCGCTGATCAGGATGGAA- 3' (SEQ LD No. 2).
32. A method of detecting a specific Y chromosome sequence by Polymerase chain reaction as described in claim 31 wherein said step of amplifying the specific Y chromosome sequence with a primer pair comprising of 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ LD No.1) and 5' -TGGTCGCTGATCAGGATGGAA- 3' (SEQ LD No.2) comprises the step of amplifying the specific bovine Y chromosome sequence with a primer pair comprising of 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ ID No.l) and 5' -
TGGTCGCTGATCAGGATGGAA- 3' (SEQ LD No. 2).
33. A method of identifying the gender of a sample comprising the step of amplifying a genetic sequence with a primer comprising 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ LD No.l).
34. A method of identifying the gender of a sample as described in claim 33 further comprising the step of amplifying said genetic sequence with a primer comprising 5' - TGGTCGCTGATCAGGATGGAA- 3' (SEQ LD No. 2).
35. A method of identifying the gender of a sample as described in claim 33 or 34 further comprising the step of amplifying the a genetic sequence with a primer pair comprising 5'-GTGATCCGGCATATAGCTGAGA - 3' (SEQ LD No.l) and 5' -
14 TGGTCGCTGATCAGGATGGAA- 3' (SEQ LD No. 2).
36. A method of amplifying a specific Y chromosome sequence by polymerase chain reaction, comprising the steps of:
a. establishing a specific Y chromosome sequence in a solution; b. providing a primer pair comprising 5'-GTGATCCGGC ATATAGCTGAGA - 3 '
(SEQ LD No.l) and 5* -TGGTCGCTGATCAGGATGGAA- 3' (SEQ LD No. 2) in said solution; c. denaturing said specific Y chromosome sequence; d. annealing each of said primer pair to a specific region on said specific Y chromosome sequence; and e. extending each of said primer pair on said specific Y chromosome sequence using said specific Y chromosome sequence as a template to amplify a portion of said Y chromosome sequence.
37. A method of amplifying a specific Y chromosome sequence by Polymerase chain reaction as described in claim 36, further comprising the steps of repeating the steps of c, d, and e.
38. A method of identifying the gender of a sample by Polymerase chain reaction, comprising the steps of:
a. establishing a DNA material from a sample in a solution; b. providing a primer pair comprising 5'-GTGATCCGGCATATAGCTGAGA - 3'
(SEQ LD No.l) and 5' -TGGTCGCTGATCAGGATGGAA- 3' (SEQ ID No. 2) in said solution; c. denaturing said DNA material to produce two single stranded DNA sequences; d. annealing each of said primer pair to a specific region on each of said single stranded DNA sequences which sequences are complementary to each of said primer sequences;
15 e. extending each of said primer pair on each of said single stranded DNA sequences using each of said single stranded DNA sequences as templates to amplify a specific region of each of said single stranded DNA sequences; f. repeating steps of c, d, and e; and g. detecting the presence of said specific regions from said DNA material wherein said specific regions have been amplified following said steps of c, d, and e and wherein the presence of said specific regions from said DNA material is indicative of male genomic material in said DNA material.
16
PCT/US1999/002387 1998-02-03 1999-02-03 Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method WO1999038883A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP99906729A EP1058688A4 (en) 1998-02-03 1999-02-03 Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method
US09/601,599 US6617107B1 (en) 1998-02-03 1999-02-03 Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7386398P 1998-02-03 1998-02-03
US60/073,863 1998-02-03

Publications (1)

Publication Number Publication Date
WO1999038883A1 true WO1999038883A1 (en) 1999-08-05

Family

ID=22116263

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/002387 WO1999038883A1 (en) 1998-02-03 1999-02-03 Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method

Country Status (3)

Country Link
US (1) US6617107B1 (en)
EP (1) EP1058688A4 (en)
WO (1) WO1999038883A1 (en)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002028311A1 (en) 2000-10-05 2002-04-11 Xy, Inc. System of hysteroscopic insemination of mares
US6372422B1 (en) 1997-12-31 2002-04-16 Colorado State University Through Its Agent Colorado State University Research Foundation And Xy, Inc. Multiple sexed embryo production system for mammals
US6524860B1 (en) 1997-12-31 2003-02-25 Xy, Inc. Methods for improving sheath fluids and collection systems for sex-specific cytometer sorting of sperm
US7713687B2 (en) 2000-11-29 2010-05-11 Xy, Inc. System to separate frozen-thawed spermatozoa into x-chromosome bearing and y-chromosome bearing populations
US7723116B2 (en) 2003-05-15 2010-05-25 Xy, Inc. Apparatus, methods and processes for sorting particles and for providing sex-sorted animal sperm
US7758811B2 (en) 2003-03-28 2010-07-20 Inguran, Llc System for analyzing particles using multiple flow cytometry units
US7820425B2 (en) 1999-11-24 2010-10-26 Xy, Llc Method of cryopreserving selected sperm cells
US7833147B2 (en) 2004-07-22 2010-11-16 Inguran, LLC. Process for enriching a population of sperm cells
US7838210B2 (en) 2004-03-29 2010-11-23 Inguran, LLC. Sperm suspensions for sorting into X or Y chromosome-bearing enriched populations
US7929137B2 (en) 1997-01-31 2011-04-19 Xy, Llc Optical apparatus
US8137967B2 (en) 2000-11-29 2012-03-20 Xy, Llc In-vitro fertilization systems with spermatozoa separated into X-chromosome and Y-chromosome bearing populations
US8486618B2 (en) 2002-08-01 2013-07-16 Xy, Llc Heterogeneous inseminate system
US8497063B2 (en) 2002-08-01 2013-07-30 Xy, Llc Sex selected equine embryo production system
US9145590B2 (en) 2000-05-09 2015-09-29 Xy, Llc Methods and apparatus for high purity X-chromosome bearing and Y-chromosome bearing populations of spermatozoa
CN107653305A (en) * 2017-11-03 2018-02-02 青海省畜牧兽医科学院 A kind of method that quick detection man cattle Y-chromosome haplotype group is formed
CN108676864A (en) * 2018-07-17 2018-10-19 安徽出入境检验检疫局检验检疫技术中心 A kind of discrimination method of recombination beef

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2338194C (en) 1998-07-30 2013-09-10 Edward L. Squires Equine system for non-surgical artificial insemination
WO2004017041A2 (en) 2002-08-15 2004-02-26 Xy, Inc. High resolution flow cytometer
US7169548B2 (en) 2002-09-13 2007-01-30 Xy, Inc. Sperm cell processing and preservation systems
CN1896274B (en) * 2005-09-29 2011-05-25 西北农林科技大学生物工程研究所 Beef embryo sex simple identification method
EP2019687B1 (en) 2006-03-29 2014-03-19 Merial Limited Vaccine against streptococci
US9888990B2 (en) 2012-06-06 2018-02-13 Inguran, Llc Methods for use of sex sorted semen to improve genetic management in swine
US9433195B2 (en) 2012-06-06 2016-09-06 Inguran, Llc Methods for increasing genetic progress in a line or breed of swine using sex-selected sperm cells

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5055393A (en) * 1989-06-13 1991-10-08 Salk Institute Biotechnology/Industrial Associates, Inc. Prenatal sex determination of bovine cells using male-specific oligonucleotides
US5437987A (en) * 1992-09-25 1995-08-01 The Board Of Trustees Of The Leland Stanford Junior University Triple gradient process with antibody panning to recover nucleated fetal cells from maternal blood
US5876942A (en) * 1997-07-24 1999-03-02 National Science Council Of Republic Of China Process for sexing cow embryos

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3644128A (en) * 1970-12-28 1972-02-22 Stuart Lipner Method of preparing comminuted meat products
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US5622820A (en) 1988-03-10 1997-04-22 City Of Hope Method for amplification and detection of RNA and DNA sequences
US5663048A (en) 1990-10-04 1997-09-02 University Of Calgary Y-chromosome specific polynucleotide probes for prenatal sexing
US5840482A (en) 1990-10-10 1998-11-24 The Regents Of The University Of California Y chromosome specific nucleic acid probe and method for determining the Y chromosome in situ
US5578449A (en) 1991-10-03 1996-11-26 Hilding Ohlsson, S.A. Procedure for the sex determination of embryos in mammals especially applied to bovine embryos
JP2593021B2 (en) 1991-12-13 1997-03-19 伊藤ハム株式会社 How to identify bovine embryo sex
US5494795A (en) 1993-05-05 1996-02-27 The United States Of America As Represented By The Secretary Of The Navy Specific oligonucleotide primers for detection of pathogenic campylobacter bacteria by polymerase chain reaction
US5480774A (en) 1993-10-14 1996-01-02 A/F Protein, Inc. Determination of genomic sex in salmonids

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5055393A (en) * 1989-06-13 1991-10-08 Salk Institute Biotechnology/Industrial Associates, Inc. Prenatal sex determination of bovine cells using male-specific oligonucleotides
US5437987A (en) * 1992-09-25 1995-08-01 The Board Of Trustees Of The Leland Stanford Junior University Triple gradient process with antibody panning to recover nucleated fetal cells from maternal blood
US5876942A (en) * 1997-07-24 1999-03-02 National Science Council Of Republic Of China Process for sexing cow embryos

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1058688A4 *

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7929137B2 (en) 1997-01-31 2011-04-19 Xy, Llc Optical apparatus
US6372422B1 (en) 1997-12-31 2002-04-16 Colorado State University Through Its Agent Colorado State University Research Foundation And Xy, Inc. Multiple sexed embryo production system for mammals
US6524860B1 (en) 1997-12-31 2003-02-25 Xy, Inc. Methods for improving sheath fluids and collection systems for sex-specific cytometer sorting of sperm
US9422523B2 (en) 1997-12-31 2016-08-23 Xy, Llc System and method for sorting cells
US9365822B2 (en) 1997-12-31 2016-06-14 Xy, Llc System and method for sorting cells
US7820425B2 (en) 1999-11-24 2010-10-26 Xy, Llc Method of cryopreserving selected sperm cells
US10208345B2 (en) 2000-05-09 2019-02-19 Xy, Llc Method for producing high purity X-chromosome bearing and Y-chromosome bearing populations of spermatozoa
US9145590B2 (en) 2000-05-09 2015-09-29 Xy, Llc Methods and apparatus for high purity X-chromosome bearing and Y-chromosome bearing populations of spermatozoa
WO2002028311A1 (en) 2000-10-05 2002-04-11 Xy, Inc. System of hysteroscopic insemination of mares
US9879221B2 (en) 2000-11-29 2018-01-30 Xy, Llc Method of in-vitro fertilization with spermatozoa separated into X-chromosome and Y-chromosome bearing populations
US7713687B2 (en) 2000-11-29 2010-05-11 Xy, Inc. System to separate frozen-thawed spermatozoa into x-chromosome bearing and y-chromosome bearing populations
US8652769B2 (en) 2000-11-29 2014-02-18 Xy, Llc Methods for separating frozen-thawed spermatozoa into X-chromosome bearing and Y-chromosome bearing populations
US7771921B2 (en) 2000-11-29 2010-08-10 Xy, Llc Separation systems of frozen-thawed spermatozoa into X-chromosome bearing and Y-chromosome bearing populations
US8137967B2 (en) 2000-11-29 2012-03-20 Xy, Llc In-vitro fertilization systems with spermatozoa separated into X-chromosome and Y-chromosome bearing populations
US8497063B2 (en) 2002-08-01 2013-07-30 Xy, Llc Sex selected equine embryo production system
US8486618B2 (en) 2002-08-01 2013-07-16 Xy, Llc Heterogeneous inseminate system
US7943384B2 (en) 2003-03-28 2011-05-17 Inguran Llc Apparatus and methods for sorting particles
US9377390B2 (en) 2003-03-28 2016-06-28 Inguran, Llc Apparatus, methods and processes for sorting particles and for providing sex-sorted animal sperm
US8664006B2 (en) 2003-03-28 2014-03-04 Inguran, Llc Flow cytometer apparatus and method
US8709817B2 (en) 2003-03-28 2014-04-29 Inguran, Llc Systems and methods for sorting particles
US8709825B2 (en) 2003-03-28 2014-04-29 Inguran, Llc Flow cytometer method and apparatus
US8748183B2 (en) 2003-03-28 2014-06-10 Inguran, Llc Method and apparatus for calibrating a flow cytometer
US9040304B2 (en) 2003-03-28 2015-05-26 Inguran, Llc Multi-channel system and methods for sorting particles
US11718826B2 (en) 2003-03-28 2023-08-08 Inguran, Llc System and method for sorting particles
US11104880B2 (en) 2003-03-28 2021-08-31 Inguran, Llc Photo-damage system for sorting particles
US7758811B2 (en) 2003-03-28 2010-07-20 Inguran, Llc System for analyzing particles using multiple flow cytometry units
US7799569B2 (en) 2003-03-28 2010-09-21 Inguran, Llc Process for evaluating staining conditions of cells for sorting
US10100278B2 (en) 2003-03-28 2018-10-16 Inguran, Llc Multi-channel system and methods for sorting particles
US7723116B2 (en) 2003-05-15 2010-05-25 Xy, Inc. Apparatus, methods and processes for sorting particles and for providing sex-sorted animal sperm
US7838210B2 (en) 2004-03-29 2010-11-23 Inguran, LLC. Sperm suspensions for sorting into X or Y chromosome-bearing enriched populations
US7892725B2 (en) 2004-03-29 2011-02-22 Inguran, Llc Process for storing a sperm dispersion
US7833147B2 (en) 2004-07-22 2010-11-16 Inguran, LLC. Process for enriching a population of sperm cells
CN107653305A (en) * 2017-11-03 2018-02-02 青海省畜牧兽医科学院 A kind of method that quick detection man cattle Y-chromosome haplotype group is formed
CN108676864A (en) * 2018-07-17 2018-10-19 安徽出入境检验检疫局检验检疫技术中心 A kind of discrimination method of recombination beef

Also Published As

Publication number Publication date
EP1058688A1 (en) 2000-12-13
US6617107B1 (en) 2003-09-09
EP1058688A4 (en) 2004-10-06

Similar Documents

Publication Publication Date Title
EP1058688A1 (en) Specific oligonucleotide primers for detection of bovine male chromosome presence by polymerase chain reaction and method
US5223414A (en) Process for nucleic acid hybridization and amplification
RU2182176C2 (en) Method of selective amplification, oligonucleotide and set for selective amplification
US5391480A (en) Method for detecting a nucleotide at a specific location within a nucleic acid using exonuclease activity
SG181543A1 (en) Processing of amplified dna fragments for sequencing
US20020058250A1 (en) Extraction and utilisation of vntr alleles
JP5702148B2 (en) Reduced inhibition of 1-step RT-PCR
US8889350B2 (en) Methods and compositions for isolating polynucleotides
WO1995002068A1 (en) Method of discriminating nucleic acid and testing set for discriminating nucleic acid
EP2691546A1 (en) Identification of a nucleic acid template in a multiplex sequencing reaction
TWI715900B (en) A primer for next generation sequencer and a method for producing the same, a dna library obtained through the use of a primer for next generation sequencer and a method for producing the same, and a dna analyzing method using a dna library
US7189512B2 (en) Methods for variation detection
CA2318371A1 (en) Method for the detection of nucleic acid sequences
KR20160138168A (en) Copy number preserving rna analysis method
Knoll et al. A Ncii PCR-RFLP within intron 2 of the porcine insulin-like growth factor 2b (IGF2) gene.
CA2366107A1 (en) Compositions and methods for genetic analysis
CN109715798B (en) Method for preparing DNA library and method for analyzing genomic DNA using DNA library
Rincón et al. Genomic polymorphism in Uruguayan Creole cattle using RAPD and microsatellite markers
EP3390671A1 (en) Method of direct target sequencing using nuclease protection
WO2001029262A2 (en) Genotyping reagents, kits and methods of use thereof
CN110430756B (en) Methods and compositions for preserving tissue and nucleic acids
WO2014083147A1 (en) Methods for dna rearrengements analysis
EP3906321A1 (en) Methods of detecting dna and rna in the same sample
WO2019163064A1 (en) Method for measuring success or failure of pcr
Lathuilliere et al. Sequence conservation of nine Barbary macaque (Macaca sylvanus) microsatellite loci: implication of specific primers for genotyping

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1999906729

Country of ref document: EP

Ref document number: 09601599

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1999906729

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1999906729

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1999906729

Country of ref document: EP