WO1999031251A1 - Method and means for producing high titer, safe, recombinant lentivirus vectors - Google Patents

Method and means for producing high titer, safe, recombinant lentivirus vectors Download PDF

Info

Publication number
WO1999031251A1
WO1999031251A1 PCT/US1998/025719 US9825719W WO9931251A1 WO 1999031251 A1 WO1999031251 A1 WO 1999031251A1 US 9825719 W US9825719 W US 9825719W WO 9931251 A1 WO9931251 A1 WO 9931251A1
Authority
WO
WIPO (PCT)
Prior art keywords
lentivirus
vector
ltr
packaging
cell
Prior art date
Application number
PCT/US1998/025719
Other languages
French (fr)
Other versions
WO1999031251A9 (en
Inventor
Luigi Naldini
Thomas Dull
Deborah A. Farson
Rochelle Witt
Original Assignee
Cell Genesys, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cell Genesys, Inc. filed Critical Cell Genesys, Inc.
Priority to AU18034/99A priority Critical patent/AU751985B2/en
Priority to CA2314609A priority patent/CA2314609C/en
Priority to JP2000539150A priority patent/JP4640742B2/en
Priority to KR1020007006425A priority patent/KR20010033064A/en
Priority to EP98962894A priority patent/EP1036182B1/en
Priority to DE69838758T priority patent/DE69838758T2/en
Publication of WO1999031251A1 publication Critical patent/WO1999031251A1/en
Publication of WO1999031251A9 publication Critical patent/WO1999031251A9/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/11011Alpharetrovirus, e.g. avian leucosis virus
    • C12N2740/11041Use of virus, viral particle or viral elements as a vector
    • C12N2740/11044Chimeric viral vector comprising heterologous viral elements for production of another viral vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16051Methods of production or purification of viral material
    • C12N2740/16052Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • the invention relates to novel lentiviral packaging vectors, " transfer vectors carrying a foreign gene of interest, stable packaging cell lines, stable producer cell lines and the use thereof for producing recombinant lentivirus in mammalian cells.
  • Retrovirus vectors are a common tool for gene delivery (Miller, Nature (1992) 357:455-460). The ability of retrovirus vectors to deliver an unrearranged, single copy gene into a broad range of rodent, primate and human somatic cells makes retroviral vectors well suited for transferring genes to a cell.
  • a useful adjunct for producing recombinant retroviral vectors are packaging cell lines which supply in trans the proteins necessary for producing infectious virions, but those cells are incapable of packaging endogenous viral genomic nucleic acids (Watanabe & Temin, Molec. Cell. Biol. (1983) 3(12) .2241-2249; Mann et al. , Cell (1983) 33:153-159; E bretson & Te in, J. Virol. (1987) 61(9) :2675-2683) .
  • One approach to minimize the likelihood of generating RCR in packaging cells is to divide the packaging functions into two genomes, for example, one which expresses the gag and pol gene products and the other which expresses the env gene product (Bosselman et al. , Molec. Cell. Biol. (1987) 7 (5) : 1797-1806 ; Markowitz et al., J. Virol. (1988) 62 (4) : 1120-1124 ; Danos & Mulligan, Proc. Natl. Acad. Sci. (1988) 85:6460-6464). That approach minimizes the ability for co-packaging and subsequent transfer of the two-genomes, as well as significantly decreasing the frequency of recombination due to the presence of three retroviral genomes in the packaging cell to produce RCR.
  • Mulligan, supra or deletions (Boselman et al., supra; Markowitz et al., supra) can be configured within the undesired gene products to render any possible recombinants non-functional.
  • deletion of the 3' LTR on both packaging constructs further reduces the ability to form functional recombinants.
  • Lentiviruses are complex retroviruses which, in addition to the common retroviral genes gag, pol and env, contain other genes with regulatory or structural function. The higher complexity enables the lentivirus to modulate the life cycle thereof, as in the course of latent infection.
  • HIV human immunodeficiency virus
  • MDM monocyte-derived macrophages
  • HeLa-Cd4 HeLa-Cd4
  • T ly phoid cells arrested in the cell cycle by treatment with aphidicolin or 7 irradiation.
  • Infection of cells is dependent on the active nuclear import of HIV preintegration complexes through the nuclear pores of the target cells. That occurs by the interaction of multiple, partly redundant, molecular determinants in the complex with the nuclear import machinery of the target cell.
  • Identified determinants include a functional nuclear localization signal (NLS) in the gag matrix (MA) protein, "the karyophilic virion-associated protein, vpr, and a C-terminal phosphotyrosine residue in the gag MA protein.
  • the instant invention relates to novel disarmed lentiviral vectors that direct the synthesis of both lentiviral vector transcripts which can be packaged and lentiviral proteins for rapid production of high titer recombinant lentivirus in mammalian cells.
  • the results are infectious particles for delivering a foreign gene of interest to a target cell.
  • the invention also provides cell lines for virus production.
  • Figure 1 depicts various lentivirus vectors.
  • RSV is the Rous sarcoma virus enhancer/promoter;
  • R is the R region of the LTR;
  • U5 is the U5 region of the LTR;
  • SD is a slice donor site, such as the HIV 5' major splice donor site; is the Psi encapsidation signal sequence;
  • Ga is a part of the gag gene;
  • RRE is the rev responsive element;
  • SA is a splice acceptor sequence; and
  • U3 is the U3 region of the LTR.
  • FIG. 2 depicts additional lentivirus vectors.
  • CMV is cytomegalovirus . Otherwise, the symbols are as found in the legend to Figure 1.
  • Figure 3 is a graph depicting graded vector production with increasing amounts of transfer vector.
  • the instant invention provides a recombinant lentivirus capable of infecting non-dividing cells as well as methods and means for making same.
  • the virus is useful for the in vivo and ex vivo transfer and expression of nucleic acid sequences.
  • the lentiviral genome and the proviral DNA have the three genes found in retroviruses : gag, pol and env, which are flanked by two long terminal repeat (LTR) sequences.
  • the gag gene encodes the internal structural (matrix, capsid and nucleocapsid) proteins; the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase) , a protease and an integrase; and the env gene encodes viral envelope glycoproteins.
  • the 5' and 3' LTR's serve to promote transcription and polyadenylation of the virion RNA's.
  • the LTR contains all other cis-acting sequences necessary for viral replication.
  • Lentiviruses have additional genes including vif, vpr, tat, rev, vpu, nef and vpx (in HIV-l, HIV-2 and/or SIV) .
  • Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (the Psi site) . If the sequences necessary for encapsidation (or packaging of retroviral RNA into infectious virions) are missing from the viral genome, the cis defect prevents encapsidation of genomic RNA.
  • the invention provides a method of producing a recombinant lentivirus capable of infecting a non-dividing cell comprising transfecting a suitable host cell with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat.
  • vectors lacking a functional tat gene are desirable for certain applications.
  • a first vector can provide a nucleic acid encoding a viral gag and a viral pol and another vector can provide a nucleic acid encoding a viral env to produce a packaging cell.
  • Introducing a vector providing a heterologous gene, herein identified as a transfer vector, into that packaging cell yields a producer cell which releases infectious viral particles carrying the foreign gene of interest.
  • the vectors per se, outside of the newly constructed vectors disclosed herein, are known in the art, see Naldini et al., Sci. (1996) 272:263-267; and Zufferey et al., Nat. Biotech. (1997) 15:871-875.
  • the vectors are plasmid-based or virus-based, and are configured to carry the essential sequences for incorporating foreign nucleic acid, for selection and for transfer of the nucleic acid into a host cell.
  • the gag, pol and env genes of the vectors of interest also are known in the art. Thus, the relevant genes are cloned into the selected vector and then used to transform the target cell of interest.
  • the second vector can provide a nucleic acid encoding a viral envelope (env) gene.
  • the env gene can be derived from any virus, including retroviruses .
  • the env preferably is an amphotropic envelope protein which allows transduction of cells of human and other species. W wO v . 9 ? 9- / .3o1 i 25s1t PCT/US98/25719
  • Retroviral vectors can be made target-specific by inserting, for example, a glycolipid or a protein. Targeting often is accomplished by using " an antigen-binding portion of an antibody or a recombinant antibody-type molecule, such as a single chain antibody, to target the retroviral vector.
  • retroviral-derived env genes include, but are not limited to: Moloney murine leukemia virus (MoMuLV or MMLV) , Harvey murine sarcoma virus (HaMuSV or HSV) , murine mammary tumor virus (MuMTV or MMTV) , gibbon ape leukemia virus (GaLV or GALV) , human immunodeficiency virus (HIV) and Rous sarcoma virus (RSV) .
  • Other env genes such as Vesicular stomatitis virus (VSV) protein G (VSV G) , that of hepatitis viruses and of influenza also can be used.
  • VSV Vesicular stomatitis virus
  • VSV G Vesicular stomatitis virus
  • the vector providing the viral env nucleic acid sequence is associated operably with regulatory sequences, e.g., a promoter or enhancer.
  • the regulatory sequence can be any eukaryotic promoter or enhancer, including for example, the Moloney murine leukemia virus promoter-enhancer element, the human cytomegalovirus enhancer or the vaccinia P7.5 promoter. In some cases, such as the Moloney murine leukemia virus promoter-enhancer element, the promoter-enhancer elements are located within or adjacent to the LTR sequences.
  • the regulatory sequence is one which is not endogenous to the lentivirus from which the vector is being constructed. Thus, if the vector is being made from SIV, the SIV regulatory sequence found in the SIV LTR would be replaced by a regulatory element which does not originate from SIV.
  • VSV G protein is a desirable env gene because VSV G confers broad host range on the recombinant virus, VSV G can be deleterious to the host cell.
  • VSV G can be deleterious to the host cell.
  • the tetracycline-regulatable gene expression system of Gossen & Bujard can be employed to provide for inducible expression of VSV G when tetracycline is withdrawn from the transferred cell.
  • the tet/VP16 transactivator is present on a first vector and the VSV G coding sequence is cloned downstream from a promoter controlled by tet operator sequences on another vector.
  • heterologous or foreign nucleic acid sequence is linked operably to a regulatory nucleic acid sequence.
  • heterologous nucleic acid sequence refers to a sequence that originates from a foreign species, or, if from the same species, it may be substantially modified from the original form. Alternatively, an unchanged nucleic acid sequence that is not expressed normally in a cell is a heterologous nucleic acid sequence.
  • operably linked refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter.
  • the heterologous sequence is linked to a promoter, resulting in a chimeric gene.
  • the heterologous nucleic acid sequence is preferably under control of either the viral LTR promoter-enhancer signals or of an internal promoter, and retained signals within the retroviral LTR can still bring about efficient expression of the transgene.
  • the foreign gene can be any nucleic acid of interest which can be transcribed. Generally the foreign gene encodes 'a polypeptide. Preferably the polypeptide has some therapeutic benefit. The polypeptide may supplement deficient or nonexistent expression of an endogenous protein in a host cell. The polypeptide can confer new properties on the host cell, such as a chimeric signalling receptor, see U.S. Patent No. 5,359,046. The artisan can determine the appropriateness of a foreign gene practicing techniques taught herein and known in the art. For example, the artisan would know whether a foreign gene is of a suitable size for encapsidation and whether the foreign gene product is expressed properly.
  • a gene regulating molecule in a cell by the introduction of a molecule by the method of the invention.
  • modulate envisions the suppression of expression of a gene when it is over-expressed or augmentation of expression when it is under-expressed.
  • nucleic acid sequences that interfere with the expression of a gene at the translational level can be used.
  • the approach can utilize, for example, antisense nucleic acid, ribozymes or triplex agents to block transcription or translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or triplex agent, or by cleaving same with a ribozyme.
  • Antisense nucleic acids are DNA or RNA molecules which are complementary to at least a portion of a specific" mRNA molecule (Weintraub, Sci. Am. (1990) 262:40). In the cell, the antisense nucleic acids hybridize to the corresponding mRNA forming a double-stranded molecule.
  • antisense nucleic acids interfere with the translation of the mRNA since the cell will not translate a mRNA that is double-stranded.
  • Antisense oligomers of about 15 nucleotides or more are preferred since such are synthesized easily and are less likely to cause problems than larger molecules when introduced into the target cell.
  • the use of antisense methods to inhibit the in vitro translation of genes is well known in the art
  • the antisense nucleic acid can be used to block expression of a mutant protein or a dominantly active gene product, such as amyloid precursor protein that accumulates in Alzheimer's disease. Such methods are also useful for the treatment of Huntington's disease, hereditary Parkinsonism and other diseases. Antisense nucleic acids are also useful for the inhibition of expression of proteins associated with toxicity.
  • oligonucleotide to stall transcription can be by the mechanism known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix. Therefore, the triplex compounds can be designed to recognize a unique site on a chosen gene (Maher et al., Antisense Res and Dev. (1991) 1(3):227; Helene, Anticancer Drug Dis. (1991) 6(6):569).
  • Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode those RNA's, it is possible to engineer molecules that recognize and cleave specific nucleotide sequences in an RNA molecule (Cech, J. Amer. Med Assn. (1988) 260:3030)'. A major advantage of that approach is only mRNA's with particular sequences are inactivated.
  • nucleic acid encoding a biological response modifier.
  • immunopotentiating agents including nucleic acids encoding a number of the cytokines classified as "interleukins” , for example, interleukins 1 through 12.
  • interferons include gamma interferon (7-IFN) , tumor necrosis factor (TNF) and granulocyte-macrophage colony stimulating factor (GM-CSF) . It may be desirable to deliver such nucleic acids to bone marrow cells or macrophages to treat inborn enzymatic deficiencies or immune defects.
  • Nucleic acids encoding growth factors, toxic peptides, ligands, receptors or other physiologically important proteins also can be introduced into specific non-dividing cells.
  • the recombinant lentivirus of the invention can be used to treat an HIV-infected cell (e.g., T-cell or macrophage) with an an i-HIV molecule.
  • an HIV-infected cell e.g., T-cell or macrophage
  • respiratory epithelium for example, can be infected with a recombinant lentivirus of the invention having a gene for cystic fibrosis transmembrane conductance regulator
  • CTR cystic fibrosis
  • the method of the invention may also be useful for neuronal, glial, fibroblast or mesenchymal cell transplantation, or "grafting", which involves transplantation of cells infected with the recombinant lentivirus of the invention ex vivo, or infection in vivo into the central nervous system or into the ventricular cavities or subdurally onto the surface of a host brain.
  • grafting Such methods for grafting will be known to those skilled W wO ⁇ 9 y 9 y / / 3o1 i 2.s51 i PCT JS98/25719
  • gene transfer could introduce a normal gene into the affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations.
  • a Factor VIII or IX encoding nucleic acid into a lentivirus for infection of a muscle, spleen or liver cell.
  • the promoter sequence may be homologous or heterologous to the desired gene sequence.
  • a wide range of promoters may be utilized, including a viral or a mammalian promoter.
  • Cell or tissue specific promoters can be utilized to target expression of gene sequences in specific cell populations. Suitable mammalian and viral promoters for the instant invention are available in the art.
  • the nucleic acid construct referred to as the transfer vector having the packaging signal and the heterologous cloning site, also contains a selectable marker gene.
  • Marker genes are utilized to assay for the presence of the vector, and thus, to confirm infection and integration. The presence of a marker gene ensures the selection and growth of only those host cells which express the inserts.
  • Typical selection genes encode proteins that confer resistance to antibiotics and other toxic substances, e.g., histidinol, puromycin, hygromycin, neomycin, methotrexate etc. and cell surface markers.
  • nucleic acid sequence refers to any nucleic acid molecule, preferably DNA, as discussed in detail herein.
  • the nucleic acid molecule may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA or combinations thereof.
  • Such nucleic acid sequences may comprise genomic DNA which may or may not include naturally occurring introns.
  • genomic DNA may be obtained in association with promoter regions, poly A sequences or other associated sequences. Genomic DNA may be extracted and purified from suitable cells by means well known in the art. Alternatively, messenger RNA (mRNA) can be isolated from cells and used to produce cDNA by reverse transcription or other means.
  • mRNA messenger RNA
  • the recombinant lentivirus produced by the method of the invention is a derivative of human immunodeficiency virus (HIV) .
  • HIV human immunodeficiency virus
  • the env will be derived from a virus other than HIV.
  • the method of the invention provides, in some embodiments, three vectors which provide all of the functions required for packaging of recombinant virions, such as, gag, pol, env, tat and rev, as discussed above.
  • tat may be deleted functionally for unexpected benefits.
  • the vectors are introduced via transfection or infection into the packaging cell line.
  • the packaging cell line produces viral particles that contain the vector genome. Methods for transfection or infection are well known by those of skill in the art. After cotransfection of the packaging vectors and the transfer vector to the packaging cell line, the recombinant virus is recovered from the culture media and titered by standard methods used by those of skill in the art.
  • the packaging constructs can be introduced into human cell lines by calcium phosphate transfection, lipofection or electroporation, generally together with a dominant selectable marker, such as neo, DHFR, Gin synthetase or ADA, followed by selection in the presence of the appropriate drug and isolation of clones.
  • the selectable marker gene can be linked physically to the packaging genes in the construct.
  • Stable cell lines wherein the packaging functions are configured to be expressed by a suitable packaging cell are known. For example, see U.S. Pat. No. 5,686,279; and
  • the construct contains tat and rev sequences and the 3' LTR is replaced with poly A sequences.
  • the 5' LTR and psi sequences are replaced by another promoter, such as one which is inducible.
  • a CMV promoter or derivative thereof can be used.
  • the packaging vectors of interest contain additional changes to the packaging functions to enhance lentiviral protein expression and to enhance safety. For example, all of the HIV sequences upstream of gag can be removed. Also, sequences downstream of env can be removed.
  • steps can be taken to modify the vector to enhance the splicing and translation of the RNA.
  • the instant invention provides for lentivirus packaging plasmids wherein tat sequences, a regulating protein which promotes viral expression through a transcriptional mechanism, are deleted functionally.
  • tat sequences a regulating protein which promotes viral expression through a transcriptional mechanism
  • the tat gene can be deleted, in part or in whole, or various point mutations or other mutations can be made to the tat sequence to render the gene non-functional.
  • An artisan can practice known techniques to render the tat gene non-functional.
  • Isolated plasmids, DNA sequences or synthesized oligonucleotides are cleaved, tailored and religated in the form desired.
  • Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions which are understood in the art, and the particulars of which are specified by the manufacturer of the commercially available restriction enzymes, see, e.g. New England Biolabs, Product Catalog.
  • suitable restriction enzyme or enzymes
  • about 1 ⁇ g of plasmid or DNA sequences is cleaved by one unit of enzyme in about 20 ⁇ l of buffer solution.
  • an excess of restriction enzyme is used to ensure complete digestion of the DNA substrate. Incubation times of about one hour to two hours at about 37 °C are workable, although variations can be tolerated.
  • cleaved fragments After each incubation, protein is removed by extraction with phenol/chloroform, which may be followed by ether extraction, and the nucleic acid recovered from aqueous fractions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods of Enzymology 65:499-560 (1980) .
  • Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli DNA polymerase I (Klenow) in the presence of the four deoxynucleotide triphosphates (dNTP's) using incubation times of about 15 to 25 minutes at 20°C in 50 mM Tris (pH 7.6) " 50 mM NaCl, 6 mM MgCl 2 , 6 mM DTT and 5-10 ⁇ M dNTP's.
  • the Klenow fragment fills in at 5' sticky ends but chews back protruding 3' single strands, even though the four dNTP's are present.
  • selective repair can be performed by supplying only one of the dNTP's, or with selected dNTP's, within the limitations dictated by the nature of the sticky ends.
  • the mixture is extracted with phenol/chloroform and ethanol precipitated.
  • Treatment under appropriate conditions with SI nuclease or Bal-31 results in hydrolysis of any single-stranded portion.
  • Ligations can be performed in 15-50 ⁇ l volumes under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 M MgCl 2 , 10 mM DTT, 33 mg/ml BSA, 10 mM-50 mM NaCl and either 40 ⁇ M ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C (for "sticky end” ligation) or 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14 °C (for "blunt end” ligation) .
  • Intermolecular "sticky end” ligations are usually performed at 33-100 ⁇ g/ml total DNA concentrations (5-100 mM total end concentration) .
  • Intermolecular blunt end ligations (usually employing a
  • a lentiviral packaging vector is made to contain a promoter and other optional or requisite regulatory sequences as determined by the artisan, gag, pol, rev, env or a combination thereof, and with specific functional or actual excision of tat, and optionally other lentiviral accessory genes.
  • the integrated lentiviral vector In transduced cells, the integrated lentiviral vector generally has an LTR at each termini.
  • the 5' LTR may cause accumulation of "viral" transcripts that may be the substrate of recombination, in particular in HIV-infected cells.
  • the 3' LTR may promote downstream transcription with the consequent risk of activating a cellular protooncogene.
  • the U3 sequences comprise the majority of the HIV LTR.
  • the U3 region contains the enhancer and promoter elements that modulate basal and induced expression of the HIV genome in infected cells and in response to cell activation.
  • Several of the promoter elements are essential for viral replication. Some of the enhancer elements are highly conserved among viral isolates and have been implicated as critical virulence factors in viral pathogenesis. The enhancer elements may act to influence replication rates in the different cellular target of the virus (Marthas et al. J. Virol. (1993) 67:6047-6055) .
  • the 3 ' LTR acts as template for the generation of both LTR's in the integrated provirus. If the 3' copy of the U3 region is altered in a retroviral vector construct, the vector RNA still is produced from the intact 5' LTR in producer cells, but cannot be regenerated in target cells.
  • the retrovirus is sel -inactivating (SIN) and those vectors are known as Sin transfer vectors.
  • the 5' end of the U3 region serves another essential function in vector transfer, being required for integration (terminal dinucleotide + att sequence).
  • the terminal dinucleotide and the att sequence may represent the 5' boundary of the U3 sequences which can be deleted.
  • some loosely defined regions may influence the activity of the downstream polyadenylation site in the R region. Excessive deletion of U3 sequence from the 3' LTR may decrease polyadenylation of vector transcripts with adverse consequences both on the titer of the vector in producer cells and the transgene expression in target cells. On the other hand, limited deletions may not abrogate the transcriptional activity of the LTR in transduced cells.
  • New versions of a lentivirus transfer vector described herein carry increasing deletions of the U3 region of the 3' LTR ( Figure 1: the U3 deletions span from nucleotide -418 of the U3 LTR to the indicated position: SIN-78,
  • Lentiviral vectors with almost complete deletion of the U3 sequences from the 3 ' LTR were developed without compromising either the titer of vector in producer cells or transgene expression in target cells.
  • the most extensive deletion (-418 to -18) extends as far as to the TATA box, therefore abrogating any transcriptional activity of the LTR in transduced cells.
  • the lower limit of the 3' deletion may extend as far as including the TATA box.
  • the deletion may be of the remainder of the U3 region up to the R region.
  • the average expression level of the transgene was even higher in cells transduced by the SIN vectors as compared to more intact vectors. That was probably due to the removal of transcriptional interference from the upstream HIV LTR on the internal promoter. SIN-type vectors with such extensive deletions of the U3 region could not be generated for murine leukemia virus (MLV) based retroviral vectors without compromising efficiency of transduction.
  • MLV murine leukemia virus
  • the 5' LTR of transfer vector construct was modified by substituting part or all of the transcriptional regulatory elements of the U3 region with heterologous enhancer/promoters. The changes were made to enhance the expression of transfer vector RNA in producer cells; to allow vector production in the absence of the HIV tat gene; and to remove the upstream wild-type copy of the HIV LTR that can recombine with the 3' deleted version to "rescue" the above described SIN vectors.
  • vectors containing the above-described alterations at the 5' LTR, 5' vectors can find use as transfer vectors because of the sequences to enhance expression and in combination with packaging cells that do not express tat.
  • LTR as discussed hereinabove to yield improved transfer vectors which have not only enhanced expression and can be used in packaging cells that do not express tat but can be self-inactivating as well.
  • the transcription from the HIV LTR is highly dependent on the transactivator function of the tat protein.
  • vector transcription from the HIV LTR is stimulated strongly.
  • full-length "viral" RNA has a full complement of packaging signals, the RNA is encapsidated efficiently into vector particles and transferred to target cells.
  • the amount of vector RNA available for packaging in producer cells is a rate-limiting step in the production of infectious vector.
  • the enhancer or the enhancer and promoter regions of the 5' LTR were substituted with the enhancer or the enhancer and promoter of the human cytomegalovirus (CMV) or murine Rous sarcoma virus (RSV) , respectively, see Figure 2 for a schematic of the constructs and the code names of the hybrid vectors.
  • CCL and RRL vectors have complete substitution of the 5' U3 region.
  • control lentivector HR2 and the panel of 5' hybrids were compared in producer cells tran ⁇ fected with the transfer vector, and with or without packaging constructs, which provide the tat transactivator.
  • the transcriptional level of the four chimeric vectors is higher than that of a control lentivector both in the presence and in the absence of the packaging construct. All chimeric vectors efficiently transfer the transgene into target cells and the RRL vector performs as well as the control HR2 vector.
  • integration of the vector in target cells was confirmed by examining transduced cells at an early and a later passage after transduction. No decrease was observed in the percentage of transgene-positive cells indicating that the vector had been integrated.
  • a lentiviral vector of significantly improved biosafety is a SIN transfer vector that has no wild-type copy of the HIV LTR either at the 5' or at the 3' end, which is used in conjunction with tat-less packaging vectors as described herein.
  • Viral supernatants are harvested using standard techniques such as filtration of supernatants 48 hours post transfection.
  • the viral titer is determined by infection of, for example, 10 6 NIH 3T3 cells or 10 5 HeLa cells with an appropriate amount of viral supernatant, in the presence of 8 ⁇ g/ml polybrene (Sigma Chemical Co., St. Louis, MO) . Forty-eight hours later, the transduction efficiency is assayed.
  • the instant invention provides methods and means for producing high titer recombinant virus.
  • Those virus particle preparations can be used to infect target cells using techniques known in the art.
  • the instant invention will find use in ex vivo gene therapy applications wherein target cells are removed from a host, transformed in culture practicing known techniques and then returned to the host.
  • the lentiviral packaging plasmids were derived from the plasmid pCMV ⁇ R8.9 ( ⁇ Vpr ⁇ Vif ⁇ Vpu ⁇ Nef) described previously in Zufferey et al., supra. All the remaining sequences of the nef gene in pCMV ⁇ R8.9 were removed by digesting with Xhol and BstEII, filing in with Klenow and religating. The construction deleted 100 basepairs, joining the truncated env reading frame of HIV-1 to the genomic insulin polyadenylation site and yielding the plasmid pCMV ⁇ R8.73.
  • 133 basepairs of CMV-derived sequences downstream of the CMV promoter were deleted in the plasmid pCMV ⁇ R8.73. That sequence contains a splice donor site and it was removed by digestion of the plasmid pCMV ⁇ R8.73 with SacII and religation of the larger fragment, obtaining the plasmid pCMV ⁇ R8.74.
  • pCMV ⁇ R8.75 was derived from pCMV ⁇ R8.74 by replacing the 94 bp Sstll-Clal fragment with an Sstll-Clal oligonucleotide linker consisting of, 5'-
  • an inducible packaging construct was obtained by replacing the Pstl-SacII fragment of pCMV ⁇ R8.74 containing the CMV promoter with seven tandem copies of the tetracycline operator sequences linked to a minimal CMV promoter.
  • the tet-regulated packaging plasmid pTet ⁇ R8.74 was obtained.
  • the lentiviral transfer vector plasmids were derived from the plasmid pHR'-CMV-LacZ described previously in Naldini et al. (Sci. (1996) 272:263-267).
  • pHR2 is a lentiviral transfer vector in which 124 bp of nef sequences upstream of the 3' LTR in pHR' were replaced with a polylinker both to reduce HIV1 sequences and to facilitate transgene cloning.
  • pHR2 was derived from pHR'-CMV-LacZ by replacing the 4.6 kb Clal-StuI fragment with the 828 bp Clal-StuI fragment generated by PCR using pHR'-CMV-LacZ as the template and the oligonucleotide, 5'- CCATCGATCACGAGACTAGTCCTACGTATCCCCGGGGACGGGATCCGCGGAATTCC GTTTAAGAC-3' (SEQ ID NO: ) and 5 ' -TTATAATGTCAAGGCCTCTC-3 ' (SEQ ID NO: ) in a three part ligation with a 4.4 kb
  • pHR3 is a lentiviral transfer vector in which 148 bp of env coding sequences (including an ATG) upstream of the Rev Response Element (RRE) in pHR2 were deleted.
  • pHR3 was derived from pHR2 by replacing the 893 bp Notl-Spel fragment of 'pHR2 with a 747 bp Notl-Spel fragment generated by PCR using pHR2 as the template with oligonucleotide primers 5'- GCGGCCGCAGGAGCTTTGTTCCTTGG-3 ' (SEQ ID NO: ) and 5'-
  • pHR5 is a lentiviral transfer vector in which 310 bp gag coding sequences (all gag coding sequences downstream from amino acid 15 of the Gag protein) were deleted from pHR2.
  • pHR5 was derived by digestion of pHR2 with Nrul, addition of a NotI linker (synthetic oligonucleotide 5 ' -TTGCGGCCGCAA-3 ' ,
  • pHR6 is a lentiviral vector in which the 5' splice donor signal was mutated (TGGT to TGAT) to enhance production of full-length transcripts capable of being packaged. pHR6 was derived from pHR5 by replacing the 239 bp Aflll-Apol fragment with a 239 bp Aflll-Apol fragment generated by
  • PCR fragments were generated by first cloning the PCR reaction product directly into the TA cloning vector pCR2.1 (Invitrogen) followed by sequence verification and excision with the appropriate enzymes.
  • the 5' LTR of the lentiviral vector contains the enhancer and promoter from the U3 region of the Rous Sarcoma Virus (RSV) joined to the R region of HIV-l (plasmid pRRL) .
  • pRRL is a lentiviral transfer vector in which the enhancer and promoter (nucleotides -233 to -1 relative to the transcriptional start site) of RSV is precisely fused to the R region of HIV-1 using an oligonucleotide linker.
  • pRRL was derived from plasmids pRT43.RSV.F3 , see WO97/07225, and pHR2 by replacing the 3.4 kb EcoRI-Hpal fragment of pRT43.RSV.F3 with the .67 kb Bglll-NotI fragment from pHR2 and the 1.7kb Notl-StuI fragment from pHR2 along with a synthetic EcoRI-Bglll oligonucleotide linker consisting of oligonucleotides 5'- AATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGG
  • the 5' LTR of the lentiviral vector contains the enhancer (nucleotides
  • pRLL is a lentiviral transfer vector in which the enhancer of RSV is fused to the promoter region of HIV-1 using an oligonucleotide linker.
  • pRRL was derived from plasmids pRT43.RSV.F3 and pHR2 by replacing the 3.4 kb EcoRI-Hpal fragment of pRT43.RSV.F3 with the .724 kb AlwNI-NotI fragment from pHR2 and the 1.7 kb Notl-StuI fragment from pHR2 along with a synthetic EcoRI-AlwNI oligonucleotide linker consisting of the oligo, 5'- AATTGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATC-3 ' (SEQ ID NO: ) and the oligonucleotide, 5'- CTGAGGGCTCGCCACTCCCCAGTCCCGCCCAGGCCACGCCTCC-3' (SEQ ID NO:
  • the 5' LTR of the lentiviral vector contains the immediate early enhancer and promoter (nucleotides -673 to -1, relative to the transcriptional start site according to
  • pCCL was derived from plasmids pRT43.2F3 (U.S. Pat. No. 5,686,279) and pHR2 by replacing the 3.8 kb Sstl-Hpal fragment of pRT43.2F3 with the 1.7 kb Bglll-NotI fragment from pHR2 and the 1.7 kb Notl-StuI fragment from pHR2 along with a synthetic Sstl-Bglll oligonucleotide linker consisting of the oligonucleotides , 5'-
  • the 5 'LTR of the lentiviral vector contains the enhancer nucleotides -220 - -673 relative to the transcriptional start site of Cytomegalovirus (CMV) joined to the promoter region (from position -78 bp relative to the transcriptional start site) of HIV-1.
  • CMV Cytomegalovirus
  • pCLL was derived from plasmids pRT43.2F3 and pHR2 by replacing the 3.6 kb Ncol-Hpal fragment of pRT43.2F3 with the .724 kb AlwNI-NotI fragment from pHR2 and the 1.7kb Notl-StuI fragment from pHR2 along with a synthetic NcoI-AlwNI oligonucleotide linker consisting of oligo, 5'- CATGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATC-3 ' (SEQ
  • pRRL.SIN-18 was derived from pRRL by deleting the 400 bp EcoRV-PvuII fragment in the 3' LTR by digestion and religation.
  • pRRL.SIN-36 was derived from pRRL by replacing the
  • pRRL.SIN-78 was derived from pRRL by replacing the 493 bp BbsI-AlwNI fragment in the 3 'LTR with an oligonucleotide linker consisting of, 5'- GATATGATCAGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATC-
  • the 293G cell line was used to generate stable lentiviral packaging cells.
  • 293G cells express the tet R /VP16 transactivator from the MD cassette (CMV promoter and intervening sequences - exons 2 and 3, intron 2- and poly (A) site from the human ⁇ globin gene) and the VSV envelope from a minimal CMV promoter linked to a tandem repeat of seven tetracycline operator sites (tet°) .
  • the expression of VSV G thus is regulated by the level of tetracycline in the culture medium, being suppressed in the presence of the antibiotic (Gossen & Bujard, Proc.
  • the best 5 clones were determined to have p24 values of 12-23 ng/ml. Of the 5 clones, 4 were positive for VSV.G expression after tetracycline withdrawal by Western blot analysis. The four p24/VSV.G positive clones were analyzed further for the ability to package lentiviral transfer vectors.
  • the clones were infected with transiently produced lentiviral vector (VSV.G pseudotype) containing an expression cassette for the Green Fluorescent Protein of A. victoria (GFP) driven by the CMV promoter, at a multiplicity of infection of 10 and in the presence of polybrene (8 ⁇ g/ml) . The infected clones then were expanded and the tetracycline removed.
  • VSV.G pseudotype transiently produced lentiviral vector
  • GFP Green Fluorescent Protein of A. victoria
  • the infected packaging population 10-28, was used for the creation of high titer producer clones of GFP lentiviral vector. 10-28 cells were sorted by FACS and the highest GFP expressing cells were retained and expanded. That population then was infected serially
  • VSV.G pseudotype transiently produced GFP lentiviral
  • the supernatants were collected after a 72-96 hr of VSV.G induction. Supernatants were titered on HeLa cells and analyzed for p24 content by immunocapture assay. Infectious titers peaked after the third ping reaching 1.5 x 10 6 T.U./ml (see Figure 3). The population of cells from the third ping then were subcloned to isolate high titer vector producers.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Lentiviral vectors modified at the 5' LTR or both the 5' and 3' LTR's are useful in the production of recombinant lentivirus vectors. Such vectors can be produced in the absence of a functional tat gene. Multiple transformation of the host cell with the vector carrying the transgene enhances virus production.

Description

METHOD AND MEANS FOR PRODUCING HIGH TITER, SAFE, RECOMBINANT LENTIVIRUS VECTORS
FIELD OF THE INVENTION
The invention relates to novel lentiviral packaging vectors," transfer vectors carrying a foreign gene of interest, stable packaging cell lines, stable producer cell lines and the use thereof for producing recombinant lentivirus in mammalian cells.
BACKGROUND OF THE INVENTION
Retrovirus vectors are a common tool for gene delivery (Miller, Nature (1992) 357:455-460). The ability of retrovirus vectors to deliver an unrearranged, single copy gene into a broad range of rodent, primate and human somatic cells makes retroviral vectors well suited for transferring genes to a cell.
A useful adjunct for producing recombinant retroviral vectors are packaging cell lines which supply in trans the proteins necessary for producing infectious virions, but those cells are incapable of packaging endogenous viral genomic nucleic acids (Watanabe & Temin, Molec. Cell. Biol. (1983) 3(12) .2241-2249; Mann et al. , Cell (1983) 33:153-159; E bretson & Te in, J. Virol. (1987) 61(9) :2675-2683) . A consideration in the construction of retroviral packaging cell lines is the production of high titer vector supernatants free of recombinant replication competent retrovirus (RCR) , which have been shown to produce T cell lymphomas in rodents (Cloyd et al., J. Exp. Med. (1980) 151:542-552) and in primates (Donahue et al., J . Exp . Med . ( 1992 ) 176 : 1125-1135 ) .
One approach to minimize the likelihood of generating RCR in packaging cells is to divide the packaging functions into two genomes, for example, one which expresses the gag and pol gene products and the other which expresses the env gene product (Bosselman et al. , Molec. Cell. Biol. (1987) 7 (5) : 1797-1806 ; Markowitz et al., J. Virol. (1988) 62 (4) : 1120-1124 ; Danos & Mulligan, Proc. Natl. Acad. Sci. (1988) 85:6460-6464). That approach minimizes the ability for co-packaging and subsequent transfer of the two-genomes, as well as significantly decreasing the frequency of recombination due to the presence of three retroviral genomes in the packaging cell to produce RCR.
In the event recombinants arise, mutations (Danos &
Mulligan, supra) or deletions (Boselman et al., supra; Markowitz et al., supra) can be configured within the undesired gene products to render any possible recombinants non-functional. In addition, deletion of the 3' LTR on both packaging constructs further reduces the ability to form functional recombinants.
Lentiviruses are complex retroviruses which, in addition to the common retroviral genes gag, pol and env, contain other genes with regulatory or structural function. The higher complexity enables the lentivirus to modulate the life cycle thereof, as in the course of latent infection.
A typical lentivirus is the human immunodeficiency virus (HIV) , the etiologic agent of AIDS. In vivo, HIV can infect terminally differentiated cells that rarely divide, such as lymphocytes and macrophages. In vitro, HIV can infect primary cultures of monocyte-derived macrophages (MDM) as well as HeLa-Cd4 or T ly phoid cells arrested in the cell cycle by treatment with aphidicolin or 7 irradiation.
Infection of cells is dependent on the active nuclear import of HIV preintegration complexes through the nuclear pores of the target cells. That occurs by the interaction of multiple, partly redundant, molecular determinants in the complex with the nuclear import machinery of the target cell. Identified determinants include a functional nuclear localization signal (NLS) in the gag matrix (MA) protein, "the karyophilic virion-associated protein, vpr, and a C-terminal phosphotyrosine residue in the gag MA protein.
SUMMARY OF THE INVENTION
Accordingly, the instant invention relates to novel disarmed lentiviral vectors that direct the synthesis of both lentiviral vector transcripts which can be packaged and lentiviral proteins for rapid production of high titer recombinant lentivirus in mammalian cells. The results are infectious particles for delivering a foreign gene of interest to a target cell. The invention also provides cell lines for virus production.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts various lentivirus vectors. RSV is the Rous sarcoma virus enhancer/promoter; R is the R region of the LTR; U5 is the U5 region of the LTR; SD is a slice donor site, such as the HIV 5' major splice donor site; is the Psi encapsidation signal sequence; Ga is a part of the gag gene; RRE is the rev responsive element; SA is a splice acceptor sequence; and U3 is the U3 region of the LTR.
Figure 2 depicts additional lentivirus vectors. CMV is cytomegalovirus . Otherwise, the symbols are as found in the legend to Figure 1.
Figure 3 is a graph depicting graded vector production with increasing amounts of transfer vector.
DETAILED DESCRIPTION OF THE INVENTION
The instant invention provides a recombinant lentivirus capable of infecting non-dividing cells as well as methods and means for making same. The virus is useful for the in vivo and ex vivo transfer and expression of nucleic acid sequences.
The lentiviral genome and the proviral DNA have the three genes found in retroviruses : gag, pol and env, which are flanked by two long terminal repeat (LTR) sequences. The gag gene encodes the internal structural (matrix, capsid and nucleocapsid) proteins; the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase) , a protease and an integrase; and the env gene encodes viral envelope glycoproteins. The 5' and 3' LTR's serve to promote transcription and polyadenylation of the virion RNA's. The LTR contains all other cis-acting sequences necessary for viral replication. Lentiviruses have additional genes including vif, vpr, tat, rev, vpu, nef and vpx (in HIV-l, HIV-2 and/or SIV) .
Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (the Psi site) . If the sequences necessary for encapsidation (or packaging of retroviral RNA into infectious virions) are missing from the viral genome, the cis defect prevents encapsidation of genomic RNA.
However, the resulting mutant remains capable of directing the synthesis of all virion proteins. The invention provides a method of producing a recombinant lentivirus capable of infecting a non-dividing cell comprising transfecting a suitable host cell with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat. As will be disclosed hereinbelow, vectors lacking a functional tat gene are desirable for certain applications. Thus, for example, a first vector can provide a nucleic acid encoding a viral gag and a viral pol and another vector can provide a nucleic acid encoding a viral env to produce a packaging cell. Introducing a vector providing a heterologous gene, herein identified as a transfer vector, into that packaging cell yields a producer cell which releases infectious viral particles carrying the foreign gene of interest.
The vectors per se, outside of the newly constructed vectors disclosed herein, are known in the art, see Naldini et al., Sci. (1996) 272:263-267; and Zufferey et al., Nat. Biotech. (1997) 15:871-875. Generally the vectors are plasmid-based or virus-based, and are configured to carry the essential sequences for incorporating foreign nucleic acid, for selection and for transfer of the nucleic acid into a host cell. The gag, pol and env genes of the vectors of interest also are known in the art. Thus, the relevant genes are cloned into the selected vector and then used to transform the target cell of interest.
According to the above-indicated configuration of vectors and foreign genes, the second vector can provide a nucleic acid encoding a viral envelope (env) gene. The env gene can be derived from any virus, including retroviruses . The env preferably is an amphotropic envelope protein which allows transduction of cells of human and other species. W wO v. 9 ?9- / .3o1i25s1t PCT/US98/25719
It may be desirable to target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type. By inserting a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific. Retroviral vectors can be made target-specific by inserting, for example, a glycolipid or a protein. Targeting often is accomplished by using" an antigen-binding portion of an antibody or a recombinant antibody-type molecule, such as a single chain antibody, to target the retroviral vector. Those of skill in the art will know of, or can readily ascertain without undue experimentation, specific methods to achieve delivery of a retroviral vector to a specific target.
Examples of retroviral-derived env genes include, but are not limited to: Moloney murine leukemia virus (MoMuLV or MMLV) , Harvey murine sarcoma virus (HaMuSV or HSV) , murine mammary tumor virus (MuMTV or MMTV) , gibbon ape leukemia virus (GaLV or GALV) , human immunodeficiency virus (HIV) and Rous sarcoma virus (RSV) . Other env genes such as Vesicular stomatitis virus (VSV) protein G (VSV G) , that of hepatitis viruses and of influenza also can be used.
The vector providing the viral env nucleic acid sequence is associated operably with regulatory sequences, e.g., a promoter or enhancer. The regulatory sequence can be any eukaryotic promoter or enhancer, including for example, the Moloney murine leukemia virus promoter-enhancer element, the human cytomegalovirus enhancer or the vaccinia P7.5 promoter. In some cases, such as the Moloney murine leukemia virus promoter-enhancer element, the promoter-enhancer elements are located within or adjacent to the LTR sequences. Preferably, the regulatory sequence is one which is not endogenous to the lentivirus from which the vector is being constructed. Thus, if the vector is being made from SIV, the SIV regulatory sequence found in the SIV LTR would be replaced by a regulatory element which does not originate from SIV.
While VSV G protein is a desirable env gene because VSV G confers broad host range on the recombinant virus, VSV G can be deleterious to the host cell. Thus, when a gene such as that for VSV G is used, it is preferred to employ an inducible promoter system so that VSV G expression can be regulated to minimize host toxicity when VSV G is expression is not required.
For example, the tetracycline-regulatable gene expression system of Gossen & Bujard (Proc. Natl. Acad. Sci. (1992) 89:5547-5551) can be employed to provide for inducible expression of VSV G when tetracycline is withdrawn from the transferred cell. Thus, the tet/VP16 transactivator is present on a first vector and the VSV G coding sequence is cloned downstream from a promoter controlled by tet operator sequences on another vector.
The heterologous or foreign nucleic acid sequence, the transgene, is linked operably to a regulatory nucleic acid sequence. As used herein, the term "heterologous" nucleic acid sequence refers to a sequence that originates from a foreign species, or, if from the same species, it may be substantially modified from the original form. Alternatively, an unchanged nucleic acid sequence that is not expressed normally in a cell is a heterologous nucleic acid sequence.
The term "operably linked" refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. Preferably, the heterologous sequence is linked to a promoter, resulting in a chimeric gene. The heterologous nucleic acid sequence is preferably under control of either the viral LTR promoter-enhancer signals or of an internal promoter, and retained signals within the retroviral LTR can still bring about efficient expression of the transgene.
The foreign gene can be any nucleic acid of interest which can be transcribed. Generally the foreign gene encodes 'a polypeptide. Preferably the polypeptide has some therapeutic benefit. The polypeptide may supplement deficient or nonexistent expression of an endogenous protein in a host cell. The polypeptide can confer new properties on the host cell, such as a chimeric signalling receptor, see U.S. Patent No. 5,359,046. The artisan can determine the appropriateness of a foreign gene practicing techniques taught herein and known in the art. For example, the artisan would know whether a foreign gene is of a suitable size for encapsidation and whether the foreign gene product is expressed properly.
It may be desirable to modulate the expression of a gene regulating molecule in a cell by the introduction of a molecule by the method of the invention. The term "modulate" envisions the suppression of expression of a gene when it is over-expressed or augmentation of expression when it is under-expressed. Where a cell proliferative disorder is associated with the expression of a gene, nucleic acid sequences that interfere with the expression of a gene at the translational level can be used. The approach can utilize, for example, antisense nucleic acid, ribozymes or triplex agents to block transcription or translation of a specific mRNA, either by masking that mRNA with an antisense nucleic acid or triplex agent, or by cleaving same with a ribozyme. Antisense nucleic acids are DNA or RNA molecules which are complementary to at least a portion of a specific" mRNA molecule (Weintraub, Sci. Am. (1990) 262:40). In the cell, the antisense nucleic acids hybridize to the corresponding mRNA forming a double-stranded molecule.
The antisense nucleic acids interfere with the translation of the mRNA since the cell will not translate a mRNA that is double-stranded. Antisense oligomers of about 15 nucleotides or more are preferred since such are synthesized easily and are less likely to cause problems than larger molecules when introduced into the target cell. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art
(Marcus-Sakura, Anal. Biochem. (1988) 172:289).
The antisense nucleic acid can be used to block expression of a mutant protein or a dominantly active gene product, such as amyloid precursor protein that accumulates in Alzheimer's disease. Such methods are also useful for the treatment of Huntington's disease, hereditary Parkinsonism and other diseases. Antisense nucleic acids are also useful for the inhibition of expression of proteins associated with toxicity.
Use of an oligonucleotide to stall transcription can be by the mechanism known as the triplex strategy since the oligomer winds around double-helical DNA, forming a three-strand helix. Therefore, the triplex compounds can be designed to recognize a unique site on a chosen gene (Maher et al., Antisense Res and Dev. (1991) 1(3):227; Helene, Anticancer Drug Dis. (1991) 6(6):569).
Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA in a manner analogous to DNA restriction endonucleases. Through the modification of nucleotide sequences which encode those RNA's, it is possible to engineer molecules that recognize and cleave specific nucleotide sequences in an RNA molecule (Cech, J. Amer. Med Assn. (1988) 260:3030)'. A major advantage of that approach is only mRNA's with particular sequences are inactivated.
It may be desirable to transfer a nucleic acid encoding a biological response modifier. Included in that category are immunopotentiating agents including nucleic acids encoding a number of the cytokines classified as "interleukins" , for example, interleukins 1 through 12. Also included in that category, although not necessarily working according to the same mechanism, are interferons, and in particular gamma interferon (7-IFN) , tumor necrosis factor (TNF) and granulocyte-macrophage colony stimulating factor (GM-CSF) . It may be desirable to deliver such nucleic acids to bone marrow cells or macrophages to treat inborn enzymatic deficiencies or immune defects. Nucleic acids encoding growth factors, toxic peptides, ligands, receptors or other physiologically important proteins also can be introduced into specific non-dividing cells.
Thus, the recombinant lentivirus of the invention can be used to treat an HIV-infected cell (e.g., T-cell or macrophage) with an an i-HIV molecule. In addition, respiratory epithelium, for example, can be infected with a recombinant lentivirus of the invention having a gene for cystic fibrosis transmembrane conductance regulator
(CFTR) for treatment of cystic fibrosis.
The method of the invention may also be useful for neuronal, glial, fibroblast or mesenchymal cell transplantation, or "grafting", which involves transplantation of cells infected with the recombinant lentivirus of the invention ex vivo, or infection in vivo into the central nervous system or into the ventricular cavities or subdurally onto the surface of a host brain. Such methods for grafting will be known to those skilled W wOυ 9 y9y//3o1i2.s51i PCT JS98/25719
in the art and are described in Neural Grafting in the Mammalian CNS, Bjorklund & Stenevi, eds. (1985) .
For diseases due to deficiency of a protein product, gene transfer could introduce a normal gene into the affected tissues for replacement therapy, as well as to create animal models for the disease using antisense mutations. For example, it may be desirable to insert a Factor VIII or IX encoding nucleic acid into a lentivirus for infection of a muscle, spleen or liver cell.
The promoter sequence may be homologous or heterologous to the desired gene sequence. A wide range of promoters may be utilized, including a viral or a mammalian promoter. Cell or tissue specific promoters can be utilized to target expression of gene sequences in specific cell populations. Suitable mammalian and viral promoters for the instant invention are available in the art.
Optionally during the cloning stage, the nucleic acid construct referred to as the transfer vector, having the packaging signal and the heterologous cloning site, also contains a selectable marker gene. Marker genes are utilized to assay for the presence of the vector, and thus, to confirm infection and integration. The presence of a marker gene ensures the selection and growth of only those host cells which express the inserts. Typical selection genes encode proteins that confer resistance to antibiotics and other toxic substances, e.g., histidinol, puromycin, hygromycin, neomycin, methotrexate etc. and cell surface markers.
The recombinant virus of the invention is capable of transferring a nucleic acid sequence into a mammalian cell. The term, "nucleic acid sequence", refers to any nucleic acid molecule, preferably DNA, as discussed in detail herein. The nucleic acid molecule may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA or combinations thereof. Such nucleic acid sequences may comprise genomic DNA which may or may not include naturally occurring introns. Moreover, such genomic DNA may be obtained in association with promoter regions, poly A sequences or other associated sequences. Genomic DNA may be extracted and purified from suitable cells by means well known in the art. Alternatively, messenger RNA (mRNA) can be isolated from cells and used to produce cDNA by reverse transcription or other means.
Preferably, the recombinant lentivirus produced by the method of the invention is a derivative of human immunodeficiency virus (HIV) . The env will be derived from a virus other than HIV.
The method of the invention provides, in some embodiments, three vectors which provide all of the functions required for packaging of recombinant virions, such as, gag, pol, env, tat and rev, as discussed above. As noted herein, tat may be deleted functionally for unexpected benefits. There is no limitation on the number of vectors which are utilized so long as the vectors are used to transform and to produce the packaging cell line to yield recombinant lentivirus.
The vectors are introduced via transfection or infection into the packaging cell line. The packaging cell line produces viral particles that contain the vector genome. Methods for transfection or infection are well known by those of skill in the art. After cotransfection of the packaging vectors and the transfer vector to the packaging cell line, the recombinant virus is recovered from the culture media and titered by standard methods used by those of skill in the art. Thus, the packaging constructs can be introduced into human cell lines by calcium phosphate transfection, lipofection or electroporation, generally together with a dominant selectable marker, such as neo, DHFR, Gin synthetase or ADA, followed by selection in the presence of the appropriate drug and isolation of clones. The selectable marker gene can be linked physically to the packaging genes in the construct.
Stable cell lines wherein the packaging functions are configured to be expressed by a suitable packaging cell are known. For example, see U.S. Pat. No. 5,686,279; and
Ory et al., Proc. Natl. Acad. Sci. (1996) 93:11400-11406, which describe packaging cells.
Zufferey et al., supra, teach a lentiviral packaging plasmid wherein sequences 3' of pol including the HIV-1 env gene are deleted. The construct contains tat and rev sequences and the 3' LTR is replaced with poly A sequences. The 5' LTR and psi sequences are replaced by another promoter, such as one which is inducible. For example, a CMV promoter or derivative thereof can be used.
The packaging vectors of interest contain additional changes to the packaging functions to enhance lentiviral protein expression and to enhance safety. For example, all of the HIV sequences upstream of gag can be removed. Also, sequences downstream of env can be removed.
Moreover, steps can be taken to modify the vector to enhance the splicing and translation of the RNA.
To provide a vector with an even more remote possibility of generating replication competent lentivirus, the instant invention provides for lentivirus packaging plasmids wherein tat sequences, a regulating protein which promotes viral expression through a transcriptional mechanism, are deleted functionally. Thus, the tat gene can be deleted, in part or in whole, or various point mutations or other mutations can be made to the tat sequence to render the gene non-functional. An artisan can practice known techniques to render the tat gene non-functional.
The techniques used to construct vectors, and to transfect and to infect cells, are practiced widely in the art. Practitioners are familiar with the standard resource materials which describe specific conditions and procedures. However, for convenience, the following paragraphs may serve as a guideline.
Construction of the vectors of the invention employs standard ligation and restriction techniques which are well understood in the art (see Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor Laboratory, N.Y., 1982). Isolated plasmids, DNA sequences or synthesized oligonucleotides are cleaved, tailored and religated in the form desired.
Site-specific DNA cleavage is performed by treating with the suitable restriction enzyme (or enzymes) under conditions which are understood in the art, and the particulars of which are specified by the manufacturer of the commercially available restriction enzymes, see, e.g. New England Biolabs, Product Catalog. In general, about 1 μg of plasmid or DNA sequences is cleaved by one unit of enzyme in about 20 μl of buffer solution. Typically, an excess of restriction enzyme is used to ensure complete digestion of the DNA substrate. Incubation times of about one hour to two hours at about 37 °C are workable, although variations can be tolerated. After each incubation, protein is removed by extraction with phenol/chloroform, which may be followed by ether extraction, and the nucleic acid recovered from aqueous fractions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods of Enzymology 65:499-560 (1980) .
Restriction cleaved fragments may be blunt ended by treating with the large fragment of E. coli DNA polymerase I (Klenow) in the presence of the four deoxynucleotide triphosphates (dNTP's) using incubation times of about 15 to 25 minutes at 20°C in 50 mM Tris (pH 7.6)" 50 mM NaCl, 6 mM MgCl2, 6 mM DTT and 5-10 μM dNTP's. The Klenow fragment fills in at 5' sticky ends but chews back protruding 3' single strands, even though the four dNTP's are present. If desired, selective repair can be performed by supplying only one of the dNTP's, or with selected dNTP's, within the limitations dictated by the nature of the sticky ends. After treatment with Klenow, the mixture is extracted with phenol/chloroform and ethanol precipitated. Treatment under appropriate conditions with SI nuclease or Bal-31 results in hydrolysis of any single-stranded portion.
Ligations can be performed in 15-50 μl volumes under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 M MgCl2, 10 mM DTT, 33 mg/ml BSA, 10 mM-50 mM NaCl and either 40 μM ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C (for "sticky end" ligation) or 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14 °C (for "blunt end" ligation) . Intermolecular "sticky end" ligations are usually performed at 33-100 μg/ml total DNA concentrations (5-100 mM total end concentration) . Intermolecular blunt end ligations (usually employing a
10-30 fold molar excess of linkers) are performed at 1 μM total ends concentration.
Thus, according to the instant invention, a lentiviral packaging vector is made to contain a promoter and other optional or requisite regulatory sequences as determined by the artisan, gag, pol, rev, env or a combination thereof, and with specific functional or actual excision of tat, and optionally other lentiviral accessory genes.
Lentiviral transfer vectors (Naldini et al., supra;
Proc. Natl. Acad. Sci. (1996) 93:11382-11388) have been used to infect human cells growth-arrested in vitro and to transduce neurons after direct injection into the brain of adult rats. The vector was efficient at transferring marker genes in vivo into the neurons and long term expression in the absence of detectable pathology was achieved. Animals analyzed ten months after a single injection of the vector, the longest time tested so far, showed no decrease in the average level of transgene expression and no sign of tissue pathology or immune reaction. (Blomer et al. , J. Virol. (1997) 71:6641-6649). An improved version of the lentiviral vector in which the HIV virulence genes env, vif, vpr, vpu and nef were deleted without compromising the ability of the vector to transduce non-dividing cells have been developed. The multiply attenuated version represents a substantial improvement in the biosafety of the vector (Zufferey et al. , supra) .
In transduced cells, the integrated lentiviral vector generally has an LTR at each termini. The 5' LTR may cause accumulation of "viral" transcripts that may be the substrate of recombination, in particular in HIV-infected cells. The 3' LTR may promote downstream transcription with the consequent risk of activating a cellular protooncogene.
The U3 sequences comprise the majority of the HIV LTR. The U3 region contains the enhancer and promoter elements that modulate basal and induced expression of the HIV genome in infected cells and in response to cell activation. Several of the promoter elements are essential for viral replication. Some of the enhancer elements are highly conserved among viral isolates and have been implicated as critical virulence factors in viral pathogenesis. The enhancer elements may act to influence replication rates in the different cellular target of the virus (Marthas et al. J. Virol. (1993) 67:6047-6055) .
As viral transcription starts at the 3' end of the U3 region of the 5' LTR, those sequences are not part of the viral mRNA and a copy thereof f om the 3 ' LTR acts as template for the generation of both LTR's in the integrated provirus. If the 3' copy of the U3 region is altered in a retroviral vector construct, the vector RNA still is produced from the intact 5' LTR in producer cells, but cannot be regenerated in target cells.
Transduction of such a vector results in the inactivation of both LTR's in the progeny virus. Thus, the retrovirus is sel -inactivating (SIN) and those vectors are known as Sin transfer vectors.
There are, however, limits to the extent of the deletion at the 3' LTR. First, the 5' end of the U3 region serves another essential function in vector transfer, being required for integration (terminal dinucleotide + att sequence). Thus, the terminal dinucleotide and the att sequence may represent the 5' boundary of the U3 sequences which can be deleted. In addition, some loosely defined regions may influence the activity of the downstream polyadenylation site in the R region. Excessive deletion of U3 sequence from the 3' LTR may decrease polyadenylation of vector transcripts with adverse consequences both on the titer of the vector in producer cells and the transgene expression in target cells. On the other hand, limited deletions may not abrogate the transcriptional activity of the LTR in transduced cells.
New versions of a lentivirus transfer vector described herein carry increasing deletions of the U3 region of the 3' LTR (Figure 1: the U3 deletions span from nucleotide -418 of the U3 LTR to the indicated position: SIN-78,
SIN-45, SIN-36 and SIN-18) . Lentiviral vectors with almost complete deletion of the U3 sequences from the 3 ' LTR were developed without compromising either the titer of vector in producer cells or transgene expression in target cells. The most extensive deletion (-418 to -18) extends as far as to the TATA box, therefore abrogating any transcriptional activity of the LTR in transduced cells. Thus, the lower limit of the 3' deletion may extend as far as including the TATA box. The deletion may be of the remainder of the U3 region up to the R region.
That represents a dramatic gain in vector safety. The various deletions were produced practicing methods known in the art.
Surprisingly, the average expression level of the transgene was even higher in cells transduced by the SIN vectors as compared to more intact vectors. That was probably due to the removal of transcriptional interference from the upstream HIV LTR on the internal promoter. SIN-type vectors with such extensive deletions of the U3 region could not be generated for murine leukemia virus (MLV) based retroviral vectors without compromising efficiency of transduction.
The 5' LTR of transfer vector construct was modified by substituting part or all of the transcriptional regulatory elements of the U3 region with heterologous enhancer/promoters. The changes were made to enhance the expression of transfer vector RNA in producer cells; to allow vector production in the absence of the HIV tat gene; and to remove the upstream wild-type copy of the HIV LTR that can recombine with the 3' deleted version to "rescue" the above described SIN vectors.
Thus, vectors containing the above-described alterations at the 5' LTR, 5' vectors, can find use as transfer vectors because of the sequences to enhance expression and in combination with packaging cells that do not express tat.
Such 5' vectors can also carry modifications at the 3'
LTR as discussed hereinabove to yield improved transfer vectors which have not only enhanced expression and can be used in packaging cells that do not express tat but can be self-inactivating as well.
The transcription from the HIV LTR is highly dependent on the transactivator function of the tat protein. In the presence of tat, often expressed by the core packaging construct existing in producer cells, vector transcription from the HIV LTR is stimulated strongly. As that full-length "viral" RNA has a full complement of packaging signals, the RNA is encapsidated efficiently into vector particles and transferred to target cells. The amount of vector RNA available for packaging in producer cells is a rate-limiting step in the production of infectious vector.
The enhancer or the enhancer and promoter regions of the 5' LTR were substituted with the enhancer or the enhancer and promoter of the human cytomegalovirus (CMV) or murine Rous sarcoma virus (RSV) , respectively, see Figure 2 for a schematic of the constructs and the code names of the hybrid vectors. The CCL and RRL vectors have complete substitution of the 5' U3 region.
The control lentivector HR2 and the panel of 5' hybrids were compared in producer cells tranεfected with the transfer vector, and with or without packaging constructs, which provide the tat transactivator. The transcriptional level of the four chimeric vectors is higher than that of a control lentivector both in the presence and in the absence of the packaging construct. All chimeric vectors efficiently transfer the transgene into target cells and the RRL vector performs as well as the control HR2 vector. Finally, integration of the vector in target cells was confirmed by examining transduced cells at an early and a later passage after transduction. No decrease was observed in the percentage of transgene-positive cells indicating that the vector had been integrated.
The high level of expression of the 5' LTR modified transfer vector RNA obtained in producer cells in the absence of a packaging construct indicates the producing vector is functional in the absence of a functional tat gene. Functional deletion of the tat gene as indicated for the packaging plasmid disclosed hereinabove would confer a higher level of biosafety to the lentiviral vector system given the number of pathogenetic activities associated with the tat protein. Thus, a lentiviral vector of significantly improved biosafety is a SIN transfer vector that has no wild-type copy of the HIV LTR either at the 5' or at the 3' end, which is used in conjunction with tat-less packaging vectors as described herein.
Viral supernatants are harvested using standard techniques such as filtration of supernatants 48 hours post transfection. The viral titer is determined by infection of, for example, 106 NIH 3T3 cells or 105 HeLa cells with an appropriate amount of viral supernatant, in the presence of 8 μg/ml polybrene (Sigma Chemical Co., St. Louis, MO) . Forty-eight hours later, the transduction efficiency is assayed. W VYO 9 w9/3J1i25a1i PCT/US98/25719
Thus, the instant invention provides methods and means for producing high titer recombinant virus. Those virus particle preparations can be used to infect target cells using techniques known in the art. Thus the instant invention will find use in ex vivo gene therapy applications wherein target cells are removed from a host, transformed in culture practicing known techniques and then returned to the host.
The invention now having been described in detail, provided* hereinbelow are non-limiting examples demonstrating various embodiments of the instant invention.
Example 1
CONSTRUCTION OF LENTIVIRAL PACKAGING PLASMIDS The lentiviral packaging plasmids were derived from the plasmid pCMVΔR8.9 (ΔVprΔVifΔVpuΔNef) described previously in Zufferey et al., supra. All the remaining sequences of the nef gene in pCMVΔR8.9 were removed by digesting with Xhol and BstEII, filing in with Klenow and religating. The construction deleted 100 basepairs, joining the truncated env reading frame of HIV-1 to the genomic insulin polyadenylation site and yielding the plasmid pCMVΔR8.73.
In another embodiment of the invention, 133 basepairs of CMV-derived sequences downstream of the CMV promoter were deleted in the plasmid pCMVΔR8.73. That sequence contains a splice donor site and it was removed by digestion of the plasmid pCMVΔR8.73 with SacII and religation of the larger fragment, obtaining the plasmid pCMVΔR8.74.
In another embodiment of the invention, all the HIV-derived sequences remaining in the plasmid pCMVΔR8.74 upstream of the initiating codon of the gag gene were removed, except for the consensus 5' splice donor site. At the same time, the sequence upstream of the gag gene was changed for optimal translation efficiency obtaining the plasmid pCMVΔR8.75. pCMVΔR8.75 was derived from pCMVΔR8.74 by replacing the 94 bp Sstll-Clal fragment with an Sstll-Clal oligonucleotide linker consisting of, 5'-
GGGACTGGTGAGTGAATTCGAGATCTGCCGCCGCCATGGGTGCGAGAGCGTCAGTA
TTAAGCGGGGGAGAATTAGAT-3 ' (SEQ ID NO: ) and 5'-
CGATCTAATTCTCCCCCGCTTAATACTGACGCTCTCGCACCCATGGCGGCGGCAGA TCTCGAATTCACTCACCAGTCCCGC-3 ' (SEQ ID NO: ). In another embodiment of the invention, an inducible packaging construct was obtained by replacing the Pstl-SacII fragment of pCMVΔR8.74 containing the CMV promoter with seven tandem copies of the tetracycline operator sequences linked to a minimal CMV promoter. The tet-regulated packaging plasmid pTet ΔR8.74 was obtained.
Example 2
CONSTRUCTION OF LENTIVIRAL TRANSFER VECTORS The lentiviral transfer vector plasmids were derived from the plasmid pHR'-CMV-LacZ described previously in Naldini et al. (Sci. (1996) 272:263-267). pHR2 is a lentiviral transfer vector in which 124 bp of nef sequences upstream of the 3' LTR in pHR' were replaced with a polylinker both to reduce HIV1 sequences and to facilitate transgene cloning. pHR2 was derived from pHR'-CMV-LacZ by replacing the 4.6 kb Clal-StuI fragment with the 828 bp Clal-StuI fragment generated by PCR using pHR'-CMV-LacZ as the template and the oligonucleotide, 5'- CCATCGATCACGAGACTAGTCCTACGTATCCCCGGGGACGGGATCCGCGGAATTCC GTTTAAGAC-3' (SEQ ID NO: ) and 5 ' -TTATAATGTCAAGGCCTCTC-3 ' (SEQ ID NO: ) in a three part ligation with a 4.4 kb
Stul-Ncol fragment and a 4.5 kb Ncol-Clal fragment from pHR'-CMV-LacZ.
In another embodiment of the invention, pHR3 is a lentiviral transfer vector in which 148 bp of env coding sequences (including an ATG) upstream of the Rev Response Element (RRE) in pHR2 were deleted. pHR3 was derived from pHR2 by replacing the 893 bp Notl-Spel fragment of 'pHR2 with a 747 bp Notl-Spel fragment generated by PCR using pHR2 as the template with oligonucleotide primers 5'- GCGGCCGCAGGAGCTTTGTTCCTTGG-3 ' (SEQ ID NO: ) and 5'-
TACGTAGGACTAGTCTCG-3 ' (SEQ ID NO: ).
In another embodiment of the invention, pHR5 is a lentiviral transfer vector in which 310 bp gag coding sequences (all gag coding sequences downstream from amino acid 15 of the Gag protein) were deleted from pHR2. pHR5 was derived by digestion of pHR2 with Nrul, addition of a NotI linker (synthetic oligonucleotide 5 ' -TTGCGGCCGCAA-3 ' ,
SEQ ID NO: ) , digestion with NotI to excise the
310 bp fragment, followed by religation. In another embodiment of the invention, pHR6 is a lentiviral vector in which the 5' splice donor signal was mutated (TGGT to TGAT) to enhance production of full-length transcripts capable of being packaged. pHR6 was derived from pHR5 by replacing the 239 bp Aflll-Apol fragment with a 239 bp Aflll-Apol fragment generated by
PCR using a pHR2 as the template with oligonucleotide primers 5 ' -CCACTGCTTAAGCCT-3 ' (SEQ ID NO: ) and 5'-
CAAAATTTTTGGCGTACTCATCAGTCGCCGCCCCTCG-3' (SEQ ID NO: ).
All PCR fragments were generated by first cloning the PCR reaction product directly into the TA cloning vector pCR2.1 (Invitrogen) followed by sequence verification and excision with the appropriate enzymes.
Example 3
CONSTRUCTION OF 5' LTR CHIMERIC LENTIVIRAL TRANSFER VECTORS
In another embodiment of the invention, the 5' LTR of the lentiviral vector contains the enhancer and promoter from the U3 region of the Rous Sarcoma Virus (RSV) joined to the R region of HIV-l (plasmid pRRL) . pRRL is a lentiviral transfer vector in which the enhancer and promoter (nucleotides -233 to -1 relative to the transcriptional start site) of RSV is precisely fused to the R region of HIV-1 using an oligonucleotide linker. pRRL was derived from plasmids pRT43.RSV.F3 , see WO97/07225, and pHR2 by replacing the 3.4 kb EcoRI-Hpal fragment of pRT43.RSV.F3 with the .67 kb Bglll-NotI fragment from pHR2 and the 1.7kb Notl-StuI fragment from pHR2 along with a synthetic EcoRI-Bglll oligonucleotide linker consisting of oligonucleotides 5'- AATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGG
GTCTCTCTGGTTAGACCA-3 ' (SEQ ID NO: ) and 5'-
GATCTGGTCTAACCAGAGAGACCCGTTTATTGTATCGAGCTAGGCACTTAAATACA
ATATCTCTGCAATGCGGC-3 ' (SEQ ID NO: ).
In another embodiment of the invention, the 5' LTR of the lentiviral vector contains the enhancer (nucleotides
-233 - -50 relative to the transcriptional start site) of the Rous Sarcoma Virus (RSV) joined to the promoter region (from the position -78 bp relative to the transcriptional start site) of HIV-1 (plasmid pRLL) . pRLL is a lentiviral transfer vector in which the enhancer of RSV is fused to the promoter region of HIV-1 using an oligonucleotide linker. pRRL was derived from plasmids pRT43.RSV.F3 and pHR2 by replacing the 3.4 kb EcoRI-Hpal fragment of pRT43.RSV.F3 with the .724 kb AlwNI-NotI fragment from pHR2 and the 1.7 kb Notl-StuI fragment from pHR2 along with a synthetic EcoRI-AlwNI oligonucleotide linker consisting of the oligo, 5'- AATTGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATC-3 ' (SEQ ID NO: ) and the oligonucleotide, 5'- CTGAGGGCTCGCCACTCCCCAGTCCCGCCCAGGCCACGCCTCC-3' (SEQ ID
NO: ) .
In another embodiment of the invention (plasmid pCCL) , the 5' LTR of the lentiviral vector contains the immediate early enhancer and promoter (nucleotides -673 to -1, relative to the transcriptional start site according to
Boshart et al. (Cell (1985) 41:521-530), of human Cytomegalovirus (CMV) joined to the R region of HIV-1. pCCL was derived from plasmids pRT43.2F3 (U.S. Pat. No. 5,686,279) and pHR2 by replacing the 3.8 kb Sstl-Hpal fragment of pRT43.2F3 with the 1.7 kb Bglll-NotI fragment from pHR2 and the 1.7 kb Notl-StuI fragment from pHR2 along with a synthetic Sstl-Bglll oligonucleotide linker consisting of the oligonucleotides , 5'-
CGTTTAGTGAACCGGGGTCTCTCTGGTTAGACCA-3' (SEQ ID NO: ) and
5'-GATCTGGTCTAACCAGAGAGACCCCGGTTCACTAAACGAGCT-3 ' (SEQ ID NO: ) . In another embodiment of the invention, (plasmid pCLL) , the 5 'LTR of the lentiviral vector contains the enhancer nucleotides -220 - -673 relative to the transcriptional start site of Cytomegalovirus (CMV) joined to the promoter region (from position -78 bp relative to the transcriptional start site) of HIV-1. pCLL was derived from plasmids pRT43.2F3 and pHR2 by replacing the 3.6 kb Ncol-Hpal fragment of pRT43.2F3 with the .724 kb AlwNI-NotI fragment from pHR2 and the 1.7kb Notl-StuI fragment from pHR2 along with a synthetic NcoI-AlwNI oligonucleotide linker consisting of oligo, 5'- CATGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATC-3 ' (SEQ
ID NO: ) and the oligonucleotide, 5'-
CTGAGGGCTCGCCACTCCCCAGTCCCGCCCAGGCCACGCCTC-3' (SEQ ID NO: ) .
Example 4
CONSTRUCTION OF SELF-INACTIVATING LENTIVIRAL VECTORS pRRL.SIN-18 was derived from pRRL by deleting the 400 bp EcoRV-PvuII fragment in the 3' LTR by digestion and religation. pRRL.SIN-36 was derived from pRRL by replacing the
493 bp BbsI-AlwNI fragment in the 3' LTR with an oligonucleotide linker consisting of synthetic oligonucleotides, 5'-GATATGATCAGATC-3 ' (SEQ ID NO: ) and 5'-CTGATCA-3' and a three part ligation along with a .54 kb AlwN-Avrll fragment and a 6.1 kb Avrll-Bbsl fragment from pRRL. pRRL.SIN-45 was derived from pRRL by replacing the
493 bp BbsI-AlwNI fragment in the 3' LTR with an oligonucleotide linker consisting of synthetic oligonucleotides, 5 ' -GATATGATCAGAGCCCTCAGATC-3 ' (SEQ ID
NO: ) and 5' -CTGAGGGCTCTGATCA-3 ' (SEQ ID NO: ) in a three part ligation along with a .54 kb AlwNI-Avrll fragment and a 6.1 kb Avrll-Bbsl fragment from pRRL. pRRL.SIN-78 was derived from pRRL by replacing the 493 bp BbsI-AlwNI fragment in the 3 'LTR with an oligonucleotide linker consisting of, 5'- GATATGATCAGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATC-
3' (SEQ ID NO: ) and oligonucleotide 5'-
CTGAGGGCTCGCCACTCCCCAGTCCCGCCCAGGCCACGCCTCCTGATCA-3 ' (SEQ ID NO: ) in a three part ligation along with a .54 kb
AlwNI-Avrll fragment and a 6.1 kb Avrll-Bbsl fragment from pRRl.
Exam le 5
CONSTRUCTION OF STABLE LENTIVIRAL PACKAGING CELL 00-28 AND OF STABLE PRODUCERS OF LENTIVIRAL VECTOR
The 293G cell line was used to generate stable lentiviral packaging cells. 293G cells express the tetR/VP16 transactivator from the MD cassette (CMV promoter and intervening sequences - exons 2 and 3, intron 2- and poly (A) site from the human β globin gene) and the VSV envelope from a minimal CMV promoter linked to a tandem repeat of seven tetracycline operator sites (tet°) . The expression of VSV G thus is regulated by the level of tetracycline in the culture medium, being suppressed in the presence of the antibiotic (Gossen & Bujard, Proc.
Natl. Acad. Sci. USA (1992) 89:5547-5551); Ory et al. , Proc. Natl. Acad. Sci. USA (1997) 93:11400-11406). The 293G cells were maintained routinely in DMEM/low glucose culture medium supplemented with 10% donor calf serum and containing lμg/ l tetracycline. A 15 cm plate of 293G υ "J :)l PCTΛJS98/25719
cells were transfected using lipofectamine (GIBCO BRL) with 13.36 μg of the packaging plasmid pCMVΔR8.74 and 1.33 μg of the selection plasmid pZeoSV2. The medium was changed at 24 hr, and at 48 hr the cells were split into medium containing 250 μg/ml zeocin and 1 μg/ml tetracycline. After 3-4 weeks in selection, 250 clones were picked and transferred to 96 well plates and the medium screened for HIV-1 p24 Gag antigen by immunocapture using a commercially available kit. Fifty two p24 positive clones were grown up for further analysis. The best 5 clones were determined to have p24 values of 12-23 ng/ml. Of the 5 clones, 4 were positive for VSV.G expression after tetracycline withdrawal by Western blot analysis. The four p24/VSV.G positive clones were analyzed further for the ability to package lentiviral transfer vectors. The clones were infected with transiently produced lentiviral vector (VSV.G pseudotype) containing an expression cassette for the Green Fluorescent Protein of A. victoria (GFP) driven by the CMV promoter, at a multiplicity of infection of 10 and in the presence of polybrene (8 μg/ml) . The infected clones then were expanded and the tetracycline removed. After 72 hours of induction, a 24 hr medium collection was performed and the supernatants were filtered and flash frozen. The frozen supernatants were titered on naive HeLa cells for transduction of the GFP gene. By FACS analysis it was determined that the population of cells (designated 10-28) created from the infection of packaging clone 00-28 had the highest titer of 5 x 104 Transducing Units (T.U.)/ml.
The infected packaging population, 10-28, was used for the creation of high titer producer clones of GFP lentiviral vector. 10-28 cells were sorted by FACS and the highest GFP expressing cells were retained and expanded. That population then was infected serially
("pinged") an additional 4 times with transiently produced GFP lentiviral (VSV.G pseudotype) . After each infection the supernatants were collected after a 72-96 hr of VSV.G induction. Supernatants were titered on HeLa cells and analyzed for p24 content by immunocapture assay. Infectious titers peaked after the third ping reaching 1.5 x 106 T.U./ml (see Figure 3). The population of cells from the third ping then were subcloned to isolate high titer vector producers.
All publications and patent applications cited in this specification are herein incorporated by reference in their entirety as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.
As will be apparent to those skilled in the art to which the invention pertains, the present invention may be embodied in forms other than those specifically disclosed above, for example to transfect and transduce other mammalian cell types, without departing from the spirit or essential characteristics of the invention. The particular embodiments of the invention described above, are, therefore, to be considered as illustrative and not restrictive. The scope of the present invention is as set forth in the appended claims rather than being limited to the examples contained in the foregoing description.

Claims

We claim:
1. A lentivirus transfer vector comprising a 5' LTR and a 3' LTR, each of which contains a U3 region, wherein a part or all of a regulatory element of the U3 region of the 5' LTR is replaced by another regulatory element, operable in a mammalian cell, which is not endogenous to said lentivirus.
2. The transfer vector of claim 1, wherein one or more nucleotide bases of the U3 region of the 3' LTR are deleted.
3. The vector of claim 1, wherein said regulatory element not endogenous to said lentivirus is a cytomegalovirus enhancer, promoter or enhancer/promoter.
4. The vector of claim 1, wherein said regulatory element not endogenous to said lentivirus is a Rous sarcoma virus enhancer, promoter or enhancer/promoter.
5. The vector of claim 2, wherein said U3 region deleted is all of said U3 region except for a 5' terminal dinucleotide and an att sequence.
6. The vector of claim 5, wherein said U3 region deleted includes a TATA box sequence.
7. The vector of claim 1, wherein said vector carries an expressed heterologous gene.
8. The vector of claim 1, wherein said lentivirus is human immunodeficiency virus (HIV) .
9. The vector of claim 8, wherein said HIV is HIV-1.
10. A lentivirus packaging plasmid lacking sequences upstream from gag endogenous to said lentivirus and lacking sequences downstream from env endogenous to ' said lentivirus .
11. The packaging plasmid of claim 10, wherein said plasmid carries an expressed gag, an expressed pol or expressed gag and pol genes.
12. The packaging plasmid of claim 10, wherein said plasmid carries a non-functional tat gene.
13. The packaging plasmid of claim 10, wherein said lentivirus is human immunodeficiency virus (HIV) .
14. The packaging plasmid of claim 13 , wherein said HIV is HIV-1.
15. A method for producing a recombinant lentivirus vector comprising: a) transforming a cell with: i) at least one lentivirus packaging plasmid lacking sequences upstream from gag endogenous to said lentivirus and lacking sequences downstream from env endogenous to said lentivirus, and said at least one packaging plasmid carries an expressed gag, an expressed pol or expressed gag and pol genes; and ii) an expression plasmid not endogenous to said lentivirus which carries an expressed env gene not endogenous to said lentivirus; to yield a packaging cell; b) multiply transforming said packaging cell with a lentivirus transfer vector which carries an expressed heterologous gene to yield a producer cell; c) culturing said producer cell in a medium; and d) separating said producer cell from said medium to recover said recombinant lentivirus vector from said medium.
16. The method of claim 15, wherein said packaging cell carries a non-functional tat gene.
17. The method of claim 15, wherein said lentivirus transfer vector comprises a 5' LTR and a 3' LTR, each of which contains a U3 region, wherein a part or all of a regulatory element of the U3 region of the 5' LTR is replaced by another regulatory element, operable in a mammalian cell, which is not endogenous to said lentivirus.
18. The method of claim 17 , wherein one or more nucleotide bases of the U3 region of the 3 ' LTR are deleted.
PCT/US1998/025719 1997-12-12 1998-12-11 Method and means for producing high titer, safe, recombinant lentivirus vectors WO1999031251A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU18034/99A AU751985B2 (en) 1997-12-12 1998-12-11 Method and means for producing high titer, safe, recombinant lentivirus vectors
CA2314609A CA2314609C (en) 1997-12-12 1998-12-11 Method and means for producing high titer, safe, recombinant lentivirus vectors
JP2000539150A JP4640742B2 (en) 1997-12-12 1998-12-11 Method and means for producing a high-titer and safe recombinant lentiviral vector
KR1020007006425A KR20010033064A (en) 1997-12-12 1998-12-11 Method and means for producing high titer, safe, recombinant lentivirus vectors
EP98962894A EP1036182B1 (en) 1997-12-12 1998-12-11 Method and means for producing high titer, safe, recombinant lentivirus vectors
DE69838758T DE69838758T2 (en) 1997-12-12 1998-12-11 METHOD AND DEVICE FOR PRODUCING SAFE, RECOMBINANT HIGH TITAN LENTIVIRUS VECTORS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/989,394 1997-12-12
US08/989,394 US5994136A (en) 1997-12-12 1997-12-12 Method and means for producing high titer, safe, recombinant lentivirus vectors

Publications (2)

Publication Number Publication Date
WO1999031251A1 true WO1999031251A1 (en) 1999-06-24
WO1999031251A9 WO1999031251A9 (en) 1999-10-07

Family

ID=25535081

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1998/025719 WO1999031251A1 (en) 1997-12-12 1998-12-11 Method and means for producing high titer, safe, recombinant lentivirus vectors

Country Status (8)

Country Link
US (6) US5994136A (en)
EP (1) EP1036182B1 (en)
JP (2) JP4640742B2 (en)
KR (1) KR20010033064A (en)
AU (1) AU751985B2 (en)
CA (1) CA2314609C (en)
DE (1) DE69838758T2 (en)
WO (1) WO1999031251A1 (en)

Cited By (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000078987A1 (en) * 1999-06-22 2000-12-28 Dnavec Research Inc. Vector for expressing two foreign genes
WO2001091801A2 (en) * 2000-05-26 2001-12-06 Chiron Corporation Methods of transducing neural cells using lentivirus vectors
EP1171624A1 (en) * 1999-04-29 2002-01-16 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
WO2002049422A2 (en) * 2000-12-20 2002-06-27 K.U. Leuven Research And Development Non-human animal disease models
US6712612B1 (en) 2000-12-12 2004-03-30 Genecure Llc Safe and stable retroviral helper cell line and related compositions and methods
US6808905B2 (en) 2001-05-14 2004-10-26 Cell Genesys, Inc. Lentiviral vectors encoding clotting factors for gene therapy
WO2006010834A1 (en) 2004-06-25 2006-02-02 Centre National De La Recherche Scientifique Non-integrative and non-replicative lentivirus, preparation and uses thereof
EP1741782A2 (en) 2000-05-10 2007-01-10 Sanofi Pasteur Limited Immunogenic polypeptides encoded by MAGE minigenes and uses thereof
EP1964573A2 (en) 1999-10-22 2008-09-03 Aventis Pasteur Limited Method of inducing and/or enhancing an immune response to tumor antigens
US8846385B2 (en) 1997-12-12 2014-09-30 Gbp Ip, Llc Method and means for producing high titer, safe recombinant lentivirus vectors
US9593340B2 (en) 2007-10-15 2017-03-14 Admedus Vaccines Pty Ltd. Expression system for modulating an immune response
WO2017096432A1 (en) 2015-12-09 2017-06-15 Admedus Vaccines Pty Ltd Immunomodulating composition for treatment
WO2017136358A1 (en) 2016-02-01 2017-08-10 Bioverativ Therapeutics Inc. Optimized factor viii genes
US9795658B2 (en) 2010-04-20 2017-10-24 Admedus Vaccines Pty Ltd Expression system for modulating an immune response
WO2018071676A1 (en) 2016-10-12 2018-04-19 Bioverativ Usa Inc. Anti-c1s antibodies and methods of use thereof
WO2018083538A1 (en) 2016-11-07 2018-05-11 Neuracle Scienc3 Co., Ltd. Anti-family with sequence similarity 19, member a5 antibodies and method of use thereof
WO2019075220A1 (en) 2017-10-11 2019-04-18 Bioverativ Usa Inc. Methods of inducing complement activity
WO2019152692A1 (en) 2018-02-01 2019-08-08 Bioverativ Therapeutics, Inc. Use of lentiviral vectors expressing factor viii
WO2020102728A1 (en) 2018-11-16 2020-05-22 Neoimmunetech, Inc. Method of treating a tumor with a combination of il-7 protein and an immune checkpoint inhibitor
WO2020118069A2 (en) 2018-12-06 2020-06-11 Bioverativ Therapeutics Inc. Use of lentiviral vectors expressing factor ix
WO2020123377A1 (en) 2018-12-10 2020-06-18 Neoimmunetech, Inc. Nrf-2 deficient cells and uses thereof
WO2021067389A1 (en) 2019-09-30 2021-04-08 Bioverativ Therapeutics Inc. Lentiviral vector formulations
US11008561B2 (en) 2014-06-30 2021-05-18 Bioverativ Therapeutics Inc. Optimized factor IX gene
WO2021146191A1 (en) 2020-01-13 2021-07-22 Neoimmunetech, Inc. Method of treating a tumor with a combination of il-7 protein and a bispecific antibody
WO2021151006A2 (en) 2020-01-22 2021-07-29 Outpace Bio, Inc. Chimeric polypeptides
WO2021151001A1 (en) 2020-01-22 2021-07-29 Outpace Bio, Inc. Chimeric polypeptides
WO2021158783A1 (en) 2020-02-05 2021-08-12 Washington University Method of treating a solid tumor with a combination of an il-7 protein and car-bearing immune cells
US11155613B2 (en) 2017-06-27 2021-10-26 Neuracle Science Co., Ltd. Use of anti-FAM19A5 antibodies for treating fibrosis
WO2021262963A1 (en) 2020-06-24 2021-12-30 Bioverativ Therapeutics Inc. Methods for the removal of free factor viii from preparations of lentiviral vectors modified to express said protein
US11285191B2 (en) 2016-07-26 2022-03-29 The Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Immunostimulatory compositions and uses therefor
WO2022087453A1 (en) 2020-10-22 2022-04-28 Lyell Immunopharma, Inc. Chimeric activation receptors
WO2022094475A1 (en) 2020-11-02 2022-05-05 Neoimmunetech, Inc. Use of interleukin-7 for the treatment of coronavirus
WO2022093718A1 (en) 2020-10-26 2022-05-05 Neoimmunetech, Inc. Methods of inducing stem cell mobilization
WO2022099022A1 (en) 2020-11-05 2022-05-12 Neoimmunetech, Inc. Method of treating a tumor with a combination of an il-7 protein and a nucleotide vaccine
US11446398B2 (en) 2016-04-11 2022-09-20 Obsidian Therapeutics, Inc. Regulated biocircuit systems
WO2022251644A1 (en) 2021-05-28 2022-12-01 Lyell Immunopharma, Inc. Nr4a3-deficient immune cells and uses thereof
WO2022256437A1 (en) 2021-06-02 2022-12-08 Lyell Immunopharma, Inc. Nr4a3-deficient immune cells and uses thereof
US11560425B2 (en) 2017-06-27 2023-01-24 Neuracle Science Co., Ltd. Use of anti-FAM19A5 antibodies for treating cancers
US11618783B2 (en) 2017-06-27 2023-04-04 Neuracle Science Co., Ltd. Anti-FAM19A5 antibodies and uses thereof
WO2023056331A1 (en) 2021-09-30 2023-04-06 Bioverativ Therapeutics Inc. Nucleic acids encoding factor viii polypeptides with reduced immunogenicity
US11634484B2 (en) 2018-04-24 2023-04-25 Neuracle Science Co., Ltd. Use of anti-family with sequence similarity 19, member A5 antibodies for the treatment of neuropathic pain
WO2023081923A1 (en) 2021-11-08 2023-05-11 Frequency Therapeutics, Inc. Platelet-derived growth factor receptor (pdgfr) alpha inhibitors and uses thereof
WO2023130081A1 (en) 2021-12-30 2023-07-06 Neoimmunetech, Inc. Method of treating a tumor with a combination of il-7 protein and vegf antagonist
US11746149B2 (en) 2017-06-27 2023-09-05 Neuracle Science Co., Ltd. Use of anti-family with sequence similarity 19, member A5 antibodies for the treatment of glaucoma
US11787851B2 (en) 2013-02-15 2023-10-17 Bioverativ Therapeutics Inc. Optimized factor VIII gene
US11884729B2 (en) 2018-06-29 2024-01-30 ApitBio, Inc Anti-L1CAM antibodies and uses thereof
WO2024026490A1 (en) 2022-07-28 2024-02-01 Sqz Biotechnologies Company Polynucleotides encoding linked antigens and uses thereof
US11970532B2 (en) 2018-05-10 2024-04-30 Neuracle Science Co., Ltd. Anti-family with sequence similarity 19, member A5 antibodies and method of use thereof
WO2024102722A1 (en) 2022-11-07 2024-05-16 Neoimmunetech, Inc. Methods of treating a tumor with an unmethylated mgmt promoter

Families Citing this family (476)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6605712B1 (en) * 1990-12-20 2003-08-12 Arch Development Corporation Gene transcription and ionizing radiation: methods and compositions
US5888767A (en) * 1996-11-27 1999-03-30 The Johns Hopkins University School Of Medicine Method of using a conditionally replicating viral vector to express a gene
US7198784B2 (en) * 1996-10-17 2007-04-03 Oxford Biomedica (Uk) Limited Retroviral vectors
PT904392E (en) 1996-10-17 2001-06-29 Oxford Biomedica Ltd RETROVIRAL VECTORS
EP1017797B1 (en) 1997-09-24 2005-06-22 The Regents Of The University Of California Non-primate lentiviral vectors and packaging systems
CN100342008C (en) 1997-10-24 2007-10-10 茵维特罗根公司 Recombinational cloning using nucleic acids having recombinatin sites
PT1895010E (en) * 1997-12-22 2012-01-25 Oxford Biomedica Ltd Equine infectious anaemia virus (eiav) based vectors
US6387695B1 (en) * 1997-12-23 2002-05-14 Merck & Co., Inc. DNA pharmaceutical formulations comprising citrate or triethanolamine and combinations thereof
CA2363924A1 (en) 1999-03-02 2000-09-08 Invitrogen Corporation Compositions and methods for use in recombinational cloning of nucleic acids
US7262049B2 (en) * 1999-03-16 2007-08-28 Dana-Farber Cancer Institute, Inc. Pseudotyped lentiviral vectors and uses thereof
EP1165842A4 (en) * 1999-03-16 2004-07-07 Dana Farber Cancer Inst Inc Lentiviral vector system for high quantity screening
KR100354562B1 (en) * 1999-12-06 2002-09-30 주식회사 제넥신 Plasmid DNA that prevents the simian immunodeficiency virus infection in monkeys
AU785483B2 (en) * 1999-12-10 2007-09-20 Invitrogen Corporation Use of multiple recombination sites with unique specificity in recombinational cloning
US6656706B2 (en) * 1999-12-23 2003-12-02 The United States Of America As Represented By The Department Of Health And Human Services Molecular clones with mutated HIV gag/pol, SIV gag and SIV env genes
US20040204379A1 (en) * 2000-06-19 2004-10-14 Cheng Seng H. Combination enzyme replacement, gene therapy and small molecule therapy for lysosomal storage diseases
US20040235173A1 (en) * 2000-07-03 2004-11-25 Gala Design, Inc. Production of host cells containing multiple integrating vectors by serial transduction
US20030224415A1 (en) * 2001-06-29 2003-12-04 Gala Design, Inc. Selection free growth of host cells containing multiple integrating vectors
CA2413156C (en) * 2000-07-03 2009-08-18 Gala Design, Inc. Expression vectors
AU2001271614B2 (en) 2000-07-03 2007-05-31 Catalent Pharma Solutions, Llc Host cells containing multiple integrating vectors
US7198924B2 (en) 2000-12-11 2007-04-03 Invitrogen Corporation Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites
US6800281B2 (en) * 2000-11-09 2004-10-05 Oxford Biomedica (Uk) Limited Lentiviral-mediated growth factor gene therapy for neurodegenerative diseases
US7575924B2 (en) 2000-11-13 2009-08-18 Research Development Foundation Methods and compositions relating to improved lentiviral vectors and their applications
US7122181B2 (en) * 2000-12-19 2006-10-17 Research Development Foundation Lentiviral vector-mediated gene transfer and uses thereof
WO2002072766A2 (en) 2001-03-09 2002-09-19 Board Of Regents, Universitx Of Texas System Induction of tumor immunity by variants of folate binding protein
WO2002072851A2 (en) 2001-03-13 2002-09-19 Novartis Ag Lentiviral packaging constructs
US20040242523A1 (en) * 2003-03-06 2004-12-02 Ana-Farber Cancer Institue And The Univiersity Of Chicago Chemo-inducible cancer gene therapy
US8034791B2 (en) 2001-04-06 2011-10-11 The University Of Chicago Activation of Egr-1 promoter by DNA damaging chemotherapeutics
JP2004532213A (en) * 2001-04-06 2004-10-21 ザ ユニヴァーシティ オヴ シカゴ Chemotherapy induction of EGR-1 promoter activity
US20040235169A1 (en) * 2001-04-20 2004-11-25 Evans Ronald M. Inducible expression of transfected genes
US20040033604A1 (en) * 2001-04-20 2004-02-19 Gary Kobinger Recombinant lentiviral vectors pseudotyped in envelopes containing filovirus binding domains
CA2448097A1 (en) 2001-05-22 2002-11-28 University Of Chicago N4 virion single-stranded dna dependent rna polymerase
ITMI20011138A1 (en) * 2001-05-29 2002-11-29 Uni Di Torino VECTOR AND METHODS OF USE FOR THE SELECTIVE EXPRESSION OF GENES IN IN VIVO ANGIOGENESIS SITES
DE60228082D1 (en) 2001-05-31 2008-09-18 Novartis Ag NTEN AND NEW LIGANDS AND PHARMACEUTICAL COMPOSITIONS
ATE535260T1 (en) 2001-06-29 2011-12-15 Sloan Kettering Inst Cancer VECTOR CODING HUMAN GLOBIN GENE AND ITS USE IN THE TREATMENT OF HEMOGLOBINOPATHIES
IL160132A0 (en) * 2001-08-02 2004-06-20 Inst Clayton De La Rech Methods and compositions relating to improved lentiviral vector production systems
US20040143104A1 (en) * 2001-08-08 2004-07-22 Wadsworth Samuel C. Methods of treating diabetes and other blood sugar disorders
AU2002327430A1 (en) * 2001-08-08 2003-02-24 Genzyme Corporation Methods for treating diabetes and other blood sugar disorders
AU2002336517B2 (en) * 2001-09-13 2008-09-11 California Institute Of Technology Method for producing transgenic animals
AU2002327755A1 (en) * 2001-09-28 2003-04-14 Rush-Presbyterian-St. Luke's Medical Center Paramyxoviruses as gene transfer vectors to lung cells
NZ532060A (en) 2001-10-02 2005-11-25 Inst Clayton De La Rech Methods and compositions relating to restricted expression lentiviral vectors and their applications
US20040038304A1 (en) * 2002-03-28 2004-02-26 Gala Design, Inc. Antibody libraries
US7384738B2 (en) * 2002-03-28 2008-06-10 Bremel Robert D Retrovirus-based genomic screening
AU2003223527B2 (en) 2002-04-09 2009-01-15 Sanofi Pasteur Limited Modified CEA nucleic acid and expression vectors
KR101002955B1 (en) 2002-04-26 2010-12-21 인스티튜트 클레이톤 드 라 리쎄르셰 Improved chimeric glycoproteins and pseudotyped lentiviral vectors
US6790641B2 (en) 2002-05-01 2004-09-14 Cell Genesys, Inc. Lentiviral vector particles resistant to complement inactivation
US20050214945A1 (en) * 2002-05-17 2005-09-29 Eastern Virginia Medical School Htlv-I tax induced killing of p53 null cancer cells
US20040009158A1 (en) * 2002-07-11 2004-01-15 Washington University Promotion of neovascularization using bone marrow-derived endothelial-progenitor cells
WO2004055157A2 (en) * 2002-08-13 2004-07-01 Whitley Chester B Methods of using vectors to treat metabolic disorders
AU2003266152A1 (en) * 2002-09-13 2004-04-30 University Of Maryland Biotechnology COMPOSITIONS FOR INDUCING INCREASED LEVELS OF Beta-CHEMOKINES AND METHODS OF USE THEREFOR
DK1563069T3 (en) * 2002-11-22 2012-07-23 Inst Clayton De La Rech COMPOSITIONS AND SYSTEMS FOR REGULATION
US20040197312A1 (en) * 2003-04-02 2004-10-07 Marina Moskalenko Cytokine-expressing cellular vaccine combinations
RU2353357C2 (en) 2003-05-16 2009-04-27 Юниверсити Оф Мэрилэнд Байотекнолоджи Инститьют Ccr5 expression supression compositions and methods of application thereof
US20050036988A1 (en) * 2003-05-28 2005-02-17 Ruian Xu Compositions and methods for preventing and treating liver cirrhosis
US7696322B2 (en) * 2003-07-28 2010-04-13 Catalent Pharma Solutions, Inc. Fusion antibodies
AU2004270275B2 (en) * 2003-09-09 2010-02-18 Virxsys Corporation Lentivirus vector-based approaches for generating an immune response to HIV humans
CN101124327A (en) * 2003-10-08 2008-02-13 圣诺菲·帕斯图尔公司 Modified CEA/B7 vector
US20050107318A1 (en) * 2003-11-17 2005-05-19 Samuel Wadsworth Methods of treating diabetes and other blood sugar disorders
DE602004027538D1 (en) 2003-12-01 2010-07-15 Life Technologies Corp NUCLEIC ACID MOLECULES AND RECOMBINATION AGENTS CONTAINED THEREOF
US20050221429A1 (en) * 2004-01-16 2005-10-06 Cardinal Health Pts, Llc Host cells containing multiple integrating vectors comprising an amplifiable marker
JP4564052B2 (en) * 2004-04-08 2010-10-20 サンガモ バイオサイエンシズ インコーポレイテッド Methods and compositions for modulating myocardial contractility
ES2315859T3 (en) * 2004-04-08 2009-04-01 Sangamo Biosciences, Inc. METHODS AND COMPOSITIONS TO TREAT NEUROPATIC AND NEURODEGENERATIVE AFFECTIONS.
WO2006017279A2 (en) * 2004-07-12 2006-02-16 Board Of Regents, The University Of Texas System Methods and compositions related to identifying protein-protein interactions
BRPI0515264B1 (en) 2004-09-13 2018-12-18 Genzyme Corp fusion protein according to formula x-y-z, composition, nucleic acid molecule, its uses and multimerization method of a polypeptide x
WO2006089001A2 (en) 2005-02-16 2006-08-24 Lentigen Corporation Lentiviral vectors and their use
RS59399B1 (en) 2005-03-23 2019-11-29 Genmab As Antibodies against cd38 for treatment of multiple myeloma
AR059089A1 (en) 2006-01-20 2008-03-12 Genzyme Corp INTRAVENTRICULAR ADMINISTRATION OF AN ENZYME FOR LISOSOMAL STORAGE DISEASES
DK1988823T3 (en) 2006-02-09 2018-12-03 Genzyme Corp SLOW INTRAVENTRICULAR ADMINISTRATION
EP1835032A1 (en) 2006-03-14 2007-09-19 Université de Liège A self-inactivating recombinant lentiviral vector for the inhibition of HIV replication
US20070231298A1 (en) * 2006-03-31 2007-10-04 Cell Genesys, Inc. Cytokine-expressing cancer immunotherapy combinations
CA2658628A1 (en) 2006-07-25 2008-01-31 Celladon Corporation Extended antegrade epicardial coronary infusion of adeno-associated viral vectors for gene therapy
ATE543097T1 (en) 2006-07-27 2012-02-15 Univ Maryland CELLULAR RECEPTOR FOR ANTIPROLIFERATIVE FACTOR
WO2008066658A2 (en) 2006-11-03 2008-06-05 The Trustees Of Princeton University Engineered cellular pathways for programmed autoregulation of differentiation
US20100092435A1 (en) 2006-12-07 2010-04-15 Emmanuel Jacques Henri Joseph Wiertz Use of a varicellovirus tap-inhibitor for the induction of tumor-or virus-specific immunity against teipp
WO2008137115A1 (en) 2007-05-03 2008-11-13 The Brigham And Women's Hospital, Inc. Multipotent stem cells and uses thereof
CN101970472B (en) 2007-06-06 2013-10-30 研究发展基金会 RTEF-1 variants and use thereof for inhibition of angiogenesis
US20090028857A1 (en) 2007-07-23 2009-01-29 Cell Genesys, Inc. Pd-1 antibodies in combination with a cytokine-secreting cell and methods of use thereof
US8425897B2 (en) * 2007-08-30 2013-04-23 Immutep S.A. Compositions containing LAG-3 and cells that secrete GM-CSF and methods of use
US8936936B2 (en) * 2007-10-25 2015-01-20 Sangamo Biosciences, Inc. Methods and compositions for targeted integration
EP2385065A1 (en) 2007-11-01 2011-11-09 Perseid Therapeutics LLC Immunosuppressive polypeptides and nucleic acids
US9605035B2 (en) 2008-01-10 2017-03-28 Research Development Foundation Vaccines and diagnostics for the ehrlichioses
JP5674476B2 (en) 2008-01-25 2015-02-25 ピー53 インコーポレイテッド P53 biomarker
KR100981092B1 (en) 2008-02-29 2010-09-08 고려대학교 산학협력단 Recombinant expression vector system for variants of coagulation factor VIII and von Willebrand factor
KR101679082B1 (en) 2008-03-17 2016-11-23 더 스크립스 리서치 인스티튜트 Combined chemical and genetic approaches for generation of induced pluripotent stem cells
US20110142880A1 (en) * 2008-03-28 2011-06-16 Franck Yann Lemiale Lentivirus-based immunogenic vectors
AU2009240738B2 (en) 2008-04-21 2014-09-11 Tissue Regeneration Therapeutics, Inc. Genetically modified human umbilical cord perivascular cells for prophylaxis against or treatment of biological or chemical agents
JP2012500005A (en) 2008-08-12 2012-01-05 セルラー ダイナミクス インターナショナル, インコーポレイテッド Method for generating iPS cells
AU2009282625A1 (en) 2008-08-18 2010-02-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Derivatives of APF and methods of use
US8840881B2 (en) 2008-08-28 2014-09-23 Aduro Gvax Inc. Methods and compositions for treating prostate cancer or inducing a humoral immune response against prostate cancer
CN102317442B (en) 2008-12-17 2014-08-13 斯克里普斯研究所 Generation and maintenance of stem cells
WO2010087702A1 (en) 2009-01-30 2010-08-05 Stichting Katholieke Universiteit TET2 gene as a marker for diagnosing a myelodysuplastic syndrome (MDS) or an acute myeloid leukemia (AML) and determining the prognosis in a subject
EP2393917B1 (en) 2009-02-03 2016-04-06 Koninklijke Nederlandse Akademie van Wetenschappen Culture medium for epithelial stem cells and organoids comprising said stem cells.
US9752124B2 (en) 2009-02-03 2017-09-05 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
EP2412800A1 (en) 2010-07-29 2012-02-01 Koninklijke Nederlandse Akademie van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
CA2754603A1 (en) * 2009-03-13 2010-09-16 Lentigen Corporation Non-integrating retroviral vector vaccines
JP6215533B2 (en) 2009-04-09 2017-10-18 サンガモ セラピューティクス, インコーポレイテッド Targeted integration into stem cells
US8748381B2 (en) 2009-04-28 2014-06-10 Vanderbilt University Compositions and methods for the treatment of disorders involving epithelial cell apoptosis
BR122021005965B1 (en) 2009-07-31 2022-01-25 Baxalta Incorporated Method for producing a disintegrin and metalloproteinase composition with thrombospondin motif (adamts)
EP2478101A1 (en) 2009-09-16 2012-07-25 Stichting Het Nederlands Kanker Instituut Fra-1 target genes as drug targets for treating cancer
EP2305717A1 (en) 2009-09-21 2011-04-06 Koninklijke Nederlandse Akademie van Wetenschappen Inhibiting TNIK for treating colon cancer
US8623352B2 (en) 2009-09-21 2014-01-07 Baxter International Inc. Stabilized liquid and lyophilized ADAMTS13 formulations
CN113621576A (en) 2009-10-16 2021-11-09 斯克里普斯研究所 Induction of pluripotent cells
CA2788850C (en) 2010-02-09 2019-06-25 Sangamo Biosciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US10787701B2 (en) 2010-04-05 2020-09-29 Prognosys Biosciences, Inc. Spatially encoded biological assays
CA2796601C (en) 2010-04-19 2019-03-26 Research Development Foundation Rtef-1 variants and uses thereof
CN106065405B (en) * 2010-05-27 2020-05-12 海因里希·佩特研究所莱比锡试验病毒学研究所-民法基金会 Tailored recombinases for recombining asymmetric target sites in multiple retrovirus strains
US20110312001A1 (en) 2010-06-15 2011-12-22 Emile Nuwaysir Compendium of ready-built stem cell models for interrogation of biological response
EP2591093B1 (en) 2010-07-07 2018-11-28 FUJIFILM Cellular Dynamics, Inc. Endothelial cell production by programming
IL286298B (en) 2010-07-08 2022-08-01 Baxalta Inc Method of producing recombinant high molecular weight vwf in cell culture
US9309534B2 (en) 2010-07-12 2016-04-12 Universidad Autonoma De Barcelona Gene therapy composition for use in diabetes treatment
US20120083035A1 (en) * 2010-09-30 2012-04-05 Dharmacon, Inc. Modified Cell Lines for Increasing Lentiviral Titers
WO2012047093A1 (en) 2010-10-05 2012-04-12 Academisch Ziekenhuis Bij De Universiteit Van Amsterdam Treatment of the sjögren's syndrome
EP2465928A1 (en) 2010-12-16 2012-06-20 Academisch Medisch Centrum bij de Universiteit van Amsterdam Treatment of Th17-mediated diseases
JP6182456B2 (en) 2010-12-22 2017-08-23 フェイト セラピューティクス,インコーポレイテッド Enhanced cell culture platform and iPSC reprogramming for single cell sorting
BRPI1105317A2 (en) 2011-01-24 2013-04-30 Fundacco Hemoct De Ribeirco Preto stable and large-scale production of human fviii in human cell line sk-hep-1
EP2673358B1 (en) 2011-02-08 2019-01-09 FUJIFILM Cellular Dynamics, Inc. Hematopoietic precursor cell production by programming
EP2741784B1 (en) 2011-03-02 2017-05-17 Board Of Regents, The University Of Texas System Tusc2 therapies
US9822379B2 (en) 2011-05-19 2017-11-21 Fundación Pública Andaluza Progreso Y Salud Highly inducible dual-promoter lentiviral TET-ON system
JP6143231B2 (en) 2011-06-10 2017-06-07 ブルーバード バイオ, インコーポレイテッド Gene therapy vectors for adrenal cerebral white matter dystrophy and adrenal spinal neuropathy
CA2841165A1 (en) 2011-07-11 2013-01-17 Cellular Dynamics International, Inc. Methods for cell reprogramming and genome engineering
WO2013026015A1 (en) 2011-08-18 2013-02-21 Dana-Farber Cancer Institute, Inc. Muc1 ligand traps for use in treating cancers
KR101931403B1 (en) 2011-09-23 2018-12-21 블루버드 바이오, 인코포레이티드. Improved gene therapy methods
EP3269802B1 (en) 2011-09-30 2019-10-23 Bluebird Bio, Inc. Compounds for improved viral transduction
CA2853379C (en) 2011-10-27 2020-11-24 Wellstat Ophthalmics Corporation Vectors encoding rod-derived cone viability factor
GB201202516D0 (en) 2012-02-13 2012-03-28 Ucl Business Plc Materials and methods relating to packaging cell lines
TWI698240B (en) 2012-05-15 2020-07-11 澳大利亞商艾佛蘭屈澳洲私營有限公司 Treatment of amd using aav sflt-1
SG11201407635XA (en) 2012-05-30 2014-12-30 Univ Cornell Generation of functional and durable endothelial cells from human amniotic fluid-derived cells
AU2013281328B2 (en) 2012-06-27 2017-11-23 Meiragtx Uk Ii Limited Combination for treating an inflammatory disorder
UA114108C2 (en) 2012-07-10 2017-04-25 Борд Оф Ріджентс, Дзе Юніверсіті Оф Техас Сістем Monoclonal antibodies for use in diagnosis and therapy of cancers and autoimmune disease
EP3103872B1 (en) 2012-07-12 2018-08-29 ProQR Therapeutics II B.V. Oligonucleotides for making a change in the sequence of a target rna molecule present in a living cell
DK2880167T3 (en) 2012-07-31 2018-07-30 Univ Texas METHODS AND COMPOSITIONS FOR IN VIVO-INDUCTION OF PANCREAS BETA CELL CREATION
EP2692868A1 (en) 2012-08-02 2014-02-05 Universitat Autònoma De Barcelona Adeno-associated viral (AAV) vectors useful for transducing adipose tissue
US20150224209A1 (en) * 2012-09-14 2015-08-13 The Regents Of The University Of California Lentiviral vector for stem cell gene therapy of sickle cell disease
EP2909337B1 (en) 2012-10-17 2019-01-09 Spatial Transcriptomics AB Methods and product for optimising localised or spatial detection of gene expression in a tissue sample
AU2013204922B2 (en) 2012-12-20 2015-05-14 Celgene Corporation Chimeric antigen receptors
KR20220100093A (en) 2013-02-06 2022-07-14 안트로제네시스 코포레이션 Modified t lymphocytes having improved specificity
EP2958992A1 (en) 2013-02-22 2015-12-30 Cellular Dynamics International, Inc. Hepatocyte production via forward programming by combined genetic and chemical engineering
WO2014132137A2 (en) 2013-03-01 2014-09-04 Université De Genève Transgenic cell selection
AU2014225708B2 (en) 2013-03-05 2018-10-18 Baylor College Of Medicine Heparanase expression in human T lymphocytes
US20160015749A1 (en) 2013-03-05 2016-01-21 Baylor College Of Medicine Engager cells for immunotherapy
EP2964753B1 (en) 2013-03-07 2018-04-25 Baylor College of Medicine Targeting cd138 in cancer
US20160015750A1 (en) 2013-03-09 2016-01-21 Baylor College Of Medicine Vascular-targeted t-cell therapy
JP6480910B6 (en) 2013-03-15 2019-04-03 ザ・チルドレンズ・ホスピタル・オブ・フィラデルフィアThe Children’S Hospital Of Philadelphia An extensible production process for producing recombinant lentiviral vectors in serum-free suspension culture systems
EP2970892A1 (en) 2013-03-15 2016-01-20 The Jackson Laboratory Isolation of non-embryonic stem cells and uses thereof
EP2970372B1 (en) 2013-03-15 2020-09-30 Celgene Corporation Modified t lymphocytes
AU2013202965B2 (en) 2013-03-15 2016-07-21 Takeda Pharmaceutical Company Limited Improved method for producing factor h from a plasma precipitation fraction
DK2981607T3 (en) 2013-04-03 2020-11-16 Memorial Sloan Kettering Cancer Center EFFICIENT GENERATION OF TUMOR-TARGETED T-CELLS DERIVED FROM PLURIPOTENT STEM CELLS
LT3013983T (en) 2013-06-25 2023-05-10 Prognosys Biosciences, Inc. Spatially encoded biological assays using a microfluidic device
CA2923857A1 (en) 2013-09-09 2015-03-12 Figene, Llc Gene therapy for the regeneration of chondrocytes or cartilage type cells
JP6454352B2 (en) 2013-11-05 2019-01-16 タカラ バイオ ユーエスエー, インコーポレイテッド Dry transfection composition, method of producing dry transfection composition, and method of using dry transfection composition
US10028902B2 (en) 2013-11-08 2018-07-24 Baylor Research Institute Nuclear localization of GLP-1 stimulates myocardial regeneration and reverses heart failure
WO2015070009A2 (en) 2013-11-08 2015-05-14 The Board Of Regents Of The University Of Texas System Vh4 antibodies against gray matter neuron and astrocyte
WO2015077717A1 (en) 2013-11-25 2015-05-28 The Broad Institute Inc. Compositions and methods for diagnosing, evaluating and treating cancer by means of the dna methylation status
WO2015080981A1 (en) 2013-11-27 2015-06-04 Baylor College Of Medicine Csgp4-specific chimeric antigen receptor for cancer
US11725237B2 (en) 2013-12-05 2023-08-15 The Broad Institute Inc. Polymorphic gene typing and somatic change detection using sequencing data
GB201322626D0 (en) 2013-12-19 2014-02-05 Immutep S A Combined preparations for the treatment of cancer
EP3082853A2 (en) 2013-12-20 2016-10-26 The Broad Institute, Inc. Combination therapy with neoantigen vaccine
EP3099719B1 (en) 2014-01-29 2020-04-01 Dana-Farber Cancer Institute, Inc. Antibodies against the muc1-c/extracellular domain (muc1-c/ecd)
WO2015130783A1 (en) 2014-02-25 2015-09-03 Research Development Foundation Sty peptides for inhibition of angiogenesis
KR20240091064A (en) 2014-03-04 2024-06-21 페이트 세러퓨틱스, 인코포레이티드 Improved reprogramming methods and cell culture platforms
CA2942776C (en) 2014-03-17 2023-01-24 Adverum Biotechnologies, Inc. Polyneucleotide cassette and expression vector for expression of a gene in cone cells using truncated m-opsin promoter
WO2015164228A1 (en) 2014-04-21 2015-10-29 Cellular Dynamics International, Inc. Hepatocyte production via forward programming by combined genetic and chemical engineering
US10774343B2 (en) 2014-04-25 2020-09-15 Bluebird Bio, Inc. MND promoter chimeric antigen receptors
CA2951044C (en) 2014-06-06 2023-10-03 Bluebird Bio, Inc. Improved t cell compositions
EP2957634A1 (en) 2014-06-20 2015-12-23 Consejo Superior De Investigaciones Científicas Compounds for prevention and/or treatment of fibrotic diseases
EP3750993B1 (en) 2014-07-11 2023-12-27 Celgene Corporation Methods of improving vector transduction efficiency into t lymphocytes
NZ728555A (en) 2014-07-24 2024-07-26 2Seventy Bio Inc Bcma chimeric antigen receptors
EP2977463A1 (en) 2014-07-25 2016-01-27 Centro de Investigación Biomédica en Red (CIBER) Methods and agents related to lung diseases
KR20170036085A (en) 2014-07-31 2017-03-31 더 보드 오브 리젠츠 오브 더 유니버시티 오브 오클라호마 High isomerohydrolase activity mutants of mammalian rpe65
SG11201701111SA (en) 2014-08-12 2017-03-30 Anthrogenesis Corp Car-t lymphocytes engineered to home to lymph node b cell zone, skin, or gastrointestinal tract
EP3194623B1 (en) 2014-08-12 2022-01-05 Wayne State University Systems and methods to detect stem cell stress and uses thereof
DK3186284T3 (en) 2014-08-28 2022-05-09 Bioatla Inc CONDITIONALLY ACTIVE CHIMERIC ANTIGEN RECEPTORS FOR MODIFIED T-CELLS
WO2016030501A1 (en) 2014-08-28 2016-03-03 Centre National De La Recherche Scientifique - Cnrs - Synthetic alu-retrotransposon vectors for gene therapy
US11111288B2 (en) 2014-08-28 2021-09-07 Bioatla, Inc. Conditionally active chimeric antigen receptors for modified t-cells
WO2016036916A1 (en) 2014-09-03 2016-03-10 Bioatla, Llc Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts
ES2773892T3 (en) 2014-09-18 2020-07-15 Univ Montreal Compounds and methods to increase viral gene transfer in human hematopoietic cells
US20170281683A1 (en) 2014-09-26 2017-10-05 Baylor College Of Medicine Glypican-3 specific chimeric antigen receptors for adoptive immunotherapy
DK3628687T3 (en) 2014-12-12 2021-10-18 2Seventy Bio Inc CHIMARY BCMA ANTIGEN RECEPTORS
IL252295B2 (en) 2014-12-19 2023-10-01 Dana Farber Cancer Inst Inc Chimeric antigen receptors and methods of use thereof
US10993997B2 (en) 2014-12-19 2021-05-04 The Broad Institute, Inc. Methods for profiling the t cell repertoire
EP3234193B1 (en) 2014-12-19 2020-07-15 Massachusetts Institute of Technology Molecular biomarkers for cancer immunotherapy
KR20170093248A (en) 2014-12-19 2017-08-14 다나-파버 캔서 인스티튜트 인크. Carbonic anhydrase ix specific chimeric antigen receptors and methods of use thereof
WO2016110518A1 (en) 2015-01-07 2016-07-14 Universitat Autònoma De Barcelona Single-vector gene construct comprising insulin and glucokinase genes
GB201500374D0 (en) 2015-01-09 2015-02-25 Immutep S A Combined preparations for the treatment of cancer
MA41346A (en) 2015-01-12 2017-11-21 Juno Therapeutics Inc POST-TRANSCRIPTIONAL REGULATORY ELEMENTS OF MODIFIED HEPATITIS
MA41433A (en) 2015-01-26 2017-12-05 Baylor College Medicine UNIVERSAL IMMUNE CELLS FOR ANTI-CANCER IMMUNOTHERAPY
EP3253791A1 (en) 2015-02-03 2017-12-13 INSERM - Institut National de la Santé et de la Recherche Médicale Anti-rho gtpase conformational single domain antibodies and uses thereof
WO2016134293A1 (en) 2015-02-20 2016-08-25 Baylor College Of Medicine p63 INACTIVATION FOR THE TREATMENT OF HEART FAILURE
EA201791939A1 (en) 2015-03-02 2018-01-31 Адверум Байотекнолоджиз, Инк. COMPOSITIONS AND METHODS OF INTRAVITREAL DELIVERY OF POLYNUCLEOTIDES IN RETCHEMBALS
US20180271891A1 (en) 2015-03-11 2018-09-27 The Broad Institute Inc. Selective treatment of prmt5 dependent cancer
EP3286225B1 (en) 2015-04-23 2020-07-01 Baylor College of Medicine Cd5 chimeric antigen receptor for adoptive t cell therapy
WO2016185026A1 (en) 2015-05-20 2016-11-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for modulation polarization and activation of macrophages
EP3297660A2 (en) 2015-05-20 2018-03-28 The Broad Institute Inc. Shared neoantigens
TW202241500A (en) 2015-06-09 2022-11-01 美商博德研究所有限公司 Formulations for neoplasia vaccines and methods of preparing thereof
US11040094B2 (en) 2015-07-01 2021-06-22 Colleen M. O'Connor Compositions and methods for treating immunological dysfunction
AU2016309948B2 (en) 2015-08-14 2021-05-20 The University Of Sydney Connexin 45 inhibition for therapy
ES2911015T3 (en) 2015-08-31 2022-05-17 Helixmith Co Ltd Chimeric anti-sialyl Tn antigen receptors
WO2017055248A1 (en) 2015-09-28 2017-04-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of heart failure
CN117737124A (en) 2015-10-16 2024-03-22 菲特治疗公司 Platform for inducing and maintaining ground state pluripotency
US10865381B2 (en) 2015-10-20 2020-12-15 FUJIFILM Cellular Dynamics, Inc. Multi-lineage hematopoietic precursor cell production by genetic programming
EP3365453A2 (en) 2015-10-22 2018-08-29 Juno Therapeutics GmbH Methods, kits, agents and apparatuses for transduction
CA3003000A1 (en) 2015-10-23 2017-04-27 The Jackson Laboratory Nicotinamide for use in the treatment and prevention of ocular neurodegenerative disorder (e.g. glaucoma)
KR20180083868A (en) 2015-10-30 2018-07-23 알레타 바이오쎄라퓨틱스, 인크. Composition and method for tumor transduction
AU2016343809B2 (en) 2015-10-30 2022-08-04 Aleta Biotherapeutics Inc. Compositions and methods for treatment of cancer
LT3370733T (en) 2015-11-02 2021-10-25 Board Of Regents, The University Of Texas System Methods of cd40 activation and immune checkpoint blockade
KR20180104597A (en) 2015-11-07 2018-09-21 멀티비르 인코포레이티드 Compositions comprising tumor suppressor gene therapy and immune blockade for cancer therapy
KR20230008256A (en) 2015-11-13 2023-01-13 다케다 야쿠힌 고교 가부시키가이샤 Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a
JP6695426B2 (en) 2015-11-13 2020-05-20 バクスアルタ インコーポレイテッド Highly Expressing Viral Vector for Hemophilia A Gene Therapy Encoding a Recombinant FVIII Variant
WO2017099712A1 (en) 2015-12-07 2017-06-15 Bluebird Bio, Inc. Improved t cell compositions
GB2545763A (en) 2015-12-23 2017-06-28 Adverum Biotechnologies Inc Mutant viral capsid libraries and related systems and methods
WO2017139561A1 (en) 2016-02-12 2017-08-17 Bluebird Bio, Inc. Vcn enhancer compositions and methods of using the same
CA3014078A1 (en) 2016-02-12 2017-08-17 Bluebird Bio, Inc. Vcn enhancer compositions and methods of using the same
WO2017143076A1 (en) 2016-02-16 2017-08-24 Dana-Farber Cancer Institute, Inc. Chimeric antigen receptors and methods of use thereof
US11225520B2 (en) 2016-02-16 2022-01-18 Dana-Farber Cancer Institute, Inc. Immunotherapy compositions and methods
US10435682B2 (en) 2016-02-19 2019-10-08 University Of South Florida Arginine deiminase gene therapy for disordered proteins
US20190177391A1 (en) 2016-03-31 2019-06-13 Baylor Research Institute Angiopoietin-like protein 8 (angptl8)
US11976116B2 (en) 2016-04-14 2024-05-07 2Seventy Bio, Inc. Salvage chimeric antigen receptor systems
US20190346442A1 (en) 2016-04-18 2019-11-14 The Broad Institute, Inc. Improved hla epitope prediction
US20190125826A1 (en) 2016-04-22 2019-05-02 Inserm (Institut National De La Santé Et De La Médicale) Methods and pharmaceutical composition for the treatment of inflammatory skin diseases associated with desmoglein-1 deficiency
TWI844509B (en) 2016-05-13 2024-06-11 美商拜奧亞特拉公司 Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof
CA3026180A1 (en) 2016-06-10 2017-12-14 Gadeta B.V. Human leukocyte antigen restricted gamma delta t cell receptors and methods of use thereof
AU2017290805B2 (en) 2016-07-01 2023-11-16 Research Development Foundation Elimination of proliferating cells from stem cell-derived grafts
CA3031994A1 (en) 2016-07-29 2018-02-01 Juno Therapeutics, Inc. Methods for assessing the presence or absence of replication competent virus
EP3491134B1 (en) 2016-08-01 2023-10-11 University of Pittsburgh - of The Commonwealth System of Higher Education Human induced pluripotent stem cells for high efficiency genetic engineering
US20190309274A1 (en) 2016-08-16 2019-10-10 Bluebird Bio, Inc. Il-10 receptor alpha homing endonuclease variants, compositions, and methods of use
CA3034782A1 (en) 2016-08-23 2018-03-01 Bluebird Bio, Inc. Tim3 homing endonuclease variants, compositions, and methods of use
CN116970630A (en) 2016-08-26 2023-10-31 贝勒医学院 Constitutive active cytokine receptors for cell therapy
WO2018049226A1 (en) 2016-09-08 2018-03-15 Bluebird Bio, Inc. Pd-1 homing endonuclease variants, compositions, and methods of use
CA3039014A1 (en) 2016-10-04 2018-04-12 Precision Biosciences, Inc. Co-stimulatory domains for use in genetically-modified cells
WO2018067836A1 (en) 2016-10-05 2018-04-12 Cellular Dynamics International, Inc. Methods for directed differentiation of pluripotent stem cells to hla homozygous immune cells
US10961505B2 (en) 2016-10-05 2021-03-30 FUJIFILM Cellular Dynamics, Inc. Generating mature lineages from induced pluripotent stem cells with MECP2 disruption
CN110072593A (en) 2016-10-05 2019-07-30 法国国家健康和医学研究院 Method and pharmaceutical composition suitable for kidney treatment
WO2018069422A1 (en) 2016-10-12 2018-04-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of non-alcoholic fatty liver disease
KR102661905B1 (en) 2016-10-12 2024-04-29 더 보드 오브 리젠츠 오브 더 유니버시티 오브 텍사스 시스템 Methods and compositions for TUSC2 immunotherapy
CA3040157A1 (en) 2016-10-17 2018-04-26 Bluebird Bio, Inc. Tgf.beta.r2 endonuclease variants, compositions, and methods of use
US11331380B2 (en) 2016-10-20 2022-05-17 Celgene Corporation Cereblon-based heterodimerizable chimeric antigen receptors
KR20240005168A (en) 2016-11-04 2024-01-11 2세븐티 바이오, 인코포레이티드 Anti-bcma car t cell compositions
WO2018091621A1 (en) 2016-11-17 2018-05-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for increasing endogenous protein level
ES2977435T3 (en) 2016-11-17 2024-08-23 2Seventy Bio Inc TGF BETA signal converter
EP3548617A4 (en) 2016-12-05 2020-06-17 The Regents of The University of California Optimized lentiviral vector for stem cell gene therapy of hemoglobinopathies
MX2019006438A (en) 2016-12-05 2019-11-28 Juno Therapeutics Inc Production of engineered cells for adoptive cell therapy.
JP2020510624A (en) 2016-12-12 2020-04-09 マルチビア インコーポレイテッド Methods and compositions comprising viral gene therapy and immune checkpoint inhibitors for the treatment and prevention of cancer and infectious diseases
WO2018130518A1 (en) 2017-01-10 2018-07-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for inducing senescence in cancer cells
US11549149B2 (en) 2017-01-24 2023-01-10 The Broad Institute, Inc. Compositions and methods for detecting a mutant variant of a polynucleotide
EP3574104A1 (en) 2017-01-30 2019-12-04 The U.S.A. As Represented By The Secretary, Department Of Health And Human Services Recombinant virus vectors for the treatment of glycogen storage disease
HUE065174T2 (en) 2017-02-12 2024-05-28 Biontech Us Inc Hla-based methods and compositions and uses thereof
AU2018220843B2 (en) 2017-02-14 2023-09-21 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Methods of engineering human induced pluripotent stem cells to produce liver tissue
AU2018221730B2 (en) 2017-02-15 2024-06-20 Novo Nordisk A/S Donor repair templates multiplex genome editing
US20200016207A1 (en) 2017-03-20 2020-01-16 Baylor College Of Medicine TRANSGENIC c-MPL PROVIDES LIGAND-DEPENDENT CO-STIMULATION AND CYTOKINE SIGNALS TO TCR-ENGINEERED T CELLS
CN110678190A (en) 2017-03-28 2020-01-10 宾夕法尼亚大学董事会 Method for protecting transplanted tissue from rejection
EP3388520A1 (en) 2017-04-11 2018-10-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for reducing the expression of nkcc1 in a subject in need thereof
DK3612557T3 (en) 2017-04-18 2022-04-19 Fujifilm Cellular Dynamics Inc ANTIGEN-SPECIFIC IMMUNE EFFECTOR CELLS
JP2020518275A (en) 2017-05-03 2020-06-25 バイオマリン ファーマシューティカル インコーポレイテッド Improved lentivirus for transduction of hematopoietic stem cells
WO2018208837A1 (en) 2017-05-08 2018-11-15 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
IL280637B1 (en) 2017-05-22 2024-07-01 Baxalta Inc Viral vectors encoding recombinant fix with increased expression for gene therapy of hemophilia b
BR112019024608A2 (en) 2017-05-24 2020-06-23 Universitat Autonoma De Barcelona VIRAL EXPRESSION CONSTRUCTION THAT UNDERSTANDS A FIBROBLAST GROWTH FACTOR CODING SEQUENCE 21 (FGF21)
US20210147818A1 (en) 2017-05-25 2021-05-20 Bluebird Bio, Inc. Cblb endonuclease variants, compositions, and methods of use
EP3645038A1 (en) 2017-06-30 2020-05-06 Precision Biosciences, Inc. Genetically-modified t cells comprising a modified intron in the t cell receptor alpha gene
US20210228738A1 (en) 2017-07-17 2021-07-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions and methods for increasing or enhancing transduction of gene therapy vectors and for removing or reducing immunoglobulins
AU2018310452A1 (en) 2017-07-29 2020-02-13 Juno Therapeutics, Inc. Reagents for expanding cells expressing recombinant receptors
WO2019027299A2 (en) * 2017-08-04 2019-02-07 주식회사 에스엘바이젠 Pharmaceutical composition for preventing or treating vascular disorders including mesenchymal stem cell expressing hepatocyte growth factor as active ingredient
AU2018313950A1 (en) 2017-08-09 2020-02-13 Juno Therapeutics, Inc. Methods for producing genetically engineered cell compositions and related compositions
CN111655340A (en) 2017-09-20 2020-09-11 国家医疗保健研究所 Methods and pharmaceutical compositions for modulating autophagy
US11579147B2 (en) 2017-09-25 2023-02-14 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of VNN1 as a biomarker and a therapeutic target in sarcomas
EP4269560A3 (en) 2017-10-03 2024-01-17 Precision Biosciences, Inc. Modified epidermal growth factor receptor peptides for use in genetically-modified cells
US11779654B2 (en) 2017-10-04 2023-10-10 2Seventy Bio, Inc. PCSK9 endonuclease variants, compositions, and methods of use
KR20200099132A (en) 2017-11-01 2020-08-21 주노 쎄러퓨티크스 인코퍼레이티드 Process for producing a therapeutic composition of engineered cells
AU2018360801A1 (en) 2017-11-01 2020-05-14 Celgene Corporation Process for producing a T cell composition
JP2021502094A (en) 2017-11-10 2021-01-28 ジュノー セラピューティクス インコーポレイテッド Closed cryogenic container
MX2020005907A (en) 2017-12-08 2020-10-19 Juno Therapeutics Inc Serum-free media formulation for culturing cells and methods of use thereof.
US20210128616A1 (en) 2017-12-08 2021-05-06 Juno Therapeutics, Inc. Phenotypic markers for cell therapy and related methods
EP3732285A1 (en) 2017-12-28 2020-11-04 Tract Pharmaceuticals, Inc. Stem cell culture systems for columnar epithelial stem cells, and uses related thereto
DE102018010282A1 (en) 2018-01-17 2019-07-18 Immatics US, Inc. Method for determining the effectiveness of viral vectors
DE102018100967B4 (en) 2018-01-17 2019-08-14 Immatics US, Inc. METHOD FOR DETERMINING THE EFFECTIVENESS OF VIRAL VECTORS
EP3746569A1 (en) 2018-01-31 2020-12-09 Juno Therapeutics, Inc. Methods and reagents for assessing the presence or absence of replication competent virus
CA3094329A1 (en) 2018-03-19 2020-02-20 Multivir Inc. Methods and compositions comprising tumor suppressor gene therapy and cd122/cd132 agonists for the treatment of cancer
WO2019186274A2 (en) 2018-03-30 2019-10-03 University Of Geneva Micro rna expression constructs and uses thereof
CA3096458A1 (en) 2018-04-12 2019-10-17 Umoja Biopharma, Inc. Viral vectors and packaging cell lines
BR112020023015A2 (en) 2018-05-15 2021-02-17 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
WO2019219979A1 (en) 2018-05-18 2019-11-21 Umc Utrecht Holding B.V. Compositions and methods for cell targeting therapies
US20220403001A1 (en) 2018-06-12 2022-12-22 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
WO2019241685A1 (en) 2018-06-14 2019-12-19 Bluebird Bio, Inc. Cd79a chimeric antigen receptors
WO2019238934A1 (en) 2018-06-15 2019-12-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of the apolipoprotein m for the treatment and diagnosis of insulin resistance
BR112021000145A2 (en) 2018-07-09 2021-04-06 Flagship Pioneering Innovations V, Inc FUSOSOME COMPOSITIONS AND USES OF THE SAME
US20210330788A1 (en) 2018-07-11 2021-10-28 Celgene Corporation Uses of anti-bcma chimeric antigen receptors
CA3106590A1 (en) 2018-07-16 2020-01-23 Baxalta Incorporated Gene therapy of hemophilia a using viral vectors encoding recombinant fviii variants with increased expression
KR20210102870A (en) 2018-08-30 2021-08-20 테나야 테라퓨틱스, 인코포레이티드 Cardiac Cell Reprogramming with Myocardin and ASCL1
WO2020049169A1 (en) 2018-09-06 2020-03-12 Centre Léon-Bérard Herv-k-derived antigens as shared tumor antigens for anti-cancer vaccine
EP3856228B1 (en) 2018-09-27 2023-03-08 Institut National de la Santé et de la Recherche Médicale (INSERM) Tafa4 polypeptide for use for reducing skin inflammation
WO2020072700A1 (en) 2018-10-02 2020-04-09 Dana-Farber Cancer Institute, Inc. Hla single allele lines
WO2020072059A1 (en) 2018-10-04 2020-04-09 Bluebird Bio, Inc. Cblb endonuclease variants, compositions, and methods of use
EP3870600A1 (en) 2018-10-24 2021-09-01 Obsidian Therapeutics, Inc. Er tunable protein regulation
MA54078A (en) 2018-11-01 2021-09-15 Juno Therapeutics Inc METHODS FOR THE TREATMENT WITH CHEMERA ANTIGEN RECEPTORS SPECIFIC FOR B LYMPHOCYTE MATURATION ANTIGEN
SG11202105079QA (en) 2018-11-14 2021-06-29 Flagship Pioneering Innovations V Inc Fusosome compositions for cns delivery
US20230048166A1 (en) 2018-11-14 2023-02-16 Flagship Pioneering Innovations V, Inc. Fusosome compositions for hematopoietic stem cell delivery
WO2020102770A1 (en) 2018-11-16 2020-05-22 Juno Therapeutics, Inc. Methods of dosing engineered t cells for the treatment of b cell malignancies
WO2020106992A1 (en) 2018-11-21 2020-05-28 Umoja Biopharma, Inc. Multicistronic vector for surface engineering lentiviral particles
MX2021005824A (en) 2018-11-26 2021-10-13 UNIV AUTòNOMA DE BARCELONA Fibroblast growth factor 21 (fgf21) gene therapy.
EA202191463A1 (en) 2018-11-28 2021-10-13 Борд Оф Риджентс, Дзе Юниверсити Оф Техас Систем MULTIPLEX EDITING OF THE GENOME OF IMMUNE CELLS TO INCREASE FUNCTIONALITY AND RESISTANCE TO SUPPRESSIVE ENVIRONMENT
CA3121210A1 (en) 2018-11-29 2020-06-04 Board Of Regents, The University Of Texas System Methods for ex vivo expansion of natural killer cells and use thereof
SG11202105502RA (en) 2018-11-30 2021-06-29 Juno Therapeutics Inc Methods for treatment using adoptive cell therapy
PT3886894T (en) 2018-11-30 2024-05-02 Juno Therapeutics Inc Methods for dosing and treatment of b cell malignancies in adoptive cell therapy
US20220056092A1 (en) 2018-12-11 2022-02-24 Obsidian Therapeutics, Inc. Membrane bound il12 compositions and methods for tunable regulation
US20220062394A1 (en) 2018-12-17 2022-03-03 The Broad Institute, Inc. Methods for identifying neoantigens
SG11202106678PA (en) 2018-12-21 2021-07-29 Biontech Us Inc Method and systems for prediction of hla class ii-specific epitopes and characterization of cd4+ t cells
CA3127065A1 (en) 2019-01-16 2020-07-23 Baxalta Incorporated Viral vectors encoding recombinant fviii variants with increased expression for gene therapy of hemophilia a
US11596671B2 (en) 2019-02-01 2023-03-07 Takeda Pharmaceutical Company Limited Gene therapy of hemophilia B using viral vectors encoding recombinant fix variants with increased expression
MX2021010831A (en) 2019-03-08 2021-12-15 Obsidian Therapeutics Inc Cd40l compositions and methods for tunable regulation.
CN113966397A (en) 2019-03-08 2022-01-21 黑曜石疗法公司 Human carbonic anhydrase 2 compositions and methods for tunable modulation
US11090336B2 (en) 2019-03-27 2021-08-17 The Trustees Of The University Of Pennsylvania Tn-MUC1 chimeric antigen receptor (CAR) T cell therapy
SG11202110607WA (en) 2019-04-01 2021-10-28 Tenaya Therapeutics Inc Adeno-associated virus with engineered capsid
EP3966227A1 (en) 2019-05-07 2022-03-16 Voyager Therapeutics, Inc. Compositions and methods for the vectored augmentation of protein destruction, expression and/or regulation
CN113891726A (en) 2019-05-31 2022-01-04 巴塞罗那自治大学 Insulin gene therapy
AU2020287882A1 (en) 2019-06-07 2022-01-20 Juno Therapeutics, Inc. Automated T cell culture
JP2022537670A (en) 2019-06-12 2022-08-29 オブシディアン セラピューティクス, インコーポレイテッド CA2 composition and tunable control methods
WO2020252404A1 (en) 2019-06-12 2020-12-17 Obsidian Therapeutics, Inc. Ca2 compositions and methods for tunable regulation
WO2020252218A1 (en) 2019-06-12 2020-12-17 Juno Therapeutics, Inc. Combination therapy of a cell-mediated cytotoxic therapy and an inhibitor of a prosurvival bcl2 family protein
EP3756680A1 (en) 2019-06-26 2020-12-30 Universitat de Lleida Intermediate filament-derived peptides and their uses
EP3997225A1 (en) 2019-07-10 2022-05-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of epilepsy
EP3997226A1 (en) 2019-07-11 2022-05-18 Tenaya Therapeutics, Inc. Cardiac cell reprogramming with micrornas and other factors
CN114555112A (en) 2019-08-22 2022-05-27 朱诺治疗学股份有限公司 Combination therapy of T cell therapy and ZESTE enhancer homolog 2(EZH2) inhibitors and related methods
WO2021040736A1 (en) 2019-08-30 2021-03-04 Obsidian Therapeutics, Inc. Tandem cd19 car-based compositions and methods for immunotherapy
WO2021041994A2 (en) 2019-08-30 2021-03-04 Juno Therapeutics, Inc. Machine learning methods for classifying cells
EP4025698A1 (en) 2019-09-03 2022-07-13 Sana Biotechnology, Inc. Cd24-associated particles and related methods and uses thereof
US20220348937A1 (en) 2019-09-06 2022-11-03 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
MX2022002747A (en) 2019-09-10 2022-04-06 Obsidian Therapeutics Inc Ca2-il15 fusion proteins for tunable regulation.
WO2021058795A2 (en) 2019-09-27 2021-04-01 Stark Labs Senescent cell-associated antigen-binding domains, antibodies and chimeric antigen receptors comprising the same, and uses thereof
CN114761546A (en) 2019-10-08 2022-07-15 波士顿学院董事会 Proteins containing multiple different unnatural amino acids and methods of making and using such proteins
WO2021076788A2 (en) 2019-10-16 2021-04-22 Umoja Biopharma, Inc. Retroviral vector for univeral receptor therapy
WO2021087305A1 (en) 2019-10-30 2021-05-06 Precision Biosciences, Inc. Cd20 chimeric antigen receptors and methods of use for immunotherapy
CN115087868A (en) 2019-11-05 2022-09-20 朱诺治疗学股份有限公司 Methods of determining attributes of therapeutic T cell compositions
US20210128619A1 (en) 2019-11-05 2021-05-06 Celgene Corporation Uses of anti-bcma chimeric antigen receptors
US20230016983A1 (en) 2019-11-19 2023-01-19 lNSERM (INSTITUT NATIONAL DE LA SANTÉ ET DE LA RECHERCHE MÉDICALE) Antisense oligonucleotides and thier use for the treatment of cancer
WO2021113644A1 (en) 2019-12-05 2021-06-10 Multivir Inc. Combinations comprising a cd8+ t cell enhancer, an immune checkpoint inhibitor and radiotherapy for targeted and abscopal effects for the treatment of cancer
AU2020395318A1 (en) 2019-12-06 2022-06-09 Juno Therapeutics, Inc. Methods related to toxicity and response associated with cell therapy for treating B cell malignancies
CN114981299A (en) 2019-12-12 2022-08-30 武田药品工业株式会社 Gene therapy for hemophilia A using viral vectors encoding recombinant FVIII variants with increased expression
US20230056856A1 (en) 2020-01-08 2023-02-23 Obsidian Therapeutics, Inc. Compositions and methods for tunable regulation of transcription
AU2021209940A1 (en) 2020-01-24 2022-08-04 Juno Therapeutics, Inc. Methods for dosing and treatment of follicular lymphoma and marginal zone lymphoma in adoptive cell therapy
KR20220146480A (en) 2020-01-28 2022-11-01 주노 쎄러퓨티크스 인코퍼레이티드 T cell transduction method
IL295129A (en) 2020-01-30 2022-09-01 Umoja Biopharma Inc Bispecific transduction enhancer
JP2023511762A (en) 2020-02-04 2023-03-22 インサーム(インスティテュ ナシオナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシェ メディカル) Methods and pharmaceutical compositions for the treatment of inflammatory diseases
EP4107173A1 (en) 2020-02-17 2022-12-28 Board of Regents, The University of Texas System Methods for expansion of tumor infiltrating lymphocytes and use thereof
US20210292713A1 (en) 2020-02-28 2021-09-23 Millennium Pharmaceuticals, Inc. Method for producing natural killer cells from pluripotent stem cells
EP4114421A1 (en) 2020-03-02 2023-01-11 Tenaya Therapeutics, Inc. Gene vector control by cardiomyocyte-expressed micrornas
CN115484978A (en) 2020-03-05 2022-12-16 尼奥克斯医疗有限公司 Methods and compositions for treating cancer using immune cells
US20210332448A1 (en) 2020-03-09 2021-10-28 Janssen Pharmaceutica Nv Compositions and methods for quantifying integration of recombinant vector nucleic acid
EP4117716A2 (en) 2020-03-10 2023-01-18 Massachusetts Institute of Technology Methods for generating engineered memory-like nk cells and compositions thereof
WO2021183761A1 (en) 2020-03-11 2021-09-16 The Trustees Of The University Of Pennsylvania Methods and composition for gene delivery using an engineered viral particle
TW202200197A (en) 2020-03-19 2022-01-01 英商崔澤爾有限公司 Temperature-responsive virus storage system
WO2021191871A1 (en) 2020-03-27 2021-09-30 Dcprime B.V. In vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
EP4127139A1 (en) 2020-03-27 2023-02-08 Mendus B.V. Ex vivo use of modified cells of leukemic origin for enhancing the efficacy of adoptive cell therapy
MX2022012191A (en) 2020-03-31 2023-01-05 Sana Biotechnology Inc Targeted lipid particles and compositions and uses thereof.
WO2021198781A2 (en) 2020-04-02 2021-10-07 Takeda Pharmaceutical Company Limited Adamts13 variant, compositions, and uses thereof
KR20230009386A (en) 2020-04-10 2023-01-17 주노 쎄러퓨티크스 인코퍼레이티드 Methods and uses for cell therapy engineered with chimeric antigen receptors targeting B-cell maturation antigens
JP2023520927A (en) 2020-04-10 2023-05-22 ソラ・バイオサイエンシズ・エルエルシー Compositions and methods for treatment of protein aggregation disorders
WO2021222133A1 (en) 2020-04-27 2021-11-04 Juno Therapeutics, Inc. Stabilization of polyethyleneimine-deoxyribonucleic acid complex size and activity
WO2021222168A2 (en) 2020-04-28 2021-11-04 Sola Biosciences Llc Compositions and methods for the treatment of tdp-43 proteinopathies
CN115803824A (en) 2020-05-13 2023-03-14 朱诺治疗学股份有限公司 Methods of identifying characteristics associated with clinical response and uses thereof
US20230190871A1 (en) 2020-05-20 2023-06-22 Sana Biotechnology, Inc. Methods and compositions for treatment of viral infections
CN115916985A (en) 2020-05-26 2023-04-04 巴塞罗那自治大学 Fibroblast growth factor 21 (FGF 21) gene therapy for central nervous system disorders
JP2023537558A (en) 2020-05-27 2023-09-04 アンチオン バイオサイエンシーズ エスアー Adapter molecules for redirecting CAR T cells to antigens of interest
JP2023536210A (en) 2020-05-29 2023-08-24 フジフィルム セルラー ダイナミクス,インコーポレイテッド Retinal pigment epithelium and photoreceptor bilayer and uses thereof
AU2021280343A1 (en) 2020-05-29 2022-12-08 FUJIFILM Cellular Dynamics, Inc. Retinal pigmented epithelium and photoreceptor dual cell aggregates and methods of use thereof
JP2023529371A (en) 2020-06-05 2023-07-10 ソラ・バイオサイエンシズ・エルエルシー Compositions and methods for the treatment of synucleinopathies
EP4153636A1 (en) 2020-06-29 2023-03-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Anti-protein s single-domain antibodies and polypeptides comprising thereof
CN116113697A (en) 2020-07-10 2023-05-12 国家健康与医学研究院 Methods and compositions for treating epilepsy
EP4182339A1 (en) 2020-07-16 2023-05-24 Umoja Biopharma, Inc. Gated adapter targeting receptor
WO2022035793A1 (en) 2020-08-10 2022-02-17 Precision Biosciences, Inc. Antibodies and fragments specific for b-cell maturation antigen and uses thereof
WO2022036068A1 (en) 2020-08-13 2022-02-17 A2 Biotherapeutics, Inc. Gene fusions for control of genetically modified cells
WO2022047316A1 (en) 2020-08-28 2022-03-03 Sana Biotechnology, Inc. Modified anti-viral binding agents
GB202013940D0 (en) 2020-09-04 2020-10-21 Synpromics Ltd Regulatory nucleic acid sequences
WO2022060806A1 (en) 2020-09-16 2022-03-24 Obsidian Therapeutics, Inc. Compositions and methods for expression of anti-bcma chimeric antigen receptors with small molecule-regulated il15 in t cells
IL301955A (en) 2020-10-07 2023-06-01 Asklepios Biopharmaceutical Inc Therapeutic adeno-associated virus delivery of fukutin related protein (fkrp) for treating dystroglycanopathy. disorders including limb girdle 21
US11781156B2 (en) 2020-10-09 2023-10-10 Tenaya Therapeutics, Inc. Plakophillin-2 gene therapy methods and compositions
CA3199433A1 (en) 2020-10-26 2022-05-05 Sola Biosciences Llc Compositions and methods for the treatment of alzheimer's disease
EP4241278A2 (en) 2020-11-04 2023-09-13 Celgene Corporation Car t cell therapy in patients who have had prior anti-cancer alkylator therapy
AU2021375493A1 (en) 2020-11-05 2023-06-29 Mendus B.V. Use of tumor-independent antigens in immunotherapies
WO2022104109A1 (en) 2020-11-13 2022-05-19 Catamaran Bio, Inc. Genetically modified natural killer cells and methods of use thereof
US20220162288A1 (en) 2020-11-25 2022-05-26 Catamaran Bio, Inc. Cellular therapeutics engineered with signal modulators and methods of use thereof
JP2023552773A (en) 2020-12-04 2023-12-19 セルジーン コーポレーション Use of chimeric antigen receptor (CAR) T cell therapy in combination with inhibitors of inflammation-related soluble factors
US20240018487A1 (en) 2020-12-10 2024-01-18 Sarepta Therapeutics, Inc. Suspension mode seed train development for adherent cells
AU2021400424A1 (en) 2020-12-14 2023-07-06 Biontech Us Inc. Tissue-specific antigens for cancer immunotherapy
WO2022133030A1 (en) 2020-12-16 2022-06-23 Juno Therapeutics, Inc. Combination therapy of a cell therapy and a bcl2 inhibitor
CA3204161A1 (en) 2021-01-11 2022-07-14 Jagesh Vijaykumar SHAH Use of cd8-targeted viral vectors
CA3206009A1 (en) 2021-01-27 2022-08-04 Umoja Biopharma, Inc. Lentivirus for generating cells expressing anti-cd19 chimeric antigen receptor
EP4284440A1 (en) 2021-01-30 2023-12-06 Universitat Autònoma De Barcelona Gene therapy for monogenic diabetes
JP2024510989A (en) 2021-03-12 2024-03-12 メンドゥス・ベスローテン・フェンノートシャップ Vaccination methods and use of CD47 blockers
CA3212615A1 (en) 2021-03-19 2022-09-22 Glaxosmithkline Intellectual Property Development Limited Chimeric antigen receptors targeting claudin-3 and methods for treating cancer
EP4314280A1 (en) 2021-03-22 2024-02-07 Juno Therapeutics, Inc. Method to assess potency of viral vector particles
JP2024511418A (en) 2021-03-22 2024-03-13 ジュノー セラピューティクス インコーポレイテッド Methods for determining efficacy of therapeutic cell compositions
KR20240005700A (en) 2021-03-29 2024-01-12 주노 쎄러퓨티크스 인코퍼레이티드 Dosing and Treatment Methods Using Combination of Checkpoint Inhibitor Therapy and CAR T Cell Therapy
WO2022221462A1 (en) 2021-04-13 2022-10-20 Kriya Therapeutics, Inc. Vector constructs for delivery of nucleic acids encoding therapeutic vlcad or mcad and methods of using the same
AU2022257093A1 (en) 2021-04-16 2023-11-02 Celgene Corporation T cell therapy in patients who have had prior stem cell transplant
JP2024519218A (en) 2021-05-03 2024-05-09 アステラス インスティテュート フォー リジェネレイティブ メディシン Method for producing mature corneal endothelial cells
WO2022235929A1 (en) 2021-05-05 2022-11-10 Radius Pharmaceuticals, Inc. Animal model having homologous recombination of mouse pth1 receptor
WO2022235940A1 (en) 2021-05-06 2022-11-10 Dana-Farber Cancer Institute, Inc. Antibodies against alk and methods of use thereof
MX2023013186A (en) 2021-05-07 2023-12-06 Astellas Inst For Regenerative Medicine Methods of generating mature hepatocytes.
EP4089171A1 (en) 2021-05-12 2022-11-16 Fundación del Sector Público Estatal Centro Nacional de Investigaciones Oncológicas Carlos III (F.S.P. CNIO) Recombinant tert-encoding viral genomes and vectors
WO2022248615A2 (en) 2021-05-26 2022-12-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Hexokinase-derived peptides and therapeutical uses thereof
US20220389436A1 (en) 2021-05-26 2022-12-08 FUJIFILM Cellular Dynamics, Inc. Methods to prevent rapid silencing of genes in pluripotent stem cells
AU2022280957A1 (en) 2021-05-28 2023-11-30 Sana Biotechnology, Inc. Lipid particles containing a truncated baboon endogenous retrovirus (baev) envelope glycoprotein and related methods and uses
WO2022258606A1 (en) 2021-06-07 2022-12-15 Gadeta B.V. Delta T-cell or Gamma T-cell receptor chains or parts thereof that mediate an anti-tumour or anti-infective response
EP4355765A2 (en) 2021-06-14 2024-04-24 Institut National de la Santé et de la Recherche Médicale (INSERM) Mutated annexin a5 polypeptides and uses thereof for therapeutic purposes
JP2024527252A (en) 2021-06-14 2024-07-24 武田薬品工業株式会社 Gene therapy for hemophilia A using viral vectors encoding recombinant FVIII variants with increased expression
JP2024523332A (en) 2021-06-15 2024-06-28 武田薬品工業株式会社 Methods for producing natural killer cells from pluripotent stem cells - Patents.com
KR20240051112A (en) 2021-07-01 2024-04-19 인답타 세라뷰틱스 인코포레이티드 Engineered Natural Killer (NK) Cells and Related Methods
AU2022310862A1 (en) 2021-07-14 2024-02-01 Regeneron Pharmaceuticals, Inc. Engineered t cell receptors fused to binding domains from antibodies
AU2022312170A1 (en) 2021-07-16 2024-02-08 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Oligonucleotide for inhibiting quaking activity
WO2023014922A1 (en) 2021-08-04 2023-02-09 The Regents Of The University Of Colorado, A Body Corporate Lat activating chimeric antigen receptor t cells and methods of use thereof
JP2024528981A (en) 2021-08-04 2024-08-01 サナ バイオテクノロジー,インコーポレイテッド Use of CD4-targeted viral vectors
AU2022324621A1 (en) 2021-08-06 2024-01-18 Celgene Corporation Compositions and methods for selective degradation of engineered proteins
AU2022325232A1 (en) 2021-08-11 2024-02-08 Sana Biotechnology, Inc. Genetically modified primary cells for allogeneic cell therapy
WO2023019227A1 (en) 2021-08-11 2023-02-16 Sana Biotechnology, Inc. Genetically modified cells for allogeneic cell therapy to reduce complement-mediated inflammatory reactions
AU2022325955A1 (en) 2021-08-11 2024-02-08 Sana Biotechnology, Inc. Genetically modified cells for allogeneic cell therapy to reduce instant blood mediated inflammatory reactions
JP2024534772A (en) 2021-08-11 2024-09-26 サナ バイオテクノロジー,インコーポレイテッド Genetically modified cells for allogeneic cell therapy
CA3229526A1 (en) 2021-08-16 2023-02-23 Hemogenyx Pharmaceuticals Llc Anti-flt3 antibodies, cars, car t cells and methods of use
EP4413023A1 (en) 2021-10-08 2024-08-14 SOLA Biosciences LLC Compositions and methods for the treatment of p53-mediated cancers
EP4413024A2 (en) 2021-10-08 2024-08-14 SOLA Biosciences LLC Compositions and methods for the treatment of proteopathies
WO2023077107A1 (en) 2021-10-29 2023-05-04 Sana Biotechnology, Inc. Methods and reagents for amplifying viral vector nucleic acid products
WO2023091954A2 (en) 2021-11-19 2023-05-25 The Trustees Of The University Of Pennsylvania Engineered pan-leukocyte antigen cd45 to facilitate car t cell therapy
WO2023114949A1 (en) 2021-12-16 2023-06-22 Sana Biotechnology, Inc. Methods and systems of particle production
EP4448549A2 (en) 2021-12-17 2024-10-23 Sana Biotechnology, Inc. Modified paramyxoviridae fusion glycoproteins
WO2023115041A1 (en) 2021-12-17 2023-06-22 Sana Biotechnology, Inc. Modified paramyxoviridae attachment glycoproteins
WO2023114543A2 (en) 2021-12-17 2023-06-22 Dana-Farber Cancer Institute, Inc. Platform for antibody discovery
KR20240133796A (en) 2021-12-17 2024-09-04 우모자 바이오파마 인코포레이티드 Cytotoxic innate lymphoid cells and uses thereof
CA3241395A1 (en) 2021-12-17 2023-06-22 Barbel SCHROFELBAUER Antibodies and uses thereof
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
WO2023147515A1 (en) 2022-01-28 2023-08-03 Juno Therapeutics, Inc. Methods of manufacturing cellular compositions
WO2023150518A1 (en) 2022-02-01 2023-08-10 Sana Biotechnology, Inc. Cd3-targeted lentiviral vectors and uses thereof
WO2023150647A1 (en) 2022-02-02 2023-08-10 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
AU2023220128A1 (en) 2022-02-17 2024-08-22 Sana Biotechnology, Inc. Engineered cd47 proteins and uses thereof
WO2023172514A1 (en) 2022-03-07 2023-09-14 Catamaran Bio, Inc. Engineered immune cell therapeutics targeted to her2 and methods of use thereof
AU2023232045A1 (en) 2022-03-09 2024-09-26 Dana-Farber Cancer Institute, Inc. Genetically engineered b cells and methods of use thereof
WO2023173123A1 (en) 2022-03-11 2023-09-14 Sana Biotechnology, Inc. Genetically modified cells and compositions and uses thereof
AU2023236826A1 (en) 2022-03-18 2024-09-26 The Regents Of The University Of Colorado, A Body Corporate Genetically engineered t-cell co-receptors and methods of use thereof
WO2023193015A1 (en) 2022-04-01 2023-10-05 Sana Biotechnology, Inc. Cytokine receptor agonist and viral vector combination therapies
WO2023196997A2 (en) 2022-04-08 2023-10-12 2Seventy Bio, Inc. Multipartite receptor and signaling complexes
WO2023212683A1 (en) 2022-04-29 2023-11-02 Kriya Therapeutics, Inc. Insulin and glucokinase gene therapy compositions and its use for treating diabetes
GB202206507D0 (en) 2022-05-04 2022-06-15 Antion Biosciences Sa Expression construct
WO2023220641A2 (en) 2022-05-11 2023-11-16 Juno Therapeutics, Inc. Methods and uses related to t cell therapy and production of same
US20240002800A1 (en) 2022-05-16 2024-01-04 Mendus B.V. Use of leukemia-derived cells for enhancing natural killer (nk) cell therapy
WO2023225569A1 (en) 2022-05-17 2023-11-23 Umoja Biopharma, Inc. Manufacturing viral particles
WO2023225160A1 (en) 2022-05-18 2023-11-23 The Children's Hospital Of Philadelphia Compositions and methods for inducible alternative splicing regulation of gene expression
WO2023227594A1 (en) 2022-05-24 2023-11-30 Gadeta Bv Novel deltat-cell receptor chains, gammat-cell receptor chains, or parts thereof
WO2023230548A1 (en) 2022-05-25 2023-11-30 Celgene Corporation Method for predicting response to a t cell therapy
WO2023230512A1 (en) 2022-05-26 2023-11-30 2Seventy Bio, Inc. Compositions for maintaining lentiviral vector and uses thereof
WO2023237541A1 (en) 2022-06-07 2023-12-14 Gadeta B.V. Delta t-cell or gamma t-cell receptor chains or parts thereof that mediate an anti-tumour or anti-infective response
WO2023237663A1 (en) 2022-06-09 2023-12-14 Institut National de la Santé et de la Recherche Médicale Use of the f359l missense irf4 variant for increasing the stability of regulatory t cells
WO2023240282A1 (en) 2022-06-10 2023-12-14 Umoja Biopharma, Inc. Engineered stem cells and uses thereof
WO2023250400A1 (en) 2022-06-22 2023-12-28 Juno Therapeutics, Inc. Treatment methods for second line therapy of cd19-targeted car t cells
US20240003871A1 (en) 2022-06-29 2024-01-04 FUJIFILM Cellular Dynamics, Inc. Ipsc-derived astrocytes and methods of use thereof
WO2024007020A1 (en) 2022-06-30 2024-01-04 Indapta Therapeutics, Inc. Combination of engineered natural killer (nk) cells and antibody therapy and related methods
WO2024015892A1 (en) 2022-07-13 2024-01-18 The Broad Institute, Inc. Hla-ii immunopeptidome methods and systems for antigen discovery
WO2024013401A1 (en) 2022-07-15 2024-01-18 Gadeta B.V. Novel method for identifying gamma t-cell (or delta t-cell) receptor chains (or gammadelta t-cell receptors) or fragments thereof that mediate an anti-tumour or an anti-infective response
WO2024017990A1 (en) 2022-07-21 2024-01-25 Institut National de la Santé et de la Recherche Médicale Methods and compositions for treating chronic pain disorders
WO2024018003A1 (en) 2022-07-21 2024-01-25 Institut National de la Santé et de la Recherche Médicale Extracellular vesicles functionalized with an erv syncitin and uses thereof for cargo delivery
WO2024026377A1 (en) 2022-07-27 2024-02-01 Sana Biotechnology, Inc. Methods of transduction using a viral vector and inhibitors of antiviral restriction factors
WO2024031060A1 (en) 2022-08-04 2024-02-08 Elevatebio Technologies, Inc. Lentiviral vectors and uses thereof
TW202416993A (en) 2022-08-15 2024-05-01 瑞士商赫孚孟拉羅股份公司 Prevention or mitigation of adverse effects related to recombinant viral vectors
WO2024044655A1 (en) 2022-08-24 2024-02-29 Sana Biotechnology, Inc. Delivery of heterologous proteins
WO2024047110A1 (en) 2022-08-31 2024-03-07 Institut National de la Santé et de la Recherche Médicale Method to generate more efficient car-t cells
WO2024052318A1 (en) 2022-09-06 2024-03-14 Institut National de la Santé et de la Recherche Médicale Novel dual split car-t cells for the treatment of cd38-positive hematological malignancies
WO2024052413A1 (en) 2022-09-07 2024-03-14 Universitat Autònoma De Barcelona Beta-hexosaminidase vectors
WO2024064838A1 (en) 2022-09-21 2024-03-28 Sana Biotechnology, Inc. Lipid particles comprising variant paramyxovirus attachment glycoproteins and uses thereof
WO2024081820A1 (en) 2022-10-13 2024-04-18 Sana Biotechnology, Inc. Viral particles targeting hematopoietic stem cells
WO2024097992A2 (en) 2022-11-04 2024-05-10 Umoja Biopharma, Inc. Particles displaying adhesion-molecule fusions
WO2024098038A2 (en) 2022-11-04 2024-05-10 Umoja Biopharma, Inc. Polynucleotide construct and related viral vectors and methods
WO2024098028A2 (en) 2022-11-04 2024-05-10 Umoja Biopharma, Inc. Lentiviral particles displaying fusion molecules and uses thereof
WO2024100136A1 (en) 2022-11-08 2024-05-16 Gadeta B.V. Novel method for obtaining gamma t-cell (or delta t-cell) receptor chains (or gamma delta t-cell receptors) or fragments thereof that mediate an anti-tumour or an anti-infective response
WO2024119157A1 (en) 2022-12-02 2024-06-06 Sana Biotechnology, Inc. Lipid particles with cofusogens and methods of producing and using the same
WO2024129696A1 (en) 2022-12-12 2024-06-20 Retromer Therapeutics Corp. Aav and lentiviral constructs comprising a sorl1 mini-gene for use in treating neurodegenerative diseases
WO2024146935A1 (en) 2023-01-06 2024-07-11 Institut National de la Santé et de la Recherche Médicale Intravenous administration of antisense oligonucleotides for the treatment of pain
WO2024151541A1 (en) 2023-01-09 2024-07-18 Sana Biotechnology, Inc. Type-1 diabetes autoimmune mouse
WO2024170500A1 (en) 2023-02-13 2024-08-22 Institut National de la Santé et de la Recherche Médicale Methods of treating iron deficiency-related diseases
WO2024178386A1 (en) 2023-02-24 2024-08-29 Aarhus Universitet Methods of treating endosomal trafficking diseases
US20240342313A1 (en) 2023-03-30 2024-10-17 Pharma Cinq, Llc Vector encoding rod-derived cone viability factor and human igk signal sequence
WO2024209036A1 (en) 2023-04-07 2024-10-10 Institut National de la Santé et de la Recherche Médicale Generating highly pure glutamatergic neuronal populations using the pro-neural factor ascl1

Family Cites Families (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5716826A (en) 1988-03-21 1998-02-10 Chiron Viagene, Inc. Recombinant retroviruses
FR2629469B1 (en) 1988-03-31 1990-12-21 Pasteur Institut DEFECTIVE RECOMBINANT RETROVIRUS, ITS APPLICATION TO THE INTEGRATION OF CODING SEQUENCES FOR PROTEINS DETERMINED IN THE GENOME OF CORRESPONDING WILD RETROVIRUS INFECTIOUS CELLS AND RECOMBINANT DNA FOR THE PRODUCTION OF THIS RECOMBINANT RETROVIRUS
US5614404A (en) 1988-06-10 1997-03-25 Theriod Biologics, Incorporated Self-assembled, defective, non-self-propagating lentivirus particles
US5665577A (en) 1989-02-06 1997-09-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
WO1991000047A1 (en) 1989-06-30 1991-01-10 The Regents Of The University Of California Retrovirus detection
EP1262554A3 (en) 1992-02-28 2007-08-29 Syngenix Limited Defective packaging non-oncoviral vectors based on mpmv and hiv
US5834256A (en) 1993-06-11 1998-11-10 Cell Genesys, Inc. Method for production of high titer virus and high efficiency retroviral mediated transduction of mammalian cells
US6051427A (en) * 1993-06-11 2000-04-18 Cell Genesys, Inc. Method for production of high titer virus and high efficiency retroviral mediated transduction of mammalian cells
US5589362A (en) 1993-06-14 1996-12-31 Basf Aktiengesellschaft Tetracycline regulated transcriptional modulators with altered DNA binding specificities
US5591579A (en) 1993-12-21 1997-01-07 Washington University Indicator cell line for detecting RNA viruses and method therefor
US5739118A (en) 1994-04-01 1998-04-14 Apollon, Inc. Compositions and methods for delivery of genetic material
AU2419595A (en) 1994-05-10 1995-11-29 Hisamitsu Pharmaceutical Co., Inc. Recombinant human immunodeficiency virus vector and process for producing the same
WO1995032300A1 (en) * 1994-05-23 1995-11-30 University Of Medicine & Dentistry Of New Jersey Selective biological destruction of tumor cells
US5693508A (en) * 1994-11-08 1997-12-02 Chang; Lung-Ji Retroviral expression vectors containing MoMLV/CMV-IE/HIV-TAR chimeric long terminal repeats
US5681746A (en) 1994-12-30 1997-10-28 Chiron Viagene, Inc. Retroviral delivery of full length factor VIII
US5650309A (en) 1995-05-16 1997-07-22 The Regents Of The University Of California Viral vectors
GB9510272D0 (en) 1995-05-22 1995-07-19 Isis Innovation Retroviral vectors
US6013516A (en) 1995-10-06 2000-01-11 The Salk Institute For Biological Studies Vector and method of use for nucleic acid delivery to non-dividing cells
AU1123497A (en) * 1995-11-28 1997-06-19 Clinical Technologies, Inc. Recombinant hiv and modified packaging cells and method for treating acquired immune deficiency syndrome
US5750383A (en) 1996-05-14 1998-05-12 Boyce Thompson Institute For Plant Research, Inc. Baculovirus cloning system
JP2001501815A (en) 1996-09-17 2001-02-13 ザ ソールク インスチチュート フォア バイオロジカル スタディズ Retroviral vector capable of transducing non-dividing cells
GB9621680D0 (en) * 1996-10-17 1996-12-11 Oxford Biomedica Ltd Lentiviral vectors
PT904392E (en) * 1996-10-17 2001-06-29 Oxford Biomedica Ltd RETROVIRAL VECTORS
US6207455B1 (en) 1997-05-01 2001-03-27 Lung-Ji Chang Lentiviral vectors
AU8576298A (en) 1997-07-18 1999-02-10 Chiron Corporation Lentiviral vectors
US5994136A (en) * 1997-12-12 1999-11-30 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
CA2318575A1 (en) 1998-01-16 1999-07-22 Chiron Corporation Feline immunodeficiency virus gene therapy vectors
EP0949332A3 (en) * 1998-04-01 2001-03-28 Smithkline Beecham Plc HSSCRG1 polypeptides
US6365150B1 (en) * 1998-05-13 2002-04-02 Genetix Pharmaceuticals, Inc. Lentiviral packaging cells
EP1849873B1 (en) 1999-04-29 2011-10-12 Gbp Ip, Llc Method and means for producing high titer, safe, recombinant lentivirus vectors

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BLOMER U, ET AL.: "HIGHLY EFFICIENT AND SUSTAINED GENE TRANSFER IN ADULT NEURONS WITH A LENTIVIRUS VECTOR", JOURNAL OF VIROLOGY., THE AMERICAN SOCIETY FOR MICROBIOLOGY., US, vol. 71, no. 09, 1 September 1997 (1997-09-01), US, pages 6641 - 6649, XP002917174, ISSN: 0022-538X *
ELDER J H, PHILLIPS T R: "FELINE IMMUNODEFICIENCY VIRUS AS A MODEL FOR DEVELOPMENT OF MOLECULAR APPROCHES TO INTERVENTION STRATEGIES AGAINST LENTIVIRUS INFECTIONS", ADVANCES IN VIRUS RESEARCH., SAN DIEGO, CA., US, vol. 45, 1 January 1900 (1900-01-01), US, pages 225 - 247, XP002917175 *
NALDINI L, ET AL.: "EFFICIENT TRANSFER, INTEGRATION, AND SUSTAINED LONG-TERM EXPRESSIONOF THE TRANSGENE IN ADULT RAT BRAINS INJECTED WITH A LENTIVIRAL VECTOR", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 93, 1 October 1996 (1996-10-01), US, pages 11382 - 11388, XP002917173, ISSN: 0027-8424, DOI: 10.1073/pnas.93.21.11382 *
NALDINI L, ET AL.: "IN VIVO GENE DELIVERY AND STABLE TRANSDUCTION OF NONDIVIDING CELLS BY A LENTIVIRAL VECTOR", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 272, 12 April 1996 (1996-04-12), US, pages 263 - 267, XP002917172, ISSN: 0036-8075, DOI: 10.1126/science.272.5259.263 *
See also references of EP1036182A4 *

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8846385B2 (en) 1997-12-12 2014-09-30 Gbp Ip, Llc Method and means for producing high titer, safe recombinant lentivirus vectors
US8652837B2 (en) 1999-04-29 2014-02-18 Gbp Ip, Llc Method and means for producing high titer, safe, recombinant lentivirus vectors
EP1849873A1 (en) * 1999-04-29 2007-10-31 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
EP1171624A1 (en) * 1999-04-29 2002-01-16 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
EP1171624A4 (en) * 1999-04-29 2002-06-26 Cell Genesys Inc Method and means for producing high titer, safe, recombinant lentivirus vectors
US7250299B1 (en) 1999-04-29 2007-07-31 Cell Genesys, Inc. Method and means for producing high titer, safe, recombinant lentivirus vectors
JP4979851B2 (en) * 1999-04-29 2012-07-18 ジービーピー アイピー リミテッド ライアビリティ カンパニー High titer and safe production method
US6979568B1 (en) 1999-06-22 2005-12-27 Dnavec Research, Inc. Vector for the expression of two foreign genes
WO2000078987A1 (en) * 1999-06-22 2000-12-28 Dnavec Research Inc. Vector for expressing two foreign genes
EP1964573A2 (en) 1999-10-22 2008-09-03 Aventis Pasteur Limited Method of inducing and/or enhancing an immune response to tumor antigens
EP1741782A2 (en) 2000-05-10 2007-01-10 Sanofi Pasteur Limited Immunogenic polypeptides encoded by MAGE minigenes and uses thereof
WO2001091801A3 (en) * 2000-05-26 2003-02-06 Chiron Corp Methods of transducing neural cells using lentivirus vectors
WO2001091801A2 (en) * 2000-05-26 2001-12-06 Chiron Corporation Methods of transducing neural cells using lentivirus vectors
US6712612B1 (en) 2000-12-12 2004-03-30 Genecure Llc Safe and stable retroviral helper cell line and related compositions and methods
WO2002049422A3 (en) * 2000-12-20 2002-11-14 Leuven K U Res & Dev Non-human animal disease models
WO2002049422A2 (en) * 2000-12-20 2002-06-27 K.U. Leuven Research And Development Non-human animal disease models
US7745179B2 (en) 2001-05-14 2010-06-29 Gbp Ip, Llc Lentiviral vectors featuring liver specific transcriptional enhancer and methods of using same
US6808905B2 (en) 2001-05-14 2004-10-26 Cell Genesys, Inc. Lentiviral vectors encoding clotting factors for gene therapy
US7179903B2 (en) 2001-05-14 2007-02-20 Cell Genesys, Inc Liver specific transcriptional enhancer
WO2006010834A1 (en) 2004-06-25 2006-02-02 Centre National De La Recherche Scientifique Non-integrative and non-replicative lentivirus, preparation and uses thereof
US9593340B2 (en) 2007-10-15 2017-03-14 Admedus Vaccines Pty Ltd. Expression system for modulating an immune response
US9795658B2 (en) 2010-04-20 2017-10-24 Admedus Vaccines Pty Ltd Expression system for modulating an immune response
US11787851B2 (en) 2013-02-15 2023-10-17 Bioverativ Therapeutics Inc. Optimized factor VIII gene
US11008561B2 (en) 2014-06-30 2021-05-18 Bioverativ Therapeutics Inc. Optimized factor IX gene
WO2017096432A1 (en) 2015-12-09 2017-06-15 Admedus Vaccines Pty Ltd Immunomodulating composition for treatment
WO2017136358A1 (en) 2016-02-01 2017-08-10 Bioverativ Therapeutics Inc. Optimized factor viii genes
US11753461B2 (en) 2016-02-01 2023-09-12 Bioverativ Therapeutics Inc. Optimized factor VIII genes
EP4137570A1 (en) 2016-02-01 2023-02-22 Bioverativ Therapeutics Inc. Optimized factor viii genes
US11446398B2 (en) 2016-04-11 2022-09-20 Obsidian Therapeutics, Inc. Regulated biocircuit systems
US11285191B2 (en) 2016-07-26 2022-03-29 The Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Immunostimulatory compositions and uses therefor
WO2018071676A1 (en) 2016-10-12 2018-04-19 Bioverativ Usa Inc. Anti-c1s antibodies and methods of use thereof
US11332521B2 (en) 2016-11-07 2022-05-17 Neuracle Science Co., Ltd. Anti-family with sequence similarity 19, member A5 antibodies and method of use thereof
WO2018083538A1 (en) 2016-11-07 2018-05-11 Neuracle Scienc3 Co., Ltd. Anti-family with sequence similarity 19, member a5 antibodies and method of use thereof
US11746149B2 (en) 2017-06-27 2023-09-05 Neuracle Science Co., Ltd. Use of anti-family with sequence similarity 19, member A5 antibodies for the treatment of glaucoma
US11155613B2 (en) 2017-06-27 2021-10-26 Neuracle Science Co., Ltd. Use of anti-FAM19A5 antibodies for treating fibrosis
US11618783B2 (en) 2017-06-27 2023-04-04 Neuracle Science Co., Ltd. Anti-FAM19A5 antibodies and uses thereof
US11560425B2 (en) 2017-06-27 2023-01-24 Neuracle Science Co., Ltd. Use of anti-FAM19A5 antibodies for treating cancers
US12077579B2 (en) 2017-06-27 2024-09-03 Neuracle Science Co., Ltd. Use of anti-FAM19A5 antibodies for treating fibrosis
WO2019075220A1 (en) 2017-10-11 2019-04-18 Bioverativ Usa Inc. Methods of inducing complement activity
WO2019152692A1 (en) 2018-02-01 2019-08-08 Bioverativ Therapeutics, Inc. Use of lentiviral vectors expressing factor viii
US11634484B2 (en) 2018-04-24 2023-04-25 Neuracle Science Co., Ltd. Use of anti-family with sequence similarity 19, member A5 antibodies for the treatment of neuropathic pain
US11970532B2 (en) 2018-05-10 2024-04-30 Neuracle Science Co., Ltd. Anti-family with sequence similarity 19, member A5 antibodies and method of use thereof
US11884729B2 (en) 2018-06-29 2024-01-30 ApitBio, Inc Anti-L1CAM antibodies and uses thereof
WO2020102728A1 (en) 2018-11-16 2020-05-22 Neoimmunetech, Inc. Method of treating a tumor with a combination of il-7 protein and an immune checkpoint inhibitor
WO2020118069A2 (en) 2018-12-06 2020-06-11 Bioverativ Therapeutics Inc. Use of lentiviral vectors expressing factor ix
WO2020123377A1 (en) 2018-12-10 2020-06-18 Neoimmunetech, Inc. Nrf-2 deficient cells and uses thereof
WO2021067389A1 (en) 2019-09-30 2021-04-08 Bioverativ Therapeutics Inc. Lentiviral vector formulations
WO2021146191A1 (en) 2020-01-13 2021-07-22 Neoimmunetech, Inc. Method of treating a tumor with a combination of il-7 protein and a bispecific antibody
WO2021151001A1 (en) 2020-01-22 2021-07-29 Outpace Bio, Inc. Chimeric polypeptides
WO2021151006A2 (en) 2020-01-22 2021-07-29 Outpace Bio, Inc. Chimeric polypeptides
WO2021158783A1 (en) 2020-02-05 2021-08-12 Washington University Method of treating a solid tumor with a combination of an il-7 protein and car-bearing immune cells
WO2021262963A1 (en) 2020-06-24 2021-12-30 Bioverativ Therapeutics Inc. Methods for the removal of free factor viii from preparations of lentiviral vectors modified to express said protein
WO2022087453A1 (en) 2020-10-22 2022-04-28 Lyell Immunopharma, Inc. Chimeric activation receptors
WO2022093718A1 (en) 2020-10-26 2022-05-05 Neoimmunetech, Inc. Methods of inducing stem cell mobilization
WO2022094475A1 (en) 2020-11-02 2022-05-05 Neoimmunetech, Inc. Use of interleukin-7 for the treatment of coronavirus
WO2022099022A1 (en) 2020-11-05 2022-05-12 Neoimmunetech, Inc. Method of treating a tumor with a combination of an il-7 protein and a nucleotide vaccine
WO2022251644A1 (en) 2021-05-28 2022-12-01 Lyell Immunopharma, Inc. Nr4a3-deficient immune cells and uses thereof
WO2022256437A1 (en) 2021-06-02 2022-12-08 Lyell Immunopharma, Inc. Nr4a3-deficient immune cells and uses thereof
WO2023056331A1 (en) 2021-09-30 2023-04-06 Bioverativ Therapeutics Inc. Nucleic acids encoding factor viii polypeptides with reduced immunogenicity
WO2023081923A1 (en) 2021-11-08 2023-05-11 Frequency Therapeutics, Inc. Platelet-derived growth factor receptor (pdgfr) alpha inhibitors and uses thereof
WO2023130081A1 (en) 2021-12-30 2023-07-06 Neoimmunetech, Inc. Method of treating a tumor with a combination of il-7 protein and vegf antagonist
WO2024026490A1 (en) 2022-07-28 2024-02-01 Sqz Biotechnologies Company Polynucleotides encoding linked antigens and uses thereof
WO2024102722A1 (en) 2022-11-07 2024-05-16 Neoimmunetech, Inc. Methods of treating a tumor with an unmethylated mgmt promoter

Also Published As

Publication number Publication date
US6428953B1 (en) 2002-08-06
US7083981B2 (en) 2006-08-01
EP1036182A4 (en) 2004-10-06
DE69838758T2 (en) 2008-10-30
CA2314609C (en) 2014-07-08
US6165782A (en) 2000-12-26
KR20010033064A (en) 2001-04-25
JP2010227122A (en) 2010-10-14
JP2002508184A (en) 2002-03-19
EP1036182B1 (en) 2007-11-21
US8846385B2 (en) 2014-09-30
AU751985B2 (en) 2002-09-05
DE69838758D1 (en) 2008-01-03
JP4640742B2 (en) 2011-03-02
EP1036182A1 (en) 2000-09-20
US5994136A (en) 1999-11-30
US20050255597A1 (en) 2005-11-17
US6924144B2 (en) 2005-08-02
US20080286836A1 (en) 2008-11-20
AU1803499A (en) 1999-07-05
US20020173030A1 (en) 2002-11-21
WO1999031251A9 (en) 1999-10-07
CA2314609A1 (en) 1999-06-24

Similar Documents

Publication Publication Date Title
US8846385B2 (en) Method and means for producing high titer, safe recombinant lentivirus vectors
US8652837B2 (en) Method and means for producing high titer, safe, recombinant lentivirus vectors
US7311907B2 (en) Lentiviral packaging cells
US10450574B2 (en) Transient transfection method for retroviral production
JPH11512615A (en) Vectors and methods of use for delivering nucleic acids to non-dividing cells
Barker et al. Vectors derived from the human immunodeficiency virus, HIV-1

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: C2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1-28, DESCRIPTION, REPLACED BY NEW PAGES 1-28; PAGES 29-31, CLAIMS, REPLACED BY NEW PAGES 29-31

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 18034/99

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2314609

Country of ref document: CA

Ref country code: JP

Ref document number: 2000 539150

Kind code of ref document: A

Format of ref document f/p: F

Ref country code: CA

Ref document number: 2314609

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1020007006425

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1998962894

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1998962894

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1020007006425

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 18034/99

Country of ref document: AU

WWW Wipo information: withdrawn in national office

Ref document number: 1020007006425

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 1998962894

Country of ref document: EP