WO1997000266A1 - Novel enhancer sequences for late t cell expressed genes - Google Patents
Novel enhancer sequences for late t cell expressed genes Download PDFInfo
- Publication number
- WO1997000266A1 WO1997000266A1 PCT/US1996/010429 US9610429W WO9700266A1 WO 1997000266 A1 WO1997000266 A1 WO 1997000266A1 US 9610429 W US9610429 W US 9610429W WO 9700266 A1 WO9700266 A1 WO 9700266A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- rantes
- nucleic acid
- gene
- promoter
- expression
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/521—Chemokines
- C07K14/523—Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1, LDCF-2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/30—Vector systems having a special element relevant for transcription being an enhancer not forming part of the promoter region
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
- C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
Definitions
- the field of this invention concerns isolated nucleic acid sequences that functions as a transcription enhancer elements for heterologous promoters and methods for using it to identify potential compounds that inhibit expression of native RANTES gene product.
- inflammatory processes are orchestrated in part by a family of soluble mediators called chemokines.
- chemokines One branch of this gene family, the "CC or a chemokines”, includes RANTES, I-309, the monocyte chemotactic proteins MCP-1 , MCP-2, MCP- 3 and MCP-4 and the macrophage inflammatory proteins MIP-1 ⁇ and MIP-1 ?.
- the CC chemokines are pro-inflammatory agents that function as potent and highly selective chemoattractants for specific subsets of hematopoietic cells.
- MIP-1 is a chemoattractant for naive helper T cells and MIP-1 ⁇ attracts cytotoxic T cells and B lymphocytes, while 1-309, MCP-1 , MCP-2 and MCP-3 are selective for monocytes.
- RANTES is chemotactic for monocytes, eosinophils, natural killer cells and the "memory" population (CD45RO + ) of T lymphocytes. RANTES is released from activated platelets and activates basophils to release histamine.
- RANTES is expressed as an immediate early gene (6-20 hours) by TNF ⁇ stimulated renal tubular epithelium and mesangial ceils, TNF ⁇ and IL-1 7 activated synovial fibroblasts, and lipopolysaccaride induced monocytes.
- TNF ⁇ stimulated renal tubular epithelium and mesangial ceils
- TNF ⁇ and IL-1 7 activated synovial fibroblasts
- lipopolysaccaride induced monocytes By contrast, RANTES is expressed in T cells “late” (3-5 days) following activation by antigen or mitogen. This "late" expression of RANTES by T cells is coincident with the development of T cell effector function, including the expression of perform and granzymes by cytotoxic T lymphocytes.
- This pattern of expression is in marked contrast to the immediate early expression (6-20 hours) found for other T cell expressed cytokines, such as IL-2, IL-3, IL-4, IL-5, IL-6, and ylFN or the chemokines I-309, MIP-1 ⁇ , and MIP-10.
- cytokines such as IL-2, IL-3, IL-4, IL-5, IL-6, and ylFN or the chemokines I-309, MIP-1 ⁇ , and MIP-10.
- RANTES and other chemokines are induced rapidly within an inflammatory site and bind to the endothelium, where they attract monocytes and T cells by haptotactic mechanisms.
- chemokines lead to mononuclear cell extravasation. The infiltrating ceils then follow a haptotactic/chemotactic trail of chemokines into the interstitium.
- T lymphocytes Within days, T lymphocytes, attracted to the inflammatory site, encounter antigen, become activated, differentiate, and strongly upregulate RANTES protein expression. This production of RANTES by T cells then amplifies and propagates the inflammatory response. Understanding the transcriptional control of an early I ⁇ mphokine, interleukin-2, has proven a powerful probe into the mechanism of action of the most potent immunosuppressive drugs in clinical use, cyclosporine and FK506. This information has lead to the development of new drugs and the elucidation of pathways involved in the early stages of T cell activation. Understanding the transcriptional control of the late expressed cytokine, RANTES, may similarly provide insight into the molecular pathways involved in later stages of T cell differentiation and lead to the development of novel immunotherapeutics.
- the transcriptional machinery controlling RANTES expression differs among the various tissue types capable of expressing this pro-inflammatory cytokine.
- the large number of potential consensus transcription factor binding sites found within the immediate upstream region of RANTES is unusual and corroborates the multiple points of control of RANTES expression indicated by functional analyses with reporter genes.
- This complex system for transcriptional control of RANTES expression indicates that diverse activation signals can give rise to a single common pathway of RANTES release, which in turn leads to the attraction of effector cells into an inflammatory site. This single common pathway, therefore, represents an important potential target for inhibition of the inflammatory response.
- This invention provides methods for readily identifying compounds that inhibit RANTES expression in T lymphocytes. These compounds can then be used to control undesired inflammatory responses.
- This invention is based on the discovery of nucleic acid sequences present in the human RANTES promoter that mediate upregulation of the RANTES gene late in the T cell developmental pathway.
- the present disclosure provides an isolated nucleic acid sequence consisting essentially of the sequence of SEQ ID NO:1 , or an isolated nucleic acid sequence consisting essentially of the sequence of SEQ ID NO:2, or an isolated nucleic acid sequence consisting essentially of the sequence of SEQ ID NO:3, or an isolated nucleic acid sequence consisting essentially of the sequence of SEQ ID NO:4, or an isolated nucleic acid sequence consisting essentially of the sequence of SEQ ID NO:5.
- the invention provides an isolated nucleic acid sequence the human RANTES enhancer element R(A) (SEQ ID NO:2), said sequence defined by its ability to inducibly express a gene when positioned upstream of the CAAT and TATA boxes of a minimal promoter with the promoter operably linked to the gene to form an expression cassette where the expression cassette is transfected into an activated peripheral blood lymphocyte cell which has been contacted with an amount of anti-CD3 antibody sufficient to induce the expression of the gene with the proviso that the nucleic acid sequence is not operably linked to the RANTES gene product nor to the native RANTES promoter sequences.
- This R(A) element can be operably linked to a heterologous gene.
- the NF/cB binding site can be the native RANTES NF/cB site which has be rendered non-functional.
- the R(A) element can also be combined with additional transcriptional elements to form an artificial RANTES promoter.
- Three elements that can be operably linked to the R(A) element are: (1 ) the R(C) binding site which is SEQ ID NO:3 corresponding to -182 to -169 of the human Rantes promoter; (2) the Region "C" sequence corresponding to -195 to -144 of the human Rantes promoter which is SEQ ID NO:4; or (3) the Region E sequence corresponding to -1 15 to -91 of the human Rantes promoter which is SEQ ID
- This R(A) element as well as the above-identified transcriptional regions can be recombined with additional nucleic acid sequence to form a vector.
- the R(A) element can be operably linked to a DNA sequence which encodes a heterologous protein.
- the heterologous protein can be selected from the group consisting of: hormones, viral capsid proteins, bacterial enzymes and mammalian enzymes.
- the vector containing the R(A) element recombined with additional nucleic acid sequence can be transfected into a host cell.
- Said host cell can be a mammalian cell competent to express the binding elements needed to induce expression of the heterologous protein.
- Said cell can be activated peripheral blood lymphocytes or T cell tumor line Hut78.
- This invention provides a method for inducing the expression of a heterologous protein in a host cell having nucleic acid sequence encoding the heterologous protein wherein said nucleic acid sequence is operably linked to a promoter comprising the R(A) enhancer element derived from the nucleic acid sequence encoding the human RANTES protein and further defined by (a) the ability to inducibly express a gene when operably linked to a gene forming an expression cassette and (b) the ability of the expression cassette when transfected into a peripheral blood lymphocyte in the presence of anti-CD3 antibody to induce the expression of the gene, with the proviso that the nucleic acid is not operably linked to the RANTES gene product nor to the native NFkB binding element of the RANTES gene, said method comprises: (i) transfecting the host cell with the expression cassette having nucleic acid sequence encoding the heterologous protein; and (ii) inducing the expression of the heterologous protein.
- heterologous proteins include those that have SEQ ID NO:2 for the R(A) element. They also include those where said host cell is selected from the group consisting of activated peripheral blood lymphocytes and T cell tumor line Hut78, or said host cell is transfected with a plasmid. Additionally, said heterologous protein can be selected from the group consisting of: hormones, viral capsid proteins, bacterial enzymes and mammalian enzymes. These methods further include those where said nucleic acid sequence is transfected into a human host cell or where the host cell is induced to express a heterologous gene by contacting the cell with an appropriate activator in an amount sufficient to induce expression of the gene.
- This invention also provides a method for detecting inhibitors of RANTES production by inducing the expression of a heterologous protein in a host cell having the nucleic acid sequence encoding the heterologous protein wherein said nucleic acid sequence is operably linked to a promoter comprising the R(A) element from the promoter of the gene encoding the human RANTES protein, wherein the promoter does not include the other native cis binding sites of the RANTES gene and is further defined by (a) the ability to inducibly express a gene when operably linked to a gene forming an expression cassette and (b) the ability of the expression cassette when transfected into a peripheral blood lymphocyte in the presence of anti-CD3 antibody to induce the expression of the gene, said method comprises: (i) transfecting the host cell with the expression cassette having nucleic acid sequence encoding the heterologous protein; (ii) choosing a composition of matter that potentially has inhibitory effect on RANTES expression; (iii) inducing the expression of the heterologous protein in
- Figure 1 A series of 5' to 3' deletions of the RANTES promoter were fused to a luciferase reporter gene and transiently transfected via electroporation into either Hut78 cells or day 1.5 PHA activated
- Results are average values of quadruplicates for Hut78 cells or triplicates for PBL ceils and are presented as percent maximum activity relative to the -192 construct. [Maximum values (x1000) for Hut78 515 + /- 120 for PBL 1 165 + /-414.].
- the map demonstrates the relative position of various elements in the RANTES promoter previously described in Nelson, et al. J. Immunol. 151 :2601 (1993 ).
- Figure 2 Binding of nuclear factors to the immediate 192 nucleotides of the RANTES promoter region was tested using DNase I footprint assay.
- TCGAGCTATTTTGGAAACTCCCCTTAGGGGATGCCCCTC AACTGCTCGA SEQ ID NO:1 .
- Figure 4 A series of truncated oligomers derived from the R(A/B) region were used to map the binding patterns seen on EMSA in day 7
- PHA stimulated PBL nuclear extract The right side of the autoradiogram represents a parallel experiment performed in the presence of a 1000 fold molar excess of cold kB (IgkB) competing oligomer.
- Figure 5 The R(A/B) and R(A) promoter sequences were assayed as trimers in enhancer assays. Results are averages of quadruplicates for Hut78 cells and triplicates for PBL cells and are presented as fold enhancement over pGL-2 pro (SV40 basal promoter). Baseline values for pGL-2 pro were 262 + /-64 for Hut78 ceils and 89 + ⁇ 33 for PBL cells.
- Figure 6 DNA sequence comparison of the murine and human RANTES promoter regions demonstrates conservation of the R(A) enhancer region.
- Figure 7 Definition of the binding size for nuclear factors recognizing region C (A) EMSA using 32 P-labeled restriction fragment containing region C. The arrow indicates the major complex. Jurkat T cells were stimulated with 20 ng of PMA per ml and 2 ⁇ M ionomycin for 2 h. (B) Methylation interference assay using the same restriction fragment. Undermethyiated G residues (contact residues) are indicated by asterisks. Complex, bound probe; free, unbound probe. (C) Comparison of human and murine RANTES promoters at the binding site. Asterisks indicate contact residues.
- Fibro normal human dermal fibroblasts.
- B EMSA using the same probe described for panel A and nuclear extracts prepared at the indicated time points in a peripheral blood T-celi activation time course.
- CTL healthy human cytolytic T-cell line.
- C R(C) size recognition by HUT78-derived nuclear proteins is sequence specific. Cold competition EMSA using labeled R(C) site oligonucleotide and uniabeled excess oligonucleotides as indicated.
- the NFAT sequence is from the human IL-2 promoter (G ATCGG AGG AAAAACTGTTTCATACAG AAGGCGTGATC) .
- Kappa B NF- ⁇ B binding sequence from immunoglobulin kappa light-chain enhancer (TCGAGTCAGAGGGGACTTTCCGAGTCGA) (49); irr, irrelevant sequence oligonucleotide (GATCCTGGAAGGGAGAGTGGAGATC).
- B EMSA-antibody supershift/blocking assay using the probe and extracts described for panel A. Rabbit polyclonal immunoglobulin G (I ⁇ g) was added as described in Materials and Methods. Alpha, beta, and delta refer to the specific C/EBP family members against which the antisera are directed (Santa Cruz Biotech). The narrow points to the blocked EMSA complex.
- isolated when used in relation to a nucleic acid or a protein refers to a nucleic acid or protein that is identified and separated from at least one containment nucleic acid or protein with which it is ordinarily associated in its natural source.
- DNA regions simply means that they are functionally related to each other.
- a presequence is operably linked to a peptide if it functions as a signal sequence, participating in the secretion of the mature form of the protein most probably involving cleavage of the signal sequence.
- a promoter is operably linked to a coding sequence if it controls the transcription of the coding sequence.
- a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation of the coding sequence. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
- Promoters are untranslated DNA sequences located upstream from the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription of genes. Promoters typically fall into two classes, inducible and constitutive. Inducible promoters initiate increased levels of transcription from DNA under their control in response to some change in environmental conditions; e.g., the presence or absence of a nutrient or a change in temperature. Constitutive promoters produce a constant level of transcription from DNA under their control when exposed to their native conditions.
- TATA box an upstream promoter element
- TATAAA DNA sequence TATAAA that is generally located -25 to -30 relative to the RNA start site. This sequence is part of the promoter sequence of eukaryotic genes and binds transcription factor IID (TFIID). RNA polymerase recognizes the TFIID-TATA protein-DNA complex.
- TATA box sequence is critical both for promoter activity and for determining the exact point of RNA chain initiation.
- the "CAAT” box is an upstream promoter element generally located at -75 to -80 relative to the RNA start site. It influences the frequency of initiation, most likely by acting directly on the basal transcription factors to enhance their assembly into an initiation complex.
- the sequences between the CAAT and TATA elements are irrelevant and the distance between them is flexible. The separation between the CAAT and TATA elements can usually be changed by 10 to 30 base pairs before rendering them inoperable.
- An “enhancer” element is a regulatory DNA sequence whose presence is associated with increased transcription of coding sequences associated with the enhancer element, either by initiating transcription from a promoter operably linked to the enhancer or by providing binding sites for gene regulatory proteins that increase transcription of a minimal promoter. Because enhancer activity fails off progressively with distance, enhancers usually function best when located close to promoter sequences. Enhancers generally function regardless of their orientation relative to promoter sequences.
- a "minimal promoter” is a promoter sequence containing only the CAAT and TATA boxes without any enhancer elements.
- Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are expressed. Numerous methods of transfection are known to the ordinary person skilled in the art; for example, CaPO 4 and electroporation. A host cell has been successfully "transfected" when any indication of the operation of this vector occurs within the host cell.
- Human78 is a cell line derived from a cutaneous T cell lymphoma that expresses a "late" T cell phenotype; i.e., constitutively expresses IL-2 receptor, IL-2 and RANTES.
- the "RANTES gene” is a member of a large supergene family of pro-inflammatory cytokines called CC chemokines that play a fundamental role in the inflammatory process. Schall, et al., J. Immunol. 141 :1018 (1988). The RANTES gene spans approximately 7.1 kb and is located on the long arm of chromosome 17.
- the "RANTES gene product” is a protein which causes the release of histamine from basophils and is a chemoattractant for CD45RO/CD4 + memory T lymphocytes, monocytes, basophils, eosinophils and natural killer cells.
- the "native RANTES promoter sequence” consists of an approximately 1 kb DNA region representing the immediate 5' upstream region and 5' untranslated region of the RANTES gene.
- NF-/cB is a nuclear factor that binds to cB consensus DNA sequences.
- heterologous refers to a DNA sequence not ordinarily found in a given gene.
- nucleic acid inducing the expression of a nucleic acid means that a cell that contains a nucleic acid commences or upregulates the transcription of that nucleic acid in response to an environmental signal, typically exposure to a substance that activates the cell to differentiate.
- nuclear factor is a substance present in the nucleus of the cell that bonds to specific regulatory nucleic acid sequences that modulate the expression of a given gene.
- the nuclear factor may, by way of example, be a protein, nucleic acid, or a combination thereof.
- modulator of RANTES production refers to an agent that increases or decreases RANTES expression by binding to the RANTES promoter, usually at a specific sequence, and inducing upregulation or downregulation of RANTES gene transcription.
- a modulator of RANTES production "operates through the R(A,C or E) site” (1) if it binds directly to the site and modulates RANTES production by virtue of binding, (2) if it induces or inhibits the synthesis, degradation or activation of a nuclear factor that itself binds to the site, or (3) it competes with binding of a nuclear factor to the site.
- nucleic acid when used with reference to a nucleic acid indicates that the nucleic acid has been altered as compared to the naturally occurring nucleic acid or protein.
- recombinant or engineered when used with reference to a protein indicates that the nucleic acid that encodes the protein has been altered as compared to the naturally occurring nucleic acid.
- the alteration encompasses deletions, insertion and substitutions in the sequence of the naturally occurring nucleic acid, and also ligation of naturally occurring nucleic acids in combinations not normally found in nature.
- Recombinant or “engineered” when used with reference to a cell indicates that the cell replicates or expresses a recombinant nucleic acid or expresses a peptide or protein encoded by a recombinant nucleic acid, whose origin is exogenous to the cell.
- Recombinant cells can express nucleic acids that are not found within the native (nonrecombinant) cell.
- Recombinant cells can also express nucleic acids found in the native cell wherein the nucleic acids are re-introduced into the cell by artificial means.
- non-functional refers to a DNA sequence which has been mutated, such as by base pair substitution or addition, such that its native biological characteristics are no longer recognizable.
- the DNA sequence, KB is a binding element for the NF- ⁇ B protein. If substantial mutations are created such that the KB sequence no longer resembles the recognized consensus, then it will no longer bind
- NF- ⁇ B protein and, therefore, it will have been rendered non-functional.
- the RANTES chemokine is a potent pro-inflammatory cytokine, which has been identified as a major HIV-suppressive factor produced by T cells.
- This enhancer element binds not only known Rel family members (including p50 homodimers and p50-p65 heterodimers) but also non-Rel factors newly upregulated in PBL cells by day 3-5 following activation. Unlike the Rel proteins, which are expressed in various different tissue cells, these late-expressed factors correlate precisely with the induction of RANTES message.
- These novel proteins - designated the R(A)FLAT complex - are likely responsible for the temporal regulation of RANTES in peripheral blood T cells and are a component of the transcriptional regulatory machinery newly expressed in late- stage T cell development.
- R(C) and R(E) regions which assist in the expression of RANTES.
- the R(C) region diminishes the ability of R(A) to drive expression by about 54% and the R(E) by about 66% compared to the wild type promoter.
- the newly identified enhancer sequences can be obtained in a variety of ways. Once obtained, these sequences have two primary uses. First, they can be used an inducible enhancer elements when operably linked to a heterologous promoter. In this fashion, any heterologous gene can be inducibly expressed in Hut78 cells or activated PBL cells with "late" kinetics. More importantly, the R(A) sequence can be used to screen for compounds that can inhibit expression of native RANTES gene product in T lymphocytes. In combination, the R(A) and R(C) and R(E) elements permit an increased degree of control and aid in the identification of specific inhibitors of RANTES expression or of expression of heterologous genes placed under the control of these elements.
- the R(A) sequence in 5' to 3' order, is
- GCTATTTTGGAAACTCCCCTTAG (SEQ ID NO:2) which is the native RANTES sequence found at -71 to -49 relative to the RANTES transcription start site. In the native RANTES gene, this sequence is located between the CAT and TATA boxes. Binding site C is internal to region C and has SEQ ID NO:3 GATGAGAGAGCAGT which corresponds to -182 to -169 relative to the RANTES transcriptional start site.
- Region C has SEQ ID NO:4
- Region E has SEQ ID NO:5 TTTGTGCAATTTCACTTATGATACC and corresponds to -115 to -91 relative to the RANTES transcriptional start site. All sequences are 5' to
- a number of bases in the R(A) sequence can be substituted without detrimentally effecting its function.
- a T residue can be substituted for the first A residue from the 5' end.
- an A residue can be substituted for the fourth T residue in the string of four T residues immediately downstream of the just mentioned first A residue.
- the GGAAACTCCCC portion of the R(A) sequence is a ⁇ B-like sequence which can also be altered so long as the changes stay consistent with the -cB recognized consensus sequence as described by Baeuerle and Henkel, Ann. Rev. Immunol. 12:141 (1994).
- the two guanine residues within this stretch are critical for transcription factor binding. No more than any two bases can be changed.
- PCR polymerase chain reaction
- sequence information from the ends of the stretch of interest (the native RANTES base pairs -71 to -49 as described previously) or beyond must be available so that oligonucleotide primers can be designed.
- These primers will point towards one another and will be identical or similar in sequence to opposite strands of the template to be amplified.
- the 5' terminal nucleotides of the two primers will coincide with the ends of the amplified material.
- R(A) oligonucleotide sequence (whether double or single stranded) can be readily synthesized by any number of commercial suppliers such as Genset (San Diego, CA) or Clontech (Palo Alto, CA). Commercial suppliers, as well as anyone synthesizing or PCR amplifying the sequence themselves, can create the sequences with particular requested overhangs to match any particular cloning needs.
- the R(A) sequence can be used as an inducible enhancer element when operably linked to heterologous promoters.
- the R(A) sequence was joined to an SV40 minimal promoter which drives the transcription of the luciferase gene.
- the vector containing these sequences was then transfected into Hut78 cells and also activated PBL cells. Transfection into mammalian cells is generally carried out by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology, 52: 546 (1978). However, other methods for introducing DNA into cells such as nuclear injection, electroporation (used in Example
- a promoter driving a gene of interest can be expressed in T lymphocytes using the R(A) sequence.
- Some candidate promoters include the SV40, thymidine kinase and IL-2 promoters among many others.
- the type of cells in which the gene construct is expressed controls the inducement of the enhancer.
- the transcription factors necessary to induce the native RANTES promoter in T lymphocytes bind to the R(A) sequence. These factors are expressed in Hut78 cells or in activated PBL cells.
- Hut78 cells are preferable when constitutive R(A) enhancer activity is warranted since Hut78 cells express a "late" T cell phenotype and constitutively produce the necessary transcription binding factors.
- any other cell type with a "late" T cell phenotype can be used as an expression host.
- Another possible activation method consists of activating a specific subset of T lymphocytes by exposing the cells to the particular antigen for the particular T cell receptor of that desired subset of T lymphocytes.
- a desired promoter/gene construct can be enhanced when operably linked to the R(A) sequence so long as Hut78 or activated peripheral blood lymphocyte nuclear extract is present.
- the most beneficial characteristic of the R(A) sequence is its ability to be used as an identifier of inhibitors of native RANTES gene product expression.
- RANTES production correlates with late T cell effector function. Late T cell effector function has been linked to T cell mediated autoimmune diseases such as multiple sclerosis, rheumatoid arthritis and juvenile diabetes, as well as common allergies and asthma. Inhibitors of RANTES production could possibly alleviate some or all of the symptoms of these diseases.
- Example 3 To test any possible compound for its effect on native RANTES gene product expression, one can perform any of the three assays described in Example 3. The simplest and fastest way to identify potential inhibitors would be to use the luciferase gene fusion assay. In that assay, the test compound can be added directly to the cell growth media following transfection. The results can then be compared to the results obtained from a control run containing no extra compounds. If a compound causes a drop, preferably a significant drop, in luciferase activity, then the compound will likewise inhibit the expression of native RANTES gene product.
- any compounds that decrease the luciferase activity should then be tested in the DNAse I footprinting and the EMSA as described in Example 3.
- test compounds can be added directly to the growth media and incubated for a sufficient amount of time to have an effect. Generally, a few days of exposure to the test compound should be sufficient for the compound to either inhibit expression of one of the transcription factors necessary for binding to the R(A) sequence, or directly block the binding at the R(A) site.
- the assays are described in Example 3. An inhibitory compound will produce no bands in the DNAse footprinting assay and a lessening or complete disappearance of bands one and two in the EMSA.
- any promoter/reporter gene fusion assay system can be used to test for inhibitors so long as the construct includes the R(A) enhancer element.
- the only critical step is to transfect the construct into a cell type, such as Hut78 or activated PBL cells, that actively produces the normal transcription factors necessary for native RANTES gene expression.
- Other cells that express native RANTES production include the erythroleukemic cell line HEL, the rhabdomyosarcoma cell line RD, TNF ⁇ stimulated renal tubular epithelium, TNF ⁇ stimulated renal tubular epithelium mesangial cells, TNF ⁇ activated synovial fibroblasts, IL-10 activated synovial fibroblasts and lipopolysaccaride induced monocytes.
- the transfection must be done both in the presence of the test compound and separately without the test compound so that relative results can be measured. The compounds that show inhibitory effect can then be tested against each other to ascertain those with the highest inhibitory effect.
- the R(C) and R(E) sequences and the R(A) sequence can both be simultaneously operably linked to a promoter (especially a minimal promoter) which is operably linked to a coding sequence (e.g. , a reporter gene, or the RANTES gene).
- a promoter especially a minimal promoter
- a coding sequence e.g. , a reporter gene, or the RANTES gene.
- the resulting expression cassette is regulated by nuclear factors that bind to these sites.
- a full description of the R(C) and R(E) elements can be found in Ortiz et ah, Mol. Cel. Biol. 16:202-210 (1996).
- a beneficial property of the R(C) sequence is its use to identify inhibitors of native RANTES gene product expression. Late T cell effector function has been linked to T cell mediated autoimmune diseases such as multiple sclerosis, rheumatoid arthritis and juvenile diabetes, as well as common allergies and asthma. Inhibitors of RANTES production could possibly alleviate some or all of the symptoms of these diseases.
- test compound for its effect on native RANTES gene product expression, one can perform any of the assays described in the examples below.
- the simplest and fastest way to identify potential inhibitors would be to use a known assay, such as the luciferase gene fusion assay.
- the test compound is added directly to the cell growth media following transfection with a vector in which the luciferase gene is operably linked to a RANTES promoter that comprises the R(A) and R(C) site.
- the results can then be compared to the results obtained from a control run containing no extra compounds. If, for example, a compound causes a drop, preferably a drop of 50% or greater, in luciferase activity, then the compound likewise inhibits the expression of native RANTES gene product.
- any compounds that decrease luciferase activity should be tested in the DNAse I footprinting and the EMSA as described in the examples below.
- test compounds can be added directly to the growth media and incubated for a sufficient amount of time to have an effect. Generally, a few days of exposure to the test compound should be sufficient for the compound to either inhibit expression of one of the transcription factors necessary for binding to the R(C) sequence, or directly block the binding at the R(C) site.
- the assays are amply described in the examples below. An inhibitory compound will simply produce no bands in the DNAse footprinting assay and a lessening or complete disappearance of bands one and two in the EMSA.
- any promoter/reporter gene fusion assay system can be used to test for inhibitors so long as the construct includes the R(A) and R(C) enhancer elements.
- the only critical step is to transfect the construct into a cell type, such as HUT78 or activated PBL cells, that actively produces the normal transcription factors necessary for native RANTES gene expression.
- RANTES erythroleukemic cell line HEL
- RD rhabdomyosarcoma cell line
- TNFa stimulated renal tubular epithelium TNFa stimulated renal tubular epithelium mesangial cells
- TNFa activated synovial fibroblasts TNFa activated synovial fibroblasts
- IL-lb activated synovial fibroblasts lipopolysaccaride induced monocytes.
- the transfection must be done both in the presence of the test compound and separately without the test compound so that relative results can be measured.
- the compounds that show inhibitory effect can then be tested against each other to ascertain those with the highest inhibitory effect. 2.
- the R(C) Sequence as an Inducible Enhancer Element to Heterologous Promoters.
- the R(C) sequence can be used as an inducible enhancer element when operably linked to R(A) and heterologous promoters.
- the R(A) and R(C) sequence is placed in front of a minimal promoter which drives the transcription of the luciferase gene (e.g., an SV40 minimal promoter).
- the vector containing these sequences is then transfected into HUT78 cells and also activated PBL cells by known methods.
- HUT78 (ATCC TIB 161), Jurkat (ATCC ⁇ B 152), Buri ⁇ tt's B-lymphoma cell lines MS (Wright, A., et al., J. Exp. Med. 169:1557-1564 (1989)) and Daudi (ATCC CCL 213), PEER ( ⁇ T cell), and normal peripheral blood lymphocytes (PBL) were cultured and maintained in RPMI 1640 medium (Irvine Scientific, Santa Ana,
- YT2C2 a natural killer cell tumor, was cultured as described above, with sodium pyruvate added to a final concentration of 1 mM. Normal human CTL lines were generated and maintained as described in Clayberger et al. , J. Immunol. 144: 4172-4176.
- RD (ATCC-CCL 136), a rhabdomyosarcoma, was cultured in RPMI 1640-15% bovine calf serum supplemented with nonessential amino acids and vitamins. Normal dermal fibroblasts were cultured as described previously (Spaete, R.R., et al., J. Virol. 56:135-143 (1985)).
- SK-HEP-1(ATCC HTB 52) cells were cultured in Dulbecco modified Eagle medium (DMEM) with 10% fetal calf serum, 2 mM L-glutamine, 100 U of penicillin G per ml. and 100 U of streptomycin per ml.
- DMEM Dulbecco modified Eagle medium
- PBL Peripheral blood lymphocytes
- Oligonucleotides such as the R(A) and R(C) sequences and mutants thereof are obtained by many methods. The more common is chemical synthesis by known methods such as phosphotriester, phosphite, or phosphoramidite chemistry, using solid phase techniques such as described in EP 266,032 published 4 May 1988, or deoxynucleoside H-phosphonate intermediates as described by Froehler et al. , Nucl. Acids Res., 14: 5399-5407 (1986).
- Another method is to amplify the desired sequence directly from a natural source (e.g., genomic RANTES DNA) using the polymerase chain reaction (PCR) as described in U.S. Pat. No. 4,683,195 issued Jul. 28, 1987.
- PCR polymerase chain reaction
- sequence information from either side of the stretch of interest or beyond must be available so that oligonucleotide primers can be designed.
- primers will bracket the desired sequence and will be identical or similar in sequence to opposite strands of the template to be amplified.
- the 5' terminal nucleotides of the two primers will coincide with the ends of the amplified material.
- the desired oligonucleotide sequence (whether double or single stranded) can be readily synthesized and purchased by any number of commercial suppliers such as Genset (San Diego, CA) or Clontech (Palo Alto, CA). Commercial suppliers, as well as anyone synthesizing or PCRing the sequence themselves, can create the R(C) sequence with particular requested overhangs to match any particular cloning needs.
- reporter gene assays a nucleic acid containing the promoter sequences to be studies was operably linked to a reporter gene.
- reporter genes include the luciferase gene or the ⁇ -galactosidase gene.
- RANTES promoter luciferase reporter constructs The construction of various RANTES promoter luciferase reporter constructs has been previously described. Nelson, P.J., et al., J. Immunol. 151:2601-2612 (1993). Luciferase assays were performed using the luciferase assay system kit (Promega) as described previously. Id,. It is preferable that the enhancer sequence be located immediately upstream of the desired promoter, but effective enhancer elements can be located at more than one site of the promoter and still have an enhancing effect. However, the amount of increased activity will usually diminish with distance. Additionally, two or more copies of the R(C) sequence can be operably linked one after the other to produce an even greater increase in promoter activity.
- jS-Galactosidase assays were performed with an aliquot of transfected cell extracts according to the instructions accompanying the reporter lysis buffer reagent (catalog no. E397A; Promega) with o-nitrophenyl-jS-o-galactopyranoside (ONPG). The results were recorded on a Beckman DU62 spectrophotometer set at a wavelength of 420 nm. All constructs were tested at least in triplicate. Only plasmids prepared at the same time were directly compared in reporter gene assays, and all results reported were confirmed with at least two separate plasmid preparations.
- Vectors containing the engineered sequences and expression cassettes are transfected into appropriate cells of the invention (HUT78 cells or activated PBL cells), for example, by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology, 52:546 (1978), by electroporation, or by protoplast fusion.
- Nuclear extracts for EMSA and DNAase I footprinting were prepared essentially according to the protocol of Durand, D., et al., Mol. Cell. Biol. 8:1715- 1724), except 0.2% Nonidet P-40 was used in buffer A to lyse the cells instead of the homogenizer. All subsequent steps were carried out at 4 °C. Nuclei were prepared by resuspending the cells in buffer A [10 mM Hepes (pH 7.6), 15 mM potassium chloride
- KCl 2 mM magnesium chloride
- MgCy 2 mM magnesium chloride
- EDTA 0.1 mM ethylenediaminetetraacetate
- PMSF 0.1 mM phenylmethylsulfonylfluoride
- the cell lysate was pelleted at 2000 x g and resuspended in buffer C, containing 25 mM Hepes (pH 7.6), 50 mM KCl, 0.1 mM EDTA, 10% volume to volume glycerol, 1 mM dithiothreitol, and 0.1 mM PMSF. Nuclei were lysed and chromatin-bound DNA precipitated by the addition of 0.3 M ammonium sulfate The protein fraction containing nuclear factors was then precipitated with 0.22 g/ml (NH 4 ) 2 SO 4 ].
- Electrophoretic mobility shift assays are used to characterize nuclear factors which bind DNA. The following describes the normal expected results when no inhibitory compound is present. If a test compound does inhibit the production of native RANTES gene product then the results of these assays will be altered as described.
- binding reactions (15 ⁇ l final volume) contain 10 mM Tris-HCl (pH 7.5), 80 mM sodium chloride, 1 mM dithiothreitol, 1 mM EDTA, 5% glycerol, 1.5-2 ⁇ g of poly(dI • dC), 5 to 10 ⁇ g of nuclear extract, and 20,000 cpm (0.1 to 0.5 ng) of the 3 P-end-labeled double-stranded oligonucleotide probe.
- Oligonucleotides were synthesized by Genset (San Diego, Calif.), with 3' overhangs that could be end labeled by the Klenow fragment as described previously (Ausubel, F.M., et al. , Green Publishing Associates and Wiley-Interscience, New York (1987); Durand, D., et al., Mol. Cell. Biol. 8:1715-1724).
- C/EBP family antisera ( ⁇ , ⁇ , and 7) were purchased (Santa Cruz Biotechnology, Santa Cruz,
- DNase I footprinting is used to assay for DNA sequences which could be protected from DNase I digestion by nuclear extracts isolated from activated T cells. DNase I footprinting of the minimal RANTES promoter identifies a large region protected by T cell derived nuclear extracts (Nelson et al. , 1993 J. Immunol. 151:2601)
- DNAse I footprinting is performed using a derivation of the procedures described by Durand et al., Mol. Cell. Biol. 8:1715 (1988) and Jones et al. , Cell
- Binding reactions are carried out under the conditions described above for EMSA but scaled up to 50 ⁇ l. After binding, using 50 ⁇ g nuclear extracts, 50 ⁇ l of a 10 mM MgCl 2 /5 mM CaCl 2 solution is added and 2 ⁇ l of an appropriate DNAse I (Worthington, Freehold, NJ) dilution is added and incubated for 1 minute on ice. DNase I digestion is stopped by adding 90 ⁇ l of stop buffer (20 mM EDTA, 1% SDS, 0.2 M
- yeast tRNA After addition of 20 ⁇ g yeast tRNA as carrier, the samples are extracted two times with an equal volume of phenol/chloroform (1:1) and precipitated after adjusting the solution to 0.3 M sodium acetate and 70% ethanol. DNA samples are then resuspended in 4 ⁇ l of an 80% formamide loading dye contaimng 1 x TBE, bromphenol blue and xylene cyanol, heated to 90°C for 2 minutes, and loaded on 6% polyacrylamide-urea sequencing gels.
- an 80% formamide loading dye contaimng 1 x TBE, bromphenol blue and xylene cyanol heated to 90°C for 2 minutes, and loaded on 6% polyacrylamide-urea sequencing gels.
- Test compounds that do not inhibit production of native RANTES gene product will have the same banding pattern as those of activated PBL and HUT78 cells.
- Test compounds that inhibit production of native RANTES gene product will have banding patterns matching the no-extract control lane and the negative control Jurkat cells.
- Methylation interference was assayed according to the protocol of Baldwin (Ausubel, F.M., et al. , Green Publishing Associates and Wiley-Interscience, New York (1987)).
- Preparative EMSA (10-fold scale up of reaction described above) was performed using the C region SacJ.-to--3.spEI single-end- 32 P-labeled restriction fragment.
- DNA was labeled with the Klenow fragment.
- DNA was eluted from the excised bands representing EMSA complexes by electroelution in a Bio-Rad apparatus. Following piperidine cleavage, the DNA ladders were analyzed on standard 10% polyacrylamide-urea sequencing gels (Ausubel, F.M., et al. , Green Publishing Associates and Wiley-Interscience, New York (1987)).
- Preparative EMSA was performed exactly as described by methylation interference.
- the gel was exposed to UV light (2,500 ml) in a Stratalinker (Stratagene, La Jolla, Calif.) as described previously (Kelsumi, H.M., et al. , Mol. Cell. Biol. 13:6690-6701 (1993)). Bands were excised and heated to 70°C in Laemmli sample buffer.
- R(A) oligonucleotide sequence as well as all other oligonucleotides used in the following examples were synthesized by Genset (San Diego, CA) with Xho I, Sal I, Xba I or Nhe I overhangs to allow end-labeling, as described by Ausubel et al., 1987 In Current Protocols in Molecular Biology (Green Publishing Associates and Wiley-Interscience, New York) pl2.2.1, and for ligating into the cloning sites of desired plasmids.
- Genset San Diego, CA
- Xho I, Sal I, Xba I or Nhe I overhangs to allow end-labeling, as described by Ausubel et al., 1987 In Current Protocols in Molecular Biology (Green Publishing Associates and Wiley-Interscience, New York) pl2.2.1, and for ligating into the cloning sites of desired plasmids.
- EXAMPLE 2 THE R(A) SEQUENCE FUNCTION AS ENHANCE
- An enhancer activity assay was performed to show that the R(A) sequences could function as enhancers for heterologous promoters. This procedure consists of placing between one and three copies of the desired test sequence in front of a minimal promoter and then assaying the results as fold increase in activation as compared to the enhancerless control construct.
- This enhancer activity assay uses the pGL-2 Promoter vector (Promega, Madison, WI) which contains an enhancerless minimal SV40 promoter upstream of the luciferase gene. DNA fragments containing enhancer sequences generally will increase transcription when inserted into this vector either upstream or downstream of the luciferase gene, and in either orientation.
- Figure 4 shows the DNA sequences tested for transcriptional enhancer activity.
- the sequences used in this assay are designated R(A/B), R(A) and R(Am3'). These were generated as synthetic oligomers and cloned as monomers and trimers into either the Xho I or Nhe I sites of the pGL-2 Promoter vector and sequenced to determine orientation.
- These test constructs, along with the control pGL-2 Promoter vector lacking inserts, were then transfected into PHA activated PBL cells and Hut78 cells followed by luciferase reporter gene assays.
- Suspension cell cultures of activated PBL cells and Hut78 cells were transfected by electroporation using a BRL Cell-Porator * electroporation apparatus according to the manufacturer's specifications for transfection of eukaryotic cells. Briefly, suspension cultures were gently pelleted, and resuspended at 2.0 x IO 7 cells/ml in electroporation media. A cytomegalovirus promoter/enhancer-luciferase fusion construct was used to determine optimal electroporation voltages (220 V for Hut78 and on average 235 V for activated PBL that had been stimulated with PHA-P (5 ⁇ g/ml) for
- Results were normalized for total protein added to the luciferase reagent (Bio-Rad Bradford protein assay reagent, Bio-Rad , Hercules, CA) and are representative data from four to ten separate assays.
- the R(A/B) trimer produced a twelve to fifteen fold increase in activation and the R(A) trimer produced a 7 to 11 fold increase.
- the RANTES promoter sequence R(A/B)-luciferase gene fusion assay, DNase I footprinting assay and electrophoretic mobility shift assay (EMSA) are three methods for readily identifying compounds that will inhibit the production of native RANTES gene product. By performing the same assays as described here, but in the presence of a potential inhibitory test compound, one can readily determine that compound's effect on the production of native RANTES gene product. If the results of assays done in the presence of the test compound are similar to those described below, then the test compound does not have the desired inhibitory effect.
- This fragment is designated deletion construct -192 in figure 1.
- This fragment was sufficient for maximal expression of the luciferase reporter gene in both the Hut78 cell line and in day three PHA activated PBL cells.
- This fragment was subcloned into pSKII bluescript (Stratagene, La Jolla, CA), then removed via BssH II digestion and subcloned into the Mlu I site of the pGL-2 Basic luciferase reporter gene plasmid (Promega, Madison, WI).
- the pGL-2 Basic vector lacks eukaryotic promoter and enhancer sequences.
- the resultant constructs were DNA sequenced to determine orientation. This construct was then transiently transfected (via electroporation as described in Example 2) into activated PBL cells and Hut78 cells. The PBL cells were transfected 36 to 48 hours after activation. Luciferase activity was determined for both cell types approximately 36 hours after transfection using the assay described in Example 2.
- test compound can be added directly to the cell growth media following transfection and results can be compared against results from assays lacking the compound. If a compound inhibits the activation of the R(A/B) site then a corresponding drop in luciferase activity should occur.
- DNase I footprinting and EMSA can further confirm the inhibitory effect of the test compound.
- Both assays can be carried out with either day five activated PBL cells (activated as described in Example 2) or Hut78 cells.
- the test compound can be added to the cell growth media 1 to 2 days prior to and throughout the activation period.
- the test compound can be added to the cell growth media 1 to 2 days prior to harvesting the nuclear extract.
- a series of complexes (labeled bands 1 through 4 in figure 3) were found to associate with the R(A) oligonucleotide.
- the nuclear factor(s) comprising band 4 appear to be constitutively expressed in T cells.
- the complexes which yield bands 1, 2 and 3 were induced in PBL following PHA activation. Band 3 is seen by day 1 and is variably present in all subsequent time points.
- the factors responsible for band 2 result in a broad complex on EMSA and were seen by day 3. Band 1 appears last, between days 3 and 5.
- bands 1 and 2 temporally correlate with the induction of RANTES mRNA expression seen following alloantigen or PHA activation of resting peripheral blood T cells. If the test compound inhibits production of native RANTES gene product, band 1 and most of band 2 will not be present.
- DNase I footprinting is used to assay for DNA sequences which could be protected from DNase I digestion by nuclear extracts isolated from activated T cells. DNase I footprinting of the minimal RANTES promoter identifies a large region protected by T cell derived nuclear extracts (Nelson et al., 1993 J. Immunol. 151:2601 )
- DNAse I footprinting is performed using a derivation of the procedures described by Durand et al., Mol. Cell. Biol. 8: 1715 (1988) and Jones et al., Cell
- Binding reactions are carried out under the conditions described above for EMSA but scaled up to 50 ⁇ l. After binding, using 50 ⁇ g nuclear extracts, 50 ⁇ l of a 10 mM MgC 5mM CaCl 2 solution is added and 2 ⁇ l of an appropriate DNAse I (Worthington, Freehold, NJ) dilution is added and incubated for 1 minute on ice. DNase I digestion is stopped by adding 90 ⁇ l of stop buffer (20 mM EDTA, 1 % SDS, 0.2 M
- yeast tRNA After addition of 20 ⁇ g yeast tRNA as carrier, the samples are extracted two times with an equal volume of phenol/chloroform (1:1) and precipitated after adjusting the solution to 0.3 M sodium acetate and 70% ethanol. DNA samples are then resuspended in 4 ⁇ l of an 80% formamide loading dye containing 1 x TBE, bromphenol blue and xylene cyanol, heated to 90 °C for 2 minutes, and loaded on 6% polyacrylamide-urea sequencing gels.
- Test compounds that do not inhibit production of native RANTES gene product will have the same banding pattern as those of activated PBL and Hut78 cells in figure 2.
- Test compounds that inhibit production of native RANTES gene product will have banding patterns matching the no-extract control lane and the negative control
- R(C)FLAT activates the RANTES promoter through a purine-rich R(C) site. This factor is induced between days 3 and 5 after initial T-cell activation, coincident with the late upregulation of RANTES mRNA. This complex contains at least two DNA binding subunits and does not appear to be related to several transcription factor families known to bind purine-rich sequences.
- R(C)FLAT is highly expressed in many lymphoid cell lines, R(C)FLAT expression does not perfectly correlate with RANTES mRNA expression.
- the R(C)FLAT-positive cell lines Jurkat, PEER, MS, and Daudi do not express RANTES.
- this transcription factor is not an absolute determinant of RANTES gene expression.
- Preliminary data indicate that transcriptional regulation through the R(C) site may be context dependent. Neither the R(C) site nor region C were capable of tr ⁇ /w-activating a heterologous simian virus 40 basal promoter (data not shown). This is also a property of the T-cell receptor beta enhancer which is much more efficient at transactivating its own promoter than a heterologous one. In addition, it is reminiscent of the context-dependent transcriptional regulatory protein lymphoid enhancer factor 1 whose binding site is found in the T-cell receptor alpha enhancer. Since lymphoid enhancer factor 1 is expressed early in T-lymphocyte ontogeny, it is unlikely to be R(C)FLAT.
- Figure 8 provides the characterization of the R(C) binding complex using EMSA. It appears that R(C) has an apparently novel complex with at least two DNA binding subunits.
- R(C) site binding complex was strongly, but transiently, upregulated between days 3 and 5 (Fig. 8B). Additional time course experiments have shown that levels of this complex remain high at least through days 4 to 6 (data not shown). These kinetics are unusual since induction of most known transcription factors occurs within the first 24 h after T-cell activation (46). The timing of R(C) complex upregulation is coincident with the late upregulation of RANTES mRNA in normal T cells.
- the complex is named R(C)FLAT for RANTES C site binding factor of late-activated T cells.
- R(C)FLAT is composed of at least two DNA binding subunits.
- R(C)FLAT complex In order to characterize the components of the R(C)FLAT complex, competition assays were performed using excess cold oligonucleotides representing known purine-rich transcription factor binding sites. R(C) binding activity was specifically inhibited by the homologous oligonucleotide but not the mutant R(C)-M oligonucleotide nor the purine-rich NFAT site of the human IL-2 promoter (Fig. 8C). Further, the binding detected in the other R(C) complex-positive cell types was similarly found to be sequence-specific by competition assays (data not shown). R(C) binding was not inhibited by using consensus binding sites for AP-1, NPkB, C/EBP, NFIL6, Oct-1, or ets family transcription factors (data not shown).
- R(C) site binding activity is widespread but highly expressed in lymphoid cell lines. Nuclear extracts prepared from cell lines of various lineages was tested for R(C) site binding protein activity (Fig. 8A). High levels of R(C) complex activity were found in normal PBL activated with PHA for 5 days, the lymphoid tumor cell lines HUT78, PEER (a y ⁇ leukemia T cell line), and two Burkitt's lymphoma (B-cell) lines, MS and Daudi. Intermediate levels of expression were found in Jurkat and YT7C2 (natural killer tumor cell line). Jurkat, a T-cell leukemia line with a resting phenotype, expressed it at a much lower level.
- This binding activity varied among experiments and may be that of an R(C) binding complex degradation product.
- Figure 9 provides evidence of a nuclear factor binding to R(E) using EMSA.
- Nuclear factors binding to Region E were also identified by cold oligonucleotide competition and antibody supershift/blocking assays.
- an expression vector containing the NFIL6 cDNA under control of the elongation factor promoter was cotransfected with the RANTES -195 promoter-luciferase construct.
- the parent expression vector without the cDNA was used as a control.
- the NFIL6 cDNA stimulated RANTES promoter driven activity over six-fold in HUT78 T-cells. Activity from a reporter construct with region E internally deleted was only minimally enhanced by the NFIL6 expression vector.
- NFJJ 6 induction in activated T cells were examined. Unlike the R(C)FLAT complex, the NFIL6 complex is upregulated by day 1 of the time course and is nearly absent by day 5. The upper band formed by PBL nuclear extracts was upregulated later, by day 3, and was maintained throughout the remainder of the time course. It was also present in terminally differentiated normal cytotoxic T cells (Fig. 10). We refer to this as the E region binding FLAT.
- R(A)FLAT which acts through a downstream kappa-B-like site.
- R(C)FLAT and R(A)FLAT mediate transcriptional control mechanisms likely to contribute to late upregulation of RANTES mRNA in normal T cells.
- the E region binding FLAT complex may also play a role in this process. It is also upregulated on day 3 of T-cell activation and is maintained by fully differentiated cytotoxic T cells, which express RANTES constitutively. Formal demonstration of its role in RANTES gene expression, however, awaits further characterization of the proteins forming this EMSA complex.
- Regions A through E comprise a promoter with the capacity to response to different microenvironmental and developmental stimuli.
- Region A binds proteins of the Rel family and the late-activated R(A)FLAT complex.
- Region B was not found to contribute significantly to activity in T cells but can also bind members of the Rel family.
- Region C contains a purine-rich sequence that binds the R(C)FLAT complex.
- Region D highly conserved between murine and human promoters, contains sequences described as a lipopolysaccharide-responsive element in murine macrophages.
- region E also described here, binds the well-characterized NFIL6 transcription factor and another, as yet uncharacterized, late-activated factor in normal T cells.
- SEQ ID NO:2 (Region A): GCTATTTTGGAAACTCCCCTTAG
- SEQ ID NO:4 (Region C): GAGCTCACTCTAGATGAGAGAGCAGTGAGGGAGAGACAGAGACTCGAATTT
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU61794/96A AU6179496A (en) | 1995-06-16 | 1996-06-14 | Novel enhancer sequences for late t cell expressed genes |
US09/341,007 US6448039B1 (en) | 1995-06-16 | 1996-06-14 | Enhancer sequences for late T cell expressed genes |
EP96919455A EP0837873A4 (en) | 1995-06-16 | 1996-06-14 | Novel enhancer sequences for late t cell expressed genes |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US27495P | 1995-06-16 | 1995-06-16 | |
US60/000,274 | 1995-06-16 | ||
US1486596P | 1996-04-04 | 1996-04-04 | |
US60/014,865 | 1996-04-04 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1997000266A1 true WO1997000266A1 (en) | 1997-01-03 |
Family
ID=26667422
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1996/010429 WO1997000266A1 (en) | 1995-06-16 | 1996-06-14 | Novel enhancer sequences for late t cell expressed genes |
Country Status (5)
Country | Link |
---|---|
US (1) | US6448039B1 (en) |
EP (1) | EP0837873A4 (en) |
AU (1) | AU6179496A (en) |
CA (1) | CA2224723A1 (en) |
WO (1) | WO1997000266A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000052030A1 (en) * | 1999-01-27 | 2000-09-08 | The Board Of Trustees Of The Leland Stanford Junior University | Rflat-1: a transcription factor that activates rantes gene expression |
WO2002008429A2 (en) * | 2000-07-24 | 2002-01-31 | Imclone Systems, Inc. | Vdup1 promoter and methods of use thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5665542A (en) * | 1989-11-03 | 1997-09-09 | Research Institute Of Palo Alto Medical Foundation | Toxoplasma gondii P28 gene and methods for its use |
FR2692282B1 (en) * | 1992-06-15 | 1995-07-13 | Pasteur Institut | CLONING OF THE GENE ENCODING THE PROTEIN GP28.5 OF T. GONDII; PEPTIDE FRAGMENTS FROM SUCH PROTEIN AND THEIR APPLICATIONS. |
-
1996
- 1996-06-14 EP EP96919455A patent/EP0837873A4/en not_active Withdrawn
- 1996-06-14 US US09/341,007 patent/US6448039B1/en not_active Expired - Fee Related
- 1996-06-14 CA CA002224723A patent/CA2224723A1/en not_active Abandoned
- 1996-06-14 WO PCT/US1996/010429 patent/WO1997000266A1/en not_active Application Discontinuation
- 1996-06-14 AU AU61794/96A patent/AU6179496A/en not_active Abandoned
Non-Patent Citations (5)
Title |
---|
LANCET, 22 January 1994, Vol. 343, PATTISON et al., "RANTES Chemokine Expression in Cell-Mediated Transplant Rejection of the Kidney", pages 209-211. * |
See also references of EP0837873A4 * |
THE JOURNAL OF IMMUNOLOGY, 01 August 1988, Vol. 141, No. 3, SCHALL et al., "A Human T Cell-Specific Molecule is a Member of a New Gene Family", pages 1018-1025. * |
THE JOURNAL OF IMMUNOLOGY, 01 February 1994, Vol. 152, No. 3, DANOFF et al., "Cloning, Genomic Organization and Chromosomal Localization of the Scya5 Gene Encoding the Murine Chemokine RANTES", pages 1182-1189. * |
THE JOURNAL OF IMMUNOLOGY, 01 September 1993, Vol. 151, No. 5, NELSON et al., "Genomic Organization and Transcriptional Regulation of the RANTES Chemokine Gene", pages 2601-2612. * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000052030A1 (en) * | 1999-01-27 | 2000-09-08 | The Board Of Trustees Of The Leland Stanford Junior University | Rflat-1: a transcription factor that activates rantes gene expression |
US6376240B1 (en) | 1999-01-27 | 2002-04-23 | Board Of Trustees Of The Leland Stanford Junior Unversity | RFLAT-1: a transcription factor that activates RANTES gene expression |
WO2002008429A2 (en) * | 2000-07-24 | 2002-01-31 | Imclone Systems, Inc. | Vdup1 promoter and methods of use thereof |
WO2002008429A3 (en) * | 2000-07-24 | 2003-03-13 | Imclone Systems Inc | Vdup1 promoter and methods of use thereof |
Also Published As
Publication number | Publication date |
---|---|
EP0837873A1 (en) | 1998-04-29 |
US6448039B1 (en) | 2002-09-10 |
AU6179496A (en) | 1997-01-15 |
EP0837873A4 (en) | 2001-06-13 |
CA2224723A1 (en) | 1997-01-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Penix et al. | Two essential regulatory elements in the human interferon gamma promoter confer activation specific expression in T cells. | |
Brightbill et al. | A prominent role for Sp1 during lipopolysaccharide-mediated induction of the IL-10 promoter in macrophages | |
Szabo et al. | Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc | |
Lin et al. | A 30-kDa alternative translation product of the CCAAT/enhancer binding protein alpha message: transcriptional activator lacking antimitotic activity. | |
Juan et al. | Participation of the transcription factor C/EBP delta in the acute-phase regulation of the human gene for complement component C3. | |
Hume et al. | Congenital immunodeficiencies associated with absence of HLA class II antigens on lymphocytes result from distinct mutations in trans-acting factors | |
Boss et al. | Regulation of a transfected human class II major histocompatibility complex gene in human fibroblasts. | |
Goldfeld et al. | Human tumor necrosis factor alpha gene regulation in phorbol ester stimulated T and B cell lines. | |
Kang et al. | NF-κB subunit regulation in nontransformed CD4+ T lymphocytes | |
Singh et al. | A nuclear factor that binds to a conserved sequence motif in transcriptional control elements of immunoglobulin genes | |
Ouyang et al. | Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism | |
Kamps et al. | The promoter of the human interleukin-2 gene contains two octamer-binding sites and is partially activated by the expression of Oct-2 | |
Seidl et al. | Genetic complexity of regulatory mutants defective for HLA class II gene expression. | |
Ortiz et al. | Kinetics of transcription factors regulating the RANTES chemokine gene reveal a developmental switch in nuclear events during T-lymphocyte maturation | |
Ohmori et al. | IL-4-induced expression of the IL-1 receptor antagonist gene is mediated by STAT6. | |
US9822379B2 (en) | Highly inducible dual-promoter lentiviral TET-ON system | |
Li et al. | Cooperative effects of C/EBP-like and NF x B-like binding sites on rat serum amyloid A1 gene expression in liver cells | |
Wong et al. | Regulation and specificity of MHC2TA promoter usage in human primary T lymphocytes and cell line | |
Wang et al. | Posttranscriptional regulation of protein expression in human epithelial carcinoma cells by adenine-uridine-rich elements in the 3′-untranslated region of tumor necrosis factor-α messenger RNA | |
EP0332416A2 (en) | Regulation of expression in mammalian cells | |
Iguchi-Ariga et al. | Identification of the initiation region of DNA replication in the murine immunoglobulin heavy chain gene and possible function of the octamer motif as a putative DNA replication origin in mammalian cells | |
O'Donnell et al. | The proximal promoter region is essential for lipopolysaccharide induction and cyclic AMP inhibition of mouse tumor necrosis factor-α | |
US6448039B1 (en) | Enhancer sequences for late T cell expressed genes | |
Mouzaki et al. | Silencing and trans‐activation of the mouse IL‐2 gene in Xenopus oocytes by proteins from resting and mitogen‐induced primary T‐lymphocytes. | |
Chauhan et al. | Regulation of c-jun gene expression in human T lymphocytes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BB BG BR BY CA CH CN CZ DE DK EE ES FI GB GE HU IL IS JP KE KG KP KR KZ LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK TJ TM TR TT UA UG US UZ VN AM AZ BY KG KZ MD RU TJ TM |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): KE LS MW SD SZ UG AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2224723 Country of ref document: CA Ref country code: CA Ref document number: 2224723 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1996919455 Country of ref document: EP |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 1996919455 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09341007 Country of ref document: US |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1996919455 Country of ref document: EP |