WO1997033904A1 - Death domain containing receptors - Google Patents

Death domain containing receptors Download PDF

Info

Publication number
WO1997033904A1
WO1997033904A1 PCT/US1996/016849 US9616849W WO9733904A1 WO 1997033904 A1 WO1997033904 A1 WO 1997033904A1 US 9616849 W US9616849 W US 9616849W WO 9733904 A1 WO9733904 A1 WO 9733904A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
polypeptide
seq
sequence
acid sequence
Prior art date
Application number
PCT/US1996/016849
Other languages
French (fr)
Inventor
Guo-Liang Yu
Jian Ni
Vishva M. Dixit
Reiner L. Gentz
Patrick J. Dillon
Original Assignee
Human Genome Sciences, Inc.
The Regents Of The University Of Michigan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc., The Regents Of The University Of Michigan filed Critical Human Genome Sciences, Inc.
Priority to EP96941942A priority Critical patent/EP0898576A1/en
Priority to AU11151/97A priority patent/AU1115197A/en
Publication of WO1997033904A1 publication Critical patent/WO1997033904A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel member of the tumor necrosis factor family of receptors. More specifically, isolated nucleic acid molecules are provided encoding human Death Domain Containing Receptors (DR3 and DR3- VI). Death Domain Containing Receptor polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of DR3 activity.
  • cytokines Many biological actions, for instance, response to certain stimuli and natural biological processes, are controlled by factors, such as cytokines. Many cytokines act through receptors by engaging the receptor and producing an intra ⁇ cellular response.
  • TNF alpha and beta are cytokines which act through TNF receptors to regulate numerous biological processes, including protection against infection and induction of shock and inflammatory disease.
  • the TNF molecules belong to the "TNF-ligand” superfamily, and act together with their receptors or counter-ligands, the "TNF-receptor” superfamily. So far, nine members of the TNF ligand superfamily have been identified and ten members of the TNF-receptor superfamily have been characterized.
  • TNF- ⁇ lymphotoxin- ⁇
  • LT- ⁇ lymphotoxin- ⁇
  • FasL FasL
  • TNF nerve growth factor
  • the superfamily of TNF receptors includes the p55TNF receptor, p75TNF receptor, TNF receptor-related protein, FAS antigen or APO-1 , CD40, CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor (Meager, A., Biologicals, 22:291-295 (1994)).
  • TNF-ligand superfamily Many members of the TNF-ligand superfamily are expressed by activated T-cells, implying that they are necessary for T-cell interactions with other cell types which underlie cell ontogeny and functions. (Meager, A., supra).
  • Targeted mutations of the low affinity nerve growth factor receptor cause a disorder characterized by faulty sensory innovation of peripheral structures (Lee, K.F. et al., Cell 69:131 (1992)).
  • TNF and LT- ⁇ are capable of binding to two TNF receptors (the 55- and 75-kd TNF receptors). A large number of biological effects elicited by TNF and
  • LT- ⁇ acting through their receptors, include hemorrhagic necrosis of transplanted tumors, cytotoxicity, a role in endotoxic shock, inflammation, immunoregulation, proliferation and anti-viral responses, as well as protection against the deleterious effects of ionizing radiation.
  • TNF and LT- ⁇ are involved in the pathogenesis of a wide range of diseases, including endotoxic shock, cerebral malaria, tumors, autoimmune disease, AIDS and graft-host rejection (Beutler, B. and Von Huffel, C, Science 264:661-668 (1994)). Mutations in the p55 Receptor cause increased susceptibility to microbial infection.
  • Apoptosis or programmed cell death, is a physiologic process essential to the normal development and homeostasis of multicellular organisms (H. whilr, Science 261, 1445-1449 (1995)). Derangements of apoptosis contribute to the pathogenesis of several human diseases including cancer, neurodegenerative disorders, and acquired immune deficiency syndrome (CB. Thompson, Science 267, 1456-1462 (1995)). Recently, much attention has focused on the signal transduction and biological function of two cell surface death receptors, Fas/APO-1 and TNFR-1 (J.L. Cleveland, et al., Cell 81 , 479-482
  • TNF receptor family which also include TNFR-2, low affinity NGFR, CD40, and CD30, among others (CA. Smith, et al., Science 248, 1019-23 (1990); M. Tewari, et al, in Modular Texts in Molecular and Cell Biology M. Purton, Heldin, Carl, Ed. (Chapman and Hall,
  • Fas/APO-1 and TNFR-1 While family members are defined by the presence of cysteine-rich repeats in their extracellular domains, Fas/APO-1 and TNFR-1 also share a region of intracellular homology, appropriately designated the "death domain", which is distantly related to the Drosophila suicide gene, reaper (P. Golstein, et al., Cell 81, 185-6 (1995); K. White et ai, Science 264, 677-83
  • TNFR-1 can signal an array of diverse biological activities-many of which stem from its ability to activate NF-kB (L.A. Tartaglia, et al, Immunol Today 13, 151-3 (1992)). Accordingly, TNFR-1 recruits the multivalent adapter molecule TRADD, which like FADD, also contains a death domain (H. Hsu, et al, Cell 81, 495-504 (1995); H. Hsu, et al, Cell 84, 299-308 (1996)). Through its associations with a number of signaling molecules including FADD, TRAF2, and RIP, TRADD can signal both apoptosis and NF-kB activation (H. Hsu, et al, Cell
  • TNF family ligands and TNF family receptors are varied and influence numerous functions, both normal and abnormal, in the biological processes of the mammalian system. There is a clear need, therefore, for identification and characterization of such receptors and ligands that influence biological activity, both normally and in disease states. In particular, there is a need to isolate and characterize novel members of the TNF receptor family.
  • the present invention provides for isolated nucleic acid molecules comprising nucleic acid sequences encoding the amino acid sequences shown in
  • FIG. 1 SEQ ID NO:2 and FIG. 2 (SEQ ID NO:4) or the amino acid sequence encoding the cDNA clones deposited in a bacterial host as ATCC Deposit No.
  • the present invention also provides vectors and host cells for recombinant expression of the nucleic acid molecules described herein, as well as to methods of making such vectors and host cells and for using them for production of DR3 or DR3 Variant 1 (DR3-V1) (formerly named DDCR) polypeptides or peptides by recombinant techniques.
  • DR3-V1 DR3-V1
  • DDCR DR3 Variant 1
  • the invention further provides an isolated DR3 or DR3-V1 polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
  • the present invention also provides diagnostic assays such as quantitative and diagnostic assays for detecting levels of DR3 or DR3-V1 protein.
  • diagnostic assays such as quantitative and diagnostic assays for detecting levels of DR3 or DR3-V1 protein.
  • a diagnostic assay in accordance with the invention for detecting over- expression of DR3 or DR3-V1, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors.
  • Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes.
  • Cellular response to TNF-family ligands include not only normal physiological responses, but also diseases associated with increased apoptosis or the inhibition of apoptosis.
  • Apoptosis- programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes.
  • Diseases associated with increased cell survival, or the inhibition of apoptosis include cancers, autoimmune disorders, viral infections, inflammation, graft v. host disease, acute graft rejection, and chronic graft rejection.
  • Diseases associated with increased apoptosis include AIDS, neurodegenerative disorders, myelodysplastic syndromes, ischemic injury, toxin-induced liver disease, septic shock, cachexia and anorexia.
  • the invention further provides a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the DR3 polypeptide an effective amount of an agonist capable of increasing DR3 mediated signaling.
  • DR3 mediated signaling is increased to treat a disease wherein decreased apoptosis is exhibited.
  • the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the DR3 polypeptide an effective amount of an antagonist capable of decreasing DR3 mediated signaling.
  • DR3 mediated signaling is decreased to treat a disease wherein increased apoptosis is exhibited.
  • Whether any candidate "agonist” or “antagonist” of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below.
  • a screening method is provided for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand.
  • the method involves contacting cells which express the DR3 or DR3-V1 polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway.
  • a cell expressing the DR3 or DR3-V1 polypeptide can be contacted with either an endogenous or exogenously administered TNF-family ligand.
  • FIG. 1A-C shows the nucleotide and deduced amino acid sequence of
  • FIG. 2A-B shows the nucleotide and deduced amino acid sequence of
  • FIG. 3A-D shows the regions of similarity between the amino acid sequences of the DR3-V1. human tumor necrosis factor receptor 1, and Fas receptor [SEQ ID NOs:5 and 6].
  • FIG. 4 shows an analysis of the DR3-V1 amino acid sequence.
  • Alpha, beta, turn and coil regions; hydrophilic ity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown.
  • amino acid residues 1-22, 33-56, 59- 82, 95-1 12, 122-133, 161-177, 179-190, 196-205 in Figure 1 correspond to the shown highly antigenic regions of the DR3-V 1 protein.
  • the present invention provides isolated nucleic acid molecules comprising a nucleic acid sequence encoding the DR3-V1 or DR3 polypeptide whose amino acid sequence is shown in FIG. 1 [SEQ ID NO:2] and FIG. 2 [SEQ ID NO:4], respectively, or a fragment of the polypeptide.
  • the DR3-V1 and DR3 polypeptides of the present invention shares sequence homology with human
  • TNF RI and Fas (FIG. 4).
  • the nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] was obtained by sequencing the HTTNB61 clone, which was deposited on February 29, 1996 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given Accession Number 97456.
  • the deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene,
  • the nucleotide sequence shown in FIG. 2 [SEQ ID NO:3] was obtained by sequencing a clone obtained from a HUVEC library, which was deposited on October 10, 1996 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given Accession Number .
  • the deposited clone is contained in the pBluescript SK(-) plasmid
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about
  • nucleotide sequence of the sequenced DNA molecule.
  • the actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • isolated polypeptide or protein is intended a polypeptide or protein removed from its native environment.
  • recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention as are native or recombinant polypeptides which have been substantially purified by any suitable technique such as, for example, the single-step purification method disclosed in Smith and Johnson, Gene 67:31 -40
  • nucleic acid molecule of the present invention encoding a DR3-V1 or DR3 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • the nucleic acid molecule described in FIG. 1 was discovered in a cDNA library derived from cells of a human testis tumor.
  • the nucleic acid molecule described in FIG. 2 was discovered in a human HUVEC cDNA library.
  • DR3-V1 (formerly called DDCR) gene contains an open reading frame encoding a protein of about 428 amino acid residues whose initiation codon is at position 198-200 of the nucleotide sequence shown in FIG. 1 [SEQ ID NO.l], with a leader sequence of about 35 amino acid residues, and a deduced molecular weight of about 47 kDa.
  • the DR3-V1 polypeptide of the invention shares the greatest degree of homology with human TNF Rl.
  • the DR3-V1 polypeptide shown in FIG. 1 [SEQ ID NO:2] is about 20% identical and about 50% similar to human TNF Rl.
  • the DR3 gene contains an open reading frame encoding a protein of about 417 amino acid residues whose initiation codon is at position 1-3 of the nucleotide sequence shown in FIG. 2 [SEQ ID NO:3], with a leader sequence of about 24 amino acid residues, and a deduced molecular weight of about 43 kDa.
  • the DR3 polypeptide of the invention shares the greatest degree of homology with human TNF Rl.
  • the DR3 polypeptide shown in FIG. 2 [SEQ ID NO:3] is about 20% identical and about 50% similar to human TNF Rl.
  • the present invention also provides the mature form(s) of the DR3-V1 and DR3 protein of the present invention.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • the present invention provides a nucleotide sequence encoding the mature DR3-V1 or DR3 polypeptides having the amino acid sequence encoded by the cDNA clones contained in the host identified as ATCC Deposit No.
  • No. 97456 and , respectively, is meant the mature form(s) of the DR3-V1 or DR3 protein produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host.
  • a mammalian cell e.g., COS cells, as described below
  • the mature DR3-V1 or DR3 having the amino acid sequence encoded by the cDNA clones contained in ATCC Deposit No.
  • 97456 and , respectively, may or may not differ from the predicted "mature" DR3-V1 protein shown in Figure 1 (amino acids from about 36 to about 428) or DR3 protein shown in Figure 2 (amino acids from about 24 to about 417) depending on the accuracy of the predicted cleavage site based on computer analysis.
  • DR3-V1 and DR3 polypeptides of the present invention were analyzed by a computer program ("PSORT").
  • PSORT a computer program
  • K. Nakai and M. Kanehisa, Genomics 74:897-911 (1992) which is an expert system for predicting the cellular location of a protein based on the amino acid sequence.
  • the analysis by the PSORT program predicted the cleavage sites between amino acids 35 and 36 in Figure 1 (SEQ ID NO:2) and between amino acids 24 and 25 in Figure 2 (SEQ ID NO:4).
  • the leader sequence for the DR3-V1 protein is predicted to consist of amino acid residues 1- 35 in Figure
  • the predicted mature DR3-V1 protein consists of residues 36-428.
  • the leader sequence for the DR3 protein is predicted to consist of amino acid residues 1 - 24 in Figure 2 (SEQ ID NO:4), while the predicted mature DR3 protein consists of residues 25-417.
  • the actual DR3-V1 polypeptide encoded by the deposited cDNA comprises about 428 amino acids, but may be anywhere in the range of 410-440 amino acids; and the actual leader sequence of this protein is about 35 amino acids, but may be anywhere in the range of about 25 to about
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded. Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DR3-V1
  • Isolated nucleic acid molecules of the present invention also include DR3 DNA molecules comprising an open reading frame (ORF) shown in FIG. 2 [SEQ ID NO:3] and further include DNA molecules which comprise a sequence substantially different than all or part of the ORF whose initiation codon is at position 1-3 of the nucleotide sequence shown in
  • FIG. 2 [SEQ ID NO:3] but which, due to the degeneracy of the genetic code, still encode the DR3 polypeptide or a fragment thereof.
  • the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate such degenerate variants.
  • the invention provides isolated nucleic acid molecules encoding the DR3-V1 polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97456 on March 1, 1996.
  • the invention provides isolated nucleic acid molecules encoding the DR3 polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. on
  • these nucleic acid molecules will encode the mature polypeptide encoded by the above-described deposited cDNA clone.
  • the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (SEQ ID NO:l) or FIG. 2 (SEQ ID NO:3) or the nucleotide sequence of the DR3-V1 or DR3 cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • Such isolated DNA molecules and fragments thereof are useful as DNA probes for gene mapping by in situ hybridiz DR3-V1 or DR3 gene in human tissue (including testis tumor tissue) by Northern blot analysis.
  • the present invention is further directed to fragments of the isolated nucleic acid molecules described herein.
  • fragments of an isolated DNA molecule having the nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] or FIG. 2 [SEQ ID NO:3] are intended DNA fragments at least 20 bp, and more preferably at least 30 bp in length which are useful as DNA probes as discussed above, of course larger DNA fragments 50-1500 bp in length are also useful as
  • DNA probes according to the present invention as are DNA fragments corresponding to most, if not all, of the nucleotide sequence shown in FIG. 1 [SEQ ID NO: l] or FIG. 2 [SEQ ID NO:3].
  • a fragment at least 20 bp in length for example, is intended fragments which include 20 or more bases from the nucleotide sequence in FIG. 1 [SEQ ID NO: 1 ] or FIG. 2 [SEQ ID NO:3].
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising the DR3 extracellular domain
  • amino acid residues from about 36 to about 212 in FIG. 1 [SEQ ID NO:2] a polypeptide comprising the DR3 transmembrane domain (amino acid residues from about 213 to about 235 in FIG. 1 [SEQ ID NO:2]; a polypeptide comprising the DR3 intracellular domain (amino acid residues from about 214 to about 428 in FIG. 1 [SEQ ID NO:2] ; and a polypeptide comprising the DR3 death domain (amino acid residues from about 353 to about 419 in FIG. 1 [SEQ ID NO:2]). Since the location of these domains have been predicted by computer graphics, one of ordinary skill would appreciate that the amino acid residues constituting these domains may vary slightly (e.g., by about 1 to 15 residues) depending on the criteria used to define the domain.
  • nucleic acid fragments of the present invention further include nucleic acid molecules encoding epitope-bearing portions of the DR3-V1 protein.
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to
  • nucleic acid fragments of the present invention also include nucleic acid molecules encoding epitope-bearing portions of the DR3 protein.
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding the corresponding regions to those epitope-bearing regions of the DR3-V1 protein disclosed above. Methods for determining other such epitope-bearing portions of the DR3 protein are described in detail below.
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clones contained in ATCC Deposit 97456 or ATCC Deposit .
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the reference polynucleotide.
  • the reference polynucleotide e.g., the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO:l) or Figure 2 (SEQ ID NO:3).
  • nucleic acid molecules of the present invention which encode the DR3-V1 or DR3 polypeptide may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding a leader or secretary sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription.
  • the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide.
  • the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Gentz et al, Proc. Natl. Acad. Sci.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the HA tag corresponds to an epitope derived of influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37:161 (1984), for instance.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode for fragments, analogs or derivatives of the DR3-V1 or DR3 polypeptide.
  • Variants may occur naturally, such as an allelic variant.
  • allelic variant is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non- naturally occurring variants may be produced using art-known mutagenesis techniques.
  • variants include those produced by nucleotide substitutions, deletions or additions which may involve one or more nucleotides.
  • the variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions.
  • nucleic acid molecules that are at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to (a) a nucleotide sequence encoding the full-length DR3-V1 polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2), including the predicted leader sequence; (b) nucleotide sequence encoding the full-length DR3 polypeptide having the complete amino acid sequence in Figure 2 (SEQ ID NO:4), including the predicted leader sequence; (c) a nucleotide sequence encoding the mature DR3-V1 polypeptide (full-length polypeptide with the leader removed) having the amino acid sequence at positions about 36 to about 428 in Figure 1 (SEQ ID NO:2); (d) a nucleotide sequence encoding the full-length DR3-V1 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No.
  • nucleotide sequence that encodes the DR3 intracellular domain and (k) a nucleotide sequence that encodes the DR3 death domain; or (1) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), 0) or (k) above.
  • a polynucleotide having a nucleotide sequence at least, for example,
  • nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the DR3-V1 or DR3 polypeptide.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figure 1 , Figure 2 or to the nucleotide sequences of the deposited cDNA clones can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1. Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences.
  • Bestfit program Wiconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1. Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences.
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
  • Figure 1 SEQ ID NO:l
  • Figure 2 SEQ ID NO:3
  • nucleic acid sequence of the deposited cDNAs irrespective of whether they encode a polypeptide having DR3 activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having DR3 activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having DDCR activity include, inter alia, (1) isolating the DR3-V1 or DR3 gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the DR3-V1 or DR3 gene, as described in Verma et al, Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting DR3-V1 or DR3 mRNA expression in specific tissues.
  • FISH in situ hybridization
  • nucleic acid molecules having sequences at least 90%), 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO.T), Figure 2 (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNAs which do, in fact, encode a polypeptide having DR3 protein activity.
  • a polypeptide having DR3 activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the DR3 protein of the invention (either the full-length protein or, preferably, the mature protein), as measured in a particular biological assay.
  • DR3 protein activity can be measured using the cell death assays performed essentially as previously described (A.M.
  • plasmids encoding full-length DR3 or a candidate death domain containing receptors are co-transfected with the pLantern reporter construct encoding green fluorescent protein. Nuclei of cells transfected with DR3 will exhibit apoptotic morphology as assessed by DAPI staining. Similar to TNFR-1 and Fas/APO-1
  • DR3-induced apoptosis is blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
  • apoptosis induced by DR3 is also blocked by dominant negative versions of FADD (FADD-DN) or FLICE
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figure 1 (SEQ ID NO:l) or Figure 2 (SEQ ID NO:3) will encode a polypeptide "having DR3 protein activity.”
  • degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • This invention is also related to the use of the DR3-V1 or DR3 polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of DR3-V1 or DR3 associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to a disease which results from under- expression over-expression or altered expression of DR3-V1 or DR3 or a soluble form thereof, such as, for example, tumors or autoimmune disease.
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the nucleic acid encoding DR3-V1 or DR3 can be used to identify and analyze DR3-V1 or DR3 expression and mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled DR3-V1 or DR3 RNA or alternatively, radiolabeled DR3-V1 or
  • DR3 antisense DNA sequences Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • DNA segments may be employed as probes to detect specific DNA segments.
  • the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method.
  • a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230:1242 (1985)).
  • Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl Acad. Sci. USA 85: 4397-4401 (1985)).
  • nuclease protection assays such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl Acad. Sci. USA 85: 4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., restriction fragment length polymorphisms ("RFLP") and Southern blotting of genomic DNA.
  • mutations also can be detected by in situ analysis.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a DR3-V1 or a DR3 gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA the is used for in situ chromosome mapping using well known techniques for this purpose.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
  • Fluorescence in situ hybridization of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 50 or 60.
  • Verma et al. Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
  • the present invention also relates to vectors which include DNA molecules of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Host cells can be genetically engineered to incorporate nucleic acid molecules and express polypeptides of the present invention.
  • the polynucleotides may be introduced alone or with other polynucleotides. Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.
  • the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double-stranded RNA or DNA viral vector.
  • Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells.
  • Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.
  • vectors are those for expression of polynucleotides and polypeptides of the present invention.
  • such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expressed.
  • Appropriate trans- acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
  • vectors can be used to express a polypeptide of the invention.
  • Such vectors include chromosomal, episomal and virus-derived vectors e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. all may be used for expression in accordance with this aspect of the present invention.
  • any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard.
  • the DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s)), including, for instance, a promoter to direct mRNA transcription.
  • appropriate expression control sequence(s) including, for instance, a promoter to direct mRNA transcription.
  • promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name just a few of the well-known promoters.
  • expression constructs will contain sites for transcription, initiation and termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the constructs may contain control regions that regulate as well as engender expression. Generally, such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others.
  • Vectors for propagation and expression generally will include selectable markers. Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells. Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline or ampicillin resistance genes for culturing E. coli and other bacteria.
  • the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide.
  • hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells.
  • bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium cells
  • fungal cells such as yeast cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS and Bowes melanoma cells
  • plant cells include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells.
  • vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and pSG available from Stratagene; and ⁇ SVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors are listed solely by way of illustration of the many commercially available and well known vectors available to those of skill in the art.
  • the present invention also relates to host cells containing the above- described constructs discussed above.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid- mediated transfection, electroporation, transduction. infection or other methods.
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions.
  • a region of additional amino acids, particularly charged amino acids may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage.
  • region also may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide.
  • the addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232262).
  • Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations.
  • human proteins such as, hIL5- has been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al, Journal of Molecular Recognition, Vol. 8:52-58 (1995) and K. Johanson et al, The
  • the DR3 and DR3-V1 polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and/or purification.
  • Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • DR3-V1 or DR3 polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of DR3.
  • applications in treatment of tumors, resistance to parasites, bacteria and viruses, to induce proliferation of T-cells, endothelial cells and certain hematopoietic cells, to treat restenosis, graft vs. host disease, to regulate anti-viral responses and to prevent certain autoimmune diseases after stimulation of DR3 by an agonist. Additional applications relate to diagnosis and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are discussed further below.
  • the invention further provides an isolated DR3-V1 or DR3 polypeptide having the amino acid sequence shown in FIG. 1 [SEQ ID NO:2] and FIG. 2[SEQ ID NO:4], respectively, or a fragment thereof. It will be recognized in the art that some amino acid sequence of DR3-V1 or DR3 can be varied without significant effect of the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity. Such areas will usually comprise residues which make up the ligand binding site or the death domain, or which form tertiary structures which affect these domains.
  • the invention further includes variations of the DR3-V1 or DR3 protein which show substantial DR3 protein activity or which include regions of DR3-V1 or DR3 such as the protein fragments discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
  • guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J.U. et al, Science 247 : ⁇ 306-1310 (1990).
  • the replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al. Nature 5(57:266-268 (1993) describes certain mutations resulting in selective binding of TNF- ⁇ to only one of the two known types of TNF receptors.
  • the DR3-V 1 or DR3 receptor of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 1).
  • Amino acids in the DR3-V1 or DR3 protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992) and de Vos et al Science 255:306-312 (1992)).
  • polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified.
  • a recombinantly produced version of the DR3-V1 or DR3 polypeptide is substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
  • polypeptides of the present invention also include the polypeptide encoded by the deposited cDNA including the leader, the mature polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein), the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4) including the leader, the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4) minus the leader, the extracellular domain, the transmembrane domain, the intracellular domain, soluble polypeptides comprising all or part of the extracellular and intracelluar domains but lacking the transmembrane domain as well as polypeptides which are at least 80% identical, more preferably at least
  • polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a DR3-V1 or DR3 polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the DR3-V1 or DR3 polypeptide.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence. As a practical matter, whether any particular polypeptide is at least 90%,
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
  • the DR3-V1 polypeptide is a 428 residue protein exhibiting three main structural domains.
  • the ligand binding domain was identified within residues from about 36 to about 212 in
  • FIG. 1 [SEQ ID NO:2].
  • the transmembrane domain was identified within residues from about 213 to about 235 in FIG. 1 [SEQ ID NO:2].
  • the intracellular domain was identified within residues from about 236 to about 428 in FIG. 1 [SEQ ID NO:2].
  • the intracellular domain includes a death domain at residues from about 353 to about 419.
  • Further preferred fragments of the polypeptide shown in FIG. 1 [SEQ ID NO:2] include the mature protein from residues about 36 to about 428 and soluble polypeptides comprising all or part of the extracellular and intracellular domains but lacking the transmembrane domain.
  • the DR3 polypeptide is a 417 residue protein exhibiting three main structural domains.
  • the ligand binding domain was identified within residues from about 25 to about 201 in FIG. 2 [SEQ ID NO:4].
  • the transmembrane domain was identified within residues from about 202 to about 224 in FIG. 2 [SEQ ID NO:4].
  • the intracellular domain was identified within residues from about 225 to about 417 in FIG. 2 [SEQ ID NO:4].
  • the intracellular domain includes a death domain at residues from about 342 to about 408. Further preferred fragments of the polypeptide shown in FIG.
  • SEQ ID NO:4 include the mature protein from residues about 25 to about 417 and soluble polypeptides comprising all or part of the extracellular and intracellular domains but lacking the transmembrane domain.
  • the full length polypeptides encoded by the DR3-V1 and DR3 cDNA differ only in the amino acid sequence of the leader peptide.
  • the first 24 amino acids of the polypeptide shown in Figure 1 are replaced by the first 13 amino acids shown in Figure 2 but the rest of the amino acid sequence is the same.
  • both the DR3-V1 cDNA and DR3 cDNA encode an identical mature protein having the same biological activity.
  • the invention further provides DR3-V1 or DR3 polypeptides encoded by the deposited cDNA clones including the leader and DR3-V1 or DR3 polypeptide fragments selected from the mature protein, the extracellular domain, the transmembrane domain, the intracellular domain, and the death domain.
  • the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide described herein.
  • the epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention.
  • An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • the number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl. Acad. Sci.
  • Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.
  • Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al, Cell 37:161-118 (1984) at 777.
  • Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention.
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate DR3-specific antibodies include: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 196 to about
  • antigenic polypeptides or peptides include polypeptides comprising the amino acid residues that are the corresponding residues to those polypeptides of DR3-V1 disclosed above. As indicated above, the inventors have determined that the above polypeptide fragments are antigenic regions of the DR3-V1 and DR3 protein.
  • the epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. Houghten, R.A., "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids," Proc. Natl. Acad. Sci. USA 52:5131-5135 (1985). This "Simultaneous Multiple Peptide
  • DR3-Vl or DR3 polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulins
  • These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 557:84-
  • Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric DR3-V 1 or DR3 protein or protein fragment alone (Fountoulakis et al, J Biochem 270:3958-3964 (1995)).
  • the present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of DR3-V1 or DR3 protein, or the soluble form thereof, in cells and tissues, including determination of normal and abnormal levels.
  • diagnostic assays such as quantitative and diagnostic assays for detecting levels of DR3-V1 or DR3 protein, or the soluble form thereof, in cells and tissues, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for detecting over-expression of DR3-V1 or DR3, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors, for example.
  • Assay techniques that can be used to determine levels of a protein, such as an DR3 protein of the present invention, or a soluble form thereof, in a sample derived from a host are well-known to those of skill in the art.
  • Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and
  • Assaying DR3-V1 or DR3 protein levels in a biological sample can occur using any art-known method.
  • Preferred for assaying DR3-V1 or DR3 protein levels in a biological sample are antibody-based techniques.
  • DR3-V1 or DR3 protein levels in a biological sample are antibody-based techniques.
  • VI or DR3 protein expression in tissues can be studied with classical immunohistological methods. (Jalkanen, M., et al, J. Cell. Biol 7(97:976-985 (1985); Jalkanen, M., et al, J. Cell . Biol. 705:3087-3096 (1987)).
  • antibody-based methods useful for detecting DR3-V1 or DR3 protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • immunoassays such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • Suitable labels are known in the art and include enzyme labels, such as glucose oxidase, radioisotopes, such as iodine ( 125 I, 121 I), carbon ( l4 C), sulphur ( 35 S), tritium ( 3 H), indium ( l l2 In), and technetium ( 9 m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as glucose oxidase, radioisotopes, such as iodine ( 125 I, 121 I), carbon ( l4 C), sulphur ( 35 S), tritium ( 3 H), indium ( l l2 In), and technetium ( 9 m Tc)
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • TNF Tumor Necrosis Factor
  • TNF-family ligands induce such various cellular responses by binding to TNF-family receptors, including the DR3-V1 or DR3 of the present invention.
  • Cells which express the DR3-V1 or DR3 polypeptide and are believed to have a potent cellular response to DR3-V1 or DR3 ligands include lymphocytes, fibroblasts, macrophages, synovial cells, activated T-cells, lymphoblasts and epithelial cells.
  • TNF-family ligand is intended any genotypic, phenotypic, and/or morphologic change to a cell, cell line, tissue, tissue culture or patient that is induced by a TNF-family ligand.
  • cellular responses include not only normal physiological responses to TNF-family ligands, but also diseases associated with increased apoptosis or the inhibition of apoptosis.
  • Apoptosis- programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes (Ameisen, J.C, AXDS 5: 1197- 1213 (1994); Krammer, P.H. et al, Curr. Opin.
  • Diseases associated with increased cell survival, or the inhibition of apoptosis include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, such as breast cancer, prostrate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as systemic lupus erythematosus and immune-related glomerulonephritis rheumatoid arthritis) and viral infections (such as he ⁇ es viruses, pox viruses and adenoviruses), information graft v. host disease, acute graft rejection, and chronic graft rejection.
  • cancers such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, such as breast cancer, prostrate cancer, Kaposi's sarcoma and ovarian cancer
  • autoimmune disorders such as systemic lupus erythematosus and immune-related glomerulonephritis rheumatoid
  • AIDS dementia
  • neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
  • myelodysplastic syndromes such as aplastic anemia
  • ischemic injury such as that caused by myocardial infarction, stroke and reperfusion injury
  • toxin- induced liver disease such as that caused by alcohol
  • septic shock cachexia and anorexia.
  • the present invention is directed to a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the DR3-V1 or DR3 polypeptide an effective amount of DR3-V1 or DR3 ligand, analog or an agonist capable of increasing DR3-V1 or DR3 mediated signaling.
  • DR3-V1 or DR3 mediated signaling is increased to treat a disease wherein decreased apoptosis or decreased cytokine and adhesion molecule expression is exhibited.
  • An agonist can include soluble forms of DR3-V1 or DR3 and monoclonal antibodies directed against the DR3-V1 or DR3 polypeptide.
  • the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the, DR3-V1 or DR3 polypeptide an effective amount of an antagonist capable of decreasing DR3-V1 or DR3 mediated signaling.
  • an antagonist capable of decreasing DR3-V1 or DR3 mediated signaling.
  • DR3-V1 or DR3 mediated signaling is decreased to treat a disease wherein increased apoptosis or NFkB expression is exhibited.
  • An antagonist can include soluble forms of DR3-V1 or DR3 and monoclonal antibodies directed against the DR3-V1 or DR3 polypeptide.
  • agonist is intended naturally occurring and synthetic compounds capable of enhancing or potentiating apoptosis.
  • antagonist is intended naturally occurring and synthetic compounds capable of inhibiting apoptosis. Whether any candidate "agonist” or “antagonist” of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below.
  • One such screening procedure involves the use of melanophores which are transfected to express the receptor of the present invention.
  • a screening technique is described in PCT WO 92/01810, published February 6, 1992.
  • Such an assay may be employed, for example, for screening for a compound which inhibits (or enhances) activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both a TNF-family ligand and the candidate antagonist (or agonist). Inhibition or enhancement of the signal generated by the ligand indicates that the compound is an antagonist or agonist of the ligand/receptor signaling pathway.
  • Other screening techniques include the use of cells which express the receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science 246:181-296 (October 1989).
  • compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g., signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
  • Another such screening technique involves introducing RNA encoding the receptor into Xenopus oocytes to transiently express the receptor.
  • the receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor.
  • Another screening technique involves expressing in cells a construct wherein the receptor is linked to a phospholipase C or D.
  • Such cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase signal.
  • Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding the receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g., by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors.
  • a screening method for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand.
  • the method involves contacting cells which express the DR3-V1 or DR3 polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway.
  • saying a cellular response is intended qualitatively or quantitatively measuring a cellular response to a candidate compound and/or a TNF-family ligand (e.g., determining or estimating an increase or decrease in T cell proliferation or tritiated thymidine labeling).
  • a cell expressing the DR3-V1 or DR3 polypeptide can be contacted with either an endogenous or exogenously administered TNF- family ligand.
  • Agonist according to the present invention include naturally occurring and synthetic compounds such as, for example, TNF family ligand peptide fragments, transforming growth factor ⁇ , neurotransmitters (such as glutamate, dopamine, N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells and antimetabolites.
  • Preferred agonist include chemotherapeutic drugs such as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate and vincristine. Others include ethanol and ⁇ -amyloid peptide. (Science 267:1457-1458 (1995)).
  • agonists include polyclonal and monoclonal antibodies raised against the DR3-V1 or DR3 polypeptide. or a fragment thereof.
  • Such agonist antibodies raised against a TNF- family receptor are disclosed in Tartaglia, L.A., et al, Proc. Natl. Acad. Sci. USA 55:9292-9296 (1991); and Tartaglia, L.A., and Goeddel, D.V., J. Biol Chem. 267 (7):4304-4307 (1992) See, also, PCT Application WO 94/09137.
  • Antagonist according to the present invention include naturally occurring and synthetic compounds such as, for example, the CD40 ligand, neutral amino acids, zinc, estrogen, androgens, viral genes (such as Adenovirus EIB,
  • Baculovirus p35 and IAP Cowpox virus crmA, Epstein-Barr virus BHRF1, LMP-I, African swine fever virus LMW5-HL, and Herpesvirus yl 34.5
  • calpain inhibitors cysteine protease inhibitors
  • tumor promoters such as PMA, Phenobarbital, and ⁇ -Hexachlorocyclohexane.
  • Other potential antagonists include antisense molecules.
  • Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al, Nucleic Acids
  • the methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense
  • RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the receptor.
  • Further antagonist according to the present invention include soluble forms of DR3-V 1 or DR3, i.e.,DR3-V 1 or DR3 fragments that include the ligand binding domain from the extracellular region of the full length receptor.
  • Such soluble forms of the receptor which may be naturally occurring or synthetic, antagonize DR3-V1 or DR3 mediated signaling by competing with the cell surface DR3-V1 or DR3 for binding to TNF-family ligands.
  • soluble forms of the receptor that include the ligand binding domain are novel cytokines capable of inhibiting apoptosis induced by TNF-family ligands.
  • Fas B a soluble form of the mouse Fas receptor
  • Fas ligand acts physiologically to limit apoptosis induced by Fas ligand
  • DR3 is a death domain-containing molecule capable of triggering both apoptosis and NF-kB activation, two pathways dominant in the regulation of the immune system.
  • the experiments also demonstrate the internal signal transduction machinery of this novel cell death receptor.
  • the experiments set forth below demonstrate that DR3 -induced apoptosis was blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk.
  • apoptosis induced by DR3 was also blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHal C360S), which were previously shown to inhibit death signaling by Fas/APO-1 and TNFR-1.
  • FADD-DN FADD-DN
  • FLICE-DN/MACHal C360S FLICE-DN/MACHal C360S
  • antibody or “monoclonal antibody” (mAb) as used herein is meant to include intact molecules as well as fragments thereof (such as, for example, Fab and F(ab') 2 fragments) which are capable of binding an antigen.
  • Fab and F (ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)).
  • Antibodies according to the present invention may be prepared by any of a variety of methods using DR3-V1 or DR3 immunogens of the present invention.
  • DR3-V1 or DR3 immunogens include the full length DR3-V1 or DR3 polypeptide (which may or may not include the leader sequence) and DR3-V1 or DR3 polypeptide fragments such as the ligand binding domain, the transmembrane domain, the intracellular domain and the death domain.
  • Proteins and other compounds which bind the DR3-V1 or DR3 domains are also candidate agonist and antagonist according to the present invention.
  • binding compounds can be "captured” using the yeast two-hybrid system (Fields and Song, Nature 540:245-246 (1989)).
  • yeast two-hybrid system Fields and Song, Nature 540:245-246 (1989)
  • a modified version of the yeast two-hybrid system has been described by Roger Brent and his colleagues (Gyuris,
  • yeast two-hybrid system is used according to the present invention to capture compounds which bind to either the DR3-V1 or DR3 ligand binding domain or to the DR3-V1 or DR3 intracellular domain.
  • Such compounds are good candidate agonist and antagonist of the present invention.
  • TNF-family ligand is intended naturally occurring, recombinant, and synthetic ligands that are capable of binding to a member of the TNF receptor family and inducing the ligand/receptor signaling pathway.
  • TNF ligand family include, but are not limited to, the DR3-V1 or DR3 ligand, TNF- ⁇ , lymphdtoxin- ⁇ (LT- ⁇ , also known as TNF- ⁇ ), LT- ⁇ (found in complex heterotrimer LT- ⁇ 2- ⁇ ), FasL, CD40, CD27, CD30, 4-1BB, OX40 and nerve growth factor (NGF).
  • T-lymphocytes T-lymphocytes. Recent reports estimate the daily loss of CD4 + T cells to be between 3.5 X 10 7 and 2 X IO 9 cells (Wei X., et al, Nature 575:117-122 (1995)).
  • CD4 + T cell depletion in the setting of HIV infection is believed to be HIV-induced apoptosis. Indeed, HIV-induced apoptotic cell death has been demonstrated not only in vitro but also, more importantly, in infected individuals
  • Retroviruses 9:553-563 (1993) and, apoptosis is not observed in those animal models in which viral replication does not result in AIDS (Gougeon, M.L. et al, AIDS Res. Hum. Retroviruses 9:553-563 (1993)).
  • TNF-family ligand FasL Using monocytic cell lines that result in death following HIV infection, it has been demonstrated that infection of U937 cells with HIV results in the de novo expression of FasL and that FasL mediates HIV-induced apoptosis (Badley, A.D. et al, J. Virol. 70: 199-206 (1996)).
  • TNF-family ligand was detectable in uninfected macrophages and its expression was upregulated following HIV infection resulting in selective killing of uninfected CD4
  • T-lymphocytes (Badley, A.D et al, J. Virol. 70:199-206 (1996)).
  • a method for treating HIV + individuals involves administering an antagonist of the present invention to reduce selective killing of CD4 T-lymphocytes. Modes of administration and dosages are discussed in detail below.
  • the immune system of the recipient animal In rejection of an allograft, the immune system of the recipient animal has not previously been primed to respond because the immune system for the most part is only primed by environmental antigens. Tissues from other members of the same species have not been presented in the same way that, for example, viruses and bacteria have been presented.
  • immunosuppressive regimens are designed to prevent the immune system from reaching the effector stage.
  • the immune profile of xenograft rejection may resemble disease recurrence more that allograft rejection.
  • the immune system In the case of disease recurrence, the immune system has already been activated, as evidenced by destruction of the native islet cells. Therefore, in disease recurrence the immune system is already at the effector stage.
  • Agonist of the present invention are able to suppress the immune response to both allografts and xenografts because lymphocytes activated and differentiated into effector cells will express the DR3-V1 or DR3 polypeptide, and thereby are susceptible to compounds which enhance apoptosis.
  • the present invention further provides a method for creating immune privileged tissues.
  • Antagonist of the invention can further be used in the treatment of Inflammatory Bowel-Disease.
  • DR3 and DR3-V1 may in some circumstances be proinflammatory, and antagonists may be useful reagents for blocking this response.
  • DR3 and DR3-V1 antagonists may be useful for treating inflammatory diseases, such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and inflammatory bowel disease.
  • soluble DR3, agonist or antagonist mABs may be used to treat this form of cancer.
  • soluble DR3 or neutralizing mABs may be used to treat various chronic and acute forms of inflammation such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and inflammatory bowel disease.
  • the agonist or antagonists described herein can be administered in vitro, ex vivo, or in vivo to cells which express the receptor of the present invention.
  • administration of an "effective amount" of an agonist or antagonist is intended an amount of the compound that is sufficient to enhance or inhibit a cellular response to a TNF-family ligand and include polypeptides.
  • administration of an "effective amount” of an agonist or antagonists is intended an amount effective to enhance or inhibit DR3-V1 or DR3 mediated apoptosis.
  • an agonist according to the present invention can be co-administered with a TNF-family ligand.
  • an agonist or antagonist can be determined empirically and may be employed in pure form or in pharmaceutically acceptable salt, ester or prodrug form.
  • the agonist or antagonist may be administered in compositions in combination with one or more pharmaceutically acceptable excipients.
  • the total pharmaceutically effective amount of DDCR polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
  • the DDCR agonists or antagonists is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • Dosaging may also be arranged in a patient specific manner to provide a predetermined concentration of an agonist or antagonist in the blood, as determined by the RIA technique.
  • patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA, on the order of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
  • compositions comprising an agonist or antagonist and a pharmaceutically acceptable carrier or excipient, which may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • a pharmaceutically acceptable carrier or excipient which may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • a pharmaceutically acceptable carrier or excipient which may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • the agonist can be "co-administered" either
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • compositions of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
  • DR3-V1 or DR3 polypeptide containing the transmembrane region can also be used when appropriately solubilized by including detergents, such as CHAPS or NP-40, with buffer.
  • the DNA sequence encoding the mature DR3-V 1 protein in the deposited cDNA clone is amplified using PCR oligonucleotide primers specific to the amino terminal sequences of the DR3-V1 protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.
  • the following primers are used for expression of DR3 extracellular domain in E. coli 5' primer 5'-GCGCCATGGGGGCCCGGCGGCAG-3' (SEQ ID NO:7) contains an Ncol site and 15 nucleotide starting from 290 nucleotide to 304 FIG. 1.
  • primer S'-GCGAAGCnCTAGGACCCAGAACATCTGCC 1 contains a Hindili site, a stop codon and 18 nucleotides complimentary to nucleotide from 822 to 840 in FIG. 1.
  • Vector is pQE60. The protein is not tagged.
  • restriction sites are convenient to restriction enzyme sites in the bacterial expression vector pQE60, which are used for bacterial expression in these examples. (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 9131 1). pQE60 encodes ampicillin antibiotic resistance (" Amp r ”) and contains a bacterial origin of replication ("ori”), an IPTG inducible promoter, a ribosome binding site (“RBS").
  • Amp r ampicillin antibiotic resistance
  • ori bacterial origin of replication
  • RBS ribosome binding site
  • the amplified DR3-V1 DNA and the vector pQE60 both are digested with Nco I and Hindili and the digested DNAs are then ligated together. Insertion of the DDCR protein DNA into the restricted pQE60 vector places the DR3-V1 protein coding region downstream of and operably linked to the vector's IPTG- inducible promoter and in-frame with an initiating AUG appropriately positioned for translation of DR3- VI protein.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures. Such procedures are described in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E.
  • coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance ("Kan r "), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing DR3-V1 protein, is available commercially from Qiagen.
  • Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis.
  • Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/ml) and kanamycin (25 ⁇ g/ml).
  • the O/N culture is used to inoculate a large culture, at a dilution of approximately 1 : 100 to 1 :250.
  • the cells are grown to an optical density at 600nm
  • IPTG Isopropyl-B-D-thiogalactopyranoside
  • the 8M urea solution containing the solubilized protein is passed over a PD-10 column in 2X phosphate-buffered saline ("PBS"), thereby removing the urea, exchanging the buffer and refolding the protein.
  • PBS 2X phosphate-buffered saline
  • the protein is purified by a further step of chromatography to remove endotoxin. Then, it is sterile filtered.
  • the sterile filtered protein preparation is stored in 2X PBS at a concentration of 95 ⁇ /ml.
  • vectors used for the transient expression of a given gene sequence in mammalian cells carry the SV40 origin of replication. This allows the replication of the vector to high copy numbers in cells (e.g. COS cells) which express the T antigen required for the initiation of viral DNA synthesis. Any other mammalian cell line can also be utilized for this purpose.
  • a typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, also cellular signals can be used (e.g. human actin, promoter).
  • LTRs long terminal repeats
  • CMV cytomegalovirus
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC67109).
  • Mammalian host cells that could be used include, human Hela, 283, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1 African green monkey cells, quail QC1-3 cells, mouse L cells and Chinese hamster ovary cells such as
  • a gene of interest can be expressed in stable cell lines that contain the gene integrated into a chromosome.
  • the co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected gene can also be amplified to express large amounts of the encoded protein.
  • the DHFR dihydrofolate reductase
  • Using this marker the mammalian cells are grown in increasing amounts of methotrexate for selection and the cells with the highest resistance are selected.
  • These cell lines contain the amplified gene(s) integrated into a chromosome.
  • Chinese hamster ovary (CHO) cells are often used for the production of proteins.
  • the expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al, Molecular and Cellular Biology 438:44701 (March 1985)), plus a fragment of the CMV-enhancer (Boshart et al,
  • the vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
  • the expression plasmid, pDR3-Vl HA is made by cloning a cDNA encoding DR3-V1 (ATCC No. 97456) into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.).
  • Expression plasmid, pDR3 HA is made by cloning a cDNA encoding DR3 (ATCC No. ) into the expression vector pcDN AI/Amp
  • the expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E. coli and other prokaryotic cell; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells;
  • an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
  • a DNA fragment encoding the entire DR3-V 1 or Dr3 precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al, Cell 37:161 (1984). The fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction sfrategy is as follows:
  • the DR3-V1 or DR3 cDNA of the deposit clone is amplified using primers that contained convenient restriction sites, much as described above regarding the construction of expression vectors for expression of DR3-V1 or DR3 in E. coli and S. fugiperda.
  • one of the primers contains a hemagglutinin tag ("HA tag") as described above.
  • Suitable primers for DR3-V1 include the following, which are used in this e x a m p l e , t h e 5 ' p r i m e r , 5 '
  • CGCGGATCCGCCATCATGGAGGAGACGCAGCAG 3' contains the underlined BamHI site, an ATG start codon and 5 codons thereafter.
  • Suitable primers for DR3 include the following, which are used in this e x a m p l e , t h e 5 ' p r i m e r , 5 ' CGCGHAIGCGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO: 10) contains the underlined BamHI site, an ATG start codon and 5 codons thereafter.
  • the 3' primer for both DR3 and DR3-V1 containing the underlined Xbal site, stop codon, hemagglutinin tag and last 14 nucleotide of 3' coding sequence (at the 3' end) has the following sequence:
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with BamHI and Xbal and then ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning
  • the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the DR3-V1 or DR3 -encoding fragment.
  • COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al, Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor. NY (1989). Cells are incubated under conditions for expression of DR3-V 1 or DR3 by the vector.
  • DR3-V1 HA fusion protein or the DR3 HA fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al, Antibodies: a Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY ( 1988). To this end, two days after transfection, the cells are labeled by incubation in media containing 35 S -cysteine for 8 hours.
  • the cells and the media are collected, and the cells are washed and then lysed with detergent-containing RIP A buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above.
  • Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
  • the vector pC 1 is used for the expression of DR3-V 1 or DR3 (ATCC No.
  • Plasmid pCl is a derivative of the plasmid pSV2-dhfr [ATCC Accession No. 37146]. Both plasmids contain the mouse DHFR gene under control of the SV40 early promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate. The amplification of the DHFR genes in cells resistant to methotrexate (MTX) has been well documented (see, e.g., Alt, F.W., Kellems,
  • DHFR gene If a second gene is linked to the DHFR gene it is usually co- amplified and over-expressed. It is state of the art to develop cell lines carrying more than 1 ,000 copies of the genes. Subsequently, when the methotrexate is withdrawn, cell lines contain the amplified gene integrated into the chromosome(s).
  • Plasmid pCl contains for the expression of the gene of interest a strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al, Molecular and Cellular Biology, March 1985:438-4470) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al. , Cell 41 :521 -530, 1985). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI followed by the 3 ' intron and the polyadenylation site of the rat preproinsulin gene.
  • LTR long terminal repeat
  • CMV cytomegalovirus
  • high efficient promoters can also be used for the expression, e.g., the human ⁇ -actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HTV and HTLVI.
  • the human ⁇ -actin promoter e.g., the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HTV and HTLVI.
  • HTV and HTLVI retroviruses
  • Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
  • the plasmid pC 1 is digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphates by procedures known in the art.
  • the vector is then isolated from a 1% agarose gel.
  • the DNA sequence encoding DR3-V1 or DR3 in the deposited cDNA clones are amplified using PCR oligonucleotide primers specific to the amino acid carboxyl terminal sequence of the DR3-V1 or DR3 protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer for DR3-V1 has the sequence 5' CGCC ⁇ i ⁇ ICCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO: 12) containing the underlined BamHI restriction site, which encodes a start AUG, followed by the Kozak sequence ad 18 nucleotides of the DR3-V1 coding sequence set out in FIG. 1 beginning with the 1st base of the ATG codon.
  • the 5' oligonucleotide primer for DR3 has the sequence 5' CGCQG ⁇ UXGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO: 13) containing the underlined BamHI restriction site, which encodes a start AUG, followed by the Kozak sequence ad 18 nucleotides of the DR3 coding sequence set out in FIG. 2 beginning with the 1st base of the ATG codon.
  • the 3' primer for both DR3 and DR3-V1 has the sequence 5' CGCG ⁇ ITXTCACGGGCCGCGCTGCA 3' (SEQ ID NO: 14) containing the underlined BamHI restriction site followed by 17 nucleotides complementary to the last 14 nucleotides of the DR3-V1 or DR3 coding sequence set out in FIG. 1 or FIG. 2, respectively, plus the stop codon.
  • restriction sites are convenient to restriction enzyme sites in the CHO expression vectors pC 1.
  • the amplified DR3 or DR3-V1 DNA and the vector pCl both are digested with BamHI and the digested DNAs then ligated together. Insertion of the DR3- VI or DR3 DNA into the BamHI restricted vector placed the DR3-V1 or DR3 coding region downstream of and operably linked to the vector's promoter. The sequence of the inserted gene is confirmed by DNA sequencing.
  • Chinese hamster ovary cells lacking an active DHFR enzyme are used for transfection.
  • 5 ⁇ g of the expression plasmid C 1 are cofransfected with 0.5 ⁇ g of the plasmid pSVneo using the lipofecting method (Feigner et al, supra).
  • the plasmid pSV2-neo contains a dominant selectable marker, the gene neo from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) and cultivated from 10-14 days. After this period, single clones are trypsinized and then seeded in 6-well petri dishes using different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM).
  • Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (500 nM, 1 ⁇ M, 2 ⁇ M, 5 ⁇ M). The same procedure is repeated until clones grow at a concentration of 100 ⁇ M.
  • the cDNA sequence encoding the soluble extracellular domain of DR3- VI or DR3 protein in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
  • the 5' primer for DR3-V1 has the sequence 5' CGCGGATCC GCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO: 15) containing the underlined BamHI restriction enzyme site followed by Kozak sequence and a number of bases of the sequence of DR3-V1 of FIG. 1. Inserted into an expression vector, as described below, the 5' end of the amplified fragment encoding DR3-V1 provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol 796:947-950 (1987) is appropriately located in the vector portion of the construct.
  • the 5' primer for DR3 has the sequence 5' CGCGGATCC GCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO: 16) containing the underlined BamHI restriction enzyme site followed by Kozak sequence and a number of bases of the sequence of DR3 of FIG. 2. Inserted into an expression vector, as described below, the 5' end of the amplified fragment encoding DR3 provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J Mol Biol 196:941- 950 (1987) is appropriately located in the vector portion of the construct.
  • the 3' primer for both DR3 and DR3-V1 has the sequence 5'
  • GCGAG TCIAGTCTGGACCC AGAACATCTGCCTCC 3 * (SEQ ID NO: 17) containing the underlined Xbal resttiction followed by nucleotides complementary to the DR3-V1 or DR3 nucleotide sequence set out in FIG. 1 or FIG.2, respectively, followed by the stop codon.
  • the amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) The fragment then is digested with BamHI and Asp718 and again is purified on a 1% agarose gel. This fragment is designated herein F2.
  • the vector pA2 is used to express the DR3-V1 or DR3 protein in the baculovirus expression system, using standard methods, such as those described in Summers et al, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
  • This expression vector contains the strong polyhedron promoter of the Autograph califomica nuclear polyhedrosis virus (ACMNPV) followed by convenient restriction sites.
  • ACMNPV Autograph califomica nuclear polyhedrosis virus
  • the beta- galactosidase gene from E. coli is inserted in the same orientation as the polyhedron promoter and is followed by the polyadenylation signal of the polyhedron gene.
  • the polyhedron sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral
  • baculovirus vectors could be used in "lace of pA2, such as pAc373, pVL941 and pAcIMl provided, as those of skul readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required.
  • Such vectors are described in Luckow et al, Virology 170:31-39, among others.
  • the plasmid is digested with the restriction enzymes Bam HI and Xbal and then is dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "V2".
  • Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase.
  • E. coli HB101 cells are transformed with ligation mix and spread on culture plates.
  • Bacteria are identified that contain the plasmid with the human DDCR gene by digesting DNA from individual colonies using BamHI and Xbal and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pBac DR3-V1 or pBac DR3.
  • plasmid pBac DR3-V1 or pBac DR3 is co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al, Proc. Natl. Acad. Sci. USA 54:7413-7417 (1987).
  • Lipofectin plus 90 ⁇ l Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27 °C After
  • the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added.
  • the plate is put back into an incubator and cultivation is continued at 27° C for four days.
  • plaque assay After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above. An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
  • the virus is added to the cells. After appropriate incubation, blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4°C A clone containing properly inserted DR3-V1 or DR3 is identified by DNA analysis including restriction mapping and sequencing.
  • Sf9 cells are grown in Grace's medium supplemented with 10% heat- inactivated FBS. The cells are infected with the recombinant baculovirus V- DR3-V1 at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3). Six hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaithersburg). 42 hours later, 5 gCi of 35 S-methionine and 5 ⁇ Ci 35 S cysteine
  • the cells are further incubated for 16 hours and then they are harvested by centrifugation, lysed and the labeled proteins are visualized by SDS-PAGE and autoradiography.
  • DR3-V1 gene (ATCC No. 97456) expression in human tissues, using methods described by, among others, Sambrook et al, cited above.
  • a cDNA probe containing the entire nucleotide sequence of the DR3-V1 protein (SEQ ID NO: 1) is labeled with 32 P using the DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labeled probe is then used to examine various human tissues for DR3-V1 mRNA.
  • H human immune system tissues
  • IM human immune system tissues
  • PBLs peripheral blood leukocytes
  • thymus thymus
  • spleen colon
  • small intestine DR3-V1 expression appears to be restricted to lymphocyte compartments, it can be envisaged that DR3-V1 plays a role in lymphocyte homeostasis.
  • Northern blot analysis is carried out to examine DR3 gene (ATCC No. ) expression in human tissues, using methods described by, among others, Sambrook et al, cited above.
  • a cDNA probe containing the entire nucleotide sequence of the DR3 protein (SEQ ID NO:l) is labeled with "P using the re- ⁇ ' primeTM DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labeled probe is then used to examine various human tissues for DR3 mRNA.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • DR3 DR3 was detected in tissues enriched in lymphocytes including peripheral blood leukocytes (PBLs), thymus, spleen, colon, and small intestine.
  • PBLs peripheral blood leukocytes
  • TNFR-1 is ubiquitously expressed and Fas/APO-1 is expressed in lymphocytes, liver, heart, lung, kidney, and ovary (Watanabae- Fukunaga, et al, J. Immunol 745:1274-9 (1992)).
  • DR3 expression appears to be restricted to lymphocyte compartments, it can be envisaged that DR3 plays a role in lymphocyte homeostasis.
  • C Northern Blot analysis ofDR3 in various cell lines
  • CD 19+, CD4+ and CD8+ cells were isolated with cell type specific immunomagnetic beads (Drynal, Lake Success, NY).
  • RNA of adult tissues were purchased from Clonetech (Palo Alto, CA). Total RNA was extracted from cell lines (in exponential growth phase) and primary cells with TriReagent (Molecular Research Center, Inc., Cincinnati, OH).
  • RNA 5 to 7.5 ⁇ g of total RNA was fractionated in a 1% agarose gel containing formaldehyde cast in a Wide Mini-Sub Cell gel tray (Bio-Rad, Hercules, CA) as described (Sambrook, et al.) with slight modifications.
  • the formaldehyde concentration was reduced to 0.5M and the RNA was stained prior to electrophoresis with 100 ⁇ g/ml of etidium bromide that was added to the loading buffer.
  • the blots were prehybridized with 50% formamide, 8% dextran sulfate, 6xSSPE, 0.1 % SDS and 100 ⁇ g/ml of sheared and denatured salmon sperm DNA for at least 30 min at 42 °C cDNA inserts labeled with 32 P-dCTP by random priming (Stratagene, La Jolla, CA), were denatured with
  • DR3 results Expression of DR3 was assessed by Northern blot in the following cell lines: TF274 (bone marrow stromal); MG63, TE85 (osteosarcoma); K562 (erythroid); KGla, KG1, PLB985, HL60, U937, TNHP-1 (myeloid); REH, BJAB, Raji, IM-9 (B cell); Sup-Tl, Jurkat, H9, Molt-3 (T cell); RL95-2 (endometrial carcinoma); MCF-7 (breast cancer); BE, HT29 (colon cancer); IMR32 (neuroblastoma) and could only be detected in KGla cells. DR3 expression was detected in several lymphoblast cell lines.
  • DR3 was weakly expressed in CD 19+ cells, and more highly expressed in monocytes. However the highest levels were observed in T cells (CD4+ or CD8+) upon stimulation with PMA and PHA, indicating that DR3 probably plays a role in the regulation of T cell activation.
  • DR3 contains a death domain
  • DAMs death domain-containing adapter molecules
  • GST and GST fusion proteins were prepared from E.coii strain BL21(DE3)pLysS using standard published procedures and the recombinant proteins immobilized onto glutathione- agarose beads.
  • 35 S-Labeled FADD, RIP and TRADD were prepared by in vitro transcription-franslation using the TNT or T7 or SP6-coupled reticulocyte lysate system from Promega according to manufacturer's instructions, using pcDNA3
  • AU1-FADD A.M. Chinnaiyan, et al. Cell 81, 505-12 (1995); M.P. Boldin, et al, JBiol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14, 5579-5588 (1995)), pRK myc-TRADD (H. Hsu, et al, Cell 81, 495-504 (1995)), or pRK myc-RIP (H. Hsu, et al. Immunity 4, 387-396 (1996)) as template. Following translation, equal amounts of total 35 S-labeled reticulocyte lysate were diluted into
  • Bound proteins were visualized following autoradioraphy at -80 °C In vitro translated 35 S-labeled RIP, TRADD and FADD were incubated with glutathione beads containing GST alone or GST fusions of the cytoplasmic domain of Fas, TNFR-1.DR3 (215-393), or DDR3 (215-321). After the beads were washed, retained proteins were analyzed by SDS-PAGE and autoradiography. The gel was Coomassie stained to monitor equivalency of loading. To demonstrate the association of DR3 and TRADD in vivo, constructs encoding Flag-TNFR-1 and Flag- ⁇ TNFR-1 were used. The Flag-TNFR-1 and Flag- ⁇ TNFR-1 constructs were described elsewhere (A.M.
  • DR3 and ⁇ DR3 were cloned into the IBI Kodak FLAG plasmid (pCMVlFLAG) utilizing the signal peptide provided by the vector.
  • 293 cells (2 x lOVlOOmm plate) were grown in DMEM media containing 10% heat-inactivated fetal bovine serum containing penicillin G, streptomycin, glutamine, and non-essential amino acids.
  • Cells were transfected using calcium phosphate precipitation with the constructs encoding the indicated proteins in combination with pcDNA3-CrmA (M. Tewari, et al, JBiol Chem 270, 3255-60 (1995)) to prevent cell death and thus maintain protein expression.
  • Cells were lysed in 1 ml lysis buffer (50mM Hepes, 150mM NaCl, ImM EDTA, 1% NP-40, and a protease inhibitor cocktail). Lysates were immunoprecipitated with a control monoclonal antibody or anti-Flag antibody for at least 4 hrs, at 4°C as previously described (A.M.
  • GST glutathione S-transferase
  • TRADD Overexpression of TRADD induces apoptosis and NF-kB activation-two of the most important activities signaled by TNFR-1 (H. Hsu, et al, Cell 81, 495- 504 (1995)). Upon oligomerization of TNFR-1 by trimeric TNF, TRADD is recruited to the receptor signaling complex (H. Hsu, et al. Cell 84, 299-308 (1996)). TRADD can then recruit the following signal transducing molecules:
  • TRAF2 a TNFR-2- and CD40 - associated molecule
  • RIP originally identified as a Fas/APO-1 -interacting protein by two-hybrid analysis (B.Z. Stanger, et al, Cell 81, 513-23 (1995)), that mediates NF-kB activation and apoptosis (H. Hsu, et al, Immunity 4, 387-396
  • Fas/APO-1 and TNFR-1 in mammalian cells mimics receptor activation (M. Muzio, et al , Cell 85, 817-827 (1996); M. P. Boldin, et al, Cell 85, 803-815 (1996)).
  • this system was utilized to study the functional role of DDCR.
  • Ectopic expression of DR3 in MCF7 breast carcinoma cells and 293 human embryonic kidney cells induced rapid apoptosis.
  • NF-kB luciferase assays were performed as described elsewhere (H. Hsu, et al, Immunity 4, 387-396 (1996); M.D. Adams, et al, Nature 377, 3-174 (1995); G.S. Feng, et al, JBiol Chem 271, 12129-32 (1996); M. Rome, et al, Cell 78, 681-92 (1994); M. Rothe, et al, Science 269, 1424-1427 (1995); (A.M. Chinnaiyan, et al , J Biol Chem 271 , 4961 -4965 ( 1996)).
  • 293 cells were co-transfected by calcium phosphate precipitation with pCMV- ⁇ -galactosidase, E-selectin-luciferase reporter gene (M. Rothe, et al, Cell 78, 681-92 (1994); M. Rothe, et al, Science 269, 1424-1427 (1995)), the indicated death receptors, and the indicated dominant negative inhibitors.
  • DR3 or DDR3 was cotransfected with the pLantern expression construct (GIBCO-BRL) which encodes green fluorescent protein (photographic inset). Cells were visualized by fluorescence microscopy using a FITC range barrier filter cube.
  • DR3 induces NF-kB activation which is inhibitable by RIP-DN (Stanger, et al, Cell 57:513-23 (1995)) and TRAF2-DN (Hsu, etal. Cell 57:495-504 (1995)); (Rothe, et al, Cell 75:681-92 (1994); Rothe, et al. Science
  • the cells displayed mo ⁇ hological alterations typical of cells undergoing apoptosis, becoming rounded, condensed and detaching from the dish.
  • plasmids encoding full-length DR3 or DDR3 were co-transfected with the pLantern reporter construct encoding green fluorescent protein.
  • Nuclei of cells transfected with DR3, but not DDR3, exhibited apoptotic mo ⁇ hology as assessed by DAPI staining. Similar to TNFR-1 and Fas/APO-1 (M. Muzio, et al, Cell 85, 817-827 (1996); M. P. Boldin, et al, Cell 85, 803-815 (1996); M.
  • DR3-induced apoptosis was blocked by the inhibitors of ICE-like proteases, Cr A and z-VAD-fmk.
  • apoptosis induced by DR3 was also blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHal C360S), which were previously shown to inhibit death signaling by Fas/APO-1 and TNFR-1 (M. Muzio, et al, Cell 85, 817-827 91996); M. P. Boldin, et al, Cell 85, 803-815 (1996); H. Hsu, et al, Cell 84, 299-398 (1996); A.M. Chinnaiyan, et al, JBiol Chem 271, 4961-
  • FADD and the ICE-like protease FLICE are likely necessary components of DR3 -induced apoptosis.
  • NF-kB activation By confrast, NF-kB was activated by ectopic expression of DR3 or TNFR-1 , but not by the inactive signaling mutants DDR3 or DTNFR-1. Importantly, DR3-induced NF-kB activation was blocked by dominant negative derivatives of RIP (RIP-DN) and TRAF2 (TRAF2-DN), which were previously shown to abrogate TNF-induced NF-kB activation (H. Hsu, et al, Cell 84, 299-
  • the DR3 signaling complex assembles in a hierarchical manner with the recruitment of the multivalent adapter molecule TRADD, from which two distinct signaling cascades emanate: 1) NF-kB activation mediated by TRAF2 and RIP and 2) cell death mediated by FADD, FLICE, and RIP.
  • ADDRESSEE Sterne, Kessler, Goldstein & Fox, P.L.L.C.
  • TELECOMMUNICATION INFORMATION (A) TELEPHONE: 202-371-2600 (B) TELEFAX: 202-371-2540
  • TCTCCACCCA TGGGCACCCC TTCTGCCCGG GGCCTGGGAA GTGGGCTGCT CTGTGGGCAA 180
  • MOLECULE TYPE cDNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Communicable Diseases (AREA)
  • Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to novel Death Domain Containing Receptor (DR3 and DR3-V1) proteins which are members of the tumor necrosis factor (TNF) receptor family. In particular, isolated nucleic acid molecules are provided encoding the human DR3 and DR3-V1 proteins. DR3 and DR3-V1 polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of DR3 and DR3-V1 activity.

Description

Death Domain Containing Receptors
Background of the Invention
Field of the Invention
The present invention relates to a novel member of the tumor necrosis factor family of receptors. More specifically, isolated nucleic acid molecules are provided encoding human Death Domain Containing Receptors (DR3 and DR3- VI). Death Domain Containing Receptor polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of DR3 activity.
Related Art
Many biological actions, for instance, response to certain stimuli and natural biological processes, are controlled by factors, such as cytokines. Many cytokines act through receptors by engaging the receptor and producing an intra¬ cellular response.
For example, tumor necrosis factors (TNF) alpha and beta are cytokines which act through TNF receptors to regulate numerous biological processes, including protection against infection and induction of shock and inflammatory disease. The TNF molecules belong to the "TNF-ligand" superfamily, and act together with their receptors or counter-ligands, the "TNF-receptor" superfamily. So far, nine members of the TNF ligand superfamily have been identified and ten members of the TNF-receptor superfamily have been characterized.
Among the ligands there are included TNF-α, lymphotoxin-α (LT-α, also known as TNF-β), LT-β (found in complex heterotrimer LT-α2-β), FasL,
CD40L, CD27L, CD30L, 4-1BBL, OX40L and nerve growth factor (NGF). The superfamily of TNF receptors includes the p55TNF receptor, p75TNF receptor, TNF receptor-related protein, FAS antigen or APO-1 , CD40, CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor (Meager, A., Biologicals, 22:291-295 (1994)).
Many members of the TNF-ligand superfamily are expressed by activated T-cells, implying that they are necessary for T-cell interactions with other cell types which underlie cell ontogeny and functions. (Meager, A., supra).
Considerable insight into the essential functions of several members of the TNF receptor family has been gained from the identification and creation of mutants that abolish the expression of these proteins. For example, naturally occurring mutations in the FAS antigen and its ligand cause lymphoproliferative disease (Watanabe-Fukunaga, R., et al., Nature 556:314 (1992)), perhaps reflecting a failure of programmed cell death. Mutations of the CD40 ligand cause an X-linked immunodeficiency state characterized by high levels of immunoglobulin M and low levels of immunoglobulin G in plasma, indicating faulty T-cell-dependent B-cell activation (Allen, R.C. et al., Science 259:990
(1993)). Targeted mutations of the low affinity nerve growth factor receptor cause a disorder characterized by faulty sensory innovation of peripheral structures (Lee, K.F. et al., Cell 69:131 (1992)).
TNF and LT-α are capable of binding to two TNF receptors (the 55- and 75-kd TNF receptors). A large number of biological effects elicited by TNF and
LT-α, acting through their receptors, include hemorrhagic necrosis of transplanted tumors, cytotoxicity, a role in endotoxic shock, inflammation, immunoregulation, proliferation and anti-viral responses, as well as protection against the deleterious effects of ionizing radiation. TNF and LT-α are involved in the pathogenesis of a wide range of diseases, including endotoxic shock, cerebral malaria, tumors, autoimmune disease, AIDS and graft-host rejection (Beutler, B. and Von Huffel, C, Science 264:661-668 (1994)). Mutations in the p55 Receptor cause increased susceptibility to microbial infection.
Moreover, an about 80 amino acid domain near the C-terminus of TNFR1 (p55) and Fas was reported as the "death domain," which is responsible for transducing signals for programmed cell death (Tartaglia et al, Cell 74:845 (1993)).
Apoptosis, or programmed cell death, is a physiologic process essential to the normal development and homeostasis of multicellular organisms (H. Steller, Science 261, 1445-1449 (1995)). Derangements of apoptosis contribute to the pathogenesis of several human diseases including cancer, neurodegenerative disorders, and acquired immune deficiency syndrome (CB. Thompson, Science 267, 1456-1462 (1995)). Recently, much attention has focused on the signal transduction and biological function of two cell surface death receptors, Fas/APO-1 and TNFR-1 (J.L. Cleveland, et al., Cell 81 , 479-482
(1995); A. Fraser, et al., Cell 85, 781-784 (1996); S. Nagata, et al., Science 267, 1449-56 (1995)). Both are members of the TNF receptor family which also include TNFR-2, low affinity NGFR, CD40, and CD30, among others (CA. Smith, et al., Science 248, 1019-23 (1990); M. Tewari, et al, in Modular Texts in Molecular and Cell Biology M. Purton, Heldin, Carl, Ed. (Chapman and Hall,
London, 1995). While family members are defined by the presence of cysteine-rich repeats in their extracellular domains, Fas/APO-1 and TNFR-1 also share a region of intracellular homology, appropriately designated the "death domain", which is distantly related to the Drosophila suicide gene, reaper (P. Golstein, et al., Cell 81, 185-6 (1995); K. White et ai, Science 264, 677-83
(1994)). This shared death domain suggests that both receptors interact with a related set of signal transducing molecules that, until recently, remained unidentified. Activation of Fas/APO-1 recruits the death domain-containing adapter molecule FADD/MORT1 (A.M. Chinnaiyan, et ai, Cell 81, 505-12 (1995); M. P. Boldin, et al, J. Biol Chem 270, 7795-8 (1995); F.C. Kischkel, et al., EMBO 14, 5579-5588 (1995)), which in turn binds and presumably activates FLICE/MACH1, a member of the ICE/CED-3 family of pro-apoptotic proteases (M. Muzio et al, Cell 85, 817-827 (1996); M.P. Boldin, et al., Cell 85, 803-815 (1996)). While the central role of Fas/APO-1 is to trigger cell death, TNFR-1 can signal an array of diverse biological activities-many of which stem from its ability to activate NF-kB (L.A. Tartaglia, et al, Immunol Today 13, 151-3 (1992)). Accordingly, TNFR-1 recruits the multivalent adapter molecule TRADD, which like FADD, also contains a death domain (H. Hsu, et al, Cell 81, 495-504 (1995); H. Hsu, et al, Cell 84, 299-308 (1996)). Through its associations with a number of signaling molecules including FADD, TRAF2, and RIP, TRADD can signal both apoptosis and NF-kB activation (H. Hsu, et al, Cell
84, 299-308 (1996); H. Hsu, et al, Immunity 4, 387-396 (1996)).
The effects of TNF family ligands and TNF family receptors are varied and influence numerous functions, both normal and abnormal, in the biological processes of the mammalian system. There is a clear need, therefore, for identification and characterization of such receptors and ligands that influence biological activity, both normally and in disease states. In particular, there is a need to isolate and characterize novel members of the TNF receptor family.
Summary of the Invention
The present invention provides for isolated nucleic acid molecules comprising nucleic acid sequences encoding the amino acid sequences shown in
FIG. 1 (SEQ ID NO:2) and FIG. 2 (SEQ ID NO:4) or the amino acid sequence encoding the cDNA clones deposited in a bacterial host as ATCC Deposit No.
97456 on March 1, 1996 and ATCC Deposit No. on October 10, 1996.
The present invention also provides vectors and host cells for recombinant expression of the nucleic acid molecules described herein, as well as to methods of making such vectors and host cells and for using them for production of DR3 or DR3 Variant 1 (DR3-V1) (formerly named DDCR) polypeptides or peptides by recombinant techniques.
The invention further provides an isolated DR3 or DR3-V1 polypeptide having an amino acid sequence encoded by a polynucleotide described herein.
The present invention also provides diagnostic assays such as quantitative and diagnostic assays for detecting levels of DR3 or DR3-V1 protein. Thus, for instance, a diagnostic assay in accordance with the invention for detecting over- expression of DR3 or DR3-V1, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors.
Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes. Cellular response to TNF-family ligands include not only normal physiological responses, but also diseases associated with increased apoptosis or the inhibition of apoptosis. Apoptosis- programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes. Diseases associated with increased cell survival, or the inhibition of apoptosis, include cancers, autoimmune disorders, viral infections, inflammation, graft v. host disease, acute graft rejection, and chronic graft rejection. Diseases associated with increased apoptosis include AIDS, neurodegenerative disorders, myelodysplastic syndromes, ischemic injury, toxin-induced liver disease, septic shock, cachexia and anorexia.
Thus, the invention further provides a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the DR3 polypeptide an effective amount of an agonist capable of increasing DR3 mediated signaling. Preferably, DR3 mediated signaling is increased to treat a disease wherein decreased apoptosis is exhibited.
In a further aspect, the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the DR3 polypeptide an effective amount of an antagonist capable of decreasing DR3 mediated signaling. Preferably, DR3 mediated signaling is decreased to treat a disease wherein increased apoptosis is exhibited.
Whether any candidate "agonist" or "antagonist" of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below. Thus, in a further aspect, a screening method is provided for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand. The method involves contacting cells which express the DR3 or DR3-V1 polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway. By the invention, a cell expressing the DR3 or DR3-V1 polypeptide can be contacted with either an endogenous or exogenously administered TNF-family ligand.
Brief Description of the Figures
FIG. 1A-C shows the nucleotide and deduced amino acid sequence of
DR3-V1. It is predicted that amino acids 1 - 35 constitute the signal peptide. amino acids 36-212 constitute the extracellular domain, amino acids 213-235 constitute the transmembrane domain, amino acids 236-428 constitute the intracellular domain, and amino acids 353-419 the death domain. FIG. 2A-B shows the nucleotide and deduced amino acid sequence of
DR3. It is predicted that amino acids 1 - 24 constitute the signal peptide, amino acids 25-201 constitute the extracellular domain, amino acids 202-224 constitute the transmembrane domain, amino acids 225-417 constitute the intracellular domain, and amino acids 342-408 constitute the death domain. FIG. 3A-D shows the regions of similarity between the amino acid sequences of the DR3-V1. human tumor necrosis factor receptor 1, and Fas receptor [SEQ ID NOs:5 and 6].
FIG. 4 shows an analysis of the DR3-V1 amino acid sequence. Alpha, beta, turn and coil regions; hydrophilic ity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown. In the "Antigenic Index - Jameson- Wolf ' graph, amino acid residues 1-22, 33-56, 59- 82, 95-1 12, 122-133, 161-177, 179-190, 196-205 in Figure 1 correspond to the shown highly antigenic regions of the DR3-V 1 protein.
Detailed Description of the Preferred Embodiments
The present invention provides isolated nucleic acid molecules comprising a nucleic acid sequence encoding the DR3-V1 or DR3 polypeptide whose amino acid sequence is shown in FIG. 1 [SEQ ID NO:2] and FIG. 2 [SEQ ID NO:4], respectively, or a fragment of the polypeptide. The DR3-V1 and DR3 polypeptides of the present invention shares sequence homology with human
TNF RI and Fas (FIG. 4). The nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] was obtained by sequencing the HTTNB61 clone, which was deposited on February 29, 1996 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given Accession Number 97456. The deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene,
LaJolla, CA).The nucleotide sequence shown in FIG. 2 [SEQ ID NO:3] was obtained by sequencing a clone obtained from a HUVEC library, which was deposited on October 10, 1996 at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, and given Accession Number . The deposited clone is contained in the pBluescript SK(-) plasmid
(Stratagene, LaJolla, CA). Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about
99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion. By "isolated" polypeptide or protein is intended a polypeptide or protein removed from its native environment. For example, recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention as are native or recombinant polypeptides which have been substantially purified by any suitable technique such as, for example, the single-step purification method disclosed in Smith and Johnson, Gene 67:31 -40
(1988).
Using the information provided herein, such as the nucleic acid sequence set out in FIG. 1 or FIG. 2, a nucleic acid molecule of the present invention encoding a DR3-V1 or DR3 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material. Illustrative of the invention, the nucleic acid molecule described in FIG. 1 was discovered in a cDNA library derived from cells of a human testis tumor. Also illustrative of the invention, the nucleic acid molecule described in FIG. 2 was discovered in a human HUVEC cDNA library. In addition, the genes of the present invention have also been identified in cDNA libraries of the following tissues: fetal liver, fetal brain, tonsil and leukocyte. Furthermore, multiple forms of DR3 transcript are seen in Northern Blots and PCR reactions indicating that multiple variants of the transcript exists, possibly due to alternate splicing of the message. The DR3-V1 (formerly called DDCR) gene contains an open reading frame encoding a protein of about 428 amino acid residues whose initiation codon is at position 198-200 of the nucleotide sequence shown in FIG. 1 [SEQ ID NO.l], with a leader sequence of about 35 amino acid residues, and a deduced molecular weight of about 47 kDa. Of known members of the TNF receptor family, the DR3-V1 polypeptide of the invention shares the greatest degree of homology with human TNF Rl. The DR3-V1 polypeptide shown in FIG. 1 [SEQ ID NO:2] is about 20% identical and about 50% similar to human TNF Rl.
The DR3 gene contains an open reading frame encoding a protein of about 417 amino acid residues whose initiation codon is at position 1-3 of the nucleotide sequence shown in FIG. 2 [SEQ ID NO:3], with a leader sequence of about 24 amino acid residues, and a deduced molecular weight of about 43 kDa. Of known members of the TNF receptor family, the DR3 polypeptide of the invention shares the greatest degree of homology with human TNF Rl. The DR3 polypeptide shown in FIG. 2 [SEQ ID NO:3] is about 20% identical and about 50% similar to human TNF Rl.
As indicated, the present invention also provides the mature form(s) of the DR3-V1 and DR3 protein of the present invention. According to the signal hypothesis, proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, cleavage of a secreted protein is not entirely uniform, which results in two or more mature species on the protein. Further, it has long been known that the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide. Therefore, the present invention provides a nucleotide sequence encoding the mature DR3-V1 or DR3 polypeptides having the amino acid sequence encoded by the cDNA clones contained in the host identified as ATCC Deposit No. 97456 and , respectively, and as shown in Figure 1 (SEQ ID NO:2) and Figure 2 (SEQ ID NO:4). By the mature DR3-V1 or DR3 protein having the amino acid sequence encoded by the cDNA clones contained in the host identified as ATCC Deposit
No. 97456 and , respectively, is meant the mature form(s) of the DR3-V1 or DR3 protein produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host. As indicated below, the mature DR3-V1 or DR3 having the amino acid sequence encoded by the cDNA clones contained in ATCC Deposit No. 97456 and , respectively, may or may not differ from the predicted "mature" DR3-V1 protein shown in Figure 1 (amino acids from about 36 to about 428) or DR3 protein shown in Figure 2 (amino acids from about 24 to about 417) depending on the accuracy of the predicted cleavage site based on computer analysis.
Methods for predicting whether a protein has a secretory leader as well as the cleavage point for that leader sequence are available. For instance, the method of McGeoch (Virus Res. 3:271-286 (1985)) and von Heinje (Nucleic Acids Res. 74:4683-4690 (1986)) can be used. The accuracy of predicting the cleavage points of known mammalian secretory proteins for each of these methods is in the range of 75-80%. von Heinje, supra. However, the two methods do not always produce the same predicted cleavage point(s) for a given protein. In the present case, the predicted amino acid sequence of the complete
DR3-V1 and DR3 polypeptides of the present invention were analyzed by a computer program ("PSORT"). (see K. Nakai and M. Kanehisa, Genomics 74:897-911 (1992)), which is an expert system for predicting the cellular location of a protein based on the amino acid sequence. As part of this computational prediction of localization, the methods of McGeoch and von Heinje are incorporated. The analysis by the PSORT program predicted the cleavage sites between amino acids 35 and 36 in Figure 1 (SEQ ID NO:2) and between amino acids 24 and 25 in Figure 2 (SEQ ID NO:4). Thereafter, the complete amino acid sequences were further analyzed by visual inspection, applying a simple form of the (-1,-3) rule of von Heine, von Heinje, supra. Thus, the leader sequence for the DR3-V1 protein is predicted to consist of amino acid residues 1- 35 in Figure
1 (SEQ ID NO:2), while the predicted mature DR3-V1 protein consists of residues 36-428. The leader sequence for the DR3 protein is predicted to consist of amino acid residues 1 - 24 in Figure 2 (SEQ ID NO:4), while the predicted mature DR3 protein consists of residues 25-417. As one of ordinary skill would appreciate, due to the possibilities of sequencing errors discussed above, as well as the variability of cleavage sites for leaders in different known proteins, the actual DR3-V1 polypeptide encoded by the deposited cDNA comprises about 428 amino acids, but may be anywhere in the range of 410-440 amino acids; and the actual leader sequence of this protein is about 35 amino acids, but may be anywhere in the range of about 25 to about
45 amino acids. The actual DR3 polypeptide encoded by the deposited cDNA comprises about 417 amino acids, but may be anywhere in the range of 400-430 amino acids; and the actual leader sequence of this protein is about 24 amino acids, but may be anywhere in the range of about 14 to about 34 amino acids. As indicated, nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. Single-stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand. By "isolated" nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically. Isolated nucleic acid molecules of the present invention include DR3-V1
DNA molecules comprising an open reading frame (ORF) shown in FIG. 1 [SEQ ID NO:l] and further include DNA molecules which comprise a sequence substantially different than all or part of the ORF whose initiation codon is at position 198-200 of the nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] but which, due to the degeneracy of the genetic code, still encode the DR3-V1 polypeptide or a fragment thereof. Isolated nucleic acid molecules of the present invention also include DR3 DNA molecules comprising an open reading frame (ORF) shown in FIG. 2 [SEQ ID NO:3] and further include DNA molecules which comprise a sequence substantially different than all or part of the ORF whose initiation codon is at position 1-3 of the nucleotide sequence shown in
FIG. 2 [SEQ ID NO:3] but which, due to the degeneracy of the genetic code, still encode the DR3 polypeptide or a fragment thereof. Of course, the genetic code is well known in the art. Thus, it would be routine for one skilled in the art to generate such degenerate variants. In another aspect, the invention provides isolated nucleic acid molecules encoding the DR3-V1 polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97456 on March 1, 1996. The invention provides isolated nucleic acid molecules encoding the DR3 polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. on
October 10, 1996. Preferably, these nucleic acid molecules will encode the mature polypeptide encoded by the above-described deposited cDNA clone. The invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (SEQ ID NO:l) or FIG. 2 (SEQ ID NO:3) or the nucleotide sequence of the DR3-V1 or DR3 cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences. Such isolated DNA molecules and fragments thereof are useful as DNA probes for gene mapping by in situ hybridiz DR3-V1 or DR3 gene in human tissue (including testis tumor tissue) by Northern blot analysis. The present invention is further directed to fragments of the isolated nucleic acid molecules described herein. By fragments of an isolated DNA molecule having the nucleotide sequence shown in FIG. 1 [SEQ ID NO:l] or FIG. 2 [SEQ ID NO:3] are intended DNA fragments at least 20 bp, and more preferably at least 30 bp in length which are useful as DNA probes as discussed above, of course larger DNA fragments 50-1500 bp in length are also useful as
DNA probes according to the present invention as are DNA fragments corresponding to most, if not all, of the nucleotide sequence shown in FIG. 1 [SEQ ID NO: l] or FIG. 2 [SEQ ID NO:3]. By a fragment at least 20 bp in length, for example, is intended fragments which include 20 or more bases from the nucleotide sequence in FIG. 1 [SEQ ID NO: 1 ] or FIG. 2 [SEQ ID NO:3].
Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising the DR3 extracellular domain
(amino acid residues from about 36 to about 212 in FIG. 1 [SEQ ID NO:2]); a polypeptide comprising the DR3 transmembrane domain (amino acid residues from about 213 to about 235 in FIG. 1 [SEQ ID NO:2]; a polypeptide comprising the DR3 intracellular domain (amino acid residues from about 214 to about 428 in FIG. 1 [SEQ ID NO:2] ; and a polypeptide comprising the DR3 death domain (amino acid residues from about 353 to about 419 in FIG. 1 [SEQ ID NO:2]). Since the location of these domains have been predicted by computer graphics, one of ordinary skill would appreciate that the amino acid residues constituting these domains may vary slightly (e.g., by about 1 to 15 residues) depending on the criteria used to define the domain.
Preferred nucleic acid fragments of the present invention further include nucleic acid molecules encoding epitope-bearing portions of the DR3-V1 protein. In particular, such nucleic acid fragments of the present invention include nucleic acid molecules encoding: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 196 to about 205 in Figure 1 (SEQ ID NO:2). The inventors have determined that the above polypeptide fragments are antigenic regions of the
DR3-V1 protein. Methods for determining other such epitope-bearing portions of the DR3-V1 protein are described in detail below. Preferred nucleic acid fragments of the present invention also include nucleic acid molecules encoding epitope-bearing portions of the DR3 protein. In particular, such nucleic acid fragments of the present invention include nucleic acid molecules encoding the corresponding regions to those epitope-bearing regions of the DR3-V1 protein disclosed above. Methods for determining other such epitope-bearing portions of the DR3 protein are described in detail below.
In another aspect, the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clones contained in ATCC Deposit 97456 or ATCC Deposit . By "stringent hybridization conditions" is intended overnight incubation at 42°C in a solution comprising: 50%o formamide, 5x SSC (150 mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65 °C By a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO:l) or Figure 2 (SEQ ID NO:3). Of course, a polynucleotide which hybridizes only to a poly A sequence
(such as the 3' terminal poly(A) tract of the DR3-V1 cDNA shown in Figure 1 (SEQ ID NO: 1)), or to a complementary stretch of T (or U) resides, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof
(e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which encode the DR3-V1 or DR3 polypeptide may include, but are not limited to the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding a leader or secretary sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription. mRNA processing - including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities. Thus, for instance, the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available. As described in Gentz et al, Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. The HA tag corresponds to an epitope derived of influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37:161 (1984), for instance.
The present invention further relates to variants of the nucleic acid molecules of the present invention, which encode for fragments, analogs or derivatives of the DR3-V1 or DR3 polypeptide. Variants may occur naturally, such as an allelic variant. By an "allelic variant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non- naturally occurring variants may be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions, deletions or additions which may involve one or more nucleotides. The variants may be altered in coding or non-coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions.
Further embodiments of the invention include isolated nucleic acid molecules that are at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to (a) a nucleotide sequence encoding the full-length DR3-V1 polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2), including the predicted leader sequence; (b) nucleotide sequence encoding the full-length DR3 polypeptide having the complete amino acid sequence in Figure 2 (SEQ ID NO:4), including the predicted leader sequence; (c) a nucleotide sequence encoding the mature DR3-V1 polypeptide (full-length polypeptide with the leader removed) having the amino acid sequence at positions about 36 to about 428 in Figure 1 (SEQ ID NO:2); (d) a nucleotide sequence encoding the full-length DR3-V1 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No. 97456; (e) a nucleotide sequence encoding the full-length DR3 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No. ; (f) a nucleotide sequence encoding the mature DR3-V 1 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97456; (g) a nucleotide sequence encoding the mature DR3-V1 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. ; (h) a nucleotide sequence that encodes the DR3 extracellular domain, (i) a nucleotide sequence that encodes the DR3 transmembrane domain,
(j) a nucleotide sequence that encodes the DR3 intracellular domain, and (k) a nucleotide sequence that encodes the DR3 death domain; or (1) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), 0) or (k) above. By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a DR3-V1 or DR3 polypeptide is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the DR3-V1 or DR3 polypeptide. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular nucleic acid molecule is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the nucleotide sequence shown in Figure 1 , Figure 2 or to the nucleotide sequences of the deposited cDNA clones can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 5371 1. Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482-489 (1981), to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
The present application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
Figure 1 (SEQ ID NO:l), Figure 2 (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNAs, irrespective of whether they encode a polypeptide having DR3 activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having DR3 activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having DDCR activity include, inter alia, (1) isolating the DR3-V1 or DR3 gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the DR3-V1 or DR3 gene, as described in Verma et al, Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting DR3-V1 or DR3 mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least 90%), 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO.T), Figure 2 (SEQ ID NO:3) or to the nucleic acid sequence of the deposited cDNAs which do, in fact, encode a polypeptide having DR3 protein activity. By "a polypeptide having DR3 activity" is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the DR3 protein of the invention (either the full-length protein or, preferably, the mature protein), as measured in a particular biological assay. For example, DR3 protein activity can be measured using the cell death assays performed essentially as previously described (A.M. Chinnaiyan, et al, Cell 81, 505-12 (1995); M.P. Boldin, et al, J Biol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14, 5579-5588 (1995); A.M. Chinnaiyan. et al, J Biol
Chem 271, 4961-4965 (1996)) and as set forth in Example 7, below. In MCF7 cells, plasmids encoding full-length DR3 or a candidate death domain containing receptors are co-transfected with the pLantern reporter construct encoding green fluorescent protein. Nuclei of cells transfected with DR3 will exhibit apoptotic morphology as assessed by DAPI staining. Similar to TNFR-1 and Fas/APO-1
(M. Muzio, etal, Cell 85, 817-827 (1996); M. P. Boldin, et al. Cell 85, 803-815 (1996); M. Tewari, et al, J Biol Chem 270, 3255-60 (1995)), DR3-induced apoptosis is blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk. In addition, apoptosis induced by DR3 is also blocked by dominant negative versions of FADD (FADD-DN) or FLICE
(FLICE-DN/MACHalC360S).
Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figure 1 (SEQ ID NO:l) or Figure 2 (SEQ ID NO:3) will encode a polypeptide "having DR3 protein activity." In fact, since degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having DR3 protein activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid). For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J.U. et al, "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein the authors indicate that proteins are surprisingly tolerant of amino acid substitutions.
Polynucleotide assays
This invention is also related to the use of the DR3-V1 or DR3 polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent. Detection of a mutated form of DR3-V1 or DR3 associated with a dysfunction will provide a diagnostic tool that can add or define a diagnosis of a disease or susceptibility to a disease which results from under- expression over-expression or altered expression of DR3-V1 or DR3 or a soluble form thereof, such as, for example, tumors or autoimmune disease.
Individuals carrying mutations in the DR3-V1 or DR3 gene may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis. (Saiki et al, Nature 524:163-166 (1986)). RNA or cDNA may also be used in the same ways. As an example, PCR primers complementary to the nucleic acid encoding DR3-V1 or DR3 can be used to identify and analyze DR3-V1 or DR3 expression and mutations. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled DR3-V1 or DR3 RNA or alternatively, radiolabeled DR3-V1 or
DR3 antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing. In addition, cloned
DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al, Science 230:1242 (1985)).
Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and SI protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl Acad. Sci. USA 85: 4397-4401 (1985)).
Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphisms ("RFLP") and Southern blotting of genomic DNA.
In addition to more conventional gel-electrophoresis and DNA sequencing, mutations also can be detected by in situ analysis.
Chromosome assays
The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
In certain preferred embodiments in this regard, the cDNA herein disclosed is used to clone genomic DNA of a DR3-V1 or a DR3 gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA the is used for in situ chromosome mapping using well known techniques for this purpose.
In addition, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60. For a review of this technique, see Verma et al. , Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man, available on line through Johns Hopkins University, Welch Medical Library. The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes)). Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
Vectors and Host Cells
The present invention also relates to vectors which include DNA molecules of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
Host cells can be genetically engineered to incorporate nucleic acid molecules and express polypeptides of the present invention. The polynucleotides may be introduced alone or with other polynucleotides. Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention.
In accordance with this aspect of the invention the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double-stranded RNA or DNA viral vector. Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells. Viral vectors may be replication competent or replication defective. In the latter case viral propagation generally will occur only in complementing host cells.
Preferred among vectors, in certain respects, are those for expression of polynucleotides and polypeptides of the present invention. Generally, such vectors comprise cis-acting control regions effective for expression in a host operatively linked to the polynucleotide to be expressed. Appropriate trans- acting factors either are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
A great variety of expression vectors can be used to express a polypeptide of the invention. Such vectors include chromosomal, episomal and virus-derived vectors e.g., vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. all may be used for expression in accordance with this aspect of the present invention. Generally, any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard.
The DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s)), including, for instance, a promoter to direct mRNA transcription. Representatives of such promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name just a few of the well-known promoters. In general, expression constructs will contain sites for transcription, initiation and termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the mature transcripts expressed by the constructs will include a translation initiating AUG at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated. In addition, the constructs may contain control regions that regulate as well as engender expression. Generally, such regions will operate by controlling transcription, such as repressor binding sites and enhancers, among others.
Vectors for propagation and expression generally will include selectable markers. Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose. In this regard, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells. Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline or ampicillin resistance genes for culturing E. coli and other bacteria. The vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide. Representative examples of appropriate hosts include bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS and Bowes melanoma cells; and plant cells. Hosts for of a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention. Among vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHlόa, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and pSG available from Stratagene; and ρSVK3, pBPV, pMSG and pSVL available from Pharmacia. These vectors are listed solely by way of illustration of the many commercially available and well known vectors available to those of skill in the art.
Selection of appropriate vectors and promoters for expression in a host cell is a well known procedure and the requisite techniques for expression vector construction, introduction of the vector into the host and expression in the host are routine skills in the art.
The present invention also relates to host cells containing the above- described constructs discussed above. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid- mediated transfection, electroporation, transduction. infection or other methods.
Such methods are described in many standard laboratory manuals, such as Davis et al. , Basic Methods in Molecular Biology ( 1986).
The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous functional regions. Thus, for instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage. Also, region also may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art. A preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins. For example, EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations. In drug discovery, for example, human proteins, such as, hIL5- has been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al, Journal of Molecular Recognition, Vol. 8:52-58 (1995) and K. Johanson et al, The
Journal of Biological Chemistry, Vol. 270, No. 16:9459-9471 (1995). The DR3 and DR3-V1 polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification. Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and/or purification. Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
DR3-V1 or DR3 polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of DR3. Among these are applications in treatment of tumors, resistance to parasites, bacteria and viruses, to induce proliferation of T-cells, endothelial cells and certain hematopoietic cells, to treat restenosis, graft vs. host disease, to regulate anti-viral responses and to prevent certain autoimmune diseases after stimulation of DR3 by an agonist. Additional applications relate to diagnosis and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are discussed further below. DR3 Polypeptides and Fragments
The invention further provides an isolated DR3-V1 or DR3 polypeptide having the amino acid sequence shown in FIG. 1 [SEQ ID NO:2] and FIG. 2[SEQ ID NO:4], respectively, or a fragment thereof. It will be recognized in the art that some amino acid sequence of DR3-V1 or DR3 can be varied without significant effect of the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity. Such areas will usually comprise residues which make up the ligand binding site or the death domain, or which form tertiary structures which affect these domains.
Thus, the invention further includes variations of the DR3-V1 or DR3 protein which show substantial DR3 protein activity or which include regions of DR3-V1 or DR3 such as the protein fragments discussed below. Such mutants include deletions, insertions, inversions, repeats, and type substitutions. As indicated above, guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie, J.U. et al, Science 247 : \ 306-1310 (1990).
Of particular interest are substitutions of charged amino acids with another charged amino acid and with neutral or negatively charged amino acids. The latter results in proteins with reduced positive charge to improve the characteristics of the DR3-V1 or DR3 protein. The prevention of aggregation is highly desirable. Aggregation of proteins not only results in a loss of activity but can also be problematic when preparing pharmaceutical formulations, because they can be immunogenic. (Pinckard et al, Clin Exp. Immunol. 2:331-340 (1967); Robbins et al, Diabetes 56:838-845 (1987); Cleland et al. Crit. Rev.
Therapeutic Drug Carrier Systems 10:301-311 (1993)).
The replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al. Nature 5(57:266-268 (1993) describes certain mutations resulting in selective binding of TNF-α to only one of the two known types of TNF receptors. Thus, the DR3-V 1 or DR3 receptor of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
As indicated, changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 1).
TABLE 1. Conservative Amino Acid Substitutions.
Figure imgf000031_0001
Amino acids in the DR3-V1 or DR3 protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992) and de Vos et al Science 255:306-312 (1992)).
The polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified. A recombinantly produced version of the DR3-V1 or DR3 polypeptide is substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
The polypeptides of the present invention also include the polypeptide encoded by the deposited cDNA including the leader, the mature polypeptide encoded by the deposited the cDNA minus the leader (i.e., the mature protein), the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4) including the leader, the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4) minus the leader, the extracellular domain, the transmembrane domain, the intracellular domain, soluble polypeptides comprising all or part of the extracellular and intracelluar domains but lacking the transmembrane domain as well as polypeptides which are at least 80% identical, more preferably at least
90% or 95% identical, still more preferably at least 96%, 97%, 98% or 99% identical to the polypeptide encoded by the deposited cDNA clones, to the polypeptide of Figure 1 (SEQ ID NO:2) or Figure 2 (SEQ ID NO:4), and also include portions of such polypeptides with at least 30 amino acids and more preferably at least 50 amino acids.
By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a reference amino acid sequence of a DR3-V1 or DR3 polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of the DR3-V1 or DR3 polypeptide. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence. As a practical matter, whether any particular polypeptide is at least 90%,
95%, 96%), 97%, 98%) or 99% identical to, for instance, the amino acid sequence shown in Figure 1 (SEQ ID NO:2), or Figure 2 (SEQ ID NO:4) or to the amino acid sequence encoded by deposited cDNA clones can be determined conventionally using known computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer
Group, University Research Park, 575 Science Drive, Madison, WI 53711. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5% of the total number of amino acid residues in the reference sequence are allowed.
The present inventors have discovered that the DR3-V1 polypeptide is a 428 residue protein exhibiting three main structural domains. First, the ligand binding domain was identified within residues from about 36 to about 212 in
FIG. 1 [SEQ ID NO:2]. Second, the transmembrane domain was identified within residues from about 213 to about 235 in FIG. 1 [SEQ ID NO:2]. Third, the intracellular domain was identified within residues from about 236 to about 428 in FIG. 1 [SEQ ID NO:2]. Importantly, the intracellular domain includes a death domain at residues from about 353 to about 419. Further preferred fragments of the polypeptide shown in FIG. 1 [SEQ ID NO:2] include the mature protein from residues about 36 to about 428 and soluble polypeptides comprising all or part of the extracellular and intracellular domains but lacking the transmembrane domain. The present inventors have also discovered that the DR3 polypeptide is a 417 residue protein exhibiting three main structural domains. First, the ligand binding domain was identified within residues from about 25 to about 201 in FIG. 2 [SEQ ID NO:4]. Second, the transmembrane domain was identified within residues from about 202 to about 224 in FIG. 2 [SEQ ID NO:4]. Third, the intracellular domain was identified within residues from about 225 to about 417 in FIG. 2 [SEQ ID NO:4]. Importantly, the intracellular domain includes a death domain at residues from about 342 to about 408. Further preferred fragments of the polypeptide shown in FIG. 2 [SEQ ID NO:4] include the mature protein from residues about 25 to about 417 and soluble polypeptides comprising all or part of the extracellular and intracellular domains but lacking the transmembrane domain. As one of skill in the art will recognize, the full length polypeptides encoded by the DR3-V1 and DR3 cDNA differ only in the amino acid sequence of the leader peptide. The first 24 amino acids of the polypeptide shown in Figure 1 are replaced by the first 13 amino acids shown in Figure 2 but the rest of the amino acid sequence is the same. Thus, both the DR3-V1 cDNA and DR3 cDNA encode an identical mature protein having the same biological activity.
Thus, the invention further provides DR3-V1 or DR3 polypeptides encoded by the deposited cDNA clones including the leader and DR3-V1 or DR3 polypeptide fragments selected from the mature protein, the extracellular domain, the transmembrane domain, the intracellular domain, and the death domain.
In another aspect, the invention provides a peptide or polypeptide comprising an epitope-bearing portion of a polypeptide described herein. The epitope of this polypeptide portion is an immunogenic or antigenic epitope of a polypeptide of the invention. An "immunogenic epitope" is defined as a part of a protein that elicits an antibody response when the whole protein is the immunogen. On the other hand, a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." The number of immunogenic epitopes of a protein generally is less than the number of antigenic epitopes. See, for instance, Geysen et al, Proc. Natl. Acad. Sci. USA 57:3998- 4002 (1983). As to the selection of peptides or polypeptides bearing an antigenic epitope (i.e., that contain a region of a protein molecule to which an antibody can bind), it is well known in that art that relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, for instance, Sutcliffe, J. G.,
Shinnick, T. M., Green, N. and Learner, R.A. (1983) Antibodies that react with predetermined sites on proteins. Science 219:660-666. Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence of a protein, can be characterized by a set of simple chemical rules, and are confined neither to immunodominant regions of intact proteins (i.e., immunogenic epitopes) nor to the amino or carboxyl terminals.
Antigenic epitope-bearing peptides and polypeptides of the invention are therefore useful to raise antibodies, including monoclonal antibodies, that bind specifically to a polypeptide of the invention. See, for instance, Wilson et al, Cell 37:161-118 (1984) at 777.
Antigenic epitope-bearing peptides and polypeptides of the invention preferably contain a sequence of at least seven, more preferably at least nine and most preferably between at least about 15 to about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention. Non-limiting examples of antigenic polypeptides or peptides that can be used to generate DR3-specific antibodies include: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 196 to about 205 in Figure 1 (SEQ ID NO:2). In additon, antigenic polypeptides or peptides include polypeptides comprising the amino acid residues that are the corresponding residues to those polypeptides of DR3-V1 disclosed above. As indicated above, the inventors have determined that the above polypeptide fragments are antigenic regions of the DR3-V1 and DR3 protein.
The epitope-bearing peptides and polypeptides of the invention may be produced by any conventional means. Houghten, R.A., "General method for the rapid solid-phase synthesis of large numbers of peptides: specificity of antigen-antibody interaction at the level of individual amino acids," Proc. Natl. Acad. Sci. USA 52:5131-5135 (1985). This "Simultaneous Multiple Peptide
Synthesis (SMPS)" process is further described in U.S. Patent No. 4,631,211 to Houghten et al. (1986).
As one of skill in the art will appreciate,DR3-Vl or DR3 polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with parts of the constant domain of immunoglobulins (IgG), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins (EPA 394,827; Traunecker et al, Nature 557:84-
86 (1988)). Fusion proteins that have a disulfide-linked dimeric structure due to the IgG part can also be more efficient in binding and neutralizing other molecules than the monomeric DR3-V 1 or DR3 protein or protein fragment alone (Fountoulakis et al, J Biochem 270:3958-3964 (1995)).
Polypeptide assays
The present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of DR3-V1 or DR3 protein, or the soluble form thereof, in cells and tissues, including determination of normal and abnormal levels. Thus, for instance, a diagnostic assay in accordance with the invention for detecting over-expression of DR3-V1 or DR3, or soluble form thereof, compared to normal control tissue samples may be used to detect the presence of tumors, for example. Assay techniques that can be used to determine levels of a protein, such as an DR3 protein of the present invention, or a soluble form thereof, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
Assaying DR3-V1 or DR3 protein levels in a biological sample can occur using any art-known method. Preferred for assaying DR3-V1 or DR3 protein levels in a biological sample are antibody-based techniques. For example,DR3-
VI or DR3 protein expression in tissues can be studied with classical immunohistological methods. (Jalkanen, M., et al, J. Cell. Biol 7(97:976-985 (1985); Jalkanen, M., et al, J. Cell . Biol. 705:3087-3096 (1987)).
Other antibody-based methods useful for detecting DR3-V1 or DR3 protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable labels are known in the art and include enzyme labels, such as glucose oxidase, radioisotopes, such as iodine (125I, 121I), carbon (l4C), sulphur (35S), tritium (3H), indium (l l2In), and technetium (9 mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
Therapeutics
The Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes (Goeddel, D. V . et al. , "Tumor Necrosis
Factors: Gene Structure and Biological Activities," Symp. Quant. Biol. 57:597- 609 (1986), Cold Spring Harbor; Beutler, B., and Cerami, A., Annu. Rev. Biochem. 57:505-518 (1988); Old, L.J., Sci. Am. 258:59-15 (1988); Fiers, W., FEBS Lett. 255:199-224 (1991)). The TNF-family ligands induce such various cellular responses by binding to TNF-family receptors, including the DR3-V1 or DR3 of the present invention. Cells which express the DR3-V1 or DR3 polypeptide and are believed to have a potent cellular response to DR3-V1 or DR3 ligands include lymphocytes, fibroblasts, macrophages, synovial cells, activated T-cells, lymphoblasts and epithelial cells. By "a cellular response to a
TNF-family ligand" is intended any genotypic, phenotypic, and/or morphologic change to a cell, cell line, tissue, tissue culture or patient that is induced by a TNF-family ligand. As indicated, such cellular responses include not only normal physiological responses to TNF-family ligands, but also diseases associated with increased apoptosis or the inhibition of apoptosis. Apoptosis- programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes (Ameisen, J.C, AXDS 5: 1197- 1213 (1994); Krammer, P.H. et al, Curr. Opin. Immunol 6:219-289 (1994)). Diseases associated with increased cell survival, or the inhibition of apoptosis, include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, such as breast cancer, prostrate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as systemic lupus erythematosus and immune-related glomerulonephritis rheumatoid arthritis) and viral infections (such as heφes viruses, pox viruses and adenoviruses), information graft v. host disease, acute graft rejection, and chronic graft rejection. Diseases associated with increased apoptosis include AIDS; neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration); myelodysplastic syndromes (such as aplastic anemia), ischemic injury (such as that caused by myocardial infarction, stroke and reperfusion injury), toxin- induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia.
Thus, in one aspect, the present invention is directed to a method for enhancing apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the DR3-V1 or DR3 polypeptide an effective amount of DR3-V1 or DR3 ligand, analog or an agonist capable of increasing DR3-V1 or DR3 mediated signaling. Preferably, DR3-V1 or DR3 mediated signaling is increased to treat a disease wherein decreased apoptosis or decreased cytokine and adhesion molecule expression is exhibited. An agonist can include soluble forms of DR3-V1 or DR3 and monoclonal antibodies directed against the DR3-V1 or DR3 polypeptide.
In a further aspect, the present invention is directed to a method for inhibiting apoptosis induced by a TNF-family ligand, which involves administering to a cell which expresses the, DR3-V1 or DR3 polypeptide an effective amount of an antagonist capable of decreasing DR3-V1 or DR3 mediated signaling. Preferably, DR3-V1 or DR3 mediated signaling is decreased to treat a disease wherein increased apoptosis or NFkB expression is exhibited. An antagonist can include soluble forms of DR3-V1 or DR3 and monoclonal antibodies directed against the DR3-V1 or DR3 polypeptide. By "agonist" is intended naturally occurring and synthetic compounds capable of enhancing or potentiating apoptosis. By "antagonist" is intended naturally occurring and synthetic compounds capable of inhibiting apoptosis. Whether any candidate "agonist" or "antagonist" of the present invention can enhance or inhibit apoptosis can be determined using art-known TNF-family ligand/receptor cellular response assays, including those described in more detail below.
One such screening procedure involves the use of melanophores which are transfected to express the receptor of the present invention. Such a screening technique is described in PCT WO 92/01810, published February 6, 1992. Such an assay may be employed, for example, for screening for a compound which inhibits (or enhances) activation of the receptor polypeptide of the present invention by contacting the melanophore cells which encode the receptor with both a TNF-family ligand and the candidate antagonist (or agonist). Inhibition or enhancement of the signal generated by the ligand indicates that the compound is an antagonist or agonist of the ligand/receptor signaling pathway. Other screening techniques include the use of cells which express the receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science 246:181-296 (October 1989). For example, compounds may be contacted with a cell which expresses the receptor polypeptide of the present invention and a second messenger response, e.g., signal transduction or pH changes, may be measured to determine whether the potential compound activates or inhibits the receptor.
Another such screening technique involves introducing RNA encoding the receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with the receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of screening for compounds which are thought to inhibit activation of the receptor. Another screening technique involves expressing in cells a construct wherein the receptor is linked to a phospholipase C or D. Such cells include endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The screening may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase signal.
Another method involves screening for compounds which inhibit activation of the receptor polypeptide of the present invention antagonists by determining inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding the receptor such that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited. Further screening assays for agonist and antagonist of the present invention are described in Tartaglia, L.A., and Goeddel, D.V., J. Biol. Chem. 267(7) :4304-4307( 1992).
Thus, in a further aspect, a screening method is provided for determining whether a candidate agonist or antagonist is capable of enhancing or inhibiting a cellular response to a TNF-family ligand. The method involves contacting cells which express the DR3-V1 or DR3 polypeptide with a candidate compound and a TNF-family ligand, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made with the ligand in absence of the candidate compound, whereby an increased cellular response over the standard indicates that the candidate compound is an agonist of the ligand/receptor signaling pathway and a decreased cellular response compared to the standard indicates that the candidate compound is an antagonist of the ligand/receptor signaling pathway. By "assaying a cellular response" is intended qualitatively or quantitatively measuring a cellular response to a candidate compound and/or a TNF-family ligand (e.g., determining or estimating an increase or decrease in T cell proliferation or tritiated thymidine labeling). By the invention, a cell expressing the DR3-V1 or DR3 polypeptide can be contacted with either an endogenous or exogenously administered TNF- family ligand.
Agonist according to the present invention include naturally occurring and synthetic compounds such as, for example, TNF family ligand peptide fragments, transforming growth factor β, neurotransmitters (such as glutamate, dopamine, N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells and antimetabolites. Preferred agonist include chemotherapeutic drugs such as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside, nitrogen mustard, methotrexate and vincristine. Others include ethanol and β-amyloid peptide. (Science 267:1457-1458 (1995)). Further preferred agonist include polyclonal and monoclonal antibodies raised against the DR3-V1 or DR3 polypeptide. or a fragment thereof. Such agonist antibodies raised against a TNF- family receptor are disclosed in Tartaglia, L.A., et al, Proc. Natl. Acad. Sci. USA 55:9292-9296 (1991); and Tartaglia, L.A., and Goeddel, D.V., J. Biol Chem. 267 (7):4304-4307 (1992) See, also, PCT Application WO 94/09137.
Antagonist according to the present invention include naturally occurring and synthetic compounds such as, for example, the CD40 ligand, neutral amino acids, zinc, estrogen, androgens, viral genes (such as Adenovirus EIB,
Baculovirus p35 and IAP, Cowpox virus crmA, Epstein-Barr virus BHRF1, LMP-I, African swine fever virus LMW5-HL, and Herpesvirus yl 34.5), calpain inhibitors, cysteine protease inhibitors, and tumor promoters (such as PMA, Phenobarbital, and α-Hexachlorocyclohexane). Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al, Nucleic Acids
Research 6:3013 (1979); Cooney et al, Science 247:456 (1988); and Dervan et al, Science 257:1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense
RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the receptor.
Further antagonist according to the present invention include soluble forms of DR3-V 1 or DR3, i.e.,DR3-V 1 or DR3 fragments that include the ligand binding domain from the extracellular region of the full length receptor. Such soluble forms of the receptor, which may be naturally occurring or synthetic, antagonize DR3-V1 or DR3 mediated signaling by competing with the cell surface DR3-V1 or DR3 for binding to TNF-family ligands. Thus, soluble forms of the receptor that include the ligand binding domain are novel cytokines capable of inhibiting apoptosis induced by TNF-family ligands. These are preferably expressed as dimers or trimers, since these have been shown to be superior to monomeric forms of soluble receptor as antagonists, e.g., IgGFc-TNF receptor family fusions. Other such cytokines are known in the art and include Fas B (a soluble form of the mouse Fas receptor) that acts physiologically to limit apoptosis induced by Fas ligand (Hughes, D.P. and Crispe, I.N., J. Exp. Med.
752:1395-1401 (1995)).
The experiments set forth in Examples 6 and 7 demonstrate that DR3 is a death domain-containing molecule capable of triggering both apoptosis and NF-kB activation, two pathways dominant in the regulation of the immune system. The experiments also demonstrate the internal signal transduction machinery of this novel cell death receptor. In addition, the experiments set forth below demonstrate that DR3 -induced apoptosis was blocked by the inhibitors of ICE-like proteases, CrmA and z-VAD-fmk. Importantly, apoptosis induced by DR3 was also blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHal C360S), which were previously shown to inhibit death signaling by Fas/APO-1 and TNFR-1. Thus, inhibitors of ICE-like proteases, FADD-DN and FLICE-DN MACHal C360S could also be used as antagonists for DR3 activity.
The term "antibody" (Ab) or "monoclonal antibody" (mAb) as used herein is meant to include intact molecules as well as fragments thereof (such as, for example, Fab and F(ab')2 fragments) which are capable of binding an antigen. Fab and F (ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding of an intact antibody (Wahl et al, J. Nucl. Med. 24:316-325 (1983)). Antibodies according to the present invention may be prepared by any of a variety of methods using DR3-V1 or DR3 immunogens of the present invention. As indicated, such DR3-V1 or DR3 immunogens include the full length DR3-V1 or DR3 polypeptide (which may or may not include the leader sequence) and DR3-V1 or DR3 polypeptide fragments such as the ligand binding domain, the transmembrane domain, the intracellular domain and the death domain.
Proteins and other compounds which bind the DR3-V1 or DR3 domains are also candidate agonist and antagonist according to the present invention. Such binding compounds can be "captured" using the yeast two-hybrid system (Fields and Song, Nature 540:245-246 (1989)). A modified version of the yeast two-hybrid system has been described by Roger Brent and his colleagues (Gyuris,
J. et al, Cell 75:791-803 (1993); Zervos, A.S. et al, Cell 72:223-232 (1993)). Preferably, the yeast two-hybrid system is used according to the present invention to capture compounds which bind to either the DR3-V1 or DR3 ligand binding domain or to the DR3-V1 or DR3 intracellular domain. Such compounds are good candidate agonist and antagonist of the present invention.
By a "TNF-family ligand" is intended naturally occurring, recombinant, and synthetic ligands that are capable of binding to a member of the TNF receptor family and inducing the ligand/receptor signaling pathway. Members of the TNF ligand family include, but are not limited to, the DR3-V1 or DR3 ligand, TNF-α, lymphdtoxin-α (LT-α, also known as TNF-β), LT-β (found in complex heterotrimer LT-α2-β), FasL, CD40, CD27, CD30, 4-1BB, OX40 and nerve growth factor (NGF).
Representative therapeutic applications of the present invention are discussed in-more detail below. The state of immunodeficiency that defines AIDS is secondary to a decrease in the number and function of CD4+
T-lymphocytes. Recent reports estimate the daily loss of CD4+ T cells to be between 3.5 X 107 and 2 X IO9 cells (Wei X., et al, Nature 575:117-122 (1995)). One cause of CD4+ T cell depletion in the setting of HIV infection is believed to be HIV-induced apoptosis. Indeed, HIV-induced apoptotic cell death has been demonstrated not only in vitro but also, more importantly, in infected individuals
(Ameisen, J.C, AIDS 5: 1197- 1213 (1994) ; Finkel, T.H., and Banda, N.K., Curr. Opin. Immunol. 6:605-615(1995); Muro-Cacho, CA. et al, J. Immunol. 754:5555-5566 (1995)). Furthermore, apoptosis and CD4+ T-lymphocyte depletion is tightly correlated in different animal models of AIDS (Brunner, T., et al, Nature 575:441-444 (1995); Gougeon, M.L., et al, AIDS Res. Hum. Retroviruses 9:553-563 (1993)) and, apoptosis is not observed in those animal models in which viral replication does not result in AIDS (Gougeon, M.L. et al, AIDS Res. Hum. Retroviruses 9:553-563 (1993)). Further data indicates that uninfected but primed or activated T lymphocytes from HIV-infected individuals undergo apoptosis after encountering the TNF-family ligand FasL. Using monocytic cell lines that result in death following HIV infection, it has been demonstrated that infection of U937 cells with HIV results in the de novo expression of FasL and that FasL mediates HIV-induced apoptosis (Badley, A.D. et al, J. Virol. 70: 199-206 (1996)). Further the TNF-family ligand was detectable in uninfected macrophages and its expression was upregulated following HIV infection resulting in selective killing of uninfected CD4
T-lymphocytes (Badley, A.D et al, J. Virol. 70:199-206 (1996)). Thus, by the invention, a method for treating HIV+ individuals is provided which involves administering an antagonist of the present invention to reduce selective killing of CD4 T-lymphocytes. Modes of administration and dosages are discussed in detail below.
In rejection of an allograft, the immune system of the recipient animal has not previously been primed to respond because the immune system for the most part is only primed by environmental antigens. Tissues from other members of the same species have not been presented in the same way that, for example, viruses and bacteria have been presented. In the case of allograft rejection, immunosuppressive regimens are designed to prevent the immune system from reaching the effector stage. However, the immune profile of xenograft rejection may resemble disease recurrence more that allograft rejection. In the case of disease recurrence, the immune system has already been activated, as evidenced by destruction of the native islet cells. Therefore, in disease recurrence the immune system is already at the effector stage. Agonist of the present invention are able to suppress the immune response to both allografts and xenografts because lymphocytes activated and differentiated into effector cells will express the DR3-V1 or DR3 polypeptide, and thereby are susceptible to compounds which enhance apoptosis. Thus, the present invention further provides a method for creating immune privileged tissues. Antagonist of the invention can further be used in the treatment of Inflammatory Bowel-Disease.
DR3, like TNFR1, also activates the NF-kB transcription factor, which is very closely associated with the stimulation of cytokine (e.g., IL-8) and adhesion molecule (e.g., ELAM) transcription. Hence, like TNF, the ligand (or agonist) for DR3 and DR3-V1 may in some circumstances be proinflammatory, and antagonists may be useful reagents for blocking this response. Thus, DR3 and DR3-V1 antagonists may be useful for treating inflammatory diseases, such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and inflammatory bowel disease. In addition, due to lymphoblast expression of DR3, soluble DR3, agonist or antagonist mABs may be used to treat this form of cancer. Further, soluble DR3 or neutralizing mABs may be used to treat various chronic and acute forms of inflammation such as rheumatoid arthritis, osteoarthritis, psoriasis, septicemia, and inflammatory bowel disease.
Modes of Administration
The agonist or antagonists described herein can be administered in vitro, ex vivo, or in vivo to cells which express the receptor of the present invention. By administration of an "effective amount" of an agonist or antagonist is intended an amount of the compound that is sufficient to enhance or inhibit a cellular response to a TNF-family ligand and include polypeptides. In particular, by administration of an "effective amount" of an agonist or antagonists is intended an amount effective to enhance or inhibit DR3-V1 or DR3 mediated apoptosis. Of course, where apoptosis is to be enhanced, an agonist according to the present invention can be co-administered with a TNF-family ligand. One of ordinary skill will appreciate that effective amounts of an agonist or antagonist can be determined empirically and may be employed in pure form or in pharmaceutically acceptable salt, ester or prodrug form. The agonist or antagonist may be administered in compositions in combination with one or more pharmaceutically acceptable excipients.
It will be understood that, when administered to a human patient, the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgement. The specific therapeutically effective dose level for any particular patient will depend upon factors well known in the medical arts.
As a general proposition, the total pharmaceutically effective amount of DDCR polypeptide administered parenterally per dose will be in the range of about 1 μg/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the DDCR agonists or antagonists is typically administered at a dose rate of about 1 μg/kg/hour to about 50 μg/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
Dosaging may also be arranged in a patient specific manner to provide a predetermined concentration of an agonist or antagonist in the blood, as determined by the RIA technique. Thus patient dosaging may be adjusted to achieve regular on-going trough blood levels, as measured by RIA, on the order of from 50 to 1000 ng/ml, preferably 150 to 500 ng/ml.
Pharmaceutical compositions are provided comprising an agonist or antagonist and a pharmaceutically acceptable carrier or excipient, which may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray. Importantly, by co-administering an agonist and a TNF-family ligand, clinical side effects can be reduced by using lower doses of both the ligand and the agonist. It will be understood that the agonist can be "co-administered" either before, after, or simultaneously with the TNF-family ligand, depending on the exigencies of a particular therapeutic application. By "pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
Pharmaceutical compositions of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
In addition to soluble DR3-V1 or DR3 polypeptides, DR3-V1 or DR3 polypeptide containing the transmembrane region can also be used when appropriately solubilized by including detergents, such as CHAPS or NP-40, with buffer.
Example I
Expression and Purification in E. coll
The DNA sequence encoding the mature DR3-V 1 protein in the deposited cDNA clone (ATCC No. 97456) is amplified using PCR oligonucleotide primers specific to the amino terminal sequences of the DR3-V1 protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively. The following primers are used for expression of DR3 extracellular domain in E. coli 5' primer 5'-GCGCCATGGGGGCCCGGCGGCAG-3' (SEQ ID NO:7) contains an Ncol site and 15 nucleotide starting from 290 nucleotide to 304 FIG. 1. 3* primer S'-GCGAAGCnCTAGGACCCAGAACATCTGCC 1 (SEQ ID NO:8) contains a Hindili site, a stop codon and 18 nucleotides complimentary to nucleotide from 822 to 840 in FIG. 1. Vector is pQE60. The protein is not tagged.
The restriction sites are convenient to restriction enzyme sites in the bacterial expression vector pQE60, which are used for bacterial expression in these examples. (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 9131 1). pQE60 encodes ampicillin antibiotic resistance (" Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site ("RBS").
The amplified DR3-V1 DNA and the vector pQE60 both are digested with Nco I and Hindili and the digested DNAs are then ligated together. Insertion of the DDCR protein DNA into the restricted pQE60 vector places the DR3-V1 protein coding region downstream of and operably linked to the vector's IPTG- inducible promoter and in-frame with an initiating AUG appropriately positioned for translation of DR3- VI protein. The ligation mixture is transformed into competent E. coli cells using standard procedures. Such procedures are described in Sambrook et al, Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989). E. coli strain M15/rep4, containing multiple copies of the plasmid pREP4, which expresses lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative example described herein. This strain, which is only one of many that are suitable for expressing DR3-V1 protein, is available commercially from Qiagen.
Transformants are identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis.
Clones containing the desired constructs are grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 μg/ml) and kanamycin (25 μg/ml).
The O/N culture is used to inoculate a large culture, at a dilution of approximately 1 : 100 to 1 :250. The cells are grown to an optical density at 600nm
("OD600") of between 0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside ("IPTG") is then added to a final concentration of 1 mM to induce transcription from lac repressor sensitive promoters, by inactivating the lacl repressor. Cells subsequently are incubated further for 3 to 4 hours. Cells then are harvested by centrifugation and disrupted, by standard methods. Inclusion bodies are purified from the disrupted cells using routine collection techniques, and protein is solubilized from the inclusion bodies into 8M urea. The 8M urea solution containing the solubilized protein is passed over a PD-10 column in 2X phosphate-buffered saline ("PBS"), thereby removing the urea, exchanging the buffer and refolding the protein. The protein is purified by a further step of chromatography to remove endotoxin. Then, it is sterile filtered. The sterile filtered protein preparation is stored in 2X PBS at a concentration of 95 μ/ml.
Example 2
Expression in Mammalian Cells
Most of the vectors used for the transient expression of a given gene sequence in mammalian cells carry the SV40 origin of replication. This allows the replication of the vector to high copy numbers in cells (e.g. COS cells) which express the T antigen required for the initiation of viral DNA synthesis. Any other mammalian cell line can also be utilized for this purpose.
A typical mammalian expression vector contains the promoter element, which mediates the initiation of transcription of mRNA, the protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription can be achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g. RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, also cellular signals can be used (e.g. human actin, promoter). Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146) and pBC12MI (ATCC67109). Mammalian host cells that could be used include, human Hela, 283, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1 African green monkey cells, quail QC1-3 cells, mouse L cells and Chinese hamster ovary cells such as
Altematively, a gene of interest can be expressed in stable cell lines that contain the gene integrated into a chromosome. The co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells. The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) is a useful marker to develop cell lines that carry several hundred or even several thousand copies of the gene of interest. Using this marker, the mammalian cells are grown in increasing amounts of methotrexate for selection and the cells with the highest resistance are selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) cells are often used for the production of proteins.
The expression vectors pCl and pC4 contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al, Molecular and Cellular Biology 438:44701 (March 1985)), plus a fragment of the CMV-enhancer (Boshart et al,
Cell 47:521-530 (1985)). Multiple cloning sites, e.g. with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of the gene of interest. The vectors contain in addition the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene.
Example 2 A
Expression of extracellular soluble domain ofDR3-Vl andDR3 in COS cells
The expression plasmid, pDR3-Vl HA, is made by cloning a cDNA encoding DR3-V1 (ATCC No. 97456) into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen, Inc.). Expression plasmid, pDR3 HA, is made by cloning a cDNA encoding DR3 (ATCC No. ) into the expression vector pcDN AI/Amp
The expression vector pcDNAI/amp contains: (1) an E. coli origin of replication effective for propagation in E. coli and other prokaryotic cell; (2) an ampicillin resistance gene for selection of plasmid-containing prokaryotic cells;
(3) an SV40 origin of replication for propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40 intron, and a polyadenylation signal arranged so that a cDNA conveniently can be placed under expression control of the CMV promoter and operably linked to the SV40 intron and the polyadenylation signal by means of restriction sites in the polylinker.
A DNA fragment encoding the entire DR3-V 1 or Dr3 precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector so that recombinant protein expression is directed by the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein described by Wilson et al, Cell 37:161 (1984). The fusion of the HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction sfrategy is as follows:
The DR3-V1 or DR3 cDNA of the deposit clone is amplified using primers that contained convenient restriction sites, much as described above regarding the construction of expression vectors for expression of DR3-V1 or DR3 in E. coli and S. fugiperda.
To facilitate detection, purification and characterization of the expressed DR3-V1 or DR3, one of the primers contains a hemagglutinin tag ("HA tag") as described above.
Suitable primers for DR3-V1 include the following, which are used in this e x a m p l e , t h e 5 ' p r i m e r , 5 '
CGCGGATCCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO:9) contains the underlined BamHI site, an ATG start codon and 5 codons thereafter. Suitable primers for DR3 include the following, which are used in this e x a m p l e , t h e 5 ' p r i m e r , 5 ' CGCGHAIGCGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO: 10) contains the underlined BamHI site, an ATG start codon and 5 codons thereafter.
The 3' primer for both DR3 and DR3-V1 , containing the underlined Xbal site, stop codon, hemagglutinin tag and last 14 nucleotide of 3' coding sequence (at the 3' end) has the following sequence:
5'GCGTCTAGATCAAAGCGTAGTCTGGGACGTCGTATGGGTACGGGC CGCGCTGCA 3' (SEQ ID NO:l 1).
The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with BamHI and Xbal and then ligated. The ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning
Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates which then are incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is isolated from resistant colonies and examined by restriction analysis and gel sizing for the presence of the DR3-V1 or DR3 -encoding fragment.
For expression of recombinant DR3-V 1 or DR3, COS cells are transfected with an expression vector, as described above, using DEAE-DEXTRAN, as described, for instance, in Sambrook et al, Molecular Cloning: a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor. NY (1989). Cells are incubated under conditions for expression of DR3-V 1 or DR3 by the vector.
Expression of the DR3-V1 HA fusion protein or the DR3 HA fusion protein is detected by radiolabelling and immunoprecipitation, using methods described in, for example Harlow et al, Antibodies: a Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY ( 1988). To this end, two days after transfection, the cells are labeled by incubation in media containing 35S -cysteine for 8 hours. The cells and the media are collected, and the cells are washed and then lysed with detergent-containing RIP A buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as described by Wilson et al. cited above. Proteins are precipitated from the cell lysate and from the culture media using an HA-specific monoclonal antibody. The precipitated proteins then are analyzed by SDS-PAGE gels and autoradiography. An expression product of the expected size is seen in the cell lysate, which is not seen in negative controls.
Example 2B
Expression and purification of human DR3-V1 and DR3 using the CHO
Expression System
The vector pC 1 is used for the expression of DR3-V 1 or DR3 (ATCC No.
97456 or ATCC No. , respectively) protein. Plasmid pCl is a derivative of the plasmid pSV2-dhfr [ATCC Accession No. 37146]. Both plasmids contain the mouse DHFR gene under control of the SV40 early promoter. Chinese hamster ovary- or other cells lacking dihydrofolate activity that are transfected with these plasmids can be selected by growing the cells in a selective medium (alpha minus MEM, Life Technologies) supplemented with the chemotherapeutic agent methotrexate. The amplification of the DHFR genes in cells resistant to methotrexate (MTX) has been well documented (see, e.g., Alt, F.W., Kellems,
R.M., Bertino, J.R., and Schimke, R.T., 1978, J. Biol. Chem. 253:1357-1370, Hamlin, J.L. and Ma, C. 1990, Biochem. et Biophys. Acta, 1097:107-143, Page, M.J. and Sydenham, M.A. 1991, Biotechnology Vol. 9:64-68). Cells grown in increasing concentrations of MTX develop resistance to the drug by overproducing the target enzyme, DHFR, as a result of amplification of the
DHFR gene. If a second gene is linked to the DHFR gene it is usually co- amplified and over-expressed. It is state of the art to develop cell lines carrying more than 1 ,000 copies of the genes. Subsequently, when the methotrexate is withdrawn, cell lines contain the amplified gene integrated into the chromosome(s).
Plasmid pCl contains for the expression of the gene of interest a strong promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al, Molecular and Cellular Biology, March 1985:438-4470) plus a fragment isolated from the enhancer of the immediate early gene of human cytomegalovirus (CMV) (Boshart et al. , Cell 41 :521 -530, 1985). Downstream of the promoter are the following single restriction enzyme cleavage sites that allow the integration of the genes: BamHI followed by the 3 ' intron and the polyadenylation site of the rat preproinsulin gene. Other high efficient promoters can also be used for the expression, e.g., the human β-actin promoter, the SV40 early or late promoters or the long terminal repeats from other retroviruses, e.g., HTV and HTLVI. For the polyadenylation of the mRNA other signals, e.g., from the human growth hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated into the chromosomes can also be selected upon co-transfection with a selectable marker such as gpt, G418 or hygromycin. It is advantageous to use more than one selectable marker in the beginning, e.g., G418 plus methotrexate.
The plasmid pC 1 is digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphates by procedures known in the art. The vector is then isolated from a 1% agarose gel.
The DNA sequence encoding DR3-V1 or DR3 in the deposited cDNA clones are amplified using PCR oligonucleotide primers specific to the amino acid carboxyl terminal sequence of the DR3-V1 or DR3 protein and to vector sequences 3' to the gene. Additional nucleotides containing restriction sites to facilitate cloning are added to the 5' and 3' sequences respectively.
The 5' oligonucleotide primer for DR3-V1 has the sequence 5' CGCC^iΔICCGCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO: 12) containing the underlined BamHI restriction site, which encodes a start AUG, followed by the Kozak sequence ad 18 nucleotides of the DR3-V1 coding sequence set out in FIG. 1 beginning with the 1st base of the ATG codon.
The 5' oligonucleotide primer for DR3 has the sequence 5' CGCQGΔUXGCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO: 13) containing the underlined BamHI restriction site, which encodes a start AUG, followed by the Kozak sequence ad 18 nucleotides of the DR3 coding sequence set out in FIG. 2 beginning with the 1st base of the ATG codon. The 3' primer for both DR3 and DR3-V1 has the sequence 5' CGCGϋΔITXTCACGGGCCGCGCTGCA 3' (SEQ ID NO: 14) containing the underlined BamHI restriction site followed by 17 nucleotides complementary to the last 14 nucleotides of the DR3-V1 or DR3 coding sequence set out in FIG. 1 or FIG. 2, respectively, plus the stop codon.
The restrictions sites are convenient to restriction enzyme sites in the CHO expression vectors pC 1.
The amplified DR3 or DR3-V1 DNA and the vector pCl both are digested with BamHI and the digested DNAs then ligated together. Insertion of the DR3- VI or DR3 DNA into the BamHI restricted vector placed the DR3-V1 or DR3 coding region downstream of and operably linked to the vector's promoter. The sequence of the inserted gene is confirmed by DNA sequencing.
Transfection of CHO-DHFR-cells
Chinese hamster ovary cells lacking an active DHFR enzyme are used for transfection. 5 μg of the expression plasmid C 1 are cofransfected with 0.5 μg of the plasmid pSVneo using the lipofecting method (Feigner et al, supra). The plasmid pSV2-neo contains a dominant selectable marker, the gene neo from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including
G418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) and cultivated from 10-14 days. After this period, single clones are trypsinized and then seeded in 6-well petri dishes using different concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM).
Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (500 nM, 1 μM, 2 μM, 5 μM). The same procedure is repeated until clones grow at a concentration of 100 μM.
The expression of the desired gene product is analyzed by Western blot analysis and SDS-PAGE. Example 3
Cloning and expression of the soluble extracellular domain ofDR3-VI and DR3 in a baculovirus expression system
The cDNA sequence encoding the soluble extracellular domain of DR3- VI or DR3 protein in the deposited clone (ATCC No. 97456 or ATCC No. , respectively) is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:
The 5' primer for DR3-V1 has the sequence 5' CGCGGATCC GCCATCATGGAGGAGACGCAGCAG 3' (SEQ ID NO: 15) containing the underlined BamHI restriction enzyme site followed by Kozak sequence and a number of bases of the sequence of DR3-V1 of FIG. 1. Inserted into an expression vector, as described below, the 5' end of the amplified fragment encoding DR3-V1 provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol 796:947-950 (1987) is appropriately located in the vector portion of the construct.
The 5' primer for DR3 has the sequence 5' CGCGGATCC GCCATCATGGAGCAGCGGCCGCGG 3' (SEQ ID NO: 16) containing the underlined BamHI restriction enzyme site followed by Kozak sequence and a number of bases of the sequence of DR3 of FIG. 2. Inserted into an expression vector, as described below, the 5' end of the amplified fragment encoding DR3 provides an efficient signal peptide. An efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J Mol Biol 196:941- 950 (1987) is appropriately located in the vector portion of the construct. The 3' primer for both DR3 and DR3-V1 has the sequence 5'
GCGAG TCIAGTCTGGACCC AGAACATCTGCCTCC 3* (SEQ ID NO: 17) containing the underlined Xbal resttiction followed by nucleotides complementary to the DR3-V1 or DR3 nucleotide sequence set out in FIG. 1 or FIG.2, respectively, followed by the stop codon. The amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean, " BIO 101 Inc., La Jolla, Ca.) The fragment then is digested with BamHI and Asp718 and again is purified on a 1% agarose gel. This fragment is designated herein F2. The vector pA2 is used to express the DR3-V1 or DR3 protein in the baculovirus expression system, using standard methods, such as those described in Summers et al, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987). This expression vector contains the strong polyhedron promoter of the Autograph califomica nuclear polyhedrosis virus (ACMNPV) followed by convenient restriction sites. For an easy selection of recombinant virus the beta- galactosidase gene from E. coli is inserted in the same orientation as the polyhedron promoter and is followed by the polyadenylation signal of the polyhedron gene. The polyhedron sequences are flanked at both sides by viral sequences for cell-mediated homologous recombination with wild-type viral
DNA to generate viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in "lace of pA2, such as pAc373, pVL941 and pAcIMl provided, as those of skul readily will appreciate, that construction provides appropriately located signals for transcription, translation, trafficking and the like, such as an in-frame AUG and a signal peptide, as required. Such vectors are described in Luckow et al, Virology 170:31-39, among others.
The plasmid is digested with the restriction enzymes Bam HI and Xbal and then is dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated herein "V2".
Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4 DNA ligase. E. coli HB101 cells are transformed with ligation mix and spread on culture plates. Bacteria are identified that contain the plasmid with the human DDCR gene by digesting DNA from individual colonies using BamHI and Xbal and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing. This plasmid is designated herein pBac DR3-V1 or pBac DR3.
5 μg of the plasmid pBac DR3-V1 or pBac DR3 is co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA.), using the lipofection method described by Feigner et al, Proc. Natl. Acad. Sci. USA 54:7413-7417 (1987). 1 μg of BaculoGold™ virus DNA and 5 μg of the plasmid pBac DR3-V1 are mixed in a sterile well of a microliter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 μl
Lipofectin plus 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27 °C After
5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation is continued at 27° C for four days.
After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, cited above. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
Four days after serial dilution, the virus is added to the cells. After appropriate incubation, blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4°C A clone containing properly inserted DR3-V1 or DR3 is identified by DNA analysis including restriction mapping and sequencing. This is designated herein as V- DR3-V1 or V-DR3. Sf9 cells are grown in Grace's medium supplemented with 10% heat- inactivated FBS. The cells are infected with the recombinant baculovirus V- DR3-V1 at a multiplicity of infection ("MOI") of about 2 (about 1 to about 3). Six hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Gaithersburg). 42 hours later, 5 gCi of 35S-methionine and 5 μCi 35S cysteine
(available from Amersham) are added. The cells are further incubated for 16 hours and then they are harvested by centrifugation, lysed and the labeled proteins are visualized by SDS-PAGE and autoradiography.
Example 4
A. Tissue distribution of DR3-V1 gene expression
Northern blot analysis is carried out to examine DR3-V1 gene (ATCC No. 97456) expression in human tissues, using methods described by, among others, Sambrook et al, cited above. A cDNA probe containing the entire nucleotide sequence of the DR3-V1 protein (SEQ ID NO: 1) is labeled with 32P using the DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN-100™ column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labeled probe is then used to examine various human tissues for DR3-V1 mRNA. Multiple Tissue Northern (MTN) blots containing various human tissues
(H) or human immune system tissues (IM) are obtained from Clontech and are examined with labeled probe using ExpressHyb™ hybridization solution (Clontech) according to manufacturer's protocol number PT1190-1. Following hybridization and washing, the blots are mounted and exposed to film at -70 °C overnight, and films developed according to standard procedures Expression of DR3-V1 was detected in tissues enriched in lymphocytes including peripheral blood leukocytes (PBLs), thymus, spleen, colon, and small intestine. DR3-V1 expression appears to be restricted to lymphocyte compartments, it can be envisaged that DR3-V1 plays a role in lymphocyte homeostasis.
B. Tissue distribution ofDR3 gene expression
Northern blot analysis is carried out to examine DR3 gene (ATCC No. ) expression in human tissues, using methods described by, among others, Sambrook et al, cited above. A cDNA probe containing the entire nucleotide sequence of the DR3 protein (SEQ ID NO:l) is labeled with "P using the re-Λ'prime™ DNA labeling system (Amersham Life Science), according to manufacturer's instructions. After labeling, the probe is purified using a CHROMA SPIN- 100™ column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labeled probe is then used to examine various human tissues for DR3 mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) are obtained from Clontech and are examined with labeled probe using ExpressHyb™ hybridization solution (Clontech) according to manufacturer's protocol number PT1190- 1. Following hybridization and washing, the blots are mounted and exposed to film at -70 °C overnight, and films developed according to standard procedures.
Expression of DR3 was detected in tissues enriched in lymphocytes including peripheral blood leukocytes (PBLs), thymus, spleen, colon, and small intestine. By contrast, TNFR-1 is ubiquitously expressed and Fas/APO-1 is expressed in lymphocytes, liver, heart, lung, kidney, and ovary (Watanabae- Fukunaga, et al, J. Immunol 745:1274-9 (1992)).
DR3 expression appears to be restricted to lymphocyte compartments, it can be envisaged that DR3 plays a role in lymphocyte homeostasis. C. Northern Blot analysis ofDR3 in various cell lines
Methods
Cells
Unless stated otherwise, cell lines were obtained from the American Type Culture Collection (Rockville, MD). The myeloid (Koeffler et al. (1980);
Koeffler (1983); Harris and Ralph (1985); and Tucker et al. (1987) and B-cell lines (Jonak et al. (1922)) studied represent cell types at different stages of the differentiation pathway. KG la and PLB 985 cells (Tucker et al (1987)) were obtained from H.P. Koeffler (UCLA School of Medicine). BJA-B was from Z. Jonak (SmithKline Beecham). TF274, a stromal cell line exhibiting osteoblastic features, was generated from the bone marrow of a healthy male donor (Z. Jonak and K.B. Tan, unpublished). Primary carotid artery endothelial cells were purchased from Clonetics Coφ. (San Diego, CA) and monocytes were prepared by differential centrifugation of peripheral blood mononuclear cells and adhesion to tissue culture dish. CD 19+, CD4+ and CD8+ cells (>90% pure) were isolated with cell type specific immunomagnetic beads (Drynal, Lake Success, NY).
RNA Analysis
Total RNA of adult tissues were purchased from Clonetech (Palo Alto, CA). Total RNA was extracted from cell lines (in exponential growth phase) and primary cells with TriReagent (Molecular Research Center, Inc., Cincinnati, OH).
5 to 7.5 μg of total RNA was fractionated in a 1% agarose gel containing formaldehyde cast in a Wide Mini-Sub Cell gel tray (Bio-Rad, Hercules, CA) as described (Sambrook, et al.) with slight modifications. The formaldehyde concentration was reduced to 0.5M and the RNA was stained prior to electrophoresis with 100 μg/ml of etidium bromide that was added to the loading buffer. After electrophoresis with continuous buffer recirculation (60 volts/90 min), the gel was photographed and the RNA was transferred quantitatively to Zeta-probe nylon membrane (Biorad, Hercules, CA) by vacuum-blotting with 25 mM NaOH for 90 min. After neutralization for 5-10 min, with IM Tris-HCl, pH 7.5 containing 3M NaCl, the blots were prehybridized with 50% formamide, 8% dextran sulfate, 6xSSPE, 0.1 % SDS and 100 μg/ml of sheared and denatured salmon sperm DNA for at least 30 min at 42 °C cDNA inserts labeled with 32P-dCTP by random priming (Stratagene, La Jolla, CA), were denatured with
0.25M NaOH (10 min at 37°C) and added to the prehybridization solution. After 24-65 hr at 42 °C, the blots were washed under high stringency conditions (Sambrook, et al.) and exposed to X-ray films.
Results Expression of DR3 was assessed by Northern blot in the following cell lines: TF274 (bone marrow stromal); MG63, TE85 (osteosarcoma); K562 (erythroid); KGla, KG1, PLB985, HL60, U937, TNHP-1 (myeloid); REH, BJAB, Raji, IM-9 (B cell); Sup-Tl, Jurkat, H9, Molt-3 (T cell); RL95-2 (endometrial carcinoma); MCF-7 (breast cancer); BE, HT29 (colon cancer); IMR32 (neuroblastoma) and could only be detected in KGla cells. DR3 expression was detected in several lymphoblast cell lines. In the purified human hematopoietic cell populations, DR3 was weakly expressed in CD 19+ cells, and more highly expressed in monocytes. However the highest levels were observed in T cells (CD4+ or CD8+) upon stimulation with PMA and PHA, indicating that DR3 probably plays a role in the regulation of T cell activation.
Example 5
Intracellular Signaling Molecules used by DR3 Protein
In vitro and in vivo binding studies were undertaken to investigate DR3 signaling pathways. Since DR3 contains a death domain, the inventors postulated that DR3, like TNFR- 1 and Fas/APO- 1 , may transduce signals by recruiting death domain-containing adapter molecules (DAMs) such as FADD, TRADD, and RIP. Experimental Design
In vitro binding experiments were performed as described previously (A.M. Chinnaiyan, et al, Cell 81, 505-12 (1995); M.P. Boldin, et ai, J Biol Chem 270, 7795-8 (1995); F.C Kischkel, et al, EMBO 14, 5579-5588 (1995)). Briefly, the cytoplasmic domains of DR3 (amino acid residues 215-393 (Figure
2)) and the death domain mutant ΔDR3 (amino acid residues 215-321 (Figure 2)) were amplified by PCR using appropriate templates and primers into pGSTag. pGSTag and pGSTag-TNFR- 1 were described previously (A.M. Chinnaiyan, et al, Cell 81, 505-12 (1995); M.P. Boldin, et al. JBiol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14. 5579-5588 (1995)). GST and GST fusion proteins were prepared from E.coii strain BL21(DE3)pLysS using standard published procedures and the recombinant proteins immobilized onto glutathione- agarose beads. 35S-Labeled FADD, RIP and TRADD were prepared by in vitro transcription-franslation using the TNT or T7 or SP6-coupled reticulocyte lysate system from Promega according to manufacturer's instructions, using pcDNA3
AU1-FADD (A.M. Chinnaiyan, et al. Cell 81, 505-12 (1995); M.P. Boldin, et al, JBiol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14, 5579-5588 (1995)), pRK myc-TRADD (H. Hsu, et al, Cell 81, 495-504 (1995)), or pRK myc-RIP (H. Hsu, et al. Immunity 4, 387-396 (1996)) as template. Following translation, equal amounts of total 35S-labeled reticulocyte lysate were diluted into
150 μl GST binding buffer (50 mM Tris, pH 7.6, 120 mM NaCl, 1% NP-40) and incubated for 2 hrs. at 4°C with the various GST fusion proteins complexed to beads, following the beads were pelleted by plus centrifugation, washed three times in GST buffer, boiled in SDS-sample buffer and resolved on a 12.5%) SDS- PAGE. Bound proteins were visualized following autoradioraphy at -80 °C In vitro translated 35S-labeled RIP, TRADD and FADD were incubated with glutathione beads containing GST alone or GST fusions of the cytoplasmic domain of Fas, TNFR-1.DR3 (215-393), or DDR3 (215-321). After the beads were washed, retained proteins were analyzed by SDS-PAGE and autoradiography. The gel was Coomassie stained to monitor equivalency of loading. To demonstrate the association of DR3 and TRADD in vivo, constructs encoding Flag-TNFR-1 and Flag-ΔTNFR-1 were used. The Flag-TNFR-1 and Flag-ΔTNFR-1 constructs were described elsewhere (A.M. Chinnaiyan, et al, J Biol Chem 271, 4961-4965 (1996)). The constructs encoding Flag-TNFR-1 and Flag-ΔTNFR-1 were described elsewhere (A.M. Chinnaiyan, et al, J Biol Chem
271, 4961-4965 (1996)). To facilitate epitope tagging, DR3 and ΔDR3 (1-321) were cloned into the IBI Kodak FLAG plasmid (pCMVlFLAG) utilizing the signal peptide provided by the vector. 293 cells (2 x lOVlOOmm plate) were grown in DMEM media containing 10% heat-inactivated fetal bovine serum containing penicillin G, streptomycin, glutamine, and non-essential amino acids.
Cells were transfected using calcium phosphate precipitation with the constructs encoding the indicated proteins in combination with pcDNA3-CrmA (M. Tewari, et al, JBiol Chem 270, 3255-60 (1995)) to prevent cell death and thus maintain protein expression. Cells were lysed in 1 ml lysis buffer (50mM Hepes, 150mM NaCl, ImM EDTA, 1% NP-40, and a protease inhibitor cocktail). Lysates were immunoprecipitated with a control monoclonal antibody or anti-Flag antibody for at least 4 hrs, at 4°C as previously described (A.M. Chinnaiyan, et al, J Biol Chem 271, 4961-4965 (1996)). The beads were washed with lysis buffer 3X, but int he case of TRADD binding, the NaCl concentration was adjusted to IM. The precipitates were fractioned on 12.5% SDS-PAGE and transferred to nitrocellulose. Subsequent Western blotting was performed as described elsewhere (H. Hsu et al, Cell 84, 299-308 (1996); Chinnaiyan, A.M. et al, JBiol Chem 271, 4961-4965 (1996)). After 24-32 hrs, extracts were prepared and immunoprecipitated with a control monoclonal antibody or anti-Flag monoclonal antibody (IBI Kodak). Western analysis indicated that myc-TRADD and death receptor expression levels were similar in all samples. Coprecipitating myc-TRADD was detected by immunoblotting using an anti-myc HRP conjugated antibody (Boehringer Mannheim). Results
As an initial screen, in vitro translated radiolabeled DAMs were precipitated with various glutathione S-transferase (GST) fusion proteins immobilized on glutathione-Sepharose beads. As predicted from previous studies (A.M. Chinnaiyan, et al, Cell 81, 505-12 (1995); M.P. Boldin, et al, J Biol
Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14, 5579-5588 (1995); H. Hsu, et al, Cell 81, 495-504 (1995)), FADD associated with the GST-Fas cytoplasmic domain while TRADD associated with the GST-TNFR-1 cytoplasmic domain. In addition, there was a direct, albeit weak, interaction between RIP and GST-TNFR-1. Interestingly, GST-DDCR associated specifically with TRADD, but not FADD or RIP. Furthermore, a truncated death domain mutant of DR3 (GST-DDR3) failed to interact with TRADD. To demonstrate the association of DR3 and TRADD in vivo, 293 cells were transiently transfected with plasmids that direct the synthesis of myc-epitope tagged TRADD (myc-TRADD) and Flag-epitope tagged DR3 (Flag-DR3),
Flag-TNFR-1 or mutants. Consistent with the in vitro binding study, TRADD specifically coprecipitated with DR3 and TNFR-1 , but not with the death domain mutants, DDR3 and DTNFR-1. Thus, it appears that DR3, like TNFR-1, may activate downstream signaling cascades by virtue of its ability to recruit the adapter molecule TRADD.
Overexpression of TRADD induces apoptosis and NF-kB activation-two of the most important activities signaled by TNFR-1 (H. Hsu, et al, Cell 81, 495- 504 (1995)). Upon oligomerization of TNFR-1 by trimeric TNF, TRADD is recruited to the receptor signaling complex (H. Hsu, et al. Cell 84, 299-308 (1996)). TRADD can then recruit the following signal transducing molecules:
1) TRAF2, a TNFR-2- and CD40 - associated molecule (M. Rothe, et al, Cell 78, 681-92 (1994); M. Rome, et al, Science 269, 1424-1427 (1995)), that mediates NF-kB activation, 2) RIP, originally identified as a Fas/APO-1 -interacting protein by two-hybrid analysis (B.Z. Stanger, et al, Cell 81, 513-23 (1995)), that mediates NF-kB activation and apoptosis (H. Hsu, et al, Immunity 4, 387-396
(1996)), and 3) FADD, a Fas/APO-1- associated molecule, that mediates apoptosis (A.M. Chinnaiyan, et al, Cell 81, 505-12 (1995); M.P. Boldin, et al, J. Biol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14. 5579-5588 (1995)). Thus, the inventors demonstrate that RIP, TRAF2 and FADD could be co-immunoprecipitated with DR3. In 293 cells expressing DR3 and RIP, only a weak association could be detected between the two molecules. However, in the presence of TRADD, RIP association with DR3 was significantly enhanced. Likewise, very little TRAF2 directly co-precipitated with DR3 in 293 cells. However, when DR3 and TRAF2 were expressed in the presence of TRADD and RIP (both of which can bind TRAF2), an enhanced binding of TRAF2 to DR3 could be detected. A similar association between FADD and DR3 was also observed. In the presence of TRADD, FADD efficiently coprecipitated with DR3.
Previous studies demonstrated that FADD could recruit the ICE/CED-3-like protease FLICE to the Fas/APO-1 death inducing signaling complex (M. Muzio, et al, Cell 85, 817-827 (1996); M.P. Boldin, et al, Cell 85,
803-815 (1996)). To demonstrate that FLICE can associate with TNFR-1 and DR3, coprecipitation experiments in 293 cells were carried out. Interestingly, FLICE was found complexed to TNFR-1 and DR3. Co-transfection of TRADD and/or FADD failed to enhance the FLICE-TNFR-1/DR3 interaction, suggesting that endogenous amounts of these adapter molecules were sufficient to maintain this association.
Example 6
DR3 Induced Apoptosis and NF-kB Activation
Overexpression of Fas/APO-1 and TNFR-1 in mammalian cells mimics receptor activation (M. Muzio, et al , Cell 85, 817-827 (1996); M. P. Boldin, et al, Cell 85, 803-815 (1996)). Thus, this system was utilized to study the functional role of DDCR. Ectopic expression of DR3 in MCF7 breast carcinoma cells and 293 human embryonic kidney cells induced rapid apoptosis. Experimental Design
Cell death assays were performed essentially as previously described (AM. Chinnaiyan. et al, Cell 81, 505-12 (1995); M.P. Boldin, et al, J Biol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14, 5579-5588 (1995); A.M. Chinnaiyan, et al, JBiol Chem 271, 4961-4965 (1996)). Briefly, MCF-7 human breast carcinoma clonal cell lines stably transfected with either vector alone, a CrmA expression construct (M. Tewari, et al, JBiol Chem 270, 3255-60 (1995)), or FADD-DN expression construct (A.M. Chinnaiyan, et al, J Biol Chem 271, 4961-4965 (1996)) were transiently transfected with pCMV-β- galatosidase in the presence of a ten-fold excess of pcDNA3 expression constructs encoding the indicated proteins using lipofectamine (GIBCO-BRL). 293 cells were likewise transfected using the CaPO4 method. The ICE family inhibitor z-VAD-fmk (Enzyme Systems Products, Dublin, CA) was added to the cells at a concentration of lOμM, 5 hrs after transfection. 32 hours following transfection, cells were fixed and stained with X-Gal as previously described
(A.M. Chinnaiyan, et al, Cell 81, 505-12 (1995); M.P. Boldin, et al, J Biol Chem 270, 7795-8 (1995); F.C. Kischkel, et al, EMBO 14, 5579-5588 (1995)). The data (mean +/- SD) shown are the percentage of round blue cells among the total number of blue cells counted. Data were obtained from at least three independent experiments.
NF-kB luciferase assays were performed as described elsewhere (H. Hsu, et al, Immunity 4, 387-396 (1996); M.D. Adams, et al, Nature 377, 3-174 (1995); G.S. Feng, et al, JBiol Chem 271, 12129-32 (1996); M. Rome, et al, Cell 78, 681-92 (1994); M. Rothe, et al, Science 269, 1424-1427 (1995); (A.M. Chinnaiyan, et al , J Biol Chem 271 , 4961 -4965 ( 1996)). Briefly, 293 cells were co-transfected by calcium phosphate precipitation with pCMV-β-galactosidase, E-selectin-luciferase reporter gene (M. Rothe, et al, Cell 78, 681-92 (1994); M. Rothe, et al, Science 269, 1424-1427 (1995)), the indicated death receptors, and the indicated dominant negative inhibitors. In addition, DR3 or DDR3 was cotransfected with the pLantern expression construct (GIBCO-BRL) which encodes green fluorescent protein (photographic inset). Cells were visualized by fluorescence microscopy using a FITC range barrier filter cube. Nuclei of transfected cells were visualized by DAPI staining and the image overlaid. (Cell death assays were performed essentially as previously described (Chinnaiyan, et al, Cell 57:505-12 (1995); Boldin, et al, J. Biol. Chem. 270:7795-8 (1995); Kischkel, et al, EMBO 74:5579-5588 (1995)); (Chinnaiyan, et al. J. Biol. Chem.
277:4961-4965 (1996)). The dominant negative inhibitors were used at a 4-fold higher quantity than the death receptors. Total DNA was kept constant.
To show that DR3 induces NF-kB activation which is inhibitable by RIP-DN (Stanger, et al, Cell 57:513-23 (1995)) and TRAF2-DN (Hsu, etal. Cell 57:495-504 (1995)); (Rothe, et al, Cell 75:681-92 (1994); Rothe, et al. Science
269:1424-1427 (1995)), 293 cells were co-transfected with the indicated molecules and an NF-kB luciferase reporter plasmid (Rothe, et al. Cell 75:681- 92 (1994); Rothe, et al Science 269:1424-1427 (1995)) and luciferase activities subsequently determined. NF-κB luciferase assays were performed as described elsewhere ((Hsu, et al, Immunity 4:387-396 (1996)); (Adams, et al, Nature
577:3-174 (1995); Feng, et al, J. Biol. Chem. 277:12129-32 (1996)); (Rothe, et al, Cell 75:681-92 (1994); Rothe, et al. Science 269:1424-1427 (1995)); Chinnaiyan, etal, J. Biol. Chem. 277:4961-4965 (1996)). Briefly, 293 cells were co-transfected by calcium phosphate precipitation with pCMB-β-galactosidase, E-selectin-luciferase reporter gene (Rothe, et al, Cell 75:681-92 (1994); Rothe, et al. Science 269:1424-1427 (1995)), the indicated death receptors, and the indicated dominant negative inhibitors. The dominant negative inhibitors were used at a 4-fold higher quantity than the death receptors. Total DNA was kept constant. Representative experiment performed in duplicate three independent times (mean + SD).
Results
The cells displayed moφhological alterations typical of cells undergoing apoptosis, becoming rounded, condensed and detaching from the dish. In MCF7 cells, plasmids encoding full-length DR3 or DDR3 were co-transfected with the pLantern reporter construct encoding green fluorescent protein. Nuclei of cells transfected with DR3, but not DDR3, exhibited apoptotic moφhology as assessed by DAPI staining. Similar to TNFR-1 and Fas/APO-1 (M. Muzio, et al, Cell 85, 817-827 (1996); M. P. Boldin, et al, Cell 85, 803-815 (1996); M. Tewari, et al, JBiol Chem 270, 3255-60 (1995)), DR3-induced apoptosis was blocked by the inhibitors of ICE-like proteases, Cr A and z-VAD-fmk. importantly, apoptosis induced by DR3 was also blocked by dominant negative versions of FADD (FADD-DN) or FLICE (FLICE-DN/MACHal C360S), which were previously shown to inhibit death signaling by Fas/APO-1 and TNFR-1 (M. Muzio, et al, Cell 85, 817-827 91996); M. P. Boldin, et al, Cell 85, 803-815 (1996); H. Hsu, et al, Cell 84, 299-398 (1996); A.M. Chinnaiyan, et al, JBiol Chem 271, 4961-
4965 (1996)). Thus, FADD and the ICE-like protease FLICE are likely necessary components of DR3 -induced apoptosis.
As DR3 activation recruits three molecules implicated in TNF-induced NF-kB activation, we examined whether DR3 could activate NF-kB. Transfection of a control vector or expression of Fas/APO-1 failed to induce
NF-kB activation. By confrast, NF-kB was activated by ectopic expression of DR3 or TNFR-1 , but not by the inactive signaling mutants DDR3 or DTNFR-1. Importantly, DR3-induced NF-kB activation was blocked by dominant negative derivatives of RIP (RIP-DN) and TRAF2 (TRAF2-DN), which were previously shown to abrogate TNF-induced NF-kB activation (H. Hsu, et al, Cell 84, 299-
398 (1996); H. Hsu, et al, Immunity 4, 387-396 (1996)). As expected, FADD-DN did not interfere with DR3-mediated NF-kB activation (H. Hsu, et al, Cell 84, 299-398 (1996); A.M. Chinnaiyan, et al, JBiol Chem 271, 4961-4965 (1996)). Thus, the experiments set forth in Examples 6 and 7 demonstrate that DR3 is a death domain-containing molecule capable of friggering both apoptosis and NF-kB activation, two pathways dominant in the regulation of the immune system. The experiments also demonstrate the internal signal transduction machinery of this novel cell death receptor. The DR3 signaling complex assembles in a hierarchical manner with the recruitment of the multivalent adapter molecule TRADD, from which two distinct signaling cascades emanate: 1) NF-kB activation mediated by TRAF2 and RIP and 2) cell death mediated by FADD, FLICE, and RIP.
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples.
Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.
The entire disclosures of all patents, patent applications, and publications referred to herein are hereby incoφorated by reference.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Human Genome Sciences, Inc. 9410 Key West Avenue Rockville, MD 20850 United States of America
The Regents of the University of Michigan
Ann Arbor, MI
United States of America
APPLICANTS/INVENTORS: Yu, Guo-Liang
Ni, Jian Dixit, Vishva Gentz, Reiner L. Dillon, Patrick J.
(ii) TITLE OF INVENTION: Death Domain Containing Receptor
(iii) NUMBER OF SEQUENCES: 17
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Sterne, Kessler, Goldstein & Fox, P.L.L.C.
(B) STREET: 1100 New York Ave. , NW, Suite 600
(C) CITY: Washington
(D) STATE: DC
(E) COUNTRY: USA
(F) ZIP: 20005-3934
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: To be assigned
(B) FILING DATE: Herewith
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 60/013,285
(B) FILING DATE: 1 -MAR-1996
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Goldstein, Jorge A.
(B) REGISTRATION NUMBER: 29,021
(C) REFERENCE/DOCKET NUMBER: 1488.031PC01
(ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 202-371-2600 (B) TELEFAX: 202-371-2540
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1783 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 198..1481
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
CATGGGTGGG GGTGGGGGCG CTGCTGGATT CCTGCTCTGG TGGAGGGGAA ACTTGTGAGG 60
GGCTGGTAAG CGCCCCCTCC GAAGCCTGGT GTGTGCGCGG GGGGAAGGAA GTTAGTTTCC 120
TCTCCACCCA TGGGCACCCC TTCTGCCCGG GGCCTGGGAA GTGGGCTGCT CTGTGGGCAA 180
ATGCTGGGGC CTCTGAA ATG GAG GAG ACG CAG CAG GGA GAG GCC CCA CGT 230
Met Glu Glu Thr Gin Gin Gly Glu Ala Pro Arg 1 5 10
GGG CAG CTG CGC GGA GAG TCA GCA GCA CCT GTC CCC CAG GCG CTC CTC 278 Gly Gin Leu Arg Gly Glu Ser Ala Ala Pro Val Pro Gin Ala Leu Leu 15 20 25
CTG GTG CTG CTG GGG GCC CGG GCC CAG GGC GGC ACT CGT AGC CCC AGG 326 Leu Val Leu Leu Gly Ala Arg Ala Gin Gly Gly Thr Arg Ser Pro Arg 30 35 40
TGT GAC TGT GCC GGT GAC TTC CAC AAG AAG ATT GGT CTG TTT TGT TGC 374 Cys Asp Cys Ala Gly Asp Phe His Lys Lys lie Gly Leu Phe Cys Cys 45 50 55
AGA GGC TGC CCA GCG GGG CAC TAC CTG AAG GCC CCT TGC ACG GAG CCC 422 Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro 60 65 70 75
TGC GGC AAC TCC ACC TGC CTT GTG TGT CCC CAA GAC ACC TTC TTG GCC 470 Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gin Asp Thr Phe Leu Ala 80 85 90
TGG GAG AAC CAC CAT AAT TCT GAA TGT GCC CGC TGC CAG GCC TGT GAT 518 Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gin Ala Cys Asp 95 100 105 GAG CAG GCC TCC CAG GTG GCG CTG GAG AAC TGT TCA GCA GTG GCC GAC 566
Glu Gin Ala Ser Gin Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp 110 115 120
ACC CGC TGT GGC TGT AAG CCA GGC TGG TTT GTG GAG TGC CAG GTC AGC 614
Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gin Val Ser 125 130 135
CAA TGT GTC AGC AGT TCA CCC TTC TAC TGC CAA CCA TGC CTA GAC TGC 662
Gin Cys Val Ser Ser Ser Pro Phe Tyr Cys Gin Pro Cys Leu Asp Cys 140 145 150 155
GGG GCC CTG CAC CGC CAC ACA CGG CTA CTC TGT TCC CGC AGA GAT ACT 710
Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr 160 165 170
GAC TGT GGG ACC TGC CTG CCT GGC TTC TAT GAA CAT GGC GAT GGC TGC 758
Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys
175 180 185
GTG TCC TGC CCC ACG AGC ACC CTG GGG AGC TGT CCA GAG CGC TGT GCC 806
Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala 190 195 200
GCT GTC TGT GGC TGG AGG CAG ATG TTC TGG GTC CAG GTG CTC CTG GCT 854
Ala Val Cys Gly Trp Arg Gin Met Phe Trp Val Gin Val Leu Leu Ala 205 210 215
GGC CTT GTG GTC CCC CTC CTG CTT GGG GCC ACC CTG ACC TAC ACA TAC 902
Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr 220 225 230 235
CGC CAC TGC TGG CCT CAC AAG CCC CTG GTT ACT GCA GAT GAA GCT GGG 950
Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly 240 245 250
ATG GAG GCT CTG ACC CCA CCA CCG GCC ACC CAT CTG TCA CCC TTG GAC 998
Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp
255 260 265
AGC GCC CAC ACC CTT CTA GCA CCT CCT GAC AGC AGT GAG AAG ATC TGC 1046
Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys lie Cys 270 275 280
ACC GTC CAG TTG GTG GGT AAC AGC TGG ACC CCT GGC TAC CCC GAG ACC 1094
Thr Val Gin Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr 285 290 295
CAG GAG GCG CTC TGC CCG CAG GTG ACA TGG TCC TGG GAC CAG TTG CCC 1142
Gin Glu Ala Leu Cys Pro Gin Val Thr Trp Ser Trp Asp Gin Leu Pro 300 305 310 315
AGC AGA GCT CTT GGC CCC GCT GCT GCG CCC ACA CTC TCG CCA GAG TCC 1190
Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser 320 325 330 CCA GCC GGC TCG CCA GCC ATG ATG CTG CAG CCG GGC CCG CAG CTC TAC 1238 Pro Ala Gly Ser Pro Ala Met Met Leu Gin Pro Gly Pro Gin Leu Tyr 335 340 345
GAC GTG ATG GAC GCG GTC CCA GCG CGG CGC TGG AAG GAG TTC GTG CGC 1286 Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg 350 355 360
ACG CTG GGG CTG CGC GAG GCA GAG ATC GAA GCC GTG GAG GTG GAG ATC 1334 Thr Leu Gly Leu Arg Glu Ala Glu lie Glu Ala Val Glu Val Glu lie 365 370 375
GGC CGC TTC CGA GAC CAG CAG TAC GAG ATG CTC AAG CGC TGG CGC CAG 1382 Gly Arg Phe Arg Asp Gin Gin Tyr Glu Met Leu Lys Arg Trp Arg Gin 380 385 390 395
CAG CAG CCC GCG GGC CTC GGA GCC GTT TAC GCG GCC CTG GAG CGC ATG 1430 Gin Gin Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met 400 405 410
GGG CTG GAC GGC TGC GTG GAA GAC TTG CGC AGC CGC CTG CAG CGC GGC 1478 Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gin Arg Gly 415 420 425
CCG TGACACGGCG CCCACTTGCC ACCTAGGCGC TCTGGTGGCC CTTGCAGAAG 1531
Pro
CCCTAAGTAC GGTTACTTAT GCGTGTAGAC ATTTTATGTC ACTTATTAAG CCGCTGGCAC 1591
GGCCCTGCGT AGCAGCACCA GCCGGCCCCA CCCCTGCTCG CCCCTATCGC TCCAGCCAAG 1651
GCGAAGAAGC ACGAACGAAT GTCGAGAGGG GGTGAAGACA TTTCTCAACT TCTCGGCCGG 1711
AGTTTGGCTG AGATCGCGGT ATTAAATCTG TGAAAGAAAA CAAAACAAAA CAAAAAAAAA 1771
AAAAAAAAAA AA 1783
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 428 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Glu Glu Thr Gin Gin Gly Glu Ala Pro Arg Gly Gin Leu Arg Gly 1 5 10 15
Glu Ser Ala Ala Pro Val Pro Gin Ala Leu Leu Leu Val Leu Leu Gly 20 25 30 Ala Arg Ala Gin Gly Gly Thr Arg Ser Pro Arg Cys Asp Cys Ala Gly 35 40 45
Asp Phe His Lys Lys lie Gly Leu Phe Cys Cys Arg Gly Cys Pro Ala 50 55 60
Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro Cys Gly Asn Ser Thr 65 70 75 80
Cys Leu Val Cys Pro Gin Asp Thr Phe Leu Ala Trp Glu Asn His His 85 90 95
Asn Ser Glu Cys Ala Arg Cys Gin Ala Cys Asp Glu Gin Ala Ser Gin 100 105 110
Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp Thr Arg Cys Gly Cys 115 120 125
Lys Pro Gly Trp Phe Val Glu Cys Gin Val Ser Gin Cys Val Ser Ser 130 135 140
Ser Pro Phe Tyr Cys Gin Pro Cys Leu Asp Cys Gly Ala Leu His Arg 145 150 155 160
His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr Asp Cys Gly Thr Cys 165 170 175
Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys Val Ser Cys Pro Thr 180 185 190
Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala Ala Val Cys Gly Trp 195 200 205
Arg Gin Met Phe Trp Val Gin Val Leu Leu Ala Gly Leu Val Val Pro 210 215 220
Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr Arg His Cys Trp Pro 225 230 235 240
His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly Met Glu Ala Leu Thr 245 250 255
Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp Ser Ala His Thr Leu 260 265 270
Leu Ala Pro Pro Asp Ser Ser Glu Lys lie Cys Thr Val Gin Leu Val 275 280 285
Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr Gin Glu Ala Leu Cys 290 295 300
Pro Gin Val Thr Trp Ser Trp Asp Gin Leu Pro Ser Arg Ala Leu Gly 305 310 315 320
Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser Pro Ala Gly Ser Pro 325 330 335
Ala Met Met Leu Gin Pro Gly Pro Gin Leu Tyr Asp Val Met Asp Ala 340 345 350
Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg Thr Leu Gly Leu Arg 355 360 365
Glu Ala Glu He Glu Ala Val Glu Val Glu He Gly Arg Phe Arg Asp 370 375 380
Gin Gin Tyr Glu Met Leu Lys Arg Trp Arg Gin Gin Gin Pro Ala Gly 385 390 395 400
Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met Gly Leu Asp Gly Cys 405 410 415
Val Glu Asp Leu Arg Ser Arg Leu Gin Arg Gly Pro 420 425
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1254 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: double
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1251
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
ATG GAG CAG CGG CCG CGG GGC TGC GCG GCG GTG GCG GCG GCG CTC CTC 48 Met Glu Gin Arg Pro Arg Gly Cys Ala Ala Val Ala Ala Ala Leu Leu 430 435 440
CTG GTG CTG CTG GGG GCC CGG GCC CAG GGC GGC ACT CGT AGC CCC AGG 96 Leu Val Leu Leu Gly Ala Arg Ala Gin Gly Gly Thr Arg Ser Pro Arg 445 450 455 460
TGT GAC TGT GCC GGT GAC TTC CAC AAG AAG ATT GGT CTG TTT TGT TGC 144 Cys Asp Cys Ala Gly Asp Phe His Lys Lys He Gly Leu Phe Cys Cys 465 470 475
AGA GGC TGC CCA GCG GGG CAC TAC CTG AAG GCC CCT TGC ACG GAG CCC 192 Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro 480 485 490
TGC GGC AAC TCC ACC TGC CTT GTG TGT CCC CAA GAC ACC TTC TTG GCC 240 Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gin Asp Thr Phe Leu Ala 495 500 505
TGG GAG AAC CAC CAT AAT TCT GAA TGT GCC CGC TGC CAG GCC TGT GAT 288 Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gin Ala Cys Asp 510 515 520
GAG CAG GCC TCC CAG GTG GCG CTG GAG AAC TGT TCA GCA GTG GCC GAC 336 Glu Gin Ala Ser Gin Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp 525 530 535 540
ACC CGC TGT GGC TGT AAG CCA GGC TGG TTT GTG GAG TGC CAG GTC AGC 384 Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gin Val Ser 545 550 555
CAA TGT GTC AGC AGT TCA CCC TTC TAC TGC CAA CCA TGC CTA GAC TGC 432 Gin Cys Val Ser Ser Ser Pro Phe Tyr Cys Gin Pro Cys Leu Asp Cys 560 565 570
GGG GCC CTG CAC CGC CAC ACA CGG CTA CTC TGT TCC CGC AGA GAT ACT 480 Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr 575 580 585
GAC TGT GGG ACC TGC CTG CCT GGC TTC TAT GAA CAT GGC GAT GGC TGC 528 Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys 590 595 600
GTG TCC TGC CCC ACG AGC ACC CTG GGG AGC TGT CCA GAG CGC TGT GCC 576 Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala 605 610 615 620
GCT GTC TGT GGC TGG AGG CAG ATG TTC TGG GTC CAG GTG CTC CTG GCT 624 Ala Val Cys Gly Trp Arg Gin Met Phe Trp Val Gin Val Leu Leu Ala 625 630 635
GGC CTT GTG GTC CCC CTC CTG CTT GGG GCC ACC CTG ACC TAC ACA TAC 672 Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr 640 645 650
CGC CAC TGC TGG CCT CAC AAG CCC CTG GTT ACT GCA GAT GAA GCT GGG 720 Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly 655 660 665
ATG GAG GCT CTG ACC CCA CCA CCG GCC ACC CAT CTG TCA CCC TTG GAC 768 Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp 670 675 680
AGC GCC CAC ACC CTT CTA GCA CCT CCT GAC AGC AGT GAG AAG ATC TGC 816 Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys He Cys 685 690 695 700
ACC GTC CAG TTG GTG GGT AAC AGC TGG ACC CCT GGC TAC CCC GAG ACC 864 Thr Val Gin Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr 705 710 715 CAG GAG GCG CTC TGC CCG CAG GTG ACA TGG TCC TGG GAC CAG TTG CCC 912 Gin Glu Ala Leu Cys Pro Gin Val Thr Trp Ser Trp Asp Gin Leu Pro 720 725 730
AGC AGA GCT CTT GGC CCC GCT GCT GCG CCC ACA CTC TCG CCA GAG TCC 960 Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser 735 740 745
CCA GCC GGC TCG CCA GCC ATG ATG CTG CAG CCG GGC CCG CAG CTC TAC 1008 Pro Ala Gly Ser Pro Ala Met Met Leu Gin Pro Gly Pro Gin Leu Tyr 750 755 760
GAC GTG ATG GAC GCG GTC CCA GCG CGG CGC TGG AAG GAG TTC GTG CGC 1056 Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg 765 770 775 780
ACG CTG GGG CTG CGC GAG GCA GAG ATC GAA GCC GTG GAG GTG GAG ATC 1104 Thr Leu Gly Leu Arg Glu Ala Glu He Glu Ala Val Glu Val Glu He 785 790 795
GGC CGC TTC CGA GAC CAG CAG TAC GAG ATG CTC AAG CGC TGG CGC CAG 1152 Gly Arg Phe Arg Asp Gin Gin Tyr Glu Met Leu Lys Arg Trp Arg Gin 800 805 810
CAG CAG CCC GCG GGC CTC GGA GCC GTT TAC GCG GCC CTG GAG CGC ATG 1200 Gin Gin Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met 815 820 825
GGG CTG GAC GGC TGC GTG GAA GAC TTG CGC AGC CGC CTG CAG CGC GGC 1248 Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gin Arg Gly 830 835 840
CCG TGA 1254
Pro
845
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 417 amino acids
(B) TYPE: amino acid (D) TOPOLOGY: linear
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Met Glu Gin Arg Pro Arg Gly Cys Ala Ala Val Ala Ala Ala Leu Leu 1 5 10 15
Leu Val Leu Leu Gly Ala Arg Ala Gin Gly Gly Thr Arg Ser Pro Arg 20 25 30
Cys Asp Cys Ala Gly Asp Phe His Lys Lys He Gly Leu Phe Cys Cys 35 40 45
Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro 50 55 60
Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gin Asp Thr Phe Leu Ala 65 70 75 80
Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gin Ala Cys Asp 85 90 95
Glu Gin Ala Ser Gin Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp 100 105 110
Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gin Val Ser 115 120 125
Gin Cys Val Ser Ser Ser Pro Phe Tyr Cys Gin Pro Cys Leu Asp Cys 130 135 140
Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr 145 150 155 160
Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys 165 170 175
Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala 180 185 190
Ala Val Cys Gly Trp Arg Gin Met Phe Trp Val Gin Val Leu Leu Ala 195 200 205
Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr 210 215 220
Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly 225 230 235 240
Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp 245 250 255
Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys He Cys 260 265 270
Thr Val Gin Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr 275 280 285
Gin Glu Ala Leu Cys Pro Gin Val Thr Trp Ser Trp Asp Gin Leu Pro 290 295 300
Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser 305 310 315 320
Pro Ala Gly Ser Pro Ala Met Met Leu Gin Pro Gly Pro Gin Leu Tyr 325 330 335 Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg 340 345 350
Thr Leu Gly Leu Arg Glu Ala Glu He Glu Ala Val Glu Val Glu He 355 360 365
Gly Arg Phe Arg Asp Gin Gin Tyr Glu Met Leu Lys Arg Trp Arg Gin 370 375 380
Gin Gin Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met 385 390 395 400
Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gin Arg Gly 405 410 415
Pro
(2) INFORMATION FOR SEQ ID NO:5 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 455 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: not relevant
(D) TOPOLOGY: not relevant
(ii) MOLECULE TYPE: protein
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu 1 5 10 15
Glu Leu Leu Val Gly He Tyr Pro Ser Gly Val He Gly Leu Val Pro 20 25 30
His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gin Gly Lys 35 40 45
Tyr He His Pro Gin Asn Asn Ser He Cys Cys Thr Lys Cys His Lys 50 55 60
Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gin Asp Thr Asp 65 70 75 80
Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu 85 90 95
Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gin Val
100 105 110
Glu He Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg 115 120 125
Lys Asn Gin Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gin Cys Phe 130 135 140
Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gin Glu 145 150 155 160
Lys Gin Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu 165 170 175
Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr 180 185 190
Lys Leu Cys Leu Pro Gin He Glu Asn Val Lys Gly Thr Glu Asp Ser 195 200 205
Gly Thr Thr Val Leu Leu Pro Leu Val He Phe Phe Gly Leu Cys Leu 210 215 220
Leu Ser Leu Leu Phe He Gly Leu Met Tyr Arg Tyr Gin Arg Trp Lys 225 230 235 240
Ser Lys Leu Tyr Ser He Val Cys Gly Lys Ser Thr Pro Glu Lys Glu 245 250 255
Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser 260 265 270
Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pro Val 275 280 285
Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys 290 295 300
Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr Gin Gly 305 310 315 320
Ala Asp Pro He Leu Ala Thr Ala Leu Ala Ser Asp Pro He Pro Asn 325 330 335
Pro Leu Gin Lys Trp Glu Asp Ser Ala His Lys Pro Gin Ser Leu Asp 340 345 350
Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro 355 360 365
Leu Arg Trp Lys Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu 370 375 380
He Asp Arg Leu Glu Leu Gin Asn Gly Arg Cys Leu Arg Glu Ala Gin 385 390 395 400
Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala 405 410 415 Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu Gly 420 425 430
Cys Leu Glu Asp He Glu Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro 435 440 445
Pro Ala Pro Ser Leu Leu Arg 450 455
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 335 amino acids
(B) TYPE: amino acid
(C) STRANDEDNESS: not relevant
(D) TOPOLOGY: not relevant
( ii ) MOLECULE TYPE : protein
(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 6 :
Met Leu Gly He Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala
1 5 10 15
Arg Leu Ser Ser Lys Ser Val Asn Ala Gin Val Thr Asp He Asn Ser 20 25 30
Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gin Asn 35 40 45
Leu Glu Gly Leu His His Asp Gly Gin Phe Cys His Lys Pro Cys Pro 50 55 60
Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro 65 70 75 80
Asp Cys Val Pro Cys Gin Glu Gly Lys Glu Tyr Thr Asp Lys Ala His 85 90 95
Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly 100 105 110
Leu Glu Val Glu He Asn Cys Thr Arg Thr Gin Asn Thr Lys Cys Arg 115 120 125
Cys Lys Pro Asn Phe Phe Gin Asn Ser Thr Val Cys Glu His Cys Asp 130 135 140
Pro Cys Thr Lys Cys Glu His Gly He He Lys Glu Cys Thr Leu Thr 145 150 155 160
Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp 165 170 175
Leu Cys Leu Leu Leu Leu Pro He Pro Leu He Val Trp Val Lys Arg 180 185 190
Lys Glu Val Gin Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gin Gly 195 200 205
Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala He Asn Leu 210 215 220
Ser Asp Val Asp Leu Ser Lys Tyr He Thr Thr He Ala Gly Val Met 225 230 235 240
Thr Leu Ser Gin Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu 245 250 255
Ala Lys He Asp Glu He Lys Asn Asp Asn Val Gin Asp Thr Ala Glu 260 265 270
Gin Lys Val Gin Leu Leu Arg Asn Trp His Gin Leu His Gly Lys Lys 275 280 285
Glu Ala Tyr Asp Thr Leu He Lys Asp Leu Lys Lys Ala Asn Leu Cys 290 295 300
Thr Leu Ala Glu Lys He Gin Thr He He Leu Lys Asp He Thr Ser 305 310 315 320
Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu He Gin Ser Leu Val 325 330 335
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GCGCCATGGG GGCCCGGCGG CAG 23
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GCGAAGCTTC TAGGACCCAG AACATCTGCC 30
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CGCGGATCCG CCATCATGGA GGAGACGCAG CAG 33
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: CDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: CGCGGATCCG CCATCATGGA GCAGCGGCCG CGG 33
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 54 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: GCGTCTAGAT CAAAGCGTAG TCTGGGACGT CGTATGGGTA CGGGCCGCGC TGCA 54
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CGCGGATCCG CCATCATGGA GGAGACGCAG CAG 33
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: CGCGGATCCG CCATCATGGA GCAGCGGCCG CGG 33
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14; CGCGGATCCT CACGGGCCGC GCTGCA 26
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: CGCGGATCCG CCATCATGGA GGAGACGCAG CAG 33
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: CGCGGATCCG CCATCATGGA GCAGCGGCCG CGG 33
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 35 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
( i) SEQUENCE DESCRIPTION: SEQ ID NO:17: GCGAGATCTA GTCTGGACCC AGAACATCTG CCTCC 35
Figure imgf000088_0001
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 131>«)
I A. The indications made below relate to the microorganism referred to in t e description on page 4 . line 18
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet ) |
Name of depositary institution
American Type Culture Collection
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
March 1, 1996 ATCC 97456
C ADDITIONAL INDICATIONS (leav blank if not applicable) This information is continued on an additional sheet Q
DNA Plasmid, 231556
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated Stalα)
E. SEPARATE FURNISHING OF INDICATIONS (leave Uenk if not applicable)
Themdicauonslistedbelowwillbesubmitted to the Inteπiational Bureau ^ "A
Number of Deposit')
For receiving Office use only For international Bureau use only
I 1 This sbeet was received with tbe international application I I This sbeet was received by the international Bureau o
Authorized officer Authorized officer
Form PCT/RO/13 (July 1992) 85 . 2
Applicant's or agent's file Internauonal application Nc reference number 1488 . 0 3 1PC0 1 Zl
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 136«)
A. The indications made below relate to the microorganism referred to in the description on psge __4 r )jne 1 8
B. IDENTIFICATION OF DEPOSIT Further deposits sre identified on an additional sheet [ I
Name of depositary institution
American Type Culture Collection
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
October 10 , 1996 ATCC 97757
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is conunued on an additional sheet |~|
DNA Plasmid, 1198782
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if ike indications are not for all designated Stoles)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
Tbe indications listed below will be submitted to the international Bureau later (specify the generalnαtureoflhetndιcatιonse.g^ 'Accession Number of Deposit ')
For receiving Office use only
I I This sheet was received with the internauonal application
Authorized officer
Figure imgf000089_0001
Form l'CT UO/13 (July 1992)

Claims

What Is Claimed Is:
1. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of:
(a) a nucleotide sequence encoding the full-length death domain containing receptor polypeptide (DR3-V1) having the complete amino acid sequence in Figure 1 (SEQ ID NO:2);
(b) nucleotide sequence encoding the full-length death domain containing receptor (DR3) polypeptide having the complete amino acid sequence in Figure 2 (SEQ ID NO:4), including the predicted leader sequence;
(c) a nucleotide sequence encoding the DR3-V1 polypeptide having the amino acid sequence at positions from about 36 to about 428 in Figure 1 (SEQ ID NO:2);
(d) a nucleotide sequence encoding the full-length DR3-V1 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(e) a nucleotide sequence encoding the full-length DR3 polypeptide having the complete amino acid sequence including the leader encoded by the cDNA clone contained in ATCC Deposit No.__________;
(f) a nucleotide sequence encoding the mature DR3- V1 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(g) a nucleotide sequence encoding the mature DR3 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.__________;
(h) a nucleotide sequence that encodes the DR3 extracellular domain;
(i) a nucleotide sequence that encodes the DR3 transmembrane domain; (j) a nucleotide sequence that encodes the DR3 intracellular domain;
(k) a nucleotide sequence that encodes the DR3 death domain; and
(l) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or (k)
2. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence in Figure 1 (SEQ ID NO: 1).
3. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO: 1) encoding the death domain containing receptor polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2).
4. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO: 1) encoding the mature death domain containing receptor polypeptide having the amino acid sequence in
Figure 1 (SEQ ID NO:2).
5. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence of the cDNA clone contained in ATCC Deposit No. 97456.
6. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence in Figure 2 (SEQ ID NO:3).
7. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO: 1) encoding the death domain containing receptor polypeptide having the complete amino acid sequence in Figure 1 (SEQ ID NO:2).
8. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 2 (SEQ ID NO:3) encoding the mature death domain containing receptor polypeptide having the amino acid sequence in Figure 2 (SEQ ID NO:4).
9. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence of the cDNA clone contained in ATCC Deposit No. __________.
10. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the death domain containing receptor polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97456.
1 1. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the mature death domain containing receptor polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97456.
12. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the death domain containing receptor polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. __________.
13. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the mature death domain containing receptor polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. __________.
14. An isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to a nucleotide sequence in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k) or (l) of claim 1 wherein said polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
15. An isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a death domain containing receptor polypeptide having an amino acid sequence in (a),
(b), (c), (d), (e), (f), (g), (h), (i), 0) or (k) of claim 1.
16. The isolated nucleic acid molecule of claim 15, which encodes an epitope-bearing portion of a death domain containing receptor polypeptide selected from the group consisting of: a polypeptide comprising amino acid residues from about 1 to about 22 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 33 to about 56 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 59 to about 82 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 95 to about 112 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 122 to about 133 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 161 to about 177 in Figure 1 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about 179 to about 190 in Figure 1 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about 196 to about 205 in Figure 1 (SEQ ID NO: 2).
17. A method for making a recombinant vector comprising inserting an isolated nucleic acid molecule of claim 1 into a vector.
18. A recombinant vector produced by the method of claim 17.
19. A method of making a recombinant host cell comprising introducing the recombinant vector of claim 18 into a host cell.
20. A recombinant host cell produced by the method of claim 19.
21. A recombinant method for producing a death domain containing receptor polypeptide, comprising culturing the recombinant host cell of claim 20 under conditions such that said polypeptide is expressed and recovering said polypeptide.
22. An isolated death domain containing receptor polypeptide having an amino acid sequence at least 95% identical to a sequence selected from the group consisting of:
(a) the amino acid sequence of the DR3-V1 polypeptide having the complete 428 amino acid sequence, including the leader sequence shown in Figure 1 (SEQ ID NO:2);
(b) the amino acid sequence of the DR3 polypeptide having the complete 417 amino acid sequence, including the leader sequence, shown in
Figure 2 (SEQ ID NO:4);
(c) the amino acid sequence of the DR3-V1 polypeptide having the amino acid sequence at positions from about 36 to about 428 in Figure 1 (SEQ ID NO:2);
(d) the amino acid sequence of the DR3-V1 polypeptide having the complete amino acid sequence, including the leader, encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(e) the amino acid sequence of the DR3 polypeptide having the complete amino acid sequence, including the leader, encoded by the cDNA clone contained in ATCC Deposit No. __________; (f) the amino acid sequence of the mature DR3 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97456;
(g) the amino acid sequence encoding the mature DR3 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. __________;
(h) the amino sequence of the DR3 extracellular domain;
(i) the amino acid sequence of the DR3 transmembrane domain;
(j) the amino acid sequence of the DR3 intracellular domain;
(k) the amino acid sequence of the DR3 death domain; and
(1) the amino acid sequence of an epitope-bearing portion of any one of the polypeptides of (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or (k).
23. An isolated antibody that binds specifically to a death domain containing receptor polypeptide of claim 22.
24. A method of treating diseases and disorders associated with the inhibition of apoptosis comprising administering an effective amount of the polypeptide as claimed in claim 22, or an agonist thereof to a patient in need thereof.
25. A method of treating diseases and disorders associated with increased apoptosis comprising administering to a patient in need thereof an effective amount of an antagonist of the polypeptide as claimed in claim 22 to a patient in need thereof.
26. A method of treating inflammatory diseases and disorders comprising administering to a patient in need thereof an effective amount of an antagonist of the polypeptide as claimed in claim 22.
PCT/US1996/016849 1996-03-12 1996-10-17 Death domain containing receptors WO1997033904A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP96941942A EP0898576A1 (en) 1996-03-12 1996-10-17 Death domain containing receptors
AU11151/97A AU1115197A (en) 1996-03-12 1996-10-17 Death domain containing receptors

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US1328596P 1996-03-12 1996-03-12
US60/013,285 1996-03-12
US2871196P 1996-10-17 1996-10-17
US3734197P 1997-02-06 1997-02-06

Publications (1)

Publication Number Publication Date
WO1997033904A1 true WO1997033904A1 (en) 1997-09-18

Family

ID=27359824

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/016849 WO1997033904A1 (en) 1996-03-12 1996-10-17 Death domain containing receptors

Country Status (3)

Country Link
US (3) US6153402A (en)
JP (1) JPH11170A (en)
WO (1) WO1997033904A1 (en)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999041374A2 (en) * 1998-02-17 1999-08-19 Incyte Pharmaceuticals, Inc. Human short-chain tnf-receptor family protein
WO2001035995A2 (en) * 1999-11-19 2001-05-25 Tittle Thomas V Tr3-specific binding agents and methods for their use
US6297022B1 (en) 1997-10-08 2001-10-02 Smithkline Beecham Corporation Method of identifying agonists and antagonists for tumor necrosis related receptor TR1
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
EP1178815A1 (en) * 1999-04-22 2002-02-13 Human Genome Sciences, Inc. Death domain containing receptors
WO2002034912A1 (en) * 2000-10-24 2002-05-02 New Ind Res Organization Genomes participating in rheumatoid arthritis, method of the diagnosis thereof, method of evaluating the onset possibility thereof, diagnostic kit for detecting them and therapeutic method and remedies for rheumatoid arthritis
US6462176B1 (en) 1996-09-23 2002-10-08 Genentech, Inc. Apo-3 polypeptide
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
US6759513B2 (en) 1996-03-12 2004-07-06 Human Genome Sciences, Inc. Death domain containing receptors
EP1500702A1 (en) * 1996-04-01 2005-01-26 Genentech, Inc. APO-2LI and APO-3 apoptosis polypeptides from the TNFR1 familiy
US6994976B1 (en) 1999-11-19 2006-02-07 Tittle Thomas V Tr3-specific binding agents and methods for their use
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
US8765130B2 (en) 2011-03-01 2014-07-01 Novo Nordisk A/S Antagonistic DR3 ligands
US8937169B2 (en) 1996-01-11 2015-01-20 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US9133273B2 (en) 2010-11-19 2015-09-15 Eisai R&D Management Co., Ltd. Nucleic acids encoding neutralizing anti-CCL20 antibodies
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
EP3502256A2 (en) 2008-09-26 2019-06-26 Tocagen Inc. Recombinant vectors
EP3623478A1 (en) 2012-10-25 2020-03-18 Tocagen Inc. Retroviral vector with mini-promoter cassette
US11103579B2 (en) 2013-03-14 2021-08-31 Bristol-Myers Squibb Company Combination of DR5 agonist and anti-PD-1 antagonist and methods of use

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030198640A1 (en) * 1994-11-07 2003-10-23 Human Genome Sciences, Inc. Methods and compositions for treating inflammatory bowel diseases relating to human tumor necrosis factor-gamma-beta
US20020165157A1 (en) * 1996-04-01 2002-11-07 Genentech, Inc. Apo-2LI and Apo-3 polypeptides
WO1998014565A1 (en) * 1996-10-04 1998-04-09 Immunex Corporation Novel receptor that causes cell death
US20030078211A1 (en) * 1998-06-24 2003-04-24 Merck & Co., Inc. Compositions and methods for inhibiting bone resorption
WO2001016180A2 (en) * 1999-08-27 2001-03-08 Board Of Regents, The University Of Texas System Cd40 agonist compositions and methods of use
US6965023B2 (en) * 2000-11-17 2005-11-15 The Burnham Institute Death domain proteins
WO2005018571A2 (en) * 2003-08-20 2005-03-03 University Of Miami Compositions and methods for treating inflammatory lung disease
ES2611307T3 (en) 2005-08-30 2017-05-08 University Of Miami Immunomodulation of agonists, antagonists and immunotoxins of the tumor necrosis factor 25 receptor (TNFR25)
US9896511B2 (en) 2007-01-10 2018-02-20 The United States Of America, As Represented By The Secretary, Dept. Of Health And Human Services Antibodies that bind to TL1A and methods of treating inflammatory or autoimmune disease comprising administering such antibodies
CN102770455B (en) 2009-08-03 2017-02-08 迈阿密大学 Method for in vivo expansion of T regulatory cells
AU2012259312A1 (en) * 2011-05-20 2013-12-12 Government Of The United States, As Represented By The Secretary Department Of Health And Human Services Blockade of tl1a-dr3 interactions to ameliorate t cell mediated disease pathology and antibodies thereof
EP2943253B1 (en) 2013-01-09 2021-10-20 University Of Miami Compositions and methods for the regulation of t regulatory cells using tl1a-ig fusion protein and il-2

Family Cites Families (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
DE3382137D1 (en) * 1982-07-30 1991-02-28 Bernard Francois Mach DNA SEQUENCE ENCODING FOR THE DR BETA CHAIN LOCUS OF THE HUMAN LYMPHOCYTANTIGEN COMPLEX AND POLYPEPTIDES, DIAGNOSTIC TYPING METHODS AND PRODUCTS RELATING TO THIS.
US5120525A (en) 1988-03-29 1992-06-09 Immunomedics, Inc. Radiolabeled antibody cytotoxic therapy of cancer
US5349052A (en) 1988-10-20 1994-09-20 Royal Free Hospital School Of Medicine Process for fractionating polyethylene glycol (PEG)-protein adducts and an adduct for PEG and granulocyte-macrophage colony stimulating factor
ATE135370T1 (en) 1988-12-22 1996-03-15 Kirin Amgen Inc CHEMICALLY MODIFIED GRANULOCYTE COLONY EXCITING FACTOR
IL106271A (en) * 1992-09-03 2008-03-20 Yeda Res & Dev Ligand to the p75 tnf receptor and its preparation
US5395760A (en) * 1989-09-05 1995-03-07 Immunex Corporation DNA encoding tumor necrosis factor-α and -β receptors
US5464938A (en) * 1990-04-09 1995-11-07 Immunex Corporation Isolated viral protein TNF antagonists
US5656272A (en) 1991-03-18 1997-08-12 New York University Medical Center Methods of treating TNF-α-mediated Crohn's disease using chimeric anti-TNF antibodies
EP0506477B1 (en) 1991-03-28 1999-06-23 Merck & Co. Inc. Vascular endothelial cell growth factor C subunit
IL99120A0 (en) 1991-08-07 1992-07-15 Yeda Res & Dev Multimers of the soluble forms of tnf receptors,their preparation and pharmaceutical compositions containing them
WO1994009137A1 (en) * 1992-10-15 1994-04-28 Genentech, Inc. Antibodies against type 2 tumor necrosis factor receptor
EP0672143B1 (en) * 1992-12-04 2008-06-04 Biogen Idec MA Inc. Lymphotoxin-beta, lymphotoxin-beta complexes, pharmaceutical preparations and therapeutic uses thereof
GB9317618D0 (en) 1993-08-24 1993-10-06 Royal Free Hosp School Med Polymer modifications
US5620889A (en) 1993-10-14 1997-04-15 Immunex Corporation Human anti-Fas IgG1 monoclonal antibodies
US5643575A (en) 1993-10-27 1997-07-01 Enzon, Inc. Non-antigenic branched polymer conjugates
US6608182B1 (en) 1994-03-08 2003-08-19 Human Genome Sciences, Inc. Human vascular endothelial growth factor 2
DE69434988T2 (en) 1994-11-07 2008-03-06 Human Genome Sciences, Inc. Tumor necrosis FACTOR GAMMA
US6599719B2 (en) 1994-11-07 2003-07-29 Human Genome Sciences, Inc. Nucleic acid molecules encoding tumor necrosis factor-gamma-alpha
US5928939A (en) 1995-03-01 1999-07-27 Ludwig Institute For Cancer Research Vascular endothelial growth factor-b and dna coding therefor
EP0822984A4 (en) 1995-04-27 2000-05-03 Human Genome Sciences Inc Human tumor necrosis factor receptors
WO1997033904A1 (en) 1996-03-12 1997-09-18 Human Genome Sciences, Inc. Death domain containing receptors
AU5711196A (en) 1996-03-14 1997-10-01 Human Genome Sciences, Inc. Apoptosis inducing molecule i
EP0904278A4 (en) 1996-03-22 1999-09-15 Human Genome Sciences Inc Apoptosis inducing molecule ii
EP1500702A1 (en) * 1996-04-01 2005-01-26 Genentech, Inc. APO-2LI and APO-3 apoptosis polypeptides from the TNFR1 familiy
US6828426B1 (en) 1996-07-15 2004-12-07 Chugai Seiyaku Kabushiki Kaisha VEGF-like factor
CA2260754C (en) 1996-07-15 2012-01-24 Chugai Research Institute For Molecular Medicine, Inc. Novel vegf-like factor
ATE412740T1 (en) 1996-08-16 2008-11-15 Human Genome Sciences Inc HUMAN ALPHA ENDOKINE
EP1947183B1 (en) 1996-08-16 2013-07-17 Merck Sharp & Dohme Corp. Mammalian cell surface antigens; related reagents
DK0956339T3 (en) 1996-08-23 2006-01-30 Licentia Oy Recombinant vascular endothelial cell growth factor D (VEGF-D)
WO1998014565A1 (en) * 1996-10-04 1998-04-09 Immunex Corporation Novel receptor that causes cell death
JP2001503263A (en) 1996-10-25 2001-03-13 ヒューマン ジノーム サイエンシーズ，インコーポレイテッド Neutrokine α
ATE321855T1 (en) 1997-01-14 2006-04-15 Human Genome Sciences Inc TUMOR NECROSIS FACTOR RECEPTOR 5
CN1247567A (en) 1997-01-14 2000-03-15 人体基因组科学有限公司 Tumor necrosis factor receptor alfa 6 and receptor beta 6
DE69837806T3 (en) 1997-01-28 2012-01-05 Human Genome Sciences, Inc. "DEATH-DOMAIN" -INTERDENTING RECEPTOR 4 (DR4), A MEMBER OF THE TNF-RECEPTOR SUPERFAMILY, BINDING ON TRAIL (APO-2L)
JP2001508783A (en) 1997-01-29 2001-07-03 ポリマスク・ファーマシューティカルズ・パブリック・リミテッド・カンパニー PEGylation method
NZ337795A (en) 1997-03-17 2001-06-29 Human Genome Sciences Inc Death domain containing receptor 5 and it's use in the treatment of DR5 related disease
AU7469998A (en) 1997-05-01 1998-11-24 Amgen, Inc. Chimeric opg polypeptides
AU7830398A (en) 1997-06-11 1998-12-30 Human Genome Sciences, Inc. Human tumor necrosis factor receptor tr9

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CELL, 14 June 1996, Vol. 85, MUZIO et al., "FLICE, A Novel FADD-Homologous ICE/CED-3-Like Protease, is Recruited to the CD95 (Fas/APO-1) Death-Inducing Signaling Complex", pages 817-827. *
SCIENCE, 08 November 1996, Vol. 274, CHINNAIYAN et al., "Signal Transduction by DR3, a Death Domain-Containing Receptor Related to TNFR-1 and CD95", pages 990-992. *
TRENDS IN BIOLOGICAL SCIENCES, September 1995, Vol. 20, FEINSTEIN et al., "The Death Domain: a Module Shared by Proteins with Diverse Cellular Functions", pages 342-344. *

Cited By (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8937169B2 (en) 1996-01-11 2015-01-20 Human Genome Sciences, Inc. Human G-protein chemokine receptor HSATU68
US6951735B2 (en) 1996-03-12 2005-10-04 Human Genome Sciences, Inc. Death domain containing receptors
US6759513B2 (en) 1996-03-12 2004-07-06 Human Genome Sciences, Inc. Death domain containing receptors
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
EP1500702A1 (en) * 1996-04-01 2005-01-26 Genentech, Inc. APO-2LI and APO-3 apoptosis polypeptides from the TNFR1 familiy
US6462176B1 (en) 1996-09-23 2002-10-08 Genentech, Inc. Apo-3 polypeptide
US6297022B1 (en) 1997-10-08 2001-10-02 Smithkline Beecham Corporation Method of identifying agonists and antagonists for tumor necrosis related receptor TR1
WO1999041374A2 (en) * 1998-02-17 1999-08-19 Incyte Pharmaceuticals, Inc. Human short-chain tnf-receptor family protein
WO1999041374A3 (en) * 1998-02-17 1999-09-23 Incyte Pharma Inc Human short-chain tnf-receptor family protein
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
EP1178815A4 (en) * 1999-04-22 2003-02-05 Human Genome Sciences Inc Death domain containing receptors
EP1178815A1 (en) * 1999-04-22 2002-02-13 Human Genome Sciences, Inc. Death domain containing receptors
WO2001035995A3 (en) * 1999-11-19 2001-11-22 Thomas V Tittle Tr3-specific binding agents and methods for their use
WO2001035995A2 (en) * 1999-11-19 2001-05-25 Tittle Thomas V Tr3-specific binding agents and methods for their use
US6994976B1 (en) 1999-11-19 2006-02-07 Tittle Thomas V Tr3-specific binding agents and methods for their use
EP2275557A1 (en) 2000-04-12 2011-01-19 Human Genome Sciences, Inc. Albumin fusion proteins
EP2295456A1 (en) 2000-04-12 2011-03-16 Human Genome Sciences, Inc. Albumin fusion proteins
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
EP2216409A1 (en) 2000-04-12 2010-08-11 Human Genome Sciences, Inc. Albumin fusion proteins
EP2236152A1 (en) 2000-04-12 2010-10-06 Human Genome Sciences, Inc. Albumin fusion proteins
EP2267026A1 (en) 2000-04-12 2010-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP2357008A1 (en) 2000-04-12 2011-08-17 Human Genome Sciences, Inc. Albumin fusion proteins
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2311872A1 (en) 2000-04-12 2011-04-20 Human Genome Sciences, Inc. Albumin fusion proteins
EP2298355A2 (en) 2000-04-12 2011-03-23 Human Genome Sciences, Inc. Albumin fusion proteins
EP2431054A2 (en) 2000-06-15 2012-03-21 Human Genome Sciences, Inc. Human tumor necrosis factor delta and epsilon
EP2275449A1 (en) 2000-06-16 2011-01-19 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
EP2281842A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to BLyS
EP2281843A1 (en) 2000-06-16 2011-02-09 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
WO2002002641A1 (en) 2000-06-16 2002-01-10 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to blys
US7306908B2 (en) 2000-10-24 2007-12-11 Shunichi Shiozawa Nucleic acids associated with rheumatoid arthritis, and methods and kits for the diagnosis thereof
WO2002034912A1 (en) * 2000-10-24 2002-05-02 New Ind Res Organization Genomes participating in rheumatoid arthritis, method of the diagnosis thereof, method of evaluating the onset possibility thereof, diagnostic kit for detecting them and therapeutic method and remedies for rheumatoid arthritis
EP2990417A1 (en) 2001-12-21 2016-03-02 Human Genome Sciences, Inc. Albumin insulin fusion protein
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
EP2261250A1 (en) 2001-12-21 2010-12-15 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277889A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and interferon beta
EP2277910A1 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277888A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and erythropoietin
EP3037544A1 (en) 2005-10-13 2016-06-29 Human Genome Sciences, Inc. Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases
EP3502256A2 (en) 2008-09-26 2019-06-26 Tocagen Inc. Recombinant vectors
US9809647B2 (en) 2010-11-19 2017-11-07 Eisai R&D Management Co., Ltd. Neutralizing anti-CCL20 antibodies
US9133273B2 (en) 2010-11-19 2015-09-15 Eisai R&D Management Co., Ltd. Nucleic acids encoding neutralizing anti-CCL20 antibodies
US8765130B2 (en) 2011-03-01 2014-07-01 Novo Nordisk A/S Antagonistic DR3 ligands
US9737612B2 (en) 2011-03-01 2017-08-22 Novo Nordisk A/S Antagonistic DR3 ligands
US9713644B2 (en) 2011-03-01 2017-07-25 Novo Nordisk A/S Antagonistic DR3 ligands
EP3623478A1 (en) 2012-10-25 2020-03-18 Tocagen Inc. Retroviral vector with mini-promoter cassette
US11103579B2 (en) 2013-03-14 2021-08-31 Bristol-Myers Squibb Company Combination of DR5 agonist and anti-PD-1 antagonist and methods of use

Also Published As

Publication number Publication date
US6951735B2 (en) 2005-10-04
US6153402A (en) 2000-11-28
JPH11170A (en) 1999-01-06
US6759513B2 (en) 2004-07-06
US20030077694A1 (en) 2003-04-24
US20020009773A1 (en) 2002-01-24

Similar Documents

Publication Publication Date Title
US6759513B2 (en) Death domain containing receptors
US6342363B1 (en) Death domain containing receptor 4 nucleic acids and methods
US7803615B1 (en) Death domain containing receptor 5
US6261801B1 (en) Nucleic acids encoding tumor necrosis factor receptor 5
US6214580B1 (en) Human tumor necrosis factor receptor tr10
EP1788086A1 (en) Death Domain Containing Receptor 5
EP0898576A1 (en) Death domain containing receptors
AU2006246525A1 (en) Death Domain Containing Receptor 5
MXPA99008486A (en) Death domain containing receptor 5

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG

121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2249182

Country of ref document: CA

Ref country code: CA

Ref document number: 2249182

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1996941942

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97532567

Format of ref document f/p: F

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1996941942

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1996941942

Country of ref document: EP