WO1998053086A1 - Sucrose-binding proteins - Google Patents
Sucrose-binding proteins Download PDFInfo
- Publication number
- WO1998053086A1 WO1998053086A1 PCT/US1998/010465 US9810465W WO9853086A1 WO 1998053086 A1 WO1998053086 A1 WO 1998053086A1 US 9810465 W US9810465 W US 9810465W WO 9853086 A1 WO9853086 A1 WO 9853086A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- glu
- binding protein
- leu
- ser
- sucrose
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
- C12N15/8234—Seed-specific, e.g. embryo, endosperm
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
Definitions
- This invention relates to carbohydrate metabolism in plants, and in particular to sucrose-binding proteins (SBPs). Aspects of the invention include a novel SBP gene isolated from soybean, and modified SBPs having enhanced sucrose uptake activity. Nucleic acid vectors, transgenic cells and transgenic plants having modified sucrose uptake activity are also provided. The invention also relates to promoter sequences useful for controlling expression of transgenes in plants, including SBP transgenes.
- SBPs sucrose-binding proteins
- sucrose transport in plants has a major impact on plant growth and productivity.
- plants fix atmospheric carbon dioxide into triose phosphates, which are then used to produce sucrose and other carbohydrates. These carbohydrates are then transported throughout the plant for use as energy sources, carbon skeletons for biosynthesis and storage for future growth needs.
- Sucrose is the major form of transported carbohydrate.
- the ability of plant cells actively to transport sucrose across the plasma membrane so that the sucrose that is mobilized in the phloem can be taken into cells for use is a critical step in sucrose utilization.
- sucrose uptake in developing seeds affects two significant agricultural characteristics of the mature seed: the carbohydrate content of the resulting seed grain, and the vitality of the seedling that emerges when the seed grain is planted.
- Enhanced sucrose uptake activity in developing seeds may be desirable where it is an advantage to increase the carbohydrate content of the seed (e.g., where the seed is the primary plant material harvested, such as soybean).
- decreased sucrose uptake activity in seeds might be desirable where the vegetative material of the plant is harvested.
- plants having modified sucrose uptake activity during seed development would be of significant agricultural importance, and it is to such plants that the present invention is directed.
- the present invention provides isolated nucleic acid molecules encoding plant sucrose binding proteins, which are key proteins in the uptake of sucrose into developing seeds.
- the invention provides modified forms of sucrose binding proteins that are shown to have enhanced sucrose uptake activity.
- sucrose binding protein from soybean (Overvoode et al., 1996) is herein referred to as SBP1.
- a new SBP is provided herein and is referred to as SBP2.
- the SBP2 polypeptide is shown to be 489 amino acid residues in length, and to be expressed at enhanced levels during seed development.
- the SBP2 polypeptide is shown to have sucrose uptake activity in a heterologous yeast assay system.
- modified forms of the SBP1 and SBP2 proteins are provided having enhanced sucrose uptake activity.
- such forms are deletion mutants in which amino acid residues are removed from the C-terminus of the proteins.
- removal of 80 amino acid residues from the C- terminus of the SBP1 protein is shown to produce increased sucrose uptake in the yeast assay system.
- the invention also provides 5' regulatory regions (including promoter sequences) of the soybean SBP1 and SBP 2 genes. These regulatory regions confer specific or enhanced expression in developing seeds and so may be used to express any transgene in developing seeds.
- the invention provides a modified plant sucrose binding protein wherein the modified sucrose binding protein has a modified amino acid sequence compared to a corresponding wild-type sucrose binding protein, and wherein expression of the modified sucrose binding protein in a yeast assay system confers enhanced sucrose uptake compared to the corresponding wild-type sucrose binding protein.
- modified sucrose binding proteins provided by the invention enhance sucrose uptake in the yeast assay system by at least 10%, and preferably by at least 25%, compared to the wild-type sucrose binding protein.
- the modified plant sucrose binding proteins have a modified amino acid sequence comprising a C-terminal truncation compared to the wild-type sucrose binding protein.
- modified SBP 1 and SBP2 are exemplary of the invention.
- Modified forms of SBP 1 and SBP2 include those forms having the amino acid sequences shown in Seq. I.D. Nos. 2 and 4, respectively.
- nucleic acid molecules encoding modified plant sucrose binding proteins are provided, together with vectors comprising such nucleic acid molecules.
- the invention also provides transgenic plants expressing modified sucrose binding proteins. Such transgenic plants may have modified sucrose uptake activity, particularly in developing seeds.
- the invention provides an isolated nucleic acid molecule encoding a SBP2 sucrose binding protein or a variant of a SBP2 protein. Such proteins may comprise an amino acid sequence as shown in Seq. I.D. Nos. 3 and 4, or sequences having at least 70% and preferably at least 90% sequence identity with these sequences.
- Recombinant expression cassettes comprising such nucleic acid molecules are also provided by the invention, as are transgenic plants comprising such recombinant expression cassettes.
- nucleic acid sequence comprising a promoter sequence operably linked to a nucleic acid sequence, wherein the promoter sequence comprises a SBP1 or SBP 2 promoter.
- promoters preferably comprise at least 25 consecutive nucleotides of the 5' regulatory sequences shown in Seq. I.D. Nos. 6 and 7.
- the nucleic acid sequence comprises a plant sucrose binding protein.
- Fig. 1 shows an alignment of the SBP1 and SBP2 protein sequences.
- Fig. 2 is a graph showing sucrose uptake activity in the yeast assay system.
- nucleic and amino acid sequences listed in the sequence listing are shown using standard single-letter abbreviations for nucleotide bases, and three- letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand.
- Seq. I.D. No. 1 shows the amino acid sequence of the SBP1 protein.
- Seq. I.D. No. 2 shows the amino acid sequence of the truncated SBP1 protein from which the C-terminus 80 amino acids are deleted.
- Seq. I.D. No. 3 shows the amino acid sequence of the SBP2 protein.
- Seq. I.D. No. 4 shows the amino acid sequence of the truncated SBP2 protein from which the C-terminus 80 amino acids are deleted.
- Seq. I.D. No. 5 shows the SBP2 cDNA sequence.
- Seq. I.D. No. 6 shows the SBP2 gene 5' regulatory region.
- Seq. I.D. No. 7 shows the SBP1 gene 5' regulatory region.
- Seq. I.D. Nos. 8-14 show oligonucleotides that may be used to amplify various regions of the SBP2 cDNA or 5' regulatory region.
- Standard molecular biology methods may be used to practice the present invention. Such methods are described in many publications, including Sambrook et al., (1989), Ausubel et al. (1994), Innis et al. (1990), Weissbach & Weissbach (1989), Tijssen (1993).
- Sucrose binding protein (SBP) SBPs are involved in sucrose uptake in plants. This activity can be conveniently determined and measured using the yeast sucrose uptake assay originally described by Overvoorde et al. (1996), which is also described in detail below; in this assay system, SBPs confer sucrose uptake ability on yeast cells that are otherwise unable to take up sucrose.
- SBP refers generally to any sucrose binding protein, including the sucrose binding protein previously described by Grimes et al. (1992).
- This invention provides a cDNA encoding a previously unreported sucrose binding protein, the SBP2 protein from soybean (Glycine max). However the invention is not limited to this particular
- SBP other nucleotide sequences which encode SBP enzymes are also part of the invention, including variants on the disclosed Glycine gene sequences and orthologous sequences from other plant species, the cloning of which is now enabled. Such sequences share the essential functional characteristic of encoding an enzyme that is capable of mediating sucrose uptake in the described yeast assay system. Nucleic acid sequences that encode SBPs and the proteins encoded by such nucleic acids share not only this functional characteristic, but also a specified level of sequence similarity (or sequence identity), as addressed below. The concept of sequence identity can also be expressed in the ability of two sequences to hybridize to each other under stringent conditions.
- the present invention also provides modified SBPs having altered functional characteristics, as well as nucleic acid sequences encoding such proteins.
- An SBP isolated from an untransformed (wild-type) plant may be referred to as having a wild-type amino acid sequence.
- Modified SBPs have amino acid sequences that differ from the wild-type amino acid sequence. Such differences may take the form of amino acid deletions, additions, substitutions or truncations.
- a protein having amino acid deletions lacks one or more of the amino acid residues present in the wild-type sequence; such residues may be deleted from any portion of the protein.
- a truncated protein is one in which one or more amino acids are deleted from the N and/or C terminus of the protein.
- truncated proteins are a subclass of proteins having amino acid deletions.
- Nucleic acid sequences encoding modified SBPs can readily be produced using standard methodologies, such as site directed mutagenesis and polymerase chain reaction amplification. Sequence identity: the similarity between two nucleic acid sequences, or two amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.
- the calculation of percentage of sequence identity for amino acid sequences may take into account conservative amino acid substitutions.
- Conservative amino acid substitutions involve the replacement of one amino acid residue with another residue having similar chemical and biological properties (e.g., charge or hydrophobicity). Such substitutions typically do not change the functional properties of the protein, and should therefore be accounted for in the calculation of sequence identity by assigning a value that is in between values assigned for identity (i.e., no change at that amino acid position) and non-conservative residue changes.
- conservative amino acid changes are scored as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. For example, if an identical amino acid is given a score of one and a non-conservative substitution is given a score of zero, a conservative substitution might be given a score of 0.5.
- the scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).
- BLAST Basic Local Alignment Search Tool
- NCBI National Cancer Institute
- blastp blastn
- blastx blastx
- tblastn tblastx
- tblastx tblastx
- Homologs of the disclosed SBP2 protein are characterized by possession of at least 80% sequence identity counted over the full length alignment with the disclosed amino acid sequence of the soybean SBP2 amino acid sequence using the NCBI Blast 2.0, gapped blastp set to default parameters.
- Such homologous peptides will more preferably possess at least 85%, more preferably at least 90% and still more preferably at least 95% sequence identity determined by this method.
- homologs will possess at least 90% and more preferably at least 95% and more preferably still at least 98% sequence identity over short windows of 10-20 amino acids.
- homologs of the soybean SBP2 gene are similarly characterized by possession of at least 70% sequence identity counted over the full length alignment with the disclosed Glycine SBP2 gene sequence using the NCBI Blast 2.0, gapped blastn set to default parameters.
- Such homologous nucleic acids will more preferably possess at least 75%, more preferably at least 80% and still more preferably at least 90%) or 95% sequence identity determined by this method.
- homologs When less than the entire sequence is being compared for sequence identity, homologs will possess at least 85% and more preferably at least 90% and more preferably still at least 95% sequence identity over 30 nucleotide windows.
- homologs having the sequence identities described above will, in some embodiments, also encode a polypeptide having ability to mediate sucrose uptake in the described yeast assay system.
- homologs as defined above are useful for modifying sucrose uptake activity in transgenic plants (for example, as used in antisense constructs) even when they do not encode a functional peptide.
- nucleic acid molecules are substantially homologous
- the two molecules hybridize to each other under stringent conditions when one molecule is used as a hybridization probe, and the other is present in a biological sample, e.g., genomic material from a cell.
- Specific hybridization means that the molecules hybridize substantially only to each other and not to other molecules that may be present in the genomic material.
- Stringent conditions are sequence dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5°C to 20°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.
- Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequence that all encode substantially the same protein.
- Probes and primers Nucleic acid probes and primers may readily be prepared based on the nucleic acids provided by this invention.
- a probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule.
- Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et. al. (1989) and Ausubel et al. (1987).
- Primers are short nucleic acids, preferably DN A oligonucleotides 15 nucleotides or more in length. Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by the polymerase chain reaction (PCR), or other nucleic-acid amplification methods known in the art.
- PCR polymerase chain reaction
- PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).
- Primer Version 0.5, ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, MA.
- a primer comprising 20 consecutive nucleotides of the SBP1 or SBP2 gene 5' regulatory region will anneal to a target sequence (e.g., a corresponding SBP regulatory region from Faba bean) with a higher specificity than a corresponding primer of only 15 nucleotides.
- a target sequence e.g., a corresponding SBP regulatory region from Faba bean
- probes and primers may be selected that comprise 20, 25, 30, 35, 40, 50 or more consecutive nucleotides of the nucleic acid sequences disclosed herein.
- a transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques.
- transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including Agrob ⁇ cterium transformation, plasmid transformation, viral tranafection and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.
- a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell.
- a vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication.
- a vector may also include one or more selectable marker genes and other genetic elements known in the art.
- Isolated An "isolated" biological component (such as a nucleic acid or protein) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids and proteins which have been “isolated” thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
- a purified SBP preparation is one in which the SBP is more enriched than the protein is in its natural environment within a cell.
- a preparation of SBP is purified such that the SBP represents at least 50% of the total protein content of the preparation.
- Operably linked A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.
- a recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
- Ortholog Two nucleotide or amino acid sequences are orthologs of each other if they share a common ancestral sequence and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.
- Transgenic plant refers to a plant that contains recombinant genetic material not normally found in plants of this type and which has been introduced into the plant in question (or into progenitors of the plant) by human manipulation.
- a plant that is grown from a plant cell into which recombinant DNA is introduced by transformation is a transgenic plant, as are all offspring of that plant which contain the introduced DNA (whether produced sexually or asexually).
- Transgenic plants may be produced from any transformable plant species, both monocotolydenous and dicotyledenous plants, including but not limited to soybean, rice, wheat, barley, and maize.
- SBP2 cDNA The nucleic acid sequence of the SBP2 cDNA is shown in Seq. I.D. No. 5, and the amino acid sequence of the SBP2 protein is shown in Seq. I.D. No. 3.
- a comparison of the amino acid sequences of SBP 1 and SBP2 is shown in Fig. 1. i. Differential expression of SBPl and SBP 2 genes in soybean leaves and cotyledons.
- the sense and antisense RNAs of 32 P-labeled SBPl and SBP2 5'-flanking region were synthesized in vitro and 5.3 x 10 5 cpm of a SBPl sense, SBPl antisense, SBP2 sense or SBP2 antisense RNA probe were hybridized with 5 ⁇ g poly(A+) mRNA from soybean leaves and cotyledons. SBPl and SBP2 transcripts were observed to accumulate to similar levels in soybean cotyledons. In contrast, no SBPl and SBP2 transcripts were detected in 4-wk old soybean leaves.
- an SBPl antisense probe protected three major fragment (119, 111, and 97 nucleotides), indicating that three different transcription start sites were used.
- the SBPl mRNA level reaches a plateau at stage 3, and this expression level is maintained until stage 5.
- 5 protected fragments were detected when using SBP 2 antisense probe, and SBP 2 mRNA level continuously increased until seed size reached 11-12 mm.
- Quantitative data indicated that SBPl mRNA level is three time more abundant than that of SBP2.
- the mRNA level of leaf tip is very low. However, low levels of SBPl mRNA can be observed in 3 mm leaf tips after prolonged exposure.
- the regulatory regions of these genes responsible for conferring such expression are of interest, and may be used to regulate transgene expression in a similarly tissue-specific manner.
- the 5' regulatory regions of SBPl and SBP2 are shown in Seq. I.D. Nos. 6 and 7, respectively.
- the susy7 strain was selected for uracil auxotrophy by growth on medium containing 5'-fluoroorotic acid (Overvoorde et al., 1996). The resulting strain, susy7/ura3 is unable to grow on a medium lacking uracil and containing glucose as the sole carbon source.
- Uptake assays were performed by growing the transformed yeast cells to an OD 600 of 0.5 to 1.3 in YPD, harvested by centrifugation, washed twice with 25 mM
- FIG. 2 shows the sucrose uptake rate obtained with yeast cells transformed with the pMK195 vector only (filed circles), and constructs expressing the full length SBPl protein (filled square) and a truncated SBPl protein missing the C-terminal 80 amino acids (filled triangle).
- the amino acid sequence of this truncated SBPl protein is shown in Seq. I.D. No. 2.
- the truncated protein comprises residues 1-444 of the full length SBPl.
- Modified SBPs having enhanced sucrose uptake activity include forms of SBPl and SBP2 having C-terminal deletions. Such deletions include removal of about 80 amino acids from the C-terminal, but deletions of greater or fewer than 80 amino acids may also be employed.
- the sucrose uptake activity any particular deletion may readily be determined using the yeast sucrose uptake assay described above.
- SBP proteins having C-terminal deletions of between 10 and 100 amino acids are candidates for enhanced sucrose uptake activity and may be assayed using this system.
- Example one Preferred method for producing SBP nucleic acids
- This invention provides a SBP2 cDNA sequence and the amino acid sequence of the SBP2 protein, modified SBP proteins having enhanced sucrose uptake activity, and 5' regulatory regions for the SBPl and SBP2 genes.
- the polymerase chain reaction (PCR) may now be utilized in a preferred method for producing nucleic acid sequences encoding the various SBP proteins described in the invention, as well as the SBP gene 5' regulatory regions.
- PCR amplification of cDNAs encoding the SBP proteins of the present invention may be accomplished either by direct PCR from a plant cDNA library or by Reverse-Transcription PCR (RT-PCR) using RNA extracted from plant cells as a template.
- RT-PCR Reverse-Transcription PCR
- Amplification of SBP gene sequences and 5' regulatory regions may be accomplished by direct PCR amplification from plant genomic DNA. or from a plant genomic library. Methods and conditions for both direct PCR and RTPCR are known in the art and are described in Innis et al. (1990).
- PCR primers will be made according to the portions of the cDNA or gene that are to be amplified. Primers may be chosen to amplify small segments of the cDNA, the open reading frame, the entire cDNA molecule or the entire gene sequence. Variations in amplification conditions may be required to accommodate primers of differing lengths; such considerations are well known in the art and are discussed in Innis et al. (1990), Sambrook et al. (1 89), and Ausubel et al (1992). By way of example only, the entire SBP 2 cDNA molecule as shown in Seq. I.D. No.
- primer 5 may be amplified using the following combination of primers: primer 1 5' TGTAAAACGACGGCCAGTGAATT 3' (Seq. I.D. No. 8) primer 2 5' GATTACGCCAAGCTCGAAATTAA 3' (Seq. I.D. No. 9)
- the open reading frame portion of the SBP2 cDNA may be amplified using the following primer pair: primer 3 5 * ATGGCGACCAGAGCCAAGCTTTCTTTA 3' (Seq. I.D. No. 10) primer 4 5' CGCAACAGCGCGACGACCACGCTCGCT 3' (Seq. I.D. No.
- a cDNA encoding a truncated version of the SBP2 protein may be amplified using the following primer pair: primer 3 5' ATGGCGACCAGAGCCAAGCTTTCTTTA 3' (Seq. I.D. No. 10) primer 5 5' GAAGGGATGACCAGGAGGGACAACAAA 3' (Seq. I.D. No. 12)
- the SBP2 5 regulatory sequence may be amplified using the following primer pair: primer 6 5' TTGTAAACGACGGCCAGTGAATT 3' (Seq. I.D. No. 13) primer 7 5' GGTGAGGTCAGTGAGGAACAACA 3' (Seq. I.D. No. 14)
- primers are illustrative only; it will be appreciated by one skilled in the art that many different primers may be derived from the provided nucleic acid sequences in order to amplify particular regions of these molecule. Resequencing of
- Oligonucleotides that are derived from the SBP 2 cDNA or SBPl and SBP2 5' regulatory regions are encompassed within the scope of the present invention.
- such oligonucleotide primers will comprise a sequence of at least 15-20 consecutive nucleotides of the SBP 2 cDNA or gene sequences.
- oligonucleotide primers comprising at least 25, 30, 35, 40, 45 or 50 consecutive nucleotides of these sequences may also be used.
- the SBP2 gene sequence may be obtained by PCR amplification using primers derived from the disclosed cDNA sequence to probe a genomic library or genomic DNA, or by probing a genomic DNA library using a labeled probe derived from the SBP2 cDNA sequence. Standard PCR amplification or hybridization methods may be used for these approaches.
- Example Two Isolation of homologous gene sequence from other plant species
- the invention also enables the production of corresponding molecules from other plant species.
- the present invention permits the isolation of SBP2 homologs from other species, as well as the production of enhanced efficiency SBP proteins of other plant species. Both conventional hybridization and PCR amplification procedures may be utilized to obtain corresponding cDNAs from other species and to produce nucleic acids encoding enhanced activity SBP proteins.
- a target nucleotide preparation which may be, in the case of conventional hybridization approaches, a cDNA or genomic library or, in the case of PCR amplification, a cDNA or genomic library, or an mRNA preparation.
- Direct PCR amplification may be performed on cDNA or genomic libraries prepared from the plant species in question, or RT-PCR may be performed using mRNA extracted from the plant cells using standard methods.
- PCR primers will comprise at least 15 consecutive nucleotides of the SBP2 cDNA.
- sequence differences between the soybean SBP2 cDNA and the target nucleic acid to be amplified may result in lower amplification efficiencies.
- longer PCR primers or lower annealing temperatures may be used during the amplification cycle. Where lower annealing temperatures are used, sequential rounds of amplification using nested primer pairs may be necessary to enhance specificity.
- the hybridization probe is preferably conjugated with a detectable label such as a radioactive label, and the probe is preferably of at least 20 nucleotides in length.
- a detectable label such as a radioactive label
- the labeled probe derived from the soybean SBP2 cDNA or gene sequence may be hybridized to a plant cDNA or genomic library and the hybridization signal detected using means known in the art.
- the hybridizing colony or plaque (depending on the type of library used) is then purified and the cloned sequence contained in that colony or plaque isolated and characterized.
- Homologs of the soybean SBP2 cDNA may alternatively be obtained by immunoscreening of an expression library.
- the enzyme may be expressed and purified in a heterologous expression system (e.g., E. coli) and used to raise antibodies (monoclonal or polyclonal) specific for the SBP2 protein.
- Antibodies may also be raised against synthetic peptides derived from the SBP2 amino acid sequence presented herein. Methods of raising antibodies are well known in the art and are described in Harlow and Lane (1988). Such antibodies can then be used to screen an expression cDNA library produced from the plant from which it is desired to clone the SBP2 ortholog, using the methods described above. The selected cDNAs can be confirmed by sequencing and enzyme activity.
- soybean SBP2 gene or cDNA, and homologs of these sequences from other plants may be incorporated into transformation vectors and introduced into plants to modify SBP activity in such plants, as described in Example Three below.
- nucleic acids encoding modified SBP proteins as taught herein may also be used to produce plants having modified sucrose uptake activity.
- the native SBP gene promoter may be particularly useful in the practice of the present invention in that it may be used to drive the expression of SBP transgenes, such as antisense constructs.
- expression of these transgenes may be regulated in coordination with the native SBP gene (for example, in the same temporal or tissue-specific expression patterns).
- Example Three Transgenic plants having modified sucrose uptake activity
- a gene (or cDNA) encoding a protein involved in the determination of a particular plant characteristic has been isolated
- standard techniques may be used to express the cDNA in transgenic plants in order to modify that particular plant characteristic.
- the basic approach is to clone the cDNA into a transformation vector, such that it is operably linked to control sequences (e.g., a promoter) that direct expression of the cDNA in plant cells.
- the transformation vector is then introduced into plant cells by one of a number of techniques (e.g., electroporation) and progeny plants containing the introduced cDNA are selected.
- all or part of the transformation vector will stably integrate into the genome of the plant cell. That part of the transformation vector which integrates into the plant cell and which contains the introduced cDNA and associated sequences for controlling expression (the introduced "transgene") may be referred to as the recombinant expression cassette.
- Selection of progeny plants containing the introduced transgene may be made based upon the detection of an altered phenotype.
- a phenotype may result directly from the cDNA cloned into the transformation vector or may be manifested as enhanced resistance to a chemical agent (such as an antibiotic) as a result of the inclusion of a dominant selectable marker gene incorporated into the transformation vector.
- control sequences determine, in part, how the plant characteristic affected by the introduced cDNA is modified.
- the control sequences may be tissue specific, such that the cDNA is only expressed in particular tissues of the plant (e.g., pollen, seed) and so the affected characteristic will be modified only in those tissues.
- the cDNA sequence may be arranged relative to the control sequence such that the cDNA transcript is expressed normally, or in an antisense orientation.
- RNA corresponding to the cloned cDNA will result in a reduction of the targeted gene product (the targeted gene product being the protein encoded by the plant gene from which the introduced cDNA was derived).
- the targeted gene product being the protein encoded by the plant gene from which the introduced cDNA was derived.
- Over-expression of the introduced cDNA, resulting from a plus-sense orientation of the cDNA relative to the control sequences in the vector, may lead to an increase in the level of the gene product, or may result in co-suppression (also termed "sense suppression") of that gene product.
- Nucleic acid molecules according to the present invention may be introduced into any plant type in order to modify sucrose uptake activity in the plant.
- sequences of the present invention may be used to modify sucrose uptake activity in any higher plant, including monocotyledonous and dicotyledenous plants, including, but not limited to maize, wheat, rice, barley, soybean, beans in general, rape/canola, alfalfa, flax, sunflower, safflower, brassica, cotton, flax, peanut, clover; vegetables such as lettuce, tomato, cucurbits, potato, carrot, radish, pea, lentils, cabbage, broccoli, brussel sprouts, peppers; tree fruits such as apples, pears, peaches, apricots; flowers such as carnations and roses.
- rape/canola alfalfa, flax, sunflower, safflower, brassica, cotton, flax, peanut, clover
- vegetables such as lettuce, tomato, cucurbits, potato, carrot, radish, pea, lentils, cabbage, broccoli, brussel sprouts, peppers
- tree fruits such as apples, pears, pe
- plant transformation vectors include one or more cloned plant genes (or cDNAs) under the transcriptional control of 5' and 3' regulatory sequences and a dominant selectable marker.
- Such plant transformation vectors typically also contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally-or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
- a promoter regulatory region e.g., a regulatory region controlling inducible or constitutive, environmentally-or developmentally-regulated, or cell- or tissue-specific expression
- constitutive plant promoters which may be useful for expressing nucleic acids include: the cauliflower mosaic virus (CaMV) 35S promoter, which confers constitutive, high-level expression in most plant tissues (see, e.g., Odel et al., 1985, Dekeyser et al., 1990, Terada and Shimamoto, 1990; Benfey and Chua. 1990); the nopaline synthase promoter (An et al., 1988); and the octopine synthase promoter (Fromm et al., 1989).
- CaMV cauliflower mosaic virus
- tissue specific (root, leaf, flower, and seed for example) promoters (Carpenter et al., 1992; Denis et al., 1993; Opperman et al., 1993; Stockhause et al. 1997; Roshal et al., 1987; Schernthaner et al., 1988; and Bustos et al., 1989) can be fused to the coding sequence to obtained particular expression in respective organs.
- the timing of the expression can be controlled by using promoters such as those acting at senescencing (Gan and Amasino, 1995) or late seed development (Odell et al., 1994).
- the promoter regions of the SBPl and SBP2 genes disclosed herein confer developing seed-specific expression in soybean. Accordingly, these promoters may be used to obtain developing seed specific expression of the introduced transgene.
- Plant transformation vectors may also include RNA processing signals, for example, introns, which may be positioned upstream or downstream of the ORF sequence in the transgene.
- the expression vectors may also include additional regulatory sequences from the 3 '-untranslated region of plant genes, e.g., a 3' terminator region to increase mRNA stability of the mRNA, such as the PI-II terminator region of potato or the octopine or nopaline synthase 3' terminator regions.
- plant transformation vectors may also include dominant selectable marker genes to allow for the ready selection of transformants.
- genes include those encoding antibiotic resistance genes (e.g., resistance to hygromycin, kanamycin, bleomycin, G418, streptomycin or spectinomycin) and herbicide resistance genes (e.g., phosphinothricin acetyltransferase).
- SBP sequence in vector The particular arrangement of the SBP sequence in the transformation vector will be selected according to the type of expression of the sequence that is desired.
- the SBP ORF may be operably linked to a constitutive high-level promoter such as the CaMV 35S promoter. Modification of sucrose uptake activity may also be achieved by introducing into a plant a transformation vector containing a variant form of the
- SBP2 gene for example a form which varies from the exact nucleotide sequence of the SBP2 ORF, but which encodes a protein that retains the functional characteristic of the SBP2 protein, i.e., conferring sucrose uptake activity.
- enhanced sucrose uptake activity may also be obtained by utilizing a nucleic acid sequence encoding a modified SBP as discussed above.
- modified SBPs include SBPs having C-terminal deletions, generally in the range of 10-100 amino acid residue, and preferably about 80 amino acid residues.
- a reduction sucrose uptake activity in the transgenic plant may be obtained by introducing into plants antisense constructs based on a SBP gene sequence.
- SBP gene is arranged in reverse orientation relative to the promoter sequence in the transformation vector.
- the introduced sequence need not be the full length SBP gene, and need not be exactly homologous to the SBP gene found in the plant type to be transformed. Generally, however, where the introduced sequence is of shorter length, a higher degree of homology to the native SBP sequence will be needed for effective antisense suppression.
- the introduced antisense sequence in the vector will be at least 30 nucleotides in length, and improved antisense suppression will typically be observed as the length of the antisense sequence increases.
- the length of the antisense sequence in the vector will be greater than 100 nucleotides.
- RNA molecules that are the reverse complement of mRNA molecules transcribed from the endogenous SBP gene in the plant cell are the reverse complement of mRNA molecules transcribed from the endogenous SBP gene in the plant cell.
- antisense RNA molecules bind to the endogenous mRNA molecules and thereby inhibit translation of the endogenous mRNA.
- Ribozymes are synthetic RNA molecules that possess highly specific endoribonuclease activity. The production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to Cech and U.S. Patent No. 5,543,508 to Haselhoff. The inclusion of ribozyme sequences within antisense RNAs may be used to confer RNA cleaving activity on the antisense RNA, such that endogenous mRNA molecules that bind to the antisense RNA -ire cleaved, which in turn leads to an enhanced antisense inhibition of endogenous gene expression.
- Constructs in which a SBP nucleic acid (or variants thereof) are over- expressed may also be used to obtain co-suppression of the endogenous SBP gene in the manner described in U.S. Patent No. 5,231,021 to Jorgensen.
- Such co- suppression also termed sense suppression
- the suppressive efficiency will be enhanced as (1) the introduced sequence is lengthened and (2) the sequence similarity between the introduced sequence and the endogenous SBP gene is increased.
- Constructs expressing an untranslatable form of a SBP mRNA may also be used to suppress the expression of endogenous SBP activity. Methods for producing such constructs are described in U.S. Patent No. 5,583,021 to Dougherty et al. Preferably, such constructs are made by introducing a premature stop codon into the SBP ORF.
- dominant negative mutant forms of the disclosed sequences may be used to block endogenous SBP activity. Such mutants require the production of mutated forms of the SBP protein that bind to sucrose but do not catalyze the uptake of sucrose.
- Transformation and Regeneration Techniques Transformation and regeneration of both monocotyledonous and dicotyledonous plant cells is now routine, and the selection of the most appropriate transformation technique will be determined by the practitioner. The choice of method will vary with the type of plant to be transformed; those skilled in the art will recognize the suitability of particular methods for given plant types. Suitable methods may include, but are not limited to: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG) mediated transformation; transformation using viruses; micro-injection of plant cells; micro- projectile bombardment of plant cells; vacuum infiltration; and Agrobacterium tumeficiens (AT) mediated transformation. Typical procedures for transforming and regenerating plants are described in the patent documents listed at the beginning of this section.
- transformed plants are preferably selected using a dominant selectable marker incorporated into the transformation vector.
- a dominant selectable marker will confer antibiotic resistance on the seedlings of transformed plants, and selection of transformants can be accomplished by exposing the seedlings to appropriate concentrations of the antibiotic.
- transformed plants After transformed plants are selected and grown to maturity, they can be assayed using known methods to determine whether SBP activity has been altered as a result of the introduced transgene.
- antisense or sense suppression of an endogenous SBP gene may be detected by analyzing mRNA expression on Northern blots.
- Example Four Production of sequence variants
- modification of sucrose uptake activity in plant cells can be achieved by transforming plants with the SBP2 cDNA or gene, antisense constructs based on the SBP2 cDNA or gene sequence or nucleic acid sequences encoding modified SBP proteins.
- Variant DNA molecules include those created by standard DNA mutagenesis techniques, for example, Ml 3 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (1989), Ch. 15. By the use of such techniques, variants may be created which differ in minor ways from the disclosed sequences disclosed. DNA molecules and nucleotide sequences which are derivatives of those specifically disclosed herein and which differ from those disclosed by the deletion, addition or substitution of nucleotides while still encoding a protein which possesses the functional characteristic of a SBP protein (i.e., the ability to mediate sucrose uptake in the yeast assay system) are comprehended by this invention. DNA molecules and nucleotide sequences which are derived from the S-5P2 cDNA and gene sequences disclosed include DNA sequences which hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof.
- Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the Na + concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (1989), chapters 9 and 11, herein incorporated by reference.
- a hybridization experiment may be performed by hybridization of a DNA molecule (for example, soybean SBP2 cDNA sequence) to a target DNA molecule (for example, the a corresponding S-9P2 cDNA sequence in tobacco) which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, 1975), a technique well known in the art and described in (Sambrook et al., 1989).
- Hybridization with a target probe labeled with [ 32 P]dCTP is generally carried out in a solution of high ionic strength such as 6xSSC at a temperature that is 20-25° C below the melting temperature, T m , described below.
- hybridization is typically carried out for 68 hours using 12 ng/ml radiolabeled probe (of specific activity equal to 10 9 CPM/ ⁇ g or greater).
- the nitrocellulose filter is washed to remove background hybridization.
- the washing conditions should be as stringent as possible to remove background hybridization but to retain a specific hybridization signal.
- T m represents the temperature above which, under the prevailing ionic conditions, the radiolabeled probe molecule will not hybridize to its target DNA molecule.
- the T m of such a hybrid molecule may be estimated from the following equation (Bolton and McCarthy, 1962):
- T m 81.5 C 16.6(log 10 [Na + j) + 0.41(%G+C)-0.63(% formamide) (600//)
- DNA sequences from plants that encode a protein having SBP activity and which hybridize under hybridization conditions of at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90% and most preferably at least 95% stringency to the disclosed SBP2 sequence are encompassed within the present invention.
- the degeneracy of the genetic code further widens the scope of the present invention as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the amino acid sequence of the encoded protein.
- the second amino acid residue of the soybean SBP2 protein is alanine.
- This is encoded in the soybean SBP2 open reading frame by the nucleotide codon triplet GCG.
- three other nucleotide codon triplets-GCA, GCC and GCT- also code for alanine.
- the nucleotide sequence of the soybean SBP2 ORF could be changed at this position to any of these three codons without affecting the amino acid composition of the encoded protein or the characteristics of the protein.
- variant DNA molecules may be derived from the cDNA and gene sequences disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences.
- this invention also encompasses nucleic acid sequences which encode a SBP protein but which vary from the disclosed nucleic acid sequences by virtue of the degeneracy of the genetic code.
- the present invention teaches that enhanced sucrose uptake activity may be obtained by modifying the sequence of a plant SBP, e.g., by deleting 80 C-terminal amino acids.
- DNA mutagenesis techniques may be used not only to produce variant DNA molecules, but will also facilitate the production of such modified SBP protein.
- amino acid sequence can be made including deletions, additions and substitutions.
- site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined.
- random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity.
- Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known.
- Amino acid substitutions are typically of single residues; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to more than 100 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. Obviously, the mutations that are made in the DNA encoding the protein must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Table 1 when it is desired to finely modulate the characteristics of the protein. Table 1 shows amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions. Table 1.
- Trp tyr Tyr trp Trphe Val ile; leu
- Substantial changes in enzymatic function or other features are made by selecting substitutions that are less conservative than those in Table 1, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in protein properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine.
- a hydrophilic residue e.g
- the promoters of the Glycine SBPl and SBP 2 genes confer developing seed- specific expression. Accordingly, the promoter sequences, shown in Seq. I.D. Nos. 7 (SBP 2) and 8 (SBPl) may be used to produce transgene constructs that are specifically expressed in developing seeds.
- SBP 2 and 8 SBPl
- transgene constructs that are specifically expressed in developing seeds.
- regulation of transgene expression in developing seeds may be achieved with less than the entire 5' regulatory sequences shown in Seq. I.D. Nos. 7 & 8.
- developing seed-specific expression may be obtained by employing a 50 base pair or 100 base pair region of the disclosed promoter sequences.
- the determination of whether a particular sub-region of the disclosed sequence operates to confer effective seed-specific expression in a particular system will be performed using known methods, such as operably linking the promoter sub-region to a marker gene (e.g. GUS), introducing such constructs into plants and then determining the level of expression of the marker gene in developing seeds and other plant tissues.
- a marker gene e.g. GUS
- the present invention therefore facilitates the production, by standard molecular biology techniques, of nucleic acid molecules comprising the SBPl or SBP2 promoter sequence operably linked to a nucleic acid sequence, such as an open reading frame.
- Suitable open reading frames include open reading frames encoding any protein for which expression in developing seeds is desired. Examples of genes that may suitably be expressed in a seed-specific manner under the control of the disclosed SBP promoters include, but are not limited to:
- genes that enhance the nutritional quality of the seeds for example, by increasing the content of limiting amino acids, including lysine, methionine and cysteine. This may be achieved by expressing proteins containing high levels of these amino acids in seeds. Examples include the high methionine storage proteins from brazil nut (Saalbach et al., 1996) and sunflower (Molvig et al., 1997).
- genes that increase gluten levels in wheat, so as to enhance the bread- making quality of the wheat flour Shewry et al., 1995).
- genes that enhance insect resistance in the seed include resistance to weevils. Suitable genes include the ⁇ -amylase inhibitor gene which kills seed weevils (Schmidt, 1994).
- ADDRESSEE Klarquist Sparkman Campbell Leigh & Whinston
- LLP STREET: One World Trade Center
- GAG CGA GAG AAA CAA GTC GAA GAG GAA ACT CGC GAG AAG GAA GAA 370 Glu Arg Glu Lys Gin Val Glu Glu Glu Thr Arg Glu Lys Glu Glu 70 75 80
- AATTCAAACC CACCATATCT TTATTAATTT CACTTTTTTC TTTATTTTAT 250
- AATTTTTAGT CTCACAGTCA CACATTTTAA CAGGTTATGA TAACAAGGGG 300 CAAAGATAAG GGTGAGACCG GGATTATAAA GCGTGTCATT CGCTCTCAAA 350
- AGTGAAAATA AATATTGTTC ACTTTCACCT CACGCTGGCC TTCCGCTGAT 3250 GGTGGTTGTA CGCACTTATT TGATTTTTTT TTCTTCCACA TTTAATGAGG 3300
- AATTCAACCT TCCATTTGTT TTCGCCAGCA TCCAGATTTG TGCTTTCTCT 500 ATCATTTCAT TTAATTAATG TGATGTATGT ATGGCTGAAT AAAAGATGGA 550
- TCTCACTCCA ATGCCTTTTG CCGTCCTCTT TATAGGTAAA GAAGCATATC 1250 AAGCAAGGGC AAGGTCATAA AGGGGGAATC TTTACAGTGG AAGCCCCACT 1300
- TGTTATCCAT AACCTTGTTA TTATACTTGG TGTTAAAAAA GGAGAGTCTC 1950
- AAATATACGA CATGGTTAGG AATTTTTTTTTT TAGTATGTCT GACATAATTT 3600
- TTATGTGTAC CGGGTACGTG TCTACTAACA TGGTGTCTCT CCATCATTTT 4200 CGTAGGAAAA AACATTATAG GAGTATGAAA AAAGCAAAAG TTTTGTCTGT 4250
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
BR9809879-9A BR9809879A (en) | 1997-05-22 | 1998-05-21 | Plant modified sucrose binding protein, nucleic acid molecule encoding a modified plant sucrose binding protein, vector, transgenic plant expressing a modified plant sucrose binding protein, isolated nucleic acid molecule encoding a plant sucrose binding protein, recombinant expression cassette, recombinant nucleic acid molecule and transgenic plant comprising a recombinant nucleic acid molecule |
JP55065998A JP2001526544A (en) | 1997-05-22 | 1998-05-21 | Sucrose binding protein |
AU75009/98A AU731616B2 (en) | 1997-05-22 | 1998-05-21 | Sucrose-binding proteins |
EP98922474A EP0991768A1 (en) | 1997-05-22 | 1998-05-21 | Sucrose-binding proteins |
US09/424,283 US6437219B1 (en) | 1997-05-22 | 1998-05-21 | Nucleic acids encoding sucrose-binding proteins |
CA002291450A CA2291450A1 (en) | 1997-05-22 | 1998-05-21 | Sucrose-binding proteins |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US4756897P | 1997-05-22 | 1997-05-22 | |
US60/047,568 | 1997-05-22 |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US09/424,283 A-371-Of-International US6437219B1 (en) | 1997-05-22 | 1998-05-21 | Nucleic acids encoding sucrose-binding proteins |
US10/155,805 Division US20030061634A1 (en) | 1997-05-22 | 2002-05-24 | Sucrose-binding proteins |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1998053086A1 true WO1998053086A1 (en) | 1998-11-26 |
Family
ID=21949729
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1998/010465 WO1998053086A1 (en) | 1997-05-22 | 1998-05-21 | Sucrose-binding proteins |
Country Status (10)
Country | Link |
---|---|
US (2) | US6437219B1 (en) |
EP (1) | EP0991768A1 (en) |
JP (1) | JP2001526544A (en) |
CN (1) | CN1257547A (en) |
AR (1) | AR012744A1 (en) |
AU (1) | AU731616B2 (en) |
BR (1) | BR9809879A (en) |
CA (1) | CA2291450A1 (en) |
WO (1) | WO1998053086A1 (en) |
ZA (1) | ZA984322B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000012733A1 (en) * | 1998-08-28 | 2000-03-09 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters from end genes |
WO2000026388A2 (en) * | 1998-11-04 | 2000-05-11 | Institut Für Pflanzengenetik Und Kulturpflanzenfor- Schung | Novel expression cassette for expressing genes in plant seed |
WO2006120197A3 (en) * | 2005-05-10 | 2007-03-22 | Basf Plant Science Gmbh | Expression cassettes for seed-preferential expression in plants |
US7524678B2 (en) | 1998-06-26 | 2009-04-28 | Iowa State University Research Foundation, Inc. | Materials and methods for the alteration of enzyme and acetyl CoA levels in plants |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP5148497B2 (en) * | 2005-10-14 | 2013-02-20 | カーネギー インスチチューション オブ ワシントン | Sucrose biosensor and method using the same |
WO2007079353A2 (en) * | 2005-12-15 | 2007-07-12 | Targeted Growth, Inc. | Increased seed size and seed number through transgenic over expression of a growth and/or development related gene during early embryo development |
CN109880845B (en) * | 2019-03-07 | 2022-04-22 | 华中农业大学 | Method for improving plant nodulation nitrogen fixation efficiency |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994000574A1 (en) * | 1992-06-24 | 1994-01-06 | Institut Für Genbiologische Forschung Berlin Gmbh | Dna sequences encoding oligosaccharide transporter |
-
1998
- 1998-05-21 JP JP55065998A patent/JP2001526544A/en active Pending
- 1998-05-21 BR BR9809879-9A patent/BR9809879A/en not_active IP Right Cessation
- 1998-05-21 EP EP98922474A patent/EP0991768A1/en not_active Withdrawn
- 1998-05-21 ZA ZA984322A patent/ZA984322B/en unknown
- 1998-05-21 CA CA002291450A patent/CA2291450A1/en not_active Abandoned
- 1998-05-21 CN CN98805333A patent/CN1257547A/en active Pending
- 1998-05-21 WO PCT/US1998/010465 patent/WO1998053086A1/en not_active Application Discontinuation
- 1998-05-21 AU AU75009/98A patent/AU731616B2/en not_active Ceased
- 1998-05-21 US US09/424,283 patent/US6437219B1/en not_active Expired - Fee Related
- 1998-05-22 AR ARP980102405A patent/AR012744A1/en not_active Application Discontinuation
-
2002
- 2002-05-24 US US10/155,805 patent/US20030061634A1/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1994000574A1 (en) * | 1992-06-24 | 1994-01-06 | Institut Für Genbiologische Forschung Berlin Gmbh | Dna sequences encoding oligosaccharide transporter |
Non-Patent Citations (8)
Title |
---|
CHAO,W.S., ET AL.: "functional and structural analysis of sucrose binding protein in a heterologous yeast system", SUPPLEMENT TO PLANT PHYSIOLOGY, vol. 114, no. 3, July 1997 (1997-07-01), pages 955, XP002079380 * |
GRIMES, H.D., ET AL.: "a 62-kD sucrose binding protein is expressed and localized in tissues actively engaged in sucrose transport", THE PLANT CELL, vol. 4, December 1992 (1992-12-01), pages 1561 - 1574, XP002079375 * |
LU, M-Y. J., ET AL.: "site-directed mutagenesis of HIS71 in the proton-sucrose symporter", SUPPLEMENT TO PLANT PHYSIOLOGY, vol. 114, no. 3, July 1997 (1997-07-01), pages 958, XP002079381 * |
OVERVOORDE, P.J., ET AL.: "a soybean sucrose binding protein independently mediates nonsaturable sucrose uptake in yeast", THE PLANT CELL, vol. 8, February 1996 (1996-02-01), pages 271 - 280, XP002079376 * |
OVERVOORDE, P.J., ET AL.: "topological analysis of the plasma membrane-associated sucrose binding protein from soybean", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 269, no. 21, May 1994 (1994-05-01), pages 15154 - 15161, XP002079379 * |
SAUER, N., ET AL.: "suc1 and suc2: two sucrose transporters from arabidopsis thaliana; expression and characterization in baker's yeast and identification of the histidine-tagged protein", THE PLANT JOURNAL, vol. 6, no. 1, 1994, pages 67 - 77, XP002079378 * |
SAUER,N., ET AL.: "sugar transport across the plasma membranes of higher plants", PLANT MOLECULAR BIOLOGY, vol. 26, 1994, pages 1671 - 1679, XP002079377 * |
STOLZ, J., ET AL.: "rapid purification of a functionally active sucrose carrier from transgenic yeast using a bacterial biotin acceptor domain", FEBS LETTERS, vol. 377, 1995, pages 167 - 171, XP002079374 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7524678B2 (en) | 1998-06-26 | 2009-04-28 | Iowa State University Research Foundation, Inc. | Materials and methods for the alteration of enzyme and acetyl CoA levels in plants |
WO2000012733A1 (en) * | 1998-08-28 | 2000-03-09 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters from end genes |
US6528704B1 (en) | 1998-08-28 | 2003-03-04 | Pioneer Hi-Bred International, Inc. | Seed-preferred promoters from end genes |
WO2000026388A2 (en) * | 1998-11-04 | 2000-05-11 | Institut Für Pflanzengenetik Und Kulturpflanzenfor- Schung | Novel expression cassette for expressing genes in plant seed |
WO2000026388A3 (en) * | 1998-11-04 | 2000-08-03 | Inst Pflanzengenetik & Kultur | Novel expression cassette for expressing genes in plant seed |
WO2006120197A3 (en) * | 2005-05-10 | 2007-03-22 | Basf Plant Science Gmbh | Expression cassettes for seed-preferential expression in plants |
US7790873B2 (en) | 2005-05-10 | 2010-09-07 | Basf Plant Science Gmbh | Expression cassettes for seed-preferential expression in plants |
AU2006245701B2 (en) * | 2005-05-10 | 2011-04-28 | Basf Plant Science Gmbh | Expression cassettes for seed-preferential expression in plants |
Also Published As
Publication number | Publication date |
---|---|
BR9809879A (en) | 2000-07-04 |
US6437219B1 (en) | 2002-08-20 |
CA2291450A1 (en) | 1998-11-26 |
AU7500998A (en) | 1998-12-11 |
CN1257547A (en) | 2000-06-21 |
ZA984322B (en) | 1999-01-19 |
EP0991768A1 (en) | 2000-04-12 |
JP2001526544A (en) | 2001-12-18 |
AU731616B2 (en) | 2001-04-05 |
AR012744A1 (en) | 2000-11-08 |
US20030061634A1 (en) | 2003-03-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6359197B1 (en) | Transgenic plants with altered senescence characteristics | |
AU739442B2 (en) | An oleosin 5' regulatory region for the modification of plant seed lipid composition | |
AU732026B2 (en) | Leafy cotyledon1 genes and their uses | |
WO1998037184A9 (en) | Leafy cotyledon1 genes and their uses | |
CA2285707A1 (en) | A sunflower albumin 5' regulatory region for the modification of plant seed lipid composition | |
CA2384973A1 (en) | Seed-preferred promoter from maize | |
AU782218B2 (en) | Flax seed specific promoters | |
JP2002531096A (en) | Methods for transforming plastids | |
US20120144524A1 (en) | Soybean promoter ltp4 and flower-preferred expression thereof in transgenic plants | |
US6437219B1 (en) | Nucleic acids encoding sucrose-binding proteins | |
CA2348388A1 (en) | Gene regulating circadian clock function and photoperiodism | |
AU701718B2 (en) | Processes for modifying plant flowering behaviour | |
US8759612B2 (en) | Soybean promoters LTP2 and flower-preferred expression thereof in transgenic plants | |
CA2363505A1 (en) | Method for shortening internode of inflorescence by introducing gene for petunia transcription factor petspl2 | |
US6784342B1 (en) | Regulation of embryonic transcription in plants | |
US7250296B2 (en) | Nucleotide sequences of 2S albumin gene and its promoter from grape and uses thereof | |
US6600091B1 (en) | Enzymes responsible for the metabolism of zeatin | |
US7179957B1 (en) | Method for altering nitrogen or oil content of seeds by down regulating AGL11 expression or activity | |
MXPA99010580A (en) | Sucrose-binding proteins | |
US7148405B2 (en) | Enzymes responsible for the metabolism of cis-zeatin | |
AU707577C (en) | Transgenic plants with altered senescence characteristics | |
AU5496199A (en) | Transgenic plants with altered senescence characteristics | |
CA2383376A1 (en) | Flax seed specific promoters |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
WWE | Wipo information: entry into national phase |
Ref document number: 98805333.0 Country of ref document: CN |
|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM GW HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: PA/a/1999/010580 Country of ref document: MX |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09424283 Country of ref document: US |
|
ENP | Entry into the national phase |
Ref document number: 2291450 Country of ref document: CA Ref document number: 2291450 Country of ref document: CA Kind code of ref document: A Ref document number: 1998 550659 Country of ref document: JP Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 75009/98 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1998922474 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1998922474 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 75009/98 Country of ref document: AU |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1998922474 Country of ref document: EP |