Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/67—General methods for enhancing the expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/0018—Culture media for cell or tissue culture
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/13—Decoys
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/315—Phosphorothioates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
  • C12N2501/60—Transcription factors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2510/00—Genetically modified cells
  • C12N2510/02—Cells for production

Definitions

• PRODUCTION OF FUNCTIONAL PROTEINS BALANCE OF SHEAR STRESS AND GRAVITY
• the present invention relates generally to the fields of protein chemistry, endocrinology and gene therapy. More specifically, the present invention relates to a method for production of functional proteins in culture in response to shear stress using a rotating wall vessel.
• Rotating wall vessels including models with perfusion, are a quantum advance.
• the rotating wall vessel is a horizontally rotated cylindrical cell culture device with a coaxial tubular oxygenator (1, 5-7).
• the rotating wall vessel induces expression of select tissue-specific proteins in diverse cell cultures (1-2, 8- 9). Examples of expression of tissue-specific proteins include carcinoembryonic antigen expression in MIP-101 colon carcinoma cells (2), prostate specific antigen induction in human prostate fibroblasts (7), through matrix material induction during chondrocyte culture (8).
• the quiescent cell culture environment of the rotating wall vessel balances gravity with shear and other forces without obvious mass transfer tradeoff (1-2, 4).
• the rotating wall vessel provides a culture environment suitable for co-cultures of diverse cell types, and three dimensional tissue construct formation.
• Pancreatic islets are prepared in rotating wall vessels to maintain production and regulation of insulin secretion.
• the islets are alginate encapsulated to create a non-inflammatory immune haven, and are implanted into the peritoneal cavity of Type I diabetic patients.
• This implantation of pancreatic islets has maintained normoglycemia for 18 months in diabetic patients, and progressed to Phase III clinical trials (4, 10).
• These vessels have also been applied to, for example, mammalian skeletal muscle tissue, cartilage, salivary glands, ovarian tumor cells, and colon crypt cells (11-13).
• Shear stress response elements have not previously been demonstrated in epithelial cells, either for structural genes of production of functional molecules.
• Vitamin D dependent rickets has been a disease familiar to family farms and larger animal husbandry industries for centuries (17-18).
• the development of renal replacement therapy by dialysis in humans expanded vitamin D deficient bone disease from an occasional human clinical caveat to a common clinical problem.
• the active 1,25-diOH form of vitamin D 3 is mainly used to treat bone disease in dialysis patients but has *also been implicated as a therapy for osteoporosis, and some forms of cancer.
• vitamin D has been recognized to play a central role not only in other common bone lesions such as osteoporosis due to aging and steroid induced osteoporosis, but in immune function and surveillance, growth and development, and cardiac and skeletal muscle function (19-22).
• the importance of the renal 1 - ⁇ -hydroxylase is best understood by comparing the kinetics of the renal enzyme to other forms in the body (29-30). Demonstration that nephrectomy in pregnant rats did not completely abolish 1,25- diOH-D 3 formation sparked an intensive search for extrarenal sites of 1 ⁇ - hydroxylase activity (29). Although 1 ⁇ -hydroxylase activity has been reported in monocytes, liver, aortic endothelium and a variety of placental and fetal tissues, the enzyme kinetics contrast sharply with the renal 1 ⁇ -hydroxylase. Extrarenal 1- ⁇ - hydroxylase has a much higher Km indicating that much higher substrate levels are needed for activity (29).
• renal proximal tubular epithelial cells are the abundance of apically derived micro villi, the glycoprotein content of associated intermicrovillar clefts, and the highly distinctive arrangement of subapical endosomal elements (39-40).
• Renal epithelial cells of the proximal tubule are characterized by thousands of long apical micro villi.
• the apical endosomal machinery begins in intermicrovillar clefts.
• the endosomal pathway is characterized by clathrin coated vesicles, small spherical endosomal vesicles, with deeper larger endosomal vacuoles (33, 39). From the endosomal vacuoles proteins and lipids either recycle to apical surface in dense apical tubules or shuttle to lysosomes to be degraded.
• a cluster of apical proteins with homologous sequence repeats are especially desirable to express in cultured cells as they are thought to be molecular mediators of renal injury (41-43).
• Two of these proteins megalin (gp330) and cubulin (gp280) (Moestrup, et al., J. Biol. Chem.R273 (9):5325-5242 (1998) are molecular mediators of tubular vacuolation and ensuing secondary damage.
• Megalin (gp330) is a receptor found on the luminal surface of the proximal tubular cells of the kidney. Megalin binds several proteins and drugs including aminoglycoside antibiotics and other polybasic drugs.
• Gp280 is a receptor found on the luminal surface of the proximal tubular cells of the kidney. Gp280 binds several proteins and drugs including intrinsic factor-cobalamin (vitamin B12 bound to its carrier protein) and myeloma light chains. Cubulin (gp280) is expressed in the kidney, ear, and placenta. The only cells which express cubulin (gp280) in culture are immortalized placental cells. There is no known renal cell culture which expresses cubulin (gp280).
• Erythropoietin is a hormone produced in the kidney, and secreted into the blood. Erythropoietin controls the rate of production of red blood cells by the bone marrow. Erythropoietin may be produced by the interstitial cells between the tubules or the proximal tubular cells or both. Erythropoietin production is lost in all known renal cell culture systems. Erythropoietin is mainly used to treat anemia in dialysis patients but is also popular to treat the anemia of AIDS patients and many forms of cancer.
• the prior art is deficient in the lack of effective means of producing functional proteins including hormones in response to shear stress. Further, the prior art is deficient in the identification of shear stress response elements in epithelial cell genes.
• the present invention fulfills this longstanding need and desire in the art.
• a method of producing a functional protein comprising the steps of: isolating mammalian cells; placing said cells into a rotating wall vessel containing a cell culture comprising culture media and culture matrix; producing three-dimensional cell aggregates under simulated microgravity conditions; and detecting expression of the functional protein in the cell culture.
• a method of inducing expression of at least one gene in a cell comprising the steps of: contacting said cell with an transcription factor decoy oligonucleotide sequence directed against a nucleotide sequence encoding a shear stress response element; and determining the expression of said gene in said cell.
• a transcription factor decoy comprising an oligonucleotide sequence directed against a nucleotide sequence encoding a shear stress response element.
• Figure 1 shows homogeneity and structure of human renal epithelial cells in culture.
• Flow cytometry frequency histograms demonstrate number of cells positive for the proximal tubular marker ⁇ -glutamyl transferase.
• Figure 1A shows the number of cells with ⁇ -glutamyl transferase activity as the frequency of activity in 2000 cells compared to an unstained control with trapping agent alone. This is the raw digest of human renal cells.
• Figure IB shows that following differential trypsinization, the percentage of proximal tubular cells present can be increased to 99+1%.
• Figure 1C and ID show transmission electron micrographs of human epithelial cells in culture.
• the intact renal cortex in vivo is compared to culture of the natural mixture of human renal cortical cells in conventional 2- dimensional culture (middle left panel) which is completely devoid of microvilli.
• Rotating wall vessel culture of pure proximal tubular cells shows some microvilli (middle right panel) but there are far more microvilli during rotating wall vessel culture of the natural mix of renal cortical cells (far right panel).
• some areas of the natural mixture of cells in the rotating wall vessel show much greater abundance of microvilli, and well defined desmosomes (lower panel) which are lacking in the other cultures.
• Figure 2 shows protein expression in the rotating wall vessel.
• Figure 2A shows analysis of the expression and endosomal compartmentation of megalin, and cubulin in renal cells following rotating wall vessel culture.
• the ability of flow cytometry to make simultaneous measurements of entrapped fiuorescein dextran as an endosomal marker and antibody binding allows construction of three dimensional frequency histograms displaying entrapped fiuorescein dextran fluorescence against antibody binding on horizontal axes.
• a control sample shows vesicles negative for fiuorescein on the left and fiuorescein containing endosomes on the right (2000 vesicles depicted left panel).
• a control without fiuorescein entrapped shows only the left population (not shown).
• Co localization of anti-cubulin binding demonstrates that all the fiuorescein positive endosomes are positive for cubulin, while non-endosomal membranes can be subdivided into cubulin positive and negative populations (middle panel). This pattern is repeated for anti-megalin binding in renal cortical cells (right panel).
• Figure 2B shows quantitation of cubulin, and megalin antibody binding to renal cell membranes under various culture conditions. Analysis of protein expression in cultured cells by antibody binding used classic serial log dilution antibody curves. An increase in binding with a decrease in dilution is pathognomonic for specific antibody binding during flow cytometry analysis.
• Figure 2C depicts non-specific (minimum) and peak binding of each antiserum following rotating wall vessel culture and two-dimensional SDS-PAGE analysis of protein content of cells following rotating wall vessel culture.
• Molecular weight (14-220 kDa) on the abscissa is displayed against isoelectric point (pH 3-10) on the ordinate.
• Figure 3 shows gene expression in the rotating wall vessel.
• Figure 3 A and Figure 3B show differential display of genetic expression of rat renal cortical cells grown in conventional culture or rotating wall vessels. Differential display of expressed genes was compared in aliquots of the same cells grown in a 55 ml rotating wall vessel (STLV) or conventional gas permeable 2-dimensional bag controls. For differential display, copies of expressed genes were generated by polymerase chain reaction using random 25mer primers and separated on a 6% DNA sequencing gel (Figure 3A). Bands of different intensity between control and STLV, representing differentially expressed genes, were identified by visual inspection, excised and reamplified using the same primers. Differential expression and transcript size were confirmed by Northern hybridization ( Figure 3B).
• PCR products were then subcloned into the pGEM-T vector and sequenced. Sequences were compared to the Genebank sequences using the BLAST search engine.
• One expressed gene which decreased in the STLV (band D on gelabove) was identified as rat manganese-containing superoxide dysmutase (98% match 142 of 144 nucleotides).
• Figure 3C and Figure 3D show RT-PCR of time dependent change in genes during rotating wall vessel culture.
• Semi quantitative RT-PCR shows increases in the epithelial genes megalin, villin and extra-cellular calcium sensing receptor (ECaR), the shear stress response element genes ICAM, VCAM and MnSOD (Figure 3C).
• EaR extra-cellular calcium sensing receptor
• ICAM the shear stress response element genes
• VCAM the shear stress response element genes
• MnSOD Figure 3C
• Figure 3C shows b-actin or GADPH.
• Figure 4 shows structure and effects of antisense probe for shear stress response element on rat renal cortical epithelial cells.
• Figure 4A shows the structure.
• the probe with sequence CTGAGACCGATATCGGTCTCAG (SEQ ID No:l) has two possible conformations. As a single strand it would fold back on itself to form a binding element for the transcription factor. As a double strand it would then have two binding sites for the transcription factor, one in the sense orientation and one in the antisense orientation.
• Figure 4B shows effects of antisense shear stress response element probe on time dependent gene expression.
• the antisense probe added to conventional 2-dimensional cultures of rat renal cortical cells at 80 nm increases MnSOD in a time dependent manner. Comparison is made to controls with the active binding site scrambled. In contrast the probe has no effect on villin gene expression.
• Figure 5 shows gene expression in the rotating wall vessel: automated gene analysis. Abundance of the expression of over 18,300 genes was assayed by annealing poly A RNA from human renal cortical epithelial cells grown in a rotating wall vessel for 8 days to a filter robotically loaded with oligonucleotide primers. Poly A RNA from a non adherent bag culture serves as a control. The filters are shown at the top of the diagram then the analysis of shear stress responsive genes, renal epithelium specific genes, and other genes germane to the current analysis.
• the present invention is directed to a method of producing a functional protein, comprising the steps of: isolating mammalian cells; placing said cells into a rotating wall vessel containing a cell culture comprising culture media and culture matrix; producing three-dimensional cell aggregates under simulated microgravity conditions; and detecting expression of the functional protein in the cell culture.
• simulated microgravity conditions comprise a balance between gravity and oppositely directed physical forces. Representative examples such physical forces include sedimentational shear stress, centrifugal forces, viscosity and coriolus forces.
• the functional protein is selected from the group consisting of a hormone, a toxin receptor and a shear stress dependent functional biomolecule.
• hormones which can be produced according to the method of the present invention include 1,25-dihydroxy- vitamin D3 and erythropoietin.
• toxin receptors which can be produced according to the method of the present invention include megalin and cubulin.
• any mammalian cell could be used in the methods of the present invention.
• mammalian cells include renal cortical cells, renal fibroblast cells, hepatocytes, pancreatic islets, renal interstitial cells, parathyroid cells, thyroid cells, pituitary cells, ovarian cells and testicular cells.
• the cell is selected from the group consisting of epithelial cell and endothelial cell.
• cell contains shear stress response elements.
• shear stress response element include GAGACC and GGTCTC.
• the rotating wall vessel is initiated and maintained from about 6 rotations per minute to about 16 rotations per minute.
• the sedimentational shear stress is from about 0.2 dynes/cm2 to about 1.0 dynes/cm2.
• the culture matrix may contain a core structure selected from the group consisting of cell aggregates and microcarrier beads, although other components to such a culture matrix are well known to those having ordinary skill in this art.
• the present invention is also directed to a method of inducing expression of at least one gene in a cell, comprising the steps of: contacting said cell with an transcription factor decoy oligonucleotide sequence directed against a nucleotide sequence encoding a shear stress response element; and determining the expression of said gene in said cell.
• oligonucleotide comprises a terminal phosphothiorate moiety and a phosphodiester backbone and a structure which allows the oligonucleotide to pass cell membranes and accumulate in the nuclear compartment of the cell.
• the cell is a cultured cell.
• the cell is selected from the group consisting of an epithelial cell and an endothelial cell.
• Representative examples of which can be used in this method include renal cortical cell, renal fibroblast cell, hepatocyte, pancreatic islet, renal interstitial cell, parathyroid cell, thyroid cell, pituitary cell, ovarian cell and testicular cell.
• the cell is grown in two dimensional culture.
• Representative examples of shear stress response elements include GAGACC and GGTCTC.
• the gene encodes a protein selected from the group consisting of megalin, cubulin, erythropoietin and 1-a-hydroxylase.
• the concentration of the oligonucleotide useful in this method generally ranges from about 10 nm to about 10 mm.
• the present invention is also directed to a transcription factor decoy, comprising an oligonucleotide sequence directed against a nucleotide sequence encoding a shear stress response element.
• the nucleotide sequence encoding a shear stress response element has a sequence selected from the group consisting of GAGACC and GGTCTC.
• the rotating wall vessel is generally initiated and maintained at 10 rotations per minute.
• the rotating wall vessel provides a balance of forces comprising gravity and equal and opposite sedimentational shear stress.
• Useful sedimentational shear stress rates within the context of the claimed methods are from about 0.2 dynes/cm2 to 1.0 dynes/cm2.
• rotating wall vessels ⁇ refers to a cylidrical horizontal rotating culture vessel with a coaxial oxygenator.
• shear stress response element ⁇ refers to a sequence of a family of genes in the cell nucleus which binds one or more transcription factors in response to shear stress on the cell.
• a representative example of a shear stress response element is GAGACC or its complementary sequence GGTCTC.
• shear stress conditions ⁇ refers to flow of liquid, or current of liquid over cells which causes genes to turn on or off.
• slow turning lateral vessel ⁇ refers to one specific size and shape of a rotating wall vessel.
• differential display ⁇ refers to displaying on a filter, gel or chip a discrete set of genes turned on or off in a cell under two different conditions.
• simulated microgravity ⁇ refers to balance of gravity by oppositely directed forces including shear stresses during rotational wall vessel culture.
• graded gravitational sedimentation shear ⁇ refers to the shear imparted to a particle or cell falling through fluid.
• functional protein ⁇ refers to a protein with biological effects.
• three-dimensional co-culture process ⁇ refers to cells grown in a matrix or on beads (or other three-dimensional structural support) in a three-dimensional array, rather than on a flat plate.
• coriolus force ⁇ refers to an incidental flow field caused by the rotating gravity vector in the rotating wall vessel.
• shear stress ⁇ refers to the force felt at the surface of the particle as it moves through the fluid.
• gravity induced sedimentation ⁇ refers to the force on a particle in the rotating wall vessel making it fall through the fluid due to gravity.
• centrifugal force ⁇ refers to the force on a particle in the rotating wall vessel which pulls it towards the wall due to rotational speed.
• transcription factor decoy ⁇ refers to an oligonucleotide folded to form a double stranded DNA which binds a nuclear trancription factor.
• the transcription factor decoy prevents the transcription factor from binding promoter regions regulating expression of specific genes.
• Human renal cortical cells were isolated by Clonetics Inc. (San Diego, CA) from kidneys unsuitable for transplantation. Differential trypsinization resulted in cell fractions highly purified for proximal tubular cells compared to the natural mixture of cells in the renal cortex. The co-culture of the natural cell mix, and highly purified proximal tubular cells were cultured separately in a special growth medium with 2% fetal calf serum.
• Rat renal cells were isolated from renal cortex harvested from euthenized Sprague Dawley rats (Harlan Sprague-Dawley, Cleveland OH) as described (44).
• renal cortex was dissected out with scissors, minced finely in a renal cell buffer 137 mmol NaCl, 5.4 mmol KCl, 2.8 mmol CaC12, 1.2 mmol MgC12, 10 mmol HEPES-Tris, pH 7.4.
• the minced tissue was placed in 10 ml of a solution of 0.1% Type IV collagenase and 0.1% trypsin in normal saline. The solution was incubated in a 37oC shaking water bath for 45 minutes with intermittent titration.
• the cells were spun gently (800rpm for 5 minutes), the supernatant aspirated, the cells resuspended in 5 ml renal cell buffer with 0.1% bovine serum, and passed through a fine (70 mm) mesh. The fraction passing through the mesh was layered over a discontinuous gradient of 5% bovine serum albumin and spun gently. The supernatant was again discarded.
• the cells were resuspended in DMEM/F-12 medium (ciprofloxacin and fungizone treated) and placed into culture in various culture vessels in a 5% CO2 95% 02 incubator.
• both the highly purified cells as well as the cell mix form a monolayer.
• Fetal calf serum was used at optimal concentration: 2% for human cells and 10% for rat cells.
• STLV slow turning lateral vessel
• the slow turning lateral vessel was filled with medium, and seeded by addition of cell suspension (2X106 cells/ml).
• Residual air was removed through a syringe port and vessel rotation was initiated at 10 rotations per minute, and maintained for 10-16 days. Medium was changed every 2 to 3 days depending on glucose utilization.
• Concomitant with cells microcarrier beads were added an 5 mg/ml to promote aggregate formation in the slow turning lateral vessel. Without beads the cells became shattered in the vessel in a few hours. Beads were cytodex-3 in all protocol except when electron microscopy was planned when the much more expensive, but easily sectioned Cultisphere GL cells were added to the vessels.
• a post-nuclear supernatant was formed as the l l,000g supernatant, 180,000g pellet of membrane vessels (Figure 2A).
• Aliquots of membrane vesicles were labeled with megalin or cubulin antisera.
• the megalin and cubulin antisera were rabbit polyclonals raised to affinity purified and chromatographically pure receptor (43, 48).
• Membrane vesicles were first pre-incubated in 50% normal goat serum for 2 hours to reduce non-specific binding of secondary antisera raised in goat. After washing aliquots of membrane vesicles were stained with serial log dilution of antisera and incubated at 4oC overnight.
• Differential display of expressed genes was compared in aliquots of the same cells grown in a 55 ml rotating wall vessel (slow turning lateral vessel) or conventional gas permeable 2-dimensional bag controls ( Figure 3 A and 3B). Differential display was performed using Delta RNA Fingerprinting system (Clontech labs, Palo Alto CA). Copies of expressed genes were generated by polymerase chain reaction using random 25mer primers and separated on a 6% DNA sequencing gal. Bands of different intensity between control and slow turning lateral vessel, representing differentially expressed genes, were identified by visual inspection, excised and reamplified using the same primers. Differential expression and transcript size were confirmed by Northern hybridization.
• PCR products were then subcloned into the pGEM-T vector (Promega, Madison WI) and sequenced using fMOL cycle sequencing system (Promega, Madison, WI). Sequences were compared to the Genebank sequences using the BLAST search engine (National Center for Biotechnology Information). For genes of interest the bands were labeled with 32P for confirmation of the changes by Northern blot analysis.
• RNA was first isolated, followed by isolation of poly A+ RNA.
• 10%-20% of each cDNA was amplified (Robocycler 40, Stratagene, La JoUa, CA) using 95oC denaturation, 63oC annealing and 72oC extension temperatures. Amplification was for a total of 30 cycles with the first three cycles having extended denaturation and annealing times.
• Positive and negative strand PCR primers, respectively, were derived from published sequences using Generunner software.
• Double stranded genetic decoys matching the sequence of a known shear stress response element were synthesized (Chemicon International Inc., La Jolla, CA) (structure and sequence shown at top of Figure 4). These decoys had a terminal phosphothiorate moiety to prevent intracellular lysis, and a phosphodiester backbone to facilitate passage across cell membranes (49). Passage to and accumulation in the nuclear compartment of cultured cells was confirmed by confocal imaging of a fiuorescein tagged decoy. Three decoys were synthesized: the active decoy, a random sequence control in which the six bases of the shear stress response element were scrambled, and a fiuorescein conjugated form of the decoy. Decoys were placed in the cell culture medium of rat renal cortical cells grown as above in conventional two-dimensional culture. Aliquots of cells exposed to control or active sequence decoy at 80 nm concentration were harvested at 2, 6 and 24 hours after exposure.
• a sample of human renal cortical cells grown in conventional flask culture was trypsinized and split into a gas permeable bag control and a rotating wall vessel (55 ml slow turning lateral vessel). After 8 days of culture on 5 mg/ml cytodex-3 beads, cells were washed once with ice cold phosphate buffered saline, the cells were then lysed and mRNA was selected with biotinylated oligo(dT) then separated with streptavidin paramagnetic particles (PolyATtract System 1000, Promega Madison, WI). 32P labeled cDNA probes were then generated by reverse transcription with 32P dCTP. The cDNA probes were hybridized to identical Gene Discovery Array Filters (Genome Systems Inc.
• the Gene Discovery Array filters contain 18,394 unique human genes from the I.M.A.G.E. Consortium [LLNL](15) cDNA Libraries which are robotically arrayed on each of a pair of filter membranes. Gene expression was then detected by phosphor imaging and analyzed using the Gene Discovery Software [Genome Systems] (50).
• the 1-a-hydroxylase enzyme As the 1-a-hydroxylase enzyme has never been isolated or cloned it is assayed functionally by the production of 1,25-dihydroxy- vitamin D3 from ultrapure exogenous 25-hydroxy vitamin D3.
• the classic Michaelis Menton kinetics of the enzyme are determined by assaying equal aliquots of renal cell aggregates in a curve of 25-OH D3 substrate concentrations from 0.1 to 10 mg/ml in 6 steps. All incubations are performed in the presence of the anti-oxidant DPED at 10 mM to ensure no contribution of non-enzymatic oxygenation (23-26). 1,25-diOH D3 generated in vitroBwas quantitated as described (23-27).
• In vitro ⁇ incubations were terminated by adding a volume of acetonitrile equal to the incubation volume. Each incubation tube received 1,000 cpm of 3 H- 1,25 dihydroxy D3 to estimate recovery losses during the extensive extraction and purification scheme.
• the 1,25-dihydroxy D3 is extracted from the incubation medium by C18 solid-phase extraction (24-25). Following extraction, the samples are evaporated to dryness under N2 and dissolved in 2 ml of methylene chloride. The samples are then applied to silica Bond-Elut cartridges and the 1,25-dihydroxy D3-containing fraction is isolated and collected (26).
• Plasma 1-25- dihydroxy vitamin D3 was assayed in a similar fashion, but as the product is already formed, assay begins with extraction into acetonitrile (23-26). Hence, all measurement of 1-a-hydroxylase activity in cells included determination of the Michaelis Menton Km and Vmax of the enzyme. The Michaelis Menton parameters were determined by automated curve fitting. EXAMPLE 13 Culturing Renal Fibrob lasts and Assay for Production ofErythropoietin
• renal fibroblasts are the source of erythropoietin secreted into the circulation
• renal fibroblasts were cultured.
• Freshly dissected rat renal cortex was minced and collagenase ⁇ trypsin digested prior to removal of debris on a single discontinuous 5% albumin gradient.
• the mixture of rat renal cortical cells was placed into culture in DMEMVF12 with 20% fetal bovine serum. After two weeks to encourage fibroblast overgrowth in the rich medium, fibroblast growth factor was added.
• the resultant culture had fibroblastic features in the culture flask and was inoculated into a high aspect rotating vessell (HARV) for culture under increased shear stress conditions. The cells aggregate on the beads and slowly increasing their numbers.
• HAV high aspect rotating vessell
• erythropoietin was assayed in the cell supernatant.
• the media were concentrated 15X and assayed via RIA.
• the media alone was also concentrated 15X as the control.
• hepatocytes are a source of erythropoietin secreted into the circulation
• immortalized human hepatocyes were cultured under control and applied shear stress conditions.
• the Hep3B cells were placed into culture in DMEM with 10%) fetal bovine serum in static flask culture. The resultant culture was split, one half remaining in static flask culture and the other half was inoculated into a HARV for culture under increased shear stress conditions. The cells aggregated on the beads. After 24 hours growing the Hep3B cells in a HARV, erythropoietin was assayed in the cell supernatant. The media were assayed by RIA. The static flask media was also assayed as the control.
• the immortal hepatic cell line, Hep3B constitutively produces erythropoietin.
• the 5' promoter and 3' enhancer regions of the gene contain putative shear stress response elements.
• the role of these elements in the enhancement of erythropoietin production in response to shear was tested by using integrated perfused rotating wall vessel culture to reintroduce graded shear.
• This protocol utilizes a library of promoters driving luciferase reporters genes, with various constructs lacking the putative shear stress response elements. It also allows DNA footprinting analysis of the histones which bind the promoter and enhancer elements.
• proximal tubular cells in human renal cell fractions isolated by differential trypsinization was assayed using an entrapped fluogenic substrate for the proximal enzyme marker g-glutamyl-transferase (44).
• proximal tubular enrichments as high as 99+1% could be achieved (right panel).
• a control without fiuorescein entrapped shows only the left population (not shown).
• Co localization of anti-cubulin binding demonstrates that all the fiuorescein positive endosomes were positive for cubulin, while non-endosomal membranes could be subdivided into cubulin positive and negative populations, (middle panel). This pattern was repeated for anti-megalin binding in renal cortical cells (right panel) in culture.
• differential display were performed. Differential display of expressed genes was compared in aliquots of the same cells grown in a 55 ml rotating wall vessel (slow turning lateral vessel) or conventional gas permeable 2-dimensional bag controls. Differential display of copies of expressed genes were generated by polymerase chain reaction using random 25mer primers and separated on a 6% DNA sequencing gel. Bands of different intensity between control and slow turning lateral vessel, representing differentially expressed genes, were identified by visual inspection, excised and reamplified using the same primers. Differential expression and transcript size were confirmed by Northern hybridization. PCR products were then subcloned into the pGEM-T vector and sequenced.
• TABLE 3 indicates that human embryonic kidney cells show increased structural differentiation during culture in simulated microgravity conditions, and express 10 fold greater 1 -a-hydroxylase activity than under conventional culture conditions.
• results of cell supernatant erythropoietin assay from renal fibroblasts and hepatocytes culture were shown in Table 4 and Table 5, respectively.
• the results shown in TABLES 4 and 5 indicate erythropoietin production was increased in both renal and hepatic cells during graded gravitational sedimentation shear.
• Erythropoietin has the classic shear stress response elements in the promoter and enhancer regions which control expression of its gene.
• the results shown in Tables 4 and 5 also indicate that the expression of the erythropoietin gene was upregulated by those shear stress response elements during graded gravitational sedimentation shear in the vessel.
• Rotating wall vessels have been used by other investigators as "simulated microgravity".
• the present invention contends that gravity is still active, and that in a rotating wall vessel gravity is balanced by equal and opposite sedimentational shear stress.
• a centrifugal force due to spinning the cells, quantitatively much smaller than gravity, is also present and offset by equal and opposite sedimentational shear stress.
• the present invention presents a new concept that rotating wall vessels provide this new balance of forces, including application of sedimentational shear, rather than microgravity.
• the rotating wall vessel bioreactor provides quiescent co-localization of dissimilar cell types (1, 46), mass transfer rates that accommodate molecular scaffolding and a micro-environment that includes growth factors (1, 46).
• Engineering analysis of the forces active in the vessel is complex (1, 5-7). This study provides the first evidence for the cell biological mechanisms by which the vessel induces changes in tissue specific gene and protein expression.
• the rotating wall vessel induces an order of magnitude more expression of the renal toxin receptors cubulin and megalin than stirred fermentor culture.
• the rotating wall vessel induces 0.5-1.0 dynes/cm2 shear stress (1), while stirred fermentors induce 2-40 dynes/cm2 depending on design and rotation speed (1, 5, 46). This degree of stress damages or kills most epithelial cells (1, 5, 46).
• Rotating wall vessel culture induced changes in a select set of genes as evidenced by the genetic differential display gels and 2-dimensional protein gel analysis.
• erythropoietin production is controlled by a shear stress element which mediates changes observed during graded gravitation sedimentation shear.
• 1 -a-hydroxylase activity is maintained and increased in both renal cortical epithelial cells and human embryonic kidney cells, wherein the induction of the enzyme (1 -a-hydroxylase) converts 25-hydroxy- vitamin D3 to the active 1,25- dihydroxy- vitamin D3 form.
• the present invention is the first demonstration of a process for production of molecules including hormones and other biomolecules induced by shear stress and other forces.
• the mechanistic information can be interpreted from knowledge of the pattern of response and distribution of certain gene products. Megalin and cubulin represent the first pattern of change, as these proteins are restricted in distribution to renal cortical tubular epithelial cells. The increase in megalin mRNA and protein,- and cubulin protein expression is therefore unequivocal evidence for changes in the epithelial cells. This provides an important new tool for studies of nephrotoxicity. Long suspected to play a role in renal toxicity, the tissue restricted giant glycoprotein receptors megalin and cubulin, have recently been shown to be receptors for common nephrotoxins.
• Megalin is a receptor for polybasic drugs such as the aminoglycoside antibiotic gentamicin (48) and vitamin D binding protein (51), and cubulin is the receptor for vitamin-B12 intrinsic factor (52). Although these receptors are expressed by transformed placental cells in culture (9, 43), there is currently no renal model expressing these markers for toxicology investigations (53). Rotating wall culture provides a fresh approach to expression of renal specific markers in culture for study on the pharmacology, biochemistry and toxicology which define the unique properties and sensitivities of renal epithelial cells.
• the second pattern of change is represented by villin.
• Message for the microvilli protein villin increases in the rotating wall vessel in the first day of culture, and soon reformation of microvilli was observed.
• a decoy matching the nuclear binding motif of a putative shear stress response element failed to induce similar changes.
• the promoter for villin has not been cloned, this suggests the changes in villin were induced by other transcription factors which may be due to shear stress or other stimuli in the bioreactor.
• Villin is also restricted to brush border membranes such as renal proximal tubular cells, or colonic villi (54-55). The observed increases in villin message resolved after 16 days of rotating wall vessel culture.
• Magnesium dependent superoxide dismutase represents a third pattern of response: a mitochondrial enzyme, ubiquitous is distribution, modulated by the classic shear stress response element in endothelial cells (56-57). Magnesium dependent superoxide dismutase message decreased early in the first day of rotating wall vessel culture, and this was persistent after 16 days in culture. These changes were confirmed when magnesium dependent superoxide dismutase was identified as suppressed in the differential display analysis of gene changes, and Northern blot confirmation was performed. A decoy for the classic shear stress response element induced an increase in magnesium dependent superoxide dismutase (MnSOD), which indicates that similar changes to the rotating wall vessel can be induced by the use of genetic decoys.
• MnSOD magnesium dependent superoxide dismutase
• the biological process of genetic induction by defined shear stress elements can be produced by multiple means including genetic decoys or use of the rotating wall vessel.
• Other shear stress response element dependent genes specifically, intercellular adhesion molecule 1 (ICAM) and vascular cell adhesion molecule (VCAM) had changes in the rotating wall vessel opposite to magnesium dependent superoxide dismutase, mirroring observations made during flow induced stress in endothelial cells (56-57). This provides three lines of evidence consistent with a role for shear stress as one mediator of genetic changes induced in the rotating wall vessel.
• IAM intercellular adhesion molecule 1
• VCAM vascular cell adhesion molecule
• the data here demonstrates internal consistency.
• the changes in magnesium dependent superoxide dismutase were observed on differential display, confirmed by Northern blot analysis, and matched responses were detected by RT- PCR.
• Megalin demonstrated matched changes in RT-PCR gene and protein expression. Changes in villin observed by RT-PCR were associated with dramatic reformation of microvilli, in which villin is a major structural protein.
• semi-quantitative RT-PCR is prone to inherent variation due to the massive amplification of signals, the use of multiple controls which remain unchanged (b- actin, GAPDH and 18S), and experimental confirmation that reactions were linearly related to cDNA concentration, minimizes these problems.
• the internally consistent findings by other methods strongly suggests this RT-PCR data is valid.
• shear stress response elements which modulate gene expression in endothelial cells, are also active in epithelial cells, although other investigators failed to see an effect of shear stress on epithelial cells.
• the present invention demonstrates that epithelial cells have shear stress response elements and change gene expression in response to physical forces including but not limited to sedimentational shear stress.
• the rotating wall vessel gains popularity as a clinical tool to produce hormonal implants it is desirable to understand mechanisms by which it induces genetic changes (10, 60), if necessary to prolong the useful life of implants.
• shear stress response elements are the first mechanism identified by which the rotating wall vessel induces genetic changes.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Chemical & Material Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Cell Biology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (6)

Applications Claiming Priority (2)

Publications (1)

Family

ID=21926026

Family Applications (1)

Country Status (7)

Cited By (3)

Families Citing this family (1)

Citations (2)

• 1998
  • 1998-04-07 JP JP54098398A patent/JP2001517081A/ja not_active Ceased
  • 1998-04-07 CA CA002286349A patent/CA2286349A1/en not_active Abandoned
  • 1998-04-07 EP EP98915320A patent/EP0972069A1/en not_active Withdrawn
  • 1998-04-07 WO PCT/US1998/006826 patent/WO1998045468A1/en not_active Application Discontinuation
  • 1998-04-07 IL IL13226498A patent/IL132264A0/xx unknown
  • 1998-04-07 AU AU69534/98A patent/AU6953498A/en not_active Abandoned
  • 1998-04-07 BR BR9808510-7A patent/BR9808510A/pt not_active IP Right Cessation

Patent Citations (2)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events