WO1997012900A2 - Ring finger protein - Google Patents

Abstract

This invention relates to a protein which is essential for the formation of an active cyclin-dependent kinase (CDK)/cyclin complex, derivatives of said protein, antibodies specific for said protein, and to means and methods for the production thereof. The invention is also directed to nucleic acids coding for a protein of the invention, to a method of obtaining such nucleic acid molecules, and to the expression thereof. Furthermore, the invention is directed to uses of the proteins and nucleic acids of the invention.

Description

Ring Finαer Protein

This invention relates to a protein which is essential for the formation of an active cyclin- dependent kinase (CDKycyclin complex, particulariy such complex comprising CDK7 and cydin H, derivatives of said protein, antibodies specific for said protein, and to means and methods forthe production thereof. The invention is also directed to nucleic acids coding for a protein of the invention, to a method of obtaining such nucleic acid molecules, and to the expression thereof. Furthermore, the invention is directed to uses of the proteins and nucleic acids of the invention.

Cell cycle progression in all eukaryotes depends on the periodic activation of cyclin- dependent kinases (CDKs). In vertebrates, entry into mitosis is controlled by CDC2, whereas progression through G1 and S phases requires multiple CDKs, of which CDK4 and CDK2 have been studied most extensively (Nigg.E.A. (1995) Bioessays, 17, 471-480; Norbury.C. and Nurse.P. (1992) Arm. Rev. Biochem., 61, 41-470). In order to be active, CDKs must associate with cyclin subunits (Sherr.C . (1993) Cell, 73, 1059-1065). In addition, their activation requires the phosphorylation of a critical threonine residue, e.g. Thr161 in human CDC2, also referred to as CDK1 , located in a region known as the T-loop (Morgan.D.O. (1995) Nature, 374, 131-134), or Thr 160 located in CDK2. This essential phosphorylation event is attributed to CDK-activating kinase (CAK). Early genetic screens have provided no clues as to the identity of CAK, but recent biochemical studies have allowed the identification of a major CAK activity in starfish oocytes, Xenopus oocytes and eggs and cultured mammalian cells. In all cases the catalytic subunit of CAK is found to be structurally related to the CDK family. Originally designated as MO15 (Shuttleworth.J. et al. (1990) EMBO J., 9, 3233-3240), this kinase was subsequently shown to be associated with cyclin H and hence has been renamed CDK7 (Fisher.R.P. and Morgan.D.O. (1994) Cell, 78, 713- 724; Makela,T.P. et al. (1994) Nature, 371, 254-257). Thus, these studies suggest an involvement of a CDK cyclin cascade in cell cycle control.

However, recent findings suggest that CDK7/cyclin H may perform additional or alternative functions. Both CDK7 and cyclin H are in fact found to be associated with TFIIH, a multiprotein complex required for transcription by RNA polymerase II and for nucleotide excision repair (Roy.R. et al. (1994) Cell, 79, 1093-1101 ; Shiekhattar.R., et al. (1995) Nature, 374, 283-287; Serizawa.H., et al. (1995) Nature, 374, 280-282.). Furthermore, CDK7/cyclin H has been implicated in the phosphorylation of the C-terminal domain (CTD) of RNA polymerase II (Roy et al., supra; Serizawa et al., supra; Shiekhattar et al., supra; akela, T.P. et al., (1995) Proc. Natl Acad. Sci. USA, 92, 5174-5178), a step that has long been recognized as being important forthe regulation of transcription. Independently, a CDK cyclin complex structurally related to CDK7/cyclin H has been identified in Saccharomyces cerevisiae. This complex, KIN28/CCL1 (Valay.J.G. et al., (1993) J. Mol Biol, 234, 307-310), was also shown to be part of the budding yeast counteφart of TFIIH (Feaver.W.J., et al. (1994) Cell, 79, 1103-1109). However, although KIN28 CCL1 is able to phosphorylate the CTD of RNA polymerase II, it does not appear to display CAK activity, thus suggesting that KIN28/CCL1 may function primarily in transcription rather than in cell cycle progression. Although it is by no means proven that KIN28/CCL1 represents a functional homolog of CDK7/cyclin H, these results also strengthen the view that CDKVcyclin H may perform an important function in regulating transcription in metazoan organisms. Taken together, the properties reported for CDK7/cyclin H indicate that this complex may contribute to integrate several fundamental cellular processes, notably cell cycle progression, transcription and DNA repair. The clarification of the physiological role of this complex is clearly an important issue, e.g. for the development of proper therapeutic agents, e.g. anti-cancer agents.

In a study on the cell cycle dependent expression of human CDK7, it was reported that this kinase associates with two major subunits, having an estimated molecular mass of 34 kD and 32 kD, respectively (Tassan.J.-P. et al., (1994) J. Cell Biol, 127, 467-468). The 34 kD protein has subsequently been identified as cyclin H (Makela.T.P. et al., (1994) Nature, 371, 254-257), but the nature of the third putative subunit associated with CDK7/cyclin H had remained mysterious. According to Fisher.R.P. and Morgan.D.O. ((1994) Cell, 78, 713-724) a CAK-active binary CDK7/cyclin H complex can be formed using subunits expressed from recombinant baculoviruses in insect cells. It has also been reported that highly purified mammalian CDK7/cyclin H complexes display CAK activity in the apparent absence of a further subunit (Fisher and Morgan, supra). The lack of deeper knowledge in this field has significantly hampered, for example, progress towards understanding the function of the CDK7/cyclin H complex, and the search for compounds pυrposively modulating the activity of said complex.

The present invention has achieved identification and isolation of a third CAK subunit, which is designated MAT1 (menage Jrois 1). This component is identified as a novel RING finger protein. It is shown that this third CAK subunit is essential for the in vitro formation of a stable complex between CDK7 and cyclin H, and that the resulting ternary MAT1/CDK7/cyclin H complex, herein also referred to as CAK-complex, is associated in vivo with both CAK and CTD-kinase activities. Hence, the present invention provides an essential CDK cyciin assembly factor. Moreover, the present invention has achieved isolation and sequencing of DNA encoding MAT1, thus enabling e.g. in vitro synthesis of the MAT1 protein and in vitro reconstitution of an active CDK7/cyclin H/MAT1 complex.

In one embodiment, the present invention relates to a purified or isolated protein designated MAT1 , or a mutant thereof. It is an additional object of the instant invention to provide immunogens for raising antibodies against MAT1 as well as to obtain antibodies capable of specifically binding to MAT1. Furthermore, the present invention relates to isolated nucleic acids (DNA, RNA) coding for MAT1. As used hereinbefore or hereinafter, the term "isolated" is intended to refer to a molecule of the invention in a substantially pure form obtainable from a natural source, by chemical synthesis or by means of genetic engineering. The isolated proteins, DNAs, RNAs of the invention may be useful in ways that the proteins, DNAs, and RNAs as they naturally occur are not, such as identification of compounds modulating the activity of MAT1.

In another aspect, the invention provides an isolated nucleic acid that is complementary to, or hybridizes under stringent conditions to, a nucleic acid encoding MAT1. The invention also provides a method for amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase (chain) reaction with nucleic acid (DNA or RNA) encoding (or complementary to) MAT1. In still another aspect of the invention, the nucleic acid is DNA and further comprises a replicable vector comprising the nucleic acid encoding MAT1 operably linked to control sequences recognized by a host transformed by the vector. Furthermore the invention provides host cells transformed with such vector and a method of using a nucleic acid encoding MAT1 to effect the production of MAT1 , comprising expressing MAT1 nucleic acid in a culture of the transformed host cells and, if desired, recovering MAT1 from the host cell culture.

The present invention also has diagnostic or therapeutic aspects. For example, it relates to a method in which the presence and/or quantity of MAT1 in a biological sample is determined using a nucleic acid probe based on a nucleic acid sequence described herein, or an anti-MAT1 antibody. Such method may e.g. suitable to predict whether cells are likely to display aberrant proliferation behaviour, impaired DNA repair or changes in transcription levels by determining whether their MAT1 or CAK-complex levels, or biological activities associated with MAT1 or the CAK complex are elevated.

In addition, the present invention relates to a method for modulating MAT1 activity or function in vitro or in vivo comprising introducing into a cell or organism a MAT1 agonist or antagonist. The invention further provides methods of modulating the activity of the CAK complex in cells, particularly by affecting the role of MAT1 in the formation, stabilization or activity of said complex. Such modulation may influence the cellular proliferation rate, DNA repair or transcription. The present invention particulariy relates to a method of inhibiting aberrant cell division by interfering with the function of MAT1. Furthermore, the present invention relates to a method of affecting transcription by interfering with the function of MAT1. Also disclosed is a method of increasing DNA repair or reducing DNA repair defects, e.g. repair defects which are associated with high UV sensitivity of an organism, by interfering with the function of MAT1. In such methods, function of MAT1 is blocked (either totally or partially) by interfering with its ability to contribute to or participate in the formation of an active CAK complex, by means of agents or signals which interfere with MAT1 activity, either directly or indirectly. Such agents include e.g. anti-sense sequences or transcriptional modulators which bind MAT1 -encoding DNA or RNA; antibodies or other agents which bind either MAT1 or a molecule with which MAT1 must interact or bind in order to carry out its physiological role , e.g. its role in cell proliferation, DNA repair or transcription, agents which degrade or otherwise inactivate MAT1 , such as proteases; and agents which interfere with the participartion of MAT1 in CDK cyclin/MAT1 complexes, or with the association of MAT1 with components of DNA repair and trancription machinery, e.g. TFIIH subunits. The invention also relates to signals or agents (oligonucleotides, antibodies, peptides) useful in the isolation, diagnostic or therapeutic methods described herein. In particular, the present invention relates to an isolated protein designated MAT1 , which is characterized in that it is an assembly factor which is essential for the formation and stabilization of an active CAK complex and, in its full-length form, comprises a Ring finger in the N-terminus. During interphase, MAT1 is located predominantly in the nucleus of the cell. The level of MAT1 is virtually constant throughout the cell cycle. Preferred is the protein having the amino acid sequence set forth in SEQ ID NO:2. MAT1 of SEQ ID NO:2 is a 312 amino acid protein with a calculated molecular mass of 36 kD.

According to the invention, MAT1 also refers to amino acid mutants or glycosylation variants of the protein of SEQ ID NO:2, and derivatives of the beforementioned proteins. Hereinbelow, MAT1, MAT1 of SEQ ID NO:2, an amino acid mutant and glycosylation variant thereof, as well as a derivative of the beforementioned proteins are collectively referred to as a "protein of the invention" or MAT1.

The in vitro and in_vivo formation of a CAK complex is dependent on MAT1 , which acts as a dose-dependent assembly factor, resulting in an active and stable ternary complex containing the subunits CDK7, also referred to as catalytic subunit, cyclin H and MAT1. A protein of the invention may be identified by its role in the formation of such ternary complex, employing conventional methods readily evident to those skilled in the art from the information provided herein. Briefly, CDK7, cyclin H and the protein of the invention are contacted under conditions suitable to allow interaction of the proteins. Conditions generally allowing such interaction occur between about 4°C and about 40°C, preferably between about 4°C and about 37°C, at a pH range of between 5 and 9, preferably between 6.5 and 8, for about 15 minutes to about 24 hours. Within the sample or incubation mixture CDK7 and cyclin H may be endogenous (intrinsic) or exogenous (extrinsic), i.e. these proteins may be of natural, synthetic or recombinant origin; the proteins may be comprised in cell extracts or lysates, or used in an isolated form. Methods suitable for assessing formation of a ternary protein complex comprising CDK7, cyclin H and the protein of the invention include, for example, immunoanalytical techniques, such as immunoprecipitation and immunoblotting using antibodies capable of co-immunoprecipitating the components of the complex, or other methods conventionally employed in protein analysis, such as methods suitable for determining protein (complex) size or molecular mass, e.g. as gelfiltration, gradient centrifugation, e.g. sucrose or glycerol gradient centrifugation, or electrophoresis, optionally after immunoprecipitation of the complex with suitable antibodies, e.g. anti-CDK7 antibodies, anti-cyclin H antibodies or anti-MAT1 antibodies. The ternary complex has a molecular mass of about 100 to about 200 kD, as determined by gelfiltration. SDS-PAGE of the ternary complex yields bands at about 40 kD to about 42 kD, about 34 kD to about 37 kD, and about 32 kD to about 34 kD, representing CDK7, cyclin H and MAT1 , respectively. Particularly suitable are the respective methods described in more detail in the Examples. For example, cell lysates or incubation mixtures comprising all three CAK subunits may be analyzed for the presence of the ternary complex by SDS-PAGE and a suitable protein detection method, such as fluorography, autoradiography and/or immunoprecipitation with anti-MAT1 or anti-CDK7 antibodies. Analysis may involve separate or collective expression in vitro transcription-translation of these proteins, e.g. using a reticulocyte transcription- translation system.

MAT1 acts as a dose-dependent assembly-factor, meaning that increasing amounts of MAT1 cause increasing amounts of cyclin H to associate with CDK7. MAT1 appears not to function as a chaperone in a catalytic fashion, but efficient reconstitution of an active CDK7/cyclin H/MAT1 complex requires about association of these three components in about stoichiometric amounts. As defined herein, the active ternary complex comprising MAT1 displays protein kinase activity towards suitable substrates, particularly substrates mimicking the T-loop in CDKs (such kinase activity is referred to as CAK-activity) and substrates mimicking the C-terminal domain of RNA polymerase II (such kinase activity is referred to as CTD activity). Nuclear CDK7/cyclin H is associated with MAT1 at all stages of the cell cycle in vivo to form a stable ternary complex. The CAK complex is said to be stable e.g. if it forms in reticulocyte lysates primed with RNAs coding for CDK7, cyclin H and MATL

CAK-activity of an active ternary complex is analyzed according to methods well-known in the art, i.e. using conventional assays for protein kinase activity. Surprisingly in view of eariier results by Fisher and Morgan (supra), high levels of CAK activity are observed only for the ternary, but not for a binary complex lacking either cyclin H or MAT1. In an assay for CAK-activity, the ternary complex may be used as a immunoprecipitate or be reconstituted from the individual subunits, using protein mixtures, such as cell extracts or lysates, e.g. reticulocyte lysates, or isolated CAK subunits. CAK activity presumes presence of catalytically active CDK7 which may also be present as a fusion protein. Briefly, to determine CAK-activity, the ternary complex is incubated with a suitable proteinaceous kinase substrate in the presence of a phosphate donor, such as ATP or GTP, which is detectably labeled, e.g. pPJATP. The proteinaceous substrate is properly analyzed for presence of labelled phosphate, e.g. by electrophoresis and subsequent autoradiography. Suitable kinase substrates are CDK/cyclin complexes with CDKs having a critical, phophorylatable threonine residue located in the T-loop region, e.g. CDK2, which is phophorylated on threonine at position 160, and CDK1 , which is phosphorylated on threonine at position 161 , and fusion proteins comprising such CDKs, wherein the accessibility of critical amino acid is not affected, e.g. the GST-CDK2 fusion protein, as employed in the Examples. An exemplary CAK assay protocol is given in the Examples.

The CDK7/cyclin H/MAT1 complex is also associated with kinase activity towards the CTD of RNA polymerase II (CTD activity). CTD activity is assayed under conditions well known in the art, e.g. under essentially the same conditions used in a CAK assay, particulariy an assay described herein. A suitable proteinaceous substrate is a protein having repeated TyrSerProTyrSerProSer motifs, such as CTD of RNA Polymerase II or GST-CTD, as employed in the Examples, or peptides comprising several repeats of the said heptamer motif.

Typically, MAT1 comprises at its N-terminus a RING finger, a specialized form of zinc finger defined by a C3HC4 sequence motif. This domain is not required for ternary complex formation with CDK7/cyclin H, indicating that the RING finger is available for promoting interactions of the ternary complex with other molecules. Using MAT1 of SEQ ID NO:2, or said MAT1 reconstituted within the ternary CAK complex, no binding of the RING finger protein to either single-stranded or double-stranded DNA is detected. In SEQ ID NO:2 the C3HC4 sequence motif consists of three cysteine residues at aa positions 6, 9 and 26, respectively, the histidine residue at position 28, and four cysteine residues at positions 31 , 34, 46 and 49, respectively.

As used herein, isolated MAT1 means substantially pure MAT1 which has been identified and is essentially free of the components of its natural environment. Substantially pure MAT1 is homogenous MAT1 , which is substantially free from other compounds with which it is normally associated in vivo, particularly free from naturally occurring macromolecules, such as cyclin H and CDK7. Homogenicity is determined by reference to purity standards known to those skilled in the art, e.g. purity sufficient to allow determination of the N- terminal amino acid sequence. Isolated MAT1 includes MAT1 in recombinant cell culture. Preferred isolated proteins of the invention are a synthetic and a recombinant protein. Preferably, a protein of the invention is capable of binding CDK7 and cyclin H in a ternary complex. The invention also relates to a composition of matter comprising a protein of the invention bound in a CAK complex, and optionally further proteins interacting with MAT1 , CDK7 or cyclin H, e.g. components of TFIIH.

Substantially pure MAT1 may be obtained from a natural source , e.g. tissue homogenates or cell lysates, through microbial expression, by chemical synthesis. Isolation from a natural source is achieved by protein purification techniques and means commonly known to these skilled in the art, such as techniques employing the affinity between MAT1 and a MAT1 ligand, e.g. immunoprecipitation and affinity chromatography. Such techniques may also be used to obtain biologically active fragments of MAT1 , which contain a binding domain for CDK7, cyclin H, or subunits of the DNA repair and transcription machinery.

Minor modifications of the primary amino acid sequence of MAT1 (which may be readily derived from SEQ ID NOs.1 and 2) may result in amino acid mutants (muteins) or variants which have substantially equivalent properties as compared to the MAT1 with the amino acid sequence set forth in SEQ ID NO:2. Such modifications may be deliberate, as by site- directed mutagenesis, or be spontaneous. Variants obtainable by these modifications are included herein, with the provision that they display qualitatively essentially the same biological activities as the protein of SEQ ID NO:2. In particular, such mutants should be able to associate with CDK7 and cyclin H to form a biologically active ternary complex, e.g. a complex exhibiting protein kinase activity. Forthe purposes of this disclosure, such variants are considered as "functional amino acid variants". According to the invention, functional amino acid variants include naturally occurring allelic or interspecies variations of the MAT1 amino acid sequence. Preferred interspecies variants of the protein of SEQ ID NO:2 are mammalian MAT1 proteins. A functional amino acid (sequence) variant of the MAT1 of SEQ ID NO:2 may be substitutional, insertional or deletional. Substitutions, deletions and insertions may be combined to arrive at an amino acid mutant of the invention. Amino acid substitutions are typically of single residues, insertions usually will be on the order of from one to about ten amino acid residues, and deletions will usually range from about one to thirty residues. However, as used herein, deletional mutants also refer to MAT1 fragments with an amino acid sequence lacking two or more consecutive amino acids as compared to the sequence of SEQ ID NO:2.

For example, a substitutional amino acid mutant is any polypeptide having an amino acid sequence substantially identical to the sequence set forth in SEQ ID NO:2, in which one or more residues have been conservatively substituted with a functionally-similar amino acid residue. Conservative substitutions include e.g. the substitution of one non-polar (hydrophobic) residue, such as methionine, valine, leucine, isoleucine for another, substitution of one polar (hydrophilic) residue for another, such as between glycine and serine, between arginine and lysine, and between glutamine and asparagine. Substitutional or deletional mutagenesis may be employed to eliminate O- or N-linked glycosylation sites. Deletions of cysteine or other labile amino acid residues may also be desirable, for example to increase the oxidative stability of a protein of the invention.

Preferred amino acid mutants are fragments of the MAT1 protein of SEQ ID NO:2. Such fragments may be functionally or immunoiogically equivalent to the full-length protein. An example of a functional equivalent is e.g. a mutant lacking the RING finger domain, e.g. the mutant designated Δ and described in the Examples. Immunoiogically equivalent fragments are fragments comprising at least eight, preferably from about 20 to about 40, contiguous amino acids of the amino acid sequence set forth in SEQ ID NO:2 and mimicking a MAT1 epitope. Such fragments are suitable for the generation of anti-MAT1 antibodies.

A derivative of a protein of the invention is a covalent or aggregative conjugate of said protein with another chemical moiety, said derivative displaying essentially the same biological activity as the underivatized protein of the invention.

An exemplary covalent conjugate according to the invention is a conjugate of a protein of the invention with another protein or peptide, such as a fusion protein comprising a protein of the invention, e.g. MAT1 of SEQ ID NO:2, or a fragment thereof, and a protein tag, such as GST or polyhistidine, or a carrier protein suitable for enhancing the in vivo antigenicity of MAT1 or said fragment. A covalent conjugate of the invention further includes a protein of the invention labelled with a detectable group, e.g. a protein of the invention which is radiolabelled, covalently bound to a rare earth chelate or conjugated to a fluorescent moiety or biotin. A protein of the invention is obtainable from a natural source, e.g. by isolation from a mammalian, e.g. human organism, particularly human cells including cell lines, such as HeLa cells or HL60 cells, or human tissue expressing MAT1 , or by chemical synthesis or recombinant DNA techniques.

Based on the amino acid sequence information provided in SEQ ID NO:2 chemical synthesis of a protein of the invention is performed according to conventional methods known in the art. In general, those methods comprise the sequential addition of one or more amino acid residues to a growing (poly)peptide chain. If required, potentially reactive groups, e.g. free amino or carboxy groups, are protected by a suitable, selectively removable protecting group. Chemical synthesis may be particularly advantageous for fragments of MAT1 having no more than about 100 to 150 amino acid residues.

The invention also provides a method for preparing a protein of the invention, said method being characterized in that suitable host cells producing the protein of the invention are multiplied in vitro or in vivo. Preferably, the host cells are transformed or transfected with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for a protein of the invention which DNA is controlled by said promoter. Subsequently, the protein of the invention may be recovered. Recovery comprises e.g. isolating the protein of the invention from the host cells or isolating the host cells comprising the protein, e.g. from the culture broth.

Suitable host cells include eukaryotic cells, e.g. animal cells, plant cells and fungi, and prokaryotic cells, such as gram-positive and gram-negative bacteria, e.g. E. coli. A protein of the invention can be produced directly in recombinant cell culture or as a fusion with a signal sequence, preferably a host-homologous signal.

As used herein, in vitro means ex vivo. In vivo includes cell culture and tissue culture conditions, as well as living organisms.

An amino acid mutant, as defined hereinbefore, may be produced e.g. from a DNA encoding a protein of SEQ ID NO:2, which DNA has been subjected to site-specific in vitro mutagenesis resulting e.g. in an addition, exchange and/or deletion of one or more amino acids. While the site for introducing an amino acid variation is predetermined, the mutation per se need not be predetermined, but random mutagenesis may be performed at the target codon or region. For example, substitutional, deletional and insertional variants are prepared by recombinant methods and screened for CDK7/cyclin H- or TFIIH subunit- binding affinity, activity in CAK or CTD kinase assays, functionality in promoting cell proliferation, DNA repair or transcription, and/or immuno-crossreactivity with the native forms of the protein of the invention, particulariy the protein of SEQ ID NO:2. Altematively, mutants of the invention may be prepared by chemical synthesis using methods routinely employed in the an".

A protein of the invention may be derivatized in vitro or in vivo according to conventional methods known in the art.

A protein of the invention may be used, for example, as immunogen, e.g. to raise MAT1 specific immunoreagents, in a drug or ligand screening assay, or in a purification method, such as affinity purification of a binding ligand, such as CDK7/cyclin H, components of the DNA and transcription machinery, or an anti-MAT1 antibody. A protein of the invention, or a fragment thereof, suitable for in vivo administration and capable of competing with endogenous MAT1 for an endogenous ligand is envisaged as therapeutic agent.

The invention also relates to the use of a protein of the invention, or a fragment thereof, for the generation of a monoclonal or polyclonal antibody, which specifically binds to MAT1. Such anti-MAT1 antibody is intended to include immune sera. Particularly useful for this purpose is a protein fragment consisting of at least eight or more, preferably eight to about fourty, consecutive amino acids of MAT1 of SEQ ID NO:2.

In another embodiment, the invention provides polyclonal and monoclonal antibodies generated against MAT1. Such antibodies may be useful e.g. for immunoassays including immunohistochemistry, as well as diagnostic and therapeutic applications. For example, antibodies specific for the CDK7/cyclin H binding site or the RING finger domain of MAT1 are suitable for blocking or interfering with the function of the endogenous MAT1. Particularly useful are antibodies selectively recognizing and binding to MAT1. The antibodies of the invention can be administered to a subject in need thereof, particularly a human, employing standard methods. The antibodies of the invention can be prepared according to methods well known in the art through immunization of a mammal using as antigen MAT1 (including antigenic fragments thereof and fusion proteins), hereafter referred to as "immunogenic MAT1". Immunogenic MAT1 according to the invention includes e.g. a tagged MAT1 fusion protein comprising e.g. a polyamino acid tag, or a myc epitope tag, and MAT1 , or a fragment thereof. A suitable polyamino acid tag is e.g. polyhistidine. Factors to consider in selecting MAT1 fragments as antigens (either as synthetic peptide or as fusion protein) include antigenicity and uniqueness to the protein. For example, the fragment may be a carboxy-terminal fragment of MAT1 comprising e.g. up to about three hundred consecutive C-terminal amino acids of the amino acid sequence set forth in SEQ ID NO:2. Antigenic MAT1 fragments will usually comprise stretches of hydrophilic amino acid residues. The antibodies as provided by the present invention may be capable of distinguishing between free MAT1 and MAT1 comprised in the CAK complex.

Preferably, a multiple injection immunization protocol is used for immunizing animals with immunogenic MAT1. For example, a good antibody response can be obtained in rabbits by intramuscular injection of about 300 μg immunogenic MAT1 emulsified in complete Freud's adjuvant followed several weeks later by one or more boosts of the same antigen in incomplete Freud's adjuvant.

If desired, immunogenic MAT1 molecules used to immunize the animal may be fused or coupled to a carrier protein by conjugation using techniques which are well-known in the art. Commmonly used carrier proteins which may be chemically coupled to the molecules include key hole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and a bacterial toxoid, e.g. tetanus or diphteria toxoid. Polyclonal antibodies produced by the immunized animals can be further purified by techniques conventionally used in immunology arts for the purification and/or concentration of polyclonal, or monoclonal antibodies, such as affinity chromatography. For example, antibodies of the invention may be purified by binding to and elution from a matrix to which the peptide against which the antibodies are raised to is bound.

For their specificity and ease of production monoclonal antibodies specific for MAT1 are preferred, e.g. for use in detecting MAT1 in analyte samples (e.g. tissue samples arid cell lines). For preparation of monoclonal antibodies, immunization of mouse, rat or goat is preferred. The general method used for the production of hybridomas is well known (Kohler and Milstein (1975), Nature 256, 495). The term antibody as used herein is intended to include intact molecules as well as fragments thereof, such as Fab or F(ab')₂ fragments, which are capable of binding the epitopic determinant.

Confirmation of MAT1 specificity among antibodies of the invention can be accomplished using routine screening techniques known to be suitable for the determination for the elementary reaction pattem of the antibody of interest, such as the enzyme-linked immunosorbent assay (ELISA). For example, it is possible to evaluate the specificity of an antibody of interest without undue experimentation in a competitive binding assay. Such an assay is useful for determining whether the antibody being tested prevents an anti-MAT1 antibody of the invention from binding to MAT1. If the antibody being tested competes with the antibody of the invention, as shown by a decrease in MAT1 binding by the antibody of the invention, then it is likely that the (monoclonal) antibodies bind to the same or a closely related epitope.

The invention is further intended to include chimeric antibodies of the MAT1 -specific antibodies described above, or biologically active fragments thereof. As used herein, the term "chimeric antibody" refers to an antibody in which the variable regions of the antibodies derived from one species are combined with the constant regions of antibodies derived from a different species, or alternatively refers to CDR grafted antibodies. Chimeric antibodies are constructed by recombinant DNA technology. In addition, methods of producing chimeric humanized antibody molecules are known in the art and include combining murine variable regions with human constant regions, or by grafting the murine antibody complementary regions (CDRs) onto the human framework. CDRs are defined as the amino acid sequences on the light and heavy chains of an antibody which form the three- dimensional loop structure that contributes to the formation of the antigen binding site. Any of the above described antibodies or biologically active fragments can be used to generated chimeric and CDR grafted antibodies.

The invention also encompasses cell lines (including hybridomas and transf ectom as) which produce monoclonal antibodies of the invention. The isolation of cell lines producing monoclonal antibodies of the invention can be accomplished using routine screening techniques which permit determination of the elelmentary reaction pattern of the monoclonal antibody of interest. Using the monoclonal antibodies of the invention, it is possible to produce anti-idiotypic antibodies which can be used e.g. to screen monoclonal antibodies to identify whether the antibody has the same binding specificity as a monoclonal antibody of the invention. These antibodies can also be used for immunization purposes.

Once produced as described hereinbefore, anti-MAT1 antibodies may be used diagnostically, e.g. to detect MAT1 expression in a biological cell or tissue sample or to monitor the level of its expression. Preferably, to detect the MAT1 protein in malignant or premalignant somatic cells, a suitable cell sample is derived from skin biopsies, sputum specimens, or urinary specimens. Cells may be obtained from any convenient source, such as skin, blood or hair follicles. Furthermore, anti-MAT1 antibodies are useful for detection of the CAK complex, e.g. by co-immunoprecipitation. MAT1 may be detected and/or bound using anti-MAT1 antibodies in either liquid or solid phase immunoassay formats (i.e. when bound to a caπier). Examples of well-known carriers for use in solid-phase assay formats include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, celluloses, poly¬ acrylamides, agaroses and magnetite. Examplary types of immunoassays which can utilized monoclonal antibodies of the invention are competitive and non-competitive immunoassays in either a direct or indirect format. Specific examples of such immunoassays include the radioimmunoassay (RIA) and the sandwich (immunometric) assay.

The anti-MAT1 antibodies of the invention may be unlabeled or detectably labelled.- There are many different tables and methods of labeling known to those of skill in the art. Examples of the types of labels which can be used in the present invention include enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, and bioluminescent compounds. Another labeling technique which may result in greater sensitivity consists of coupling the antibodies of the invention to low molecular weight haptens, such as biotin. These haptens can then be specifically labeled by means of a second reaction.

The anti-MAT1 antibodies of the invention may also be useful for in vivo diagnosis, such as to identify a site of aberrant cell proliferation, altered transcription or impaired (reduced) DNA repair, or to monitor a particular therapy. In using the anti- MAT1 antibodies of the invention for the |n vivo detection of MAT1 antigen, the detectably labeled monoclonal antibody is given in a dose which is diagnostically effective, meaning that the amount of detectably labelled anti-MAT1 antibody is administered in sufficient quantity to enable detection of the site having cells which (over)express MAT1.

This invention further covers a nucleic acid (DNA, RNA) comprising an isolated, preferably recombinant, nucleic acid (DNA, RNA) coding for a protein of the invention, or a fragment of such a nucleic acid. In addition to being useful for the production of the above mentioned recombinant proteins of the invention, these nucleic acids are useful as probes, thus e.g. readily enabling those skilled in the art to identify and/or isolate nucleic acid encoding MAT1. The nudeic acid may be unlabeled or labeled with a detectable moiety. Furthermore, nucleic acid according to the invention is useful e.g. in a method for determining the presence of MAT1 , said method comprising hybridizing the DNA (or RNA) encoding (or complementary to) MAT1 to test sample nucleic acid and to determine the presence of MATL

Isolated MAT1 nucleic acid embraces such nucleic acid in ordinarily MAT1 expressing cells where the nucleic add is in a chromosomal location different from that of natural cells or is otherwise flanked by a different DNA sequence than that found in nature.

In particular, the invention provides an isolated DNA molecule encoding a MAT1 protein of the invention, or a fragment of such DNA. By definition, such a DNA comprises a coding single-stranded DNA, a double-stranded DNA consisting of said coding DNA and complementary DNA thereto, or this complementary (single stranded) DNA itself. Preferred is a DNA coding for the above captioned preferred MAT1 , e.g. the MAT1 of SEQ ID NO:2, or a fragment of such DNA. Furthermore, the invention relates to a DNA comprising a DNA coding for the above captioned preferred MAT1 , or a fragment thereof, e.g. the DNA with the nucleotide sequence set forth in SEQ ID NO:1 , or a fragment thereof.

The nucleic acid sequences provided herein may be employed to identify DNAs encoding MAT1 amino acid variants, particularly allelic or interspecies variants. A method for identifying such DNA comprises contacting metazoan, particularly mammalian DNA with a nucleic acid probe described above and identifying DNA(s) which hybridize to said probe. Exemplary nucleic acids of the invention can altematively be characterized as those nudeic acids which encode a protein of the invention and hybridize to the DNA having the sequence set forth in SEQ ID NO: 1 , or a seleded portion (fragment) of said DNA. Preferred are such DNA molecules encoding a protein of the invention which hybridize under stringent conditions to the above-mentioned DNAs.

Stringency of hybridization refers to conditions under which polynucleic acids hybrids are stable. Such conditions are evident to those of ordinary skill in the field. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T_m) of the hybrid which decreases approximately 1 to .5°C with every 1 % decrease in sequence homology. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of higher stringency, followed by washes of varying stringency.

Given the guidance of the present invention, the nucleic acids of the invention are obtainable according to methods well known in the art. The present invention further relates to a process for the preparation of such nucleic acids.

For example, a DNA of the invention is obtainable by chemical synthesis, by recombinant DNA technology or by polymerase chain reaction (PCR). Preparation by recombinant DNA technology may involve screening a suitable cDNA or genomic library. A suitable method for preparing a DNA or of the invention may e.g. comprise the synthesis of a number of oligonucleotides, their use for amplification of DNA by PCR methods, and their splicing to give the desired DNA sequence. Suitable libraries are commercially available, e.g. the libraries employed in the Examples, or can be prepared from tissue samples.

As a screening probe, there may be employed a DNA or RNA comprising substantially the entire coding region of MAT1 , or a suitable oligonucleotide probe based on said DNA. A suitable oligonucleotide probe (for screening involving hybridization) is a single stranded DNA or RNA that has a sequence of nucleotides that includes at least about 20 to about 30 contiguous bases that are the same as (or complementary to) any about 20 or more contiguous bases of the nucleic acid sequence set forth in SEQ ID NO:1. The nucleic acid sequences selected as probes should be of sufficient length and sufficiently unambiguous so that false positive results are minimized. Preferred regions from which to construct probes include 5' and/or 3' coding sequences, sequences predicted to encode ligand binding sites, and the like. For example, either the full-length cDNA clone disclosed herein or fragments thereof can be used as probes. Preferably, nucleic acid probes of the invention are labeled with suitable label means, e.g. a chemical moiety, for ready detection upon hybridization. For example, a suitable label means is a radiolabel. The preferred method of labelling a DNA fragment is by incoφorating ^P-labeled α-dATP with the Klenow fragment of DNA polymerase in a random priming readion, as is well known in the art. Oligonucleotides are usually end-labeled with ^P-labeled γ-ATP and polynucleotide kinase. However, other methods (e.g. non-radioactive) may also be used to label the fragment or oligonucleotide, including e.g. enzyme labelling and biotinylation.

After screening e.g. a suitable library, e.g. with a portion of DNA including substantially the entire MAT1 -encoding sequence or a suitable oligonucleotide based on a portion of said DNA, positive clones are identified by deteding a hybridization signal; the identified clones are charaderized by restridion enzyme mapping and/or DNA sequence analysis, and then examined, e.g. by comparison with the sequences set forth herein, to ascertain whether they include DNA encoding a complete MAT1 (i.e., if they include translation initiation and termination codons). If the selected clones are incomplete, they may be used to rescreen the same or a different library to obtain overlapping clones. If the library is genomic, then the overlapping clones may include exons and introns. If the library is a cDNA library, then the overlapping clones will include an open reading frame. In both instances, complete clones may be identified by comparison with the DNAs and deduced amino acid sequences provided herein.

Furthermore, in order to detect any abnormality of an endogenous MAT1 genetic screening may be caπied out using nucleotide sequences of the invention as hybridization probes. Also, based on the nucleic acid sequences provided herein antisense-type therapeutic agents may be designed.

It is envisaged that a nucleic acid of the invention can be readily modified by nucleotide substitution, nucleotide deletion, nucleotide insertion or inversion of a nucleotide stretch, and any combination thereof. Such modified sequences can be used to produce mutant MAT1s which differ from the proteins found in nature. Mutagenesis may be predetermined (site-specific) or random. A mutation which is not a silent mutation must not place sequences out of reading frames and preferably will not create complementary regions that could hybridize to produce secondary mRNA structures such as loops or haiφins.

The cDNA or genomic DNA encoding native or mutant MAT1 of the invention can be incoφorated into vectors for further manipulation. Furthermore, the invention concerns a recombinant DNA which is a hybrid vector comprising at least one of the above mentioned DNAs.

The hybrid vectors of the invention comprise an origin of replication or an autonomously replicating sequence, one or more dominant marker sequences and, optionally, expression control sequences, signal sequences and additional restriction sites.

Preferably, the hybrid vector of the invention comprises an above described nucleic acid insert operably linked to an expression control sequence, in particular those described hereinafter.

Vectors typically perform two functions in collaboration with compatible host cells. One function is to facilitate the cloning of the nucleic acid that encodes a MAT1 protein of the invention, i.e. to produce usable quantities of the nucleic acid (cloning vectors). The other function is to provide for replication and expression of the gene constructs in a suitable host, either by maintenance as an extrachromosomal element or by integration into the host chromosome (expression vectors). A cloning vector comprises the DNAs as described above, an origin of replication or an autonomously replicating sequence, selectable marker sequences, and optionally, signal sequences and additional restriction sites. An expression vector additionally comprises expression control sequences essential for the transcription and translation of the DNA of the invention. Thus an expression vector refers to a recombinant DNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into a suitable host cell, results in expression of the cloned DNA. Suitable expression vectors are well known in the art and include those that are replicable in eukaryotic and/or prokaryotic cells.

Most expression vectors are capable of replication in at least one class of organisms but can be transfected into another organism for expression. For example, a vector is cloned in E. coli and then the same vector is transfected into yeast or mammalian cells even though it is not capable of replicating independently of the host cell chromosome. DNA may also be amplified by insertion into the host genome. However, the recovery of genomic DNA encoding MAT1 is more complex than that of exogenously replicated vector because restridion enzyme digestion is required to excise MAT1 DNA. DNA can be amplified by PCR and be directly transfected into the host cells without any replication component.

Advantageously, expression and cloning vector contain a selection gene also referred to as selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that confer resistance to antibiotics and other toxins, e.g. ampidllin, neomycin, methotrexate or tetracycline, complement auxotrophic deficiencies, or supply critical nutrients not available from complex media.

Since the amplification of the vectors is conveniently done in E. coli. an E. coli genetic marker and an E. coli origin of replication are advantageously included. These can be obtained from E. coli plasmids, such as pBR322, Bluescript vector or a pUC plasmid.

Suitable seledable markers for mammalian cells are those that enable the identification of cells competent to take up MAT1 nucleic acid, such as dihydrofolate reductase (DHFR, methotrexate resistance), thymidine kinase, or genes confering resistance to G418 or hygromycin. The mammalian cell transfectants are placed under selection pressure which only those transf edants are uniquely adapted to survive which have taken up and are expressing the marker.

Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to MAT1 nucleic acid. Such promoter may be inducible or constitutive. The promoters are operably linked to DNA encoding MAT1 by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native MAT1 promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of MAT1 DNA. However, heterologous promoters are preferred, because they generally allow for greater transcription and higher yields of expressed MAT1 as compared to native MAT1 promoter.

Promoters suitable for use with prokaryotic hosts include, for example, the β-lactamase and ladose promoter systems, alkaline phosphatase, a tryptophan (tφ) promoter system and hybrid promoters such as the tac promoter. Their nucleotide sequences have been published, thereby enabling the skilled worker operably to ligate them to DNA encoding MAT1 , using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems will also generally contain a Shine-Delgarno sequence operably linked to the DNA encoding MATL MAT1 gene transcription from vectors in mammalian host cells may be controlled by promoters compatible with the host cell systems, e.g. promoters derived from the genomes of viruses.

Transcription of a DNA encoding a protein according to the invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vedor.

The various DNA segments of the vedor DNA are operatively linked, i.e. they are contiguous and placed into a fundionai relationship to each other employing conventional ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the plasmids required. If desired, analysis to confirm correct sequences in the constructed plasmids is performed in a manner known in the art. Suitable methods for construding expression vedors, preparing in vitro transcripts, introducing DNA into host cells, and performing analyses for assessing MAT1 expression and function are known to those skilled in the art. Gene presence, amplification and/or expression may be measured in a sample diredly, for example, by conventional Southern blotting, northern blotting to quantitate the transcription of mRNA, dot blotting (DNA or RNA analysis), in situ hybridization, using an appropriately labelled probe based on a sequence provided herein, binding assays, immunodetedion and functional assays. Those skilled in the art will readily envisage how these methods may be modified, if desired.

The invention further provides host cells capable of producing a MAT1 protein of the invention and including heterologous (foreign) DNA encoding said protein. The nucleic acids of the invention can be expressed in a wide variety of host cells, e.g. those mentioned above, that are transformed or transfected with an appropriate expression vector. A protein of the invention may also be expressed as a fusion protein. Recombinant cells can then be cultured under conditions whereby the protein (s) encoded by the DNA of the invention is (are) expressed.

Suitable prokaryotes include eubaderia, such as Gram-negative or Gram-prositive organisms, such as E. coli, e.g. E. coli K-12 strains, DH5α and HB 101 , or Bacilli. Further host cells suitable for MAT1 encoding vectors include eukaryotic microbes such as filamentous fungi or yeast, e.g. Saccharomyces cerevisiae. Higher eukaryotic cells include insed, amphebian and vertebrate cells. In recent years propagation of vertebrate cells in culture (tissue culture) has become a routine procedure. The host cells referred to in this application comprise cells in culture as well as cells that are within a host animal. DNA may be stably incoφorated into the cells or may be transiently expressed according to conventional methods.

Stably transfected mammalian cells may be prepared by transfecting cells with an expression vector having a seledable marker gene, and growing the transfected cells under conditions selective for cells expressing the markeF gene. To prepare transient transfedants, mammalian cells are transfected with a reporter gene to monitor transfection efficiency. To produce such stably or transiently transfected cells, the cells should be transfeded with a sufficient amount of MAT1 -encoding nucleic acid to form MAT1 of the invention. The precise amounts of DNA encoding MAT1 of the invention may be empirically determined and optimized for a particular cell and assay.

A DNA of the invention may also be expressed in non-human transgenic animals, particularly transgenic warm-blooded animals. Methods for producing transgenic animals, induding mice, rats, rabbits, sheep and pigs, are known in the art and are disclosed, for example by Hammer et al. ((1985) Nature 315, 680-683). An expression unit including a DNA of the invention coding for a MAT1 together with appropriately positioned expression control sequences, is introduced into pronuciei of fertilized eggs. Introduction may be achieved, e.g. by microinjection. Integration of the injected DNA is detected, e.g. by blot analysis of DNA from suitable tissue samples. It is preferred that the introduced DNA be incoφorated into the germ line of the animal so that it is passed to the animal's progeny. Furthermore, a knock-out animal may be developed by introducing a mutation in the MAT1 sequence, thereby generating an animal which does not express the functional MAT1 gene anymore. Such knock-out animal is useful e.g. for studying the role of the MAT1 or the MAT1/cyclin H/CDK7 complex in metabolism, but in particular for providing a mammalian animal model with a suitable genetic background for introducing and expressing transgenes encoding the homologous human MAT1. Expression of human counterpart MAT1 on a homologous gene knock-out background has the unique advantage of excluding differences in efficacies of drugs on a given protein (in this case MAT1 ) caused by species- specific sequence differences in said protein.

Host cells are transfeded or transformed with the above-captioned expression or cloning vectors of this invention and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. Heterologous DNA may be introduced into host cells by any method known in the art, such as transfedion with a vector encoding a heterologous DNA by the caidum phosphate coprecipitation technique, by electroporation or by lipofectin-mediated. Numerous methods of transfection are known to the skilled worker in the field. Successful transfedion is generally recognized when any indication of the operation of this vector occurs in the host cell. Transformation is achieved using standard techniques appropriate to the particular host cells used (see, e.g. Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press).

While the DNA provided herein may be expressed in any suitable host cell, e.g. those referred to above, preferred for expression of DNA encoding functional MAT1 are eukaryotic expression systems, particularly mammalian expression systems, including commercially available systems and other systems known to those of skill in the art.

In a further embodiment, the present invention provides a method for identifying compounds capable of binding to MAT1 , said method comprising employing a protein of the invention in a binding assay. Such assay may be useful for identification of a MAT1 ligand including a novel endogenous ligand. More specifically, a binding assay according to the invention involves exposure of a protein of the invention, e.g. the MAT1 of SEQ ID NO:2, to a ligand candidate under conditions and for a time sufficient to allow binding of said potential ligand to said protein of the invention, and determining qualitatively and/or quantitatively, whether binding has occurred, e.g. by deteding the complex formed between the ligand and the protein of the invention. If appropriate, such binding assay may further comprise cyclin H and/or CDK7. Binding of a ligand to the protein of the invention may be analyzed according to conventional methods, e.g. methods suitable for detecting the association of proteins, such as electrophoresis or immunoanalytical methods, e.g. immunoprecipitation with an anti-MAT1 antibody.

A preferred binding assay is a competitive binding assay. The principle underlying a competitive binding assay is generally known in the art. Briefly, such a binding assay is performed by allowing a compound to be tested for its capability to compete with a known, suitably labeled ligand for the binding site at a target molecule, i.e. a protein of the invention. A suitably labeled ligand is e.g. a radioactively labeled ligand or a ligand which can be deteded by its optical properties, such as absorbance or fluorescence. After removing unbound ligand and test compound the amount of labeled ligand bound to the protein of the invention is measured. If the amount of bound labeled ligand is reduced in the presence of the test compound, said compound is found to bind to the target molecule, i.e. the protein of the invention. Compounds binding to the target protein of the invention may modulate a functional property of MAT1 and may thereby be identified as an agonist or antagonist in a functional assay. A competitive binding assay may be performed e.g. with transformed or transfected host cells expressing the protein of the invention, or with a soluble or immobilized protein of the invention.Also, such assay may be performed in the presence of CDK7 and cyclin H.

In yet another aspect, the present invention relates to a functional assay, which is suitable for detection of a change of a physical-chemical property of MAT1 , such as conformation, and binding affinity for associatable molecules. Such functional response is the result of the interaction of the compound to be tested with MAT1 , and may affect e.g. the phosphory¬ lation status or activity of another protein influenced by MAT1 within a cell expressing functional MAT1 (as compared to a negative control). Based on the information provided herein those of skill in the art can readily identify an assay suitable for detecting such change in the activity of another protein indicative of the expression of MAT1. More specifically, the present invention also provides a method suitable for identifying a component or agent which modulates the biological activity of MAT1 , said method comprising contacting MAT1 of SEQ ID NO:2, or another suitable protein of the invention, with at least one compound or agent, whode ability to modulate the activity of MAT1 is sought to be investigated, and determining the change of MAT1 acitivity of said protein coused by said component or agent. The method enables identification of stimulatory or inhibitory components of MAT1 activity. An assay is then designed to measure a functional property of MAT1.

In context with a fundional assay, MAT1 is intended to include MAT1 in association with other macromolecules it is naturally associated with, particularly a CAK complex comprising a protein of the invention, CDK7 and cyclin H. Preferred for use in a functional assay is a CAK complex comprising the MAT1 of SEQ ID NO:2, cyclin H and CDK7.

A component or agent which modulates the activity of MAT1 refers to a compound or signal that is capable of altering the response pathway mediated by functionally active MAT1 within a cell (as compared to the absence of MAT1). Analogously, a component or agent which modulates the adivity of the CAK complex refers to a compound or signal that is capable of altering the response pathway mediated by the functionally active CAK complex within a cell (as compared to the absence of a functionally active complex).

Modulation of MAT activity particularly refers to modulation of its ability to act as an assembly factor in the formation of a CAK complex. Modulation of CAK activity particularly refers to modulation of one or more of the following properties of the CAK complex:, ligand (substrate) binding affinity and/or kinetics, catalytic adivity (CAK- or CTD-adivity), the ability to regulate cell cycle progression, DNA repair and transcription. Methods for determining a change in any of these properties are well-known in the art.

For example, a change in the ability of MAT1 to act as assembly factor may be determined using the methods described herein. More specifically, the effect of a particular compound or signal on the interaction of MAT1 with CDK7/cyclin H may be determined in an assay suitable for determining the affinity and/or rate of binding of MAT1 to the CDK7/cyclin H complex. To this end, MAT1 and cyclin H/CDK7 are (co-) expressed in an appropriate expression system, such as yeast, E. soli, insect cells or mammalian cells transformed with suitable expression vectors. For example, the proteins in question may be expressed in baculovirus-infected insect cells, either separately or jointly. The proteins are recovered from the cells, and in enriched or purified form, e.g. in a cell extract or lysate, exposed to the test compound under conditions allowing interaction. If desired, the host cells may be metabolically labeled, e.g. [^Sj-labeled. In response to increasing amounts of a compound inhibiting the interaction of MAT1 with cyclin H/CDK7(antagonist), corresponding decreases in CAK complex formation, or the ability of CAK to phosphorylate a suitable substrate are detectable. If the antagonist associates with MAT1 , this inhibition will correlate with the association between the antagonist and MAT1 , as detectable e.g. by immunoprecipitation.

Modulation of the CAK complex associated kinase activity may be assessed by analyzing phosphorylation of a suitable substrates, e.g. by employing a protein kinase assay as decribed hereinbefore. To study the ability of the CAK complex to regulate the cell cycle, cell cycle progression may be analyzed, e.g. in mammalian, particularly human cells, according to methods known in the art, e.g. as described by Tassan, J.P. et al. ((1994), J. Cell Biology 127, 467-478). Briefly, cells, particularly human cells, such asHeLa cells, containing recombinant MAT1 encoding nucleic acid, and, optionally, recombinant cyclin H- and CDK7-encoding nucleic add are synchronized, e.g. by centifugal elutriation or using drug arrest-release protocols (see e.g. Krek, W. & Nigg, E.A. (1991) EMBO J. 10, 305-31 ; O'Connor, P.M. & Jackman, J. in "Cell Cycle - Material and Methods" (1995), ed. M. Pagano, Springer Verlag, Berlin, Heidelberg, New York). The interaction with the transcription apparatus or the ability to integrate cellular events with cell cycle progression may be analyzed using in vitro transcription systems or reporter assays involving e.g. chloramphenicol transferase (CAT) or luciferase in vivo.

Assay methods generally require comparison to various controls. A change in MAT1 activity is said to be induced by a test compound if such an effect does not occur in the absence of the test compound.

In an assay of the invention, MAT1 of SEQ ID NO:2, or another protein of the invention, may be used in a soluble, immobilized or cellular form. If used in an immobilized form, the protein of the invention is attached to a solid support. To obtain a cellular form of the protein of the invention, it is produced by a suitably transformed host cell which is employed in the assay. Preferably, the protein of the invention is a recombinant protein. Also, cyclin H or CDK7 may be present in a soluble, immobilized or cellular form, with the provision that they are available in a form allowing formation of an active CAK complex. Cellular cyclin H or CDK7 may be homologous or heterologous to the producing cell. For produdion of heterologous cyclin H or CDK7, cells are transformed with a suitable expression vector. For example, the protein of the invention, cyclin H and CDK7 may be produced by (coupled) in vitro transcription-translation, e.g. using a system as described in the Examples. Advantageously, the protein of the invention, cyclin H and CDK7 are obtained from the same species, e.g. an assay of the invention employing human MAT1 further comprises human cyclin H and human CDK7.

The assays of the invention may be useful to identify compounds or signals which are capable of acting as therapeutic agents in a mammal in need thereof, which are effective against a disease or disorder caused by a decrease or increase of cellular MAT1 activity. Thus, the assays described herein render possible e.g. identification of cell growth inhibitors, which may be suitable as therapeutic agents against hypeφroliferative disorders, such as benign and malignant tumors, and psioriasis, e.g. components which are capable of affecting progression of the cell cyclus. Furthermore, compounds identified by a method according to the invention may be therapeutically effedive in diseases which are caused by inappropriate transcription or dysfunctional DNA repair. In particular, the assays provided herein will enable identification and design of MAT1 -specific compounds, particulariy molecules specifically binding to MAT1 (MAT1 -ligands).

Host cells expressing a nucleic acid coding for a protein of the invention are e.g. useful for drug screening, and the present invention encompasses a method for identifying a compound or signal which modulates the biological activity of MAT1, said method comprising exposing cells containing heterologous DNA encoding a suitable protein of the invention, wherein said cells produce functionally active MAT1 , to at least one compound or signal, whose ability to modulate the activity of said MAT1 is sought to be determined, and thereafter monitoring said cells for changes caused by said modulation.

In particular, the invention covers an assay for identifying compounds which modulate the activity of MAT1 , said assay comprising:

- contacting cells producing functionally active MAT1 and containing heterologous DNA encoding MAT1 and, optionally, additionally containing heterologous DNA encoding cyclin H and/or, with at least one compound to be tested for its ability to modulate the activity of MAT1 , and - monitoring said cells for a resulting change in MAT1 adivity.

Preferred such cells are suitably manipulated mammalian cells, particularly human cells, such as HeLa cells, which express MAT1 , and optionally cyclin H and CDK7. Cells producing functionally active CAK complex may be employed for the identification of compounds, particulariy low molecular weight molecules including oligopeptides capable of ading as agonists or antagonists of MAT1 , and which are bioavailable in vitro and in vivo. Within the context of the present invention, an agonist is understood to refer to a molecule that is capable of mimicking the adion of MAT1, e.g. that is capable of interacting with CDK7/cyclin H. For example, an agonist is capable of increasing or decreasing a measurable parameter within the host ceil as does natural MAT1 increase or decrease said parameter. More specifically, an agonist is e.g. capable of associating with cyclin H/CDK7, resulting in the formation of a ternary complex having CAK- and CTD activity.

A preferred method for detecting a MAT1 agonist comprises the steps of (a) exposing a protein of the invention coupled to a CAK response pathway, under conditions and for a time sufficient to allow interaction of the compound with the protein of the invention and an associated response through the pathway, and (b) detecting an increase or decrease in the stimulation of the response pathway resulting from the interaction of the compound with the protein of the invention, relative to the absence of the tested compound and therefrom determining the presence of a MAT1 agonist.

By contrast, in situations where it is desirable to tone down the activity of the CAK complex, MAT1 antagonizing molecules are useful. Within the context of the present invention, an antagonist is capable of counteracting or neutralizing the action of MAT1. For example, an antagonist is capable of interacting with CDK7/cyclin H, but does not stimulate a CAK- complex mediated response pathway within the cell. In particular, MAT1 antagonists are generally identified by their ability to interact with CDK7/cyclin H by interfering with the binding of MAT1.

A preferred method for identifying a MAT1 antagonist comprises the steps of (a) exposing a compound in the presence of a suitable protein of the invention, e.g. MAT1 of SEQ ID NO:2 or the deletional mutant Δ , to CDK7/cyclin H coupled to a CAK complex mediated response pathway, under conditions and for a time sufficient to allow interaction of all components and an associated response through the pathway, and (b) detecting an inhibition of the stimulation of the response pathway induced by CAK, said inhibition resulting from the interaction of the compound with the protein of the invention or with CDK7/cyclin H relative to the stimulation of the response pathway by the protein of the invention alone and therefrom determining the presence of a MAT1 antagonist. Inhibition may be detected, e.g. if the test compound competes with the protein of the invention. Compounds which may be screened utilizing such method include blocking antibodies specifically binding to a protein of the invention.

Generally, conditions and times suffident for interaction of an agonist or antagonist with MAT1 may vary with the source and purity of MAT1 , however, conditions generally suitable for interadion occur between about 4°C and about 40°C, preferably between about 4°C and about 37°C, in a buffer solution containing between 0 and 2 M NaCl, preferably between 0.1 and 0.9 M NaCl, and within a pH range of between 5 and 9, preferably between 6.5 and 8. Sufficient time for the binding and response will generally be between about 15 min and about 24 h after exposure. Advantageously, the buffer solution comprises magnesium ions (Mg^2*), added e.g. in form of a magnesium salt, such as magnesium acetate or magnesium nitrate, in a concentration between about 300 to about 2000 μM, and calcium ions (Ca²⁺), preferably in a concentration between about 1 to about 15 nM. Suitable conditions are e.g. those existing in a commercially available reticulocyte lysate, such as the lysates used in the Examples.

Finally, the present invention also relates to a method of inhibiting CAK complex associated-activity in a cell, comprising introducing into said cell an agent which inhibits the binding of MAT1 to cyclin H/CDK7. Such agent may e.g. be selected from the group consisting of an oligonucleotide which binds nucleic acid encoding MAT1 , thereby inhibiting e.g. expression of MAT1; an antibody which specifically binds MAT1, and a compound which inactivates MAT1 in such a way that formation of the ternary CAK complex is prevented, e.g. by binding to or degrading MAT1.

The invention particularly relates to the specific embodiments (e.g. the proteins, nucleic acids, methods for the preparation, assays and uses thereof) as described in the Examples which serve to illustrate the present invention, but should not be construed as a limitation thereof. Abbreviations used herein have the following meaning: aa = amino acid(s); CAK: cyclin-dependent kinase-activating kinase; CDK= cyclin- dependent Kinase; CTD = C-terminal domain; DTT = dithiothreitol; GST = glutathione-S- transferase; RT-PCR = reverse transcriptase -polymerase chain reaction; SDS-PAGE: sodium dodecyl sulfate - polyacrylamide gel electrophoresis

Miscellaneous Methods and Techniques

Cell culture and cell cycle synchronization: HeLa cells (ATCC accession No. CCL2) are cultured at 37°C in a 7 % CO2 atmosphere in Dulbecco's modified Eagle's medium, supplemented with 5 % fetal calf serum and penicillin-streptomycin (GIBCO BRL). For cell cycle synchronization, HeLa cells are released from cell cycle blocks imposed by either thymidine/aphidicolin (G1/S phase) or nocodazole (M phase), exactly as described previously (Golsteyn.R.M. et al. (1995) J. Cell Biol , 129, 1617-1628; Fry.A.M. et al. (1995) J. BioL Chem, 270, 12899-12905).

For immunoprecipitation experiments, exponentially growing HeLa cells are lysed in radioimmunoprecipitation assay (RIPA) buffer containing both protease and phosphatase inhibitors (50 mM Tris, pH 8.0, 150 mM NaCl, 1 % NP40, 1 % deoxycholate, 0.1 % SDS, 1 mM PMSF, and 10 μg/ml each of leupeptin, aprotinin, and pepstatin, and 20 mM NaF, 0.3 mM Na3VO₄, 20 mM β-glycerophosphate) and incubated with anti-CDK7 or anti-MAT1 antibodies (infra), as described by Krek.W. and Nigg.E.A. (1991) EMBO J., 10, 305-316. Briefly, the lysates are incubated with immunoglobulin-protein A/G-Sepharose beads (prepared as described below) for 2h at 4°C on a rotating wheel. Immune complexes are washed four times with RIPA buffer, twice with PBS, and, if suitable, once with kinase assay buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCI₂, 1 mM DTT).

Western blotting is performed as described previously (Krek.W. and Nigg.E.A. (199.1 ) EMBOJ., 10, 3331-3341 ; Maridor.G. et al., (1993) J. Cell Sci., 106, 535-544), using enhanced chemoluminescence (ECL) (Amersham) for detection of immunoreactive proteins. Indired immunofluorescence microscopy is performed according to Tassan,J.-P., et al. (1994) J. Cell Biol, 127, 467-468.

To create a catalytically inactive mutant of CDK7 designated K41 R, lysine 41 (for CDK7 amino acid sequence and numbering, see Tassan et al., supra, p. 470, Figure 1 ) is substituted by arginine, using the Transformer™ Site-Directed Mutagenesis Kit (Clontech), as described by the manufacturer. Amino-terminally myc epitope tagged CDK7 is contructed in the eukaryotic expression plasmid pRc CMV (Invitrogen, San Diego, CA). The protein produced by this plasmid contains the peptide Met Glu Gin Lys Ile Ser Glu Glu Asp Leu Asn Met Asn Phe fused in frame to the initiator Met of CDK7; thus, the anti-myc epitope mAb 9E10 (Evan.G.I. et al., (1985) Mol. Cel Biol, 5, 3610-3616) can be used for its detection. In vitro translation of CDK7 or myc epitope-tagged CDK 7 (constructed in pBluescript; Schmidt-Zachmann, M.S. and Nigg, E.A. (1993), J. Cell Sci., 105, 799-806) is performed by priming the coupled transcription-translation reticulocyte lysate system (Promega Coφ.) with the corresponding Bluescript plasmids, as described by the manufacturer.

Example 1 : Purification and Microsequencing of MAT1

For purification of MAT1 , HeLa cells are grown on 15-cm tissue culture dishes and lysed in RIPA buffer containing both protease and phosphatase inhibitors (supra). Protein complexes containing CDK7 are then immunoprecipitated by incubation of lysates for 2h at

4°C with MO-1.1 immunoglobulin, which is a murine monoclonal anti-CDK7 antibody, (Tassan et al., supra) covalently attached to protein G sepharose beads with dimethyl pimelimidate (Hariow.E. and Lane.D. (1988). Antibodies: a laboratory manual, U.S.A., Cold Spring Harbor Laboratory). After washing with RIPA and PBS, immune complexes are released from the beads by boiling in 3 % SDS, 5 % β-mercaptoethanol, 5 mM Tris-HCl, pH

6.8. Proteins are concentrated by precipitation for 1 hour at -70°C with 7 volumes of acetone, and pellets are resuspended in 3 x gel sample buffer. 100-200 pMol of the MAT1 polypeptide coprecipitating with CDK7 ( referred to as p32 in Tassan et al., supra) are separated on a mini-SDS gel (10 % acryiamide, 1.5 mm thickness) and visualized by negative staining as described by Ortiz, M.L. et al. ((1992) FEBS Lett., 296, 300-304). Bands are cut out, sliced into small pieces, dried by rotary evaporation, and reswollen in a solution of 70 % formic acid containing 100 mg/ml CNBr. CNBr-Digestions are performed for 48 hours at room temperature with occasional shaking. Gel pieces are then extracted twice for one hour with 300-500 μl of 0.1 % trifluoroacetic acid acetonitrile (4:6, v/v). Supernatants are pooled, dried, and the extracted peptides are separated on a Tris-tricine SDS gel as described by Schagger, H. and von Jagow, G. ((1987) Anal. Biochem., 166, 368-379) before blotting onto a polyvinylidene difluoride membrane. After staining with 0.1 % amidoblack in water, the blot is destained extensively with water and the bands are cut out. N-terminal sequence determinations are performed by microsequencing. Example 2: Cloning and sequencing of human MAT1 cDNA.

Degenerate oligonucleotides are designed on the basis of two peptide sequences obtained by microsequence analysis (peptides a and b, infra). First, a 25mer peptide (in the following referred to as peptide b with the amino acid sequence extending from aa 126to aa 150 in SEQ ID NO:1 ) is used to design two PCR primers corresponding to its N- and C-terminal sequences (GlulleTyrGlnGluAsn, aa 126 to 132, and ThrArgGluGlnGluGlu, aa 144 to 149, respedively). Using these oligonucleotides for RT-PCR on HeLa polyA⁺ RNA, as described by Schultz,S.J. and Nigg.E.A. ((1993) Cell Growth and Diff. , 4, 821-830), a 72 bp cDNA, having the sequence extending from bp 425 to 496 in SEQ ID NO:1 , encoding peptide b is isolated. Subsequently, a homologous oligonucleotide corresponding to the intemal sequence LysAspVallleGlnLys in peptide a (infra) is synthesized. In combination with a degenerate primer corresponding to the sequence PheValArgGlyAlaGlyAsn (aa 39 to aa 45 in SEQ ID NO:1) in peptide a (ValAsnValXGIyHisThrLeuXGIuSerXValAspLeuLeuPheValArg GlyAlaGlyAsnXProGlu, (X representing unidentified residues; aa 23 to aa 48 in SEQ ID NO:1) a longer PCR produd of 280 bp is obtained (bp 182 to 461 in SEQ ID NO:1 ). This 280 bp cDNA fragment is then used as a probe for screening of the cDNA library. 10⁶ plaque forming units from a human placenta λgt10 cDNA library (Clontech) are screened by DNA hybridization as described by Tassan et al. (1994, supra), using the 280 bp cDNA fragment of Example 1 as probe. Inserts are excised from λgt10 by EcoRI digestion and subcloned into the EcoRI site of pBluescript IIKS (Stratagene, La Jolla, CA). Sequencing of the MAT1 cDNA is carried out for both strands by the dideoxynucleotide method as described previously (Maridor.G., et al. (1993) J. Cell Sci., 106, 535-544). The isolated cDNA codes for a 312 amino acid protein with a calculated molecular weight of 36 kDa. Thus, the protein (herein termed MAT1 ) is somewhat larger than estimated previously (32 kD) on the basis of its gel electrophoretic mobility (Tassan et al., 1994, supra). The nucleotide sequence of the cloned cDNA as well as the deduced aminό acid sequence of MAT1 are shown in SEQ ID NOs.1 and 2. The complete sequence are also available from the EMBL database (Accession No. X87843). Independently, two partial sequences derived from genome sequencing projects have been deposited (Accession Nos. T71380 and Z44069).

The two peptide sequences a and b (Example 1) determined from the purified protein are encoded by this cDNA, confirming that it codes for the third subunit of CAK. Database searches uncover no extensive similiarities between MAT1 and known proteins, but they reveal the presence of a C3HC4 putative zinc binding domain in the N-terminus (aa 6 to aa 48 in SEQ ID NO:2). This particular zinc finger motif is frequently referred to as a RING finger (from the human ring! gene; Freemont, P.S. et al., (1991) Cell, 64, 483-484). The nucleotide sequence shown in SEQ ID NO:1 does not predid an in-frame stop codon upstream of the putative translation initiator AUG. Nevertheless, it is believed that the cDNA of SEQ ID NO:1 comprises cDNA coding for the entire 36 kD CAK subunit. Firstly, the sequence context surrounding the proposed initiator AUG matches perfectly the consensus determined for effident translational initiation (Kozak, M. (1989) J. Cell Biol, 108, 229-241). Secondly, SDS-PAGE reveals precise comigration between the 36 kD protein synthesized from the cloned cDNA jn_vjlτo and the third subunit co-immunoprecipitating with CDK7/cyclin H from HeLa cells.

Example 3: Mutant lacking the N-terminal ring domain (MAT1Δ)

Since the initiator ATG is found to be contained within an Ncol restriction site, the N-terminal RING finger can be deleted by excising an Ncol to Bglll fragment encompassing the RING domain (extending from bp 48 to 673 in SEQ ID NO:1) and be replaced by a PCR fragment extending from glycine in position 50 (Gly50) of SEQ ID NO:1 to the Bglll site of MAT1 (aa 207/208 in SEQ ID NO:1). The latter PCR fragment is amplified using the PCR primer GATGCCATGGGTACTCCACTCAGAA (bp 10 to 25 of said primer correspond to bp 197 to 212 in SEQ ID NO:2) introducing an Ncol site upstream of Gly50. Hence, MAT1Δ codes for a polypeptide corresponding to the fusion of the initiator codon with the sequence C terminal to Gly50 starting with threonine at position 51 in SEQ ID NO:1. MAT1Δ lacking the RING domain is used to determine whether the RING finger of MAT1 might be required for the formation of the ternary complex with CDK7 and cyclin H. To this end, the mutant is tested for its ability to reconstitute an active CAK complex, following translation of the individual components in a rabbit reticulocyte lysate (cf. Example 6). MAT1Δ is as efficient in forming a ternary complex as is the wild-type MAT1 , indicating that the presence of the RING finger is not required for the association of MAT1 with CDK7 and cyclin H. Also, the RING finger of MAT1 is not necessary for conferring CAK activity to CDK7. These results indicate that the RING finger of MAT1 remains available for promoting interactions of the ternary complex with other molecules. The RING domain may play a role in mediating protein-protein (or protein-lipid) interactions, since no binding of MAT1 to either single-stranded or double-stranded DNA may be detected using MAT1 alone or MAT1 reconstituted within a CAK complex.

Example 4: Expression of MAT1 in E.coli

A cDNA spanning the entire coding sequence of MAT1 is cloned into the plasmid pGEX-KG (Guan.K. and Dixon.J.E. (1991) Anal. Biochem., 192, 262-267), and the GST-MAT1 fusion protein, as obtained using a QIAGEN kit and following the instrudion of the manufadurer, is expressed in E.coli strain BL21 (DE3). The expressed protein is highly insoluble and is therefore solubilized under denaturing conditions, before being renatured and subjeded to purification (Guan.K. and Dixon.J.E., supra). To this end, 200 ml cultures are grown to an OD 0C I .0, and production of GST-MAT1 protein is induced by the addition of isopropyl-β-

D-thiogaladopyranoside (0.1 mM). After centrifugation, cells are resuspended and lysed in 15 ml of 50 mM Tris-HCl pH 7.5, 2 mM EDTA, 1 mM DTT, 1 mM PMSF, 10 μg ml leupeptin, 10 μg/ml pepstatin, 10 μg/ml aprotinin and 2 mg/ml lysozyme. The lysate is sonicated and centrifuged at 10,000 g for 15 min. The pellet is resuspended in 2.5 ml of 0.1 M Tris-HCl, pH 8.5, containing 6 M urea, and the sample is centrifuged again for 15 min. Then, the supernatant is diluted 1:10 with 50 mM KH₂PO₄ (pH 10.7), 1 mM EDTA (pH 8.0), 50 mM

NaCl and incubated at room temperature for 30 min. During this incubation, the pH of the solution is maintained at 10.7. Subsequently, the pH is adjusted to 8.0 and the incubation is continued for 30 min at room temperature. Finally, insoluble material is removed by centrifugation at 10,000 g for 15 min. Renaturated, soluble GST-MAT1 protein is affinity- purified on a glutathione-Sepharose 4B column.

Example 5: Production of anti-MAT1 antibodies.

Recombinant GST-MAT1 protein, purified from baderial inclusion bodies, is used to raise both polyclonal (rabbit) and monoclonal (mouse) antibodies. For generation of anti-MAT1 antibodies, rabbits are immunized with the bacterially expressed GST-MAT1 fusion protein obtained according to Example 4 and anti-MAT1 immunoglobulins are affinity-purified according to standard methods (Tassan et al., supra; Harlow and Lane, supra). Intramuscular injections are carried out every four weeks with 280 μg of recombinant MAT1 in 8 M urea, 0.1 M NaH₂PO , 10 mM Tris-HCl, pH 4.5 emulsified in Freud's adjuvant. Complete adjuvant is used for the first injection and incomplete adjuvant is used for all subsequent injections. Monoclonal mouse antibodies are raised analogously to the method described by Lukas, J. et al. (1992), Eur. J. Biochem. 207, 169-176. Several antibodies are found to be highly specific forthe MAT1 protein. Anti-MAT1 antibodies are capable of immunoprecipitating the ternary CAK complex comprising CDK7, MAT1 and cyclin H from reticulocyte lysates programmed with mRNAs encoding the three subunits or HeLa cells (see Example 6).

Anti-MAT1 antibodies are affinity purified as follows: purified recombinant MAT1 is subjeded to SDS-PAGE, blotted on a nitrocellulose membrane, and a nitrocellulose strip containing the MAT1 protein is excised. After incubation with anti-MAT1 serum, this strip is extensively washed with 0.1 M glycine, pH 2.5, neutralized with an equal volume of 1 M tris- HCI, pH 8.0, and stored at 4°C. For coupling of antibodies to a solid support, affinity-purified rabbit immunoglobulins or hybridoma supernatants are incubated for 2h at 4°C with protein A or protein G-Sepharose, repsectively, equilibrated in 0.5 M Tris-HCl, pH 7.5. Immunoglobulin-protein A/G-sepharose beads are washed with phosphate buffered saline (PBS: 137mM NaCl, 2.7 mM KCl, 8.1 mM Na₂HPO₄, 1.5 mM KH₂HPO₄; pH 7.2) and stored at 4°C.

Example 6: Production of recombinant proteins in reticulocyte lysates

In vitro transcription-translation experiments are performed by priming the TNT coupled reticulocyte lysate system (Promega Coφ.) with pBluescript II KS plasmids comprising a cDNA insertions coding for MAT1 (or CDK7 or cyclin H) in the presence of [³⁵S] methionine/cysteine (Express ^S^S, Dupont NEN), as described by the manufacturer. Transcripts are obtained from these plasmids using T3 polymerase and in vitro-translated in reticulocyte lysates in the presence or absence of radioadive marker. The amount of protein produced is monitored by autoradiography and/or Western blotting.

Example 7: In vitro association experiments.

For association experiments, reticulocyte lysates containing the desired proteins (MAT1 ,

CDK7 or cyclin H) are mixed, incubated for 1 hour at 30°C and an aliquot of each sample is analyzed directly by SDS-PAGE and fluorography. For immunoprecipitation, samples are diluted 1 :10 in NP40 buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1 % NP40, 0.1 % deoxycholate, 0.01 % SDS, 1 mM PMSF, and 10 μg/ml each of leupeptin, aprotinin, and pepstatin) and incubated for 2 hours at 4°C with anti-CDK7 or anti-myc antibodies. Immune complexes are isolated and then subjected to SDS-PAGE and fluorography, as described previously (Krek.W. and Nigg.E.A. (1991) EMBOJ., 10, 3331-3341, Tassan et al., 1994, supra).

To examine the possible role of MAT1 in the formation of CDK7/cyclin H complexes, the three proteins are produced separately by coupled transcription-translation in a rabbit reticulocyte lysate (Figure 1A, wherein MAT1 is referred to as p36). Equal amounts of protein are mixed as indicated and incubated long enough to allow protein-protein interactions to occur. One aliquot of each sample is then subjected to an SDS-PAGE and autoradiography (Figure 1 A, upper panel), whereas the remainder of the sample is subjected to immunoprecipitation with anti-CDK7 antibodies. In order to visualize protein complex formation, one half of each immunoprecipitate is analyzed directly by SDS-PAGE (Figure 1 A, middle panel); the other half is used for an in vitro kinase assay with GST-CDK2 as a substrate for measuring CAK adivity. From samples containing only one CAK subunit, anti-CDK7 antibodies precipitate CDK7, but virtually no cyclin H or MAT1 (lanes 1-3). When pairwise combinations of CAK subunits are analyzed, neither cydin H nor MAT1 can be cc- immυnoprecipitated with CDK7 (lanes 4 to 6). In contrast, a ternary complex consisting of CDK7, cyclin H, and MAT1 can readily be precipitated from the lysate containing all three proteins (line 7). Similar results are obtained on use of a myc epitope-tagged version of CDK7 and anti-myc antibodies for the isolation of CAK complexes (lanes 8 and 9). Furthermore, high levels of CAK adivity are observed only when both cyclin H and MAT1 are present in the reconstituted CAK (Figure 1A, bottom panel, lanes 7 and 9), although some background level kinase activity is present in all CDK7 immunoprecipitates (bottom panel, lanes 1-6 and 8).To confirm that the kinase activity measured in reconstituted CAK complexes is due to the catalytic activity of CDK7, the same type of experiment is repeated with a catalytically inadive CDK7 mutant (K41R, supra), carrying an arginine in place of lysine 41. Although the K41 R mutant readily participates in the formation of the ternary complex with cyclin H and MAT1 , no specific CAK activity is associated with this complex. The results of the above association studies are corroborated further by the experiment shown in Figure 1 B. A GST-MAT1 fusion protein (referred to as GST-p36 in Figure 1 B) is expressed in E.coli (Example 4). and increasing amounts of the purified protein are added to reticulocyte lysates containing equal and constant amounts of [³⁵S]-labeled CDK7 and cyclin H. Samples are then incubated for one hour at 30°C and CDK7 is isolated by immunoprecipitation. As expected, equal amounts of CDK7 are immunoprecipitated from all lysates (Figure 1 B). However, virtually no cyclin H is recovered in the absence of GST- MAT1 (lane 1). Instead, the addition of increasing amounts of GST-MAT1 caused increasing amounts of cyclin H to associate with CDK7 (lanes 2-8). These results clearly show that in vitro formation of a stable CDK7/cyclin H complex is dependent on MAT1 , and that MAT1 acts as a dose-dependent assembly fador.

To determine whether MAT1 can also function as a dose-dependent inhibitor of CAK activity, CAK is reconstituted from purified GST-MAT1 and from in vitro translated CDK7 and cyclin H, as described above. Then, CAK activity is measured as a function of GST- MAT1 levels, using amounts of GST-MAT1 up to 10 fold higher than those required for maximal formation of the ternary complex. No evidence is obtained for inhibition of CAK activity by MAT1 at any concentration tested. Also, addition of large amounts of GST-MAT1 to CDK7 immunoprecipitates prepared from HeLa cells does not affect CAK activity. These results provide no indication that MAT1 can function as an inhibitor of CDK7/cyclin H- associated CAK adivity. However, this finding does not exclude the possibility that MAT1 might act as an inhibitor in vivo, for instance in response to posttranslational modifications.

Example 8: Subcellular Localization and Cell Cycle Expression of MAT1 Subcellular localization: When used for immunoblotting, the antibodies raised against the GST-MAT1 fusion protein (Example 5) recognize endogenous MAT1 in total HeLa cell protein extracts as well as MAT1 proteins translated in a reticulocyte lysate (Example 5). The immunoreactive protein present in HeLa cells comigrates with in vitro translated wild¬ type MAT1 , whereas the MAT1 mutant lacking the N-terminal RING domain (MAT1Δ, Example 3) displays the expected enhanced electrophoretic mobility. As determined by indirect immunofluorescence microscopy, MAT1 is predominantly nuclear in all inteφhase cells, whilst it is diffusely distributed throughout the cell during mitosis, showing no obvious association with condensed chromosomes.

Cell cycle expression of MAT1 : To determine the expression levels of MAT1 during the cell cycle, HeLa cells are synchronized at various stages of the cell cycle. Cells are either arrested at the G1/S phase boundary using a thymidine/aphidicolin double block or in mitosis (prometaphase) using nocodazole. Then, cells are released from the blocks for various lengths of time (2, 4, 6, 8 and 10 h for the thymidine/aphidicoline block; 3, 9, 18, 21 and 24 h for the nocodozale block). Aliquots of cells are used for FACS* analyses to determine the proportions of cells at different stages in the cell cycle. In parallel, for each sample, the amount of MAT1 recovered is determined by immunoblotting with anti-MAT36 antibodies (Example 5). The results show that the level of MAT1 is virtually constant throughout the cell cycle.

Example 9: CAK and CTD-Kinase adivity

The adivity of CAK is assayed as described previously (Tassan, J.-P et al., (1994) J. Cell Biol, 127, 467-468) using immunoprecipitates or reticulocyte lysates comprising the CDK7/cyclin H/MAT1 complex. Kinase assays are carried out in a total volume of 50 μl of kinase assay buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCI₂, 1 mM DTT), supplemented with 4 mM ATP, 10 μCi of [γ-32P]ATP (Amersham) and 400 μg/ml of purified GST-CDK2 protein (prepared as described by Tassan et al., supra) as a substrate. After 30 min at 32°C, the readion is stopped with 50 μl of 3x gel sample buffer (see e.g. Rickwood, D. and Holmes, B.D., Gel Eledrophoresis of Proteins (1990), Oxford University Press, Oxford, New York, Tokyo). Phosphorylation of GST-CDK2 protein is analyzed by SDS-PAGE, autoradiography and counting in a liquid scintillation counter of radioactivity incoφorated into GST-CDK2. CTD kinase adivity is assayed under the same conditions, replacing GST-CDK2 by GST- CTD (Peterson,S.R., et al. (1995) /. Biol. Chem., 270, 1449-1454). In view of the recent demonstration that the CDK7/cyclin H complex copurifies with the basal transcription fador TFI I H (Roy.R. et al. (1994) Cell, 79, 1093-1101 ; Shiekhattar.R., et al. (1995) Nature, 374, 283-287; Makela.T.P et al., (1995) Proc. Natl Acad. Sci. USA, 92, 5174-5178), it is of interest to determine whether the ternary complex identified here also displays kinase activity towards the CTD of RNA polymerase II. To address this issue, two experiments are performed. Firstly, CDK7 is isolated from HeLa cells, using either anti- MAT1 or anti-CDK7 antibodies for immunoprecipitation. Then, GST-CTD and GST-CDK2 fusion proteins are used as substrates to measure CTD-kinase and CAK activities associated with these immunoprecipitates. Both MAT1 and CDK7 immunoprecipitates contain CTD kinase as well as CAK activities. No phosphorylation of GST alone can be detected and no significant kinase activities are seen in control immunoprecipitates prepared with pre-immune sera. In the second experiment, CDK7/cyclinH/MAT1 complexes are reconstituted in a reticulocyte lysate, using myc-eptiope tagged versions of either wild¬ type CDK7 or the catalytically inactive K41 R mutant. After immunoprecipitation of the complexes with anti-myc antibodies, kinase activities are monitored using both GST-CDK2 and GST-CTD as substrates. For control, kinase assays are alos performed using immunoprecipitates prepared from lysates that have not been primed with mRNA. Reconstituted complexes containing wild-type CDK7 readily phosphorylate both GST-CDK2 and GST-CTD, whereas only background activities are associated with complexes containing the K41 R mutant CDK7. These results indicate that the ternary complex of CDK7, cyclin H and MAT1 is associated with both CAK and CTD kinase activities

Brief description of the Figure

Figure 1 : p36 is required for CDK7/cyclin H association in a dose-dependent manner.

A; CDK7 or myc-tagged CDK7, cyclin H and p36 (hereinbefore referred to as MAT1 ) are produced in reticulocyte lysates and mixed as indicated. After incubation at 30°C for one hour to allow protein association, an aliquot is analysed by SDS-PAGE and autoradiography (total I VT). The remaining samples are subjected to immunoprecipitation with either anti- CDK7 (lanes 1-7) or anti-myc tag antibodies (lanes 8 and 9). Immunoprecipitates are divided in two. One half is analysed by electrophoresis in a polyacrylamide gel followed by autoradiography (IP). The second half of the immunoprecipitate is assayed for CAK activity on the GST-CDK2 fusion protein (CAK activity). fi: Reticulocyte lysates containing equal and constant amounts of [³⁵S]-labeled CDK7 and cyclin H are mixed with increasing quantities of purified GST-p36 expressed in E.coli. Lysates are then incubated with anti-CDK7 antibodies and immune complexes are analysed by fluorography after separation of the proteins by SDS-PAGE.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: CIBA-GEIGY AG

(B) STREET: Klybeckstr. 141

(C) CITY: Basel

{E) COUNTRY: SCHWEIZ (F) POSTAL CODE (ZIP) : 4002 <G) TELEPHONE: +41 61 69 11 11 (H) TELEFAX: + 41 61 696 79 76 (I) TELEX: 962 991

(ii) TITLE OF INVENTION: Ring Finger Protein

(iii) NUMBER OF SEQUENCES: 2

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC coπpatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1283 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION:50..988

(D) OTHER INFORMATION:/product= "Human MATl"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

GGGCGGGCTG AAACAGGCGC CTGCGAGAGT CTGTAGGAGG GAAACCGCC ATG GAC 55

Met Asp

1

GAT CAG GGT TGC CCT CGG TGT AAG ACC ACC AAA TAT CGG AAC CCC TCC 103 Asp Gin Gly Cys Pro Arg Cys Lys Thr Thr Lys Tyr Arg Asn Pro Ser 5 10 15

TTG AAG CTG ATG GTG AAT GTG TGC GGA CAC ACT CTC TGT GAA AGT TGT 151 Leu Lys Leu Met Val Asn Val Cys Gly His Thr Leu Cys Glu Ser Cys 20 25 30

GTA GAT TTA CTG TTT GTG AGA GGA GCT GGA AAC TGC CCT GAG TGT GGT 199 Val Asp Leu Leu Phe Val Arg Gly Ala Gly Asn Cys Pro Glu Cys Gly 35 40 45 50

ACT CCA CTC AGA AAG AGC AAC TTC AGG GTA CAA CTC TTT GAA GAT CCC 247 Thr Pro Leu Arg Lys Ser Asn Phe Arg Val Gin Leu Phe Glu Asp Pro 55 60 65

ACT GTT GAC AAG GAG GTT GAG ATC AGG AAA AAA GTG CTA AAG ATA TAC 295 Thr Val Asp Lys Glu Val Glu Ile Arg Lys Lys Val Leu Lys Ile Tyr 70 75 80

AAT AAA AGG GAA GAA GAT TTT CCT AGT CTA AGA GAA TAC AAT GAT TTC 343 Asn Lys Arg Glu Glu Asp Phe Pro Ser Leu Arg Glu Tyr Asn Asp Phe 85 90 95 TTG GAA GAA GTG GAA GAA ATT GTT TTC AAC TTG ACC AAC TTG ACC AAC 391 Leu Glu Glu Val Glu Glu Ile Val Phe Asn Leu Thr Asn Leu Thr Asn 100 105 110

AAT GTG GAT TTG GAC AAC ACC AAA AAG AAA ATG GAG ATA TAC CAA AAG 439 Asn Val Asp Leu Asp Asn Thr Lys Lys Lys Met Glu Ile Tyr Gin Lys 115 120 125 130

GAA AAC AAA GAT GTT ATT CAG AAA AAT AAA TTA AAG CTG ACT CGA GAA 487 Glu Asn Lys Asp Val Ile Gin Lys Asn Lys Leu Lys Leu Thr Arg Glu

135 140 145

CAG GAA GAA CTG GAA GAA GCT TTA GAA GTG GAA CGA CAG GAA AAT GAA 535 Gin Glu Glu Leu Glu Glu Ala Leu Glu Val Glu Arg Gin Glu Asn Glu 150 155 160

CAA AGA AGA TTA TTT ATA CAA AAA GAA GAA CAA CTG CAG CAG ATT CTA 583 Gin Arg Arg Leu Phe Ile Gin Lys Glu Glu Gin Leu Gin Gin Ile Leu 165 170 175

AAA AGG AAG AAT AAG CAG GCT TTT TTA GAT GAG CTG GAG AGT TCT GAT 631 Lys Arg Lys Asn Lys Gin Ala Phe Leu Asp Glu Leu Glu Ser Ser Asp 180 185 190

CTC CCT GTT GCT CTG CTT TTG GCT CAG CAT AAA GAT AGA TCT ACC CAA 679 Leu Pro Val Ala Leu Leu Leu Ala Gin His Lys Asp Arg Ser Thr Gin 195 200 205 210

TTA GAA ATG CAA CTT GAG AAA CCC AAA CCT GTA AAA CCA GTG ACG TTT 727 Leu Glu Met Gin Leu Glu Lys Pro Lys Pro Val Lys Pro Val Thr Phe 215 220 225

TCC ACA GGC ATC AAA ATG GGT CAA CAT ATT TCA CTG GCA CCT ATT CAC 775 Ser Thr Gly Ile Lys Met Gly Gin His Ile Ser Leu Ala Pro Ile His 230 235 240 AAG CTT GAA GAA GCT CTG TAT GAA TAC CAG CCA CTG CAG ATA GAG ACA 823 Lys Leu Glu Glu Ala Leu Tyr Glu Tyr Gin Pro Leu Gin Ile Glu Thr 245 250 255

TAT GGA CCA CAT GTT CCT GAG CTT GAG ATG CTA GGA AGA CTT GGG TAT 871 Tyr Gly Pro His Val Pro Glu Leu Glu Met Leu Gly Arg Leu Gly Tyr 260 265 270

TTA AAC CAT GTC AGA GCT GCC TCA CCA CAG GAC CTT GCT GGA GGC TAT 919 Leu Asn His Val Arg Ala Ala Ser Pro Gin Asp Leu Ala Gly Gly Tyr 275 280 285 290

ACT TCT TCT CTT GCT TGT CAC AGA GCA CTA CAG GAT GCA TTC AGT GGG 967 Thr Ser Ser Leu Ala Cys His Arg Ala Leu Gin Asp Ala Phe Ser Gly 295 300 305

CTT TTC TGG CAG CCC AGT TAA CC^TTTATAA GATTTGGACC TTGGAGCTGA 1018 Leu Phe Trp Gin Pro Ser * 310

ACCAGGGAGC TAGCAAAAGT AAAGCAGACT TATAAAATTA TAGCTATGTG CAGCTGCACA 1078

ACACAGTCCT TCCACTAGCA GCTGTGTTAA AGTATTTATA AGGAGAAAAT TTCAGAACTG 1138

AAGTTGAGTA ATATAGGGGA TATATATTTG TGAAAAATAA TITrTACTTA TATTTTCAGA 1198

GXΞΆTTTGACA CGATAGCCTC ATCTGATGGA AGAGAGGAAT AAATAATTCA CCTATATGTG 1258

TTTGAGGTTG TGACAGACTT ATACC 1283

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 313 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

Met Asp Asp Gin Gly Cys Pro Arg Cys Lys Thr Thr Lys Tyr Arg Asn 1 5 10 15

Pro Ser Leu Lys Leu Met Val Asn Val Cys Gly His Thr Leu Cys Glu 20 25 30

Ser Cys Val Asp Leu Leu Phe Val Arg Gly Ala Gly Asn Cys Pro Glu 35 40 45

Cys Gly Thr Pro Leu Arg Lys Ser Asn Phe Arg Val Gin Leu Phe Glu 50 55 60

Asp Pro Thr Val Asp Lys Glu Val Glu Ile Arg Lys Lys Val Leu Lys 65 70 75 80

Ile Tyr Asn Lys Arg Glu Glu Asp Phe Pro Ser Leu Arg Glu Tyr Asn 85 90 95

Asp Phe Leu Glu Glu Val Glu Glu Ile Val Phe Asn Leu Thr Asn Leu 100 105 110

Thr Asn Asn Val Asp Leu Asp Asn Thr Lys Lys Lys Met Glu Ile Tyr 115 120 125

Gin Lys Glu Asn Lys Asp Val Ile Gin Lys Asn Lys Leu Lys Leu Thr 130 135 140

Arg Glu Gin Glu Glu Leu Glu Glu Ala Leu Glu Val Glu Arg Gin Glu 145 150 155 160

Asn Glu Gin Arg Arg Leu Phe Ile Gin Lys Glu Glu Gin Leu Gin Gin 165 170 175 Ile Leu Lys Arg Lys Asn Lys Gin Ala Phe Leu Asp Glu Leu Glu Ser 180 185 190

Ser Asp Leu Pro Val Ala Leu Leu Leu Ala Gin His Lys Asp Arg Ser 195 200 205

Thr Gin Leu Glu Met Gin Leu Glu Lys Pro Lys Pro Val Lys Pro Val 210 215 220

Thr Phe Ser Thr Gly Ile Lys Met Gly Gin His Ile Ser Leu Ala Pro 225 230 235 240

Ile His Lys Leu Glu Glu Ala Leu Tyr Glu Tyr Gin Pro Leu Gin Ile 245 250 255

Glu Thr Tyr Gly Pro His Val Pro Glu Leu Glu Met Leu Gly Arg Leu 260 265 270

Gly Tyr Leu Asn His Val Arg Ala Ala Ser Pro Gin Asp Leu Ala Gly 275 280 285

Gly Tyr Thr Ser Ser Leu Ala Cys His Arg Ala Leu Gin Asp Ala Phe 290 295 300

Ser Gly Leu Phe Trp Gin Pro Ser * 305 310

Claims

Claims:

1. An isolated protein designated MAT1 characterized in that it acts as an assembly factor in the formation of a biologically active protein complex comprising a cyclin-dependent kinase (CDK) and a cyclin, and that it comprises a RING finger domain in the N-tenminal region.

2. An isolated MAT1 protein according to daim 1 , which acts as an assembly factor in the formation of a biologically active complex, wherein the CDK is CDK7 and the cyclin is cydin H.

3. An isolated protein according to claim 1 which has the amino acid sequence set forth in SEQ ID NO:2.

4. A protein according to claim 1 which is a derivative of MAT1.

5. An isolated protein according to claim 1 which is a recombinant protein.

6. An isolated amino acid mutant or a glycosylation variant of the protein designated MAT1 , said protein being characterized in that it acts as an assembly factor in the formation of a biologically active protein complex comprising a cyclin-dependent kinase (CDK) and a cyclin, and that it comprises a RING finger domain in the N-terminal region, or a derivative of such mutant or variant.

7. A process forthe preparation of a protein according to claim 1 comprising recovery of MAT1 from a natural source using conventional protein purification methods, chemical synthesis and/or recombinant DNA techniques.

8. A process for the production of MAT1 according to claim 7 characterized in that suitably transformed host cells producing MAT1 are multiplied in vitro or in vivo.

9. An antibody specifically recognizing and binding to MAT1 according to claim 1.

10. A cell line producing an antibody according to claim 9.

11. Use of an antibody according to claim 9 for the detection of MAT1.

12. A nucleic acid comprising an isolated nucleic acid coding for MAT1 according to claim 1 , particularly a nucleic acid which is a DNA, or a portion of said isolated nucleic acid.

13. A nucleic acid according to claim 12 comprising an isolated nucleic acid, particularly a DNA, which codes forthe protein with the amino acid sequence set forth in SEQ ID NO:1 , particulariy such nucleic acid with the sequence extending from the nucleotide at position 49 to the nucleotide at position 985, or a portion of said DNA.

14. An isolated nucleic acid probe which is a single-stranded DNA or RNA having a sequence that includes at least about twenty contiguous nucleotides that are the same as, or complementary to, any twenty or more contiguous nucleotides of the nucleic acid sequence set forth in SEQ ID NO:1.

15. A nucleic acid according to claim 12 which is a hybrid vedor wherein the isolated nucleic acid coding for MAT1 is operably linked to suitable control sequences.

16. An isolated nucleic acid molecule which is capable of hybridizing under stringent conditions to the an nucleic acid molecule with the nucleotide sequence residing between positions 49 and 985 of the human MAT1 sequence shown in SEQ ID NO:1 or to its complementary strand, particulariy such isolated nucleic acid molecule encoding a MAT1 protein.

17. A process for the preparation of a nucleic acid according to claim 12 comprising chemical synthesis of oligonucleotides, recombinant DNA technology and/or polymerase chain reaction.

18. A host cell capable of producing a protein according to claim 1 and containing a heterologous, preferably a recombinant, nucleic acid encoding said protein.

19. Cells transfected or transduced with the hybrid vector of claim 15.

20. A method to determine the presence and or quantity of MAT1 in a biological sample using a nucleic acid probe according to claim 14 or an antibody according to claim 9.

21. A method for modulating MAT1 fundion comprising introducing into a cell or organism a MAT1 agonist or antagonist.

22. A method for identifying compounds capable of binding to MAT1 , said method comprising employing a protein according to claim 1 in a binding assay.

23. Method according to claim 22 which is a competitive binding assay.

24. A method suitable for identifying a component or agent which modulates the biological activity of MAT1 , said method comprising contading a protein according to claim 1 with at least one compound or agent, whode ability to modulate the activity of MAT1 is sought to be investigated, and determining the change of MAT1 acitivity of said protein caused by said component or agent.

25. MAT1 agonist identified by the method of claim 24.

26. MAT antagonist identified by the method of claim 24.