WO1997013402A1 - Modified bacillus thuringiensis gene for lepidopteran control in plants - Google Patents
Modified bacillus thuringiensis gene for lepidopteran control in plants Download PDFInfo
- Publication number
- WO1997013402A1 WO1997013402A1 PCT/US1996/016582 US9616582W WO9713402A1 WO 1997013402 A1 WO1997013402 A1 WO 1997013402A1 US 9616582 W US9616582 W US 9616582W WO 9713402 A1 WO9713402 A1 WO 9713402A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- plant
- gene
- maize
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
- C07K14/325—Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the present invention relates to the design, synthesis and expression in plants of a DNA sequence that encodes a Bacillus thuringiensis protein that is toxic to specific insects. More particularly, the invention is directed to a synthetic DNA sequence which is optimized for expression in plants, a vector containing the
- a widely used microbial pesticide is derived from the soil microbe Bacillus thuringiensis ( Bt ) .
- Bt is a gram-positive, spore-forming bacterium characterized by parasporal crystalline protein inclusions.
- the crystal protein often referred to as the ⁇ -endotoxin, has two forms: a nontoxic protoxin with an approximate molecular weight (MW) of 130 kilodaltons (kD); and a toxic form having an approximate MW of 68 kD.
- the crystalline protein inclusions contain the protoxin protein which is activated in the gut of larvae of a number of insect species.
- the protoxin is cleaved, the toxic moiety residing in an amino-proximal 58-68 kD polypeptide.
- the crystal is activated by being solubilized and converted to toxic form by the alkalinity and proteases of the insect gut.
- the toxic activity of the protein produced by Bt is highly specific to particular insect species and is recognized as safe to higher vertebrates. Numerous reports have shown that the intrasporal crystal proteins isolated from many strains of Bt possess extremely high levels of toxicity specific for Lepidopteran larvae, oi Coleopteran larvae, with an efrective concentration required to inhibit 50% of larval growth in the range ol 1 ng/ml of diet for the most sensitive insects (Macintosh et al., J. Invert. Pathol. 565 (1990) 258).
- insecticidal protein genes derived from Bt in plants has been extremely difficult, and typically, only low levels of protein have been obtained in transgenic plants (Vaeck et al., Nature, 328 (1987) 33; Barton et al., Plant
- Another possible reason for low levels of expression of the native Bt gene in transgenic plants may be due to fortuitous transcription processing sites which produce aberrant forms of mRNA (International Publication No. WO 93/07278).
- Possible processing sites include polyadenylation sites, intron splicing sites,
- the synthetic gene is at least
- the synthetic gene has GC and TA doublet avoidance indices, based on the frequency in a host gene sequence, that deviates from that of the host plant by no more than about 10-15%, and has a GC content of about 45%.
- International Publication No. WO 93/07278 describes a synthetic Bt crystal protein gene in which codon usage has been altered in order to increase
- the synthetic gene is at least approximately 66. homologous to a native insecticidal protein gene of Bt and 98% homologous to a pure maize optimized gene.
- the synthetic gene has a GC content of from 50-64% and does not have prolines at the 3' end of the sequence.
- the present invention is directed to the design, synthesis, and expression in both bacterial and plant cells of a plant optimized DNA sequence that encodes a Bacillus thuringiensis HD73 protein which is toxic to Lepidopteran insects.
- the invention is further related to a method of designing a synthetic gene.
- the plant optimized DNA sequence comprises codons effective to encocte an insecticidal plant protein (hereinafter ICP with about 589 to about 619 amino acids.
- ICP insecticidal plant protein
- the nucleotide sequence coding for ICP is about 70 to about 71%
- the present invention is also directed to plant expression vectors capable of expression in plant cells, such as maize.
- the plant expression vector comprising in sequence 5' to 3', a promoter sequence effective to initiate transcription in plant cells; a translational enhancer sequence specific to maize; a first vector unique restriction enzyme cleavage site; a coding sequence coding for a protein typically of less than about 620 amino acids, the protein preferably being substantially homologous with the amino-proximal portion of a Bt ICP; a second vector unique restriction enzyme cleavage site; and a polyadenylation sequence.
- Another aspect of the invention is directed to a transgenic plant and seeds from a transgenic plant.
- transgenic plant and seeds from a transgenic plant comprising in their genome the inheritable synthetic Bt gene described herein.
- This Bt synthetic gene is
- the present invention also provides methods of engineering any structural gene so that it may be
- the invention prescribes a method or modifying the genetic sequence of any gene so that the resulting protein that is expressed is unchanged, out the codons are modified to optimize the expression of the protein in the particular plant of interest.
- the codon bias of the plant is determined.
- the codon bias is the statistical codon distribution that the plant uses for coding its proteins. After determining the bias, the percent frequency of the codons in the gene of interest, such as a native Bacillus thuringiensis, is determined.
- the amino acid sequence of the protein of interest is reverse translated so that the resulting nucleic acid sequence codes for the same protein as the native gene, but the resulting nucleic acid sequence corresponds to the first preferred codons of the desired plant.
- the new sequence is analyzed for restriction enzyme sites that might have been created by the modification.
- identified sites are further modified by replacing the codons with second or third choice preferred codons.
- sequences which could affect the transcription or translation of the gene of interest are the exon:intron 5' or 3' junctions, poly A addition signals, or RNA polymerase termination signals.
- the sequence is further analyzed and modified to reduce the frequency of TA or GC doublets.
- G or C sequence blocks that have more than about four residues that are the same can affect
- the invention further provides a doubly
- the invention provides a leader sequence which could be used to enhance the expression of any promoter.
- Fig. 1 illustrates the PCR synthesis strategy.
- Fig. 1A is a graphic representation of the modified ICP gene with key restriction sites indicated above the bar, numbers underneath denote their locations in the gene. The three gene parts that were synthesized separately are shown underneath the gene, the cloning sites incorporated into the ends of each part are shown at the ends of each fragment.
- Fig. 1B sets forth the PCR synthesis of the 5' end fragment of the ICP gene. The 12 oligonucleotides used in the synthesis are indicated by arrows. The direction of the arrows correspond to the polarity of synthesis of the nascent DNA strand. The location of each oligonucleotide in the gene fragment is indicated between the parentheses, the reverse order of the
- nucleotide location of the bottom set of oligonucleotides indicates their reverse complementarity to the top
- Fig. 2 shows the resulting gel from the
- ICP oligonucleotides Bt6 through Bt10 were fractionated by electrophoresis on 12% denaturing PAGE as described in Example 1. Oligonucleotide identities are shown above each lane, and the size of each (nucleotides) is shown below the lane.
- the mobilities of the tracking dyes xylene cyanol (XC) and bromophenol blue (BPB) are shown above each lane, and the size of each (nucleotides) is shown below the lane.
- Fig. 3 shows a gel which illustrates the progression in the synthesis of the three ICP gene parts. For each section, products of PCR steps 1-6 (5' and 3' sections) or 1-5 (center section) are shown in the lanes marked 1-6 or 1-5, respectively. Each lane contains 5 ⁇ l of gel purified DNA from the previous PCR step. Unmarked lanes at the outside of the gel contain 100 bp ladder DNA size standards (GIBCO/BRL).
- Fig. 4 shows a gel that illustrates the
- ICP expressed in E. coli cells from a cytoplasmic expression vector was analyzed by SDS-PAGE and Western blotting as described in Example 4.
- Lane 1 contains an amount of E. coli total cell protein corresponding to about a 50 ng pellet of protein extract of E. coli cells expressing the cytoplasmic expression vector;
- Lane 2 contains about 50 ng of
- cytoplasmic expression vector extract pellet lane 3 contains about 10 ng of pellet extract.
- the negative control lane 4 contains 100 ng of extract pellet of E. coli cells expressing pET-9d.
- Lanes 5, 6 and 7 contain 20, 50 and 100 ng, respectively, of purified native Bt ICP.
- Fig. 5 is a graphical representation which sets forth the results of Manduca sexta bioassays. Feeding assays with 500 ng each of E . coli extract protein (pET-9d pellet), pellet protein from extract of cells
- cytoplasmic expression vector CEV pellet
- CEV cells cytoplasmic expression vector expressing cells
- native ICP Bt protein
- Fig. 6 is a map of plasmid vector pDAB 910 as further described in Example 7.
- Fig. 7 is a map of plasmid vector pDAB 911 as further described in Example 7.
- Fig. 8 is a map of plasmid vector pDAB 917 as further described in Example 7.
- Fig. 9 is a gel that illustrates the expression of ICP in transgenic MSD callus.
- ICP expressed in MSD callus isolates was detected by SDS-PAGE and western blotting as described in Example 8.
- Lanes 1 through 7 contain callus extracts of maize isolates obtained by transformation of MSD line #4 with plasmid pDAB 911;
- lane 8 contains callus extract of nontransformed MSD line #4;
- lanes 9 and 10 contain 10 and 1 ng, respectively, of purified ICP.
- Fig. 10 is a map of plasmid vector pDAB303 as further described in Example 7.
- Fig. 11 illustrates several maps of tested promoters in plasmids pKA882, PDAB305, pDAB310, pDAB348 and pDAB353. More specifically, pKA882 contains the native 35S promoter, as embodied within CaMV nts 6605 to 7439 (MCASTRAS), followed by Linker Sequence A (SEQ. ID. NO. 3)
- pDAB348 contains an enhanced 35S promoter with additional 3' sequences and embodied as nucleotides 7093 to 7344 of CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, followed by the Linker Sequence A from above.
- pDAB305 contains an enhanced 35S promoter with additional 3' sequences and embodied as nucleotides 7093 to 7344 of CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence GGGGACTCTAGAGGATCCAG (SEQ. ID. NO. 4;, nucleotides 167 to 186 of MSV, nucleotides 188 to 277 of MSV, a C residue followed by nucleotides 120 to 210 of maize Adh1.S, nucleotides 555 to 672 of maize Adh1.S, the linker sequence GACGGATCTG (SEQ. ID. NO.
- nucleotides 278 to 317 of MSV nucleotides 278 to 317 of MSV, and a G residue that represents the final base of an Nco I recognition sequence CCATGG.
- the GUS translational start codon is part of the Nco I site.
- Transcripts from this promoter contain as the 5' untranslated leader essentially the MSV coat protein leader sequence, into which has been inserted a deleted version of the maize Adh1.S intror 1.
- pDAB310 contains an enhanced 35S promoter with additional 3' sequences and embodied as nucleotides 7093 to 7344 of CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence GGGGACTCTAGAGGATCCAG (SEQ. ID. NO. 6), nucleotides 167 to 186 of MSV, nucleotides 188 to 317 of MSV, and a G residue that represents the final base of an Nco I recognition sequence, CCATGG.
- the GUS the GUS
- untranslated leader essentially the MSV coat protein leader sequence.
- pDAB353 contains an enhanced 35S promoter with additional 3' sequences and embodied as nucleotides 7093 to 7344 of CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence GGGGACTCTAGAG (SEQ. ID. NO. 7), nucleotides 120 to 210 of maize Adh1.S, nucleotides 555 to 672 of maize Adh1.S, and the sequence CCGTCGACCATGG (SEQ. ID. NO. 8).
- the GUS translational start codon is part of the Nco I site. Transcripts from this promoter contain as the 5' untranslated leader essentially a deleted version of the maize Adh.S intron 1.
- Crystal protein or insecticidal crystal protein (ICP) or crystal toxin refers to the major protein component of the parasporal crystals formed in strains of Bt . This protein component exhibits selective toxicity to different species of insects.
- the molecular size of the major protein isolated from parasporal crystals varies depending on the strain of Bt from which it is derived. Crystal proteins having molecular weights of approximately 132, 65, and 28 kDa have been reporter. It has been shown that the approximately 132 kDa protein is a protoxin that is cleaved to form an amino proximal insect toxin of approximately 65 kDa.
- the crystal protein gene refers to the DNA sequence encoding the insecticidal crystal protein in either full length protoxin or toxin form, depending on the strain of Bt from which the gene is derived.
- nucleotide refers to monomeric unit of DNA or RNA consisting of a sugar moiety (pentose), a phosphate, and a nitrogenous heterocyclic base.
- the base is linked to the sugar moiety via the glycosidic carbon (1' carbon of the pentose).
- the combination of base and sugar is called a nucleoside; the base characterizes the nucleotide.
- the four DNA bases are adenine ("A"), guanine (“G”), cytosine ("C”), and thymine (“T”).
- the four RNA bases are A, G, C, and uracil ("U”).
- a structural gene is that portion of a gene comprising a DNA segment encoding a protein, polypeptide or a portion thereof, and excluding the 5' sequence which drives the initiation of transcription.
- the structural gene may be one which is normally found in the cell or one which is not normally found in the cellular location wherein it is introduced, in which case it is termed a heterol ogous gene .
- a heterologous gene may be derived in whole or in part from any source known to the art, including a bacterial genome or episome, eukaryotic, nuclear or plasmid DNA, cDNA, viral DNA or cnemically synthesized DNA.
- a structural gene may contain one or more modifications in either the coding or the
- the structural gene may be a composite of segments derived from a plurality of sources (naturally occurring or synthetic, where
- the structural gene may also encode a fusion protein.
- Operably linked refers to a juxtaposition wherein the components are configured so as to perform their usual function.
- control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
- Plant tissue includes differentiated and undifferentiated tissues of plants, including, but not limited to, roots, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells in culture, such as single cells, protoplasts, embryos and callus tissue.
- the plant tissue may be in planta or in organ, tissue or cell culture.
- Plant cell as used herein includes plant cells in planta and plant cells and protoplasts in culture.
- Homology refers to identity or near identity of nucleotide or amino acid sequences.
- nucleotide mismatches can occur at the third or wobble base in the codon without causing amino acid substitutions in the final polypeptide sequence.
- minor nucleotide modifications e.g., substitutions, insertions or deletions
- chemically synthesized copies of whole, or parts of, gene sequences can replace the corresponding regions in the natural gene without loss of gene function.
- Homologs of specific DNA sequences may be identified by those skilled in the art using the test of cross-hybridization of nucleic acids under conditions of stringency as is well understood in the art (as described in Hames et al., Nucleic Acid Hybridisation, (1985) IRL Press, Oxford, UK). Extent of homology is often measured in terms of percentage of identity between the sequences compared.
- Preferred codon or frequency of preferred codon usage refers to the preference exhibited by a specific host cell in usage of nucleotide codons to specify a given amino acid. To determine the frequency of usage of a particular codon in a gene, the number of occurrences of that codon in the gene is divided by the total number of occurrences of all codons specifying the same amino acid in the gene. The frequency of preferred codon usage exhibited by a host cell can be calculated by averaging the frequency of preferred codon usage in a large number of genes expressed by the host cell. The percent deviation of the frequency of preferred codon usage for a synthetic gene from that employed by a host cell is calculated first by
- this calculation includes unique codons (i.e., ATG and TGG). In general terms the overall average deviation of the codon usage of a
- X frequency of usage for codon n in the host cell
- Y frequency of usage for codon n in the synthetic gene
- pure plantt optimized nucleotide sequence refers to a gene or DNA sequence comprising 100% of the host plant preferred codon sequences for a
- a pure maize optimized sequence is a gene or DNA sequence which comprises 100% of the maize preferred codon sequence for a particular
- a plant optimized nucleotide sequence refers to a gene or DNA sequence produced from variations of the pure plant optimized sequence.
- the variations as described herein include alterations of the pure plant optimized nucleotide sequence to permit manipulation of the gene, such as by altering a
- nucleotide to create or eliminate restriction sites; and variations to eliminate potentially deleterious
- a maize optimized nucleotide sequence refers to a gene or DNA sequence produced from variations of a pure maize optimized sequence.
- the plant optimized nucleotide sequence is about 70 to about 71% homologous with a native Bt nucleotide sequence encoding ICP, and about 63% homologous based on first choice codon usage and about 83% homologous to a pure maize optimized nucleotide sequence.
- Derived from is used to mean taken, obtained, received, traced, replicated or descended from a source (chemical and/or biological).
- a derivative may be produced by chemical or biological manipulation
- sequence of DNA means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well established procedures (Caruthers, Methodology of DNA and RNA Sequencing,
- the term designed to be highly expressed as used herein refers to a level of expression of a designed gene wherein the amount of its full-length specific mRNA transcripts produced is sufficient to be quantified in Northern blots and, thus, represents a level of specific mRNA expressed corresponding to greater than or equal to approximately 0.001% of the poly (A) +mRNA.
- natural Bt genes were transcribed at levels wherein the amount of full-length specific mRNA produced was insufficient to be estimated using the Northern blot technique.
- the present invention
- the resulting maize optimized Bt ICP gene is identified in SEQ. ID. NO. 1.
- insecticidal gene sequence contains about 63% first choice codons, between about 22% to about 37% second choice codons and between about 15% to about 0. third and/or fourth choice codons, wherein the total percentage is 100%. More preferably, the maize specific optimized insecticidal gene sequence contains about 63% first choice codons, between about 22% to about 37% second choice codons, and between 15% and 0% third choice codons, wherein the total percentage is 100%. Most preferably, the maize specific optimized insecticidal gene sequence contains about 63% first choice codons, at least about 22% second choice codons, about 7.5% third choice codons, and about 7.5% fourth choice codons, wherein the total percentage is 100%.
- B . thuringiensis Cry1A(c) was used as the starting material.
- Analysis of the base composition of the native gene reveals significant disparity from maize genes.
- G+C guanosine plus cytosine
- maize genes fall into the G+C range of 45-75% (Table 1).
- Group I and II storage protein gene sequences were distinguished by their marked difference in base composition.
- the very low G+C content of the native Bt ICP gene results in the generation of sequences mimicking or duplicating plant gene control sequences that are known to be highly A+T rich.
- the presence of some A+T-rich sequences within the DNA of the introduced gene e.g. TATA box regions normally found in gene promoters
- the presence of other regulatory sequences residing in the transcribed mRNA e.g. polyadenylation signal sequences (AAUAAA), or sequences complementary to small nuclear RNAs involved in pre-mRNA splicing
- AAUAAA polyadenylation signal sequences
- one goal in the design of a maize optimized Bt ICP gene was to generate a DNA sequence having a higher G+C content, and preferably one close to that of maize genes coding for metabolic enzymes.
- optimized Bt ICP gene was to generate a DNA sequence that not only has a higher G+C content, but by modifying sequence changes should be made so as to not hinder translation. Due to the plasticity afforded by the redundancy of the genetic code (i.e. some amino acids are specified by more than one codon), evolution of the genomes of different organisms or classes of organisms has resulted in differential usage of redundant codons. This "codon bias" is reflected in the mean base
- composition of protein coding regions For example, organisms with relatively low G+C contents utilize codons having A or T in the third position of redundant codons, whereas those having higher G+C contents utilize cooons having G or C in the third position. It is thought that the presence of "minor" codons within a gene's mRNA may reduce the absolute translation rate of that mRNA, especially when the relative abundance of the charged tRNA corresponding to the minor codon is low.
- restriction enzyme recognition sites desirable base composition, and a lack of sequences that might interfere with transcription of the gene, or translation of the product mRNA.
- Mze HD73 #1 trnc Synthesis of an ICP gene with preferred maize codons.
- a "Maize Genetic Code” was created, wherein each amino acid is specified by a unique codon chosen on the basis of the most commonly occurring maize codons from Table 2 (frequencies as underlined numerals in the "Maize %" columns).
- the native Bt ICP DNA sequence was translated into the corresponding protein sequence, and the amino-terminal 610 amino acids (which comprise the minimal insecticidal peptide of the ICP) were reverse-translated into a new DNA sequence based on the Maize Genetic Code. This sequence,
- Mze HD73 #1 trnc was therefore comprised entirely of "preferred" maize codons and had a G+C content of 66%, somewhat higher than a "typical” maize gene (Table 1).
- the new DNA sequence had 624 base changes from the native Bacillus ICP DNA sequence.
- Mze HD73 #2 trnc Elimination of enzyme recognition sites.
- the restriction enzymes BamH I, Bgl II, Bcl I, and Nco I are routinely used for the
- a DNA sequence that encodes a protein of interest not contain recognition sites for these enzymes.
- Analysis of the DNA sequence of Mze HD73 #1 trnc revealed recognition sequences for three Bcl I sites, three Bgl I sites, two Bgl II sites, one BamH I site, and one Nco I site. Alteration of the DNA sequence in such a fashion as to eliminate these sites forces the use of codons that are not the "preferred" maize codons, but rather are second or lower choice codons.
- nucleotide 249 of the sequence was changed from G to C, changing a leucine codon from CTG (the preferred maize codon, being present 31% of the time, Table 2), to CTC (the second most frequently used leucine codon, occurring 28% of the time).
- CTG the preferred maize codon, being present 31% of the time, Table 2
- CTC the second most frequently used leucine codon, occurring 28% of the time
- the resulting sequence was designated Mze HD73 #2 trnc, and encoded the identical protein as Mze HD73 #1 trnc.
- enzymatic DNA syntheses has an upper limit in the range of a few hundred base pairs for the size of fragments that can be reasonably synthesized in vi tro .
- CTCAG Xh o I recognition site
- GTCAC Xh o I recognition site
- Asp Xh o I recognition site
- GTCGAC Sal I site
- GGTA is found as part of all Kpn I recognition sites [GGTACC] which occur naturally in some plant genes, so it likely does not represent a potential splice donor site per se .
- the Mze HD73 #3 trnc DNA sequence was then searched for sequences similar to or identical with the poly A addition site signal consensus AATAAA. A perfect match was found in the native ICP gene sequence, but no homology was found to this engineered sequence, or shorter versions of it (down to AATA) in Mze HD73 #3 trnc. Sequences resembling an RNA polymerase II termination sequence were searched using the template CAN AGTNNAA, wnere N represents any of the four bases found in DNA. There were no matches at any level with N set 7 to 9.
- Mze HD73 #3 trnc Elimination of TA or GC doublets.
- Eukaryotic genes are relatively deficient in the nucleotide doublets TA and GC, and enriched in doublets TG and CT.
- Only two "preferred" maize codons (Table 2) contain TA or CG doublets: TAC (Tyr) and CGC (Arg).
- TAC (Tyr) and CGC (Arg) The use of these codons in the synthetic sequence necessitates the generation of doublets we wished to avoid. Therefore, the benefit of using the preferred codon must be balanced against the detriment of creating an overabundance of "forbidden" doublets.
- substitution by the second choice codon does not eliminate the TA doublet, since it is also a component of that codon (TAT).
- the second choice codon (AGG) is used in maize only slightly less frequently than the first choice (26% vs 40% of the time), so the substitution of CGC by AGG was completed.
- the other codons that contain TA or CG doublets [GTA (Val); ATA (lle); TAG, TAA (End); TTA, CTA (Leu); GCG (Ala); CGG, CGA, CGT (Art); ACG (Thr); and CCG (Pro)] are either not acceptable for use in coding regions (e.g. the stop codons), are found so infrequently in maize genes that they are not suitable for inclusion in a codon-biased sequence, or are members of codons sets that have acceptable synonyms (Table 2). In addition to occurring within a single codon,
- CG and TA doublets are generated by juxtaposition of codons ending in C or T and codons beginning with G or A. Since none of the maize preferred codons end in T, T/A juxtapositions are necessarily due to doublets internal to single codons, in gene versions using only preferred codons. CG doublets generated by amino acid pairs are located by reviewing the protein sequence for
- C-enders are Gly (GGC), Asp (GAC), Ala (GCC), Arg (CGC, Ser (AGC), Asn (AAC), lie (ATC), Thr (ACC), Cys (TGC), Tyr (TAC), Phe (TTC), His (CAC, and Pro (CCC);
- G-starters are Gly (GGC), Glu (GAG), Asp (GAC), Val (GTG), and Ala (GCC) (Table 5).
- composition by using second (or third) choice codons as long as the natural usage of the codon in maize genes seems to accommodate the choice.
- the frequency of codon occurrence in any organism's genes must be weighted relative to the number of synonymous codons that exist for the particular amino acid in the universal genetic code. For example, the relative frequencies of maize usage of the Phe codon TTT (20%) clearly reflects a greater amount of
- Table 7 summarizes these and other changes made to the sequence of Mze HD73 #3 trnc to generate Mze HD73 #4 trnc.
- Table 8 summarizes the changes made to the sequence of Mze HD73 #4 trnc+ to generate Mze HD73 #5 trnc+.
- CCT substitutes for one another, CCT generates a CT doublet, as well as lowers the G+C content.
- Ser codons AGC and TCC are considered to be interchangeable. Analogous frequency similarities exist for the Val codons GTG and GTC, Leu codons CTG and CTC, and Ala minor codons GCT and GCG.
- TTG and TCT are acceptable when they follow a C-ending codon, so that additional CT doublets are generated.
- TTG offers the added feature of increasing the TG doublet count.
- Arg codon AGG may be substituted for the preferred codon CGC (see discussion in previous section). Although AGG occurs in maize genes at substantially lower frequency than the preferred codon, it is found twice as often as the third choice codon.
- v) Minor codons such as GAT (Asp), GAA (Glu), ATT (lle), ACT (Thr), and GTT (Val), which have obviously been counterselected in maize, should be used sparingly, if possible. It is preferable that they be placed before or after codons that will contribute to the formation of a CT or TG doublet. Because they are a feature of native maize genes, their inclusion in a synthetic gene need not be avoided entirely.
- Mze HD73 #6 trnc+ Only a few changes were made to the sequence of Mze HD73 #5 trnc+ to generate the final version of the gene, Mze HD73 #6 trnc+. (summarized in Table 10).
- Table 12 lists the codon usage patterns of the native Bacillus HD73 gene, the Mze HD73 #1 trnc+ gene, and Mze HD73 #6 trnc+.
- Table 14 set forth below further illustrates the teachings of the method of modifying a gene by using preferred and non-preferred maize codons to make a plant optimized nucleotide sequence.
- 6 of the 8 fourth choice codons are used a total of 47 times out of 618 possible times, or 7.5% of the time.
- MZE HD73 #6 trnc+ is 63% homologous to a pure plant optimized nucleotide sequence.
- a nucleotide sequence corresponding to Mze HD73 #6 trnc+ was synthesized in a series of Polymerase Chain Reactions (PCR) as taught in U.S. Patent No. 4,683,202 to Mullis and U.S. Patent No. 4,683,195 to Mullis et al., by stepwise addition of overlapping oligonucleotides.
- PCR Polymerase Chain Reactions
- the intermediate product is purified, annealed to the next set of overlapping primers, and amplified. Entire genes can thus be synthesized without annealing, ligation, transformation and selection of intermediate reaction products; steps that are necessary with other approaches.
- Taq polymerase the enzyme used in PCR amplification, lacks 3'-5' exonuclease activity, and therefore is unable to 'proofread' the nascent sequence and remove misincorporated nucleotides. Under certain conditions (55oC annealing temperature and 200 ⁇ M
- the polymerase was calculated to misincorporate nucleotides at a frequency of 5 ⁇ 10 -6 (GeIfland et al., PCR Protocols, (1989), Academic Press, Inc., San Diego, CA). The chance that an error occurs in a certain sequence increases with
- Each part upon completion of the synthesis, was designed to contain at each of its ends a unique restriction site. These sites were used to join the individual parts together to construct the contiguous sequence encoding 617 amino acids.
- the 5' part was designed to have unique 5' Nco I and 3' Xho I sites at the ends
- the central part was designed to have unique 5' Xho I and 3' Kpn I sites at the ends
- the 3' part was designed to have unique 5' Kpn I and 3' BamH I sites (see Figure 1A).
- the 5'-most ICP gene fragment of 653 basepairs was synthesized from 12 overlapping 61 to 86 base long oligonucleotides in 6 PCR steps. All oligonucleotides were designed to produce 18 to 20 base overlaps during the successive PCR steps. In each case, synthesis of the fragment was carried out from the "inside-out", as is exemplified in Figure 1B. Step 1 of the synthesis process was begun by annealing of oligonucleotides Bt1 and Bt2. Only in the central area of overlap between the two is the annealed molecule double stranded. The remainder of the molecule was made double stranded by extension with the Taq
- this double stranded molecule was denatured, then annealed to and reamplified with oligonucleotides Bt2 and Bt4.
- this double stranded molecule (corresponding to the sequence of Bt3, Bt1, Bt2 and Bt4) was denatured, annealed to and amplified with
- oligonucleotides Bt5 and Bt6 This process was repeated until the sequence was extended to a 653 bp double stranded molecule corresponding to the entire sequence of the 5' part of the Bt gene (see Figure 1B).
- the 584 bp central fragment was synthesized using 10 overlapping 75 to 83 base long oligonucleotides in 5 PCR steps and the 3'-most ICP gene fragment of 657 bp was synthesized using 12 overlapping 59 to 84 base
- oligonucleotides in 6 PCR steps. Following synthesis, each of the gene parts cloned in pBlueScript ("pBS", Stratagene, La Jolla, CA) vectors were verified by sequence analysis. Corrections, when necessary, were made using a PCR mutagenesis approach. The corrections were resequenced prior to joining of the individual fragments into the complete gene.
- pBS Stratagene, La Jolla, CA
- the Bt ICP gene was constructed from a total of 34 oligonucleotides ranging in size from 59 to 86 nt .
- the sequence of all 34 oligonucleotides is presented in Table 15.
- oligonucleotide was chosen to be G or C; iii) The 5'-most base of each oligonucleotide was chosen adjacent to and downstream of a T residue in the sequence, in order to avoid problems with non-template addition of A
- the maize optimized nucleotide sequence coding for Bt ICP is expressed in plants at an enhanced level when compared to that observed with natural Bt structural genes. Expression of the maize optimized Bt ICP
- nucleotide sequence requires transformation of a plant cell with an appropriate vector.
- the maize optimized nucleotide sequence for Bt ICP was combined with a promoter functional in plants, where the structural gene and the promoter region being in such position and orientation with respect to each other that the
- the structural gene can be expressed in a cell in which the promoter region is active, thereby forming a functional gene.
- the promoter regions include, but are not limited to, bacterial and plant promoter regions.
- the promoter is selected from the group consisting of inducible promoters, constitutive promoters, temporal or developmentally-regulated
- tissue-preferred, and tissue-specific promoters promoters, tissue-preferred, and tissue-specific
- the vector includes an MSV (Maize Streak Virus) leader sequence, a 35S promoter, and an enhancer specific for maize, such as an Adh intron 1 or Adh intron 6 as further described in the Examples.
- MSV Maize Streak Virus
- Adh intron 1 or Adh intron 6 as further described in the Examples.
- the DNA segment carrying the combination is contained by a cell.
- Combinations which include plant promoter regions are contained by plant cells, which, in turn, may be contained by plants or seeds.
- Combinations which include bacterial promoter regions are contained by bacteria, e.g., Bt or E. coli .
- the recombinant DNA molecule carrying a maize optimized Bt ICP gene under promoter control can be introduced into plant tissue by any means known to those skilled in the art.
- the technique used for a given plant species or specific type of plant tissue depends on the known successful techniques. As novel means are
- the doubly enhanced promoters can be used to express foreign genes in maize as well as dicots or other monocots. More specifically, dicots include but are not limited to soybeans, legumes, rapeseed, cotton,
- Monocots include but are not limited to maize, wheat, sorghum, oats, rye, barley, rice, millets, sugar cane and grasses.
- promoters which may be modified with the MSV leader sequence adhl, adh6, or other introns (SEQ. ID. NOS . 43, 44, 45, 46 and 47) include but are not limited to octopine synthase promoter, nopaline synthase promoter and manopine
- Plant promoters can also be further modified by the teachings herein and include but are not limited to ribulose-1, 6-biphosphate (RUBP) carboxylase small subunit (ssu), beta-conglycinin promoter, phaseolin promoter, ADH promoter, actin, ubiquitin, zein, oleosin, napin, ACP, heat-shock promoters, and tissue specific promoters or pollen-specific, embryo specific, corn silk specific, cotton fiber specific, root specific, seed endosperm specific promoters and the like.
- RUBP ribulose-1, 6-biphosphate
- tissue would include but would not be limited to
- hypocotyl, meristem, and the like Almost all plant tissues may be transformed during dedifferentiation using appropriate techniques within the skill of an artisan.
- selectable marker Another variable is the choice of a selectable marker.
- the preference for a particular marker is at the discretion of the artisan, but any of the following selectable markers may be used along with any other gene not listed herein which could function as a selectable marker.
- selectable markers include but are not limited to aminoglycoside phosphotransferase gene of transposon Tn5 (Aph II) which encodes resistance to the antibiotics kanamycin, neomycin and G418, as well as those genes which code for resistance or tolerance to glyphosate; hygromycin; methotrexate; phosphinothncin (bar); imidazolinones, sulfonylureas and
- triazolopyrimidine herbicides such as chlorosulfuron; bromoxynil, dalapon and the like.
- a reporter gene may be used without a selectable marker.
- Reporter genes are genes which are typically not present or expressed in the recipient organism or tissue. The reporter gene typically encodes for a protein which provide for some phenotypic change or enzymatic property. Examples of such genes are provided in K. Weising et al. Ann. Rev. Genetics, 22, 421 (1988), which is incorporated herein by reference.
- a preferred reporter gene is the glucuroindase (GUS) gene.
- the expression of the structural gene may be assayed by any means known to the art, and expression may be measured as mRNA transcribed or as protein synthesized. Techniques are known for the in vitro culture of plant tissue, and in a number of cases, for regeneration into whole plants (EP Appln No. 88810309.0). Procedures for transferring the introduced expression complex to commercially useful cultivars are known to those skilled in the art. Once plant cells expressing the gene under control of a plant expressible promoter are obtained, plant tissues and whole plants can be regenerated
- Oligonucleotides were synthesized on either the Applied Biosystems Inc., DNA synthesizer model 380A or model 390 using 0.2 ⁇ M columns and FOD phosphoramidites and standard cyanoethyl chemistry; synthesis was done in the Trityl-Off mode. Following synthesis on the Model 380A synthesizer, each oligonucleotide was cleaved off the column and deprotected at 50°C for 1 hr. and dried down by evaporation at 50°C. The oligonucleotides were resuspended in 300 ⁇ l TE buffer (10 mM Tris HCl pH 8.0, 1 mM EDTA) and the concentration was determined by
- PAGE 12% denaturing polyacrylamide gels
- a PAGE gel stock solution of 300 mls was made by dissolving 126 g urea in 30 ml 10x Tris Borate EDTA buffer (TBE; 1x TBE is 0.9 M Tris-borate, 2 mM EDTA) and 90 ml 401 acrylamide stock and adjusting the volume of the solution to 300 mls with H 2 O.
- the gel solution was filtered through a 0.2 ⁇ m filter.
- 40 mls of the PAGE stock was used to pour a 5-well gel using a Hoeffer Sturdier gel apparatus. Polymerization was initiated by addition of 350 ⁇ l 10% ammonium persulfate and 35 ⁇ l TEMED prior to pouring.
- Each oligonucleotide was prepared as follows:
- oligonucleotide 300 to 500 ⁇ g was diluted to 60 ⁇ l with TE buffer, then 60 ul of formamide gel loading duffer (10 ml formamide, 10 mg xylene cyanol FF, 10 mg bromophenol blue, 200 ⁇ l 0.5 M EDTA pH 8.0) was added and the sample was boiled for 5 minutes and chilled on ice. The samples were loaded on the gel using a sequencing pipet tip. Electrophoresis was carried out in 1x TBE at 300 volts for 3 hrs.
- the acrylamide gel was transferred to SaranWrapTM, placed on a white background (e.g., X-Ray intensifying screen), and exposed to short wave UV light.
- a white background e.g., X-Ray intensifying screen
- oligo elution buffer 100 mM Tris HCl pH 8.0, 500 mM NaCl, 5 mM EDTA
- the polyacrylamide slurry was filtered through a 3 cc syringe containing a glasswool plug and an attached 0.2 ⁇ m filter.
- the eluted oligonucleotide was concentrated by centrifugation for 2 hrs.
- Figure 2 shows two successful syntheses with the 380A synthesizer (Bt9 and Bt10) and two successful syntheses with the 390
- PCR amplifications were done in 100 ⁇ l reactions containing 20 mM Tris HCl pH 8.3, 1.5 mM MgCl 3 , 25 mM KCl, 200 ⁇ M each of dATP, dGTP, dCTP and dTTP, and 5 units of Taq Polymerase (Perkin Elmer Cetus). Template and PCR primer concentrations varied depending on the step in the protocol.
- template was generated for each fragment by amplification with 0.5 ⁇ M of each of the primers of the first set (see Figure 1) in the following regime: 1 minute denaturation at 94°C, 2 minutes annealing at 55°C and 3 minutes extension at 72°C for 30 cycles, followed by an additional extension period of 7 minutes at 72°C.
- the reaction products were loaded on a 5% native polyacrylamide gel and
- the second PCR step in the synthesis of each fragment was carried out in the same reaction mixture as the first step except that 5 ⁇ l of gel purified product of step 1 was used as template and the oligonucleotide concentration was 0.2 ⁇ M.
- the entire PCR reaction was electrophoresed on a 1% agarose gel and the bands of the expected size were excised and DNA was purified fror the gel slices using the GeneClean Kit (Bi0101) and eluted in a final volume of 50 ⁇ l TE. All subsequent reactions were done as described for step 2.
- Each of the individual PCR steps gave large amounts of product of the expected size. In addition, in most cases bands of double the expected size could be seen, as well as other minor bands.
- PCR reaction amplified the 5' half of the fragment, using a 5' end oligonucleotide and the error-correcting oligonucleotide.
- the other PCR reaction amplified the 3' half of the fragment using the complementary error correction oligonucleotide and a 3' end oligonucleotide.
- the 5' and 3' corrected fragments were gel purified and -joined together in a second step PCR reaction by amplification with only the 5' end and 3' end oligonucleotides as primers.
- Oligonucleotides used in the error correction were synthesized and gel purified as described above. PCR reaction conditions were as described above, except that annealing was done at 50°C and 25 cycles were used. Fragments were gel purified using the GeneClean kit available from Bi0101.
- EXAMPLE 4 E. coli Expression.
- the ICP was inserted as a 1862 base pair Nco I BamH I DNA fragment in the Nco I and BamH I sites of cytoplasmic expression vector pET-9d (Novagen, Madison, WI.).
- One microgram of plasmid was transformed into 0.2 mls of competent cells of E. coli strain BL21 (which was available for purchase from
- IPTG isopropyl- ⁇ -D-thiogalactoside
- the size of the anti-ICP cross-reactive protein produced in E. coli corresponds closely to the size of 68 kD predicted by the sequence of the ICP gene.
- the native ICP is slightly smaller (Mw 66 kD) compared to the product of the modified ICP gene (lanes 5, 6 and 7 .
- the toxin is produced as a 130 kL protoxin. Upon ingestion by Lepidopteran insects, the protoxin is solubilized and activated by proteolytic cleavage. This proteolysis produces an active toxin moiety of 60-70 kD, depending on the strain of B.
- proteolytic processing occurs in the center of the protoxin, and separates the toxin moiety from the C-terminal domain. Processing also occurs at the extreme N-terminus between amino acids Arg 28 and lie 29, and is probably carried out by a serine-type protease. Amino terminal protein sequencing of trypsin activated protoxin of Cry1A(b) and Cry1C
- EXAMPLE 5 Protein Concentrations Expressed by E. coli.
- Protein concentrations were determined using the BioRad protein assay. Proteins were analyzed on 12.5% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE) made in a Hoeffer Mighty Small minigel device, or on a Danchi minigel device according to the
- the membrane was incubated with primary antiserum at a 1:500 dilution in blocking reagent, followed by washing three times in 100 ml TBS-Tween (no milk) at room temperature for 10 minutes.
- the membrane was incubated for 1 hr. in blocking reagent containing secondary antiserum (goat anti-rabbit-IgG conjugated to horseradish peroxidase; Bio-Rad
- ICP signals were scanned with a Model 620 video densitometer (Bio-Rad) and the
- ICP expressed in E. coli and extracted as indicated in Example 4 was used for feeding assays in Manduca sexta (tobacco hornworm). Neonate larvae were allowed to feed on artificial diets into which ICP or control samples were incorporated. After 4 days, their weights and mortality were determined.
- Cauliflower Mosaic Virus (CaMV). They are available as the MCASTRAS sequence of GenBank, and published by Franck et al. (Cell 21 (1980) 285). All of the DNA sequences are given in the conventional 5' to 3' direction.
- the starting material is plasmid pUCl3/35S (-343) as descirbed by Odell et al. (Nature 313 (1985) 810).
- This plasmid comprises, starting at the 3' end of the Sma I site of pUCl3 (Messing, Methods in Enzymology 101 (1983) 20), and reading on the strand contiguous to the noncoding strand of the lacZ gene of pUC13, nucleotides 6495 to 6972 of CaMV, followed by the linker sequence CATCGATG (which encodes a Cla I recognition site., followed by CaMV nucleotides 7089 to 7443, followed by the linker sequence CAAGCTTG, the latter sequence comprising the recognition sequence for Hind III, which is then followed by the remainder of the pUC13 plasmid DNA.
- the blunt-ended DNA was the ligated to synthetic oligonucleotide linkers having the sequence CCCATGGG, which includes an Nco I recognition site.
- the ligation reaction was transformed into competent
- Escherichia coli cells and a transformant was identified that contained a plasmid (named pOO#1) that had an Nco I site positioned at the former Cla I site.
- DNA of pOO#1 was digested with Nco I and the compatible ends of the large fragment were religated, resulting in the deletion of 70 bp from pOO#1, to generate intermediate plasmid pOO#1 Nco ⁇ .
- DNA of pOO#1 Nco ⁇ RV>Cla DNA was digested with Cla I and Nco I, and the small (268 bp) fragment was purifed from an agarose gel. This fragment was then ligated to the 3429 bp Cla I/Nco I fragment of
- pUC13/35S(-343) prepared above in step 1, and an E. coli transformant that harbored a plasmid having Cla I/Nco I fragments 3429 and 268 bp was identified. This plasmid was named pUC13/35S En.
- pUC13/35S En DNA was digested with Nco I, and the protruding ends were made blunt by treatment with T4 DNA polymerase. The treated DNA was then cut with Sma I, and was ligated to Bgl II linkers having the sequence CAGATCTG.
- An E. col i transformant that harbored a plasmid in which the 416 bp Sma I/Nco I fragment had been replaced with at least two copies of the Bgl II linkers was identified, and named p35S En 2 .
- sequences of the CaMV 35S promoter which lie in the region upstream of the EcoR V site in the viral genome (nts 7090 to 7344), have been duplicated.
- This promoter construct incorporates the native 35S transcriptior start site, which lies 11 nucleotides upstream of the first A residue of the Hind III site.
- Plasmids utilizing the 35S promoter and the Agrobacterium NOS Poly A sequences The starting material for the first construct is plasmid pBl221, purchased from
- termination/polyadenylation signal sequences derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, and comprise the 256 bp Sau3A I fragment
- pBl221 DNA was digested with EcoR I and BamH I, and the 3507 bp fragment was purified from an agarose gel.
- pRAJ275 CLONTECH, Jefferson, 1987
- DNA was digested with EcoR I and Sal I, and tie 1862 bp fragment was purified from an agarose gel.
- These two fragments were mixed together, and complementary synthetic oligonucleotides having the sequence GATCCGGATCCG (SEQ. ID. NO. 51) and TCGACGGATCCG (SEQ. ID. NO. 52) were added. [These oligonucleotides when annealed have protruding single-stranded ends compatible with the protruding ends
- DNA of this plasmid was digested with Bal I and Eco RI, and the 4148 bp fragment was isolated from an agarose gel.
- DNA pBl221 was similarly digested, and the 1517 bp Eco RI/Bal I fragment was gel purified and ligated to the above pKA881 fragment, to generate plasmid pKA882.
- pKA882 DNA was digested with Sac I, the protruding ends were made blunt by treatment with T4 DNA polymerase, and the fragment was ligated to synthetic BamH I linkers having the sequence CGGATCCG .
- An E. coli transformant that harbored a plasmid having BamH I fragments of 3784 and 1885 bp was identified and named pKA882B.
- pKA882B DNA was digested with BamH I, and the mixture of fragments was ligated.
- An E. col i transformant that harbored a plasmid that generated a single 3783 bp fragment upon digestion with BamH I was identified and named p35S/NOS.
- This plasmic has the essential DNA structure of pBl221, except that the coding sequences of the GUS gene have been deleted. Therefore, CaMV
- nucleotides 6605 to 7439 are followed by the linker sequence GGGGACTCTAGAGGATCCCGAATTTCCCC (SEQ. ID. NO. 53), where the single underlined bases represent an Xba I site, and the double underlined bases represent a BamH I site.
- the linker sequence is then followed by the NOS Polyadenylation sequences and the rest of pBI221. 4.
- p35S/NOS DNA was digested with EcoR V and Pst I, and the 3037 bp fragment was purified and ligated to the 534 op fragment obtained from digestion of p35S En 2 DNA with EcoR V and Pst I.
- coli transformant was identified that harbored a plasmid that generated fragments of 3031 and 534 bp upon digestion with EcoR V and Pst I, and the plasmid was named p35S En 2 /NOS.
- This plasmid contains the duplicated 35S promoter enhancer region described for p35S En 2 in Example 7A Step 5, the promoter sequences being separated from the NOS polyadenylation sequences by linker sequences that include unique Xba I and BamH I sites.
- This example describes the molecular manipulations used to construct a DNA fragment that includes sequences which comprise the 5' untranslated leader portion of the major rightward transcript of the Maize Streak Virus (MSV) genome.
- the MSV genomic sequence was published by
- SEQ. ID. NO. 55 were synthesized and purified by standard procedures. Annealing of these nucleotides into double-stranded structures leaves 4-base single stranded protruding ends [hereinafter referred to as "sticky ends"] that are compatible with tnose generated by BamH I on one end of the molecule (GATC), and with Hind Ill-generated single stranded ends on the other end of the molecule (AGCT). Such annealed molecules were ligated into plasmid pBluescript SK(-) [hereinafter called pBSK; Stratagene Cloning Systems, LaJolla, CA], that had been digested with BamH I and Hind III.
- pBSK plasmid pBluescript SK(-)
- pMSV A The sequence of these oligonucleotides is such that, when ligated onto the respective BamH I and Hind III sticky ends, the sequences of the respective recognition sites are maintained.
- An E . coli transformant harboring a plasmid containing the oligonucleotide sequence was identified by restriction enzyme analysis, and the plasmid was named pMSV A.
- TCGACCCGGGATTGCCCTGACTTGGTGGTGCTGGTATATTAGGGATAGGGTTGCTCC TATCCAC (SEQ. ID. NO. 57) were synthesized and purified by standard procedures.
- the underlined bases represent the recognition sequence for restriction enzymes Sma I and Xma I.
- Annealing of these nucleotides into double-stranded structures leaves 4-base sticky ends that are compatible with those generated by Hind III on one end of the molecule (AGCT), and with Sal I-generated sticky ends on the other end of the molecule (TCGA).
- the sequence of these oligonucleotides is such that, when ligated onto the Hind III sticky ends, the recognition sequence for Hind III is destroyed.
- DNA of pMSV A was digested with Hind III and Sal I, and was ligated to the above annealed oligonucleotides.
- An E. coli transformant harboring a plasmic containing the new oligonucleotides was identified by restriction enzyme site mapping, and was named pMSV AB.
- TCGAGGGATCCAAGCTTGATATCCCATGGCTGAATGCTTATCCCGTGCCTGGAACAA ATGGC (SEQ. ID. NO. 59) were synthesized and purified by standard procedures.
- the oligonucleotides incorporate bases that comprise recognition sites (underlined) for Nco I (CCATGG), EcoR V (GATATC), Hind III (AAGCTT), and BamH I (GGATCC).
- Annealing of these nucleotides into double-stranded structures leaves 4-base sticky ends that are compatible with those generated by Xma I on one end of the molecule (CCGG), and with Xho I-generated sticky ends on the other end of the molecule (TCGA).
- Such annealed molecules were ligated into pMSV AB DNA that had been digested with Xma I and Xho I.
- oligonucleotide sequence was identified by restriction enzyme analysis, and DNA structure was verified by sequence analysis.
- the plasmid was named pMSV CPL; it contains the A, B and C blocks of nucleotides in
- the starting material is plasmid pVW119, which was obtained from V. Walbot, Stanford University, Stanford, CA.
- This plasmid contains the DNA sequence of the maize Adh1.S gene, including intron 1, from nucleotides 119 to 672 [numbering of Dennis et al. (1984)], and was
- Plasmid pSG3525a(Pst) DNA was digested with BamH I and Bcl I, and the 3430 bp fragment was purified from an agarose gel. [NOTE: The structure of plasmid
- pSG3525a(Pst) is not directly relevant to the end result of this construction series. It was constructed during an unrelated series, and was chosen because it contained restriction recognition sites for both Bcl I and BamH I, and lacks Hind III and Stu I sites. Those skilled in the art will realize that other plasmids can be substituted at this step with equivalent results.] DNA of plasmid pVWlL9 was digested with BamH I and Bcl I, and the gel purified fragment of 546 bp was ligated to the 3430 bp fragment. An E. coli transformant was identified that harbored a plasmid that generated fragments of 3430 and 546 upon digestion with BamH I and Eel I. This plasmid was named pSG AdhA1.
- DNA of pSG AdhA1 was digested with Hind III, [which cuts between bases 209 and 210 of the Dennis et al., (1984) sequence, bottom strand], and with Stu I, which cuts between bases 554 and 555. The ends were made flush by T4 DNA polymerase treatment, and then ligated. An E. coli transformant that harbored a plasmid lacking Hind III and Stu I sites was identified, and the DNA structure was verified by sequence analysis. The plasmid was named pSG AdhA1 ⁇ . In this construct, 344 bp of DNA have been deleted from the interior of the intron 1. The loss of these bases does not affect splicing of this intron. The functional intron sequences are obtained on a 213 bp fragment following digestion with Bcl I and BamH I.
- DNA of plasmid pCPL-Bgl (Example 7C Step 4), was digested with Bgl II, and the linearized DNA was ligated to the 213 bp Bcl I/BamH I fragment containing the deleted version of the Adh1.S intron sequences from pSG AdhA1 ⁇ .
- Bgl II, Bcl I, and BamH I are compatible, but ligation of the BamH I or Bcl I sticky ends onto ones generated by Bgl II creates a sequence not cleaved by any of these three enzymes.
- coli transformant was identified by restriction enzyme site mapping that harbored a plasmid that contained the intron sequences ligated into the Bgl II site, in the orientation such that the Bgl II/Bcl I juncture was nearest the 5' end of the MSV CPL leader sequence, and the Bgl 11/ BamH I juncture was nearest the 3' end of the CPL.
- the plasmid was named pCPL AIII ⁇ .
- the MSV leader/intron sequences can be obtained from this plasmid by digestion with BamH I and Nco I, and purification of the 373 bp fragment.
- DNA of plasmid p35S En 2 /NOS was digested with BamH I, and the 3562 bp linear fragment was ligated to a 171 bp fragment prepared from pMSV CPL DNA digested with BamH I. This fragment contains the entire MSV CPL sequence described in Example 7C.
- An E. coli transformant was identified by restriction enzyme site mapping that harbored a plasmid that contained these sequences in an orientation such that the Nco I site was positioned near the NOS Poly A sequences. This plasmid was named p35S En 2 CPL/NOS.
- DNA of plasmid pKA882 (see Example 7B Step 1) was digested with Hind III and Nco I, and the large 4778 bp fragment was ligated to an 802 bp Hind III/Nco I fragment containing the enhanced 35S promoter sequences and MSV leader sequences from p35S En 2 CPL/NOS.
- transformant harboring a plasmid that contained fragments of 4778 and 802 bp following digestion with Hind III and Nco I was identified, and named pDAB310.
- the enhanced version of the 35S promoter is used to control expression of the GUS gene.
- untranslated leader portion of the transcript contains the leader sequence of the MSV coat protein gene.
- DNA of plasmid pDAB310 was digested with Nco I and Sac I.
- the large 3717 bp fragment was purified from an agarose gel and ligated to complementary synthetic oligonucleotides having the sequences CGGTACCTCGAGTTAAC
- DNA of plasmid pDAB1148 was digested with Bam HI and Nco I, the large 3577 bp fragment was purified from an agarose gel and ligated to a 373 bp fragment purified from pCPL A1I1 ⁇ (Example 7D Step 3) following digestion with Bam HI and Nco I.
- An E. coli transformant was identified that harbored a plasmid with BamH I and Nco I, and the plasmid was named pDAB303.
- This plasmid has the following DNA structure: beginning with the base after the final G residue of the Pst I site of pUC19 (base 435), and reading on the strand contiguous to the coding strand of the lacZ gene, the linker sequence
- ATCTGCATGGGTG (SEQ. ID. NO. 63), nucleotides 7093 to 7344 of CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the linker sequence
- GGGGACTCTAGAGGATCCAG (SEQ. ID. NO. 64), nucleotides 167 to 186 of MSV, nucleotides 188 to 277 of MSV, a C residue followed by nucleotides 119 to 209 of Adh1.S, nucleotides 555 to 672 of maize Adh1.S, the linker sequence
- nucleotide 317 of MSV (including the EcoR I site). It is noteworthy that the junction between nucleotide 317 of MSV and the long polylinker sequence creates an Nco I recognition site.
- DNA of plasmid pDAB303 was digested with Nco I and Sac I, and the 3939 bp fragment was ligated to the 1866 bp fragment containing the GUS coding region prepared from similarly digested DNA of pKA882.
- the appropriate plasmid was identified by restriction enzyme site
- This plasmid has the enhanced promoter, MSV leader and Adh1 intron arrangement of pDAB303, positioned to control expression of the GUS gene.
- DNA of plasmid pKA882 was digested with Xba I and Nco I and the 5687 bp fragment was ligated to annealed synthetic oligonucleotides having the sequence CTAGAGGATC (SEQ. ID. NO. 66) and CATGGATCCT (SEQ. ID. NO. 67).
- oligonucleotides when annealed form a double-stranded structure having Xba I- and Nco I-compatible sticky ends.
- a recombinant plasmid lacking a Sal I site was identified by restriction enzyme mapping, verified by DNA sequence analysis, and was named pDAB349.
- DNA of plasmid p35S En 2 /NOS was digested with Xba I and EcoR I, and the large fragment (3287 bp) was ligated to a 2152 bp fragment containing the GUS coding region and NOS polyadenylation region from similarly-digested pDAB349.
- a plasmid having the appropriate structure was identified by restriction site mapping, and was named pDAB313.
- DNA of plasmid pDAB313 was digested with Xba I and Sac I, and the large 3558 bp fragment was ligated to a
- DNA of plasmid pDAB348 was digested with BamH I, and the large fragment (5437 bp) was ligated to a 213 bp Bcl I/BamH I fragment containing the deleted version of the Adh1.S intron 1, from pSG AdhA1 ⁇ (Example 7D Step 2).
- a plasmid having the appropriate structure was identified by restriction site mapping and was named pDAB353.
- the starting material is plasmid pIC35.
- This plasmid contains the 845 bp Sma I/ Hind III fragment from pUC13 35S (-343) (see Section C of this example), ligated into the Nru I and Hind III sites of pIC19R (Marsh et al.,
- the source of the A. tumefaciens ORF25/26 sequences is plasmid pICl925. This plasmid contains the 713 bp Hinc II fragment
- pIC 19R35/A DNA of plasmid pIC35 was digested with BamH I, and ligated to the 738 bp fragment prepared by digestion of pIC1925 DNA with BamH I and Bgl II. An E. coli transformant was identified that harbored a plasmid in which a BamH I site was present positioned between the 35S promoter fragment, and the ORF 25/26 Poly A fragment. This plasmid was named pIC 19R35/A. (Note: Ligation of the compatible sticky ends generated by BamH I and Bgl II generates a sequence that is not a recognition site for either enzyme.)
- pIC35/A DNA of pIC 19R35/A was digested with Sma I at its unique site, and the DNA was ligated to Bgl II linkers having the sequence CAGATCTG. [NOTE: The tandomization of these Bgl II linkers generates, besides Bgl II recognition sites, also Pst I recognition sites, CTGCAG] . An E. coli transformant was identified that had at least two copies of the linkers (and therefore new Bgl II and Pst I sites) at the position of the former Sma I site. This plasmid was named pIC35/A.
- pIC 20R ⁇ DNA of plasmid pIC 20R (Marsh et al.,
- pSG Bgl 3525 (Pst) DNA of pIC 20R ⁇ was digested with Bgl II, and was ligated to the 1625 bp Bgl II fragment of pIC35/A.
- An E. coli transformant was
- pSG 3525 a DNA of pSG Bgl 3525 (Pst) was digested with Bgl II under conditions in which only one of the two Bgl II sites of the molecule were cleaved.
- the 4301 bp linear fragments were ligated to synthetic adapter oligonucleotides having the sequence GATCGTGA
- TCAC SEQ. ID. NO. 68
- the underlined bases represent the Bcl I recognition sequence.
- An E. coli transformant was identified that had a Bcl I site at the position of the former Bgl II site positioned 5' to the 35S promoter. This plasmid was named pSG 3525 a (Pst).
- pDAB 218 DNA of plasmid pIJ4104 (see Example 8) was digested with Sma I, and the 569 bp fragment was purified from an agarose gel. DNA of plasmid pSG 3525 a (Pst) (see above) was linearized by digestion at the unique Hin c II that lies between the 35S promoter and ORF 25 poly A sequences, and the linear fragment was ligated to the 569 bp bar gene fragment. An E . coli transformant was identified by restriction enzyme site mapping that harbored a plasmid that contained the jbar gene in the orientation such that Bgl II digestion generated
- pDAB 218 DNA of plasmid pDAB 218 was digested with Bcl I, and the linear fragment of 4882 bp was ligated to a 3133 bp Bgl II fragment prepared from DNA of pKA882-2xBg (see step 10 below). The latter fragment contains the GUS coding region, under the transcriptional control of the 35S promoter, with the Nos Poly A transcription termination signals.
- An E. coli transformant was
- This plasmid was named pDAB 219.
- DNA of plasmid pDAB 219 was used as the template for the polymerase chain reaction (PCR, (Saiki et al.,
- Primer i) represents nucleotides 419 to 446 of pDAB
- the single underlined bases in Primer n) represent the recognition sequence of BamH I, and the double underlined oases represent nucleotides 1138 to 1159 of pDAB 219, and correspond to nucleotides 21728 to 21749 of the ORF 25
- pKA882-Bg pKA882 DNA was digested with Pst I, and the linear fragments were ligated to synthetic adaptors having the sequence CAGATCT GTGCA (SEQ. ID. NO. 71) (Note: When annealed, these molecules form double stranded molecules that have sticky ends compatible with those generated by Pst I. Ligation of such molecules to Ps t I digested DNA results in a sequence that is no longer cleaved by Pst I, and introduces a new Bgl II site.). An E . coli transformant was identified that harbored a plasmid that was not cleaved by Pst I, and that had a unique Bgl II site. The plasmid was named pKA882-Bg.
- pKA882-2xBg DNA was digested with EcoR I, and the linear fragments were ligated to synthetic adaptors having the sequence AATTGAGATCTC (SEQ. ID. NO. 72). Ligation of annealed such molecules to EcoR I digested DNA results in a sequence that is no longer cleaved by EcoR I, and introduces a new Bgl II site. An E. coli transformant was identified that harbored a plasmid that was not cleaved by EcoR I, and that
- This plasmid was named pKA882-2xBg.
- pDAB 305 Bg Plasmid pDAB305 was digested to completion with EcoR I, and the linearized DNA was ligated to kinased, self-complementary oligonucleotide adapters having the sequence AATTGAGATCTC (SEQ. ID. NO. 73). Ligation of this adapter to the overhanging ends generated by EcoR I recircularized the plasmid DNA, introduced a new Bgl II recognition site, and destroyed the former EcoR I recognition site. The resulting plasmid was named pDAB 305 Bg.
- EXAMPLE 8 Construction of plant transformation vectors containing the bar gene of Streptomyces hygroscopicus
- the starting material is plasmid pIJ4104 (White et al., Nucl. Acid Res. 18 (1990) 1062), which contains the coding region of the bar gene of S . hygroscopicus, and was obtained from M.J. Bibb (John Innes Institute, Norwich, United Kingdom).
- the bar gene encodes the enzyme phosphinothricin acetyl transferase (PAT).
- pDAB 219 ⁇ DNA of plasmid pDAB 219 was
- This plasmid was named pDAB 219 ⁇ .
- the DNA sequence of pDAB 219 ⁇ is as follows: Beginning with the base following the last A residue of the Xba I site on the lac Z coding strand of pIC20R (Marsh et al., Gene, 32 (1984) 481), the linker TCCTGATCTGTGCA GGTCCCC (SEQ. ID. NO. 74), followed by CaMV nucleotides 6605 to 7439, followed by the linker sequence
- GGGGACTCTAGAGGATCCGGATCCGTCGACCATGGTC SEQ. ID. NO. 75
- the underlined bases represent the codons for the first two amino acids of the GUS protein, the second of which was changed from leucine in the original E. coli uid A gene (Jefferson et al., (Proc. Natl. Acad. Sci., 83 (1986) 8447) to valine in pRAJ275 (Jefferson et al., Plant Molec. Biol, Reporter, 5 (1987) 387). These bases are followed by the linker sequence
- GGGGAATTGGAGAGCTCGAATTTCCCC (SEQ. ID. NO. 76), then by bases 1298 to 1554 of the Nos Poly A sequence (DePicker et al., J. Molec. Appl. Genet., 1 (1982) 5561).
- the linker sequence GGGAATTGAGATCAGGATCTCGAGCTCGGG (SEQ. ID. NO. 77) is followed by bases 6495 to 6972 of CaMV, the linker CATCGATG, and CaMV bases 7090 to 7443. These bases are followed by the linker CAAGCTTGGCTGC AGGTC (SEQ. ID. NO. 78), then by bases corresponding to
- nucleotides 20 to 579 of the bar clone in pIJ4104 (White et al., Nucl. Acids Res. 18 (1990) 1062), the linker CTGTGATAACC (SEQ. ID. NO. 79), ORF 25/26 poly A
- recognition site (underlined) represents a unique site into which other genes may be introduced.
- the Bt ICP gene was subcloned into three
- the ICP gene was cloned in plasmid pDAB305Bg.
- the BamH I site situated downstream of the ICP gene was modified to a Ss t I site by insertion of a BamH I/ Ss t I adapter.
- the 1854 base pair Nco I-Sst I fragment carrying the ICP gene was inserted under the control of the high expression doubly enhanced 35S promoter and the nopaline synthase (Nos) poly A addition sequences, resulting in plasmid pDAB910 ( Figure 6).
- the enhanced 35S/Bt/Nos cassette was subcloned from pDAB910, as a 3150 base pair Bgl II fragment, into the unique Bgl II site of pDABl99, where the preparation of this plasmid is
- EXAMPLE 9 Construction of a Reference Gene Encoding Firefly Luciferase.
- GUS protein Production of the GUS protein from genes controlled by different promoter versions was often compared relative to an internal control gene that produced firefly luciferase (DeWet et al., Molec. Cell Biol. 7 (1987) 725).
- a plasmid (pT3/T7-1 LUC) containing the luciferase (LUC) coding region was purchased from CLONTECH (Palo Alto, CA), and the coding region was modified at its 5' and 3' ends by standard methods.
- sequences surrounding the translational start (ATG) codon were modified to include an Nco I site (CCATGG) and an alanine codon (GCA) at the second
- an Ssp I recognition site positioned 42 bp downstream of the Stop codon of the luciferase coding region was made blunt ended with T4 DNA polymerase, and ligated to synthetic oligonucleotide linkers encoding the Bgl II recognition sequence.
- the 5' untranslated leader of the primary transcript includes the modified MSV leader/Adh intron sequence.
- EXAMPLE 10 Cell Transformation. Cell suspension cultures derived from immature maize microspores were used as the starting plant
- microspore-derived (MSD) cultures were maintained as described by Mitchell et al., J. Plant Physiol., 137 (1991) 530. The cultures are haploid, and some cell lines were capable of regenerating haploid plants. Eight- to 20-month old cell suspension cultures were used for protoplast isolation. The protoplast density was adjusted to 4 ⁇ 10 6 protoplasts/ml of
- plasmid DNA in 20-40 ⁇ l sterile 1.0 mM Tris, pH 8.0, 1.0 mM EDTA, was placed in a one ml polystyrene electroporation cuvette
- isolates could be observed and selected. From a total of four transformation experiments with the mentioned plasmids, over 400 isolates were selected. These callus isolates were grown on the same medium until enough tissue was accumulated for further analysis.
- Embryogenic callus cultures were initiated from immature embryos of genotypes specially bred for
- B73x (B73xA188), and n) "High II” is a hybrid made by intermating two S 3 lines derived from a B73xA188 cross. When exposed to appropriate cultural conditions, immature embryos from both of these genotypes display consistently high levels of callus formation capable of fertile plant regeneration.
- Ambient daylight was supplemented with a combination of high pressure sodium and metal halide lamps such that the minimum light intensity 2 m above pot level was
- Greenhouse temperature was maintained within 3°C of 28°C during the day and 22°C at night.
- the plants were irrigated as needed with a solution containing 400 mg/L of 20-20-20 fertilizer (W.R. Grace & Co., Fogelsville, PA), plus 8 mg/L chelated iron (CIBA-GEIGY, Greensboro, NC).
- the ear was excised and surface sterilized by emersion in 70% v/v ethanol for 10 minutes followed by soaking in 20% v/v commercial bleach (1% sodium hypochlorite) for 30 minutes. Following a sterile, distilled water rinse, immature embryos were aseptically isolated and placed onto an "initiation" medium with the embryo axis in contact with the medium (scutellar-side away from the medium).
- the "initiation" medium consisted of the following components: N6 basal salts and vitamins (Chu, Proc. Symp. Plant Tissue Culture, (1978), Peking Press, pp.
- the immature embryos were incubated at 28°C in the dark for 10-30 days during which time callus tissue, displaying various types of morphology, proliferated from the scutellar region.
- the callus tissue produced during this time was classified into three distinct types: i) soft, granular, translucent callus lacking any apparent morphological organization (known as nonembrogenic), n) compact, nodular, yellowish-to-white callus consisting of groups of somatic embryos (often fused) with distinct scutellar- and coleoptile-like structures (known as Type I), and in) soft callus with numerous globular and elongated somatic embryos on suspensor-like structures (known as Type II).
- Type II callus was the most suitable for establishing friable, embryogenic cultures.
- the “Maintenance” medium differed from the "initiation” medium in that it contained 690 mg/L proline and no AgNO 3 . After 8-16 weeks of
- plasmid DNA containing coding sequences for selectable and screenable marker genes.
- the selectable marker gene was bar which encodes for the enzyme phosphinothricin acetyltransferase (PAT) and confers resistance to the herbicide BastaTM.
- the screenable marker gene was uidA which encodes for ⁇ -glucuronidase (GUS), the activity of which was monitored histochemically. Both genes were driven by the 35S constitutive promoter from Cauliflower Mosaic Virus. In this way, rare transformed cells were selected out of a background of non-transformed tissue by exposure to the herbicide BastaTM and tested for the presence of ⁇ - glueuronidase activity using a histochemical assay which turned positive tissue blue.
- Plasmid DNA was adsorbed onto the surface of gold particles prior to use in transformation
- the gold particles were spherical with diameters ranging from about 1.5-3.0 microns (Aldrich Chemical Co., Milwaukee, WI). Adsorption was
- DNA/gold suspension 140 ug pDAB917, 0.01 M Tris buffer, and 1mM EDTA.
- DNA-coated gold particles were then resuspended in 1 mL of 100% ethanol. The suspension was then diluted to 15 mg DNA/gold per mL of ethanol for use in helium blasting experiments.
- callus tissue was allowed to incubate for 1-2 days under the conditions described previously. Each tissue sample was then divided into approximately 60 equal pieces (1-3 mm diameter) and transferred to fresh "maintenance" medium containing 30 mg/L BastaTM. Every three weeks, callus tissue was non- selectively transferred (with no regard for tissue morphology) to fresh BastaTM-containing "maintenance” medium. At this concentration of herbicide, very little growth occurred. After 8-16 weeks, sectors proliferating from a background of growth inhibited tissue were
- the "regeneration” medium was composed of MS salts and vitamins, 30 g/L sucrose, and 2.5 g/L gelrite adjusted to pH 5.7. Every 14-21 days the callus was subcultured to fresh "regeneration” medium selecting for tissue which appeared to be differentiating leaves and roots. Both "induction” and “regeneration” media contained 30 mg/L BastaTM. Plantlets were transferred to 10 cm pots containing approximately 0.1 kg of dry soil mix, and were then moistened thoroughly and covered with clear plastic cups for approximately 4 days. At the 3-5 leaf stage, plants were transplanted to larger pots and grown to maturity as previously described. Self- or sibling-pollinations were performed on plants regenerated from the same culture or crossed to non-transformed seed- derived plants in order to obtain transgenic progenies.
- Example 11 Using the procedures and transgenic progency described in Example 11, four (4) transgenic inbreds were prepared using conventional breeding techniques. The resulting inbreds were used to develop four transgenic hybrids.
- Seed from each of four (4) transgenic hybrids were planted in single row plots using a randomized complete block design. Locations included research stations in Indiana, Illinois, Minnesota, and Iowa.
- Control plots were used to measure the amount of insect damage due to natural (Control A) and artificial infestations (Control B).
- protoplasts were heat shocked for 5 min at 42°C, then placed on ice until use. Aliquots of about 2 ⁇ 10 6 protoplasts were electroporated with the appropriate DNA mixture in a 1 ml volume. Typically DNA mixtures
- test plasmid DNA contained (per 2 ⁇ 10 6 protoplasts in 1 ml), 60 ug of test plasmid DNA and 4.5 ug of reference plasmid DNA.
- Electroporation conditions were: 1500 uF, 200-400V across a 1 cm gap, pulse time of 25 msec (Promega Model 240/250, Madison, WI). Following electroporation, the protoplasts were placed on ice for 10 min, then plated into plastic Petri dishes (previously coated with a thin layer of 1.2% SeaPlaque agarose; FMS BioProducts, Rockland, ME)
- Fluorometric assays for GUS activity using 4-methyl-umbelliferyl-glucuronide as a substrate were essentially as described by Jefferson (Plant Molec. Biol. Reporter 5 (1987) 387), and assays for luciferase
- EXAMPLE 14 Cloning of Intron 6 This example describes the cloning of intron 6 of the maize Adh1.S gene and its incorporation into the synthetic 5' untranslated leader sequence derived from the Maize Streak Virus coat protein gene (MSV/CPL, see above).
- the starting material is plasmid pB428,
- TTCAGTGGATCCGAACTTCCTAGCTGAAAAATGGG SEQ. ID. NO. 82.
- These primers contain the recognition sequences for Bcl I (TGATCA, underlined in forward primer), and BamH I,
- GGATCC underlined in reverse primers. They are designed to introduce the Be I site immediately before nucleotide 2162, and the BamH I site immediately
- Reactions (100 ul final volume) contained, besides template and primers, 1 ⁇ PCR reaction buffer (as described in Example 2), 0.2 mM final concentration of dATP, dTTP, dGTP, and dCTP, and 5 units of Taq DNA polymerase (Perkin Elmer/Cetus). Temperature cycles were: 94° (1 min; 25 cycles of 94° (1 min), 55° (30 sec), 72° (30 sec), followed by an extension period of 72°, 10 min. Appropriate-sized fragments were extracted from an agarose gel, digested with restriction enzymes Bcl I and BamH I, and ligated into Bgl II-digested DNA of pCPL-Bg (see above). A plasmid was identified that had an appropriate restriction enzyme map, and was named pCPL-Adh6. The structure of pCPL-Adh6 is as follows
- Example 7C step 1 the linker sequence GGATCCAG that includes a BamH I recognition site, nucleotides 167 to 186 of MSV, nucleotides 188 to 277 of MSV, the linker sequence GATCA, nucleotides 2162 to 2534 of maize Adh1.S, the linker sequence GGATCTG, and finally nucleotides 278 to 317 of MSV, including an Nco I recognition sequence (SEQ. ID. NO. 84).
- the MSV leader/intron sequences can be obtained from this plasmid by digestion with BamH I and Nco I, and purification of the 541 bp fragment. This fragment is therefore the functional equivalent of the analogous fragment containing the Adh1.S intron 1 fragment utilized in palsmids described in Examples 7 and 13.
- nucleotide sequence coding for an insecticial protein from Bt having the nucleotide SEQ. ID. NO. 1 and amino acid SEQ. ID. NO. 2 is shown in Table 22.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Insects & Arthropods (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Pest Control & Pesticides (AREA)
- Gastroenterology & Hepatology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Catching Or Destruction (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002234656A CA2234656C (en) | 1995-10-13 | 1996-10-11 | Modified bacillus thuringiensis gene for lepidopteran control in plants |
| EP96936576A EP0861021B1 (en) | 1995-10-13 | 1996-10-11 | Modified bacillus thuringiensis gene for lepidopteran control in plants |
| AU74467/96A AU708256B2 (en) | 1995-10-13 | 1996-10-11 | Modified bacillus thuringiensis gene for lepidopteran control in plants |
| JP51530097A JP4030582B2 (en) | 1995-10-13 | 1996-10-11 | Modified Bacillus thuringiensis genes for lepidopteran control in plants |
| IL12402096A IL124020A (en) | 1995-10-13 | 1996-10-11 | Plant optimized nucleotide sequence that encodes an insecticidal crystal protein |
| BR9611000-7A BR9611000A (en) | 1995-10-13 | 1996-10-11 | Plant-optimized nucleotide sequence and corn-specific optimized insecticidal gene, synthetic genetic construction capable of expression in plant cells, transgenic plant, only plants, process of building a corn-specific optimized insecticide gene sequence and recombinant promoter. |
| DE69638032T DE69638032D1 (en) | 1995-10-13 | 1996-10-11 | MODIFIED BACILLUS THURINGIENSIS GENE FOR THE CONTROL OF LEPIDOPTERA IN PLANTS |
| AT96936576T ATE443437T1 (en) | 1995-10-13 | 1996-10-11 | MODIFIED BACILLUS THURINGIENSIS GENE FOR CONTROL OF LEPIDOPTERA IN PLANTS |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US540595P | 1995-10-13 | 1995-10-13 | |
| US60/005,405 | 1995-10-13 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO1997013402A1 true WO1997013402A1 (en) | 1997-04-17 |
Family
ID=21715689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1996/016582 Ceased WO1997013402A1 (en) | 1995-10-13 | 1996-10-11 | Modified bacillus thuringiensis gene for lepidopteran control in plants |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US6166302A (en) |
| EP (1) | EP0861021B1 (en) |
| JP (1) | JP4030582B2 (en) |
| CN (1) | CN1176577C (en) |
| AT (1) | ATE443437T1 (en) |
| AU (1) | AU708256B2 (en) |
| BR (1) | BR9611000A (en) |
| CA (1) | CA2234656C (en) |
| DE (1) | DE69638032D1 (en) |
| ES (1) | ES2330168T3 (en) |
| IL (1) | IL124020A (en) |
| RU (1) | RU2224795C2 (en) |
| WO (1) | WO1997013402A1 (en) |
Cited By (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999006568A1 (en) * | 1997-07-31 | 1999-02-11 | Mycogen Corporation | Bacillus thuringiensis cry6-toxins with improved activity |
| WO1999024581A3 (en) * | 1997-11-12 | 1999-09-30 | Mycogen Corp | Plant-optimized genes encoding pesticidal toxins |
| WO1999050430A2 (en) | 1998-03-30 | 1999-10-07 | Dow Agrosciences Llc | Modification of fatty acid composition in plants by expression of an aspergillus nidulans delta-9 coa desaturase |
| WO2000011185A3 (en) * | 1998-08-19 | 2000-06-02 | Monsanto Co | Improved expression of cry3b insecticidal protein in plants |
| WO2001011029A1 (en) * | 1999-08-11 | 2001-02-15 | Dow Agrosciences Llc | Transgenic plants expressing photorhabdus toxin |
| US6340593B1 (en) | 1998-10-23 | 2002-01-22 | Mycogen Corporation | Plant-optimized polynucleotides encoding approximately 15 kDa and approximately 45 kDa pesticidal proteins |
| JP2002509865A (en) * | 1998-01-16 | 2002-04-02 | ノバルティス アクチエンゲゼルシャフト | Use of neonicotinoids on transgenic plants |
| US6501009B1 (en) | 1999-08-19 | 2002-12-31 | Monsanto Technology Llc | Expression of Cry3B insecticidal protein in plants |
| EP0900842A3 (en) * | 1997-09-01 | 2004-01-02 | National Agricultural Research Organisation (NARO) | Artificially synthesized gene for trypsin inhibitor |
| US6740342B1 (en) * | 1999-01-06 | 2004-05-25 | Cooperatieve Verkoop-En Productievereniging Van Aardappelmeel En Derivaten Avebe B.A. | Separating and recovering components from plants |
| WO2005002359A3 (en) * | 2003-05-22 | 2005-12-29 | Syngenta Participations Ag | Modified starch, uses, methods for production thereof |
| EP2019115A2 (en) | 2002-06-28 | 2009-01-28 | Dow AgroSciences LLC | Pesticidally active proteins and polynucleotides obtainable from paenibacillus species |
| WO2010108114A2 (en) | 2009-03-19 | 2010-09-23 | Martek Biosciences Corporation | Polyunsaturated fatty acid synthase nucleic acid molecules and polypeptides, compositions, and methods of making and uses thereof |
| WO2010120452A1 (en) | 2009-04-17 | 2010-10-21 | Dow Agrosciences Llc | Dig-3 insecticidal cry toxins |
| EP2258856A1 (en) | 1998-02-20 | 2010-12-08 | Syngenta Limited | Hybrid seed production |
| EP2298901A2 (en) | 2004-04-30 | 2011-03-23 | Dow AgroSciences LLC | Novel herbicide resistance genes |
| WO2011075588A1 (en) | 2009-12-16 | 2011-06-23 | Dow Agrosciences Llc | COMBINED USE OF CRY1Ca AND CRY1Fa PROTEINS FOR INSECT RESISTANCE MANAGEMENT |
| WO2011163632A2 (en) | 2010-06-24 | 2011-12-29 | Dow Agrosciences Llc | Lowering saturated fatty acid content of plant seeds |
| WO2012016222A2 (en) | 2010-07-29 | 2012-02-02 | Dow Agrosciences Llc | Strains of agrobacterium modified to increase plant transformation frequency |
| WO2012074868A2 (en) | 2010-12-03 | 2012-06-07 | Ms Technologies, Llc | Optimized expression of glyphosate resistance encoding nucleic acid molecules in plant cells |
| EP2484202A1 (en) | 2005-10-28 | 2012-08-08 | Dow AgroSciences LLC | Novel herbicide resistance genes |
| US8513492B2 (en) | 1997-12-18 | 2013-08-20 | Monsanto Technology Llc | Coleopteran-resistant transgenic plants and methods of their production |
| WO2015051075A1 (en) | 2013-10-04 | 2015-04-09 | Dow Agrosciences Llc | Zea mays metallothionein-like regulatory elements and uses thereof |
| WO2015081270A1 (en) | 2013-11-26 | 2015-06-04 | Dow Agrosciences Llc | Production of omega-3 long-chain polyunsaturated fatty acids in oilseed crops by a thraustochytrid pufa synthase |
| WO2015109241A1 (en) | 2014-01-17 | 2015-07-23 | Dow Agrosciences Llc | Increased protein expression in plants |
| WO2015130931A1 (en) | 2014-02-28 | 2015-09-03 | Dow Agrosciences Llc | Root specific expression conferred by chimeric gene regulatory elements |
| WO2015195594A2 (en) | 2014-06-20 | 2015-12-23 | Dow Agrosciences Llc | Vegetative insecticidal proteins useful for control of insect pests |
| US9234208B1 (en) | 2010-05-10 | 2016-01-12 | Dow Agrosciences Llc | DIG-13 insecticidal cry toxins |
| WO2016109212A1 (en) | 2014-12-30 | 2016-07-07 | Dow Agrosciences Llc | MODIFIED Cry1Ca TOXINS USEFUL FOR CONTROL OF INSECT PESTS |
| US9434773B2 (en) | 2011-09-14 | 2016-09-06 | Dow Agrosciences Llc | Plants having stress related traits and methods for making the same |
| WO2016168229A1 (en) | 2015-04-15 | 2016-10-20 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2016168230A2 (en) | 2015-04-15 | 2016-10-20 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2017030843A1 (en) | 2015-08-17 | 2017-02-23 | Dow Agrosciences Llc | Engineered cry6a insecticidal proteins |
| WO2017053164A1 (en) | 2015-09-22 | 2017-03-30 | Dow Agrosciences Llc | Plant promoter and 3' utr for transgene expression |
| US9624505B2 (en) | 2007-05-09 | 2017-04-18 | Dow Agrosciences Llc | Uses and detection of herbicide resistance genes for resistance to aryloxyalkanoate herbicides |
| WO2017070298A1 (en) | 2015-10-22 | 2017-04-27 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2017078935A1 (en) | 2015-11-04 | 2017-05-11 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| US9725730B2 (en) | 2013-12-31 | 2017-08-08 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| WO2017180180A2 (en) | 2015-09-22 | 2017-10-19 | Dow Agrosciences Llc | Plant promoter and 3' utr for transgene expression |
| WO2017194683A1 (en) | 2016-05-12 | 2017-11-16 | Dsm Ip Assets B.V. | Method of increasing omega-3 polyunsaturated fatty acids production in microalgae |
| WO2018063870A1 (en) | 2016-09-30 | 2018-04-05 | Dow Agrosciences Llc | Binary insecticidal cry toxins |
| WO2018067265A1 (en) | 2016-10-03 | 2018-04-12 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2018067264A1 (en) | 2016-10-03 | 2018-04-12 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| US10030247B2 (en) | 2013-12-31 | 2018-07-24 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US10030246B2 (en) | 2013-12-31 | 2018-07-24 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US10036028B2 (en) | 2013-12-31 | 2018-07-31 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US10047368B2 (en) | 2013-10-15 | 2018-08-14 | Dow Agrosciences Llc | Zea mays regulatory elements and uses thereof |
| US10047367B2 (en) | 2013-10-15 | 2018-08-14 | Dow Agrosciences Llc | Zea mays regulatory elements and uses thereof |
| WO2019046776A1 (en) | 2017-08-31 | 2019-03-07 | Dow Agrosciences Llc | Compositions and methods for expressing transgenes using regulatory elements from chlorophyll binding ab genes |
| WO2019089402A1 (en) | 2017-10-30 | 2019-05-09 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2019125651A1 (en) * | 2017-12-19 | 2019-06-27 | Pioneer Hi-Bred International, Inc. | Insecticidal polypeptides and uses thereof |
| EP3654763A1 (en) | 2017-06-28 | 2020-05-27 | Dow Agrosciences LLC | Plant promoter for transgene expression |
| WO2023084416A1 (en) | 2021-11-09 | 2023-05-19 | Benson Hill, Inc. | Promoter elements for improved polynucleotide expression in plants |
| WO2023111961A1 (en) | 2021-12-15 | 2023-06-22 | Benson Hill, Inc. | Spatio-temporal promoters for polynucleotide expression in plants |
| WO2024127362A1 (en) | 2022-12-15 | 2024-06-20 | Benson Hill, Inc. | Spatio-temporal promoters for polynucleotide expression in plants |
Families Citing this family (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1002091B1 (en) * | 1997-07-09 | 2012-02-29 | Coridon Pty Limited | Nucleic acid sequence and method for selectively expressing a protein in a target cell or tissue |
| AUPP058797A0 (en) * | 1997-11-28 | 1997-12-18 | Commonwealth Scientific And Industrial Research Organisation | Novel gene |
| KR101152465B1 (en) * | 2003-05-02 | 2012-07-04 | 다우 아그로사이언시즈 엘엘씨 | Corn event tc1507 and methods for detection thereof |
| EP1807522B1 (en) | 2004-10-21 | 2013-11-20 | Venganza Inc. | Methods and materials for conferring resistance to pests and pathogens of plants |
| EP2843053A1 (en) | 2006-02-17 | 2015-03-04 | Monsanto Technology LLC | Chimeric regulatory sequences comprising introns for plant gene expression |
| CN100420751C (en) * | 2006-02-27 | 2008-09-24 | 浙江大学 | A kind of insecticidal gene and its use |
| US20100275326A1 (en) * | 2007-10-08 | 2010-10-28 | Santanu Dasgupta | Engineered dicotyledonous promoters capable of expressing in monocotyledonous plants |
| WO2009151748A1 (en) * | 2008-06-11 | 2009-12-17 | Pioneer Hi-Bred International, Inc. | Novel bacillus thuringiensis gene with lepidopteran activity |
| EP2199399A1 (en) * | 2008-12-17 | 2010-06-23 | BASF Plant Science GmbH | Production of ketocarotenoids in plants |
| US20120156718A1 (en) * | 2008-12-17 | 2012-06-21 | Basf Plant Science Gmbh | Production of Ketocarotenoids in Plants |
| WO2012030714A2 (en) | 2010-08-30 | 2012-03-08 | Agrigenetics, Inc. | Activation tagging platform for maize, and resultant tagged population and plants |
| AR092482A1 (en) | 2012-09-07 | 2015-04-22 | Dow Agrosciences Llc | ENRICHMENT OF THE CLASSIFICATION OF FLUORESCENCE ACTIVATED CELLS (FACS) TO GENERATE PLANTS |
| US20150173319A1 (en) | 2013-12-06 | 2015-06-25 | Altria Client Services Inc. | Tobacco plants having altered amounts of one or more alkaloids in leaf and methods of using such plants |
| EP3164496A1 (en) | 2014-07-02 | 2017-05-10 | Altria Client Services LLC | Tobacco having altered leaf properties and methods of making and using |
| US10626409B2 (en) | 2014-07-08 | 2020-04-21 | Altria Client Services Llc | Genetic locus imparting a low anatabine trait in tobacco and methods of using |
| CN113652416A (en) | 2014-10-06 | 2021-11-16 | 奥驰亚客户服务有限公司 | Genetic control of axillary bud growth in tobacco plants |
| EP4342290A3 (en) | 2016-10-07 | 2024-06-26 | Altria Client Services LLC | Tobacco plants having increased nitrogen efficiency and methods of using such plants |
| CN111212562B (en) | 2017-09-01 | 2023-06-27 | 奥驰亚客户服务有限公司 | Methods and compositions related to increased nitrogen use efficiency in tobacco |
| BR102018009263A8 (en) * | 2018-05-07 | 2023-01-31 | Embrapa Pesquisa Agropecuaria | CODON-OPTIMIZED CRY1DA NUCLEIC ACID MOLECULE, NUCLEIC ACID CONSTRUCTION, VECTOR, HOST CELL, PLANT CELL, TRANSGENIC PLANT, METHOD FOR TRANSFORMING A CELL, METHOD FOR PRODUCING A TRANSGENIC PLANT, METHOD OF CONTROLING INVERTEBRATE PEST OF CULTIVE PLANTS OF THE NUCLEIC ACID MOLECULE |
| WO2019233349A1 (en) | 2018-06-04 | 2019-12-12 | 青岛清原化合物有限公司 | Mutant p-hydroxyphenylpyruvate dioxygenase, and coding nucleic acid and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0359472A2 (en) * | 1988-09-09 | 1990-03-21 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
Family Cites Families (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1983001176A1 (en) * | 1981-10-01 | 1983-04-14 | Int Plant Research Inst | Process for the genetic modification of cereals with transformation vectors |
| JPS60500438A (en) * | 1983-01-17 | 1985-04-04 | モンサント カンパニ− | Plasmids for transforming plant cells |
| US5034322A (en) * | 1983-01-17 | 1991-07-23 | Monsanto Company | Chimeric genes suitable for expression in plant cells |
| EP0131620B1 (en) * | 1983-01-17 | 1991-08-21 | Monsanto Company | Genetically transformed plants |
| WO1984002913A1 (en) * | 1983-01-17 | 1984-08-02 | Monsanto Co | Chimeric genes suitable for expression in plant cells |
| US5380831A (en) * | 1986-04-04 | 1995-01-10 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
| BR8404834A (en) * | 1983-09-26 | 1985-08-13 | Agrigenetics Res Ass | METHOD TO GENETICALLY MODIFY A PLANT CELL |
| US4889918A (en) * | 1983-12-21 | 1989-12-26 | Boehringer Mannheim Gmbh | Protein tokin from bacillus thiringiensis which is toxic to coleoptera |
| DE3346138A1 (en) * | 1983-12-21 | 1985-07-11 | Boehringer Mannheim Gmbh, 6800 Mannheim | BACILLUS THURINGIENSIS VAR. TENEBRIONIS AND AN INSECTICIDALLY EFFECTIVE PRESERVATIVE OR AVAILABLE. TOXIN AND THEIR USE FOR COMBATING COLEOPTERA |
| US5231019A (en) * | 1984-05-11 | 1993-07-27 | Ciba-Geigy Corporation | Transformation of hereditary material of plants |
| CA1301094C (en) * | 1984-08-31 | 1992-05-19 | Helen Riaboff Whiteley | Bacillus thuringiensis crystal protein gene toxin segment |
| US5036006A (en) * | 1984-11-13 | 1991-07-30 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| US4945050A (en) * | 1984-11-13 | 1990-07-31 | Cornell Research Foundation, Inc. | Method for transporting substances into living cells and tissues and apparatus therefor |
| BR8600161A (en) * | 1985-01-18 | 1986-09-23 | Plant Genetic Systems Nv | CHEMICAL GENE, HYBRID, INTERMEDIATE PLASMIDIO VECTORS, PROCESS TO CONTROL INSECTS IN AGRICULTURE OR HORTICULTURE, INSECTICIDE COMPOSITION, PROCESS TO TRANSFORM PLANT CELLS TO EXPRESS A PLANTINIDE TOXIN, PRODUCED BY CULTURES, UNITED BY BACILLA |
| EP0192319B1 (en) * | 1985-01-22 | 1992-07-15 | Mycogen Corporation | Cellular encapsulation of biological pesticides |
| US4797276A (en) * | 1985-03-22 | 1989-01-10 | Mycogen Corporation | Control of cotton boll weevil, alfalfa weevil, and corn rootworm via contact with a strain of Bacillus thuringiensis |
| US4764372A (en) * | 1985-03-22 | 1988-08-16 | Mycogen Corporation | Compositions containing bacillus thuringiensis toxin toxic to beetles of the order coleoptera, and uses thereof |
| US5182200A (en) * | 1985-04-22 | 1993-01-26 | Lubrizol Genetics, Inc. | T-dna promoters |
| DE3685517T2 (en) * | 1985-05-20 | 1993-01-21 | Abbott Lab | CLONING AND EXPRESSION OF DELTA ENDOTOXIN GENES FROM BACILLUS THURINGIENSIS IN BACTERIA CELLS AND PRODUCTS FROM THEM. |
| EP0206613B1 (en) * | 1985-06-14 | 1992-08-19 | Repligen Corporation | Activated bacillus thuringienses delta-endotoxin produced by an engineered hybrid gene |
| ZA864898B (en) * | 1985-07-18 | 1987-03-25 | Lubrizol Genetics Inc | Insecticidal phizobiaceae cells |
| US4771131A (en) * | 1985-08-16 | 1988-09-13 | Mycogen Corporation | Cloning and expression of Bacillus thuringiensis toxin gene encoding a protein toxic to beetles of the order Coleoptera |
| AU7360087A (en) * | 1986-04-30 | 1987-11-24 | Boyce Thompson Institute For Plant Research Inc. | Electric field mediated dna transformation of plant cells and organelles |
| TR27832A (en) * | 1987-04-29 | 1995-08-31 | Monsanto Co | Plants resistant to harmful volatile damage. |
| CA1328236C (en) * | 1987-05-05 | 1994-04-05 | Novartis Ag | Plant tissue transformation |
| ATE169955T1 (en) * | 1987-05-20 | 1998-09-15 | Ciba Geigy Ag | METHOD FOR PRODUCING TRANSGENIC ZEA MAYS PLANTS REGENERATED FROM PROTOPLASTS OR FROM CELLS OBTAINED FROM PROTOPLASTS |
| US4948734A (en) * | 1987-08-12 | 1990-08-14 | Mycogen Corporation | Novel isolates of bacillus thuringiensis having activity against nematodes |
| NZ226442A (en) * | 1987-10-13 | 1991-08-27 | Lubrizol Genetics Inc | Anti-coleopteran toxin and gene |
| WO1989004868A1 (en) * | 1987-11-19 | 1989-06-01 | Agracetus | Production of proteins in plants |
| DE68914477T2 (en) * | 1988-01-22 | 1994-11-24 | Mycogen Corp | Bacillus thuringiensis hybrid gene, plasmid and transformed Pseudomonas fluorescens. |
| BR8900881A (en) * | 1988-02-25 | 1989-10-17 | Sandoz Ag | PROCESSES FOR THE PRODUCTION OF A TOXIC ENDOTOXIN PROTEIN TO INSECTS AND INSECTICIDE COMPOSITION |
| US5055294A (en) * | 1988-03-03 | 1991-10-08 | Mycogen Corporation | Chimeric bacillus thuringiensis crystal protein gene comprising hd-73 and berliner 1715 toxin genes, transformed and expressed in pseudomonas fluorescens |
| ATE126005T1 (en) * | 1988-04-25 | 1995-08-15 | Monsanto Co | INSECT RESISTANT SALAD PLANTS. |
| ES2071671T3 (en) * | 1988-09-06 | 1995-07-01 | Plant Genetic Systems Nv | PLANTS TRANSFORMED WITH A DNA SEQUENCE ORIGINATING FROM BACILLUS THURINGIENSIS, LETHAL FOR LEPIDOPTERS. |
| EP0382990A1 (en) * | 1989-02-15 | 1990-08-22 | Plant Genetic Systems, N.V. | Strains of bacillus thuringiensis |
| EP1103616A3 (en) * | 1989-02-24 | 2001-06-27 | Monsanto Company | Synthetic plant genes and method for preparation |
| CA2015951A1 (en) * | 1989-05-18 | 1990-11-18 | Mycogen Corporation | Novel bacillus thuringiensis isolates active against lepidopteran pests, and genes encoding novel lepidopteran-active toxins |
| US5141131A (en) * | 1989-06-30 | 1992-08-25 | Dowelanco | Method and apparatus for the acceleration of a propellable matter |
| US5177308A (en) * | 1989-11-29 | 1993-01-05 | Agracetus | Insecticidal toxins in plants |
| JPH04117279A (en) * | 1989-12-18 | 1992-04-17 | Sandoz Ag | Improvement in organic compound |
| US5187091A (en) * | 1990-03-20 | 1993-02-16 | Ecogen Inc. | Bacillus thuringiensis cryiiic gene encoding toxic to coleopteran insects |
| TR26973A (en) * | 1990-04-16 | 1994-09-12 | Ecogen Inc | Bacillus thuringiensis cryie gene and toxic protein against insects from the lepidoptera team. |
| CA2080584C (en) * | 1990-04-18 | 2000-09-05 | Marc Cornelissen | Modified bacillus thuringiensis insecticidal-crystal protein genes and their expression in plant cells |
| EP0528857B1 (en) * | 1990-04-26 | 2002-01-30 | Aventis CropScience N.V. | New bacillus thuringiensis strain and its gene encoding insecticidal toxin |
| ATE318318T1 (en) * | 1990-11-23 | 2006-03-15 | Bayer Bioscience Nv | METHOD FOR TRANSFORMING MONOCOTYL PLANTS |
| US5384253A (en) * | 1990-12-28 | 1995-01-24 | Dekalb Genetics Corporation | Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes |
| US5286485A (en) * | 1991-01-16 | 1994-02-15 | Mycogen Corporation | Process for controlling lepidopteran pests |
| US6294184B1 (en) * | 1991-01-16 | 2001-09-25 | Mycogen Corporation | Process for controlling lepidopteron pests |
| US5186934A (en) * | 1991-02-21 | 1993-02-16 | Mycogen Corporation | Bacillus thuringiensis gene encoding a coleopteran-active toxin |
| CA2059897A1 (en) * | 1991-02-25 | 1992-08-26 | Kenneth E. Narva | Bacillus thuringiensis genes encoding novel coleopteran-active protein toxins |
| UA48104C2 (en) * | 1991-10-04 | 2002-08-15 | Новартіс Аг | Dna fragment including sequence that codes an insecticide protein with optimization for corn, dna fragment providing directed preferable for the stem core expression of the structural gene of the plant related to it, dna fragment providing specific for the pollen expression of related to it structural gene in the plant, recombinant dna molecule, method for obtaining a coding sequence of the insecticide protein optimized for corn, method of corn plants protection at least against one pest insect |
| US5262324A (en) * | 1991-11-06 | 1993-11-16 | Mycogen Corporation | Coleopteran-active Bacillus thuringiensis isolates and genes encoding coleopteran-active toxins |
| US5679558A (en) * | 1992-04-15 | 1997-10-21 | Plant Genetic Systems, N.V. | Transformation of monocot cells |
| EP0582541A3 (en) * | 1992-05-01 | 1995-04-19 | Sandoz Ltd | Process for creating conjugation competent Bacillus Thuringiensis strains. |
| US5262159A (en) * | 1992-08-24 | 1993-11-16 | Mycogen Corporation | Use of Bacillus thuringiensis isolates for controlling pests in the family aphididae |
-
1996
- 1996-10-11 RU RU98111460/13A patent/RU2224795C2/en not_active IP Right Cessation
- 1996-10-11 ES ES96936576T patent/ES2330168T3/en not_active Expired - Lifetime
- 1996-10-11 WO PCT/US1996/016582 patent/WO1997013402A1/en not_active Ceased
- 1996-10-11 US US08/729,601 patent/US6166302A/en not_active Expired - Lifetime
- 1996-10-11 IL IL12402096A patent/IL124020A/en not_active IP Right Cessation
- 1996-10-11 AU AU74467/96A patent/AU708256B2/en not_active Ceased
- 1996-10-11 EP EP96936576A patent/EP0861021B1/en not_active Expired - Lifetime
- 1996-10-11 JP JP51530097A patent/JP4030582B2/en not_active Expired - Fee Related
- 1996-10-11 BR BR9611000-7A patent/BR9611000A/en not_active IP Right Cessation
- 1996-10-11 AT AT96936576T patent/ATE443437T1/en not_active IP Right Cessation
- 1996-10-11 CA CA002234656A patent/CA2234656C/en not_active Expired - Fee Related
- 1996-10-11 CN CNB961975873A patent/CN1176577C/en not_active Expired - Fee Related
- 1996-10-11 DE DE69638032T patent/DE69638032D1/en not_active Expired - Lifetime
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0359472A2 (en) * | 1988-09-09 | 1990-03-21 | Mycogen Plant Science, Inc. | Synthetic insecticidal crystal protein gene |
Cited By (88)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999006568A1 (en) * | 1997-07-31 | 1999-02-11 | Mycogen Corporation | Bacillus thuringiensis cry6-toxins with improved activity |
| US6831062B2 (en) | 1997-07-31 | 2004-12-14 | Mycogen Corporation | Bacillus thuringiensis toxins with improved activity |
| US6303364B1 (en) | 1997-07-31 | 2001-10-16 | Mycogen Corporation | Bacillus thuringiensis toxins with improved activity |
| EP0900842A3 (en) * | 1997-09-01 | 2004-01-02 | National Agricultural Research Organisation (NARO) | Artificially synthesized gene for trypsin inhibitor |
| WO1999024581A3 (en) * | 1997-11-12 | 1999-09-30 | Mycogen Corp | Plant-optimized genes encoding pesticidal toxins |
| US6218188B1 (en) | 1997-11-12 | 2001-04-17 | Mycogen Corporation | Plant-optimized genes encoding pesticidal toxins |
| US8513492B2 (en) | 1997-12-18 | 2013-08-20 | Monsanto Technology Llc | Coleopteran-resistant transgenic plants and methods of their production |
| JP4833404B2 (en) * | 1998-01-16 | 2011-12-07 | シンジェンタ パーティシペーションズ アクチェンゲゼルシャフト | Use of neonicotinoids on transformed plants |
| JP2002509865A (en) * | 1998-01-16 | 2002-04-02 | ノバルティス アクチエンゲゼルシャフト | Use of neonicotinoids on transgenic plants |
| EP2258856A1 (en) | 1998-02-20 | 2010-12-08 | Syngenta Limited | Hybrid seed production |
| WO1999050430A2 (en) | 1998-03-30 | 1999-10-07 | Dow Agrosciences Llc | Modification of fatty acid composition in plants by expression of an aspergillus nidulans delta-9 coa desaturase |
| CN100390284C (en) * | 1998-08-19 | 2008-05-28 | 孟山都技术有限公司 | Increased expression of Cry3B insecticidal proteins in plants |
| WO2000011185A3 (en) * | 1998-08-19 | 2000-06-02 | Monsanto Co | Improved expression of cry3b insecticidal protein in plants |
| EP1698699A3 (en) * | 1998-08-19 | 2006-09-27 | Monsanto Technology, LLC | Improved expression of CRY3B insecticidal protein in plants |
| JP2002528083A (en) * | 1998-10-23 | 2002-09-03 | マイコジェン コーポレーション | Polynucleotides most effectively expressed in plants, encoding pesticidal proteins of about 15 kDa and about 45 kDa |
| US6340593B1 (en) | 1998-10-23 | 2002-01-22 | Mycogen Corporation | Plant-optimized polynucleotides encoding approximately 15 kDa and approximately 45 kDa pesticidal proteins |
| JP2010131021A (en) * | 1998-10-23 | 2010-06-17 | Mycogen Corp | Plant-optimized polynucleotide encoding approximately 15 kda and approximately 45 kda pesticidal protein |
| US6740342B1 (en) * | 1999-01-06 | 2004-05-25 | Cooperatieve Verkoop-En Productievereniging Van Aardappelmeel En Derivaten Avebe B.A. | Separating and recovering components from plants |
| WO2001011029A1 (en) * | 1999-08-11 | 2001-02-15 | Dow Agrosciences Llc | Transgenic plants expressing photorhabdus toxin |
| US7408096B2 (en) | 1999-08-19 | 2008-08-05 | Monsanto Technology Llc | Expression of Cry3B insecticidal protein in plants |
| US6943281B2 (en) | 1999-08-19 | 2005-09-13 | Monsanto Technology Llc | Expression of Cry3B insecticidal protein in plants |
| US6501009B1 (en) | 1999-08-19 | 2002-12-31 | Monsanto Technology Llc | Expression of Cry3B insecticidal protein in plants |
| US8101826B2 (en) | 1999-08-19 | 2012-01-24 | Monsanto Technology Llc | Expression of Cry3B insecticidal protein in plants |
| EP2019115A2 (en) | 2002-06-28 | 2009-01-28 | Dow AgroSciences LLC | Pesticidally active proteins and polynucleotides obtainable from paenibacillus species |
| WO2005002359A3 (en) * | 2003-05-22 | 2005-12-29 | Syngenta Participations Ag | Modified starch, uses, methods for production thereof |
| EP2319932A2 (en) | 2004-04-30 | 2011-05-11 | Dow AgroSciences LLC | Novel herbicide resistance gene |
| EP2308977A2 (en) | 2004-04-30 | 2011-04-13 | Dow AgroSciences LLC | Novel herbicide resistance gene |
| US10947555B2 (en) | 2004-04-30 | 2021-03-16 | Dow Agrosciences Llc | Herbicide resistance genes |
| US11149283B2 (en) | 2004-04-30 | 2021-10-19 | Dow Agrosciences Llc | Herbicide resistance genes |
| EP2308976A2 (en) | 2004-04-30 | 2011-04-13 | Dow AgroSciences LLC | Novel herbicide resistance gene |
| US11299745B1 (en) | 2004-04-30 | 2022-04-12 | Dow Agrosciences Llc | Herbicide resistance genes |
| EP2298901A2 (en) | 2004-04-30 | 2011-03-23 | Dow AgroSciences LLC | Novel herbicide resistance genes |
| US11371055B2 (en) | 2005-10-28 | 2022-06-28 | Corteva Agriscience Llc | Herbicide resistance genes |
| EP2484202A1 (en) | 2005-10-28 | 2012-08-08 | Dow AgroSciences LLC | Novel herbicide resistance genes |
| EP2484767A1 (en) | 2005-10-28 | 2012-08-08 | Dow AgroSciences LLC | Novel Herbicide resistance genes |
| EP3241430A1 (en) | 2005-10-28 | 2017-11-08 | Dow AgroSciences LLC | Novel herbicide resistance genes |
| US9624505B2 (en) | 2007-05-09 | 2017-04-18 | Dow Agrosciences Llc | Uses and detection of herbicide resistance genes for resistance to aryloxyalkanoate herbicides |
| WO2010108114A2 (en) | 2009-03-19 | 2010-09-23 | Martek Biosciences Corporation | Polyunsaturated fatty acid synthase nucleic acid molecules and polypeptides, compositions, and methods of making and uses thereof |
| EP3192871A1 (en) | 2009-03-19 | 2017-07-19 | DSM IP Assets B.V. | Polyunsaturated fatty acid synthase nucleic acid molecules and polypeptides, compositions, and methods of making and uses thereof |
| WO2010120452A1 (en) | 2009-04-17 | 2010-10-21 | Dow Agrosciences Llc | Dig-3 insecticidal cry toxins |
| WO2011075588A1 (en) | 2009-12-16 | 2011-06-23 | Dow Agrosciences Llc | COMBINED USE OF CRY1Ca AND CRY1Fa PROTEINS FOR INSECT RESISTANCE MANAGEMENT |
| US9567602B2 (en) | 2009-12-16 | 2017-02-14 | Dow Agrosciences Llc | Combined use of CRY1Ca and CRY1Fa proteins for insect resistance management |
| US9234208B1 (en) | 2010-05-10 | 2016-01-12 | Dow Agrosciences Llc | DIG-13 insecticidal cry toxins |
| EP2862931A1 (en) | 2010-06-24 | 2015-04-22 | Dow AgroSciences LLC | Lowering saturated fatty acid contents of plant seeds |
| WO2011163632A2 (en) | 2010-06-24 | 2011-12-29 | Dow Agrosciences Llc | Lowering saturated fatty acid content of plant seeds |
| EP2862930A1 (en) | 2010-06-24 | 2015-04-22 | Dow AgroSciences LLC | Lowering saturated fatty acid content of plant seeds |
| WO2012016222A2 (en) | 2010-07-29 | 2012-02-02 | Dow Agrosciences Llc | Strains of agrobacterium modified to increase plant transformation frequency |
| EP3066915A1 (en) | 2010-07-29 | 2016-09-14 | Dow AgroSciences LLC | Strains of agrobacterium modified to increase plant transformation frequency |
| WO2012074868A2 (en) | 2010-12-03 | 2012-06-07 | Ms Technologies, Llc | Optimized expression of glyphosate resistance encoding nucleic acid molecules in plant cells |
| US9434773B2 (en) | 2011-09-14 | 2016-09-06 | Dow Agrosciences Llc | Plants having stress related traits and methods for making the same |
| WO2015051075A1 (en) | 2013-10-04 | 2015-04-09 | Dow Agrosciences Llc | Zea mays metallothionein-like regulatory elements and uses thereof |
| US9777286B2 (en) | 2013-10-04 | 2017-10-03 | Dow Agrosciences Llc | Zea mays metallothionein-like regulatory elements and uses thereof |
| US10047367B2 (en) | 2013-10-15 | 2018-08-14 | Dow Agrosciences Llc | Zea mays regulatory elements and uses thereof |
| US10047368B2 (en) | 2013-10-15 | 2018-08-14 | Dow Agrosciences Llc | Zea mays regulatory elements and uses thereof |
| EP3666066A1 (en) | 2013-11-26 | 2020-06-17 | Dow AgroSciences LLC | Production of omega-3 long-chain polyunsaturated fatty acids in oilseed crops by a thraustochytrid pufa synthase |
| WO2015081270A1 (en) | 2013-11-26 | 2015-06-04 | Dow Agrosciences Llc | Production of omega-3 long-chain polyunsaturated fatty acids in oilseed crops by a thraustochytrid pufa synthase |
| US10030246B2 (en) | 2013-12-31 | 2018-07-24 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US9885054B2 (en) | 2013-12-31 | 2018-02-06 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US10036028B2 (en) | 2013-12-31 | 2018-07-31 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US10030247B2 (en) | 2013-12-31 | 2018-07-24 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| US9725730B2 (en) | 2013-12-31 | 2017-08-08 | Dow Agrosciences Llc | Maize ubiquitin promoters |
| WO2015109241A1 (en) | 2014-01-17 | 2015-07-23 | Dow Agrosciences Llc | Increased protein expression in plants |
| EP3892091A1 (en) | 2014-01-17 | 2021-10-13 | Dow AgroSciences LLC | Increased protein expression in plants |
| WO2015130931A1 (en) | 2014-02-28 | 2015-09-03 | Dow Agrosciences Llc | Root specific expression conferred by chimeric gene regulatory elements |
| WO2015195594A2 (en) | 2014-06-20 | 2015-12-23 | Dow Agrosciences Llc | Vegetative insecticidal proteins useful for control of insect pests |
| WO2016109212A1 (en) | 2014-12-30 | 2016-07-07 | Dow Agrosciences Llc | MODIFIED Cry1Ca TOXINS USEFUL FOR CONTROL OF INSECT PESTS |
| EP4183405A1 (en) | 2014-12-30 | 2023-05-24 | Corteva Agriscience LLC | Modified cry1ca toxins useful for control of insect pests |
| WO2016168229A1 (en) | 2015-04-15 | 2016-10-20 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2016168230A2 (en) | 2015-04-15 | 2016-10-20 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2017030843A1 (en) | 2015-08-17 | 2017-02-23 | Dow Agrosciences Llc | Engineered cry6a insecticidal proteins |
| WO2017180180A2 (en) | 2015-09-22 | 2017-10-19 | Dow Agrosciences Llc | Plant promoter and 3' utr for transgene expression |
| WO2017053164A1 (en) | 2015-09-22 | 2017-03-30 | Dow Agrosciences Llc | Plant promoter and 3' utr for transgene expression |
| WO2017070298A1 (en) | 2015-10-22 | 2017-04-27 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2017078935A1 (en) | 2015-11-04 | 2017-05-11 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2017194683A1 (en) | 2016-05-12 | 2017-11-16 | Dsm Ip Assets B.V. | Method of increasing omega-3 polyunsaturated fatty acids production in microalgae |
| US11987819B2 (en) | 2016-05-12 | 2024-05-21 | Dsm Ip Assets B.V. | Method of increasing omega-3 polyunsaturated fatty acids production in microalgae |
| WO2018063870A1 (en) | 2016-09-30 | 2018-04-05 | Dow Agrosciences Llc | Binary insecticidal cry toxins |
| WO2018067265A1 (en) | 2016-10-03 | 2018-04-12 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2018067264A1 (en) | 2016-10-03 | 2018-04-12 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| EP3654763A1 (en) | 2017-06-28 | 2020-05-27 | Dow Agrosciences LLC | Plant promoter for transgene expression |
| WO2019046776A1 (en) | 2017-08-31 | 2019-03-07 | Dow Agrosciences Llc | Compositions and methods for expressing transgenes using regulatory elements from chlorophyll binding ab genes |
| WO2019089402A1 (en) | 2017-10-30 | 2019-05-09 | Dow Agrosciences Llc | Plant promoter for transgene expression |
| WO2019125651A1 (en) * | 2017-12-19 | 2019-06-27 | Pioneer Hi-Bred International, Inc. | Insecticidal polypeptides and uses thereof |
| US11492639B2 (en) | 2017-12-19 | 2022-11-08 | Pioneer Hi-Bred International, Inc. | Insecticidal polypeptides and uses thereof |
| US11920146B2 (en) | 2017-12-19 | 2024-03-05 | Pioneer Hi-Bred International, Inc. | Insecticidal polypeptides and uses thereof |
| WO2023084416A1 (en) | 2021-11-09 | 2023-05-19 | Benson Hill, Inc. | Promoter elements for improved polynucleotide expression in plants |
| WO2023111961A1 (en) | 2021-12-15 | 2023-06-22 | Benson Hill, Inc. | Spatio-temporal promoters for polynucleotide expression in plants |
| WO2024127362A1 (en) | 2022-12-15 | 2024-06-20 | Benson Hill, Inc. | Spatio-temporal promoters for polynucleotide expression in plants |
Also Published As
| Publication number | Publication date |
|---|---|
| BR9611000A (en) | 1999-12-28 |
| CN1176577C (en) | 2004-11-24 |
| CA2234656A1 (en) | 1997-04-17 |
| EP0861021A4 (en) | 2005-01-12 |
| JP4030582B2 (en) | 2008-01-09 |
| EP0861021B1 (en) | 2009-09-23 |
| IL124020A (en) | 2003-05-29 |
| RU2224795C2 (en) | 2004-02-27 |
| DE69638032D1 (en) | 2009-11-05 |
| AU708256B2 (en) | 1999-07-29 |
| CA2234656C (en) | 2008-01-08 |
| JP2000507808A (en) | 2000-06-27 |
| EP0861021A1 (en) | 1998-09-02 |
| ATE443437T1 (en) | 2009-10-15 |
| AU7446796A (en) | 1997-04-30 |
| ES2330168T3 (en) | 2009-12-04 |
| CN1199321A (en) | 1998-11-18 |
| US6166302A (en) | 2000-12-26 |
| MX9802778A (en) | 1998-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0861021B1 (en) | Modified bacillus thuringiensis gene for lepidopteran control in plants | |
| US7064249B2 (en) | Plants transformed to express Cry2A δ-endotoxins | |
| US5349124A (en) | Insect-resistant lettuce plants | |
| EP0359472B1 (en) | Synthetic insecticidal crystal protein gene | |
| US5608142A (en) | Insecticidal cotton plants | |
| US20020152496A1 (en) | Coleopteran toxin proteins of bacillus thuringiensis | |
| CN113195723A (en) | Codon-optimized cry1Da nucleic acid molecules, nucleic acid constructs, vectors, host cells, plant cells, transgenic plants, methods of transforming cells, methods of producing transgenic plants, methods of controlling invertebrate pests in crop plants, and uses of the nucleic acid molecules | |
| US6706860B2 (en) | Toxins | |
| CN1426465B (en) | A construct that can be released in a closed circular form from a larger nucleotide sequence and allows site-specific expression and/or developmentally regulated expression of a selected genetic sequence | |
| JP5054267B2 (en) | New toxin | |
| US20040221333A1 (en) | Novel toxins | |
| AU5424499A (en) | Modified synthetic dna sequences for improved insecticidal control | |
| MXPA98002778A (en) | Gene of bacillus thuringiensis modified for control of lepidopteros in plan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 96197587.3 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2234656 Country of ref document: CA Ref document number: 2234656 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/1998/002778 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1996936576 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1996936576 Country of ref document: EP |


































