WO1997042349A1 - Cryptosporidium detection method - Google Patents
Cryptosporidium detection method Download PDFInfo
- Publication number
- WO1997042349A1 WO1997042349A1 PCT/US1997/007972 US9707972W WO9742349A1 WO 1997042349 A1 WO1997042349 A1 WO 1997042349A1 US 9707972 W US9707972 W US 9707972W WO 9742349 A1 WO9742349 A1 WO 9742349A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- primer
- hsp
- substantial part
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- Protozoan parasites are a major cause of gastrointestinal disease.
- the protozoa Cryptosporidium and Giardia have been increasingly associated with waterborne outbreaks of acute diarrhea.
- Cryptosporidium parvum is of particular concern because no known treatment of the illness is available at present.
- a C. parvum infection can lead to prolonged severe diarrhea, malnutrition, wasting, and death.
- Cryptosporidium is an enteric coccidia, which has a multi-staged life cycle one to eight days in duration.
- the oocyst contains four sporozoites which, during normal infection, are released in the presence of bile salts and proteases.
- the sporozoites attach and penetrate intestinal epithelial cells. Once inside they develop into a rounded trophozoite in the area between the cytoplasmic membrane and the cytoplasm.
- the trophozoite (a type I meront) forms up to eight merozoites.
- the merozoites may then develop into a type II meront, which by asexual reproduction forms four merozoites.
- the second generation merozoites may develop into male (microgamont) or female (macrogamont) forms.
- the male form may lead to the sexual phase of the Cryptosporidium life cycle which culminates, in vivo, in the production of the environmentally resistant oocysts.
- These hardy structures possess a thick, double-layered protective cell wall which is resistant to most disinfectants, chlorine concentrations generally present in municipal water supplies, and temperatures between -4°C and 60°C.
- Cryptosporidium is prevalent in most vertebrate groups. Domestic animals, such as rodents, kittens, puppies, and calves may constitute an important reservoir of the human Cryptosporidium.
- disease outbreaks in day-care centers, hospitals and urban family groups indicate that most human infections are transmitted person-to-person rather than via a zoonotic route. Since oocysts are found almost exclusively in stool, the transmission is undoubtedly fecal-oral. Moreover, the recovery of oocysts from both surface and drinking water suggests that indirect transmission via water is not uncommon.
- the infectious dose is 132 oocysts, with as few as 30 oocysts causing infection in 20% of individuals tested (DuPont et al., 1995).
- the ID 50 could be lower, e.g. one to ten oocysts, in more susceptible individuals.
- Cryptosporidium has been documented as a major cause of waterborne illness on numerous occasions. The largest outbreak occurred during the spring of 1993, in Milwaukee, Wisconsin, resulting in approximately 400,000 illnesses and 100 deaths (MacKenzie et al . , 1994) .
- Cryptosporidium has been found to be somewhat ubiquitous in source waters. Two large multi-state surveys found Cryptosporidium in 50% of source waters tested (LeChevalier et al, 1991, and Rose et al., 1991). The Metropolitan Water District of Southern California (MWD) found Cryptosporidium in 24% of source water samples tested (unpublished data, 1992). Cryptosporidium was also found in 27%, 17%, and 6% of finished water samples in the LeChevalier, Rose, and MWD surveys, respectively.
- the current techniques for isolating Cryptosporidium and Giardia from water involve filtration and centrifugation to concentrate and purify oocysts and cysts, respectively, followed by immunofluorescence microscopy. Objects with the correct shape, dimensions, and fluorescence are confirmed by observation of internal structures using differential interference contrast microscopy.
- the limitations of these procedures includes loss of oocysts or cysts during isolation, resulting in recovery efficiencies ranging from 70 to 80 percent to less than one percent for Cryptosporidium.
- the immunofluorescent assay (IFA) method cannot distinguish viable and potentially infective from non-viable or non-infective oocysts and cysts. Additional limitations of IFA include nonspecific antibody binding and cross-reactive antibody binding among human and animal infective species of Cryptosporidium or Giardia.
- the present invention is directed to detection methods and kits that satisfy these needs. Detection of viable and infective protozoa, particularly encysted forms of Cryptosporidium and Giardia, is accomplished by the enzymatic amplification of a target gene sequence, which encodes an inducible heat shock protein (HSP).
- HSP heat shock protein
- the method exploits the speed, sensitivity, and specificity associated with an amplification procedure, such as polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- Pathogenic forms of protozoa present in low copy numbers can be identified and distinguished from morphologically similar but non-pathogenic protozoa.
- a first version of the invention is a method that selectively detects viable protozoan oocysts from a test sample.
- Oocysts are recovered from the test sample and the temperature is elevated to induce the transcription of heat shock protein (HSP) RNA.
- HSP heat shock protein
- the oocysts are then lysed to release the RNA and DNA is removed from the lysate.
- a single- stranded cDNA is synthesized that is complementary to the HSP RNA by combining the RNA, a DNA polymerase having reverse transcriptase activity, four different deoxynucleotide triphosphates, and a first primer, which is complementary to a target HSP RNA sequence.
- a double-stranded cDNA sequence is then synthesized by incubating the single-stranded cDNA from the preceding step with a DNA polymerase, four different deoxynucleotide triphosphates, and a second primer.
- the second primer is complementary to a portion of the single-stranded cDNA and can initiate synthesis of a second cDNA strand.
- the double-stranded cDNA is then amplified to form an amplified target DNA by one of the amplification procedures well known in the art, such as PCR.
- the presence of viable oocysts is then determined by detecting the amplified target DNA.
- a second version of the invention is a method that selectively detects infective protozoan oocysts in a sample.
- Cell cultures which are susceptible to infection, are inoculated with a sample suspected of harboring infective oocysts. The cell culture is incubated under conditions that permit the infective oocysts to infect the susceptible cells. Cultured cells are then treated to gain access to the nucleic acids within the cells.
- An HSP gene sequence is selected as a target for detection.
- the nucleic acids from the cells serve as templates for at least two rounds of DNA synthesis, where a first primer and then a second primer hybridize with a portion of a first strand and a second strand of the HSP gene sequence.
- the primers initiate synthesis of a double-stranded polynucleotide sequence which is subsequently amplified by an appropriate amplification procedure.
- the presence of infective oocysts is then determined by detecting the amplified target DNA.
- the second version of the invention may amplify either DNA or RNA from the infected cells.
- a quantitative assay for infective oocysts can be performed by adjusting, if necessary, the amount of oocysts used to inoculate the cells to a level that permits the enumeration of infection foci. Formation of discrete infection foci can be facilitated by adding an overlay to the cell culture, which retards the migration of infective organisms.
- the invention can be adapted to detect HSP sequences conserved among different members of Cryptosporidium genus. In addition, the invention can be adapted to only detect the human pathogen, C. parvum. A third alternative is to simultaneously detect Cryptosporidium and Giardia. The specificity of the method is determined by the choice of primer pairs that specifically recognize HSP sequences for the protozoa of interest. In addition, the identification of a protozoa of interest can be confirmed by using oligonucleotide probes, which can hybridize with the amplified HSP target DNA.
- kits for use in amplifying and detecting viable or infective Cryptosporidium and/or Giardia organisms can contain suitable amounts of the primers, or a suitable amount of the probe, or suitable amounts of the primers and probe.
- Fig. 1 is a diagram showing the relative map positions of primer pair SEQ ID NO: 2 and SEQ ID NO: 3, primer pair SEQ ID NO: 4 and SEQ ID NO: 5, probe SEQ ID NO: 8, and probe SEQ ID NO: 9 within the HSP70 gene sequence SEQ ID NO: 1;
- Fig. 2 shows amplification of DNA from C. parvum (lanes 1-5) and C. muris (lanes 6-10) by PCR using primer pair SEQ ID NO: 2 and SEQ ID NO: 3, which amplifies Cryptosporidium heat shock protein gene (HSP70) to give a 307 bp product (lanes 1 and 6), primer pair SEQ ID NO: 4 and SEQ ID NO: 5, which amplifies the C.
- SEQ ID NO: 2 SEQ ID NO: 3
- HSP70 Cryptosporidium heat shock protein gene
- parvum HSP70 gene to give a 361 bp product (lanes 2 and 7), primer pair LAX469F and LAX869R, which amplifies an undefined genomic region of Cryptosporidium DNA to give a 451 bp product (lanes 3 and 8), primer pair AWA722F and AWA1325R, which amplifies a portion of a Cryptosporidium 18S rRNA gene to give 556 bp product (lanes 4 and 9), and primer pair AW A 995F and AWA1206R, which amplifies another portion of a Cryptosporidium 18S rRNA gene to give a 256 bp product (lanes 5 and 10); Lane 11 contained a molecular weight marker.
- Fig. 3 shows amplification of DNA from C. parvum and G. lamblia using primer pair SEQ ID NO: 2 and SEQ ID NO: 3 to give a 307 bp Cryptosporidium specific product (lane 1), primer pair SEQ ID NO: 4 and SEQ ID NO: 5 to give a Cryptosporidium specific 361 bp (lane 2), primers SEQ ID NO: 2 and SEQ ID NO: 3 combined with SEQ ID NO: 6 and SEQ ID NO: 7 for a multiplex PCR (lane 3), primers SEQ ID NO: 4 and SEQ ID NO: 5 combined with SEQ ID NO: 6 and SEQ ID NO: 7, which target heat shock protein genes of C. parvum (361 bp product) and G.
- Fig. 4 shows a Southern blot of the gel shown in Fig. 6 hybridized with an internal oligonucleotide probe specific for both of the C. parvum amplification products (307 bp and 361 bp), which was labeled with fluorescein and detected by a chemiluminescent reaction mediated by alkaline phosphatase conjugated anti-fluorescein antibody;
- Fig. 5 shows amplification, with primers SEQ ID NO: 2 and SEQ ID NO: 3 (lanes 1-3) and primers SEQ ID NO: 4 and SEQ ID NO: 5 (lanes 4-6), of DNA fragments from the following Cryptosporidium species.: C. parvum (lanes 1 and 4); C. muris (lanes 2 and 5); C. baileyi (lanes 3 and 6); Lane 7 shows 50, 150, 300, 500, 750, 1000-bp molecular size standards;
- Fig. 6 shows a Southern blot of the gel shown in Fig. 5 hybridized with the SEQ ID NO: 9 oligonucleotide probe, which was labeled with fluorescein and detected by chemiluminescence using an anti-fluorescein antibody conjugated to alkaline phosphatase; and
- Fig. 7 shows hybridization of the SEQ ID NO: 9 probe with the C. parvum specific PCR products of primers SEQ ID NO: 4 and SEQ ID NO: 5 using DNA extracted from 5 individual growth chambers containing mammalian cell cultures infected with C. parvum (lanes 1-5), uninfected cultured cells (lane 6), and environmental water concentrates seeded with C. parvum (lanes 7 and 8).
- the present invention provides a method for amplifying and detecting viable and/or infective Cryptosporidium oocysts by monitoring the presence or absence of heat shock protein (HSP) genes and their transcripts.
- HSP heat shock protein
- the heat shock response has a fundamental role during host invasion by parasites. When parasitic microorganisms infect another organism they experience an increase in environmental temperature, because the body temperature of the host organism is higher than that of the surrounding environment. The physiological response of cells or entire organisms to this increased temperature is called the heat shock response and is characterized by increased transcription of the HSP genes (Maresca and Carratu, 1992). Increased expression (determined by elevated concentrations of mRNA) of HSP genes has been detected in a range of organisms including Plasmodium, Trypanosoma, Candida, and Giardia (Maresca and Carratu, 1992).
- HSP gene transcription is a physiological response of living cells to an environmental stimulus
- only viable Cryptosporidia are identified by amplifying and detecting HSP RNA transcripts from intact oocysts.
- infective Cryptosporidia are determined by first inoculating susceptible cell cultures with oocysts, and subsequently amplifying and detecting HSP DNA or RNA molecules from infected cells.
- a third alternative provides a method for simultaneously detecting Cryptosporidium and Giardia HSP gene amplification products. II. RECOVERY OF OOCYSTS
- Cryptosporidium and Giardia The diagnosis of Cryptosporidium and Giardia is generally established by the recovery of Cryptosporidium oocysts and Giardia cysts from stool specimens.
- evidence for indirect transmission via contaminated water is provided by concentrating Cryptosporidium oocysts and Giardia cysts from water samples.
- Cryptosporidium oocysts and Giardia cysts can be concentrated from water by a variety of methods. For example, a predetermined volume of water, e.g. 100 liters, can be filtered through a 1 ⁇ m nominal porosity yarn-wound polypropylene filter or its equivalent. The filtration flow rate is restricted to about 4 liters/min.
- Sampled filters are typically shipped on ice to analytical laboratories for analysis within 24 hours. Retained protozoa are eluted from the filter within 96 hours of collection with a buffered detergent solution, filter fibers are cut, teased and washed by hand or with the aid of a stomacher. Oocysts or cysts recovered in the eluent are concentrated by centrifugation and partially purified by flotation on a Percoll- sucrose solution with a specific gravity of 1.1. A portion of the purified material is placed on a membrane filter, tagged with antibody using the indirect staining method, and examined under UV microscopy. Specific criteria are used to identify cysts and oocysts including, immunofluorescence, size, shape, and internal morphology.
- oocysts are inoculated onto susceptible cells, incubated under conditions that permit infection of cells to occur, and tested for the presence of HSP target DNA or RNA by an amplification procedure. Prior to the inoculation step the oocysts are decontaminated and, optionally, subjected to an excystation protocol.
- Oocysts recovered from water samples and stool specimens should be decontaminated to kill other microorganisms that may be present in the sample.
- Oocysts can be decontaminated by treatment with 10% chlorine bleach followed by washing with sterile 0.1 % sodium thiosulfate to remove residual chlorine. If necessary, oocysts can also be treated with antibiotics prior to inoculation.
- An optional excystation procedure may be included in oocyst pre-treatments to release sporozoites and improve infectivity.
- oocysts are pelleted for 2 min at 5,000 x g in a microfuge, resuspended with ice-cold 10% chlorine bleach solution, and allowed to stand for 10 min on ice. The oocysts are then washed twice by successive pelleting and resuspension in sterile ice-cold saline solution. Finally, the decontaminated oocysts are resuspended in 1 ml of cell culture growth media.
- An alternative excystation procedure includes the following steps. Purified oocysts are suspended in PBS and placed on ice. An equal volume of cold 40% chlorox bleach solution is added to the oocyst suspension and the mixture is allowed to stand on ice for 1 min. Oocysts are washed 2-3 times in cold phosphate buffered saline (PBS) to remove the bleach and pre- incubated in PBS for 1 hr at 37°C. An equal volume of prewarmed excystation fluid, consisting of 0.25% trypsin and 0.75% taurocholic acid, is added to the oocysts. The oocysts are incubated for up to 2 hrs at 37°C on a shaker.
- PBS cold phosphate buffered saline
- excysted sporozoites are recovered by filtration through a syringe filter with a pore size of about 0.2 ⁇ m. Sporozoites are washed in Hanks Balanced Salt Solution (HBSS) to remove the excystation fluid.
- HBSS Hanks Balanced Salt Solution
- Cryptosporidium oocysts or sporozoites are inoculated onto susceptible cells to determine whether the oocysts or sporozoites are capable of initiating an infection.
- Cells that are susceptible to Cryptosporidium infection include CaCo-2, HCT-8, and MDBK cells
- Susceptible cells can be grown as monolayers. When the monolayers are 90% confluent, an inoculum is placed on the cells in a volume that is sufficient to cover the monolayer. The cells are then incubated at 37°C for 2 hours in 5% C0 2 , 95% air. Inoculated monolayers are washed once with a saline-antibiotics solution to remove residual toxicity and re-incubated at 37°C. Inoculation of Giardia cysts can be conducted similarly to Cryptosporidium infection.
- a quantitative infectivity assay can be performed by preparing cell monolayers attached to microscope slides and inoculating the cell with a measured dose of inoculum.
- the slides are pre-treated with silane, collagen, BSA, laminin, fibronectin, or other cell attachment factors to increase cell adherence.
- Oocyst preparations are serially diluted until the inoculum contains less than about 1 oocyst per cell, i.e, a multiplicity of infection less than one (MOI ⁇ 1).
- Quantitative accuracy may be affected if mobile sporozoites and stage I or II merozoites are able to produce secondary infection sites. Short incubation periods, e.g., 24 hrs, may prevent some mobility of organisms. However, the movement of parasites is preferably restricted by the use of overlays. For example, soft agarose, agar, and methylcellulose overlays can be used to restrict movement of parasites only to adjacent cells (cell-to-cell transmission). As a result, discrete infection foci are produced, which can be enumerated. D. Fixation Treatments
- cDNA synthesis, amplification, and detection procedures can occur in situ, i.e. within the confines of infected cells. Accordingly, the cells are fixed, in a manner that does not destroy cell morphology. An optimum fixation procedure will permit the reagents for subsequent reactions to diffuse into the semi-permeabilized cell. In addition, the reaction products should not be able to diffuse out of the semi-permeabilized cells.
- a preferred fixation method includes treating the slides with methanol: acetic acid (3:1) at room temperature for 5 min. Following acidic methanol fixation, cells are rehydrated in graded ethanol (95%, 70%, and 50%, 2 min each) and treated with 200 ⁇ l proteinase K (5 ⁇ g/ml) for 15 min at 37°C in a humid chamber. After the proteinase treatment, the slides are rinsed in PBS, pH 7.4 for 5 min. at room temperature. If the cells are to be used for detecting RNA, then 200 ⁇ l of an RNase-free DNase solution (about 750 U/ml) is layered on the cells, covered with a cover slip, and incubated in a humid chamber for about two to about four hours at room temperature.
- the cells are treated in a similar manner with DNase-free RNase A. Following nuclease treatment, the cultured cells are washed with PBS and dehydrated in graded ethanol (50%, 70%, 95%, and 100%, 2 min each) IV. PREPARATION OF NUCLEIC ACID EXTRACTS
- cDNA synthesis and amplification procedures can also be performed using nucleic acid containing extracts from cysts, oocysts, and infected cell cultures.
- Nucleic acids can be liberated from cysts, oocysts, and infected cell cultures by any method capable of lysing the cells.
- the oocysts can be frozen in liquid nitrogen for 2 min., followed by thawing at 95°C for 5 min. The freeze/thaw cycle can be repeated, if necessary, and the lysate can be used directly in an amplification reaction.
- RNA can be removed from the lysate by treatment with DNase-free RNase A. Further purification of DNA from oocysts and infected cell cultures can be accomplished by additional extraction steps. For example, cells can be lysed in 50 mM Tris-HCl, 20 mM EDTA, pH 8, containing 2 mg/ml proteinase K and 0.5% sarkosyl, and incubated at 37°C for 1 h. Then, 5 M NaCl is added to give a final concentration of 1 M, and CTAB (hexadecyltrimethyl ammonium bromide) is added to a concentration of 1 % .
- CTAB hexadecyltrimethyl ammonium bromide
- the lysate is subjected to at least one freeze/thaw cycle, and phenol/chloroform extraction.
- the DNA is precipitated by the addition of 0.6 vol, of isopropanol and the DNA precipitate is then washed with 70% ethanol.
- RNA can be removed from the lysate by treatment with RNase-free DNase.
- Total RNA can be also be isolated from lysed cells by extraction with strong denaturants, such as guanidium thiocyanate, followed by centrifugation through a cesium chloride solution.
- mRNA can be isolated using solid state particles attached to oligo-dT, which can select mRNA transcripts having a poly(A) tail.
- mRNA from HSP genes can be induced by incubating cysts, oocysts, or infected cells at about 37°C to about 42°C for 30 min.
- a cDNA, complementary to the HSP mRNA can then be synthesized by a reverse transcription reaction.
- the basic components for synthesizing a first strand of cDNA includes an HSP RNA template, a DNA polymerase having reverse transcriptase activity, sufficient amounts of four different nucleotide triphosphates, e.g. dATP, dCTP, dGTP, dUTP, or their analogs, and a first primer.
- the target HSP RNA template can be extracted from lysed cysts, oocysts, or infected cells. Alternatively the HSP RNA can remain within fixed cells for an in situ reaction. Moreover, the first primer can hybridize with a portion of the HSP mRNA, thereby initiating the synthesis of the first cDNA.
- the reverse transcriptase reactions typically contain: 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2-5 mM MgCl 2 , 1 mM each dATP, dCTP, dGTP, dUTP, 1 U/ ⁇ l RNase inhibitor, 2.5 U/ ⁇ l reverse transcriptase, 0.5 ⁇ M specific primer or 2.5 ⁇ M random primers, and total RNA or messenger RNA from at least one oocyst, in a 20 ⁇ l reaction.
- the reaction mixture can be incubated within a test tube or a multiwell plate.
- an in situ reaction is conducted by layering the mixture directly onto cells, placing a coverslip on top of the mixture, and sealing the edges of the coverslip with rubber cement or other suitable sealant.
- the reaction is preferably performed at 42°C for 15-60 min followed by 5 min at 99°C to stop the reaction.
- the amplification step of the present invention can be conducted using any of the amplification systems known in the art including the polymerase chain reaction system (U.S. Patent Nos. 4,683,195; 4,683,202; and 4,965,188), the ligase amplification system (PCT Patent Publication No. 89/09835) the self-sustained sequence replication system (U.S. Patent No. 5,409,818 and PCT Patent Publication No. 90/06995), the transcription-based amplification system (U.S. Patent No. 5,437,990), and the Q ⁇ replicase system (U.S. Pat. No. 4,957,858).
- PCT Patent Publication No. 89/09835 the self-sustained sequence replication system
- U.S. Patent No. 5,409,818 and PCT Patent Publication No. 90/06995 the transcription-based amplification system
- U.S. Patent No. 5,437,990 the transcription-based amplification system
- Q ⁇ replicase system U
- PCR is the preferred amplification system of the present invention.
- a target HSP nucleic acid sequence is amplified by treating the double- stranded polynucleotide with two oligonucleotide primers, each being complementary to one of the two strands.
- the primers hybridize with their complementary stands and extension products are synthesized using DNA polymerase and four different deoxynucleotide triphosphates.
- the DNA polymerase is preferably a thermostable enzyme, such as Taq, Tth, Pfu, or any other native, mutated, or deleted enzyme derived from a thermophilic organism.
- the extension products are separated from their complementary strands by denaturation at an elevated temperature, generally from about 80° to 100°C.
- the reaction mixture is repeatedly cycled between a low temperature annealing step, generally of from about 37° to 70°C, an intermediate temperature primer extension step, generally of from about 70° to 80°C, and a higher temperature denaturation step, generally of from about 80° to 100°C. If a thermostable DNA polymerase is used, the polymerase reaction can be cycled many times, typically 20-40 times, without needing additional enzyme.
- Reagent mixtures and conditions for in situ amplification are generally the same as those for standard PCR although concentrations of MgCl 2 and thermostable DNA polymerase are generally higher. Cycling parameters are determined by the optimal annealing temperature of the primers and the length of the PCR amplification product. Reaction sensitivity and specificity can be improved by using a "hot start", which prevents mis-priming and non-specific amplification. A hot start can be achieved by adding Taq polymerase only after the amplification reagents have reached 55°C. However, chemical hot start methods, e.g. by inclusion of dUTP and uracil-DNA glycosylase (UDG) or Taq antibodies (TaqStartTM Clontech), both of which inhibit PCR below 50°C, are preferred for in situ PCR due to their relative convenience.
- UDG uracil-DNA glycosylase
- TaqStartTM Clontech both of which inhibit PCR below 50°C
- a typical amplification cocktail contains: 10 mM Tris-HCl, pH 8.3; 50 mM KCl; about 2 mM to about 5 mM MgCl 2 ; about 250 ⁇ m each of dATP, dCTP, dGTP, and dUTP; about 3 ⁇ g/ml BSA; 10% glycerol; about 0.5 ⁇ M of each primer; and about 5 U to about 10 U of thermostable polymerase.
- dUTP is a preferred reaction component because UDG can be used to prevent carryover contamination of amplification reactions and as a chemical hot start.
- Temperature cycling can be performed in a dedicated in situ PCR thermal cycler (PTC-100-16MS, MJ Research). The amplification cycle is repeated up to about 40 times with denaturation and extension taking place at about 94°C for about 1 min and 72°C for about 2 min, respectively. The annealing temperature will depend on the primers used. VII. PRIMERS AND PROBES
- Primers for the reverse transcription and amplification steps of the present invention are chosen to efficiently amplify nucleic acid sequences from organisms within a particular genus of protozoa, e.g. Cryptosporidium or Giardia.
- primers are chosen which only amplify a single protozoan species within a genus, e.g the human pathogens C. parvum or G. lamblia.
- the targets for amplification, i.e., the HSP sequences are genes which can be easily induced to produce mRNA, since organisms capable of transcribing mRNA are viable and potentially infectious. If a Cryptosporidium oocyst or Giardia cyst is not viable then it will not produce HSP mRNA.
- Primers and probes are preferably synthetic oligonucleotides, which can be prepared by an automated instrument (e.g, Applied Biosystems Inc., Foster City, CA). Alternatively, customized oligonucleotide primer and probes can be purchased from commercial suppliers, e.g., National Biosciences, Inc., Madison, MN.
- Preferred primer pairs and probes target the HSP70 gene sequence of C. parvum (SEQ ID NO: 1, see also, Khramtsov et al., 1995). An alignment of HSP70 gene sequences from a range of organisms was done to find primers and probes for
- a most preferred primer pair (SEQ ID NO: 2 and SEQ ID NO: 3) can amplify
- primer pairs can amplify DNA or RNA from several Cryptosporidium species.
- a most preferred primer pair is: SEQIDNO: 2: CTGTTGCTTATGGTGCTGCTG, and
- SEQIDNO: 3 CCTCTTGGTGCTGGTGGAATA, which typically gives a 307 base pair amplification product from Cryptosporidium nucleic acid extracts (see Fig. 1).
- the experimentally determined optimum annealing temperature of SEQ ID NO: 2 and SEQ ID NO: 3 is about 55°C.
- the primer pairs are specific for C. parvum.
- the second embodiment is exemplified by the following most preferred primer pair:
- SEQ ID NO: 4 AAA TGG TGA GCA ATC CTC TG
- SEQ ID NO: 5 CTT GCT GCT CTT ACC AGT AC, which typically gives a 361 base pair amplification product from C. parvum nucleic acid extracts (see Fig. 1).
- SEQ ID NO: 4 and SEQ ID NO: 5 is about 55°C.
- primer pairs specific for Giardia are combined with Cryptosporidium specific pairs for a "multiplex" amplification.
- the DNA sequence for a heat shock protein in G. lamblia that is unrelated to HSP 70 has been described (Aggarwal et al., 1990, incorporated herein by reference).
- primers targeting the HSP gene have been described, which are suitable for the detection of viable G. lamblia cysts in water samples (Abbaszadegan et al., 1993, inco ⁇ orated herein by reference) The following primers:
- SEQ ID NO: 6 AGGGCTCCGGCATAACTTTCC
- SEQ ID NO: 7 GTATCTGTGACCCGTCCGAG, amplify a 163 base pair product from G. lamblia. The optimum annealing temperature for
- SEQ ID NO: 6 and SEQ ID NO: 7 is about 55°C and the optimum MgCl 2 concentration is 2.5 mM.
- primer pair SEQ ID NO: 6 and SEQ ID NO: 7 and primer pair SEQ ID NO: 7 are primer pair SEQ ID NO: 6 and SEQ ID NO: 7 and primer pair SEQ ID NO: 7 and primer pair SEQ ID NO:
- the first amplification product is a 361 base pair DNA fragment, corresponding to C. parvum HSP 70 sequences.
- the second amplification product is a 163 base pair DNA fragment, corresponding to sequences of a G. lamblia heat shock protein gene that are unrelated to HSP 70. VTH. DETECTION
- the amplified HSP target DNA can be detected directly by any method that can distinguish among different lengths of DNA. Electrophoresis through agarose is the standard method used to separate, identify, and purify DNA fragments. The location of DNA within the gel can be determined directly by staining with low concentrations of the fluorescent intercalating dye ethidium bromide. Bands corresponding to die predicted length for amplified target DNA can then be detected by direct examination of the gel in ultraviolet light. In addition, the DNA bands from an electrophoresed gel can be transferred to a membrane support by capillary action, followed by indirect detection using oligonucleotide probes.
- a typical transfer protocol includes denaturing the DNA within the gel using an alkaline solution, such as 0.4 M NaOH, 0.6 M NaCl, followed by a neutralization step in a buffer solution, e.g. 1.5 M NaCl, 0.5 M Tris-HCl, pH 7.5.
- the gel is then equilibrated with a high ionic strength transfer buffer, such as 10X SSC, wherein IX SSC is 0.15 M NaCl, 0.015 M Na citrate.
- the denatured DNA can then be transferred from the gel to a membrane support by capillary blotting in transfer buffer.
- a preferred mode for detecting amplified target sequences is via hybridization to a single-stranded oligonucleotide probe which is sequence-complementary to a sequence located between the two selected oligonucleotide primers in the target HSP gene.
- the identity of the amplified extension products from each set of primers can thereby be confirmed using the sequence specific probes.
- Oligonucleotide probes are normally selected according to their ability to hybridize with an internal sequence of an amplified target DNA.
- probes that can detect the amplified products of the viability or infectivity assays are complementary to an amplified heat shock protein gene sequence, preferably HSP70.
- a most preferred probe is an oligonucleotide, which specifically hybridizes with HSP70 sequences of C. parvum.
- the following two probes are exemplary of C. parvum specific probes: SEQ ID NO: 8: AAA TGG TGA GCA ATC CTC TGC CG SEQ ID NO: 9: CCA TTA TCA CTC GGT TTA GA
- the first C. parvum HSP70 specific probe contains sequences corresponding to nucleotide base numbers 2423 to 2446 of SEQ ID NO: 1.
- the SEQ ID NO: 8 probe can be used to detect C. parvum specific sequences of any HSP70 targets having complementary sequences to nucleotide base numbers 2423 to 2446 of SEQ ID NO: 1. Consequently, SEQ ID NO: 8 can be used to detect the amplification products of the SEQ ID NO: 2 and SEQ ID NO: 3 primer pair (see Fig. 1).
- the second C. parvum HSP70 specific probe contains sequences corresponding to nucleotide base numbers 2475 to 2495 of SEQ ID NO: 1.
- the SEQ ID NO: 9 probe can be used to detected C. parvum specific sequences of any HSP70 targets having complementary sequences to nucleotide base numbers 2475 to 2495 of SEQ ID NO: 1. Accordingly, SEQ ID NO: 9 can be used to detect the amplification products of a variety of primer pairs, such as SEQ ID NO: 2 and SEQ ID NO: 3; SEQ ID NO: 2 and SEQ ID NO: 5; and SEQ ID NO: 4 and SEQ ID NO: 5 (see Fig. 1).
- an internal probe can be used to confirm the identity of the Giardia targets.
- the following internal oligonucleotide probe can be used for detecting G. lamblia HSP targets.
- SEQ ID NO: 10 CAGGCCTTGGCGTTCCCGAAG.
- Giardia HSP probes are especially useful in a "multiplex" amplification procedure, which includes primers for both Giardia and Cryptosporidium target sequences. The Giardia HSP probes can then be used to distinguish Giardia specific amplification products from any other amplification products.
- Amplified target DNA that has been captured on a solid support can be detected by using a labeled hybridization probe.
- the probe can be labeled with a radioactive or fluorescent tag, or attached directly or indirectly to an enzyme molecule. Then, the membrane-bound amplified target DNA is incubated with the probe under hybridization conditions. Following hybridization, excess probe is washed away. If the hybridization probe is radioactively tagged, the remaining hybridized probe can be detected by autoradiography or scintillation counting.
- the immobilized probe can be detected with an enzyme attached to the specific binding molecule, such as horseradish peroxidase or alkaline phosphatase attached to streptavidin.
- an enzyme attached to the specific binding molecule such as horseradish peroxidase or alkaline phosphatase attached to streptavidin.
- a preferred method of detection is via hybridization with a nonradioactive 5' digoxigenin (DIG)-labeled oligonucleotide probe.
- DIG nonradioactive 5' digoxigenin
- the solid support is washed with a high ionic strength buffer, such as 5X SSC, at about 70°C.
- the immobilized hybridization probe that remains after washing can be visualized by incubating the solid support with anti-DIG antibody conjugated to alkaline phosphatase, followed by addition of a chemiluminescent substrate, such as Lumigen-PPD (Boehringer Mannheim).
- the support is finally washed, sealed in Saran Wrap, and exposed to X-ray film to detect any chemiluminescence .
- the first in situ detection method is a direct technique, which involves incorporation of a label directly into the amplification product.
- a reporter molecule such as digoxigenin [DIG]-dUTP or fluorescein-dUTP can be included in the amplification cocktail and incorporated into the amplification product.
- a simple immunochemical step using alkaline phosphatase- or peroxidase-conjugated anti-DIG detects DIG labeled amplification products.
- fluorescein labeled amplification products can be detected by fluorescence microscopy or immunochemical methods.
- the second in situ detection method is an indirect technique, which involves hybridization of a specific labeled probe to the amplification product after PCR.
- the label on the probe is then detected either by immunochemical methods or fluorescence microscopy.
- the indirect method is preferred because it has a higher specificity than direct in situ PCR.
- each labeled with a different fluorescent molecule, e.g., fluorescein, rhodamine, and couramin each targeting different amplification products, the potential exists for detecting multiple target genes in a single sample.
- kits used to amplify and detect viable or infective Cryptosporidium and/or Giardia organisms.
- the kit may comprise suitable amounts of the primers, or a suitable amount of the probe, or suitable amounts of the primers and probe.
- kits can contain a suitable amount of at least one standard sample, which contains a known concentration of a Cryptosporidium or Giardia species, and a negative control sample substantially free of the protozoa of interest.
- the methods and kits of the present invention have many advantages over previous methods, including the speed, sensitivity, and specificity associated with amplification procedures, such as PCR. Since the methods can detect only viable and infectious forms of Cryptosporidium and Giardia, the effectiveness of disinfection procedures can be monitored. Moreover, the human pathogen, C. parvum, can be distinguished from other Cryptosporidia, such as C. muris and C. bailey i, which only infect animal hosts.
- This example compares the specificity of primers directed to different portions of the HSP70 gene, an undefined genomic region of Cryptosporidium DNA, and the 18S rRNA gene, for C. parvum and C. muris.
- DNA was extracted from C. parvum and C. muris oocysts by freezing in liquid nitrogen for 2 min, followed by thawing at 95 °C for 5 min.
- freeze-thaw lysate (equivalent to about 1,000 cysts or oocysts) was added to individual amplification reactions, which also contained: 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 0.01% gelatin; 2.5 mM MgCl 2 , 0.25 ⁇ M of each primer, 200 ⁇ M each of dATP, dCTP, dGTP and dUTP; and 2 U of Amplitaq * DNA polymerase (Perkin-Elmer, Foster City, CA) in a 100- ⁇ L volume.
- primer pair SEQ ID NO: 4 and SEQ ID NO: 5 which is directed to a different portion of HSP70 gene, primed the amplification of a 361 bp product from C. parvum, but not C. muris DNA extracts (see Lanes 2 and 7 of Figure
- primer pairs directed to the 18S rRNA gene (Awad-El-Kariem et al., 1994), which primed the synthesis of amplification products from C. parvum and C. muris extracts (see Fig. 2, lanes 4, 5, 9, and 10).
- primers directed to an unspecified genomic region of Cryptosporidium DNA (Laxer et al., 1991) primed a 451 base pair amplification product from C. parvum extracts (see Fig. 2, lane 3).
- primer pair SEQ ID NO: 2 and SEQ ID NO: 3 exemplifies an HSP 70 primer pair that is specific for at least two different members of the Cryptosporidium genus, whereas the specificity of primer pair SEQ ID NO: 4 and SEQ ID NO: 5 was limited to C. parvum.
- Oligoprobe Detection This example illustrates that a combination of two primer pairs directed to C. parvum and G. lamblia HSP sequences can accurately amplify both target sequences simultaneously. Moreover, the identity of the C. parvum amplification product can be confirmed using a C. parvum specific oligonucleotide probe.
- DNA was extracted from C. parvum oocysts and G. lamblia cysts by freezing in liquid nitrogen for 2 min, followed by thawing at 95 C C for 5 min.
- the amplification reaction contained 10 mM Tris-HCl, pH 8.3; 50 mM KCl; 0.01 % gelatin; 1.5 mM MgCl 2 ; 0.25 ⁇ M of each primer; 200 ⁇ M each of dATP, dCTP, dGTP and dUTP; and 2 U of Amplitaq * DNA polymerase (Perkin-Elmer, Foster City, CA) in a 100- ⁇ L volume with 5 ⁇ L template DNA.
- Negative control reactions contained sterile distilled water in place of template DNA.
- the reactions were overlaid with two drops of sterile mineral oil (Sigma Chemical Co., St. Louis, MO). Hot start reactions were performed in a DNA Thermal Cycler model 480 (Perkin-Elmer) with denaturation at 94°C for 2 min, followed by 40 cycles of denaturation at 94 °C for 1 min, annealing for 1 min at 52° C, and extension at 72 °C for 1 min. A final extension incubation at 72 °C for 5 min was included, followed by 5 min at 5°C to stop the reactions.
- sterile mineral oil Sigma Chemical Co., St. Louis, MO.
- PCR products (15% of the amplification reaction) were detected by standard agarose gel electrophoresis and ethidium bromide staining (see Fig. 3). Reactions primed only with SEQ ID NO: 2 and SEQ ID NO: 3 exhibited the expected 307 base pair product (Fig. 3, lane 1). Similarly, reactions primed only with SEQ ID NO: 4 and SEQ ID NO: 5 exhibited the expected 361 base pair product (Fig. 3, lane 1). Amplification products from reactions primed with both primer pair SEQ ID NO: 2 and SEQ ID NO: 3, and primer pair SEQ ID NO: 8 and SEQ ID NO: 9 were not visible on the ethidium bromide stained gel (see Fig. 3, lane 3).
- DNA was denatured by incubation of the gel for 30 min each in 0.4 M NaOH, 0.6 M NaCl followed by 1.5 M NaCl, 0.5 M Tris-HCl, pH 7.5 at room temperature. The gel was then incubated for 20 min in 10 x SSC (IX SSC is 0.15 M NaCl, 0.015 M Na citrate). Denatured DNA was transferred to a positively charged nylon membrane (Boehringer Mannheim) by overnight capillary blotting in 10X SSC. Transferred DNA was cross-linked to the membrane by UV irradiation (120 mJ for 2 min) followed by drying at 80°C.
- the membrane was prehybridized for 1 h in 20 of hybridization solution which contained 5X SSC, 1 % blocking reagent (Boehringer Mannheim), 0.1 % sarcosine, 0.02% SDS at 64°C.
- the membrane was then hybridized in fresh hybridization solution containing 50 pmoles of 5' -fluorescein labeled oligonucleotide probe SEQ ID NO: 9 for 18 h at 64 C C in a rotary hybridization oven (Model 310, Robbins Scientific, Sunnyvale, CA). Stringency washes containing 20 mM Tris-HCl, pH 7.4, 0.01 % SDS, and 5X SSC were performed at 70 C C, twice for 15 min each.
- Hybridized probe was detected with an anti-fluorescein alkaline phosphatase conjugate and a chemiluminescent substrate.
- Membranes were washed for 5 min in 20 ml of 0.3 % Tween 20 followed by 30 min incubation in 100 ml of 1 % blocking reagent. Both of these solutions were made up in 0.1 M maleic acid, 0.15 M NaCl, pH 7.5 and all incubations were at 23 C C in a rotary hybridization oven.
- Fluorescein labeled anti-Digoxigenin (1.5 U, Boehringer Mannheim) was added in 20 ml of 0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl, 1% blocking reagent and incubated for 15 min to label the molecular size markers.
- Anti-fluorescein alkaline phosphatase (1.5 U, Boehringer Mannheim) was added to the membrane in 20 ml of 0.1 M Tris-HCl, pH 7.5, 0.15 M NaCl, 1 % blocking reagent and incubated for 30 min.
- the membranes were washed twice in 100 ml of 0.3% Tween 20 followed by 5 min in 20 ml of 0.1 M Tris, 0.1 M NaCl, 50 mM MgCl 2 , pH 9.5 and then incubated for 15 min at 37 °C with Lumigen * -PPD (0.1 mg/ml; Boehringer Mannheim) in 1 ml of 0.1 M Tris, 0.1 M NaCl, 50 mM MgCl 2 , pH 9.5. The membrane was sealed in Saran Wrap and incubated at room temperature for
- Fig. 4 shows that the SEQ ID NO: 9 probe specifically detected C.parvum amplification products that are 307 base pair (Fig. 4, lanes 1 and 3) and 361 base pair (Fig. 4, lanes 1 and 4) in size. Moreover, the C. parvum specific probe did not hybridize with G. lamblia sequences from either multiplex reaction (Fig. 4, lanes 3 and 4)
- Example 3 Differential Amplification and Detection of Cryptosporidium DNA from Oocysts
- This example illustrates the use of Cryptosporidium genus specific primers to amplify DNA extracted from a variety of Cryptosporidium species.
- this example demonstrates the use of a Cryptosporidium species specific primer pair to selectively amplify C. parvum HSP70 DNA.
- the example demonstrates differential detection of C. parvum amplification products using a species specific probe.
- DNA was extracted from C. parvum, C. muris and C. bailey i oocysts by freezing in liquid nitrogen for 2 min, followed by thawing at 95 C C for 5 min.
- Amplification reactions were conducted using primer pair SEQ ID NO: 2 and SEQ ID NO: 3 (see Fig. 5, lanes 1 to 3) or primer pair SEQ ID NO: 4 and SEQ ID NO: 5 (see Fig. 5, lanes 1 to 3) essentially as described in Example 1.
- the PCR products (15% of the amplification reaction) were detected by standard agarose gel electrophoresis and ethidium bromide staining, as shown in Fig. 5.
- Primer pair SEQ ID NO: 2 and SEQ ID NO: 3 amplified nucleic acid sequences from C. parvum (Fig. 5, lane 1), C. muris (Fig. 5, lane 2), and C. bailey i (Fig. 5, lane 3).
- primer pair SEQ ID NO: 4 and SEQ ID NO: 5 only amplified DNA target sequences from C. parvum (Fig. 5, lane 4).
- a Southern blot of the gel shown in Fig. 5 was performed as described in Example 2. Moreover, hybridization with probe SEQ ID NO: 9, washing, and probe detection were also done essentially as described in Example 2. The C. parvum specific probe did not hybridize with the C. muris (Fig. 6, lane 2), and C. baileyi (Fig. 6, lane 3) amplification products, but did detect both C. parvum HSP70 amplification products (Fig. 6, lanes 1 and 4).
- This example illustrates methods for recovering and concentrating oocysts from water samples, In addition, the example illustrates an effective method for extracting template DNA from infected cells and oocysts for use in amplification reactions.
- Total DNA was extracted from infected mammalian cell cultures and seeded concentrates of source water samples (100 ⁇ l) by lysis in 50 mM Tris-HCl, 20 mM EDTA, pH 8, containing 2 mg/ proteinase K and 0.5% sarkosyl, followed by incubation at 37 °C for 1 h. Then, 5 M NaCl was added to give a final concentration of 1 M, and CTAB was added to a concentration of 1%. Following incubation at 65 °C for 30 min, the lysate was subjected to one freeze/thaw cycle and phenol/chloroform extraction. The DNA was precipitated by the addition of 0.6 vol of isopropanol, and the DNA precipitate was washed with 70% ethanol. After desiccation, the DNA pellet was resuspended in 100 ⁇ L of sterile distilled water.
- the amplification reaction conditions using primer pair SEQ ID NO:4 and SEQ ID NO: 5 were generally the same as in Example 1.
- DNA was amplified by 40 cycles of denaturation at 94 °C for 45 sec, annealing for 45 sec at 55 °C and extension at 72 °C for 1 min in reactions containing 1.5 mM MgCl 2 .
- the seeded water concentrate amplification reactions also contained 10 ⁇ g/ml BSA.
- PCR products (15% of the amplification reaction) were detected by standard agarose gel electrophoresis and ethidium bromide staining. DNA transfer, hybridization and detection were performed essentially as described in Example 2.
- the membrane was hybridized with the SEQ ID NO: 9 probe in 1 x SSC at 57°C for 18 h and washed in 1 x SSC at 54°C.
- the developed film (Fig. 7) shows that the primer and probe combination gave a strong detection signal whenever C. parvum specific sequences were present in the DNA extracts.
- TTTAATTCGA TTTCAATCTA CAAATACTAA TTAGAGAAAA TTATATGCAA TATTTTTTTT 840 CCATGTTATA GAAAATTGAA GGGTTTAGGC GCCAAATCGA GAGTTACTAC TTTGTATAAA 900
- AGA ATC ATT AAC GAG CCA ACT GCA GCT GCT ATT GCT TAT GGT CTT GAT 1838 Arg lie lie Asn Glu Pro Thr Ala Ala Ala lie Ala Tyr Gly Leu Asp 175 180 185
- GTT AAA GCT ACC GCT GGT GAT ACT CAC TTG GGT GGT GAA GAT TTT GAT 1982 Val Lys Ala Thr Ala Gly Asp Thr His Leu Gly Gly Glu Asp Phe Asp 225 230 235
- MOLECULE TYPE Other nucleic acid
- DESCRIPTION primer sequence
- SEQUENCE DESCRIPTION SEQ ID NO: 4:
- MOLECULE TYPE Other nucleic acid
- DESCRIPTION primer sequence
- SEQUENCE DESCRIPTION SEQ ID NO: 6:
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Crystals, And After-Treatments Of Crystals (AREA)
- Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
- Saccharide Compounds (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU31216/97A AU709186C (en) | 1996-05-09 | 1997-05-08 | Cryptosporidium detection method |
BR9709308A BR9709308A (en) | 1996-05-09 | 1997-05-08 | Cryptosporidium detection process |
JP9540250A JPH11509104A (en) | 1996-05-09 | 1997-05-08 | Cryptosporium detection method |
CA002253642A CA2253642C (en) | 1996-05-09 | 1997-05-08 | Cryptosporidium detection method |
EP97926451A EP1007724A4 (en) | 1996-05-09 | 1997-05-08 | Cryptosporidium detection method |
US09/326,074 US6436638B1 (en) | 1996-05-09 | 1999-06-04 | Cryptosporidium detection method |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US08/647,351 | 1996-05-09 | ||
US08/647,351 US5770368A (en) | 1996-05-09 | 1996-05-09 | Cryptosporidium detection method |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US08/647,351 Continuation-In-Part US5770368A (en) | 1996-05-09 | 1996-05-09 | Cryptosporidium detection method |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1997042349A1 true WO1997042349A1 (en) | 1997-11-13 |
Family
ID=24596626
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1997/007972 WO1997042349A1 (en) | 1996-05-09 | 1997-05-08 | Cryptosporidium detection method |
Country Status (7)
Country | Link |
---|---|
US (1) | US5770368A (en) |
EP (1) | EP1007724A4 (en) |
JP (1) | JPH11509104A (en) |
AU (1) | AU709186C (en) |
BR (1) | BR9709308A (en) |
CA (1) | CA2253642C (en) |
WO (1) | WO1997042349A1 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6153411A (en) * | 1998-10-30 | 2000-11-28 | American Water Works Company, Inc. | Methods and kits for detection of Cryptosporidium parvum using immunomagnetic separation and amplification |
WO2002002811A2 (en) * | 2000-07-06 | 2002-01-10 | Bio Merieux | Method for controlling the microbiological quality of an aqueous medium and kit therefor |
US7081527B2 (en) | 2000-09-12 | 2006-07-25 | Gen-Probe Incorporated | Compositions, methods and kits for determining the presence of Cryptosporidium parvum organisms in a test sample |
CN103364569A (en) * | 2013-07-30 | 2013-10-23 | 广西壮族自治区兽医研究所 | Bovine Cryptosporidium ELISA detection kit |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AUPN391695A0 (en) * | 1995-06-30 | 1995-07-27 | Murdoch University | Diagnostic assay |
US6436638B1 (en) | 1996-05-09 | 2002-08-20 | Metropolitan Water District Of Southern California | Cryptosporidium detection method |
US6514694B2 (en) * | 1997-12-19 | 2003-02-04 | Heska Corporation | Methods for the detection of encysted parasites |
JP2001221721A (en) * | 2000-02-09 | 2001-08-17 | Sapporo Imuno Diagnostic Laboratory:Kk | Genetic diagnosis based on dry filter paper feces |
US6432646B1 (en) * | 2000-03-16 | 2002-08-13 | The University Of Melbourne | PCR-based identification of Eimeria species and strains |
US6867021B2 (en) | 2001-02-20 | 2005-03-15 | Board Of Trustees Of Michigan State University | Multiplex RT-PCR/PCR for simultaneous detection of bovine coronavirus, bovine rotavirus, Cryptosporidium parvum, and Escherichia coli |
CA2763584A1 (en) * | 2009-05-29 | 2010-12-02 | Phthisis Diagnostics | Advanced pathogen detection and screening |
CN102762745A (en) * | 2009-12-24 | 2012-10-31 | Seegene株式会社 | Real-time multiplexing detection of target nucleic acid sequences with elimination of false signals |
CN118086351B (en) * | 2024-01-30 | 2024-08-23 | 华南农业大学 | Cryptosporidium parvum gene deletion insect strain deleting 60kDa glycoprotein gene and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4908308A (en) * | 1985-06-19 | 1990-03-13 | The Trustees Of Columbia University In The City Of New York | Method for detecting animal-infective protozoa in vitro and a method for detecting agents which block the differentiation thereof |
US4983511A (en) * | 1989-01-09 | 1991-01-08 | Olin Corporation | Method and kit for detecting live microorganisms in chlorine- or bromine-treated water |
US5298392A (en) * | 1990-01-19 | 1994-03-29 | Hoffmann-La Roche Inc. | Process for detection of water-borne microbial pathogens and indicators of human fecal contamination in water samples and kits therefor |
Family Cites Families (15)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4801530A (en) * | 1984-02-29 | 1989-01-31 | Rockefeller University | Nucleotide hybridization assay for protozoan parasites |
US4957858A (en) * | 1986-04-16 | 1990-09-18 | The Salk Instute For Biological Studies | Replicative RNA reporter systems |
US4683195A (en) * | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
US4965188A (en) * | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
US4683202A (en) * | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
JP2774121B2 (en) * | 1987-07-31 | 1998-07-09 | ザ ボード オブ トラスティーズ オブ ザ リーランド スタンフォード ジュニア ユニバーシティ | Selective amplification of target polynucleotide sequence |
US5004682A (en) * | 1987-11-02 | 1991-04-02 | Olin Corporation | Method and kit for detecting live microorganisms in chlorine- or bromine-treated water |
CA1340807C (en) * | 1988-02-24 | 1999-11-02 | Lawrence T. Malek | Nucleic acid amplification process |
WO1989009835A1 (en) * | 1988-04-08 | 1989-10-19 | The Salk Institute For Biological Studies | Ligase-based amplification method |
CA2005589C (en) * | 1988-12-16 | 2001-02-06 | Thomas Raymond Gingeras | Self-sustained, sequence replication system |
SE8904100D0 (en) * | 1989-12-05 | 1989-12-05 | Astra Ab | NEW ANALYSIS METHOD |
EP0517154A1 (en) * | 1991-06-06 | 1992-12-09 | F. Hoffmann-La Roche Ag | Method for detecting giardia |
EP0550883A3 (en) * | 1992-01-09 | 1993-08-25 | F. Hoffmann-La Roche Ag | Method and reagents for determining the presence of giardia lamblia |
GB9215656D0 (en) * | 1992-07-23 | 1992-09-09 | Mini Agriculture & Fisheries | Detection of cryptosporidium |
IT1262975B (en) * | 1992-08-13 | 1996-07-23 | Univ Roma | THE SEQUENCE OF THE CPRL3 INSERT, PART OF THE CRYPTOSPORIDIUM OOCISTE (COWP) PROTEIN GENE, AND DERIVATIVES USEFUL FOR THE DIAGNOSIS OF CRYPTOSPORIDIUM INFECTION |
-
1996
- 1996-05-09 US US08/647,351 patent/US5770368A/en not_active Expired - Fee Related
-
1997
- 1997-05-08 AU AU31216/97A patent/AU709186C/en not_active Ceased
- 1997-05-08 CA CA002253642A patent/CA2253642C/en not_active Expired - Fee Related
- 1997-05-08 BR BR9709308A patent/BR9709308A/en not_active Application Discontinuation
- 1997-05-08 WO PCT/US1997/007972 patent/WO1997042349A1/en not_active Application Discontinuation
- 1997-05-08 EP EP97926451A patent/EP1007724A4/en not_active Withdrawn
- 1997-05-08 JP JP9540250A patent/JPH11509104A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4908308A (en) * | 1985-06-19 | 1990-03-13 | The Trustees Of Columbia University In The City Of New York | Method for detecting animal-infective protozoa in vitro and a method for detecting agents which block the differentiation thereof |
US4983511A (en) * | 1989-01-09 | 1991-01-08 | Olin Corporation | Method and kit for detecting live microorganisms in chlorine- or bromine-treated water |
US5298392A (en) * | 1990-01-19 | 1994-03-29 | Hoffmann-La Roche Inc. | Process for detection of water-borne microbial pathogens and indicators of human fecal contamination in water samples and kits therefor |
Non-Patent Citations (4)
Title |
---|
JOURNAL OF EUKARYOTIC MICROBIOLOGY, 1995, Vol. 42, No. 4, KHRAMTSOV et al., "Cloning and Analysis of a Cryptosporidium Parvum Gene Encoding a Protein With Homology to Cytoplasmic Form Hsp70", pages 416-422. * |
NUCLEIC ACIDS RESEARCH, 1990, Vol. 18, No. 11, AGGARWAL et al., "A Heat Shock Protein Gene in Giardia Lamblia Unrelated to HSP70", page 3409. * |
PROCEEDINGS AMERICAN WATER WORKS ASSOCIATION, WATER QUALITY TECHNOLOGY CONFERENCE, Toronto, 1993, ABBASZADEGN et al., "Detection of Viable Giardia Cysts in Water Samples Using Polymerase Chain Reaction", pages 529-541. * |
See also references of EP1007724A4 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6153411A (en) * | 1998-10-30 | 2000-11-28 | American Water Works Company, Inc. | Methods and kits for detection of Cryptosporidium parvum using immunomagnetic separation and amplification |
WO2002002811A2 (en) * | 2000-07-06 | 2002-01-10 | Bio Merieux | Method for controlling the microbiological quality of an aqueous medium and kit therefor |
WO2002002811A3 (en) * | 2000-07-06 | 2003-03-20 | Bio Merieux | Method for controlling the microbiological quality of an aqueous medium and kit therefor |
US7081527B2 (en) | 2000-09-12 | 2006-07-25 | Gen-Probe Incorporated | Compositions, methods and kits for determining the presence of Cryptosporidium parvum organisms in a test sample |
US7585631B2 (en) | 2000-09-12 | 2009-09-08 | Gen-Probe Incorporated | Method for obtaining purified RNA from viable oocysts |
US8008017B2 (en) | 2000-09-12 | 2011-08-30 | Gen-Probe Incorporated | Compositions and methods for detecting the presence of cryptosporidium organisms in a test sample |
US8105779B2 (en) | 2000-09-12 | 2012-01-31 | Cunningham Melissa M | Compositions and methods for detecting the presence of Cryptosporidium parvum in a test sample |
CN103364569A (en) * | 2013-07-30 | 2013-10-23 | 广西壮族自治区兽医研究所 | Bovine Cryptosporidium ELISA detection kit |
Also Published As
Publication number | Publication date |
---|---|
AU709186B2 (en) | 1999-08-26 |
EP1007724A1 (en) | 2000-06-14 |
JPH11509104A (en) | 1999-08-17 |
US5770368A (en) | 1998-06-23 |
AU3121697A (en) | 1997-11-26 |
CA2253642C (en) | 2003-08-19 |
CA2253642A1 (en) | 1997-11-13 |
AU709186C (en) | 2003-12-04 |
BR9709308A (en) | 1999-08-10 |
EP1007724A4 (en) | 2000-08-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5298392A (en) | Process for detection of water-borne microbial pathogens and indicators of human fecal contamination in water samples and kits therefor | |
Rochelle et al. | An assay combining cell culture with reverse transcriptase PCR to detect and determine the infectivity of waterborne Cryptosporidium parvum | |
Mahbubani et al. | Detection of Giardia cysts by using the polymerase chain reaction and distinguishing live from dead cysts | |
AU709186C (en) | Cryptosporidium detection method | |
Glasgow Jr et al. | PCR and FISH detection extends the range of Pfiesteria piscicida in estuarine waters. | |
Abbaszadegan et al. | Detection of viable Giardia cysts by amplification of heat shock-induced mRNA | |
US6436638B1 (en) | Cryptosporidium detection method | |
Xiao et al. | Detection and differentiation of Cryptosporidium oocysts in water by PCR-RFLP | |
US5258284A (en) | Nucleic acid probes specific for pathogenic strains of vibrio vulnificus and method employing the same | |
Whiteman et al. | Detection of phaeomoniella chlamydospora in soil using speciesspecific PCR | |
AU732150B2 (en) | Means for qualitative and quantitative analysis of microbial populations potentially present in a sample | |
US6153411A (en) | Methods and kits for detection of Cryptosporidium parvum using immunomagnetic separation and amplification | |
US20040248148A1 (en) | Ultrasensitive detection of pathogenic microbes | |
Chae et al. | Two Theileria cervi SSU RRNA gene sequence types found in isolates from white-tailed deer and elk in North America | |
Tansuphasiri et al. | Duplex PCR-hybridization based detection of pathogenic Leptospira in environmental water samples obtained from endemic areas in northeast region of Thailand | |
ES2253279T3 (en) | METHODS AND COMPOSITIONS FOR THE DETECTION OF SPECIES OF THE MYCOBACTERIUM AVIUM COMPLEX. | |
US6156505A (en) | Specific DNA probes for the identification of the Taenia solium and Taenia saginata species | |
KR20120138176A (en) | Kits for detecting giardia lamblia, cryptosporidium parvum and entamoeba histolytica | |
JP2001505411A (en) | Nucleic acid assays for detection and identification of three Chlamydia species | |
JPH05184399A (en) | Method for detecting giardia containing giardin gene | |
JP4431775B2 (en) | Method for detecting RNA derived from Cryptosporidium parvum | |
US6054275A (en) | Detection methods for cryptosporidium | |
ES2329343T3 (en) | DETECTION OF MICRO-ORGANISMS USING INDUCIBLE GENES. | |
Nikaeen et al. | Sensitive detection of Giardia cysts by polymerase chain reaction (PCR) | |
JPH11243953A (en) | Primer dna for detection of cryptosporidium parvum, and detection of cryptosporidium parvum using the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE GH HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN YU AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref document number: 2253642 Country of ref document: CA Ref country code: CA Ref document number: 2253642 Kind code of ref document: A Format of ref document f/p: F |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 1997 540250 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1997926451 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1997926451 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1997926451 Country of ref document: EP |