WO1999036526A1

WO1999036526A1 - Cbmajc02: a gene similar to bovine f1f0-atp synthase complex f0 membrane domain f-subunit

Info

Publication number: WO1999036526A1
Application number: PCT/CN1998/000008
Authority: WO
Inventors: Ji-Sheng Wu; Bai-Wei Gu; Jian Gu; Juan Zhou
Original assignee: Shanghai Second Medical University
Priority date: 1998-01-19
Filing date: 1998-01-19
Publication date: 1999-07-22

Abstract

CBMAJC02 polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing CBMAJC02 polypeptides and polynucleotides in the design of protocols for the treatment of diabetes mellitus, cardiovascular diseases, and kidney diseases, among others, and diagnostic assays for such conditions.

Description

CBMAJC02: A Gene Similar to Bovine FιF„-ATP synthase complex F„ membrane domain f - subunit

FIELD OF INVENTION

This invention relates to newly identified polynucleotides, polypeptides encoded by them and to the use of such polynucleotides and polypeptides, and to their production More particularly, the polynucleotides and polypeptides of the present invention relate to the gene family including ATPase and ATP synthase, hereinafter referred to as CBMAJC02 The invention also relates to inhibiting or activating the action of such polynucleotides and polypeptides

BACKGROUND OF THE INVENTION

The bovine FιF₀ ATP synthase complex was first purified from heart mitochondrion membrane, The f subunit contains a membrane-spanning alpha-helix Research indicates that it is involved in ATP energy metabolism This indicates that the a gene femily including ATPase and ATP synthase has an established, proven history as therapeutic targets Clearly, there is a need for identification and characterization of further members of the gene family including ATPase and ATP synthase which can play a role in preventing, ameliorating or correcting dysfunctions or diseases, mcluding, but not limited to, diabetes melhtus, cardiovascular diseases, and kidney disease

SUMMARY OF THE INVENTION

In one aspect, the invention relates to CBMAJC02 polypeptides and recombmant materials and methods for their production Another aspect of the invention relates to methods for using such CBMAJC02 polypeptides and polynucleotides Such uses include the treatment of diabetes melhtus, cardiovascular diseases, and kidney diseases, among others In still another aspect, the invention relates to methods to identify agonists and antagonists using the mateπals provided by the invention, and treating conditions associated with CBMAJC02 imbalance with the identified compounds Yet another aspect of the invention relates to diagnostic assays for detecting diseases associated with inappropnate CBMAJC02 activity or levels

DESCRIPTION OF THE INVENTION

Definitions

The following definitions are provided to facilitate understanding of certain terms used frequently herein "CBMAJC02" refers, among others, generally to a polypeptide having the amino acid sequence set forth in SEQ ID NO 2 or an allelic variant thereof

"CBMAJC02 activity or CBMAJC02 polypeptide activity" or "biological activity of the

CBMAJC02 or CBMAJC02 polypeptide" refers to the metabolic or physiologic function of said CBMAJC02 including similar activities or improved activities or these activities with decreased undesirable side-effects Also included are antigenic and immunogenic activities of said CBMAJC02

"CBMAJC02 gene" refers to a polynucleotide having the nucleotide sequence set forth m SEQ ID NO 1 or allelic variants thereof and/or their complements

"Antibodies" as used herein includes polyclonal and monoclonal antibodies, chimeπc, single chain, and humanized antibodies, as well as Fab fragments, including the products of an Fab or other lmmunoglobulin expression library

"Isolated" means altered "by the hand of man" from the natural state If an "isolated" composition or substance occurs m nature, it has been changed or removed from its original environment, or both For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting mateπals of its natural state is "isolated", as the term is employed herein

"Polynucleotide" generally refers to any polyπbonucleoUde or polydeoxπbonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions In addition, "polynucleotide" refers to triple-stranded regions compπsmg RNA or DNA or both RNA and DNA The term polynucleotide also mcludes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons "Modified" bases include, for example, tπtylated bases and unusual bases such as inosine A variety of modifications has been made to DNA and RNA, thus, "polynucleotide" embraces chemically, enzymatically or metabo cally modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteπstic of viruses and cells "Polynucleotide" also embraces relatively short polynucleotides, often referred to as ohgonucleotides

"Polypeptide" refers to any peptide or protein compπsing two or more ammo acids joined to each other by peptide bonds or modified peptide bonds, l e , peptide isosteres "Polypeptide" refers to both short chains, commonly referred to as peptides, ohgopeptides or ohgomers. and to longer chains, generally referred to as proteins Polypeptides may contain ammo acids other than the 20 gene-encoded ammo acids "Polypeptides" include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known m the art Such modifications are well described m basic texts and m more detailed monographs, as well as in a voluminous research literature Modifications can occur anywhere m a polypeptide, mcludmg the peptide backbone, the ammo acid side-chams and the ammo or carboxyl termini It will be appreciated that the same type of modification may be present m the same or varying degrees at several sites m a given polypeptide Also, a given polypeptide may contain many types of modifications Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching Cyclic, branched and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods Modifications include acetylation, acylation, ADP-πbosylation, amidation, covalent attachment of flavm, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide deπvative, covalent attachment of a hpid or pid derivative, covalent attachment of phosphotidylinositol, cross-linking, cychzation. disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, lodination, methylation, myπstoylation, oxidation, proteolytic processmg, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of ammo acids to proteins such as argmylation, and ubiquitination See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed , T E Creighton, W H Freeman and Company, New York, 1993 and Wold, F , Posttranslational Protem Modifications Perspectives and Prospects, pgs 1-12 in

POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B C Johnson, Ed , Academic Press, New York, 1983, Seifter et al , "Analysis for protem modifications and nonprotem cofactors", Meth Enzymol (1990) 182 626-646 and Rattan et al , "Protein Synthesis Posttranslational Modifications and Agmg", Ann NY AcadSct (1992) 663 48-62 "Variant" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retains essential properties A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide Changes in the nucleotide sequence of the variant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result m amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below A typical vaπant of a polypeptide differs in ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference polypeptide and the vaπant are closely similar overall and, in many regions, identical A variant and reference polypeptide may differ in ammo acid sequence by one or more substitutions, additions, deletions in any combination A substituted or inserted ammo acid residue may or may not be one encoded by the genetic code A vaπant of a polynucleotide or polypeptide may be a naturally occurπng such as an allelic variant, or it may be a variant that is not known to occur naturally Non-naturally occurπng variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis

"Identity" is a measure of the identity of nucleotide sequences or ammo acid sequences In general, the sequences are aligned so that the highest order match is obtained "Identity" per se has an art-recognized meaning and can be calculated using published techniques See, e g (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A M , ed , Oxford University Press, New York, 1988, BIOCOMPUTING INFORMATICS AND GENOME PROJECTS, Smith, D W , ed , Academic Press, New York, 1993, COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A M , and Griffin, H G , eds , Humana Press, New Jersey, 1994, SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heiηje, G , Academic Press, 1987. and SEQUENCE ANALYSIS PRIMER, Gπbskov, M and Devereux, J , eds , M Stockton Press. New York, 1991) While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Caπllo, H , and Lφton, D , SLAM J Applied Math (1988) 48 1073) Methods commonly employed to determine identity or similaπty between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J Bishop, ed , Academic Press, San Diego, 1994, and Caπllo, H , and Lipton, D , SLAM J Applied Math (1988) 48 1073 Methods to determine identity and similarity are codified m computer programs Preferred computer program methods to determine identity and similaπty between two sequences include, but are not limited to. GCS program package (Devereux, J , et al , Nucleic Acids Research (1984) 12(1) 387), BLASTP, BLASTN, FASTA (Atschul, S F et al , JMolec Biol (1990) 215 403) As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence of SEQ ID NO 1 is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence of SEQ ID NO 1 In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence These mutations of the reference sequence may occur at the 5 or 3 terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or m one or more contiguous groups within the reference sequence

Similarly, by a polypeptide having an ammo acid sequence havmg at least, for example, 95% "identity" to a reference ammo acid sequence of SEQ ID NO 2 is mtended that the ammo acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five ammo acid alterations per each 100 ammo acids of the reference ammo acid of SEQ ID NO 2 In other words, to obtain a polypeptide havmg an ammo acid sequence at least 95% identical to a reference ammo acid sequence, up to 5% of the ammo acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of ammo acids up to 5% of the total amino acid residues in the reference sequence may be inserted mto the reference sequence These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference ammo acid sequence or anywhere between those terminal positions, mterspersed either individually among residues m the reference sequence or m one or more contiguous groups within the reference sequence

Polypeptides of the Invention

In one aspect, the present mvention relates to CBMAJC02 polypeptides (or CBMAJC02 proteins) The CBMAJC02 polypeptides mclude the polypeptide of SEQ ID NO 2, as well as polypeptides compπsmg the ammo acid sequence of SEQ ID NO 2, and polypeptides compnsmg the ammo acid sequence which have at least 80% identity to that of SEQ ID NO 2 over its entire length, and still more preferably at least 90% identity, and even still more preferably at least 95% identity to SEQ ID NO 2 Furthermore, those with at least 97-99% are highly preferred Also included within CBMAJC02 polypeptides are polypeptides having the amino acid sequence which have at least 80% identity to the polypeptide havmg the ammo acid sequence of SEQ ID NO 2 over its entire length, and still more preferably at least 90% identity, and still more preferably at least 95% identity to SEQ ID NO 2 Furthermore, those with at least 97-99% are highly preferred Preferably CBMAJC02 polypeptide exhibit at least one biological activity of CBMAJC02

The CBMAJC02 polypeptides may be in the form of the "mature" protem or may be a part of a larger protein such as a fusion protem It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in puπfication such as multiple histidine residues, or an additional sequence for stability duπng recombinant production

Fragments of the CBMAJC02 polypeptides are also included m the invention A fragment is a polypeptide having an amino acid sequence that entirely is the same as part, but not all, of the ammo acid sequence of the aforementioned CBMAJC02 polypeptides As with CBMAJC02 polypeptides. fragments may be "free-standing," or compπsed within a larger polypeptide of which they form a part or region, most preferably as a smgle continuous region Representative examples of polypeptide fragments of the invention, mclude, for example, fragments from about ammo acid number 1-20, 21-40, 41-60, 61-80, 81-100, and 101 to the end of CBMAJC02 polypeptide In this context "about" includes the particularly recited ranges larger or smaller by several, 5, 4, 3, 2 or 1 ammo acid at either extreme or at both extremes

Preferred fragments mclude, for example, truncation polypeptides havmg the ammo acid sequence of CBMAJC02 polypeptides, except for deletion of a continuous senes of residues that mcludes the ammo termmus, or a continuous senes of residues that mcludes the carboxyl termmus or deletion of two continuous senes of residues, one mcludmg the ammo termmus and one mcludmg the carboxyl termmus Also preferred are fragments characterized by structural or functional attributes such as fragments that compnse alpha-helix and alpha-helix forming regions, beta-sheet and beta-sheet-forming regions, rum and turn-forming regions, coil and coil-forming regions, hydrophihc regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigemc mdex regions Other preferred fragments are biologically active fragments Biologically active fragments are those that mediate CBMAJC02 activity, mcludmg those with a similar activity or an improved activity, or with a decreased undesirable activity Also included are those that are antigemc or immunogemc in an animal, especially m a human

Preferably, all of these polypeptide fragments retain the biological activity of the CBMAJC02, mcludmg antigemc activity Variants of the defined sequence and fragments also form part of the present mvention Preferred vanants are those that vary from the referents by conservative ammo acid substitutions - l e , those that substitute a residue with another of like charactenstics Typical such substitutions are among Ala, Val, Leu and lie. among Ser and Thr, among the acidic residues Asp and Glu, among Asn and Gin, and among the basic residues Lys and Arg, or aromatic residues Phe and Tyr Particularly preferred are vanants m which several, 5-10, 1-5, or 1-2 ammo acids are substituted, deleted, or added m any combination The CBMAJC02 polypeptides of the mvention can be prepared m any suitable manner Such polypeptides mclude isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods Means for preparing such polypeptides are well understood in the art

Polynucleotides of the Invention

Another aspect of the mvention relates to CBMAJC02 polynucleotides CBMAJC02 polynucleotides mclude isolated polynucleotides which encode the CBMAJC02 polypeptides and fragments, and polynucleotides closely related thereto More specifically, CBMAJC02 polynucleotide of the mvention include a polynucleotide compnsmg the nucleotide sequence contained m SEQ ID NO 1 encoding a CBMAJC02 polypeptide of SEQ ID NO 2, and polynucleotide havmg the particular sequence of SEQ ID NO 1 CBMAJC02 polynucleotides further mclude a polynucleotide compnsmg a nucleotide sequence that has at least 80% identity over its entire length to a nucleotide sequence encoding the CBMAJC02 polypeptide of SEQ ID NO 2, and a polynucleotide compnsmg a nucleotide sequence that is at least 80% identical to of SEQ ID NO 1 over its entire length In this regard, polynucleotides at least 90% identical are particularly preferred, and those with at least 95% are especially preferred Furthermore, those with at least 97% are highly preferred and those with at least 98-99% are most highly preferred, with at least 99% being the most preferred Also mcluded under CBMAJC02 polynucleotides are a nucleotide sequence which has sufficient identity to a nucleotide sequence contained in SEQ ID NO 1 to hybπdize under conditions useable for amplification or for use as a probe or marker The mvention also provides polynucleotides which are complementary to such CBMAJC02 polynucleotides

CBMAJC02 of the mvention is structurally related to other proteins of the gene family mcludmg ATPase and ATP synthase, as shown by the results of sequencing the cDNA of Table 1 (SEQ ID NO 1) encoding human CBMAJC02 The cDNA sequence of SEQ ID NO 1 contains an open reading frame

(nucleotide number 28 to 309) encoding a polypeptide of 94 ammo acids of SEQ ID NO 2 The ammo acid sequence of Table 2 (SEQ ID NO 2) has about 73% identity (using FASTA) in 94 ammo acid residues with bovine F]F₀-ATP synthase complex F₀ membrane domain f subunit (I R Col nson, et al ,Bιochemιstry, 33 7971-7978, 1994) Furthermore, CBMAJC02 (SEQ ID NO 2) is 79% identical to pig intestine H+- transportmg ATP synthase (Q95339) over 84 ammo acid residues (AK Wmteroe, et al , unpublished) The nucleotide sequence of Table 1 (SEQ ID NO 1) has about 79 0 % identity (usmg FASTA) in 305 nucleotide residues with bovine F]F₀-ATP synthase complex F₀ membrane domain f subunit (I R Colhnson, et al ,Bιochemιstry,3 3 7971-7978, 1994) Thus, CBMAJC02 polypeptides and polynucleotides of the present mvention are expected to have, mter aha, similar biological functions/properties to their homologous polypeptides and polynucleotides, and their utility is obvious to anyone skilled in the art

Table 1"

GGGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCAGTGAAG GACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCT AGTGGCATTTTCGGAGCGTTTCAAAGAGGTTACTACCGGTACTACAACAAGTACATCAATGTGAAGAAG GGGAGCATCTCGGGGATTACCATGGTGCTGGCATGCTACGTGCTCTTTAGCTACTCCTTTTCCTACAAG CATCTCAAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGA CCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGG AATTAACCTCCAAATAAAACATGACTGGTAAAAAAAAA

A nucleotide sequence of a human CBMAJC02 (SEQ ID NO 1) Table 2^b

1 MASVGECPAP VPVKDKKLLΞ VKLGE PS I LMRDFSPSGI FGAFQRGYYR

51 YYNKYINVKK GSISGIT VL ACYVLFSYSF SYKHL HERL RKYH

An ammo acid sequence of a human CBMAJC02 (SEQ ID NO 2)

One polynucleotide of the present mvention encoding CBMAJC02 may be obtained usmg standard cloning and screening, from a cDNA library deπved from mRNA m cells of human cord blood usmg the expressed sequence tag (EST) analysis (Adams, M D , et al Science (1991) 252 1651-1656, Adams, M D et al , Nature, (1992) 355 632-634, Adams, M D , et al , Nature (1995) 377 Supp 3-174) Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized usmg well known and commercially available techniques

The nucleotide sequence encoding CBMAJC02 polypeptide of SEQ ID NO 2 may be identical to the polypeptide encoding sequence contained in Table 1 (nucleotide number 28 to 309 of SEQ ID NO 1), or it may be a sequence, which as a result of the redundancy (degeneracy) of the genetic code, also encodes the polypeptide of SEQ ID NO 2

When the polynucleotides of the invention are used for the recombmant production of CBMAJC02 polypeptide, the polynucleotide may include the coding sequence for the mature polypeptide or a fragment thereof, by itself, the coding sequence for the mature polypeptide or fragment m reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protem sequence, or other fusion peptide portions For example, a marker sequence which facilitates purification of the fused polypeptide can be encoded In certain preferred embodiments of this aspect of the mvention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc ) and descnbed m Gentz et al , Proc Natl Acad Sci USA ( 1989) 86 821 -824, or is an HA tag The polynucleotide may also contam non-codmg 5' and 3' sequences, such as transcnbed, non-translated sequences, splicmg and polyadenylation signals, nbosome binding sites and sequences that stabilize mRNA

Further preferred embodiments are polynucleotides encoding CBMAJC02 vanants compnse the ammo acid sequence CBMAJC02 polypeptide of Table 2 (SEQ ID NO 2) m which several, 5-10, 1-5, 1-3, 1-2 or 1 ammo acid residues are substituted, deleted or added, m any combination

The present mvention further relates to polynucleotides that hybπdize to the herem above-descnbed sequences In this regard, the present mvention especially relates to polynucleotides which hybndize under stringent conditions to the herem above-descnbed polynucleotides As herem used, the term "stringent conditions" means hybndization will occur only if there is at least 80%, and preferably at least 90%, and more preferably at least 95%, yet even more preferably 97-99% identity between the sequences

Polynucleotides of the mvention, which are identical or sufficiently identical to a nucleotide sequence contained in SEQ ID NO 1 or a fragment thereof, may be used as hybndization probes for cDNA and genomic DNA, to isolate fiill-length cDNAs and genomic clones encoding CBMAJC02 polypeptide and to isolate cDNA and genomic clones of other genes (mcludmg genes encoding homologs and orthologs from species other than human) that have a high sequence similanty to the CBMAJC02 gene Such hybndization techmques are known to those of skill m the art Typically these nucleotide sequences are 80% identical, preferably 90% identical, more preferably 95% identical to that of the referent The probes generally will compnse at least 15 nucleotides Preferably, such probes will have at least 30 nucleotides and may have at least 50 nucleotides Particularly preferred probes will range between 30 and 50 nucleotides

In one embodiment, to obtain a polynucleotide encoding CBMAJC02 polypeptide. mcludmg homologs and orthologs from species other than human, compnses the steps of screening an appropnate library under stingent hybndization conditions with a labeled probe havmg the SEQ ID NO 1 or a fragment thereof, and isolating fiill-length cDNA and genomic clones containmg said polynucleotide sequence Thus m another aspect, CBMAJC02 polynucleotides of the present mvention further mclude a nucleotide sequence compnsmg a nucleotide sequence that hybndize under stnngent condition to a nucleotide sequence havmg SEQ ID NO 1 or a fragment thereof Also mcluded with CBMAJC02 polypeptides are polypeptide compnsmg ammo acid sequence encoded by nucleotide sequence obtained by the above hybndization condition Such hybndization techmques are well known to those of skill m the art Stnngent hybndization conditions are as defined above or, alternatively, conditions under overnight incubation at 42°C m a solution compnsmg 50% formamide, 5xSSC (150mM NaCl. 15mM tnsodium citrate), 50 mM sodium phosphate (pH7 6), 5x Denhardt's solution, 10 % dextran sulfate, and 20 microgram/ml denatured, sheared salmon speπn DNA, followed by washing the filters m 0 lx SSC at about 65°C The polynucleotides and polypeptides of the present mvention may be employed as research reagents and matenals for discovery of treatments and diagnostics to animal and human disease

Vectors, Host Cells, Expression

The present mvention also relates to vectors which compnse a polynucleotide or polynucleotides of the present mvention. and host cells which are genetically engmeered with vectors of the mvention and to the production of polypeptides of the mvention by recombinant techniques Cell-free translation systems can also be employed to produce such proteins usmg RNAs deπved from the DNA constructs of the present mvention

For recombinant production, host cells can be genetically engmeered to incorporate expression systems or portions thereof for polynucleotides of the present mvention Introduction of polynucleotides into host cells can be effected by methods descnbed in many standard laboratory manuals, such as Davis et al , BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al , MOLECULAR CLONING A LABORATORY MANUAL, 2nd Ed , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y (1989) such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, micromjection, catiomc lipid-mediated transfection, electroporation, transduction. scrape loading, ballistic introduction or infection

Representative examples of appropnate hosts mclude bacteπal cells, such as streptococci, staphylococci, E coh, Streptomyces and Bacillus subtihs cells, fiingal cells, such as yeast cells and Aspergillus cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells, and plant cells

A great vaπety of expression systems can be used. Such systems mclude, among others, chromosomal, episomal and virus-deπved systems, e g , vectors deπved from bacteπal plasmids, from bacteπophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculovmises, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors deπved from combinations thereof, such as those deπved from plasmid and bacteπophage genetic elements, such as cosmids and phagemids The expression systems may contam control regions that regulate as well as engender expression Generally, any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide m a host may be used The appropnate nucleotide sequence may be inserted mto an expression system by any of a vaπety of well-known and routine techmques, such as, for example, those set forth m Sambrook et al , MOLECULAR CLONING, A LABORATORY MANUAL (supra)

For secretion of the translated protem mto the lumen of the endoplasmic reticulum, mto the penplasmic space or mto the extracellular environment, appropnate secretion signals may be incorporated mto the desired polypeptide These signals may be endogenous to the polypeptide or they may be heterologous signals

If the CBMAJC02 polypeptide is to be expressed for use m screening assays, generally, it is prefeπed that the polypeptide be produced at the surface of the cell In this event, the cells may be harvested pπor to use m the screemng assay If CBMAJC02 polypeptide is secreted into the medium, the medium can be recovered in order to recover and puπfy the polypeptide, if produced rntracellularly, the cells must first be lysed before the polypeptide is recovered

CBMAJC02 polypeptides can be recovered and purified from recombinant cell cultures by well-known methods mcludmg ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography Most preferably, high performance liquid chromatography is employed for purification Well known techmques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or puπfication

Diagnostic Assays

This mvention also relates to the use of CBMAJC02 polynucleotides for use as diagnostic reagents Detection of a mutated form of CBMAJC02 gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under- expression, over-expression or altered expression of CBMAJC02 Individuals carrying mutations m the CBMAJC02 gene may be detected at the DNA level by a vaπety of techmques

Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy mateπal The genomic DNA may be used directly for detection or may be amplified enzymatically by usmg PCR or other amplification techmques pπor to analysis RNA or cDNA may also be used in similar fashion Deletions and insertions can be detected by a change m size of the amplified product m compaπson to the normal genotype Pomt mutations can be identified by hybπdizmg amplified DNA to labeled CBMAJC02 nucleotide sequences Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences m melting temperatures DNA sequence differences may also be detected by alterations m electrophoretic mobility of DNA fragments m gels, with or without denaturing agents, or by direct DNA sequencmg See, e g , Myers et al , Science (1985) 230 1242 Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method See Cotton et al , Proc Natl Acad Sci USA ( 1985) 85 4397-4401 In another embodiment an array of oligonucleotides probes compnsmg CBMAJC02 nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of e g , genetic mutations Array technology methods are well known and have general applicability and can be used to address a vanety of questions in molecular genetics mcludmg gene expression, genetic linkage, and genetic vaπabi ty (See for example M Chee et al , Science, Vol 274, pp 610-613 (1996))

The diagnostic assays offer a process for diagnosing or determining a susceptibility to diabetes melhtus, cardiovascular diseases, and kidney diseases, through detection of mutation m the CBMAJC02 gene by the methods descπbed In addition, diabetes melhtus, cardiovascular diseases, and kidney diseases, can be diagnosed by methods compnsmg determining from a sample derived from a subject an abnormally decreased or increased level of CBMAJC02 polypeptide or CBMAJC02 mRNA Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods Assay techmques that can be used to determine levels of a protem, such as an CBMAJC02 polypeptide, m a sample deπved from a host are well-known to those of skill m the art Such assay methods mclude radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays Thus m another aspect, the present mvention relates to a diagonostic kit for a disease or suspectability to a disease, particularly diabetes melhtus. cardiovascular diseases, and kidney diseases, which compπses

(a) a CBMAJC02 polynucleotide, preferably the nucleotide sequence of SEQ ID NO 1, or a fragment thereof , (b) a nucleotide sequence complementary to that of (a),

(c) a CBMAJC02 polypeptide, preferably the polypeptide of SEQ ID NO 2, or a fragment thereof, or

(d) an antibody to a CBMAJC02 polypeptide, preferably to the polypeptide of SEQ ID NO 2

It will be appreciated that in any such kit. (a), (b), (c) or (d) may compnse a substantial component

Chromosome Assays

The nucleotide sequences of the present mvention are also valuable for chromosome identification The sequence is specifically targeted to and can hybndize with a particular location on an individual human chromosome The mapping of relevant sequences to chromosomes according to the present mvention is an important first step m coπelating those sequences with gene associated disease Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data Such data are found, for example, m V McKusick, Mendelian Inheπtance in Man (available on lme through Johns Hopkins University Welch Medical Library) The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheπtance of physically adjacent genes) The differences in the cDNA or genomic sequence between affected and unaffected individuals can also be determined. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease

Antibodies

The polypeptides of the mvention or their fragments or analogs thereof, or cells expressmg them can also be used as lmmunogens to produce antibodies immunospecific for the CBMAJC02 polypeptides The term "immunospecific" means that the antibodies have substantial! greater affinity for the polypeptides of the mvention than their affimty for other related polypeptides the pnor art Antibodies generated against the CBMAJC02 polypeptides can be obtained by administering the polypeptides or epitope-beanng fragments, analogs or cells to an anitnal, preferably a nonhuman, usmg routine protocols For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell lme cultures can be used Examples mclude the hybπdoma technique (Kohler, G and Milstein, C , Nature (1975) 256 495-497), the tnoma technique, the human B-cell hybπdoma technique (Kozbor et al , Immunology Today (1983) 4 72) and the EBV-hybπdoma technique (Cole et al , MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp 77-96, Alan R Liss, Inc , 1985)

Techmques for the production of smgle chain antibodies (U S Patent No 4,946,778) can also be adapted to produce single chain antibodies to polypeptides of this mvention Also, transgenic mice, or other organisms mcludmg other mammals, may be used to express humanized antibodies

The above-descnbed antibodies may be employed to isolate or to identify clones expressing the polypeptide or to punfy the polypeptides by affimty chromatography

Antibodies against CBMAJC02 polypeptides may also be employed to treat diabetes mellitus, cardiovascular diseases, and kidney diseases, among others

Vaccines

Another aspect of the invention relates to a method for inducing an immunoiogical response in a mammal which compπses inoculating the mammal with CBMAJC02 polypeptide, or a fragment thereof, adequate to produce antibody and/or T cell immune response to protect said animal from diabetes mellitus, cardiovascular diseases, and kidney diseases, among others Yet another aspect of the mvention relates to a method of mducmg immunoiogical response in a mammal which compπses, dehveπng CBMAJC02 polypeptide via a vector directing expression of CBMAJC02 polynucleotide in vivo m order to induce such an immunoiogical response to produce antibody to protect said animal from diseases

Further aspect of the mvention relates to an lmmunological/vaccme formulation (composition) which, when introduced mto a mammalian host, induces an immunoiogical response in that mammal to a CBMAJC02 polypeptide wherein the composition comprises a CBMAJC02 polypeptide or CBMAJC02 gene The vaccme formulation may further compnse a suitable carrier Since CBMAJC02 polypeptide may be broken down m the stomach, it is preferably administered parenterally (including subcutaneous, intramuscular, intravenous, mtradermal etc injection) Formulations suitable for parenteral administration include aqueous and non-aqueous steπle injection solutions which may contain anti-oxidants, buffers, bacteπostats and solutes which render the formulation lnstomc with the blood of the recipient, and aqueous and non-aqueous steπle suspensions which may include suspending agents or thickening agents The formulations may be presented m unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dπed condition requiπng only the addition of the steπle liquid earner immediately pnor to use The vaccme formulation may also include adjuvant systems for enhancing the lmmunogenicity of the formulation, such as oil-in water systems and other systems known in the art The dosage will depend on the specific activity of the vaccine and can be readily determined by routme expeπmentation

Screening Assays

The CBMAJC02 polypeptide of the present mvention may be employed m a screening process for compounds which activate (agonists) or inhibit activation of (antagomsts, or otherwise called inhibitors) the CBMAJC02 polypeptide of the present mvention Thus, polypeptides of the mvention may also be used to assess identify agomst or antagomsts from, for example, cells, cell-free preparations, chemical hbraπes, and natural product mixtures These agonists or antagomsts may be natural or modified substrates, hgands, receptors, enzymes, etc , as the case may be, of the polypeptide of the present mvention, or may be structural or functional mimetics of the polypeptide of the present mvention See Co gan et al , Current Protocols in Lmmunology 1(2) Chapter 5 (1991) CBMAJC02 polypeptides are responsible for many biological functions, mcludmg many pathologies

Accordingly, it is desirous to find compounds and drugs which stimulate CBMAJC02 polypeptide on the one hand and which can inhibit the function of CBMAJC02 polypeptide on the other hand In general, agonists are employed for therapeutic and prophylactic purposes for such conditions as diabetes melhtus, cardiovascular diseases, and kidney diseases Antagomsts may be employed for a vaπety of therapeutic and prophylactic purposes for such conditions as diabetes melhtus, cardiovascular diseases, and kidney diseases In general, such screening procedures may mvolve usmg appropnate cells which express the CBMAJC02 polypeptide or respond to CBMAJC02 polypeptide of the present mvention Such cells mclude cells from mammals, yeast, Drosophila or E coh Cells which express the CBMAJC02 polypeptide (or cell membrane containmg the expressed polypeptide) or respond to CBMAJC02 polypeptide are then contacted with a test compound to observe bmdmg, or stimulation or inhibition of a functional response The abihty of the cells which were contacted with the candidate compounds is compared with the same cells which were not contacted for CBMAJC02 activity

The assays may simply test bmdmg of a candidate compound wherem adherence to the cells beaπng the CBMAJC02 polypeptide is detected by means of a label directly or indirectly associated with the candidate compound or in an assay involving competition with a labeled competitor Further, these assays may test whether the candidate compound results in a signal generated by activation of the CBMAJC02 polypeptide, using detection systems appropriate to the cells bearing the CBMAJC02 polypeptide Inhibitors of activation are generally assayed in the presence of a known agomst and the effect on activation by the agonist by the presence of the candidate compound is observed

Further, the assays may simply compnse the steps of mixing a candidate compound with a solution containing a CBMAJC02 polypeptide to form a mixture, measuring CBMAJC02 activity in the mixture, and compaπng the CBMAJC02 activity of the mixture to a standard

The CBMAJC02 cDNA, protein and antibodies to the protein may also be used to configure assays for detecting the effect of added compounds on the production of CBMAJC02 mRNA and protein in cells For example, an ELISA may be constructed for measurmg secreted or cell associated levels of CBMAJC02 protein using monoclonal and polyclonal antibodies by standard methods known in the art, and this can be used to discover agents which may inhibit or enhance the production of

CBMAJC02 (also called antagonist or agomst, respectively) from suitably manipulated cells or tissues The CBMAJC02 protem may be used to identify membrane bound or soluble receptors, if any, through standard receptor bmdmg techniques known m the art These mclude. but are not limited to, ligand bmdmg and crosshnking assays in which the CBMAJC02 is labeled with a radioactive isotope (eg 1251), chemically modified (eg biotmylated), or fused to a peptide sequence suitable for detection or puπfϊcation, and incubated with a source of the putative receptor (cells, cell membranes, cell supernatants, tissue extracts, bodily fluids) Other methods mclude biophysical techniques such as surface plasmon resonance and spectroscopy In addition to bemg used for puπfication and cloning of the receptor, these bindmg assays can be used to identify agonists and antagonists of CBMAJC02 which compete with the binding of CBMAJC02 to its receptors, if any Standard methods for conductmg screening assays are well understood in the art

Examples of potential CBMAJC02 polypeptide antagomsts mclude antibodies or, m some cases, oligonucleotides or proteins which are closely related to the gands, substrates, receptors, enzymes, etc , as the case may be, of the CBMAJC02 polypeptide, e g , a fragment of the hgands, substrates, receptors, enzymes, etc , or small molecules which bmd to the polypetide of the present mvention but do not elicit a response, so that the activity of the polypeptide is prevented

Thus in another aspect, the present mvention relates to a screening kit for identifying agomsts, antagonists, hgands, receptors, substrates, enzymes, etc for CBMAJC02 polypeptides, or compounds which decrease or enhance the production of CBMAJC02 polypeptides, which comprises (a) a CBMAJC02 polypeptide, preferably that of SEQ ID NO 2,

(b) a recombinant cell expressing a CBMAJC02 polypeptide, preferably that of SEQ ID NO 2,

(c) a cell membrane expressing a CBMAJC02 polypeptide, preferably that of SEQ ID NO 2, or

(d) antibody to a CBMAJC02 polypeptide, preferably that of SEQ ID NO 2

It will be appreciated that m any such kit, (a), (b), (c) or (d) may comprise a substantial component Prophylactic and Therapeutic Methods

This mvention provides methods of treating abnormal conditions such as, diabetes mellitus, cardiovascular diseases, and kidney diseases related to both an excess of and insufficient amounts of CBMAJC02 polypeptide activity

If the activity of CBMAJC02 polypeptide is m excess, several approaches are available One approach compπses administering to a subject an inhibitor compound (antagonist) as hereinabove descnbed along with a pharmaceutically acceptable earner m an amount effective to inhibit the function of the CBMAJC02 polypeptide, such as, for example, by blocking the bmdmg of hgands, substrates, receptors, enzymes, etc , or by inhibiting a second signal, and thereby alleviating the abnormal condition In another approach, soluble forms of CBMAJC02 polypeptides still capable of binding the ligand, substrate, enzymes, receptors, etc m competition with endogenous CBMAJC02 polypeptide may be administered Typical embodiments of such competitors comprise fragments of the CBMAJC02 polypeptide

In still another approach, expression of the gene encoding endogenous CBMAJC02 polypeptide can be inhibited using expression blockmg techniques Known such techmques involve the use of antisense sequences, either internally generated or separately administered See, for example, O'Connor, J Neurochem (1991) 56 560 ιn Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression. CRC Press, Boca Raton, FL (1988) Alternatively, oligonucleotides which form tnple helices with the gene can be supplied See, for example, Lee et al , Nucleic Acids Res (1979) 6 3073, Cooney et al , Science (1988) 241 456, Dervan et al , Science (1991) 251 1360 These ohgomers can be administered /?er se or the relevant ohgomers can be expressed in vivo

For treating abnormal conditions related to an under-expression of CBMAJC02 and its activity, several approaches are also available One approach compnses admimstermg to a subject a therapeutically effective amount of a compound which activates CBMAJC02 polypeptide, I e , an agomst as descnbed above, m combination with a pharmaceutically acceptable earner, to thereby alleviate the abnormal condition Alternatively, gene therapy may be employed to effect the endogenous production of CBMAJC02 by the relevant cells in the subject For example, a polynucleotide of the mvention may be engmeered for expression m a replication defective retroviral vector, as discussed above The retroviral expression construct may then be isolated and introduced mto a packagmg cell transduced with a retroviral plasmid vector contammg RNA encodmg a polypeptide of the present mvention such that the packagmg cell now produces infectious viral particles containmg the gene of interest These producer cells may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo For overview of gene therapy, see Chapter 20, Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, (and references cited therein) m Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers Ltd (1996) Another approach is to administer a therapeutic amount of CBMAJC02 polypeptides in combination with a suitable pharmaceutical earner

Formulation and Administration Peptides, such as the soluble form of CBMAJC02 polypeptides, and agonists and antagonist peptides or small molecules, may be formulated in combination with a suitable pharmaceutical earner Such formulations compnse a therapeutically effective amount of the polypeptide or compound, and a pharmaceutically acceptable earner or excipient Such earners mclude but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof Formulation should suit the mode of admmistration, and is well within the skill of the art The mvention further relates to pharmaceutical packs and kits compnsmg one or more containers filled with one or more of the ingredients of the aforementioned compositions of the mvention

Polypeptides and other compounds of the present mvention may be employed alone or in con_junction with other compounds, such as therapeutic compounds Prefeπed forms of systemic admmistration of the pharmaceutical compositions mclude injection, typically by intravenous injection Other injection routes, such as subcutaneous, intramuscular, or mtrapentoneal, can be used Alternative means for systemic admmistration mclude transmucosal and transdermal administration usmg penetrants such as bile salts or fusidic acids or other detergents In addition, if properly formulated m enteπc or encapsulated formulations, oral admmistration may also be possible Admmistration of these compounds may also be topical and/or localized, m the form of salves, pastes, gels

The dosage range required depends on the choice of peptide, the route of admmistration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner Suitable dosages, however, are m the range of 0 1-100 μg/kg of subject Wide vanations m the needed dosage, however, are to be expected m view of the vaπety of compounds available and the differing efficiencies of vaπous routes of admmistration For example, oral admmistration would be expected to require higher dosages than admmistration by intravenous injection Vanations m these dosage levels can be adjusted usmg standard empincal routines for optimization, as is well understood the art

Polypeptides used m treatment can also be generated endogenously m the subject, m treatment modalities often refeπed to as "gene therapy" as descnbed above Thus, for example, cells from a sub_ject may be engmeered with a polynucleotide, such as a DNA or RNA, to encode a polypeptide ex vivo, and for example, by the use of a retroviral plasmid vector The cells are then introduced mto the subject All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though f illy set forth.

SEQUENCE LISTING

(1) GENERAL INFORMATION

(i) APPLICANT: SHANGHAI SECOND MEDICAL UNIVERSITY

(ii) TITLE OF THE INVENTION: CBMAJC02 : A Gene Similar to Bovine F]_F₀-ATP synthase complex F₀ membrane domain f -subunit

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: RATNER & PRESTIA (B) STREET: P.O. BOX 980

(C) CITY: VALLEY FORGE

(D) STATE: PA

(E) COUNTRY: USA

(F) ZIP: 19482

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Diskette

(B) COMPUTER: IBM Compatible

(C) OPERATING SYSTEM: DOS (D) SOFTWARE: FastSEQ for Windows Version 2.0

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: TO BE ASSIGNED

(B) FILING DATE: (C) CLASSIFICATION: UNKNOWN

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(viii) ATTORNEY/AGENT INFORMATION: (A) NAME: PRESTIA, PAUL F (B) REGISTRATION NUMBER: 23,031

(C) REFERENCE/DOCKET NUMBER: GP70349

(ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 610-407-0700

(B) TELEFAX: 610-407-0701

(C) TELEX: 846169

(2) INFORMATION FOR SEQ ID NO : 1 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 452 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

GGGCACAGCG GACACCAGGA CTCCAAAATG GCGTCAGTTG GTGAGTGTCC GGCCCCAGTA 60

CCAGTGAAGG ACAAGAAACT TCTGGAGGTC AAACTGGGGG AGCTGCCAAG CTGGATCTTG 120 ATGCGGGACT TCAGTCCTAG TGGCATTTTC GGAGCGTTTC AAAGAGGTTA CTACCGGTAC 180

TACAACAAGT ACATCAATGT GAAGAAGGGG AGCATCTCGG GGATTACCAT GGTGCTGGCA 240

TGCTACGTGC TCTTTAGCTA CTCCTTTTCC TACAAGCATC TCAAGCACGA GCGGCTCCGC 300

AAATACCACT GAAGAGGACA CACTCTGCAC CCCCCCACCC CACGACCTTG GCCCGAGCCC 360

CTCCGTGAGG AACACAATCT CAATCGTTGC TGAATCCTTT CATATCCTAA TAGGAATTAA 420 CCTCCAAATA AAACATGACT GGTAAAAAAA AA 452

(2) INFORMATION FOR SEQ ID NO : 2 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 94 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 2 :

Met Ala Ser Val Gly Glu Cys Pro Ala Pro Val Pro Val Lys Asp Lys 1 5 10 15

Lys Leu Leu Glu Val Lys Leu Gly Glu Leu Pro Ser Trp lie Leu Met

20 25 30

Arg Asp Phe Ser Pro Ser Gly lie Phe Gly Ala Phe Gin Arg Gly Tyr 35 40 45

Tyr Arg Tyr Tyr Asn Lys Tyr lie Asn Val Lys Lys Gly Ser lie Ser

50 55 60

Gly lie Thr Met Val Leu Ala Cys Tyr Val Leu Phe Ser Tyr Ser Phe 65 70 75 80

Ser Tyr Lys His Leu Lys His Glu Arg Leu Arg Lys Tyr His 85 90

Claims

What is claimed is:

1 An isolated polynucleotide compnsmg a nucleotide sequence that has at least 80% identity over its entire length to a nucleotide sequence encodmg the CBMAJC02 polypeptide of SEQ ID NO 2, or a nucleotide sequence complementary to said isolated polynucleotide

2 The polynucleotide of claim 1 wherein said polynucleotide comprises the nucleotide sequence contained m SEQ ID NO 1 encoding the CBMAJC02 polypeptide of SEQ ED N02

3 The polynucleotide of claim 1 wherein said polynucleotide compnses a nucleotide sequence that is at least 80% identical to that of SEQ ID NO 1 over its entire length

4 The polynucleotide of claim 3 which is polynucleotide of SEQ ID NO 1

5 The polynucleotide of claim 1 which is DNA or RNA

6 A DNA or RNA molecule compnsmg an expression system, wherem said expression system is capable of producing a CBMAJC02 polypeptide compnsmg an ammo acid sequence, which has at least 80% identity with the polypeptide of SEQ ID NO 2 when said expression system is present m a compatible host cell

7 A host cell comprising the expression system of claim 6

8 A process for producing a CBMAJC02 polypeptide compnsmg cultu╧Çng a host of claim 7 under conditions sufficient for the production of said polypeptide and recove╧Çng the polypeptide from the culture

9 A process for producing a cell which produces a CBMAJC02 polypeptide thereof comprising transforming or transfecting a host cell with the expression system of claim 6 such that the host cell, under appropnate culture conditions, produces a CBMAJC02 polypeptide

10 A CBMAJC02 polypeptide comprising an amino acid sequence which is at least 80% identical to the ammo acid sequence of SEQ ID NO 2 over its entire length

11 The polypeptide of claim 10 which comp╧Çses the ammo acid sequence of SEQ ID NO 2

12 An antibody immunospecific for the CBMAJC02 polypeptide of claim 10

13 A method for the treatment of a subject in need of enhanced activity or expression of CBMAJC02 polypeptide of claim 10 compnsmg

(a) administering to the subject a therapeutically effective amount of an agonist to said polypeptide, and/or

(b) providing to the subject an isolated polynucleotide compnsmg a nucleotide sequence that has at least 80% identity to a nucleotide sequence encodmg the CBMAJC02 polypeptide of SEQ ID NO 2 over its entire length, or a nucleotide sequence complementary to said nucleotide sequence m a form so as to effect production of said polypeptide activity in vivo

14 A method for the treatment of a subject having need to inhibit activity or expression of CBMAJC02 polypeptide of claim 10 compnsmg (a) admmiste╧Çng to the subject a therapeutically effective amount of an antagonist to said polypeptide, and/or

(b) admimste╧Çng to the subject a nucleic acid molecule that inhibits the expression of the nucleotide sequence encodmg said polypeptide, and/or

(c) administering to the subject a therapeutically effective amount of a polypeptide that competes with said polypeptide for its ligand, substrate , or receptor

15 A process for diagnosing a disease or a susceptibility to a disease in a subject related to expression or activity of CBMAJC02 polypeptide of claim 10 m a subject compnsmg

(a) determining the presence or absence of a mutation m the nucleotide sequence encodmg said CBMAJC02 polypeptide in the genome of said subject, and/or

(b) analyzing for the presence or amount of the CBMAJC02 polypeptide expression m a sample denved from said subject

16. A method for identifying compounds which inhibit (antagonize) or agonize the CBMAJC02 polypeptide of claim 10 which comprises:

(a) contacting a candidate compound with cells which express the CBMAJC02 polypeptide (or cell membrane expressing CBMAJC02 polypeptide) or respond to CBMAJC02 polypeptide; and

(b) observing the binding, or stimulation or inhibition of a functional response; or comparing the ability of the cells (or cell membrane) which were contacted with the candidate compounds with the same cells which were not contacted for CBMAJC02 polypeptide activity.

17. An agonist identified by the method of claim 16.

18. An antagonist identified by the method of claim 16.

19. A recombinant host cell produced by a method of Claim 9 or a membrane thereof expressing a CBMAJC02 polypeptide.