WO1998007734A1 - Oligonucleotide prodrugs - Google Patents

Oligonucleotide prodrugs Download PDF

Info

Publication number
WO1998007734A1
WO1998007734A1 PCT/US1997/014751 US9714751W WO9807734A1 WO 1998007734 A1 WO1998007734 A1 WO 1998007734A1 US 9714751 W US9714751 W US 9714751W WO 9807734 A1 WO9807734 A1 WO 9807734A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
prodrug
group
phosphate
linkage
Prior art date
Application number
PCT/US1997/014751
Other languages
French (fr)
Inventor
Radhakrishnan P. Iyer
Dong Yu
Sudhir Agrawal
Theresa Devlin
Original Assignee
Hybridon, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US2426296P priority Critical
Priority to US60/024,262 priority
Application filed by Hybridon, Inc. filed Critical Hybridon, Inc.
Publication of WO1998007734A1 publication Critical patent/WO1998007734A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/548Phosphates or phosphonates, e.g. bone-seeking
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/555Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound pre-targeting systems involving an organic compound, other than a peptide, protein or antibody, for targeting specific cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol

Abstract

Disclosed is an oligonucleotide prodrug comprising at least six covalently linked nucleotides, at least one of which is site-specifically derivatized with a lipophilic chemical group reversibly and covalently attached to the nucleotide at a 5' phosphate, a 3' phosphate, or an internucleotidic phosphate linkage. The prodrug is reactive with a cellular or tissue enzyme which cleaves the lipophilic group from the derivatized nucleotide, thereby regenerating the parent oligonucleotide.

Description

OLIGONUCLEOTIDE PRODRUGS

BACKGROUND OF THE INVENTION

This invention relates to antisense therapy. More particularly, this invention relates to compositions and methods for enhancing the cellular uptake of antisense oligonucleotides .

New chemotherapeutic agents have been developed which are capable of modulating cellular and foreign gene expression. These agents, called antisense oligonucleotides, are single-stranded oligonucleotides which bind to a target nucleic acid molecules according to the Watson-Crick or Hoogsteen rule of base pairing, and in doing so, disrupt the function of the target by one of several mechanisms: by preventing the binding of factors required for normal transcription, splicing, or translation; by triggering the enzymatic destruction of RNA by RNase H, or by destroying the target via reactive groups attached directly to the antisense oligonucleotide. Thus, they have become widely used research tools for inhibiting gene expression sequence specifically, and are under investigation for possible use as therapeutic agents {see, e.g., Lisciewicz et al . ( Proc. Natl. Acad. Sci. (USA) ( 1993 ) 90 : 3860-3864 ) ; Bayever et al . (1992) Antisense Res. Development 2:109- 110) .

In order for antisense molecules to have therapeutic value, they must have the ability to enter a cell and contact target endogenous nucleic acids. Furthermore, they must be able to withstand the rigors of the highly nucleolytic environment of the cell and/or body.

Recent studies have shown that oligonucleotides with certain modifications, such as artificial internucleotide linkages, not only render the oligonucleotides resistant to nucleolytic degradation (see, e.g., Agrawal et al . (1988) Proc. Natl. Acad. Sci. (USA) 85:7079-7083; Agrawal et al. (1989) Proc. Natl. Acad. Sci. (USA) 86:7790-7794; Gao et al . (1990) Antimicrob. Agents Che . 34:808; and Storey et al . (1991) Nucleic Acids Res. 19:4109), but also may increase cellular uptake of the oligonucleotide. For example, oligonucleotides with phosphorothioate or methylphosphonate internucleotide linkages have been found to bind to, and to be taken up by, cells more readily than phosphodiester-linked oligonucleotides (Zhao et al. (1993) Antisense Res. Dev. 3:53-56).

Oligonucleotide uptake is saturable, sequence-independent, and temperature and energy dependent . While there is some evidence to suggest that such uptake may occur through a

80,000 dalton membrane protein (Loke et al . (1989) Proc. Natl Acad. Sci. (USA) 86:3474; Yakubov et al .

(1989) Proc. Natl. Acad. Sci. (USA) 86:6454), the gene for this protein has not yet been cloned or characterized. One study suggests internalization of the oligonucleotide is by a caveolar, protocytotic mechanism rather than by endocytosis (Zamecnick (1994) Proc. Natl. Acad. Sci. (USA) 91:3156) . Whether oligonucleotides are internalized via a receptor-mediated endocytotic pathway, a pinocytic mechanism, or a combination of both remains poorly understood.

To improve on their cellular uptake, oligonucleotides have also been modified in ways other than those described above. For example, an oligonucleotide with improved cellular uptake has been disclosed having at least one nucleotide residue covalently linked at its 2 ' position with various molecules including an amino acid, polypeptide, protein, sugar, sugar phosphate, neurotransmitter , hormone, cyclodextrin, starch, steroid, or vitamin (WO 93/23,570). Enhanced cellular uptake of biotinylated oligonucleotide in the presence of avidin has also been demonstrated (Pardridge et al . (1991) FEBS Lett.

288:30-32). In addition, phosphodiester-linked oligodeoxynucleotides have been introduced into cells by the pore-forming agent streptolysin O (Barry et al . (1993) Biotech iques 15:1016-1018), and a liposomal preparation including cationic lipid has been shown to enhance the cellular uptake of antisense molecules targeted to a portion of a human intercellular adhesion molecule (Bennett et al. (1992) Mol Pharmacol. 41:1023-1033).

Phosphodiester-linked oligonucleotides bearing a 5 ' -cholesteryl modification show increased cellular uptake and biological effects (Krieg et al. (1993) Proc. Natl. Acad. Sci. (USA) 90:1048). In addition, antibody-targeted liposomes have been used to enhance the cellular uptake of oligonucleotides targeted to HLA class I molecules expressed by HIV-infected cells (Zelphati et al . (1993) Antisense Res. Dev. 3:323-338).

Specific non-oligonucleotidic , metabolically unstable molecules useful as medicaments have been prepared in the form of precursors or "prodrugs" which are capable of undergoing a chemical or enzyme-mediate transformation within the target organ or cell to release the therapeutic molecule (see, Bundgaard, in Bio-reversible Carriers in Drug Design. Theory and Application (Roche, ed.) Pergamon Press, NY (1987) pp. 13-94). For example, acyloxyalkyl ester-type groups have been appended to carboxylic groups of the β-lactam antibiotics such as pivampicillin, talampicillin, and bacampicillin to form prodrug derivatives of ampicillin (see, e.g., Daehne et al . (1970) J. Med. Chem. 13:607; Bodin et al. (1975) Antimicrob. Agents Chemother. 8:518; Clayton et al. (1976) J. Med. Chem. 19:1385). Phosphonate prodrugs of antiviral agents such as 9- [2-

(phosphonomethyoxy) -ethyl] adenine (PMEA) (Starrett et al. (1994) J. Med. Chem. 37:1857-1864) and trisodium phosphonoformate (foscarnet sodium) (Iyer et al . (1989) Tetrahedron Lett. 30:7141-7144) have been prepared to increase oral availability. Phosphate groups have been appended to N- phosphomethyl dipeptides to form prodrugs of zinc protease neutral endopeptidase, an antihypertensive (De Lombaert et al . (1994) J. Med. Chem. 37:498-511). Anticancer prodrugs of butyric acid have been prepared (Nudelman et al . (1994) J. Med. Chem. 35:687-694). In addition, anti-herpes prodrugs composed of diphosphate analogs of 5- iodo-2 ' -deoxy-uridine-5 ' -diphosphate have been reported (Jennings et al . (1992) J. Chem. Soc. Perkin Trans. 1:2196-2202)

However, prodrugs of antisense oligonucleotides heretofore have not existed, and insufficient uptake of modified and unmodified oligonucleotides remains a problem both in vitro and in vivo . Thus, there remains a need for improved compositions and methods for enhancing the cellular uptake and metabolic stability of antisense oligonucleotides. Such enhancement would ultimately result in an increased efficacy of antisense oligonucleotides and a reduction in the dose administered that have to be used. Ideally, such compositions and methods will also be useful for increasing the general lipid solubility of oligonucleotides.

SUMMARY OF THE INVENTION

This invention provides improved methods for enhancing the cellular uptake and metabolic stability of antisense oligonucleotides, for site- specific attachment or derivatization of a bioreversible ligands to oligonucleotides, and for increasing the cellular and general in vivo lipid solubility of such oligonucleotides. Also provided are antisense oligonucleotides with enhanced cellular uptake, increased oral bioavailability, sustained or controlled release characteristics, reduced toxicity, and increased ability to cross physiological barriers.

It has been discovered that the in vivo half- life and uptake of antisense oligonucleotides into cells can be enhanced by the reversible derivatization of these oligonucleotides with a lipophilic chemical group. Derivatization or covalent attachment of the lipophilic group to the oligonucleotide (s ) enhances lipophilicity of the hydrophilic oligonucleotide and consequently, cellular uptake. The addition of the lipophilic group also renders oligonucleotides less ionic and more susceptible to transport through of cell membranes than their underivatized parent. The lipophilic group masks the negative charges on the backbone of the oligonucleotide, thereby lessening undesirable interactions with other cellular macromolecules and reducing polyanion-related side effects. Once inside the cell or body, an endogenous enzyme cleaves the lipophilic group from the derivatized oligonucleotide, thereby regenerating the parent oligonucleotide. This discovery has been exploited to produce synthetic, reversibly derivatized antisense oligonucleotides or "oligonucleotide prodrugs" and methods of their use.

In one aspect of the invention, an oligonucleotide prodrug is provided. As used herein, the term "oligonucleotide prodrug" refers to a molecule including a plurality of nucleotides that are covalently linked together, 3' to 5 ' , 5' to 3 ' , 3 ' to 3 ' , 5 ' to 2 ' , 2 ' to 5 , 2 ' to 3 ' , or 3 ' to 2 ' , and which has been masked or derivatized with a chemical group that causes the oligonucleotide to become more lipophilic, and hence to pass through lipid membranes with more ease than can the parent molecule. In addition, the oligonucleotide in its "prodrug" form may be less susceptible to degradation than its parent, but like its parent, may hybridize to other nucleic acids having a complementary nucleotide sequence. When in contact with certain enzymes in the cell, tissue, or body, the prodrug is cleaved such that the parent oligonucleotide is regenerated.

The oligonucleotide prodrug includes at least six covalently linked nucleotides. At least one of these nucleotides is derivatized with a lipophilic chemical group reversibly and covalently attached to a 5 ' phosphate or a 3 ' phosphate of the nucleotide, or to an intemucleotidic phosphate linkage.

As used herein, the term "nucleotide" refers to deoxyribonucleotides and analogs thereof, including analogs having a cyclic sugar and/or modified bases and riboxynucleotides and analogs thereof. In some embodiments, the oligonucleotide prodrug is "a hybrid oligonucleotide," i.e., it includes at least one ribonucleotide or analog thereof, and at least one deoxyribonucleotide or analog thereof. In one specific embodiment, the ribonucleotide analog is a 2-O-alkyl ribonucleotide such as a 2-O-methyl. The lipophilic group attached to the nucleotide includes an ester linkage or an amide linkage. The prodrug reacts with a cellular or tissue enzyme which cleaves the lipophilic group from the derivatized nucleotide. In preferred embodiments, the enzyme is an esterase if the lipophilic group comprises an ester, or is a phosphoramidase if the lipophilic group is an amide .

In some aspects, the lipophilic group further includes a substituted aromatic ring, a cycloalkenyl ring, an alkenyl linkage, or an alkynyl linkage. As used herein, a "substituted aromatic ring" is meant to encompass a cyclic compound having six, ten, or multiples thereof, pi electron ring systems, wherein the ring has electron withdrawing groups or electron donating groups. Electron withdrawing groups include but are not limited to CN, COOR (where R = methyl, ethyl, propyl, or butyl), COOH, CO, halogen, N02 , or combinations thereof, and any other functional group into which delocalization of electrons from the aromatic ring occurs . Electron donating groups include but are not limited to OH, OR, R,

S, SR, and SH (where R = methyl, ethyl, propyl, or butyl), or combinations thereof. In some embodiments, the substituted aromatic ring is a phenyl , biphenyl , naphthyl , ananthranyl , or heterocyclic ring. In one embodiment, the substituted aromatic ring is a substituted phenyl ring. In particular embodiments, the aromatic ring is a para-disubstituted phenyl ring. The lipophilic chemical group covalently attached to the nucleotide is an alkyl, aryl, alkane, ar-alkyl, heterocyclic group, fatty acid, steroid ester, or steroid amide. In some preferred embodiments, if more than one nucleotide is derivatized, the chemical group attached thereto may be a mixture of these lipophilic groups. In other preferred embodiments, the lipophilic chemical group is attached to a sulfur, oxygen, or amine group on the 3 ' phosphate or the 5' phosphate of the nucleotide, or on an intemucleotidic phosphate, or to a phosphorothioate , phosphorodithioate, phosphoramidate, or phosphate ester group on the nucleotide.

In other embodiments, the oligonucleotide prodrug is "chimeric" . As used herein, "chimeric" refers to an oligonucleotide composed of more than one type of nucleotide. In one particular embodiment, the oligonucleotide prodrug consists of at least two different nucleotides such as a phosphodiester, carbamate, phosphorothioate, phosphorodithioate, acetamidate, phosphoramidate, phosphodiester, alkylphosphonate, carbonate, alkylphosphonothioate, phosphoramidite, or carboxymethyl ester, or any analog that is isosteric with the base sugar and internucleoside moiety of an unmodified oligonucleotide. In other embodiments, the oligonucleotide prodrug may be branched, i.e., may comprise two oligonucleotide sequences linked together via their 3 ' and/or 2 ' ends . The invention also provides a pharmaceutical formulation including an oligonucleotide prodrug and a pharmaceutically acceptable carrier. In some embodiments, this pharmaceutical formulation contains an oligonucleotide prodrug that is complementary to a region of a viral nucleic acid, and also contains another antiviral agent in addition to the prodrug. In one particular embodiment, the oligonucleotide prodrug in the pharmaceutical formulation is complementary to a first region of the viral nucleic acid, and the antiviral agent is an antisense oligonucleotide having a nucleotide sequence complementary to a second region of the viral nucleic acid which does not overlap with the first region. In yet another embodiment, the pharmaceutical formulation includes an orally tolerable carrier.

A method of increasing the cellular uptake and intracellular concentration of an exogenous oligonucleotide is also provided by the present invention. In this method, a cell is treated or contacted with the pharmaceutical formulation described above. Once inside the cell a cellular enzyme cleaves the lipophilic group on the prodrug from the reversibly derivatized nucleotide, thereby regenerating the parent oligonucleotide from the oligonucleotide prodrug. In this way, the intracellular concentration of the oligonucleotide is increased. In some preferred embodiments, the lipophilic group is cleavable by an esterase or phosphoramidase. In another aspect of the invention, a method of treating a cell for viral infection, or of preventing viral infection in the cell, is provided. In this method, the cell is contacted with an oligonucleotide prodrug having a nucleotide sequence complementary to a portion of the nucleic acid of a virus. The oligonucleotide prodrug enters the cell wherein an esterase or phosphoramidase cleaves the lipophilic chemical group from the derivatized nucleotide, thereby releasing the parent oligonucleotide. The oligonucleotide then hybridizes to a complementary portion of the viral nucleic acid. Thus, the invention provides a useful composition for treating inadvertently infected cell culture lines. Contamination of cell lines with viruses or mycoplasma can be eliminated by using the compositions according to the invention.

In yet another aspect, the invention provides a method of increasing the intracellular or in vivo lipid solubility and bioavailability of an oligonucleotide. In this method an oligonucleotide is derivatized to form an oligonucleotide prodrug which is more lipid soluble and bioavailable than the oligonucleotide. As described above, the prodrug includes at least six covalently linked nucleotides, at least one of which nucleotide has a 5' phosphate, a 3' phosphate, or an intemucleotidic phosphate linkage to which is reversibly and covalently attached a lipophilic chemical group, and which is cleavable with a cellular esterase or a phosphoramidase . The invention also provides a method of site specific derivitization of an oligonucleotide to increase its lipophilicity, ability to be taken up by a cell, intracellular or in vivo lipid solubility, and/or bioavailability. In this method a phosphate of a substituted nucleoside phosphoramidite is covalently coupled to a hydroxy group of a support-bound nucleoside or support- bound oligonucleotide, thereby forming a derivatized, support-bound oligonucleotide. The support-bound nucleoside or support-bound oligonucleotide comprises at least one protecting group on at least one nucleobase or base of the nucleoside or oligonucleotide. In one embodiment, the protecting group is N-pent-4-enoyl (PNT) . The substituted nucleoside phosphoramidite comprises a bioreversible linkage. This linkage comprises a lipophilic chemical group including an ester or an amide, and further comprises a substituted aromatic ring, a cycloalkenyl ring, an alkenyl linkage, or an alkynyl linkage. The bioreversible linkage further comprises a protecting group on at least one phosphate, the linkage being attached to the nucleoside phosphoramidite at a 3 ' phosphate, a 5' phosphate, or an inte ucleotidic phosphate. The protecting groups are then removed from the derivatized support-bound oligonucleotide with the exception of the protecting group on the bioreversible linkage. The derivatized support- bound oligonucleotide is cleaved from the support, and the derivatized oligonucleotide is then isolated. [In some embodiments, the coupling step is repeated with one or more substituted or unsubstituted nucleoside phosphoramidite monomers] .

BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing and other aspects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. 1 is a diagrammatic representation of a generalized scheme depicting the conversion of an oligonucleotide prodrug of the invention to an oligonucleotide, wherein "Z" is a functional group, "X" is O, S, or NR (R is alkyl or aryl), Y is O or S, R is alkyl, aryl, ar-alkyl, heterocyclic group, fatty acid, or steroid, " R" " is a branching group, and "Q" is a heteroatom such as O or S, or is a covalent bond;

FIG. 2 is diagrammatic representation of the action of an enzyme on various lipophilic groups of different oligonucleotide prodrugs of the invention to yield the same parent oligonucleotide;

FIG. 3 shows a diagrammatic representation of the general structure of a steroid nucleus which can be covalently attached to a nucleotide via any site on the steroid via a Z (amide or ester) group;

FIG. 4 is a schematic representation of the bioactivation of acyloxyalkyl ester-type prodrug 1 with esterases to yield oligonucleotide 5; FIG. 5 is a diagrammatic representation of the preparation of iodoalkylacylates lOa-d and the treatment of R. 2 or Sp 2 with iodoalkylacylates lOa-d to yield the S-alkyl dinucleoside, phosphorothioates 3a-3d;

FIG. 6 is a schematic representation of the hydrolysis of prodrug d(TpsT) esters 3a-c to yield compound 4 and parent oligonucleotide 2;

FIG. 7A is a collection of reversed-phase HPLC profiles of the time course of hydrolysis of Rp 3b with human serum, wherein the arrows indicate the retention times in minutes;

FIG. 7B is a collection of reversed phase HPLC profiles of the time course of hydrolysis of Sp 3b with human serum, wherein the arrors indicate the retention times in minutes;

FIG. 8 shows the 31P-NMR spectra and autoradiogram of a polyacrylamide gel of a PS/PO containing parent oligonucleotide (A) , the oligonucleotide prodrug (B) , and the oligonucleotide prodrug after incubation with an esterase for 24 hours (C) ;

FIG. 9 is a representation of an autoradiogram of parent oligonucleotide (lanes 1 and 3), uniformly derivatized prodrug oligonucleotide (lanes 2 and 4), and uniformly derivatized prodrug oligonucleotide after incubation with an esterase for 36 hours; FIG. 10 is a generic formula of an alternative prodrug 13 of the invention, where X = O, S, NH, or NR; Y = 0, S, NH, or NR; R is aryl, heterocyclic, heteroaryl, polyaromatic , fatty acid, steroid, lipid, or a ligand; the circle = aryl, heterocyclic, heteroaryl, polyaromatic, cycloalkenyl, alkenyl, or alkynl ; and B = a natural or modified nucleobase;

FIG. 11 is a scheme depicting the mechanism of bioreversibility including the cyclic intermediate 11 and trigonal bipyramidal intermediates 11a and lib;

FIG. 12 is a synthetic scheme depicting the synthesis of prodrug 13a, a nonlimiting embodiment of the prodrug 13 depicted generically in FIG. 10, from starting reagents 9 and 2;

FIG. 13A is one embodiment (15a) of an oligonucleotide prodrug 15 of the invention having one site-specifically incorporated pro-moiety;

FIG. 13B is another embodiment (15b) of an oligonucleotide prodrug 15 of the invention having two site-specifically incorporated pro-moieties;

FIG. 14 is a synthetic scheme depicting the synthesis of intermediate 16, which is required in the synthesis of oligonucleotide prodrug 15b;

FIG. 15A is a representation of an autoradiogram of parent oligonucleotide (lane 1); prodrug oligonucleotide 15a with one bioreversible linkage (lane 2); prodrug oligonucleotide 15a incubated with chymotrypsin for 2 hours at 37°C (lane 3); and prodrug oligonucleotide 15 incubated with chymotrypsin for 4 hours at 37°C (lane 4) ; and

FIG. 15B is a representation of an autoradiogram of parent oligonucleotide (lane 1 ) ; prodrug oligonucleotide 15a with one bioreversible linkage (lanes 2, 4, and 6); prodrug oligonucleotide 15b with two bioreversible linkages (lane 8); and prodrug oligonucleotide 15a after incubation with an esterase for 2, 6, and 20 hours, respectively (lanes 3, 5, and 7) .

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The patent and scientific literature referred to herein establishes the knowledge that is available to those with skill in the art. The issued U.S. patents, allowed applications, and references cited herein are hereby incorporated by reference .

In order for antisense oligonucleotides to elicit their therapeutic action as inhibitors of gene expression, they must be taken up by cells and internalized. However, if the oligonucleotide is polyionic and of high molecular weight, its ability to cross lipid membranes is reduced; oligonucleotides that carry less negative charges are known to be taken up by cells more efficiently (Temsamani et al . (1994) Antisense Res. Dev. 4:35-42).

The present invention provides a method of improving oligonucleotide uptake through lipid membranes into cells, thereby increasing the efficacy of treatment and reducing the dose of antisense oligonucleotide required. In this approach, oligonucleotide-containing prodrugs have been designed which undergo an enzyme-mediated transformation near or within the target organ, tissue, or cell to release the functional parent antisense oligonucleotide. The oligonucleotide prodrugs are oligonucleotides that have been reversibly derivatized to become lipophilic, less ionic oligonucleotide conjugates having the ability to enter cells by passive diffusion through cell membranes and also to get transported across various physiologic barriers including the blood-brain barrier.

The oligonucleotide prodrugs include at least six, and preferably 10 to 30 nucleotides. The 3' terminus of one nucleotide is covalently linked to the 5' terminus of the next nucleotide. The nucleotides may be deoxyribonucleotides or analogs thereof, ribonucleotides or analogs thereof, or a combination of deoxyribonucleotides, deoxyribonucleotide analogs, ribonucleotides, and ribonucleotide analogs, thereby forming a chimeric oligonucleotide prodrug.

The term "nucleotide analog" as used herein encompasses a nucleotide not found naturally in vivo and having a synthetic group attached or replacing its 3' or 5 ' terminal chemical groups. Thus a nucleotide analog forms an internucleotide linkage other than a phosphodiester between the 5' end of one nucleotide and the 3 ' end of another nucleotide in which the 5 ' nucleotide phosphate has been replaced with any number of chemical groups . Preferable synthetic linkages include alkylphosphonates, phosphate esters, alkylphosphonates , phosphorothioates , phosphorodithioates, carbonates, alkylphosphonothioates , phosphoramidates , carbamates, phosphate triesters, acetamidate, and carboxymethyl esters.

The term "nucleotide analog" also encompasses nucleotides with a modified base and/or sugar. For example, a 3', 5 ' -substituted nucleotide is a modified nucleotide having a sugar which, at both its 31 and 5' positions is attached to a chemical group other than a hydroxyl group (at its 3' position) and other than a phosphate group (at its 5 ' position) . A modified nucleotide may also be a capped species. In addition, unoxidized or partially oxidized nucleotides having a substitution in one nonbridging oxygen per nucleotide in the molecule are also considered to be modified oligonucleotides . Also considered as modified nucleotides are those having nuclease resistance-conferring bulky substituents at their 3' and/or 5' end(s) and/or various other structural modifications not found in vivo without human intervention. Modifications may also include a substitution at the phosphate group. For example, the oxygen at the 5' phosphate group may be substituted with a sulfur, amine, or other group. Also considered as modified nucleotides are nucleotides having various other structural modifications not found in vivo without human intervention .

At least one nucleotide of the oligonucleotide prodrug has been derivatized such that the prodrug becomes less ionic and more lipophilic than it was before derivatization. This is accomplished by covalently attaching a lipophilic chemical group to the 3' phosphate, 5' phosphate, or intemucleotidic phosphate group of the nucleotide at a sulfur, oxygen, or amine group, shown as prodrug 1 in FIG. 1. Some preferred nucleotides to which the lipophilic chemical group can be attached include phosphorothioates , phosphorodithioates , phosphoramidates, and phosphate esters.

At least one nucleotide of the prodrug is derivatized as described above, and all of the nucleotides may be likewise derivatized. The derivatized nucleotides may be located anywhere in the oligonucleotide prodrug, i.e., they may be in the internal or terminal regions of the prodrug, or may be scattered throughout the molecule .

TABLE 1 below lists some representative oligonucleotide prodrugs having 6, 17, 25, and 30 nucleotides. "X" indicates the position of the derivatized nucleotide residue.

TABLE 1A

SEQ ID OLIGONUCLEOTIDE PRODRUG SEQUENCE NO.

AAAiTGT 3

AAATGT 3

AAATGT 3

AiA4.A-lτpAGiτ 3

CGG4CAA 4

C4GGCAA 4

CGiGiCAA 4

CiGiGiC4A4A 4

Figure imgf000024_0001

GTAAAACGACGGCCAG4T 6

GTAAAACG4'ACGGCCAGT 6

GiTAAAACGACGGCCAGiT 6

GiT4AiA4AiA4C4G4A4'CiG4'GiC AcAG T 6

GTATTCAAAGGAGTAC C 7

GTATTCAAAGGAGTACC 7

G4TATTCA4AAGGAGTAC4C 7

G4T4A4TT4C4A4A4A4G4G4AG T4A4C4C 7

GAGCAUCACGGUGAGC4G 8

GAGCAUCA C GGUGAGCG 8

GiAGCAAUCACGGUGAAGC4G 8

GiA4G4C4AU4C A4C4G4G4U4G4A4G4C4G 8

TABLE IB

SEQ ID

OLIGONUCLEOTIDE PRODRUG SEQUENCE NO:

CHJCUCGGACCCATCTCTCTCCUUCU 2

CUCUCGGA4CCCATCTC TCTCCUUCU 2

CUCUC4G4G4ACCCATCT4CTCTCCUU4C4U 2

C4U4C4UC4G4GA C4C4C4A4T C4T4C TC4T4C4C U U4C4U 2

C4TCTCGGACCCATCTCTCTCCTTCT 1 CTCTCGGA4CCCATCTC TCTCCTTCT 1 CTCTC4G4G4ACCCATCT4CTCTCCTT4C4T 1 C T4C4T C G4G4A4C4C C4AT4C4T4C4T4C T4C 4C TT4C T 1

G4AATGACTGATTGAGTGACTGAATGCCCGT 9 GAATGACTGATTGAGTGACTGAATGCC4CG4T 9 GAATGA4C4TGATTGA4GTGACTGAA4TGCCCGT 9 G4A4A4TG4AC4TG4A4TTGA4G4TGA4C TG4A4ATG4C4C4C4G T 9

C4AGUGACUGACUGAGCGACUGAACUCCCGT 10 CAGUGACUGACUGAG CGACUGAACUCCCG T 10 CAGU4G4ACUGA4C UGAGCG4ACUGAACUC CCGT 10 C4AGU4G4AC U4G4A4C4U4GAG4C G4AC UG4AA C4U4C C4C4G T 10

The derivatizing chemical group may be any chemical group which is lipophilic and which decreases the ionic strength of the oligonucleotide as a whole. This derivatizing group may also modulate the pharmacokinetic profile of the parent oligonucleotide, and/or to enhance the resistance of the oligonucleotide to degradation by cellular nucleases. In addition, specific lipophilic ligands may be used to target the oligonucleotide to specific tissue.

Useful lipophilic chemical groups include, but are not limited to, alkyl, aryl, ar-alkyl, alkane groups. Other useful lipophilic groups include fatty acids or carboxylic acids with long hydrocarbon chains having from about 3 to about 40 carbons, and heterocyclic compounds having a 5 or 6 membered carbon ring or a fused polycyclic system containing heteroatoms such as 0, N, S, or P at one or multiple positions in the system.

Non-limiting examples of heterocyclic compounds include thiophene, imidazole, pyrimidine, pyrrole, furan, and purines, and steroids such as steroid esters and steroid amides. Yet other useful lipophilic groups are steroids have from about 17 to about 40 carbons, and preferably from about 17 to about 32 carbons. FIG. 3 shows the general structure of a steroid having 4 carbon rings and 17 positions at which the lipophilic group may be attached. The lipophilic chemical groups attached to multiple derivatized nucleotides may be the same or different. The sequence of the nucleotides in the oligonucleotide prodrugs of the invention may be any sequence, as the ability of the oligonucleotide prodrug to pass or be transported through cell membranes is not sequence-dependent. Thus, the sequence of nucleotides in the oligonucleotide prodrugs may vary according to the purpose for which the antisense oligonucleotide is being used. For example, if the oligonucleotide is being used to prevent or treat a specific viral infection, at least a portion of the nucleotide sequence of the prodrug will be complementary to a portion of the nucleotide sequence of the viral nucleic acid. Alternatively, the antisense oligonucleotide may be used to control the expression of a particular gene encoding a protein of interest in the target cell or tissue, such as an enzyme. The nucleotide sequences of many viruses and cellular genes are known and antisense oligonucleotides have been prepared thereto.

The oligonucleotide prodrugs of the invention are prepared by synthesizing the antisense oligonucleotide using nucleotides capable of derivatization, and then derivitizing or covalently linking the lipophilic chemical group to a reactive group on the oligonucleotide.

The parent antisense oligonucleotide of the invention can be prepared by any art recognized method ( reviewed in Protocols For Oligonucleotides and Analogs (Meth. Mol. Bio. (Agrawal , ed . ) Humana Press , Totowa , NJ , Volume 20 , 1993 ) ; Goodchild ( 1990 ) Bioconjugate Chem. 1 : 165-187 ; and Uhlmann et al . (1990) Chem. Rev. 90:543-584). For example, nucleotides can be covalently linked using techniques such as phosphoramidate, H-phosphonate chemistry, methylphosphoramidate, or methoxy- phosphoramidite chemistry which can be carried out manually or by an automated synthesizer and then processed.

The oligonucleotides of the invention may also be modified in a number of ways without compromising their ability to be derivatized or to hybridize to a target nucleic acid. For example, modifications include those which are internal or are at the end(s) of the oligonucleotide molecule and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the viral genome. Examples of such modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3 ' , 5'- substituted oligonucleotide having a sugar which, at both its 3 ' and 5 ' positions is attached to a chemical group other than a hydroxy1 group (at its 3 ' position) and other than a phosphate group (at its 5' position). Other modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3' and/or 5' end(s) or have a substitution in one nonbridging oxygen per nucleotide. Such modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule (reviewed in Agrawal et al . (1992) Trends Biotechnol. 10:152-158).

The nucleotide in the oligonucleotide prodrug is derivatized with a lipophilic chemical group attached to the 3' phosphate, 51 phosphate, or internucleotide phosphate group of at least one nucleotide in the oligonucleotide. Covalent linkage of the chemical group can be accomplished by any art recognized protocol specific for the group to be appended such as an amide or ester.

Once inside the cell, target tissue, or body in general, the oligonucleotide prodrug is processed by an endogenous enzyme such as esterase or phosphoramidase. This enzyme may be tissue- or cell-specific, and thus the oligonucleotide prodrug may be designed such that the lipophilic chemical groups are cleaved from the drug, thereby regenerating the parent antisense oligonucleotide only when the prodrug reaches or approaches the target tissue or cell. FIG. 1 depicts the generalized scheme of parent oligonucleotide

(compound 5) regeneration from prodrug 1 with an enzyme, and FIG. 2 illustrates the specific action of an enzyme on various specific lipophilic chemical groups attached to the oligonucleotide prodrug .

Enzymes which release the lipophilic group from the oligonucleotide include esterases and phosphoramidases . Useful esterases found in cells and body tissues include but are not limited to thiol proteases, carboxyl proteases, metalloproteases, and serine proteases such as trypsin, chymotrypsin and elastase (found in the pancreas) , thrombin, plasmin, and complement CI (found in the serum), kallikrein (found in the blood and tissues), acrosomal protease (found in sperm), and lysosomal protease (found generally in animal cells) .

For example, FIG. 4 shows the regeneration of an antisense oligonucleotide phosphorothioate, phosphorodithioate, or phosphoramidate from a prodrug form of the oligonucleotide (prodrug 1) where X=S . In prodrug 1, a labile carboxylic ester group has been incorporated so that an enzyme-mediated hydrolytic attack is directed to a highly electrophilic carbonyl carbon center rather than to the phosphoryl group of the phosphorothioate. This, in turn, ensures the regeneration of the phosphorothioate rather than the native phosphodiester backbone during the bioactivation (i.e., regeneration of the parent antisense oligonucleotide) in vivo . An acyloxyalkyl ester type group fulfills the requirements of an ideal appendage for the phosphorothioate oligonucleotides. Thus, the acyloxyalkyl ester type prodrug 1 undergoes bio-activation with an esterase to give the unstable hydroxymethyl oligonucleotide la which then readily eliminates formaldehyde to give the parent phosphorothioate oligonucleotide 5. The rate of enzymatic hydrolysis is modulated by choosing various acyl groups, with the more hindered derivatives such as prodrug 1 (where R = t-butyl) undergoing slower hydrolysis .

Incorporation of the acyloxyalkyl as well as aryl, alkyl, ar-alkyl, heterocyclic, fatty acid, steroid esters, and steroid amide groups into phosphorothioates, phosphorodithioates or phosphoramidates results in lipophilic and less ionic oligonucleotides. Such modifications enable these prodrugs to be efficiently taken up by cells, where cellular esterases or phosphoramidases hydrolyze the ester or amide group in the prodrug to regenerate the parent oligonucleotide .

The following methodology was designed for the chemoselective S-functionalization of an dinucleotide phosphorothioate as a model for the preparation of various oligonucleotide prodrugs. The dinucleoside phosphorothioate 2 [d(TpsT)] bearing the 5' dimethoxytrityl group (DMT) at the 5 ' end was synthesized on a 10 x 10 μmole scale using known phosphoramidite chemistry on an automated DNA synthesizer (see, e.g., Beaucage et al. (1992) Tetrahedron 48 :2223-2311) . Oxidative sulfurization of the intemucleotidic phosphite linkage was carried out using 3H-1,2- benzodithiole-3-one-l, 1-dioxide to generate the phosphorothioate linkage as described by Iyer et al. (J. Org. Chem. (1990) 55 : 4693-4698 and J. Am. Chem

Soc. (1990) 112:1253-1254). Following the synthesis, the controlled-pore-glass (CPG) support was treated with 28-30% NH3 to cleave the dinucleoside phosphorothioate from the support and remove the β-cyanoethyl phosphate protecting group. The dimer was then subjected to reverse- phase HPLC to isolate the constituent Rp (retention time (Rt) = 3 min.) and Sp (Rt, 35 min. ) diastereomers of phosphorothioate prodrug 2 bearing the 5 ' -DMT group. Each of the individual Rp and Sp diastereomers were then treated with 80% acetic acid to remove the 5 ' -DMT group and purified again by reverse phase HPLC to obtain pure Rp and Sp isomers (Rp:Rt, 24.2 min.; Sp : Rt 25.4 min . ) .

The assignment of absolute configurations "Rp" and "Sp" to the individual diastereomers of prodrug 2 follows the well-established literature precedent (Connolly et al . (1984) Biochem. 23:3443- 3453), and is based on the relative mobilities of the Rp and Sp dinucleoside phosphorothioates (5'- DMT "on" and 5 ' -DMT "off") on reverse-phase HPLC.

To further confirm these assignments, the individual diastereomers of PS-prodrug 2 were treated with snake venom phosphodiesterase (type II) using the method of Connolly et al . (ibid. ) . The snake venom stereospecifically hydrolyzed the Rp diastereomer (Rt, 24.2 min., δ 52.6 ppm) and nuclease Pi which hydrolyzed the Sp diastereomer (R,., 25.4 min., δ 52.2 ppm).

The diastereomers of prodrug 2 were converted to the S-alkyl phosphorothioates (PS-prodrugs 3a- d) using a chemoselective S-alkylation protocol (e.g., Agrawal et al . (1991) Nucl. Acids Res. 18:5419- 5423), as shown in FIG. 5. The iodoalkylacylates (compounds lOa-d) required for the alkylation reactions were prepared from the corresponding chloroalkylacylates (FIG. 4) using the chloroalkylacylates according to the method of Iyer et al . ( Tetrahedron Lett. (1989) 30:7141-7144). These, in turn, were synthesized by the reaction of the corresponding acid chlorides with paraformaldehyde in presence of catalytic amounts of anhydrous zinc chloride, as described by Ulich et al. (J. Am. Chem. Soc. (1921) 43:660). The reactions were monitored by reverse-phase HPLC, and no evidence of any epimerization at the chiral phosphorous center was noted. Significant side products were not detected reflecting the lack of reactions at other sites. Thus, Rp2 gives Rp 3a- d, and Sp 2 gives Sp 3a-d.

In all cases, the reaction mixture was worked up and products isolated by preparative reverse- phase HPLC. The retention times of the various analogs of prodrug 3 are shown in TABLE 2.

TABLE 2

Buf fer Hydrolysis of 3a-c

Compound Rt (min ) t1/2 ( days ) % parent

( analog 2 ]

Figure imgf000034_0001

As measured by 31P-NMR, the Rp isomer of analog 3c typically had a value of 24.8 ppm and the Sp isomer of 3c had a δ value 25.8 ppm. The Rp and Sp triesters of 3, unlike the Rp and Sp diester counterparts (i.e., analog 2) were resistant to hydrolysis by snake venom phosphodiesterase and PI nuclease, respectively. These results indicate that the prodrug is less susceptible to nuclease digestion than is its parent.

Although prodrugs 3a-d are phosphotriesters bearing a labile carboxylic ester moiety, they are easily isolated and purified; they are soluble in aqueous buffers and in organic solvents such as acetonitrile and chloroform. They can be stored indefinitely in aqueous buffers (pH 7.0) at 0-5°C with no evidence of decomposition. However, upon prolonged storage in aqueous buffers (pH 7.0) at ambient temperature, some decomposition occurs. TABLE 2 above shows the half-lives of decomposition of the analogs in aqueous buffers at ambient temperature. As would be expected, the less hindered analogs 3a were more susceptible to hydrolytic decomposition than the more hindered analogs 3b-c . The major product of decomposition was the desulfurized product, the natural diester, 4.

Prodrug analogs 3a-3c were then analyzed for their ability to undergo hydrolysis in serum. These serum-mediated hydrolysis studies were carried out on HPLC-purified materials containing ammonium acetate (i.e., salt). To determine whether the presence of salt had an impact on the kinetics and product profile of hydrolysis, (i.e., on bio-reversibility) , esters 3a-c (HPLC mobile phase containing or not containing salt were incubated with human serum. TABLE 3 shows the half-lives (t1/2) of hydrolysis of analogs 3a-c in the presence and absence of salt.

TABLE 3

Hydrolysis of Analogs 3a-c by Human Serum

Figure imgf000036_0001

@ estimated at t1/2 of hydrolysis

* no salt n.d. not determined

In all cases, stereospecific hydrolytic conversion of the Sp triesters 3a-c to the Rp 2 was observed. The Sp esters 3a-c were hydrolyzed much faster compared to the Rp esters 3a-c. In addition, the formation of significant amounts of phosphoric diester 4 as a by-product was seen upon hydrolysis of 3c. As TABLE 3 shows, when the same serum- mediated hydrolysis studies were done using salt- free materials, the half-lives of hydrolysis were significantly reduced. Typically, the half-life of hydrolysis Rp 3c* (salt free) was 163 minutes, whereas that of Rp 3c (with salt) was 1,980 minutes. Increased formation of the desulfurized products 4 was also observed, especially in case of the hindered analogs Rp and Sp 3c, when the enzyme-mediated hydrolysis was carried out in the absence of salt. In that event, the origin of the desulfurized product 4 in the case of analogs 3a- c, is likely to follow the path shown in FIG. 6.

Alternatively, at least part of the desulfurized product may be formed due to hydrolysis mediated by a phosphodiesterase-like activity present in serum, and that ammonium acetate may suppress this phosphodiesterase-like activity and reduce esterase activity.

Studies were thus undertaken to confirm that the factor (s) present in serum which is responsible for mediating the hydrolysis of the esters has esterase-like activity. In these only salt-free materials were used. Porcine liver esterase (which is a mixture of at least seven enzymes) was used as a typical carboxyl esterase enzyme. The reactions were monitored by reverse- phase HPLC using a gradient of 100% ammonium acetate buffer (0.1 M) to 80% acetonitrile in ammonium acetate (0.1 M) . The date obtained from these studies was analyzed according to a first order kinetic model. The results are shown in FIGS. 7A and 7B, where the arrows indicate the retention times in minutes of 4, 2, and 3b, and are summarized in TABLE 4.

TABLE 4

Hydrolysis of 3a-c (Salt-Free) by Pig Liver Carboxy Esterase

Figure imgf000038_0001

@ estimated at t1/2 of hydrolysis, remaining being 4. n.d. not determined

Upon incubation of the substrates 3a-c with pig liver esterase in a stoichiometric ratio (one unit/one μmole of substrate) , almost instantaneous stereospecific hydrolysis was observed to give the desired product Rp or Ξp 2. Under these conditions, no stereo-differentiation in the rates of hydrolysis of 3a-c was noted (i.e., both Rp and Sp were hydrolyzed at the same rate) . Also, no difference in the half-lives of the hindered and less hindered analogs was noted. These observations reflect a high binding affinity of the substrate for the enzyme and a fast catalyst rate. However, upon lowering the enzyme concentration, some stereo-differentiation was noted as previously observed in case of the serum studies. Inverse stereochemical preference was observed; Rp was hydrolyzed slightly faster (Rp 3c, t1/2 = 185 min.) than Sp (Sp 3c, t1/2 = 430 min.). These results suggest that pig liver esterases have different stereochemical specificities for substrates 3a-c when compared to human plasma carboxyl esterase. As in case of the serum studies, the more hindered t-butyl analogs were hydrolyzed more slowly compared to the less hindered analogs . The formation of the desulfurized product 4 was also observed, especially in the case of hindered analogs 3c, under these conditions as in case of the serum- mediated hydrolysis studies.

In order to get further insight into the mechanism of the hydrolysis reaction and to demonstrate that hydrolysis proceeds by initial attack on the carboxyl group, the Rp and Sp benzoyl analog 3d was prepared. Incubation of Rp or Sp 3d with pig liver esterase gave analog 2 along with the formation of benzoic acid which was identified by co-chromatographic comparison with an authentic standard. These data are indicative of an initial nucleophilic attack on the carbonyl carbon by esterases, rather than attack at the phosphoryl group, to generate analog 2. A pathway for the formation of analog 4 is shown in FIG. 6. This pathway involves an initial nucleophilic attack by the serine hydroxyl group of the esterase on the ester carbonyl center to generate the oxy-anion intermediate 9 which performs an intramolecular attack on the juxta-positioned phosphorous center to give cyclic intermediate 11. Fragmentation of intermediate 11 by path a gives the desired product 2, whereas fragmentation of 11 by path b gives the desulfurized product 4, each pathway generating the same acyl-enzyme intermediate 12. The enzyme-mediated hydrolysis gives the expected phosphorothioate 2 (by path a ) as the predominant product.

Based on the results of the model described above, an oligonucleotide prodrug and its parent oligonucleotide, both having SEQ ID NO : 2 , were examined before and after hydrolysis with an esterase by NMR spectroscopy and polyacrylamide gel electrophoresis . The oligonucleotides were dissolved in D20, and the NMR spectra recorded. The results are shown in FIG. 8 wherein A is the spectrum of the parent oligonucleotide, B is the spectrum of the prodrug, and C is the spectrum of the prodrug that had been incubated with an esterase .

As shown in FIG. 8, a chemical shift is seen in the spectrum of the phosphorus nuclei which have been derivatized with a lipophilic group (in A it is at about δ 57, wherein in B, it has shifted to the right) . Furthermore, a shift in the spectrum of the derivatized phosphorus nuclei back to the position it was at in the parent after 24 hours of esterase digestion (δ-8) is seen in C, demonstrating the reversibility of the derivatization . The species analyzed in A, B, and C were subjected to polyacrylamide gel electrophoresis and autoradiography, as shown in FIGS. 8 and 9. These autoradiograms demonstrate that the oligonucleotide prodrug is converted back to the parent oligonucleotide within 36 hours of incubation with the enzym .

An alternative prodrug was designed in which the "pro" moiety can be incorporated site- specifically within the oligonucleotide framework. This prodrug was also designed to achieve greater stability in buffer at ambient temperature, complete esterase- or ami ase-mediate bioreversibility to the parent oligonucleotide from which it was derived, and minimal formation of the desulfurized drug upon hydrolysis. A generic form of this prodrug is shown schematically in FIG. 10 as Analog 13, where X = 0, S, or NH; Y = 0, or S; Z = 0, S, or NH; R is aryl, heterocyclic, heteroaryl, polyaromatic, fatty acid, steroid, lipid, or a ligand; the circle = aryl, heterocyclic, heteroaryl, polyaromatic, cycloalkenyl, alkenyl, or alkynl; and B = a natural or modified nucleobase. The stability of the prodrug is dictated by the nature of the X and R groups. When the substituents on the R group are bulky, e.g., t-butyl, phenyl, or 2, 6-dimethyl-phenyl, the resulting analog is more chemically stable.

In the mechanism of bioreversibility depicted in FIG. 11, the attack of the incoming nucleophile on the electrophilic carbonyl carbon of 9 is followed by the interception of the resulting oxyanion by the juxtapoεitioned phosphoryl group to give the cyclic intermediate 11, in turn leading to the trigonal bipyramidal intermediates 11a and lib which can interconvert by pseudorotation. In the presumed intermediate lib, the S-acyloxyalkyl group (the preferred leaving group) is favorably positioned to depart from an apical direction and produce the desulfurized product 4. However, in the case of the enzyme- mediated hydrolysis, the formation of the preferred intermediate lib is hampered because it requires considerable reorganization of the initially formed enzyme-substrate complex 12. Consequently, the hydrolysis pathway8b is directed to occur via 11a to yield 2.

When the formation of the key cyclic intermediate 11 is precluded, e.g., by using a more rigid analog represented by the general structure 13 in FIG. 10, the desulfurization pathway is suppressed both under enzymatic and non-enzymatic conditions. In 13, the intervention of the substituted aromatic ring imposes the desired conformational restraint on the phosphate appendage, rendering the formation of 11 geometrically impossible.

To test the validity of this alternative prodrug design, a typical analog 13a was used.

Analog 13a was synthesized as shown in FIG. 12 by chemoselective 5-alkylation of the dinucleoside phosphorothioate Rp/5P 2 with 14. 14 was prepared from 15, which in turn was prepared from 9. The resulting diastereomeric mixture of 13A (Rp/≤p, 52/48) was subjected to reversed-phase HPLC to separate the Rp and Sp diastereomers, lyophilized and stored dry until ready for use.

To evaluate their stability and bioreversibility, the Rp and Sp diastereomers of 13a, either individually or as mixtures, were incubated with human serum. The hydrolysis was monitored by quantifying the product and reactant peaks by reversed-phase HPLC. A slow but stereospecific hydrolytic conversion of the Rp and Sp triesters to the corresponding Rp and Sp 2 occurred. There was no detectable formation of any desulfurized product representing 4. Nuclease- mediated hydrolytic fission products (e.g., mononucleosides) were also not seen during the assay period. Interestingly, unlike the corresponding Rp and Sp acyloxyalkyl derivatives of 3b (t1/2:Rp 3b = 23 min; Sp 3b = 5 min), there was less stereodifferentiation in the rates of hydrolysis between Rp and Sp 13a (t1/2:Rp 13a = 480 min; Sp 13a = 780 min), i.e., Rp and Rs are hydrolyzed at almost the same rate.

The solution stabilities of [Rp,Sp] 13a at 37°C, in Tris buffer (250 mM, pH 7.4) and glycine buffer (100 mM, pH 2.0) was evaluated by reversed- phase HPLC. The t1/2 of hydrolysis, at 37°C was - 25 days at pH 2.0 and - 5 days at pH 7.4. Unlike the prodrug derivative 3b, the predominant product of hydrolysis (>96%) was the desired parent phosphorothioate 2. The presence of 4, representing desulfurized material, was minimal (<4%) . These observations are consistent with the hydrolytic process depicted in FIG. 6A.

The present invention also provides a method of site specific derivitization of an oligonucleotide to increase its lipophilicity, ability to be taken up by a cell, intracellular or in vivo lipid solubility, and/or bioavailability. In this method, a substituted nucleoside phosphoramidite monomer is coupled to a support- bound nucleoside or oligonucleotide via a bioreversible internucleotide linkage. The resulting support-bound oligonucleotide is then deprotected and the prodrug isolated. In some embodiments, the coupling step is repeated with one or more substituted or unsubstituted nucleoside phosphoramidite monomers.

The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLES

UNIFORMLY MODIFIED PRODRUGS

A. Synthesis of d(TpsT) and Parent Oligonucleotides

The automated solid-phase synthesis of d(TpsT) 2 and oligonucleotides was carried out on a 10 x 10 mole scale on a DNA synthesizer (Biosearch 8700, Bedford, MA using phosphoramidite chemistry (Beaucage et al . (1992) Tetrahedron 48:2223-2311). The oxidative sulfurization reaction required for the preparation of oligodeoxyribonucleoside phosphorothioates was effected by a 0.2 M solution of crystalline 3H-

1, 2-benzodithiole-3-one-l, 1-dioxide (R.I. Chemical Co., Costa Mesa, CA) , in acetonitrile as described by Iyer et al. (J. Am. Chem. Soc. (1990) 112:1253-54; J. Org. Chem. (1990) 55:4693-98). The sulfurization reaction was performed over a period of 45 seconds to 2 minutes depending on the scale of synthesis. Following synthesis, the controlled pore glass (CPG) support was treated with 28-30% NΗ3 at 55°C for 8-10 hours to cleave the dinucleoside phosphorothioate from the support and remove the β-cyanoethyl phosphate protecting group. The RP:SP ratio of 2 was estimated to be 60:40 based on 31P-NMR and HPLC analysis.

B. Synthesis of Iodoalkyl Acylates

Iodoalkyl acylates lOa-d were prepared and characterized as previously described by Srivastva et al. (Bioorg. Chem. (1984) 12:118-129), and by Iyer et al . ( Tetrahedron. Lett. (1989) 30 : 7141-7144 ) . Briefly, to a 117 mM solution of sodium iodide (17.56) in 100 ml dry acetonitrile, was added 12.70 g (85 mM) chloroalkyl acylate over a period of 30 minutes at 25°C in the dark. A white precipitate of NaCl began to appear immediately. The contents were stirred for 12 hours. The precipitate was filtered, and the acetonitrile was removed from the filtrate in vacuo . The filtrate was taken up in 70 ml toluene, washed two times with 40 ml 5% aqueous sodium bisulfite, and then 40 ml water. The toluene layer was then dried over anhydrous sodium sulfate. Toluene was removed in vacuo and distillation of the resulting pale yellow oil gave a clear, colorless liquid (48-50°C, 3 mm Hg, 14.2 g, 70%) ^-NMR (CDC13) δ ppm 1.19 (s, 9H) , 5.91 (ε, 2H) 13C-NMR (CDC13): δ ppm 26.4 (CH3), 3L4 (CH2), 38.7 (-C), 176.0 (CO)). The distilled products lOa-d were stored at -80°C until ready to use.

Synthesis of Dinucleoside S-alkyl Phosphorothioates

The esters 3a-c were synthesized by reacting 50 A260 units of R„ or Sp 2 in (0.5 ml 250 mM Tris buffer, pH 7.0) with the corresponding iodoalkyl acylates lOa-d (2 mmoles) in 3 ml acetonitrile, at 37°C for 3-4 hr . The reaction mixture was quenched with 100 μ.1 0.5% sodium bisulfite, evaporated to dryness in vacuo and subjected to preparative reverse-phase HPLC as described below. The solvent was removed in vacuo and the esters (3a- c) thus obtained (isolated yields 60-70% based on compound 2 ) , were used as such for further studies. NMR spectra were recorded on a spectrometer operating in the presence of broad band decoupling at 7.05 Tesla (300 MHz for Η. 31P-NMR spectra were recorded in deuterated solvents using trimethylphosphate as the external reference. Typical 31P-NMR (D20) : δ Rp 3c, 24.8; Sp 3c 25.8 ppm.

D. Purification of Prodrug by Preparative Reversed-Phase HPLC

Deprotected TpsT dimer bearing the DMT group at the 5 ' -end was purified by reversed-phase HPLC using a C-18 reverse-phase column (125A, 55-105 μM, WATERS (Milford, MA) , and a gradient of 100% A to 100% B over 70 minutes [A: CH3C02NH4 (0.1 M in water); B: acetonitrile: CH3C02NH4 (0.1 M)

(80:20)], using a flow rate of 12 ml/min. The TpsT DMT-on peaks (Rt = 41 and 45 min) were collected and subjected to detritylation using 80% acetic acid for 30 min. The solvent was removed and the crude compound 2 subjected to reverse- phase HPLC as described below using a C-18 column developed with a gradient of 100% A to 100% B over 70 min, using either A, (0.1 M CH3C02NH4 in water); B (acetonitrile : 0.1 M CH3C02NH4, *80:20) or A (water) and B (acetonitrile : water (80:20)). Use of the latter system afforded salt-free materials. The Rp and Sp 2 fractions were collected, evaporated, lyophilized and stored at 0°C until ready to use. 31P-NMR (D20) : δ Rp 2 , 52.6 and Sp 2, δ 52.2 ppm. E. Bioreversibility Studies

1. Hydrolysis With Snake Venom Phosphodiesterase .

To confirm the Rp and Rs assignments, the individual diastereomers of 2 were treated with snake venom phosphodiesterase (type II) which stereospecifically hydrolyzed the Rp diastereomer (R,. = 24.2 min., 6 = 52.6 ppm) and nuclease PI which hydrolyzed the Sp diastereomer (Rt = 25.4 min., δ = 52.2 ppm). This was accomplished by using the method of Connolly et al . (Biochem. (1984) 23:3443-3453). Snake venom phosphodiesterase was obtained from Boehringer Mannheim GmbH, Indianapolis, Indiana, in a suspension of 50% glycerol, pH 6.0.

2. Hydrolysis With Buffer

The hydrolysis mixture contained about. 0.6 A260 units of substrates 3a-3c in 80 μl 25 mM Tris buffer, pH 7.0 at 37°C. At each time point, 10 μl aliquots of incubation mixture were diluted with 140 μl buffer A and analyzed by reverse-phase

HPLC, (600E instrument, Waters, Milford, MA) using a C18 4μ Radial Pak cartridge column (Waters, Milford, MA), developed with a gradient (100% A to 60% B over 60 minutes) of buffer A (0.1 M CH3C02NH ) and buffer B (80:20, CH3CN:0.1 M

CH3C02NH4), with a flow rate 1.5 ml/min. Retention times (Rt) of Rp 2, were 24.2; Sp 2, 25.4; and 4, 21.0 minutes respectively. Prodrugs 3a-3c were converted back to the starting dinucleotides after exposure to buffer. 3 . Serum Hydrolysis

The hydrolysis mixture contained about 0.6 A260 units of substrates 3a-3c, 20 μl human serum (GIBCO, BRL, Gaithersburg, MD) in 60 μl of 25 mM Tris buffer, pH 7.0 at 37°C. At each time point, aliquots of incubation mixture were diluted with 140 μl buffer A and analyzed by reverse-phase HPLC, as described in EXAMPLE 5B above. Prodrugs 3a-3c were converted back to the starting dinucleotides after exposure to serum, as shown in FIG. 7A and 7B.

4. Hydrolysis With Porcine Liver Esterase

The hydrolysis mixture contained about 0.6 A260 units of substrates 3a-3c and μl of pig liver carboxyl esterase in 60 μl of 25 mM Tris buffer, pH 7.0) at 37°C. At each time point, 10 μl aliquots of incubation mixture were diluted with 140 μl buffer A and analyzed by reverse-phase HPLC, as described in EXAMPLE 5B above. Prodrugs 3a-3c were converted back to the starting dinucleotides after exposure to the pig liver esterase .

F. Preparation of Oligonucleotide Prodrugs

To a solution of 90 O.D. of an oligonucleotide (SEQ ID NO:l or SEQ ID NO:2) in 0.5 ml 250 mM Tris-HCl buffer, pH 7.0, was added 20 μl iodomethyl isobutyrate in 0.5 ml acetonitrile. The solution was incubated at 37°C for 1-3 hr . The pH of the solution was maintained around 6-7 by adding trace amounts of triethyl amine periodically. At the end of the reaction, the solvent was removed under pressure and the residue dissolved in 200-500 μl water and 30-40 μl 1 M sodium chloride solution. To the solution was added 1-1.2 ml cold ethanol, and the solution kept at about -80°C for 1-2 hr . The solution was centrifuged at 10,000 g for 15 minutes, and the resulting pellet analyzed by HPLC and gel elctrophoresis, or dissolved in sodium chloride solution and ethanol precipitated as above.

As shown in FIG. 8, 31P-NMR of this product showed a signal at δ 25 ppm as compared to the starting oligonucleotide at δ 51 ppm. Analysis by gel electrophoresis (20% polyacrylamide) of the product showed a slow moving band as compared to the starting oligonucleotide.

G. Bio-reversibility Studies with

Oligonucleotide Prodrugs

Hydrolysis with Pig Liver Esterase

To 1.5 A260 units of prodrug (in 25 μl 250 mM Tris, pH 7.2) was added 2 μl pig liver esterase and the reaction mixture incubated at 3 °C overnight. Aliquots of the reaction mixture were then analyzed by gel electrophoresis using a 20% polyacrylamide, 7 M urea denaturing gel. FIGS. 8 and 9 show the profile of the reaction mixture obtained after 24 and 36 hours, respectively. The prodrug oligonucleotide is converted back to the parent oligonucleotide after exposure to the pig liver esterase.

2. Hydrolysis with Serum

To 1.5 A260 units of the prodrug (25 μl) oligonucleotide in 250 mM Tris buffer, pH 7.2) was added 40 μl human serum, and the reaction mixture incubated at 37°C overnight. Aliquots of the reaction mixture was analyzed by gel electrophoresis as described in EXAMPLE 7A. FIG. 8 shows the profile obtained of the incubate after 24 hours. The prodrug oligonucleotide is converted back to the starting oligonucleotide after exposure to serum.

3. In vivo Hydrolysis

Hybrid, chimeric prodrugs having SEQ ID NO: 2 and a combination of 2-0-methyl ribonucleotides and phosphorothioates were administered in normal saline as a bolus intravenous injection into the tail vein of 150-200 g Sprague Dawley or albino rats . Three rats were used for each dose to provide doses of 1-10 mg/Kg. After administration, the animals were placed in metabolism cages and urine samples were collected for up to 72 hours. 0.25 ml blood samples are collected from the cut axilla region at period intervals following dosing. The samples were collected in microfuge tubes containing 0.25 μl of 27.5 mM EDTA at 0°C and centrifuged at 16,000 x g speed. The plasma samples (150-200 μl) were analyzed by polyacrylamide gel electrophoresis (PAGE) in a 20% polyacrylamide, 7 M urea denaturing gel. These samples were also analyzed by HPLC to determine the half-life of bio-reversibility of the oligonucleotide prodrugs to parent oligonucleotide. The urine samples are also analyzed by PAGE and HPLC to determine content of the oligonucleotide prodrug and its metabolites. 35S-labelled oligo-prodrugs are used in these studies .

Anti-HIV screening of the oligonucleotide prodrugs in chronically HIV-infected cells is conducted as described in Lisciewicz et al . (1993) Proc. Natl. Acad. Sci. (USA) 90 : 3860-3864.

These studies illustrate that the above- described specifically embodied oligonucleotide prodrugs of the invention, in addition to having favorable physicochemical and pharmacologic properties, have good therapeutic potential against AIDS.

H. Dinucleoside S-acyloxyaryl

Phosphorothioate Prodrugs

In these prodrugs, generally depicted as indicated in Figure 2, the acyloxyaryl group is linked to the phosphorothioate group via a methylene bridge. Incorporation of the aryl group in the appendage confers a certain degree of conformational rigidity to the appendage, providing greater stability of the prodrug in aqueous buffers within a wide pH range.

Acyloxyaryl phosphorothioate prodrugs were synthesized by reaching the underivatized phosphorothioate with 4-0-isobutyryl-α- iodotoluene, which was synthesized as described below.

Commercially available 4-hydroxybenzyl alcohol (Aldrich, Milwaukee, WI) was evaporated three times from pyridine, then dissolved in pyridine to yield 0.2 M 4-hydroxybenzyl alcohol. Chlorotrimethylsilan (Aldrich) was added in 1.2 molar equivalents, and the solution was stirred for fifteen minutes at room temperature.

Isobutyryl chloride (Aldrich) was added in 1.2 molar equivalents, and the reaction was stirred for two hours. The reaction mixture was cooled to 0°C in an ice bath and excess water was added (50 equivalents) . The ice bath was removed, and the reaction was stirred for four hours. The reaction mixture was concentrated and extracted with ethyl acetate. The organic layer was washed with 10% sodium bicarbonate solution. Evaporation yielded an oily residue which was purified by column chromatography on silica gel using hexane: ethyl acetate (80:20) as the eluent. Evaporation gave 4-O-Isobutyryl benzyl alcohol as a colorless oil in 80-90% yield.

The 4-0-isobutyryl benzyl alcohol was then dissolved in a 1:2 mixture of ether : acetonitrile to a concentration of 0.28 M. Triphenyl phosphine, imidazole, and sublimed iodine were added in 1.5 molar equivalents each, and the reaction was stirred for two hours . The reaction mixture was extracted with ether. Concentration of the ether layer was followed by chromatography on a silica column, using hexane: ethyl acetate

(90:10) as eluent. The fractions containing the product were concentrated to dryness and 4-0- isobutyryl-α-iodotoluene was obtained as a white solid in 90-95% yield.

4-0-isobutyryl-α-iodotoluene (27 mg) was dissolved in a 50:50 mixture of pH 7 Tris HC1 buffer (0.5 M) : acetonitrile . This solution was added to 30 O.D. units of TpsT and kept at 37°C for three hours. Every half hour, the pH was adjusted with triethylamine (Aldrich) to maintain pH = 6-7. After three hours, the reaction was complete as evaluated by HPLC.

The acyloxybenzyl dinucleoside phosphorothioate was obtained as an Rp, Sp mixture, which is a substrate for Porcine liver esterases (Sigma) . Incubation of the acyloxybenzyl dinucleoside phosphorothioate with esterases resulted in rapid, stereospecific , and quantitative conversion to the parent phosphorothioate, with a quinomethide as a byproduct of the hydrolysis. The tH of the Rp acyloxybenzyl dinucleoside phosphorothioate was eight hours, and that of the Sp stereoisomer was twelve hours. In addition, no desulfurized product resulted from hydrolysis of the prodrugs. The half-lives of degradation of the prodrugs in buffers ranging from pH 2 to pH 8 was greater than 30 days at 22°C.

II. SITE-SPECIFICALLY MODIFIED PRODRUGS

A. Synthesis of Alternative Prodrug

1. Prodrug Dimer

Synthesis of prodrug 13a was carried out as delineated in FIG. 12. Briefly, 4-hydroxy benzyl alcohol 9 (0.5 g, 4.028 mmol) was evaporated three times from dry pyridine and then suspended in 20 ml of anhydrous pyridine. It was then treated in one of three ways to yield the ester alcohol 15.

Using the TMS route, trimethylsilyl chloride (TMSC1) (1.22 ml, 8.06 mmol) was added and the reaction was stirred for 15 min. Isobutyryl chloride (1.12 ml, 9.67 mmol) was added and the reaction was stirred for 2 hours at room temperature. The reaction mixture was cooled to 0°C and water (4 ml) was added. After the addition, the ice bath was removed and the reaction was stirred for an additional 4 hours. The reaction mixture was concentrated and then partitioned between EtOAc (150 ml) and 10% NaHC03. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The ester alcohol product 15 was purified by flash chromatography using hexane/EtOAc, 85/15. Yield 60%, Rf, 0.15 (hexane/EtOAc, 85/15). ^-NMR, (CDC13), δ 1.3 (d, 6H) , 2.5 (broad, 1H) 2.8 ( septet , 1H ) 4 . 58 ( s , 2H) , 7 . 31 ( d, 2H ) 7 . 31 ( d, 2H) .

Alternatively, the ester alcohol 15 was synthesized via the DMT route as follows. 4- hydroxybenzyl alcohol (4.028 mmol) was evaporated three times from dry pyridine and suspended in dry pyridine (20 ml). 4, 4-dimethoxy trityl chloride (6.06 mmol) was added and the reaction mixture was stirred for 8 hours at ambient temperature. The reaction mixture was quenched in ice-cold water and extracted with methylene chloride (3 x 50 ml) . The organic layer was separated and dried over anhydrous sodium sulfate. The solvent was evaporated in vacuo to yield the intermediate DMT ether derivative of 4-hydroxybenzyl alcohol . The residue was diluted with dry pyridine (20 ml) and Isobutyryl chloride (9.67 mmol) was added and the reaction mixture stirred for 2 hours. The reaction mixture was cooled to 0°C and water (4 ml) was added. After the addition, the ice-bath was removed, and the reaction mixture was stirred for 4 hours at ambient temperature. The reaction mixture was concentrated in vacuo and then partitioned between EtOAc (150 ml) and NaHC03

(10%, 150 ml). The organic layer was dried over anhydrous Na2S04 and concentrated. To the residue was added Dowex resin (H") (3 g) (Aldrich Chemical Company, Milwaukee, WI) and stirred for 30 minutes at ambient temperature. The mixture was filtered and the filtrate concentrated to dryness . The residue was subjected to flash chromatography using hexane/EtOAc (85/15) as the eluent . Elution of the product (Rf = 0.15, hexane/EtOAc, 85/15) gave the ester alcohol 15 in 85% yields.

The ester alcohol 15 was also be prepared via the TBDMS route. Briefly, 4-hydroxybenzyl alcohol (4.028 mmol) was evaporated three times from dry pyridine and suspended in dry pyridine (20 ml) . t-Butyl dimethyl silyl chloride 98.06 mmol) was added, and the reaction mixture was stirred for 15 minutes at ambient temperature. Isobutyryl chloride (9.67 mmol) was added and the stirring continued for 2 hours. The reaction mixture was cooled to 0°C and water (4 ml) was added. After the addition, the ice-bath was removed and the reaction mixture was stirred for 4 hours at ambient temperature. The reaction mixture was concentrated in vacuo and then partitioned between

EtOAc (150 ml) and NaHC03 (10%, 150 ml) . The organic layer was dried over anhydrous Na2S04 and concentrated. To the residue was added tetrabutyl ammonium fluoride in THF (about 30 mmol) and stirred for 8 hours at ambient temperature. The mixture was concentrated to dryness and the residue subjected to flash chromatography using hexane/EtOAc (85/15) as the eluent . Elution of the product (R£ = 0.15, hexane/EtOAc, 85/15) gave the ester alcohol 15 in 95% yields.

A mixture of triphenyl phosphine (0.28 g, 1.07 mmol), imidazole (0.07 g, 1.07 mmol), iodine

(0.27 g, 1.07 mmol) and 15 (0.14 g, 0.71 mmol) was dissolved in diethyi ether (2 ml) and acetonitrile (1 ml) . The reaction was stirred for 2 hours at ambient temperature and then partitioned between ether (20 ml) and water (5 ml) . The aqueous layer was extracted with diethyi ether (3 X 10 ml) . The aqueous layer was extracted with diethyi ether (3 X 10 ml) . The organic layer was dried over Na2S04 and solvent removed in vacuo. The residue was purified by flash column chromatography (silica gel) using hexane/ethyl acetate (90/10) as the mobile phase to give the product 14 in 75% yield. 14: Rt = 0.55 (silica gel, hexane/ethyl acetate, 80/20). 'H NMR (CDC13): 6 1.3 (6H, d, J = 7 Hz ) , 2.8 (1H, septet, J = 7 Hz), 4.4 (2H, s), 7.0 (2H, d, J = 9 Hz), 7.4 (2H, d, J = 9 Hz ) ppm; 13C NMR (CDC13): 4.6, 18.8, 34.1, 121.8, 129.7, 136.6, 150.3, 175.2 ppm.

The dinucleoside phosphorothioate 2 was prepared as follows. Approximately 250 mg of controlled-pore-glass (CPG) -bound thymidine nucleoside (approximately 40 mmol/g) was placed in a DNA synthesis column and subjected to standard solid-phase DNA synthesis cycle employing phosphoramidite chemistry (Beaucage and Iyer (1992) Tetrahedron 48:2223-2311). A typical synthesis cycle consisted of four steps: (a) detritylation using 2% dichloroacetic acid in methylene chloride; (b) coupling the support-bound nucleoside with 5'-0-(4, 4') -dimethoxytrityl-3'- O-phosphoramidite thymidine nucleoside in presence of tetrazole as a coupling reagent; (c) oxidative sulfurization with 3H-1 , 2-benzodithiole-3-one-l,

1-dioxide (R. I. Chemical Inc., Costa Mesa, CA) in acetonitrile as described by Iyer et al . (J. Am. Chem. Soc. (1990) 112:1253-54; J. Org. Chem . (1990) 55:4693-98) with the sulfurization reaction being performed over a period of 45 seconds to 2 minutes; and (d) capping the unreacted 5'-OH group of the nucleoside with a capping reagent usually consisting of a mixture of acetic anhydride, tetrahydrofuran, and N-methyl imidazole . The synthesis was terminated after the detrtitylation step as described in (a) above. The appropriate washing cycles using anhydrous acetonitrile (water content less than 30 ppm) were also incorporated between each synthesis cycle step. The composition of the reagents, the synthesis cycle times for each step (consisting of delivery and waiting times of the reactants) were performed as recommended by the manufacturer of the DNA synthesizer (Biosearch, Bedford, MA) . Following the completion of the synthesis cycle, the CPG-bound dinucleoside was removed and treated with approximately 10 ml of 28% NH4OH to achieve the deprotection of the phosphate protecting group and cleavage of the dinucleoside from the support. The supernatant was removed and the CPG carefully washed with 28% NH4OH (55°C, 6 hours) . The washings and supernatant were combined and carefully evaporated in vacuo to yield the dinucleoside phosphorothioate 2.

To 50 A260 units of 2 in 0.5 ml of Tris buffer (250 mM, pH 7.0) was added to the iodocompound 14 (20 mg, 0.06 mmol) in acetonitrile (0.5 ml) and the reaction mixture incubated in the dark at

37°C. After 3 to 4 hours, the reaction mixture was quenched by the addition of sodium bisulfite (0.5%, 100 μl) and evaporated to dryness in vacuo. The crude 13a thus obtained was subjected to reversed-phase HPLC as described previously, the solvent was concentrated to a small volume and lyophilized dry to give 42 A260 units of 13a.

2. Site-Specifically

Derivatized Prodrug Dimer

Synthesis of the dimer prodrug was carried out using a solid-support-bound T nucleoside and an ester phosphoramidite 16 prepared as described follows .

To 5 ' -0-4 , 4 ' -dimethoxytrityl nucleoside (e.g., thymidine, adenine, cytosine, uracil, or analogs thereof (0.415 mmol) in 5 ml of dry methylene chloride was added 1 ml triethylamine, followed by N,N diisopropylphosphoramidic dichloride (0.498 mmol) and the contents stirred at 0°C for 5 minutes. The ester alcohol 15 (0.1 g, 0.498 mmol) was then added. The reaction mixture was stirred at room temperature for 30 minutes . The solvent was then evaporated and the product was isolated following chromatography in silica gel (hexane/CH2C12/EtOAc/ N(Et)3, 1/1/0.5/0.1 and triethylamine.

Approximately 250 mg of controlled- pore-glass-bound thymidine nucleoside (approximately 40 μmol/g) was placed in a DNA synthesis column and subjected to standard solid-phase DNA synthesis cycle employing phosphoramidite chemistry (Beaucage and Iyer (1992) Tetrahedron 48:2223-2311). A typical synthesis cycle consisted of 4 steps: (a) detritylation using 2% dichloroacetic acid in methylene chloride; (b) coupling the support-bound nucleoside with 5'-0- (4, 4') -dimethoxytrityl-3'- O-thymidine nucleoside ester phosphoramidite 16 in the presence of tetrazole as a coupling reagent; (c) oxidative sulfurization with 3H-1,2- benzodithiole-3-one-l, 1-dioxide (R. I. Chemical Inc., Costa Mesa, CA) in acetonitrile as described by Iyer et al . (J. Am. Chem. Soc . (1990) 112:1253-54; J. Org. Chem . (1990) 55:4693-98), with the sulfurization reaction being performed over a period of 45 seconds to 2 minutes; and (d) capping the unreacted 5'-OH group of the nucleoside with a capping reagent usually consisting of a mixture of acetic anhydride, tetrahydrofuran, and N-methyl imidazole. The synthesis was terminated after the detritylation step as described in (a) above. The appropriate washing cycles using anhydrous acetonitrile (water content less than 30 ppm) were also incorporated between each synthesis cycle step. The composition of the reagents, the synthesis cycle times for each step (consisting of delivery and waiting times of the reactants) were performed as recommended by the manufacturer of the DNA synthesizer (Biosearch, Bedford, MA) . Following the completion of the synthesis cycle, the CPG-bound dinucleoside was removed and treated with approximately 10 ml of K2C03 (0.05 M in methanol) to achieve the cleavage of the dinucleoside from the support. The supernatant was removed and carefully neutralized with glacial acetic acid to pH 7.0. The solution was evaporated in vacuo to yield the dinucleoside phosphorothioate prodrug as a mixture of Rp and Sp diastereomers and characterized by 31P NMR δ (DMSO- d6), 66.74, 66.65 ppm.

For the preparation of the dinucleoside prodrug with nucleobases other than thymidine, the corresponding N-pent-4-enoyl (PNT) nucleoside derivative was employed (see PCT/US96/08136 ) .

3. Oligonucleotide Prodrug with One Bioreversible Linkage

The oligonucleotide prodrug shown in FIG. 13A carrying one specific bioreversible prodrug linkage or modifier, was prepared as follows. Approximately 250 mg of controlled-pore-glass- bound thymidine nucleoside (approximately 40 μmol/g) was placed in a DNA synthesis column and subjected to standard solid-phase DNA synthesis cycle, which employs phosphoramidite chemistry (Beaucage and Iyer (1992) Tetrahedron 48:2223-2311).

A typical synthesis cycle consisted of 4 steps: (a) detritylation using 2% dichloroacetic acid in methylene chloride; (b) coupling the support-bound nucleoside with 5'-0- (4, 4') -dimethoxytrityl-3'-0-thymidine nucleoside ester phosphoramidite 16 in the presence of tetrazole as a coupling reagent; (c) oxidative sulfurization with 3H-1, 2-benzodithiole-3- one-1, 1-dioxide (R. I. Chemical Inc., Costa Mesa, CA) in acetonitrile as described by Iyer et al . , ( J. Am. Chem. Soc . (1990) 112:1253-54; J. Org. Chem . (1990) 55:4693-98) . The sulfurization reaction was performed over a period of 45 seconds to 2 minutes; and (d) capping the unreacted 5'-0H group of the nucleoside with a capping reagent usually consisting of a mixture of acetic anhydride, tetrahydrofuran, and N-methyl imidazole. The above sequence of steps incorporated the intemucleotidic prodrug linkage. The extension of the oligonucleotidic chain was then carried out using standard phosphoramidite synthesis cycles as above except that the appropriate

5'-0-DMT-PNT-3'-0-nucleoside phosphoramidites (see PCT/US96/08136) were employed during the synthesis. The appropriate washing cycles using anhydrous acetonitrile (water content less than 30 ppm) were also incorporated between each synthesis cycle step. The composition of the reagents, the synthesis cycle times for each step (consisting of delivery and waiting times of the reactants) were as recommended by the manufacturer of the DNA synthesizer (Biosearch, Bedford, MA) . Following the completion of the synthesis cycle, the CPG-bound oligonucleotide prodrug was removed and treated with approximately 10 ml of K2C03 (0.05 M in methanol) (ambient temperature 10-16 hours) to achieve: (a) removal of the PNT nucleobase protecting group and, (b) the removal of the β-cyanoethyl phosphate protecting group, and the cleavage of the oligonucleotide prodrug from the support (under these conditions, the prodrug linkage is stable and does not undergo detectable hydrolysis) . The supernatant was removed and carefully neutralized with glacial acetic acid to pH 7 . 0 . The solution was evaporated in vacuo to yield the oligonucleotide prodrug 15a. The mobility of the oligonucleotide 15a, as evaluated by analytical PAGE, is shown in FIG. 15A, lane 2, and is slower compared to the 15-mer phosphorothioate with no bioreversible linkage (lane 1) .

4. Oligonucleotide Prodrug with Two Bioreversible Linkages

The oligonucleotide prodrug 15b shown in FIG. 13B carrying two bioreversible linkages was prepared as follows. The ester phosphoramidite 16 was prepared as shown in FIG. 14. Briefly, to 5'- 0-4, 4'-Dimethoxytrityl thymidine nucleoside (0.226 g, 0.415 mmol) in 5 ml of dry methylene chloride and 1 ml triethylamine was added N,N diisopropylphosphoramidic dichloride (0.1 g, 0.498 mmol) and the contents stirred at 0°C for 5 minutes. The ester alcohol 17 (0.1 g, 0.498 mmol) was then added. The reaction mixture was stirred at room temperature for 30 minutes, quenched in ice-cold water, and extracted with methylene chloride (2 x 50 ml) . The solvent was then evaporated and the product 16 (0.3 g) was isolated following chromatography in silica gel (hexane/ CH,C12 /EtOAc/N(Et)3, 1/1/0.5/0.1). 31P NMR of 16

(CDC13) δ 146.16, 146 ppm.

Approximately 250 mg of controlled-pore- glass-bound thymidine nucleoside (approximately 40 μmol/g) was placed in a DNA synthesis column and subjected to standard solid-phase DNA synthesis cycle employing phosphoramidite chemistry (Beaucage and Iyer (1992) Tetrahedron 48:2223-2311) . A typical synthesis cycle consisted of four steps: (a) detritylation using 2% dichloroacetic acid in methylene chloride; (b) coupling the support-bound nucleoside with 5'-0- (4, 4') -dimethoxytrityl-3'-0-thymidine nucleoside ester phosphoramidite 16 in the presence of tetrazole as a coupling reagent; (c) oxidative sulfurization with 3H-1, 2-benzodithiole- 3-one-l, 1-dioxide (R. I. Chemical Inc., Costa

Mesa, CA) in acetonitrile as described by Iyer et al. (J. Am. Chem. Soc . (1990) 112:1253-54; J. Org. Chem . (1990) 55:4693-98). The sulfurization reaction was performed over a period of 45 seconds to 2 minutes; and (d) capping the unreacted 5'-OH group of the nucleoside with a capping reagent usually consisting of a mixture of acetic anhydride, tetrahydrofuran, and N-methyl imidazole. The above cycle was repeated twice to allow incorporation of two intemucleotidic prodrug linkages. The extension of the oligonucleotidic chain was then carried out using standard phosphoramidite synthesis cycles as above except that the appropriate PNT nucleoside phosphoramidites (see PCT/US96/08136 ) were employed during the synthesis. The appropriate washing cycles using anhydrous acetonitrile (water content less than 30 ppm) were also incorporated between each synthesis cycle step. The composition of the reagents, the synthesis cycle times for each step (consisting of delivery and waiting times of the reactants) were as recommended by the manufacturer of the DNA synthesizer (Biosearch, Bedford, MA) . Following the completion of the synthesis cycle, the

CPG-bound oligonucleotide prodrug was removed and treated with approximately 10 ml of K2C03 (0.05 M in methanol) (ambient temperature 10-16 hours) to achieve: (a) removal of the PNT nucleobase protecting group (b) removal of the β-cyanoethyl phosphate protecting group, and (c) the cleavage of the oligonucleotide prodrug from the support. The supernatant was removed and carefully neutralized with glacial acetic acid to pH 7.0. The solution was evaporated in vacuo to yield the oligonucleotide prodrug 15b. The mobility of the oligonucleotide 15b as evaluated by analytical PAGE is shown in FIG. 15B, lane 8, and is slower compared to the 15-mer phosphorothioate with no bioreversible linkages (lane 1) and 15a which carries one such linkage.

B. Prodrug Chemical Stability Studies

Approximately 10 O.D. units of dinucleoside prodrug was mixed with 5 ml of 0.05 M K2C03 in MeOH at room temperature. Approximately 200 ul aliquots were periodically withdrawn over a 16 hour period and analyzed by reversed-phase HPLC using conditions described in Example 1(D) above.

After 30 hours, only 20% of the product was hydrolyzed. The analog where R = 2,6 dimethyl- phenyl was stable for up to 15 hours when exposed to K2C03/MeOH. Following exposure for 30 hours, less than 25% material had been degraded to the corresponding dinucleotide phosphorothioate.

5. Bioreversibility Studies

Prodrug dimers (para-disubstituted) (see FIG. 10) having various R groups (isopropyl, tert butyl, 2,6-dimethyl phenyl) were subjected to hydrolysis with porcine liver esterase ( 1/2 of 400 minutes )_as described above in Example 1(E)(4), or with chymotrypsin ( tl /2 TS 65 minutes) for 2-4 hours at 37 °C. The results are shown below in TABLE 5.

TABLE 5

Enzyme ---1/2

esterase isopropyl 100 min (Rp isomer) 150 min ( Sp isomer)

esterase tert-Butyl 180 min (Rp isomer) 260 min ( Sp isomer) esterase 2,6-dimethyl 400 min (R isomer) phenyl 650 min ( Sp isomer) chymo2,6-dimethyl 65 min (Rp isomer) trypsin phenyl 125 min { Sp isomer)

The oligonucleotide prodrugs shown in FIGS. 13A and 13B were also subjected to esterase and chymotrypsin digestion as described above. The results are shown in FIGS. 15A (chymotrypsin) and 15B (esterase) . Bioreversibility to parent phosphorothioate was demonstrated in each case.

EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Iyer, Radhakrishnan P. Yu, Dong Devlin, Theresa Agrawal, Sudhir

(ii) TITLE OF INVENTION: OLIGONUCLEOTIDE PRODRUGS

(iii) NUMBER OF SEQUENCES: 10

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: HALE AND DORR LLP

(B) STREET: 60 State Street

(C) CITY: Boston

(D) STATE: Massachusetts

(E) COUNTRY: USA

(F) ZIP: 02109

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE : Patentin Release #1.0, Version #1.25

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT

(B) FILING DATE:

(C) CLASSIFICATION:

(viii) ATTORNEY /AGENT INFORMATION:

(A) NAME: Keown, Wayne A.

(B) REGISTRATION NUMBER: 30,271

(C) REFERENCE/DOCKET NUMBER: 475.08.243

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 617-526-6000

(B) TELEFAX: 617-526-5000

(2) INFORMATION FOR SEQ ID NO : 1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID Nθ:l: CTCTCGCACC CATCTCTCTC CTTCT 25 (2) INFORMATION FOR SEQ ID NO: 2:

(l) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY- linear

(u) MOLECULE TYPE: cDNA/RNA

(ill) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(Xl) SEQUENCE DESCRIPTION: SEQ ID NO: 2.

CUCUCGCACC CATCTCTCTC CUUCU 25

(2) INFORMATION FOR SEQ ID NO: 3:

(l) SEQUENCE CHARACTERISTICS

(A) LENGTH: 6 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY linear

(li) MOLECULE TYPE- cDNA

(ill) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi ) SEQUENCE DESCRIPTION. SEQ ID NO .3 AAATGT 6

(2) INFORMATION FOR SEQ ID NO- 4-

(l) SEQUENCE CHARACTERISTICS:

(A) LENGTH. 6 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS- single

(D) TOPOLOGY: linear

(li) MOLECULE TYPE: cDNA

(in) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(Xl) SEQUENCE DESCRIPTION: SEQ ID NO: 4: CGGCAA 6

(2) INFORMATION FOR SEQ ID NO: 5:

(l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 base pairs (B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: mRNA

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: UGCCAG 6

(2) INFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI -SENSE: YES

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO: 6. GTAAAACGAC GGCCAGT 17

(2) INFORMATION FOR SEQ ID NO : 7

(1) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS- single

(D) TOPOLOGY: linear

(ll) MOLECULE TYPE: cDNA (ill) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GTATTCAAAG GAGTACC 17

(2) INFORMATION FOR SEQ ID NO: 8:

(l) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: mRNA (ill) HYPOTHETICAL. NO (iv) ANTI-SENSE: YES

(xi ) SEQUENCE DESCRIPTION: SEQ ID NO: 8: GAGCAUCACG GUGAGCG 17

(2) INFORMATION FOR SEQ ID NO : 9

(l) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ll ) MOLECULE TYPE: cDNA/mRNA (ill) HYPOTHETICAL- NO (iv) ANTI -SENSE: YES

(XI ) SEQUENCE DESCRIPTION: SEQ ID NO : 9 : GAATGACTGA TTGAGTGACT GAATGCCCGT 30 (2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA/mRNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: YES

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: CAGUGACUGA CUGAGCGACU GAACUCCCGT 30

Claims

What is claimed is:
1. An oligonucleotide prodrug comprising at least six covalently linked nucleotides, at least one nucleotide being derivatized with a lipophilic chemical group reversibly and covalently attached to the nucleotide at a 5 ' phosphate, a 3' phosphate, or an intemucleotidic phosphate linkage, the lipophilic group being selected from the group consisting of an ester linkage and an amide linkage, and further comprising a substituted aromatic ring, a cycloalkenyl ring, an alkenyl linkage, or an alkynyl linkage, the prodrug being reactive with a cellular or tissue enzyme which cleaves the lipophilic group from the derivatized nucleotide, the enzyme being as esterase when the lipophilic group comprises an ester, and the enzyme being a phosphoramidase when the lipophilic group is an amide.
2. The oligonucleotide prodrug of claim 1 wherein the substituted aromatic ring is selected from the group consisting of a phenyl, a biphenyl, a naphthyl, ananthranyl, and a heterocyclic ring.
3. The oligonucleotide prodrug of claim 2 wherein the substituted aromatic ring is a disubstituted phenyl.
4. The oligonucleotide prodrug of claim 1 wherein the aromatic ring is substituted with an electron withdrawing group or an electron donating group .
5. The oligonucleotide prodrug of claim 4 wherein the aromatic ring is substituted with an electron withdrawing group selected from the group consisting of CN, COOH, C00CH3 , COOCH2CH3, COO(CH2)2CH3, COO(CH2)3CH3, CO, halogen, N02 , and mixtures thereof .
6. The oligonucleotide prodrug of claim 4 wherein the aromatic ring is substituted with an electron donating group.
7. The oligonucleotide prodrug of claim 6 wherein the aromatic ring is substituted with an electron donating group selected from the group consisting of OH, OCH3, OCH2CH3 , 0(CH2)2CH3,
0(CH2)3CH3, methyl, ethyl, propyl, butyl S, SH, SCH3, SCH2CH3, S(CH2)2CH3, S(CH2)3CH2, and mixtures thereof .
8. The oligonucleotide prodrug of claim 1 wherein the lipophilic chemical group is selected from the group consisting of an alkyl, aryl, alkane, ar-alkyl, heterocyclic group, fatty acid, steroid ester, steroid amide, and mixtures thereof.
9. The oligonucleotide prodrug of claim 1 wherein the lipophilic chemical group is attached to a sulfur, oxygen, or amine group on the nucleotide phosphate, the 5' phosphate,
10. The oligonucleotide prodrug of claim 1 wherein the nucleotide to which the lipophilic chemical group is attached to the nucleotide via a linkage selected from the group consisting of a phosphorothioate, phosphorodithioate, phosphoramidate, and phosphate ester.
11. The oligonucleotide prodrug of claim 1 which is chimeric .
12. The oligonucleotide prodrug of claim 5 wherein at least one of the nucleotides is selected from the group consisting of a phosphorothioate, phosphorodithioate, phosphoramidate, phosphodiester, alkylphosphonate, alkylphosphonothioate, phosphoramidite, carbamate, carbonate, acetamidate, and carboxymethyl ester.
13. The oligonucleotide prodrug of claim 1 comprising at least one deoxyribonucleotide and at least one ribonucleotide.
14. The oligonucleotide prodrug of claim 13 wherein the ribonucleotide is a 2-O-alkyl ribonucleotide.
15. A pharmaceutical formulation comprising the oligonucleotide prodrug of claim 1 in a pharmaceutically acceptable carrier.
16. The pharmaceutical formulation of claim 15 wherein the oligonucleotide prodrug comprises a nucleic acid sequence complementary to a region of a viral nucleic acid, and the formulation further comprises a second antiviral agent.
17. The pharmaceutical formulation of claim 16 wherein the oligonucleotide prodrug comprises nucleic acid sequence complementary to a first region of the viral nucleic acid, and the second antiviral agent is a second antisense oligonucleotide having a nucleotide sequence complementary to a second region of the viral which does not overlap with the first region.
18. The pharmaceutical formulation of claim 15 in a orally tolerable carrier.
19. A method of increasing the cellular uptake and intracellular concentration of an exogenous oligonucleotide, the method comprising the step of treating a cell with a pharmaceutical formulation comprising the oligonucleotide prodrug of claim 1, the enzyme cleaving the lipophilic group from the reversibly derivatized nucleotide, thereby regenerating the oligonucleotide from the oligonucleotide prodrug, whereby the intracellular concentration of the oligonucleotide is increased.
20. A method of treating a cell for viral infection, and of preventing viral infection in the cell, the method comprising the step of contacting the cell with the oligonucleotide prodrug of claim 1, the oligonucleotide prodrug comprising a nucleotide sequence complementary to a portion of the nucleic acid of a virus, the oligonucleotide prodrug entering the cell wherein the esterase or phosphoramidase cleaves the lipophilic chemical group from the nucleotide, thereby releasing the oligonucleotide which binds the complementary portion of the viral nucleic acid, whereby treating or preventing viral infection is treated or prevented in the cell.
21. A method of increasing the intracellular or in vivo lipid solubility and bioavailability of an oligonucleotide, the method comprising the step of derivatizing the oligonucleotide to form the oligonucleotide prodrug of claim 1, the prodrug being more lipid soluble and bioavailable than the oligonucleotide,
22. A method of site-specifically derivatizing an oligonucleotide comprising the steps of:
(a) covalently coupling a phosphate of a substituted nucleoside phosphoramidite to a hydroxy group of a support-bound nucleoside or support-bound oligonucleotide, thereby forming a derivatized, support-bound oligonucleotide, the support-bound nucleoside or support- bound oligonucleotide comprising at least one protecting group on at least one nucleobase, the substituted nucleoside phosphoramidite comprising a bioreversible linkage, the linkage comprising a lipophilic chemical group selected from the group consisting of an ester linkage and an amide linkage, and further comprising a substituted aromatic ring, a cycloalkenyl ring, an alkenyl linkage, or an alkynyl linkage, and further comprising a protecting group on a phosphate, the linkage being attached to the nucleoside phosphoramidite at a 3 ' phosphate, a 5' phosphate, or an intemucleotidic phosphate;
(b) removing the protecting groups from the derivatized support-bound oligonucleotide with the exception of the protecting group on the bioreversible linkage;
(c) cleaving the derivatized support-bound oligonucleotide from the support; and
(c) isolating the derivatized oligonucleotide.
PCT/US1997/014751 1996-08-21 1997-08-21 Oligonucleotide prodrugs WO1998007734A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US2426296P true 1996-08-21 1996-08-21
US60/024,262 1996-08-21

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
AU41561/97A AU4156197A (en) 1996-08-21 1997-08-21 Oligonucleotide prodrugs

Publications (1)

Publication Number Publication Date
WO1998007734A1 true WO1998007734A1 (en) 1998-02-26

Family

ID=21819691

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/014751 WO1998007734A1 (en) 1996-08-21 1997-08-21 Oligonucleotide prodrugs

Country Status (2)

Country Link
AU (1) AU4156197A (en)
WO (1) WO1998007734A1 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003078626A2 (en) * 2002-03-15 2003-09-25 Nuevolution A/S A building block capable of transferring a functional entity
US6911428B2 (en) 2000-12-12 2005-06-28 Schering Corporation Diaryl peptides as NS3-serine protease inhibitors of hepatitis C virus
US6914122B2 (en) 2000-04-19 2005-07-05 Schering Corporation Macrocyclic NS-3 serine protease inhibitors of hepatitis C virus comprising alkyl and aryl alanine P2 moieties
US7012066B2 (en) 2000-07-21 2006-03-14 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
WO2006065751A2 (en) * 2004-12-13 2006-06-22 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Cpg oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
WO2007070598A2 (en) 2005-12-13 2007-06-21 Spring Bank Nucleotide and oligonucleotide prodrugs
JP2012513450A (en) * 2008-12-23 2012-06-14 ギリンダス・アメリカ・インコーポレイテッドGirindus America Inc. Their use for synthesizing sulfurized agent and oligonucleotide
GB2471806B (en) * 2008-04-03 2012-12-19 Spring Bank Pharmaceuticals Inc Compositions and methods for treating viral infections
WO2014031575A1 (en) 2012-08-20 2014-02-27 The Regents Of The University Of California Polynucleotides having bioreversible groups
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
US10307434B2 (en) 2016-05-27 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4547569A (en) * 1982-11-24 1985-10-15 The United States Of America As Represented By The Department Of Health And Human Services Intercalating agents specifying nucleotides
US4958013A (en) * 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
WO1994002499A1 (en) * 1992-07-27 1994-02-03 Hybridon, Inc. Oligonucleotide alkylphosphonothioates
WO1994026764A1 (en) * 1993-05-12 1994-11-24 Centre National De La Recherche Scientifique (Cnrs) Triester phosphorothioate oligonucleotides and method of preparation
WO1996007392A2 (en) * 1994-09-07 1996-03-14 Hybridon, Inc. Oligonucleotide prodrugs
WO1996029337A1 (en) * 1995-03-23 1996-09-26 Hybridon, Inc. Thiono triester modified antisense oligodeoxynucleotide phosphorothioates

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4547569A (en) * 1982-11-24 1985-10-15 The United States Of America As Represented By The Department Of Health And Human Services Intercalating agents specifying nucleotides
US4958013A (en) * 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
WO1994002499A1 (en) * 1992-07-27 1994-02-03 Hybridon, Inc. Oligonucleotide alkylphosphonothioates
WO1994026764A1 (en) * 1993-05-12 1994-11-24 Centre National De La Recherche Scientifique (Cnrs) Triester phosphorothioate oligonucleotides and method of preparation
WO1996007392A2 (en) * 1994-09-07 1996-03-14 Hybridon, Inc. Oligonucleotide prodrugs
WO1996029337A1 (en) * 1995-03-23 1996-09-26 Hybridon, Inc. Thiono triester modified antisense oligodeoxynucleotide phosphorothioates

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TOMKINS J M ET AL: "Lipophilic Modification of Oligonucleotides", TETRAHEDRON LETTERS, vol. 38, no. 4, 27 January 1997 (1997-01-27), pages 691-694, XP004016708 *

Cited By (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6914122B2 (en) 2000-04-19 2005-07-05 Schering Corporation Macrocyclic NS-3 serine protease inhibitors of hepatitis C virus comprising alkyl and aryl alanine P2 moieties
USRE43298E1 (en) 2000-07-21 2012-04-03 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US7012066B2 (en) 2000-07-21 2006-03-14 Schering Corporation Peptides as NS3-serine protease inhibitors of hepatitis C virus
US6911428B2 (en) 2000-12-12 2005-06-28 Schering Corporation Diaryl peptides as NS3-serine protease inhibitors of hepatitis C virus
WO2003078626A2 (en) * 2002-03-15 2003-09-25 Nuevolution A/S A building block capable of transferring a functional entity
WO2003078626A3 (en) * 2002-03-15 2003-12-04 Jakob Felding A building block capable of transferring a functional entity
WO2006065751A2 (en) * 2004-12-13 2006-06-22 Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Cpg oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
WO2006065751A3 (en) * 2004-12-13 2006-12-07 Us Gov Health & Human Serv Cpg oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
US9809824B2 (en) 2004-12-13 2017-11-07 The United States Of America, Represented By The Secretary, Department Of Health And Human Services CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
US8076303B2 (en) 2005-12-13 2011-12-13 Spring Bank Pharmaceuticals, Inc. Nucleotide and oligonucleotide prodrugs
JP2009519345A (en) * 2005-12-13 2009-05-14 スプリング バンク Nucleotide prodrugs and oligonucleotide prodrugs
KR101123534B1 (en) * 2005-12-13 2012-03-13 스프링 뱅크 Nucleotide and oligonucleotide prodrugs
WO2007070598A3 (en) * 2005-12-13 2008-10-30 Spring Bank Nucleotide and oligonucleotide prodrugs
US10047114B2 (en) 2005-12-13 2018-08-14 Spring Bank Pharmaceuticals, Inc. Nucleotide and oligonucleotide prodrugs
CN101437397B (en) 2005-12-13 2012-09-05 斯普林银行 Nucleotide and oligonucleotide prodrugs
CN102796155A (en) * 2005-12-13 2012-11-28 斯普林银行 Nucleotide and oligonucleotide prodrugs
WO2007070598A2 (en) 2005-12-13 2007-06-21 Spring Bank Nucleotide and oligonucleotide prodrugs
EP3090748A1 (en) * 2005-12-13 2016-11-09 Spring Bank Pharmaceuticals, Inc. Compositions comprising nucleotide and oligonucleotide prodrugs
KR101248873B1 (en) 2005-12-13 2013-04-02 스프링 뱅크 Nucleotide and oligonucleotide prodrugs
CN102796155B (en) * 2005-12-13 2015-08-26 斯普林银行 Nucleotides and oligonucleotides prodrugs
US8691787B2 (en) 2005-12-13 2014-04-08 Spring Bank Pharmaceuticals, Inc. Nucleotide and oligonucleotide prodrugs
US9138442B2 (en) 2008-04-03 2015-09-22 Spring Bank Pharmaceuticals, Inc. Compositions and methods for treating viral infections
GB2471806B (en) * 2008-04-03 2012-12-19 Spring Bank Pharmaceuticals Inc Compositions and methods for treating viral infections
US8404651B2 (en) 2008-04-03 2013-03-26 Spring Bank Pharmaceuticals, Inc. Compositions and methods for treating viral infections
US9539276B2 (en) 2008-04-03 2017-01-10 Spring Bank Pharmaceuticals, Inc. Compositions and methods for treating viral infections
US9695211B2 (en) 2008-12-02 2017-07-04 Wave Life Sciences Japan, Inc. Method for the synthesis of phosphorus atom modified nucleic acids
JP2012513450A (en) * 2008-12-23 2012-06-14 ギリンダス・アメリカ・インコーポレイテッドGirindus America Inc. Their use for synthesizing sulfurized agent and oligonucleotide
US9605019B2 (en) 2011-07-19 2017-03-28 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US10280192B2 (en) 2011-07-19 2019-05-07 Wave Life Sciences Ltd. Methods for the synthesis of functionalized nucleic acids
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
US9617547B2 (en) 2012-07-13 2017-04-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
US10167309B2 (en) 2012-07-13 2019-01-01 Wave Life Sciences Ltd. Asymmetric auxiliary group
WO2014031575A1 (en) 2012-08-20 2014-02-27 The Regents Of The University Of California Polynucleotides having bioreversible groups
US9950001B2 (en) 2012-08-20 2018-04-24 The Regents Of The University Of California Polynucleotides having bioreversible groups
EP2885313A4 (en) * 2012-08-20 2016-03-09 Univ California Polynucleotides having bioreversible groups
JP2015529073A (en) * 2012-08-20 2015-10-05 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア Polynucleotide having the biological reversible group
US10149905B2 (en) 2014-01-15 2018-12-11 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10144933B2 (en) 2014-01-15 2018-12-04 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
US10160969B2 (en) 2014-01-16 2018-12-25 Wave Life Sciences Ltd. Chiral design
US10307434B2 (en) 2016-05-27 2019-06-04 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof

Also Published As

Publication number Publication date
AU4156197A (en) 1998-03-06

Similar Documents

Publication Publication Date Title
Stein et al. Oligodeoxynucleotides as inhibitors of gene expression: a review
MacKellar et al. Synthesis and physical properties of anti-HIV antisense oligonucleotides bearing terminal lipophilic groups
US5466786A (en) 2&#39;modified nucleoside and nucleotide compounds
Agrawal et al. Modified oligonucleotides as therapeutic and diagnostic agents
AU678085B2 (en) Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
US6617442B1 (en) Human Rnase H1 and oligonucleotide compositions thereof
AU2015210397B2 (en) Peptide-based in vivo sirna delivery system
US6111095A (en) Capped synthetic RNA, analogs, and aptamers
JP3131222B2 (en) 2 &#39;modified oligonucleotides having a gap
EP0635023B1 (en) Covalently cross-linked oligonucleotides
EP0677056B1 (en) Oligonucleotide alkylphosphonates and alkylphosphonothioates
EP0968223B1 (en) Bioconjugation of macromolecules
US8957223B2 (en) Ligand-conjugated monomers
US5210264A (en) S-(2,4-dichlorobenzyl)-β-cyanoethyl phosphorothioate diester
KR101624869B1 (en) Compositions and methods for inhibiting expression of transthyretin
US5459255A (en) N-2 substituted purines
Stec et al. Diastereomers of Nucleoside 3'-O-(2-Thio-1, 3, 2-oxathia (selena) phospholanes): Building Blocks for Stereocontrolled Synthesis of Oligo (nucleoside phosphorothioate) s
Manoharan et al. Introduction of a lipophilic thioether tether in the minor groove of nucleic acids for antisense applications
RU2145964C1 (en) Nucleosides with modified sugars and oligonucleotides
JP3050595B2 (en) Oligonucleotide analogs
US6762169B1 (en) Ligand-conjugated oligomeric compounds
US6111085A (en) Carbamate-derivatized nucleosides and oligonucleosides
AU661365B2 (en) Oligonucleotide analogs, their preparation and use
US5770713A (en) Phosphorothioate triester oligonucleotides and method of preparation
JP2823959B2 (en) Derivatized oligonucleotides with improved uptake and other properties

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH KE LS MW SD SZ UG ZW AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT

COP Corrected version of pamphlet

Free format text: PAGES 1/16-16/16, DRAWINGS, REPLACED BY NEW PAGES BEARING THE SAME NUMBER; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: CA

NENP Non-entry into the national phase in:

Ref country code: JP

Ref document number: 1998510980

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase