WO1996008512A1 - POLYPEPTIDES WITH Fc BINDING ABILITY - Google Patents

POLYPEPTIDES WITH Fc BINDING ABILITY Download PDF

Info

Publication number
WO1996008512A1
WO1996008512A1 PCT/AU1995/000606 AU9500606W WO9608512A1 WO 1996008512 A1 WO1996008512 A1 WO 1996008512A1 AU 9500606 W AU9500606 W AU 9500606W WO 9608512 A1 WO9608512 A1 WO 9608512A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
receptor
molecule
binding
immunoglobulin
Prior art date
Application number
PCT/AU1995/000606
Other languages
French (fr)
Inventor
Phillip Mark Hogarth
Ian Farquhar Campbell Mckenzie
Ross Ian Baker
Mark Darren Hulett
Maree Sharne Powell
Original Assignee
Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AUPM8232A external-priority patent/AUPM823294A0/en
Application filed by Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1 filed Critical Austin Research Institute Cancer And Anti-Inflammatory Syndicate No. 1
Priority to EP95932563A priority Critical patent/EP0773960A4/en
Priority to JP8509765A priority patent/JPH10508463A/en
Priority to AU35572/95A priority patent/AU697387C/en
Publication of WO1996008512A1 publication Critical patent/WO1996008512A1/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • G01N33/6857—Antibody fragments
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70535—Fc-receptors, e.g. CD16, CD32, CD64 (CD2314/705F)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention generally relates to molecules having Fc binding ability such as those with Fc receptor-like activity.
  • the present invention also relates to the molecules, nucleic acids encoding the molecules, antagonist compounds, pharmaceutical compositions comprising the molecules and compounds, methods for testing potential antagonists, methods for producing the polypeptide ⁇ , methods of treatment of disease and other aspects.
  • FC ⁇ R Cell surface receptors for the Fc portion of IgG (FC ⁇ R) are expressed on most hematopoietic cells, and through the binding of IgG play a key role in homeostasis of the immune system and host protection against infection.
  • FC ⁇ RII is a low affinity receptor for IgG that essentially binds only IgG i ⁇ tmune complexes and Ig ⁇ immune complexes and is expressed on a diverse range of cells such as monocytes, macrophage ⁇ , neutrophils, eosinophils, platelets and B cells (1-3) .
  • FC ⁇ RII is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators and regulation of antibody production (1-6).
  • Fc receptors for other classes of immunoglobulin also occur.
  • the Fc receptor for IgE is present on mast cells, basophil ⁇ and Langerhans cells.
  • Both the IgG and the IgE Fc receptors contain an extracellular Ig-interactive region which comprises two Ig- like disulphide bonded extracellular domains of the C2 set (7-11) .
  • These receptors are structurally conserved in all the Ig-superfamily leukocyte FcR (including FC ⁇ RI, FC ⁇ RIII, Fc ⁇ RI and Fc ⁇ RI) and presumably represents an Ig- interactive motif (12-16) .
  • the inventors identified the IgG binding region of human FC ⁇ RII (17, 18) .
  • FC ⁇ II domain 2 predicted a structure comprising 7 ⁇ strands ( ⁇ , B, C, C, E, F, G) forming two antiparallel ⁇ sheets (containing the ⁇ CFG and BC'E strands respectively), stabilised by a disulphide bond between strands B and F and a core of hydrophobic residues (20) .
  • the ⁇ sn 154 to Ser 161 binding region was shown to encompass an exposed loop region (the F-G loop) at the interface of domains 1 and 2.
  • the invention relates to a polypeptide with Fc binding ability wherein the polypeptide is altered compared to a native Fc receptor by addition, deletion or substitution of one or more amino acids compared to said native Fc receptor.
  • the invention also relates to a method of testing compounds for their ability to act as an Fc receptor antagonist, to the antagonist compounds identified by the method, to nucleic acid molecules encoding the polype tides of the invention and to methods of making the nucleic acid molecules.
  • the invention relates to methods of detecting immunoglobulin, methods of removing immunoglobulin, methods of treatment and pharmaceutical compositions involving the peptides of the invention or their antagonists.
  • FIG. 1 IgG complex binding of chimeric Fc receptors.
  • COS-7 cell monolayers were transfected with chimeric cDNA constructs: Dl ⁇ D2 ⁇ (a), ⁇ l09-116 ⁇ (b), ⁇ l30- 135 ⁇ (c), or Fc ⁇ RI (d) .
  • the binding of IgG immune complexes was assessed directly on the monolayers by EA resetting using mouse IgGl sensitised erythrocytes.
  • FIG. 1 Human IgGl-dimer binding of chimeric Fc receptors. Radiolabelled dimeric human IgGl was titrated on COS-7 cells transfected with wild-type FC ⁇ RIIa
  • FIG. 3 Human IgGl-dimer binding by FC ⁇ RIIa alanine point mutants. Radiolabelled dimeric human IgGl was titrated on COS-7 cells transfected with wild-type Fc-RIIa or Fc ⁇ IIa containing alanine point mutations, (A) B-C loop mutants, Lys 113 -Ala (D) , Pro 114 -Ala (A), Leu 115 -Ala (t), Val"*-Ala (0), (B) C'-E loop mutants, Phe 12 '-Ala (+), Ser"°- Ala (0), Arg/His 131 -Ala ( ⁇ ), Leu 13a -Ala (X), Asp 133 -Ala (FB), Pro 134 -Ala ( ⁇ ) .
  • Figure Histogram showing the effect of mutations on Ig receptor binding immunoglobulin.
  • Figure 7 Histogram showing a comparison of Fc receptor mutants binding IgG ! and IgG-.
  • Figure 8 Graph showing efficiency with which chimeric receptors bind IgE, ⁇ ( ), ⁇ ( ), CC ( ), EF ( ) and GC ( ).
  • FIG. 9 Photograph of SDS-PAGE showing specificity of the fusion protein, (HSA.Fc ⁇ Rll) for mouse Ig ⁇ 2a ( ⁇ 2a) Ig ⁇ 2b ( ⁇ 2b) and HA ⁇ but not for Fab'2 fragments (1302). Shows epitopes present in the fusion protein as detected b four different anti-Fc ⁇ RII antibodies (8.2, 8.26, IV-3 & 8.7).
  • the fusion protein was radiolabelled with I 125 and precipitated using Ig or antibodies shown then subjected to SDS-PAGE after reduction.
  • Figure 10a Graph showing the clearance of HSA:Fc ⁇ RIl (-E3- ) and Fc ⁇ RII (— —) in the blood.
  • FIG. 10b Graph showing failure of HSA.Fc ⁇ Rll to accumulate in the urine affinities.
  • FIG 11. Graph showing the binding affinities of HAGG to HSA.Fc ⁇ RIl-silica (t) and HSA. ⁇ ilica (0). HAGG did not bind HSA:silica.
  • Figure 12. Nucleotide and predicted amino acid sequence of HSA: Fc ⁇ RII DNA.
  • FIG. 13 Graphs showing results of ELISA studies on the ability of the fusion protein, rsHSA-FcR (— ⁇ — ) to bind immune complexes.
  • the recombinant receptor rsFcR is denoted by (— ⁇ —) .
  • FIG 14a ELISA studies of serum from a patient with rheumatoid arthritis. Plates were coated with anti-FC ⁇ RII antibody and then with rec.sFCrRII.
  • FIG. 14b Shows results of plates coated with rec.sFcyRII.
  • FIG. 15 Graph of heat depleted HAGG using Fc ⁇ RII- HSA silica ( ⁇ ) . This shows that inrmune complexes are depleted from liquid by incubation with HSA.Fc ⁇ Rll protein silica resin but not by HSA-silica resin (0) no silica is denoted by (I) .
  • FIG. 17 Titration of rsFC ⁇ RII from various sources.
  • the binding of the recombinant protein from various sources is detected by use of anti-FcRII antibody 8.2 followed by anti-mouse Ig labelled with peroxidase.
  • the sources of the recombinant protein are CHO cells (CHO rs FcR) ( —•— ) , bacteria expressing a fusion protein consisting of the extracellular domains of FC ⁇ RII fused to maltose binding protein (C2 MBP-rsFcR) ( -0— ), the extracellular domains of FC ⁇ RII cleaved from the FC ⁇ RII maltose binding fusion protein (C2 rs FcR) (H 1—) ⁇
  • a fusion protein (d2) (-- >-) was used as a control.
  • FIG. 18 Graph of inhibition of HRP labelled r ⁇ HSA- Fc ⁇ RII by rheumatoid factors and sera. Titration of patients' sera in the HRP-HSA.FC ⁇ RII ELISA assay. Patients' sera (columns 1-14) was titrated on Hagg coated plates prior to addition of the HRP fusion protein conjugate. Titration of normal serum is also shown (column 15) . No inhibition of activity was seen with normal serum but, all sera except column 12 profoundly inhibited Fc receptor binding to Hagg.
  • Figure 19 Names of various peptiods and absorbences thereof in the test for antagonist compounds.
  • the invention relates to a polypeptide with Fc binding ability wherein the polypeptide is altered compared to a native Fc receptor by addition, deletion or substitution of one or more amino acids such that said alteration results in improved characteristics compared to said nature receptor.
  • a polypeptide with Fc binding ability means a polypeptide or protein comprising natural or synthetic amino acids which has an ability to bind the Fc region of immunoglobulin.
  • the immunoglobulin may be of any class such as IgG, IgE, IgA, IgM or igD.
  • the in ⁇ sunoglobulin may be derived from any animal such as human, rat, mice, cattle, sheep, goats and other domestic animals, including birds such as chickens, ostriches and emus.
  • altered compared to a native Fc receptor means that the polypeptide is different to the native Fc receptor. Such difference may include differences in immunoglobulin binding ability, difference in therapeutic ability , amino acid composition or solubility and the like.
  • the term "improved characteristics" means that a desirable characteristic compared to the native Fc receptor is achieved. This characteristic may enhance or decrease Fc binding ability, cause increased serum half life of the polypeptide for use as a therapeutic or make the polypeptide detectable.
  • the present invention relates to a polypeptide with Fc binding ability wherein the polypeptide is an Fc receptor-like molecule with an altered ability to bind iinmunoglobulin wherein said altered ability is brought about by alteration of one or more amino acid residues which affect immunoglobulin binding.
  • Fc receptor-like molecule means a molecule which is able to bind immunoglobulin to at least some degree.
  • the immunoglobulin may be IgG, IgE, IgA, IgM or IgD.
  • the molecule will usually be a peptide, polypeptide or protein, or made up, at least partially, of amino acids. In its most usual form the molecule will be a peptide composed of a number of amino acid residues linked by peptide bonds.
  • the amino acid components may be natural or synthetic and will be known to those skilled in the art.
  • the phrase "an altered ability to bind i ⁇ mrunoglobu1in” means that the molecule has an immunoglobulin binding activity different to that of one or more native Fc receptors.
  • the activity of the molecule may be increased or decreased compared to a native Fc receptor for a given iimnunoglobulin class.
  • alteration of one or more amino acid residues which affect immunoglobulin binding ability means that the comparable amino acid residue or region of amino acid residues, implicated in immunoglobulin binding in a native Fc receptor are changed in the Fc receptor-like molecule.
  • the amino acids implicated in iimnunoglobulin binding may function directly in immunoglobulin binding or may be involved indirectly such as by maintaining the structural integrity of the receptor so that binding can occur.
  • the change(s) may be the result of insertion, deletion or substitution.
  • the present inventors have determined that amino acid residues or regions of residues in the first and second domains of the FC ⁇ RII receptor and Fc eR I receptor function in binding of i ⁇ rnrnnoglobulin.
  • Fc receptors for iinmunoglobulins are conserved it is expected that similar regions of Fc receptors for other immunoglobulins such as IgA, IgM and IgD will be implicated in immunoglobulin binding and hence be within the ambit of the present invention.
  • the Fc receptor-like molecule is in the form of an isolated preparation meaning it has undergone some purification away from other proteins and/or non-proteinaceous molecules.
  • the purity of the preparatio may be represented at least 40% Fc receptor-like molecule, preferably at least 60% Fc receptor-like molecule, more preferably at least 75% Fc receptor-like molecule, even more preferably at least 85% Fc receptor-like molecule and still more preferably at least 95% Fc receptor-like molecule relative to non-Fc receptor-like molecule material as determined by weight, activity, amino acid similarity, antibody reactivity or any other convenient means.
  • the Fc receptor-like molecule may be bound to a cell membrane or a support means, or be soluble in form. Where a pharmaceutical use is indicated preferably the molecule is soluble for example as a genetically engineered soluble molecule.
  • Soluble Fc receptor-like molecules can be made by methods such as those of lerino et al J. Exp. Med. (Nov) 1993.
  • the molecule may also be labelled with a reporter molecule providing, under suitable conditions, a detectable signal.
  • reporter molecules include radio-nucleotides, chemiluminscent molecules, bioluminescent molecules, fluorescent molecules or enzymes.
  • Commonly used enzymes include horseradish peroxidase, glucose oxidase, ⁇ - glactosidase and alkaline phosphatase amongst others.
  • the Fc receptor-like molecule is an amino acid mutant, variant or derivative of a native Fc receptor.
  • the Fc receptor-like molecule comprises a peptide which has undergone deletion, insertion, substitution or other changes to its amino acid residues compared to a native Fc receptor.
  • the native Fc receptor providing the basis for the mutant, variant or derivative may be derived from human or animal species. Such animal species are preferably mammalian species such as mice, rats, rabbits, bovine, ovine, porcine or caprine species. Deletion, insertion or substitution of amino acids to produce the Fc receptor-like molecule of the present invention may be performed by known means.
  • the nucleic acid encoding the molecule will have incorporated in its sequence the appropriate code for one or more amino acid insertions or substitutions or have undergone the appropriate deletion from its coding sequence.
  • the receptor-like molecule is produced by de novo peptide synthesis the desired amino acid sequences may be incorporated.
  • Insertions or substitutions may be achieved by placing a stretch of amino acid residues from another type of Fc receptor into the Fc receptor-like molecule which is being constructed.
  • the first domain from one receptor such as Fc ⁇ receptor may be used to replace the first domain in Fc r receptor to produce the desired result.
  • site directed mutagenesis or other techniques may be used to achieve amino acid substitution.
  • Deletions may be achieved by removal of one or more amino acids.
  • Substitution of amino acids may be conservative by replacing an amino acid with a residue of similar properties.
  • the amino acid substitution may be in accordance with Table 1.
  • substitutions may be with an amino acid of different chemical characteristics imparting a different character to the molecule when compared to a native Fc receptor.
  • the invention relates to an Fc receptor-like molecule having enhanced ability to bind immunoglobulin wherein the enhanced ability is brought about by alteration of one or more amino acid residues which affect immunoglobulin binding ability.
  • the phrase "enhanced ability to bind immunoglobulin 1 ' means that the molecule has an immunoglobulin binding activity higher than, or increased compared to, a native Fc receptor in a given class.
  • the alteration of one or more amino acid residues may be in the first or second domain.
  • the Fc receptor-like molecule has an enhanced ability to bind IgG, preferably alterations in the first domain to included changes to the A/B, C/C and/or E/F loops and/or G/A strand.
  • the loops referred to hereafter are the loops identified in the putative 3-D structures or their equivalents for the receptors discussed earlier and identified in the Examples. The term
  • equivalents means amino acid residues that occur in the same position on the native Fc receptor which comprise the putative loops. It also includes eqivalent loop structures in other native Fc receptors. In addition all of the amino acid residue positions discussed herein are relative to the amino acid sequences of FC ⁇ RII or Fc ⁇ RI.
  • Alterations to the second domain of a Fc receptor-like molecule specific for IgG include changes in the B/C, C'/E and/or F/G loops, and/or ⁇ / ⁇ strand which connects domains 1 and 2.
  • the changes comprise substitution of one or more amino acids especially a conservative substitution.
  • Such changes include but are not limited to replacement by alanine, glycine, serine, asparagine or email synthetic neutrally charged amino acids. Most preferably the replacement is alanine.
  • the alterations are at the following positions 133, 134, 158, 159 and/or 160.
  • the Asp 133 and/or Pro 134 residues of Fc ⁇ RII are replaced by alanine.
  • the alterations in the first domain include changes in A/B, C/C and/or E/F loops and/or the G/A strand that connects domain 1 and domain 2.
  • Alterations to the second domain of a Fc receptor-like molecule specific for IgE include changes in the B/C, C'/E and/or F/G loops.
  • the changes are at the following positions 130, 156, 160 and/or 161. Still more preferably the Trp 130 , Trp 156 , Tyr" 0 and/or Glu 161 is/are replaced by alanine.
  • the invention relates to an Fc receptor-like molecule having reduced ability to bind immunoglobulin wherein the reduced ability is brought about by the alteration of one or more amino acid residue ⁇ which affect immunoglobulin binding ability.
  • the phrase "reduced ability to bind immunoglobulin” means that the molecule has an immunoglobulin binding activity lower than, or decreased compared to, a native Fc receptor in a given class. This includes a reduced activity for binding of one form of immunoglobulin such as, for example, dimeric immunoglobulin.
  • the reduced binding ability may be brought about by deletion ⁇ , insertions or substitutions of amino acid residue ⁇ in the fir ⁇ t or the second domain.
  • the reduced binding ability will be the result of substitution or deletion of one or more amino acid residue ⁇ although insertions are also clearly contemplated.
  • substitutions will be with an amino acid residue (natural or synthetic) which has different chemical characteristics to the corresponding amino acid in the relevant native Fc receptor in question.
  • the substituted amino acid may have different charge, acidity or basicity.
  • Fc receptor-like molecule has a reduced ability to bind IgG
  • alterations in the first domain include replacement of that domain or changes to the A/B, C/C or B/F loops or G/A strand.
  • the changes are at the following positions 10 to 21, 42 to 48 and/or 59 to 62.
  • Alterations to the second domain of a Fc receptor-like molecule specific for IgG preferably include changes to the F/G, B/C, or C/C loops.
  • the changes are at the following positions 113, 114, 115, 116, 129, 131, 155 and/or 156.
  • the fir ⁇ t domain is deleted or replaced by a domain from an Fc receptor for another inBnunoglobulin.
  • Lys 113 , Pro 114 , Leu 115 , Val 1 ", Phe 129 and/or Arg/His 131 of FC ⁇ RII i ⁇ /are replaced by alanine.
  • alterations in the first domain include the A/B, C/C or E/F loops. More preferably the changes are at the following positions in the first domain 10 to 21, 42 to 48 and/or 59 to 62.
  • Alterations in the second domain of a Fc receptor-like molecule specific for IgE preferably include changes to the F/G, C'/E or B/C loops.
  • More preferably changes are at one or more of the following positions: 131, 132, 155, 158 and/or 159.
  • the B/C loop (Ser 109 to Val 1 ") of Fc-RI is deleted or replaced by a B-C loop from a receptor for another immunoglobulin.
  • the C'/E loop (Ser 130 to Thr 135 ) of Fc ⁇ RI is deleted or replaced by a C/E loop from a receptor from another immunoglobulin.
  • Tyr 131 , Glu 132 , Val 155 , Leu 1 " and/or Asp 159 of Fc ⁇ RI is/are replaced by alanine.
  • the alterations contemplated may be other alterations which make the polypeptide useful as a therapeutic or reagent
  • the alteration may be in the form of an addition deletion or subtraction.
  • a polypeptide or other suitable molecule may be added to a native Fc receptor in order to increase the size of the molecule or to provide a linker which links a native Fc receptor with a reporter molecule.
  • the invention in a second embodiment relates to a polypeptide with Fc binding ability wherein the polypeptide is altered compared to a native Fc receptor such that the size of the polypeptide is larger than said native Fc receptor.
  • the inventors have surprisingly found that the addition of an amino acid sequence to a polypeptide with Fc binding ability not only result ⁇ in an extended life in the body of an animal but also retains biological activity of the Fc binding component.
  • the augmented polypeptide has a greater serum half life compared to soluble protein with Fc binding ability and is therefore capable of being more effective as a therapeutic than an altered soluble native Fc receptor.
  • polypeptide with Fc binding ability is in an isolated form such as that described earlier in relation to the Fc receptor-like molecule.
  • polypeptide of the invention is in soluble form where it is to be used in serum or other administration routes requiring solubility. This would generally mean that the tran ⁇ membrane region is not included however the intracellular region may be included.
  • the augmentation of the Fc binding polypeptide i ⁇ achieved by linking an amino acid sequence, such a ⁇ a ⁇ econd polypeptide or other suitable molecule to a peptide with Fc binding ability.
  • the peptide with Fc binding ability may be a native receptor, a modified native receptor (for example a receptor without the transmembrane or cytopla ⁇ mic region ⁇ ) or a Fc receptor-like molecule a ⁇ described earlier.
  • the polypeptide with Fc binding ability i ⁇ of a ⁇ ize larger than about 67 kD ⁇ ince protein ⁇ below this size are excreted by the kidneys. More preferably the polypeptide is in the ⁇ ize range of 67 to 1000 kD. Still more preferably the polypeptide i ⁇ approximately 100 kD.
  • the augmentation i ⁇ achieved by adding a peptide, polypeptide or other molecule which i ⁇ well tolerated in an animal.
  • Such pe ides or polype tides include human serum albumin (HSA), bovine serum albumin, other Fc receptors, immunoglobulin from any specie ⁇ , cytokine ⁇ , complement regulating molecules (eg. CD46, CD55, CD59), complement receptors and cytokine receptors.
  • HSA human serum albumin
  • bovine serum albumin other Fc receptors
  • the polypeptide may be directed against any class of Ig.
  • the polypeptide is directed against IgG or IgE. Even more preferably the polypeptide i ⁇ HSA.Fc ⁇ Rll a ⁇ herein described.
  • the polypeptide with Fc binding ability may be produced by any convenient means such as through recombinant DNA technology as a fusion protein, or alternatively the two components may be produced separately (by recombinant DNA or other means) and then linked. Alternatively one or both components may be made via peptide synthesis. These methods are described in more detail later on.
  • the invention relates to a polypeptide with Fc binding ability comprising a component capable of detection.
  • component capable of detection means that the polypeptide is linked to or contains a detectable signal such a ⁇ a reporter molecule, a bio ⁇ en ⁇ or or a molecule which may be directly or indirectly detected.
  • the reporter or label i ⁇ a component which i ⁇ capable of detection such as by radio labelling, chemiluminescent labelling, fluorometric labelling, chromophoric labelling or labelled antibody binding.
  • Detection may be achieved by direct labelling of the polypeptide with a ligand such as, for example, biotin which specifically binds to streptavidin linked covalently to hor ⁇ eradi ⁇ h peroxida ⁇ e or another enzyme such as alkaline phosphata ⁇ e.
  • the actual component capable of detection may be suitably chosen by those skilled in the art.
  • the polypeptide is in an isolated form as described above.
  • the polypeptide comprising a component capable of detection comprises the polypeptide described in the first or second embodiments of the invention.
  • the component capable of detection is present on, or comprised part of the augmentation.
  • the component capable of detection may be present on the Fc binding portion of the molecule provided this does not inhibit Fc binding ability.
  • the component capable of detection i ⁇ an enzyme such as hor ⁇ eradi ⁇ h peroxida ⁇ e.
  • the pre ⁇ ent invention relate ⁇ to a method of testing a compound for its ability act as an antagonist of an Fc receptor said method comprising contacting the compound with a polypeptide with Fc binding ability or a native Fc receptor under conditions and for a time ⁇ ufficient to allow binding of the compound to the polypeptide or receptor and determining whether binding has occurred.
  • Fc receptor used directly above includes any native or non-native Fc receptor or a portion thereof which binds Fc.
  • the compound tested may be any compound which could possibly be useful as an Fc receptor antagonist.
  • Such compounds may be antibodies, including polyclonal and monoclonal antibodies, or fragments of antibodies, such as ⁇ cantibodie ⁇ , antibody mimetic ⁇ (Smythe & von Itz ⁇ tein) and the like.
  • the compounds may be extracts from produced from plants or animals such a ⁇ rain forest plants, corals and the like.
  • the compounds may be peptides or peptide-like substances or other organic substances such as tho ⁇ e derived from combinational libraries ( ⁇ eysen et al 1995; Stratton-Thomas et al 1995, Lome Conference on Protein Structure and Function, Australia) .
  • the method of the invention may be conducted in any suitable manner known to those skilled in the art.
  • the polypeptide with Fc binding ability or the Fc receptor may be attached to a support leaving the Fc binding site free. Then the immunoglobulin and compound under investigation may be added to the attached polypeptide or Fc receptor. Alternatively Ig or the Fc fragment thereof may be attached to a support. The polypeptide or the Fc receptor and compound under investigation may be added to the bound ligand.
  • Determination of whether binding has taken place may be made by any convenient means. This may be achieved by common detection method such as by using a labelled polypeptide or labelled FcR or by using a labelled Ig. Such detection methods are well known by those skilled in the art and are discussed elsewhere in this document.
  • the method may be used to screen compounds which are potential inhibitors of receptors for any class of imunoglobulin.
  • the method is used to screen compounds for their ability to block binding of Ig to the Fc ⁇ receptor or the Fc ⁇ receptor.
  • the pre ⁇ ent invention relate ⁇ to antagonist compounds identified by the above method which interfere with the amino acid residues in Fc receptors which are involved in immunoglobulin binding.
  • Such compounds embrace any compound which interact with the ⁇ e amino acid re ⁇ idue ⁇ or regions of residue ⁇ so as to interfere with or reduce immunoglobulin binding and include compounds which bind to these re ⁇ idue ⁇ or regions of residues by hydrophobic, electrostatic or other chemical interaction. This also includes compounds which interfere with the structural integrity of the molecule thereby reducing its affinity for immunoglobulin a ⁇ well a ⁇ compounds which directly interfere with the amino acids involved in immunoglobulin binding. Also included are compounds that bind to Ig, as opposed to its receptor, and thereby inhibit the receptor-Ig interaction.
  • the antagoni ⁇ t ⁇ may be antibodies, peptides, peptide-like ⁇ ub ⁇ tances or any other compound a ⁇ described above.
  • the antagonist once identified is in an isolated form.
  • the Fc receptor antagoni ⁇ t ⁇ may be used in the treatment of asthma, rheumatoid arthritis, lupus , glomerulonephriti ⁇ , IgA nephropathies, etc. and a host of immune complex and other diseases including but not limited to autoiinmune diseases.
  • the compound will preferably interact with the A/B, C/C or E/F loops in the fir ⁇ t domain or with the F/G, B/C or C'/E loops in the second domain or the G/A strand.
  • the compounds will be capable of binding to or blocking the function of one or more of the following re ⁇ idue ⁇ in the native Fc receptors 10-21, 42-48, 59-62, 113, 114, 115, 116, 129 131, 133, 156, 158, 159 and/or 160 or their functional equivalents.
  • the compound will preferably interact with the A/B, C/C or E/F loops in the fir ⁇ t domain and/or the F/G, C'/E or B/C loops of the second domain or the G/A strand.
  • the compounds will be capable of binding to or blocking the function of the following residue ⁇ : 10-21, 42-48, 59-62, 131, 132, 155, 158 and/or 159.
  • the present invention contemplates pharmaceutical compositions containing as an active ingredient the polypeptide with Fc binding ability including the Fc receptor-like molecules or the antagoni ⁇ t compounds described above, depending on the condition to be treated, together with a pharmaceutically appropriate carrier or diluent.
  • polypeptide with Fc binding ability or Fc receptor-like molecule with enhanced immunoglobulin binding ability may be u ⁇ ed to treat di ⁇ ea ⁇ e ⁇ including by not limited to glomerulonephriti ⁇ , lupus, arthritis, heparin induced thrombocytopoenia thrombosis syndrome (HITTS) or idiopathic thrombocytopoenia pupuera (ITP), asthma, allergy, eczema, Ig nephropathies and rheumatoid arthritis.
  • Fc receptor-like molecule with reduced binding ability may be used to treat disease where it is desirable to remove only some or one particular kind of iimminoglobulin.
  • Antagoni ⁇ t compounds may be used in the treatment of inappropriate or excessive immunoglobulin levels or aggregates or immune complexes are part of the symptoms of the disease such as a ⁇ thma, allergy, rheumatoid arthritis, etc.
  • a ⁇ thma a ⁇ thma
  • allergy a ⁇ rheumatoid arthritis
  • all of the above molecules and compounds will be referred to herein a ⁇ "active molecule ⁇ ".
  • active molecule ⁇ therefore should be read a ⁇ one or more of the above molecule ⁇ depending on the condition to be treated.
  • the active molecule ⁇ of the pharmaceutical composition ⁇ are contemplated to exhibit therapeutic activity when administered in an amount which depends on the particular case. The variation depends, for example, on the animal and the active molecule. For example, from about 0.05 ⁇ g to about 100 mg of Fc receptor-like molecule or antagonist compound may be administered per kilogram of body weight per day to alter Fc receptor-immunoglobulin interaction. Do ⁇ age ⁇ may be adjusted to provide the optimum therapeutic response. For example, ⁇ everal divided doses may be administered daily, weekly, monthly, or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation.
  • the active molecules may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intraperitoneal, intramuscular, subcutaneous, topical, intranasal, intradermal or suppository routes or implanting (e.g. using slow release molecule ⁇ ) .
  • the active molecule ⁇ may be required to be coated in a material to protect said molecules from the action of enzymes, acids and other natural condition which may inactivate said ingredients.
  • the active molecules may also be administered in dispersions prepared in glycerol, liquid polyethylene glycol, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pre ⁇ ent invention relate ⁇ to a nucleic acid molecule encoding a polypeptide with Fc binding ability wherein the structure of the polypeptide i ⁇ altered compared to a native Fc receptor by addition, deletion and/or substitution of the amino acids encoded by the nucleic acid ⁇ uch that ⁇ aid alteration re ⁇ ult ⁇ in improved characteri ⁇ tic ⁇ compared to ⁇ aid native receptor.
  • nucleic acid molecule refers to molecule made up of natural or synthetic purines and pyrimidine ⁇ .
  • the nucleic acid molecule may be DNA or RNA, single or double stranded, linear or circular and may form a part of a larger nucleic acid molecule.
  • polypeptide with Fc binding ability the meaning given earlier.
  • polypeptide is altered compared to a native Fc receptor
  • improved characteristics have the same meaning as given earlier.
  • the nucleic acid molecule is in isolated form meaning it has undergone some purification away from other nucleic acids and/or non-nucleic acid molecule ⁇ .
  • the purity of the preparation may be represented by at least 40% nucleic acid molecule encoding a polypeptide with Fc binding ability, preferably at least 60% nucleic acid molecule, more preferably at least 75% nucleic acid molecule, even more preferably at least 85% nucleic acid molecule, even more preferably at leat 95% nucleic acid molecule relative to nucleic acid molecules not encoding a polypeptide with Fc binding ability as determined by nucleic acid homology, sequence or any other convenient means.
  • the present invention relates to a nucleic acid molecule encoding an Fc receptor ⁇ like molecule comprising an altered ability to bind Fc wherein said ability i ⁇ brought about by alteration of one or more amino acid residue ⁇ which affect immunoglobulin binding ability.
  • Fc receptor-like molecule has the meaning given earlier.
  • the nucleic acid molecule may encode an Fc receptor-like molecule which functions a ⁇ a receptor for any type of immunoglobulin ⁇ uch a ⁇ IgG, IgE, IgA, IgM, or IgD.
  • the Fc receptor-like molecule encoded may be derived from any species, such as human, mouse, rat, bovine, ovine, caprine etc and may comprise a combination of different sources.
  • the term "derived from” means that the original coding sequence providing the basi ⁇ for the nucleic acid molecule prior to alteration comes from the species specified.
  • nucleic acid molecule may be made by site mutagene ⁇ i ⁇ of DNA encoding native Fc receptor, splice extension overlap PCR, de novo synthe ⁇ i ⁇ , etc.
  • nucleic acid molecule encodes a mutant, derivative or variant of a native Fc receptor a ⁇ described earlier.
  • nucleic acid molecule encodes an Fc receptor like peptide which has enhanced ability to bind IgG or IgE.
  • enhanced ability has the same meaning a ⁇ given earlier.
  • nucleic acid molecule encode ⁇ an Fc receptor-like molecule with an enhanced ability to bind IgG
  • the molecule compri ⁇ e ⁇ codon ⁇ re ⁇ ulting in one or more altered amino acids in the A/B, C/C and/or B/F loops of the first domain or B/C, C'/E and/or F/G loops of the ⁇ econd domain and/or the G/A strand that connects the two domains.
  • the codon ⁇ result in altered amino acids at positions 158, 159, 160, 133 and/or 13 .
  • the altered amino acids comprise alanine, glycine, ⁇ erine, a ⁇ paragine or small synthetic neutrally charged amino acids.
  • codon specifies the amino acid alanine.
  • nucleic acid molecule compri ⁇ es a cDNA encoding FC ⁇ RII with the codon for Asp 133 and/or Pro 134 specifying alanine. Even more preferable the nucleic acid molecule is Asp 133 -Ala or Pro 134 -Ala a ⁇ described in the Examples.
  • the nucleic acid molecule encode ⁇ an Fc receptor-like molecule with an enhanced ability to bind IgE.
  • the molecule compri ⁇ e ⁇ codon ⁇ re ⁇ ulting in one or more altered amino acids in the A/B, C/C and/or E/F loops of the first domain or the F/G, C'/E and/or B/C loops of the ⁇ econd domain or the G/A strand.
  • codons result in altered amino acids at po ⁇ ition ⁇ 130, 156, 160 and/or 161.
  • nucleic acid molecule compri ⁇ e ⁇ a cDNA encoding Fc.RI with the codon for Trp 130 , Trp 154 , Tyr 1 ⁇ 0 and/or Glu 141 specifying alanine.
  • nucleic acid molecule is Trp 130 -Ala, Asp 159 - Ala, Tyr 1 * 0 -Ala or Glu 1(1 -Ala as described in the Examples.
  • nucleic acid molecule encode ⁇ an Fc receptor like peptide which ha ⁇ reduced ability to bind IgG or IgE.
  • reduced ability has the same meaning as given earlier.
  • the amino acid alterations specified by the codons will generally be amino acids with different chemical characteri ⁇ tic ⁇ ⁇ uch a ⁇ that described earlier.
  • nucleic acid molecule encodes an Fc receptor-like molecule with a reduced ability to bind ig ⁇
  • the molecule comprises codons which result in one or more altered amino acids in the A/B, C/C and/or E/F loops in the first domain and/or the B/C, C'/E and/or F/G loop ⁇ in the ⁇ econd domain and/or the G/A strand.
  • the codons result in altered amino acids at position ⁇ 10-21, 42-48, 59-62, 113, 114, 115, 116, 129, 131 155 and/or 156. Even more preferably the codons for the first domain of FC ⁇ RII are removed or replaced by tho ⁇ e for a receptor for another inrmunoglobulin.
  • the codon ⁇ for Lye 113 , Pro 114 , Leu 115 , Val 1 ", Phe 129 , Arg/Hi ⁇ 131 and He 155 and/or Gly 1 " are replaced by the codon for alanine in the FC ⁇ RII.
  • the nucleic acid molecule compri ⁇ e ⁇ the con ⁇ truct ⁇ DleD2 r , Lye 113 -Ala, Pro 11 -Ala, Leu 115 -Ala, Val 116 -Ala, Phe 129 -Ala and/or Arg/Hi ⁇ 131 -Ala described in the Examples.
  • nucleic acid molecule encodes an Fc receptor-like molecule with a reduced ability to bind IgE the molecule compri ⁇ e ⁇ codon ⁇ which re ⁇ ult in one or more altered amino acid ⁇ in the A/B, C/C and/or E/F loop ⁇ in the fir ⁇ t domain or the F/G, C'/E and/or B/C loop ⁇ in the second domain or the G/A strand.
  • codons result in altered amino acid ⁇ at po ⁇ ition ⁇ 10-21, 42-48, 59-62, 129, 131, 132, 155, 158, 159.
  • codons for the fir ⁇ t domains of Fc ⁇ RI are removed or replaced by those for a receptor for another i ⁇ r ⁇ ninoglobulin.
  • the codons for Tyr 129 , Tyr 131 , Glu 132 , Val 155 , Leu 1 " and/or Asp 159 is/are replaced by the codon for alanine in Fc ⁇ RI.
  • the nucleic acid molecule of the invention comprises the constructs ⁇ l09-116 ⁇ , ⁇ l30-135 ⁇ , Tyr 131 -Ala, Glu 132 -Ala, Val 155 -Ala, Leu 15 ⁇ -Ala and Asp 159 -Ala a ⁇ de ⁇ cribed in the Examples.
  • the invention relates to a nucleic acid molecule encoding a polypeptide with Fc binding ability wherein the polypeptide is altered compared to native Fc receptor such that the size of the polypeptide is larger than said native Fc receptor.
  • nucleic acid molecule encodes a polypeptide that is soluble.
  • the nucleic acid compri ⁇ e ⁇ a component encoding naive Fc receptor, the extracellular region thereof or the Fc receptor-like molecule de ⁇ cribed earlier and a component encoding an amino acid sequence that result ⁇ in the protein being larger than about 67 kD.
  • the protein encoded is in the range of 67 kD to 1000 kD.
  • the non-Fc binding component encoded is a peptide well tolerated by an animal ⁇ uch a ⁇ HSA, other Fc receptors, Igs from any species, cytokines and complement regulating molecule ⁇ ⁇ uch a ⁇ tho ⁇ e discussed earlier. Even more preferably the nucleic acid has the same sequence as HSA : Fc ⁇ RII or is substantially similar thereto.
  • the invention relate ⁇ to a nucleic acid molecule encoding a polypeptide with Fc binding ability comprising a component capable of detection.
  • component capable of detection has the ⁇ ame meaning a ⁇ given earlier.
  • the nucleic acid molecule encode ⁇ the polypeptide de ⁇ cribed in the fir ⁇ t or ⁇ econd embodiments of the invention and preferably the component capable of detection i ⁇ encoded by the appropriate nucleotide sequence ⁇ uch a ⁇ a nucleotide sequence encoding an immunoglobulin, HRP, Alk-Phos or other detectable component.
  • the invention al ⁇ o extends to the nucleic acid molecules used as primers to produce the nucleic acid molecule of the invention.
  • the primers described in the Examples are particularly preferred.
  • the invention further extends to a method of making the nucleic acid molecule of the invention comprising producing a nucleic acid encoding a polypeptide with Fc binding ability the structure of which is altered compared to a native Fc receptor by addition, deletion or substitution of one or more amino acids such that said alteration result ⁇ in improved characteri ⁇ tic ⁇ compared to ⁇ aid native receptor.
  • the term "producing a nucleic acid molecule” encompas ⁇ e ⁇ direct mutagene ⁇ i ⁇ of a native Fc receptor gene by chemical means, SOE-PCR, de novo synthesis or addition of a nucleic acid such that a fusion protein is encoded.
  • the different methods of effecting mutations will be well known to those skilled in the art.
  • the invention also extends to vectors comprising the nucleic acid molecules encoding the polypeptide with Fc binding ability described above and host cells expressing the nucleic acid molecules. Suitable vectors and host cells will be well known to tho ⁇ e skilled in the art. In a preferred from the invention relates to the cDNA constructs and host cells containing them described in the Examples.
  • the invention also relate ⁇ to a method of producing the polypeptid ⁇ s of the invention by recombinant means.
  • the method comprises causing the nucleic acid molecule of the invention to be expressed and isolating or purifying the polypeptide to at least some degree.
  • the nucleic acid molecule will be present on a suitable vector or integrated into a host genome.
  • Suitable hosts, vectors and purification methods will be known to those skilled in the art. However for the purposes of illustration only, some discussion of hosts and vectors is given below.
  • Suitable prokaryotic hosts include but not are limited to Escherichia, Streptomyces, Bacillus and the like.
  • Suitable eukaryotic host include but are not limited to yeast, such a ⁇ Pichia and Saccharomyces and animal cells in culture ⁇ uch a ⁇ VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, BHK, COS, MDCK, NS1, J558 and insect cell lines.
  • yeast such a ⁇ Pichia and Saccharomyces and animal cells in culture ⁇ uch a ⁇ VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, BHK, COS, MDCK, NS1, J558 and insect cell lines.
  • yeast such as a ⁇ Pichia and Saccharomyces and animal cells in culture ⁇ uch a ⁇ VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, BHK, COS, MDCK,
  • the DNA may be introduced into an expression vector and that construction u ⁇ ed to transform an appropriate host cell.
  • An expression vector is characterised as having expression control sequences such that when a DNA sequence of interest is operably linked thereto, the vector is capable of directing the production of the product encoded by the DNA ⁇ equence of intere ⁇ t in a host cell containing the vector.
  • the product After the recombinant product is produced it is desirable to recover the product. If the product is exported by the cell producing it, the product can be recovered directly from the cell culture medium. If the product is retained intracellularly, the cells must be physically disrupted by mechanical, chemical or biological means in order to obtain the intracellular product.
  • the purification protocol provides a protein product that is essentially free of other proteins, and eliminates or reduces to acceptable levels other host cell contaminants, such as DNA, RNA, potential pyrogen ⁇ and the like.
  • a commercially available system such as FLAGTM peptide system to allow easy purification.
  • the inherent ig binding property of the polypeptide may be used to affinity purify it or anti-Fc receptor antibodies may be used.
  • a variety of host cells may be u ⁇ ed for the production of the polypeptide of the invention.
  • the choice of a particular host cell is well within the knowledge of the ordinary skilled person taking into account, inter alia, the nature of the receptor, its rate of synthesis, its rate of decay and the characteristics of the recombinant vector directing the expression of the receptor.
  • the choice of the host cell expres ⁇ ion system dictates to a large extent the nature of the cell culture procedures to be employed.
  • the selection of a particular mode of production be it batch or continuous, spinner or air lift, liquid or immobili ⁇ ed can be made once the expression system has been selected. Accordingly, fluidi ⁇ ed bed bioreactors, hollow fibre bioreactors, roller bottle cultures, or stirred tank bioreactors, with or without cell microcarrier may variously be employed. The criteria for ⁇ uch selection are appreciated in the cell culture art.
  • the invention in another embodiment relates to a method of determining the presence of and/or amount of Immunoglobulin in a sample said method comprising contacting said sample with the polypeptide of the present invention, or an Fc receptor or a part thereof, for a time and under conditions sufficient to allow the polypeptide or Fc receptor or part thereof and any immunoglobulin present in said ⁇ ample to bind and detecting the presence of and/or determining the amount of ⁇ aid bound polypeptide- immunoglobulin, Fc receptor-immunoglobulin or part Fc receptor-iim ⁇ unoglobin.
  • the ⁇ ample may be from any source where it is desired to determine the pre ⁇ ence of immunoglobulin.
  • Samples from body fluids and ⁇ ecretions ⁇ uch a ⁇ blood, ⁇ aliva, sweat, semen, vaginal secretions may be u ⁇ ed.
  • Solid tis ⁇ ue samples such as biop ⁇ y ⁇ pecimen ⁇ from kidneys, etc, are al ⁇ o contemplated.
  • an Fc receptor refers to any native or non-native Fc receptor or a portion thereof whether derived from natural sources or by recombinant means.
  • the Fc receptor i ⁇ at least partly purified.
  • Detection of the bound polypeptide or Fc receptor can be determined by any convenient means.
  • Prestion of immunoglobulin is detected by a reporter molecule.
  • the bound antibody-receptor may be detected by an anti-polypeptide labelled with a label, reporter molecule anti-Ig or other detectable signal. Determination of the amount of immunoglobulin may be made by comparison to a standard curve obtained using known quantities of Ig under identical conditions.
  • polypeptide of the pre ⁇ ent invention or Fc receptor may be soluble or bound to a solid support ⁇ uch a ⁇ nitrocellulose, paper, matrices or resins which will be known to those skilled in the art.
  • kits for detecting immunoglobulin including immune complexes in a ⁇ ample, ⁇ aid kit comprising in compartmentalised form a fir ⁇ t compartment adapted to receive the polypeptide of the invention or an Fc receptor and at least one other compartment adapted to contain a detector means.
  • detector means refers to means for detecting i ⁇ nminoglobulin bound to Fc receptor-like molecule and includes the appropriate substrates, buffers, etc required for detection of the bound immunoglobulin- receptor.
  • the polypeptide of the invention in the form of an Fc receptor-like molecule with enhanced ability to bind immunoglobulin of the present invention provides a useful laboratory reagent.
  • the Fc receptor-like molecule including one with enhanced Ig binding ability may be used in immunoprecipitation as a replacement for protein A, for example, which does not exhibit a selective binding ability.
  • the present invention provides a method of detecting immune complex in a ⁇ ample comprising contacting ⁇ aid ⁇ ample with the polypeptide of the invention or an Fc receptor specific for IgG for a time and under conditions sufficient for any complex present in the sample and the polypeptide or Fc receptor to form a further complex and detecting ⁇ aid further complex.
  • the above method utilises the ability of the polypeptide of the invention and the Fc receptor for IgG to bind complexes as they do not recognise monomeric IgG. Further the use of the Fc receptor-like molecule with enhanced activity provides a more ⁇ en ⁇ itive a ⁇ ay a ⁇ it will detect lower level ⁇ of complex in the ⁇ ample and also be selective for the same.
  • the above method may be a useful tool in diagnosis of di ⁇ ea ⁇ e ⁇ where immune complexes are implicated such as, for example, glomerulonephritis, lupus, arthritis, heparin induced thrombocytopoenia thrombosis syndrome (HITTS), Gullien-Bare syndrome or idiopathic thrombocytopoenia pupuera (ITP) .
  • immune complexes such as, for example, glomerulonephritis, lupus, arthritis, heparin induced thrombocytopoenia thrombosis syndrome (HITTS), Gullien-Bare syndrome or idiopathic thrombocytopoenia pupuera (ITP) .
  • a method of removing immunoglobulin from a ⁇ ample comprising contacting said sample with the polypeptide of the invention or an Fc receptor for a time and under conditions suitable for any immunoglobulin in the sample to form a complex with said polypeptide or Fc receptor and separating said complex from the remainder of the sample.
  • the sample used in the method may be any sample such a ⁇ that de ⁇ cribed above or may be a ⁇ ample continuously taken from a patient ⁇ uch a ⁇ blood or plasma which is withdrawn, treated by the method and then returned to the patient as part of a closed sy ⁇ tem.
  • the polypeptide or Fc receptor used is specific for IgG and/or IgA. It has been noticed by the present inventors that Fc ⁇ RH described herein is able to bind IgA. Thus, use of Fc ⁇ RH would be particularly advantageous in the treatment of diseases involving immune complexes of IgG and/or IgA such as IgA nephropathies.
  • the method is directed at removing immune complex existing in the sample and the polypeptide used i ⁇ capable of binding immune complexes containing IgG or IgA.
  • Separation of the complex may be achieved by any convenient means such as by standard haemoperfusion or plasmaphore ⁇ i ⁇ technologies but utilising a device containing the polypeptide of the pre ⁇ ent invention or a Fc receptor or a portion thereof bound to a solid support.
  • Such a solid support includes silica, ⁇ ephoro ⁇ eTM, agarose, cellulo ⁇ e membranes, etc.
  • a device would preferably comprise a container enclosing the polypeptide or receptor or part thereof attached to a support, an inlet through which the ⁇ ample can flow in and an outlet through which the ⁇ ample can be returned to the patient.
  • the pre ⁇ ent invention relate ⁇ to a method of removing immunoglobulin from a body fluid comprising taking body fluid from a patient, contacting the body fluid with the polypeptide of the invention or an Fc receptor, for a time and under conditions sufficient to allow the polypeptide to bind said immunoglobulin, removing ⁇ aid bound immunoglobulin from the body fluid and replacing ⁇ aid body fluid in the patient.
  • the method involves removal of immune complex. This may be used in the treatment of diseases where it is desirable to remove immune complex such as in lupus, IPT, HITTS, rheumatoid arthritis or after infection in a glomerulonephriti ⁇ patient. More preferably the method i ⁇ u ⁇ ed in pla ⁇ maphore ⁇ i ⁇ in the treatment of immune complex diseases. Even more preferably the method utilised an Fc receptor ⁇ like molecule with enhanced ability to bind IgG.
  • the Fc receptor-like molecule is bound to a solid support such as a membrane when used in plasmaphore ⁇ i ⁇ .
  • a solid support such as a membrane when used in plasmaphore ⁇ i ⁇ .
  • Any suitable support could be used ⁇ uch a ⁇ silica, agarose, ⁇ epharo ⁇ eTM or cellulose derivatives and will be known to tho ⁇ e skilled in the art.
  • the present invention relate ⁇ to a method of treatment of disease where the disease involves immune complexes or antigen-antibody interactions, ⁇ aid method comprising administering an effective amount of the polypeptide of the invention, an Fc receptor or an antagoni ⁇ t compound of the invention to a subject.
  • the subject may be a human or animal, preferably a mammal.
  • the polypeptide with an increased serum half life is used in the method of the invention. More preferably this polypeptide comprises the Fc receptor ⁇ like molecule with enhanced immunoglobulin binding ability is used in the method. In some di ⁇ ea ⁇ e ⁇ however an Fc receptor-like molecule with reduced immunoglobulin, or differential immunoglobulin binding ability may be indicated ⁇ uch a ⁇ where it i ⁇ desirable bind one form of immunoglobulin and not another. For example, an Fc receptor-like molecule with altered IgG binding ability such that it binds complexes and not monomers may be useful.
  • the polypeptides used in the method are soluble. More preferably they are administered in a pharmaceutical composition.
  • the polypeptide of the invention optionally comprising the Fc receptor-like molecule ⁇ with enhanced IgG binding ability may be u ⁇ ed in the treatment of diseases where an excess of immunoglobulin is implicated as a causative agent of the inflammation or disea ⁇ e such as immune complex diseases, glomerulonephritis, lupus, rheumatoid arthritis, diseases involving inappropriate production of IgG after infection, heparin induced thrombocytopoenia thrombosis syndrome (HITTS) hyperacute graft rejection and idiopathic thrombocytopoenia pupuera (ITP) .
  • HITTS heparin induced thrombocytopoenia thrombosis syndrome
  • ITP idiopathic thrombocytopoenia pupuera
  • polypeptides of the pre ⁇ ent invention, Fc receptor-like molecule ⁇ with enhanced IgG binding ability may be u ⁇ ed in the treatment of any di ⁇ ea ⁇ e involving IgE, where IgE i ⁇ one of the causative agents of disease.
  • diseases include asthma, allergy and eczema.
  • Such a method comprises administering an effective amount of the polypeptide of the invention, or an Fc receptor, to a patient.
  • the polypeptide of the invention particularly a soluble one comprising IgE specific Fc receptor-like molecule with enhanced activity according to the invention will be particularly useful as a competitive inhibitor of IgE binding when admini ⁇ tered to a subject.
  • the polypeptide will function in two ways. First, it will absorb unbound IgE and ⁇ econd it will di ⁇ place already bound IgE or prevent rebinding of IgE by virtue of its strong affinity for IgE. In this way the action of IgE in an asthma attack or allergic reaction such a ⁇ in food allegy or bee sting may be reduced or alleviated.
  • soluble IgG specific polypeptide of the invention Similar comments apply to a soluble IgG specific polypeptide of the invention. It is envi ⁇ aged that particularly a soluble IgG specific Fc receptor-like molecule with enhanced activity according to the invention will be useful as a competitive inhibitor of IgG binding when admini ⁇ tered to patient ⁇ . Fir ⁇ t it will absorb to immune complexes aggregates or IgG which will prevent binding to cell surface F e ⁇ R, e.g. F c ⁇ RI, F e ⁇ RII, F c ⁇ RIII which will prevent or reduce activation of inflammation.
  • F e ⁇ R e.g. F c ⁇ RI, F e ⁇ RII, F c ⁇ RIII which will prevent or reduce activation of inflammation.
  • irasune complex induced inflammation e.g. in rheumatoid arthritis, Good pastures syndrome, hyperacute graft rejection or lupus will be reduced or alleviated.
  • FC ⁇ RII/Fc ⁇ RIa chain or mutant FC ⁇ RII cDNAs were constructed by Splice Overlap Extension (SOE) PCR (27) using the FC ⁇ RIIa"* cDNA (7) as template.
  • SOE PCR was performed as follows: Two PCR reactions were used to amplify the FC ⁇ RII-Fc ⁇ RI or FC ⁇ RII fragments to be spliced together.
  • the reactions were performed on lOOng of the FC ⁇ RIIaNR cDNA in the presence of 500ng of each oligonucleotide primer, 1.25nM dNTPs, 50nM KC1, lOmM Tris- Cl pH 8.3 and 1.5nM MgCl 2 using 2.5 units of Taq polymerase (Amplitaq, Cetus) for 25 amplification cycles.
  • a third PCR reaction was performed to splice the two fragments and amplify the spliced product.
  • lOOng of each fragment purified by size fractionation through an agarose gel (28) was used with the appropriate oligonucleotide primers under the above PCR conditions.
  • the chimeric FC ⁇ RII/Fc e RI a chain receptors were generated as follows.
  • Chimera g, el09-116 oligonucleotide pair ⁇ (NRl + CHM10) and (CHM09 + EG5) were u ⁇ ed to produce two fragments which were spliced together using oligonucleotides NRl and EG5.
  • Chimera g, el30-135 oligonucleotide pair ⁇ (NRl + PM12) and (PM11 + EG5) followed NRl and BG5.
  • the sequence of the oligonucleotide u ⁇ ed and their positions of hybridisation with the FC ⁇ RIIaNR cDNA are:
  • FC ⁇ RII Alanine point mutant cDNAs were generated using the following oligonucleotide combinations.
  • Oligonucleotide NRl and EG5 were u ⁇ ed to splice together the two component fragments of each mutant to produce the point substituted cDNAs.
  • the ⁇ equence of the oligonucleotides used and their positions of hybridisation with the FC ⁇ RIIaNR cDNA are: NRl and EG5 as de ⁇ cribed above;
  • GBCOl 5'-GAAGGACAAGGCTCTGGTCAAG-3', (nucleotide position 443-464); GBC02, 5'-CTTGACCAGAGCCTTGTCCTTC-3', (443-464)
  • GBC03 5'-CT ⁇ GAAGGACGCTCCTCT ⁇ TC-3', (440-461)
  • GBC04 5'-GACCAGAGGAGCGTCCTTCCAG-3', (440-461)
  • GBC06 5'-GACCTTGAC ⁇ CAGGCTTGTCC-3', (446-467)
  • GBC07 5'-GACAAGCCTCTGGCTAAGGTCAC-3', (447-469);
  • GBC08 5'-GTGACCTTAGCCAGAGGCTTGTC-3', (447-469);
  • GCE02 5'-CCAAACGGGAAGCTTTCTG ⁇ -3', (490-611);
  • GCE03 5'-CAGAAATTCGCTCGTTT ⁇ TC-3', (492-614)
  • GCE04 5'-GATCCAAACGAGCGAATTTCTG-3', (492-614)
  • GCE05 5'-GAAATTCTCCGCTTTGGATCCC-3', (494-616)
  • GCE06 5'-GGGATCCAAAGCGGAGAATTTC-3', (494-616)
  • GCE08 5'-G ⁇ TG ⁇ GATCAGCACGGGA ⁇ AAT-3', (497-619)
  • GCE09 5'-CTCCCGTTTGGCTCCCACCTTC-3', (500-622)
  • GCE10 5'-GAAGGTGGGAGCCAAACGGGA ⁇ -3', (500-622)
  • GCE11 5'-CCGTTTGGATGCTACCTTCTCC-3', (503-625)
  • GCE12 5'-GGAGAAGGTAGCATCCAAACGG-3', (503-625).
  • the Ala codon or it ⁇ complement are shown in bold type.
  • Chimeric and mutant receptor cDNA expression constructs were produced by subcloning the cDNAs into the eukaryotic expression vector pKC3 (29) .
  • Each cDNA was engineered in the PCR reactions to have an EcoRI site at their 5' end (the 5'-flanking oligonucleotide primer NRl containing an EcoRI recognition site), and a Sail site at their 3' end (the 3'-flanking oligonucleotide primer EG5, containing a Sail recognition site), which enabled the cDNAs to be cloned into the EcoRI and Sail sites of pKC3.
  • the nucleotide sequence integrities of the chimeric cDNAs were determined by dideoxynucleotide chain-termination sequencing (30) using SequenaseTM (United States
  • Transfection ⁇ -COS-7 cells (30-50% confluent per 5cm 2 Petri-dish) were transiently transfected with FcR cDNA expression constructs by the DEAE-dextran method (32).
  • Cells were incubated with a transfaction mixture (lml/5cm2 dish) consisting of 5-10mg/ml DNA, 0.4mg/ml DEAE-dextran (Pharmacia, Uppsala, Sweden) and lmM chloroquine (Sigma, St Louis, Mo) in Dulbecco' ⁇ Modified Eagle ⁇ Medium (DME) (Flow Laboratories, Australia) containing 10% (v:v) Nu ⁇ erum (Flow Laboratories, Australia), for 4hr.
  • DME Dulbecco' ⁇ Modified Eagle ⁇ Medium
  • the transfeetion mixture was then removed, cells treated with 10% (v:v) dimethysulphoxide in Phosphate buffered saline (PBS, 7.6mM Na 3 HP0 4 /3.25mM NaH 3 P0 4 /145mN NaCl) pH7.4 for 2 min, washed and returned to fully ⁇ upplemented culture medium for 48-72 hr before use in assays.
  • PBS Phosphate buffered saline
  • COS-7 cells were maintained in DME supplemented with 10% (v:v) heat inactivated foetal calf serum, lOOU/ml penicillin, lOOmg/ml streptomycin, 2mM glutamine (Commonwealth Serum Laboratories, Australia) and 0.05mM-2-mercaptoethanol (2mE) (Kock Light Ltd., UK).
  • Monoclonal antibodies and Ig reagents The anti- FC ⁇ RII m ⁇ b 8.2 wa ⁇ produced in this laboratory (19) .
  • the mouse IgE anti-TNP m ⁇ b (TIB142) wa ⁇ produced from a hybridoma cell line obtained from the American Type Culture Collection (Rockville, Ma) ; the mouse IgGl anti-TNP m ⁇ b (A3) wa ⁇ produced from a hybridoma cell line which wa ⁇ a gift of Dr A Lopez (33) .
  • Human IgGl myeloma protein wa ⁇ purified from the ⁇ erum of a myeloma patient a ⁇ de ⁇ cribed (34) .
  • Human IgGl oligomers were prepared by chemical cros ⁇ linking using S-acetylmercapto ⁇ uccinic anhydride (SAMSA) (Sigma, St Louie, Mo) and N-Succinimidly 3-(2- pyridyldithio) propionate (SPDP) (Pierce Chemical Company, Rockford, IL) a ⁇ follows: hlgGl myeloma protein (5mg at lOmg/ml) in phosphate buffer (0.01M sodium phosphate pH 7.5/0.15M NaCl) was treated with a 5-fold molar excess of SPDP in dioxine, for 30 min.
  • SAMSA S-acetylmercapto ⁇ uccinic anhydride
  • SPDP N-Succinimidly 3-(2- pyridyldithio) propionate
  • Erythrocyte-Antibody resetting - COS-7 cell monolayers transfected with FcR expression constructs were incubated with EA complexes, prepared by coating sheep-red blood cells (SRBC) with trinitrobenzene ⁇ ulphonate (TNBS) (Fluka Chemika, Switzerland) and then sensitising these cells with mouse IgGl or IgE anti-TNBS mAb (36).
  • EA complexes prepared by coating sheep-red blood cells (SRBC) with trinitrobenzene ⁇ ulphonate (TNBS) (Fluka Chemika, Switzerland) and then sensitising these cells with mouse IgGl or IgE anti-TNBS mAb (36).
  • SRBC sheep-red blood cells
  • TNBS trinitrobenzene ⁇ ulphonate
  • IgGl or IgE anti-TNBS mAb mouse IgGl or IgE anti-TNBS mAb
  • Direct binding of dimeric-hlg ⁇ l or dimeric-mlgGl - COS-7 cells transfected with FcR expression constructs were harvested, washed in PBS/0.5% BSA and re ⁇ u ⁇ pended at 107/ml in L-15 medium/0.5% BSA. 50ml of cells were incubated with 50ml serial dilutions of 125 I-dimeric-hlgGl for 120 min at 4°C. 125 I-dimeric-Ig was prepared by the chloramine-T method a ⁇ de ⁇ cribed (37) and shown to compete equally with unlabelled dimeric-Ig in binding to Fc receptor expressing COS-7 cells.
  • Cell bound 125 I-dimeric- Ig ⁇ l was determined following centrifugation of cells through a 3:2 (v:v) mixture of dibutylphthalate and dioctylphthalate oil ⁇ (Fluka Chemika, Switzerland) and cell bound 125 I-dimer determined.
  • Non-specific dimer binding was determined by assaying on mock transfected cells and subtracted from total binding to give specific dimeric-IgGl bound.
  • Levels of cell surface FC ⁇ RII expression were determined using the anti-FC ⁇ RII mAb 8.2, shown to bind distantly to the binding site (19), and u ⁇ ed to correct for variable cell surface receptor expression between the mutant FC ⁇ RII COS-7 cell transfectant ⁇ . The binding of 8.2 was determined in a direct binding assay as described for the human IgGl-dimer binding assays.
  • chimeric receptors were generated whereby each of these regions in FC ⁇ RII were replaced with the equivalent regions of the human Fc ⁇ RI a chain.
  • Chimeric receptor cDNAs were constructed by SOE PCR, subcloned into the eukaryotic expression vector pKC3 and transiently transfected into COS-7 cells.
  • the IgG binding capacities of the chimeric receptors were determined by both EA rosetting and the direct binding of dimeric hlgGl.
  • FC ⁇ RII domain 1 The substitution of FC ⁇ RII domain 1 with that of the Fc ⁇ RI a chain produced a receptor (designated Dl ⁇ D2 ⁇ ) which a ⁇ expected retained the capacity to bind the highly sensitised IgG-EA complexes (Fig. la), however in contrast to the wild-type receptor did not bind dimeric-hlgGl (Fig. 2) .
  • the resultant expre ⁇ sion constructs were transiently transfected into COS-7 cells and the Ig binding capacity of the mutant receptors determined by assessing the binding of dimeric hlgGl.
  • the levels of cell membrane expression of the mutants on the COS-7 cell transfectant ⁇ were determined u ⁇ ing the anti-FC ⁇ RII mAb 8.2 (shown to detect an epitope distant to the binding site) and were comparable to the of the wild-type receptor ( ⁇ ee legend Fig. 3) .
  • the relative capacity of the mutant receptor ⁇ to bind hlg ⁇ l were determined u ⁇ ing the direct binding assay following correction for variation in cell surface expression levels, and expressed a ⁇ percentage of wild-type FC ⁇ RII binding.
  • the molecular model of the entire F c ⁇ RII shows that the regions involved in Ig binding are located on the ⁇ ame face of domain 2 and at the interface between domains 1 and 2. Furthermore, this also indicates that the A/B and E/F loops of domain 1 a ⁇ well a ⁇ the strand connecting domains 1 and 2 ( ⁇ /A strand) are located in the ⁇ ame region (int ⁇ rdomain interface) and contribute to the binding area of the domain. Thi ⁇ area forms a hydrophobic pocket and development of receptor antagoni ⁇ t ⁇ would be targeted at thi ⁇ region.
  • domain 1 of hFC ⁇ RII although does not appear to play a direct role in Ig ⁇ binding, does play an important role in the affinity of Ig ⁇ binding by hFC ⁇ RII. This is suggested as replacement of domain 1 of hFC ⁇ RII with domain 1 of hFc c eRI, reduced the capacity to bind IgG, as shown by the failure of this receptor to bind dimeric hlg ⁇ l.
  • the ⁇ e data imply that the Ig ⁇ binding role of domain 1 i ⁇ likely to be an influence on receptor conformation, stabilizing the structure of domain 2 to enable efficient Ig ⁇ binding by hFC ⁇ RII.
  • domain 2 of hFc.RI contains at least 3 regions each capable of directly binding IgE, a ⁇ the introduction of the Fc ⁇ RI region ⁇ encompassed by residue ⁇ Trp* 7 to Lys 12 *, Tyr 129 to Asp 135 and Lys 154 to Gin 141 into the corresponding regions of hFC ⁇ RII wa ⁇ found to impart IgE binding to hFC ⁇ RII (17, 20) .
  • the ⁇ e data sugge ⁇ t at lea ⁇ t 4 region ⁇ of hFc ⁇ RI domain 2 contribute to the binding of IgE, Ser 93 to Phe 104 , Arg 111 to Glu 12S , Tyr 129 to Asp 135 and Lys 154 to He" 1 .
  • Three of the ⁇ e region ⁇ correspond to the 3 regions identified herein a ⁇ important in the binding of Ig ⁇ by FC ⁇ RII, Arg 111 to ⁇ lu 125 , Tyr 129 to A ⁇ p 135 and Lye 154 to He" 1 , which encompass the B-C, C'-E and F- ⁇ loop ⁇ re ⁇ pectively.
  • Oligonucleotide sequences and their positions of hybridization with the Fc ⁇ RII a 1 " 1 cDNA are as follows:
  • CC-02 5'-CT ⁇ ATTTTCCT ⁇ CCT ⁇ AAGAAT ⁇ -3' (467-494)
  • CC-03 5'-CTTCCA ⁇ AAT ⁇ CAAAATCCCA ⁇ AAATTC-3', (473-500)
  • CC-04 5'-GAATTTCTG ⁇ ATTTT ⁇ CATTCT ⁇ AA ⁇ -3', (473-500)
  • CC-05 5' -CCA ⁇ AAT ⁇ A ⁇ CATCCCA ⁇ AAATTC-3', (476-500
  • I 155 , G 156 decrease Ig ⁇ l and Ig ⁇ 2 binding.
  • Mutation of Val 11 * decreases Ig ⁇ l binding only. Mutation of Ser 130 , Leu 132 , Asp 133 , Pro 134 , Tyr 157 reduces Ig ⁇ 2 binding only. Mutation of Thr 1 " and Leu 159 al ⁇ o enhances Ig ⁇ l and IgG2 binding.
  • Ig ⁇ receptor FC ⁇ RII were performed on the IgE receptor, Fc ⁇ RI.
  • the ⁇ e region ⁇ defined by re ⁇ idue ⁇ 112 to 116, 129 to 134 and 154 to 161 are located in the ⁇ econd domain of Fc-RI.
  • Mutation of the Fc ⁇ RI was performed by splice overlap extension on described for the FC ⁇ RII u ⁇ ing the oligonucleotide ⁇ ⁇ hown in Fig. 5.
  • Chimeric receptors were made as described in Example 1. Chimeric receptors were produced which have Domain 2 of the Fc ⁇ RII but have varying components in Domain 1. The terminology is as follows:
  • ⁇ denote ⁇ a receptor with Domain ⁇ 1 & 2 from Fc ⁇ RI and a tran ⁇ membrane region from Fc ⁇ RII. This wa used a ⁇ a control.
  • ⁇ denote ⁇ a receptor with Domain 1 from Fc ⁇ RII,
  • Fc ⁇ Rl CC denotes ⁇ which contains the CC loop from
  • oligonucleotides used to create the above chimeric receptors were as follows :
  • NRl and EG5 are a ⁇ de ⁇ cribed in Example 1.
  • the result ⁇ of the rosetting assay showed that the cells transfected with the CC chimeric construct rosette lees well (data not shown) than the other transfectants.
  • the chimeric receptor ⁇ restores binding to the ⁇ ame level a ⁇ that ⁇ een in the normal receptor ( ⁇ in thi ⁇ case) . This implies that the EF and the ⁇ regions are important in binding in Fc ⁇ RII.
  • Two examples of the genetically engineered polypeptide of the invention are recombinant soluble Fc ⁇ RII (which consists only of the extracellular domains of Fc ⁇ RII) and a fusion protein consisting of human serum albumin genetically fused to the extracellular domain ⁇ of Fc ⁇ RII.
  • the recombinant soluble Fc receptor (rec. sFC ⁇ RII) can be generated using standard mutagenesis techniques including splice overlap extension (SOE) as described earlier.
  • SOE splice overlap extension
  • the Fc ⁇ RIIcDNA or genomic DNA or a combination thereof i ⁇ mutated ⁇ uch that a translation termination codon (e.g. TAA, ⁇ A OR TAG) is inserted into the DNA in a position that will terminate the translation of RNA derived from such mutant DNA to yield proteins containing the Ig binding extracellular region without the tran ⁇ membrane anchoring segment.
  • a molecule was generated by using SOE to introduce the codon, TAG, 3' of the residue 170.
  • This mutated DNA was introduced into several expression systems and a polypeptide with Fc binding ability was obtained.
  • the expression systems included CHO cells, fibroblasts, a yeast ( Pichia pastor is) and bacculovirus.
  • the molecular weight of the rec.sFc ⁇ RII varies according to the expression system, ie. 30 KD from CHO cells or 26 KD from Pichia pastor is .
  • Thi ⁇ is due to differences in glycosylation.
  • Clearly many other expression systems could be used including bacteria, plants and mammals.
  • the second example of a polypeptide of the present invention is a fusion protein which is produced by fusing DNA encoding a polypeptide with Fc binding ability to DNA encoding a different protein to generate a new protein which retains Fc binding ability.
  • Such new protein would include human serum albumin fused to Fc ⁇ RII.
  • This protein can be generated using SOE to fuse the DNA encoding HSA to Fc ⁇ RII. This is done in such a way that the residues near the C terminus of HSA are fused to amino acid residues in the amino terminus of Fc ⁇ RII.
  • Fc ⁇ RII encoding DNA is u ⁇ ed in the fusion protein, it is al ⁇ o possible to use DNA encoding other protein ⁇ ⁇ uch a ⁇ the DNA encoding the Fc receptor-like molecule ⁇ de ⁇ cribed earlier.
  • the HSA:FC ⁇ RII fusion protein was produced according to the following method. Oligonucleotides HT4 an HT7 were used to amplify the HSA DNA. HT4 contains the restriction site (Eco Rl) for cloning and HT7 contain ⁇ a ⁇ equence that overlap ⁇ with Fc ⁇ RII. The sequences are as follows:
  • HT4 5' ATCGATGAATTCAT ⁇ A ⁇ AA ⁇ T ⁇ T ⁇ TAAC 3' HT7 5' ⁇ A ⁇ C/ ⁇ CCTAA ⁇ CA ⁇ CTT ⁇ AC 3'
  • the Eco Rl restriction site is shown in bold in HT4 above. Just adjacent to this i ⁇ the AT ⁇ which i ⁇ the HSA ⁇ tart codon. A slash in the HT7 sequence shown above denotes the Fc ⁇ RII-HSA junction.
  • Oligonucleotides HT8 and HT5 were used to amplify the required segment (extracellular domains) of Fc ⁇ RII.
  • HT8 contain ⁇ a ⁇ equence that overlap ⁇ with the HSA ⁇ equence (and al ⁇ o oligonucleotide HT7).
  • HT5 al ⁇ o contain ⁇ a translation termination codon as well as a re ⁇ triction ⁇ ite (Eco Rl) for cloning purposes.
  • HT5 i ⁇ The Eco Rl site in HT5 i ⁇ denoted by bold type.
  • HT7 and HT5 are anti ⁇ en ⁇ e sequences.
  • the constructs made were used to transform Pichia pastoris cells. Western blots of the proteins expressed were conducted.
  • a Western blot was performed using a polyclonal anti-Fc ⁇ RII antibody.
  • the supernatants from the transformed yeasts were tested with the antibody and the result ⁇ demonstrated that only the supernatants from HSA:Fc ⁇ RII transfected cell ⁇ and the cell tran ⁇ fected with a construct encoding soluble Fc ⁇ RII reacted with the antibody.
  • the controls did not react (re ⁇ ult ⁇ not shown) .
  • the Western blotting detected a protein of approximately 100KD which is of the expected molecular weight being 67KD from HSA plus 30kD from Fc ⁇ RII extracellular domains.
  • a recombinant Fc ⁇ RII of 30kD was al ⁇ o detected by the antibody.
  • the 100KD protein produced bound to immunoglobulin coated beads but not to Fab'2 coated beads indicating that it ha ⁇ specificity for the Fc portion of IgG.
  • sequencing of the SOE produce confirmed the predicted sequence of the fusion protein as shown in Fig. 12.
  • Fc ⁇ R extracellular domains can be attached to additional molecule ⁇ and still retain Fc receptor activity. Since there are a number of Fc receptors closely related to the Fc ⁇ RII, especially in their Ig binding extracellular region ⁇ , it i ⁇ clear that modifications of the type described for Fc ⁇ RII would al ⁇ o be possible for these other Fc receptors such as Fc ⁇ RI, Fc ⁇ Rl, Fc ⁇ RIII and Fc ⁇ RI. This appears to be particularl the case when the receptors mentioned immediately above have essentially the same number of amino acids in the extracellular region ⁇ .
  • Fc ⁇ Rl, Fc ⁇ RII, FccxR and Fc ⁇ RIII all have extracellular region ⁇ that are organised into two di-sulphide bonded domains that are members of the immunoglobulin super family.
  • the ligands for Fc ⁇ RII, Fc ⁇ RHI, Fc ⁇ Rl and Fc ⁇ R are all homologous.
  • the non-Fc binding portion of the fusion protein may be attached to the other species receptors discussed above.
  • the "foreign" component of the fusion protein may be an immunoglobulin provided that the immunogolobulin would be a type unable to bind the Fc binding portion of the fusion peptide.
  • the extracellular portion of Fc ⁇ RII could be attached to IgM o the extracellular portion of Fc ⁇ Rl could be attached to IgG.
  • Other foreign protein components could include ovalbumin, other Fc receptors, compliment, other recombinant derived protein ⁇ including CD46, CD59, DAF, CRI, CR3 and protein ⁇ especially those involved in regulating inflammation including cytokines and complement regulating proteins.
  • the receptor could also be attached t other high molecular weight entities.
  • polypeptides according to the invention via recombinant means it is al ⁇ o possible that polypeptides according to the invention could be generated by other non- recombinant means. This could be achieved by chemical means ⁇ uch a ⁇ attaching the Fc binding portion of the protein to other molecules such as dextrans, lipid ⁇ , and carbohydrates with the proviso that the molecule ⁇ produced retain Fc binding ability.
  • Figure 9 shows that HSA-Fc ⁇ RII i ⁇ specific for immunoglobulin, and that the fusion protein i ⁇ correctly folded ⁇ ince the epitopes detected by the monoclonal antireceptor antibodies are intact.
  • HSA-Fc ⁇ RII binds mouse IgGl (m ⁇ l), Ig ⁇ 2b ( ⁇ 2b) and human Ig ⁇ (HAGG) but it does not bind IgG lacking an Fc portion (1302) .
  • Figure 10a deplete curves showing the clearance of the HSA:Fc ⁇ RII fusion protein from the blood of mice.
  • the animals were injected with either HSA:Fc ⁇ RII fusion protein or soluble Fc ⁇ RII and the disappearance from the circulation measured.
  • the conclusions are that the half life of the receptor Fc ⁇ RII is approximately 40 minutes whilst that of HSA:Fc ⁇ RII is 140 minutes.
  • the HSA:Fc ⁇ RII persists for many hours, eg. 9% of the dose was present after 8 hours and 7% at 24 hours, in contrast, all the soluble Fc ⁇ RII was excreted.
  • the FcR or a mutant or fusion protein thereof is attached to a solid support.
  • the substrate may be silica ⁇ uch a ⁇ in thi ⁇ Example.
  • Human albumin (native) and HSA:Fc ⁇ RII were coupled to ⁇ ilica beads in two separate preparations.
  • the coupling of the protein to produce a reagent in accordance with the pre ⁇ ent invention may be achieved by standard methods.
  • the hydroxyl groups on the silica beads were replaced by amino groups via an exchange reaction with 3-aminopropyltriethyoxysilane (APTS) . This activates the ⁇ ilica beads.
  • APTS 3-aminopropyltriethyoxysilane
  • the protein was mixed with a carbodimide (such as EDC) and added to the activated silica beads.
  • Carboxyl groups on the protein combine with the carbodiimide to form an O-acylisourea derivative which in turn reacts with the amino groups on the ⁇ ilica beads to form an amide with elimination of the urea derivative.
  • the protein and carbodiimide were reacted in the presence of N-hydroxysuccinimide to form a more stable amino- reactive intermediate, ⁇ -mercaptoethanol was added to quench the unreacted carbodiimide.
  • the protein succinimide derivative was then added to the activated ⁇ ilica beads.
  • Table 2 shows that after conjugation of HSA to ⁇ ilica (mea ⁇ ured by the u ⁇ e of tracer labelled HSA in mixture), three wa ⁇ he ⁇ with NaHC0 3 were required to remove non-specifically bound material.
  • Example 7 Each tube 2 ⁇ g of ⁇ ilica matrix conjugated with either l. ⁇ g of the HSA: c ⁇ RII fusion protein or HSA in a volume of 1ml of PBS and 0.5% BSA. Three hundred nanograms of either iodinated HAGG or monomeric IgG was added. Additional controls included tube ⁇ with no ⁇ ilica to determine non-specific depletion. Samples were taken at the indicated time points and the quantity of label HAGG or monomeric Ig remaining in the supernatant after removal of silica beads wa ⁇ determined.
  • HSA:Fc ⁇ RII HSA:Fc ⁇ RII to bind immune complexes as represented by HA ⁇ is illustrated.
  • proteins of the present invention to bind one form of immunoglobulin and not another form has important therapeutic implications.
  • the proteins of the present invention have been found to specifically bind immunoglobulin complex as opposed to monomeric Ig.
  • Table 3 describee the binding of immune complexes in the form of aggregated Ig (HAGG) to the HSA:Fc ⁇ RIla fusion protein but not to HSA on ⁇ ilica.
  • HAG ⁇ The interaction of HAG ⁇ with HSA:Fc ⁇ RII wa ⁇ studied. This i ⁇ shown in Figure 11.
  • the polypeptide ⁇ of the present invention are useful in detecting the presence of immune complexes.
  • the polypeptide ⁇ of the present invention can be u ⁇ ed to detect immune complexes and that certain modifications may be made to optimise the assays.
  • Two approaches are used in the development of the immune complex assays. The first utilises recombinant soluble (rec. ⁇ Fc ⁇ RII) in combination with anti-Fc receptor antibodies. The second approach uses the HSA fusion protein.
  • the assays described in this example use an ELISA format but the principles apply to any format ⁇ uch as chemiluminescence, biosensor, agglutination, etc.
  • Thi ⁇ ⁇ tep i ⁇ performed just prior to a ⁇ ay. Stripwells were decanted prior to as ⁇ ay and wash x2 with PBS/0.2%BSA pH7.4. Wells are blocked by adding 200 ⁇ l PBS/2%BSA pH7.4 then incubated for 30 min at room temperature. Thi ⁇ wa ⁇ decanted and 100 ⁇ l recombinant
  • FcRII wa ⁇ added, l ⁇ g/ml per well. Thi ⁇ wa ⁇ then incubated at 37°C for 30 min. Welle were then washed x4 with PBS/0.2%BSA.
  • Elisa Assay Standard (100 ⁇ l), control or test sample were added per well.
  • a standard curve was prepared by diluting heat aggregated Ig ⁇ in PBS. This was incubated at 37°C for 30 min. then wa ⁇ hed x4 with PBS/0.2%BSA.
  • p-nitrophenyl phosphate substrate (Sigma 104 phosphatase tablets:-2.5mg.ml carbonate buffer) (100 ⁇ l) was added and this was incubated at room temperature in the dark for 30 min. then the reading wa ⁇ taken at OD 405 nm.
  • Sample ⁇ tested for anti-mouse reactivity by substituting mouse IgG2b (Sigma MOPC-141) for 8.26 m ⁇ b.
  • Fig. 13 shows that ELISA plates were coated with rec.sFc ⁇ RII denoted in the figure as rsFc ⁇ RH or with HSA:Fc ⁇ RII fusion protein (denoted in the figure a ⁇ rsHSA- FCR) .
  • ⁇ ggregated immunoglobulin (HAGG) wa ⁇ titrated and bound immunoglobulin detected u ⁇ ing HRP conjugated anti- human Ig.
  • Fig 14 shows Elisa plates were either coated with anti-Fc ⁇ RII antibody 8.2 and then with rec.sFc ⁇ RII (A) or with rec.sFc ⁇ RII (B) .
  • U ⁇ ing either of the above approaches immune complexes can be detected.
  • Clearly variations on the above methods may be used.
  • EXAMPLE 11 Immunophoresis Device & Method ⁇ of U ⁇ e Immune complexes may be removed from the circulation using the polypeptide ⁇ of the pre ⁇ ent invention attached to a ⁇ olid ⁇ upport in a pla ⁇ maphore ⁇ i ⁇ device, for example. Attachment of ⁇ uch polypeptide ⁇ to a ⁇ olid ⁇ upport ⁇ uch a ⁇ ⁇ ilica wa ⁇ discussed earlier in respect of HSA:Fc ⁇ RII.
  • HSA:Fc ⁇ RII protein is functional the following tests were conducted. It has been demonstrated that immune complexes (in the form of HAGG) bind to HSA:FcRII and not to HSA or HSA: ⁇ ilica. See
  • Figures 11, 14, 15 and 16 demonstrate ⁇ that 1 5 I labelled HAGG (A) or monomeric Ig (B) was incubated with HSA:Fc ⁇ RII- ⁇ ilica or HSA ⁇ ilica for up to 20 hour ⁇ at room temperature. Sample ⁇ were removed at various time points and HAGG or Ig remaining after removal of the silica complexes wa ⁇ determined.
  • Figure 15 shows immune complexes are depleted from liquid by incubation with HSA:Fc ⁇ RII protein-silica resin but not by HSA- ⁇ ilica resin.
  • monomeric immunoglobulin does not bind to HSA-Fc ⁇ RII.
  • thi ⁇ connection ⁇ ee Fig 16 in which monomeric radio-labelled immunoglobulin does not bind to HSA-Fc ⁇ RII silica or to HSA- ⁇ ilica.
  • Fc Receptors A cell free system has been devised to detect the presence of compounds that inhibit the activity of Fc receptors.
  • Fc ⁇ RII is exemplified but the strategy is equally applicable to other Fc receptors.
  • the principle of the invention i ⁇ to use known or unknown compounds to attempt to inhibit the binding of polypeptide ⁇ with Fc binding ability to immune complexes.
  • the polypeptides of the pre ⁇ ent invention may be labelled directly or indirectly.
  • the ⁇ e polypeptides may be rec.sFc ⁇ RII or HSA:FcRII.
  • an ELISA assay is used wherein iim ⁇ une complexes are attached to a surface under standard incubation conditions.
  • Polypeptides of the invention are directly labelled with a reporting enzyme, horseradish peroxidase (HRP) and mixed with the putative antagoni ⁇ t ⁇ .
  • HRP-sub ⁇ trate horseradish peroxidase
  • any reporting substance could be used, eg. radioiodine, other enzymes ⁇ uch a ⁇ alkaline pho ⁇ phata ⁇ e, bead ⁇ or erythrocyte to which the receptor had been attached, flurogenic substances, etc.
  • HRP is attached to HSA-Fc ⁇ RII.
  • Our result ⁇ indicated that when HRP i ⁇ u ⁇ ed as a label it is necessary to employ a spacer in order to preserve Fc binding ability.
  • polypeptide of the invention is added to a mixture of putative inhibitors and the mixture is then added to the i ⁇ rmune complexes which are attached to a surface. Following an incubation period the surface i ⁇ wa ⁇ hed and any Fc receptor that i ⁇ bound i ⁇ detected u ⁇ ing anti- receptor antibody. Any antagonists of the Fc binding ability of the polypeptides inhibit the binding to immune complexes and reduce potential signal.
  • HAGG plates were prepared by incubating 50 ⁇ l-well HAG ⁇ at 25 ⁇ g/ml in coating buffer (0.5M carbonate/bicarbonate, pH9.6), for 16 hours at 37°. Some wells contained no HAAG as a negative control. To prevent non-specific binding to the surface, the well ⁇ of the plate ⁇ were treated with mPBS containing 1% (w/v) bovine ⁇ erum albumin at 3 hour ⁇ at 37°. The well ⁇ were then rinsed three times by immer ⁇ ion in mPBS. Sample ⁇ containing ⁇ oluble Fc ⁇ RII were diluted a ⁇ required and added in a volume of 30 ⁇ l.
  • HAGG plate ⁇ were prepared by incubating 50 ⁇ l/well at 25 ⁇ g/ml in coating buffer for 16 hour ⁇ at 37°C. A negative control containing no HAAG wa ⁇ al ⁇ o prepared. To prevent non-specific binding to the ⁇ urface, the well ⁇ of the plate ⁇ were treated with mPBS containing .5% (w/v) Tween 20 (for library screening) or 1% (w/v) bovine serum albumin for 3 hours at 37°C.
  • the polypeptide ⁇ may be specific for other classes of immunoglobulin ⁇ uch a ⁇ IgE or IgA.
  • the HRP-HSA:Fc ⁇ RII i ⁇ mixed with the compounds and the effect on binding to HAG ⁇ (or any immune complex) is determined a ⁇ described directly above. Inhibition of binding i ⁇ indicated by decreased absorbence compared to the control (no inhibitor) .
  • the result ⁇ of ⁇ uch an experiment are given in Fig 19. This shows a di-peptoid library which was screened as de ⁇ cribed above. As an example of the type of results obtained, the maximum binding is indicated by an absorbance (at 540 nm) of .619 units.
  • the ⁇ e functional a ⁇ ay ⁇ can be u ⁇ ed to ⁇ creen for inhibitors of Fc receptor function either by binding to the Fc receptor or by binding to the immune complex (IgA, IgE, IgG, IgM, IgD) at the site where the Fc receptors bind.
  • Thi ⁇ ⁇ econd type of antagoni ⁇ t does not fit the classical definition of an antagonist of Fc receptor function, however, it i ⁇ still within the scope of the present invention in as far as the pre ⁇ ent invention relate ⁇ to a method of testing compounds for their ability to inhibit Fc receptor function and to the antagonists per ⁇ e identified by ⁇ uch a method.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention generally relates to molecules having Fc binding ability such as those with Fc receptor-like activity. The present invention also relates to the molecules, nucleic acids encoding the molecules, antagonist compounds, pharmaceutical compositions comprising the molecules and compounds, methods for testing potential antagonists, methods for producing the polypeptides, methods of treatment of disease and other aspects.

Description

POLYPEPTIDES WITH Fc BINDING ABILITY
Field of Invention
The present invention generally relates to molecules having Fc binding ability such as those with Fc receptor-like activity. The present invention also relates to the molecules, nucleic acids encoding the molecules, antagonist compounds, pharmaceutical compositions comprising the molecules and compounds, methods for testing potential antagonists, methods for producing the polypeptideβ, methods of treatment of disease and other aspects.
Background of the Invention
Cell surface receptors for the Fc portion of IgG (FCγR) are expressed on most hematopoietic cells, and through the binding of IgG play a key role in homeostasis of the immune system and host protection against infection. By way of example FCγRII is a low affinity receptor for IgG that essentially binds only IgG iπtmune complexes and Igλ immune complexes and is expressed on a diverse range of cells such as monocytes, macrophageβ, neutrophils, eosinophils, platelets and B cells (1-3) . FCγRII is involved in a number of immune responses including antibody-dependent cell-mediated cytotoxicity, clearance of immune complexes, release of inflammatory mediators and regulation of antibody production (1-6).
Similarly Fc receptors for other classes of immunoglobulin also occur. For example the Fc receptor for IgE is present on mast cells, basophilβ and Langerhans cells. Both the IgG and the IgE Fc receptors contain an extracellular Ig-interactive region which comprises two Ig- like disulphide bonded extracellular domains of the C2 set (7-11) . These receptors are structurally conserved in all the Ig-superfamily leukocyte FcR (including FCγRI, FCγRIII, FcεRI and FcαRI) and presumably represents an Ig- interactive motif (12-16) . In previous studies the inventors identified the IgG binding region of human FCγRII (17, 18) . Chimeric FCγRII/FceRI α chain receptors were used to demonstrate that the second extracellular domain of Fc^RII was responsible for the binding of IgG, with a direct binding region located between residues λsn154 to Serlsl. Molecular modelling of FCγ II domain 2 predicted a structure comprising 7 β strands (λ, B, C, C, E, F, G) forming two antiparallel β sheets (containing the λCFG and BC'E strands respectively), stabilised by a disulphide bond between strands B and F and a core of hydrophobic residues (20) . The λsn154 to Ser161 binding region was shown to encompass an exposed loop region (the F-G loop) at the interface of domains 1 and 2.
In work leading up to the present invention, the inventors surprisingly discovered that alteration of amino acid residues in the Fc receptors lead to altered affinities for iirnminoglobulin.
Summary of the Invention
The invention relates to a polypeptide with Fc binding ability wherein the polypeptide is altered compared to a native Fc receptor by addition, deletion or substitution of one or more amino acids compared to said native Fc receptor.
The invention also relates to a method of testing compounds for their ability to act as an Fc receptor antagonist, to the antagonist compounds identified by the method, to nucleic acid molecules encoding the polype tides of the invention and to methods of making the nucleic acid molecules. In addition the invention relates to methods of detecting immunoglobulin, methods of removing immunoglobulin, methods of treatment and pharmaceutical compositions involving the peptides of the invention or their antagonists. Brief Description of the Figures
Figure 1. IgG complex binding of chimeric Fc receptors. COS-7 cell monolayers were transfected with chimeric cDNA constructs: DlεD2γ (a), γl09-116ε (b), γl30- 135ε (c), or FcεRI (d) . The binding of IgG immune complexes was assessed directly on the monolayers by EA resetting using mouse IgGl sensitised erythrocytes.
Figure 2. Human IgGl-dimer binding of chimeric Fc receptors. Radiolabelled dimeric human IgGl was titrated on COS-7 cells transfected with wild-type FCγRIIa
(I) or chimeric receptor cDNAs; DlεD2γ (D), γl09-116ε (f), γl30-135ε (0) . All of the chimeras were expressed on the cell surface as determined by EA rosetting outlined in Figure 1.
Figure 3. Human IgGl-dimer binding by FCγRIIa alanine point mutants. Radiolabelled dimeric human IgGl was titrated on COS-7 cells transfected with wild-type Fc-RIIa or Fc^IIa containing alanine point mutations, (A) B-C loop mutants, Lys113-Ala (D) , Pro114-Ala (A), Leu115-Ala (t), Val"*-Ala (0), (B) C'-E loop mutants, Phe12'-Ala (+), Ser"°- Ala (0), Arg/His131-Ala (♦), Leu13a-Ala (X), Asp133-Ala (FB), Pro134-Ala (Λ) . Comparison of the levels of human IgGl dimer binding to FCγRII mutants relative to wild-type FCγRIIa, (C) B-C loop mutants, (D) C'-E loop mutants. The binding of wild-type FCγRIIa taken as 100% and mock transfected cells as 0% binding. Results are expressed as + S.E. To control for variable receptor expression between the mutant Fc^RlI COS-7 cell transfeetants, levels of expression were determined using a radiolabelled monoclonal anti-FCγRII antibody 8.2, and dimer binding normalised to that seen for wild-type FCγRII. Typical levels of 8.2 binding in cpm + S.E : WT FCγRII 95279; Lys113-Ala 71660; Val114-Ala 61636; Leu115-Ala 44696; Pro116-Ala; Phe"'-Ala 74707; Ser130-Ala 139802; Arg/His131-Ala 140475; Leu13a-Ala 121096; Asp"3-Ala 100149; Pro13-Ala 172047. Figure 4. Molecular model of the extracellular Ig interactive region of FCγRII putatively involved in the interaction with IgGl. The position of the loops and G/A strand from domains 1 and 2 are indicated. Examples of amino acids, mutations of which alter Fc receptor function such as Phe1S0 and Gly1" are also shown.
Figure 5. Oligonucleotides used in SOE-PCR of Example 2.
Figure . Histogram showing the effect of mutations on Ig receptor binding immunoglobulin.
Figure 7. Histogram showing a comparison of Fc receptor mutants binding IgG! and IgG-.
Figure 8. Graph showing efficiency with which chimeric receptors bind IgE, εεγ ( ), γεγ ( ), CC ( ), EF ( ) and GC ( ).
Figure 9. Photograph of SDS-PAGE showing specificity of the fusion protein, (HSA.FcγRll) for mouse Igβ2a (γ2a) Igβ2b (γ2b) and HAββ but not for Fab'2 fragments (1302). Shows epitopes present in the fusion protein as detected b four different anti-FcγRII antibodies (8.2, 8.26, IV-3 & 8.7). The fusion protein was radiolabelled with I125 and precipitated using Ig or antibodies shown then subjected to SDS-PAGE after reduction.
Figure 10a. Graph showing the clearance of HSA:FcγRIl (-E3- ) and FcγRII (— —) in the blood.
Figure 10b. Graph showing failure of HSA.FcγRll to accumulate in the urine affinities.
Figure 11. Graph showing the binding affinities of HAGG to HSA.FcγRIl-silica (t) and HSA.βilica (0). HAGG did not bind HSA:silica. Figure 12. Nucleotide and predicted amino acid sequence of HSA: FcγRII DNA.
Figure 13. Graphs showing results of ELISA studies on the ability of the fusion protein, rsHSA-FcR (—φ— ) to bind immune complexes. The recombinant receptor rsFcR is denoted by (—■■—) .
Figure 14a. ELISA studies of serum from a patient with rheumatoid arthritis. Plates were coated with anti-FCγRII antibody and then with rec.sFCrRII.
Figure 14b. Shows results of plates coated with rec.sFcyRII.
Figure 15. Graph of heat depleted HAGG using FcτRII- HSA silica (§) . This shows that inrmune complexes are depleted from liquid by incubation with HSA.FcγRll protein silica resin but not by HSA-silica resin (0) no silica is denoted by (I) .
Figure 16. Graph showing no depletion of monomeric iimminoglobulin using FCγRII-HSA silica. This indicates the fusion protein does not bind monomeric Ig.
Figure 17. Titration of rsFCγRII from various sources. The binding of the recombinant protein from various sources is detected by use of anti-FcRII antibody 8.2 followed by anti-mouse Ig labelled with peroxidase. The sources of the recombinant protein are CHO cells (CHO rs FcR) ( —•— ) , bacteria expressing a fusion protein consisting of the extracellular domains of FCγRII fused to maltose binding protein (C2 MBP-rsFcR) ( -0— ), the extracellular domains of FCγRII cleaved from the FCγRII maltose binding fusion protein (C2 rs FcR) (H 1—) ♦ A fusion protein (d2) (-- >-) was used as a control. This contains a single FcR domain and has no functional activity. Figure 18. Graph of inhibition of HRP labelled rβHSA- FcγRII by rheumatoid factors and sera. Titration of patients' sera in the HRP-HSA.FCγRII ELISA assay. Patients' sera (columns 1-14) was titrated on Hagg coated plates prior to addition of the HRP fusion protein conjugate. Titration of normal serum is also shown (column 15) . No inhibition of activity was seen with normal serum but, all sera except column 12 profoundly inhibited Fc receptor binding to Hagg.
Figure 19. Names of various peptiods and absorbences thereof in the test for antagonist compounds.
Detailed Description of Preferred Embodiments
The invention relates to a polypeptide with Fc binding ability wherein the polypeptide is altered compared to a native Fc receptor by addition, deletion or substitution of one or more amino acids such that said alteration results in improved characteristics compared to said nature receptor.
The term "a polypeptide with Fc binding ability" means a polypeptide or protein comprising natural or synthetic amino acids which has an ability to bind the Fc region of immunoglobulin. The immunoglobulin may be of any class such as IgG, IgE, IgA, IgM or igD. The inαsunoglobulin may be derived from any animal such as human, rat, mice, cattle, sheep, goats and other domestic animals, including birds such as chickens, ostriches and emus.
The term "altered compared to a native Fc receptor" means that the polypeptide is different to the native Fc receptor. Such difference may include differences in immunoglobulin binding ability, difference in therapeutic ability , amino acid composition or solubility and the like.
The term "improved characteristics" means that a desirable characteristic compared to the native Fc receptor is achieved. This characteristic may enhance or decrease Fc binding ability, cause increased serum half life of the polypeptide for use as a therapeutic or make the polypeptide detectable. In a first embodiment the present invention relates to a polypeptide with Fc binding ability wherein the polypeptide is an Fc receptor-like molecule with an altered ability to bind iinmunoglobulin wherein said altered ability is brought about by alteration of one or more amino acid residues which affect immunoglobulin binding.
The phrase "Fc receptor-like molecule" means a molecule which is able to bind immunoglobulin to at least some degree. The immunoglobulin may be IgG, IgE, IgA, IgM or IgD. The molecule will usually be a peptide, polypeptide or protein, or made up, at least partially, of amino acids. In its most usual form the molecule will be a peptide composed of a number of amino acid residues linked by peptide bonds. The amino acid components may be natural or synthetic and will be known to those skilled in the art. The phrase "an altered ability to bind iπmrunoglobu1in" means that the molecule has an immunoglobulin binding activity different to that of one or more native Fc receptors. This includes the ability of the molecule to bind one form of immunoglobulin compared to another form of iiUBunoglobulin i.e. where the molecule has an altered ability to bind immune complexes, aggregates, dimeric or monomeric immunoglobulin compared to a native Fc receptor. The activity of the molecule may be increased or decreased compared to a native Fc receptor for a given iimnunoglobulin class.
The phrase "alteration of one or more amino acid residues which affect immunoglobulin binding ability" means that the comparable amino acid residue or region of amino acid residues, implicated in immunoglobulin binding in a native Fc receptor are changed in the Fc receptor-like molecule. The amino acids implicated in iimnunoglobulin binding may function directly in immunoglobulin binding or may be involved indirectly such as by maintaining the structural integrity of the receptor so that binding can occur. The change(s) may be the result of insertion, deletion or substitution. The present inventors have determined that amino acid residues or regions of residues in the first and second domains of the FCγRII receptor and FceRI receptor function in binding of iπrnrnnoglobulin. As the extracellular regions of Fc receptors for iinmunoglobulins are conserved it is expected that similar regions of Fc receptors for other immunoglobulins such as IgA, IgM and IgD will be implicated in immunoglobulin binding and hence be within the ambit of the present invention.
Preferably the Fc receptor-like molecule is in the form of an isolated preparation meaning it has undergone some purification away from other proteins and/or non-proteinaceous molecules. The purity of the preparatio may be represented at least 40% Fc receptor-like molecule, preferably at least 60% Fc receptor-like molecule, more preferably at least 75% Fc receptor-like molecule, even more preferably at least 85% Fc receptor-like molecule and still more preferably at least 95% Fc receptor-like molecule relative to non-Fc receptor-like molecule material as determined by weight, activity, amino acid similarity, antibody reactivity or any other convenient means.
The Fc receptor-like molecule may be bound to a cell membrane or a support means, or be soluble in form. Where a pharmaceutical use is indicated preferably the molecule is soluble for example as a genetically engineered soluble molecule.
Soluble Fc receptor-like molecules can be made by methods such as those of lerino et al J. Exp. Med. (Nov) 1993.
The molecule may also be labelled with a reporter molecule providing, under suitable conditions, a detectable signal. Such reporter molecules include radio-nucleotides, chemiluminscent molecules, bioluminescent molecules, fluorescent molecules or enzymes. Commonly used enzymes include horseradish peroxidase, glucose oxidase, β- glactosidase and alkaline phosphatase amongst others.
Preferably the Fc receptor-like molecule is an amino acid mutant, variant or derivative of a native Fc receptor. This means that the Fc receptor-like molecule comprises a peptide which has undergone deletion, insertion, substitution or other changes to its amino acid residues compared to a native Fc receptor. The native Fc receptor providing the basis for the mutant, variant or derivative may be derived from human or animal species. Such animal species are preferably mammalian species such as mice, rats, rabbits, bovine, ovine, porcine or caprine species. Deletion, insertion or substitution of amino acids to produce the Fc receptor-like molecule of the present invention may be performed by known means. Where the Fc receptor-like molecule is recombinant derived, the nucleic acid encoding the molecule will have incorporated in its sequence the appropriate code for one or more amino acid insertions or substitutions or have undergone the appropriate deletion from its coding sequence. Where the receptor-like molecule is produced by de novo peptide synthesis the desired amino acid sequences may be incorporated.
Insertions or substitutions may be achieved by placing a stretch of amino acid residues from another type of Fc receptor into the Fc receptor-like molecule which is being constructed. For example the first domain from one receptor such as Fcε receptor may be used to replace the first domain in Fcr receptor to produce the desired result. Alternatively, or in addition, site directed mutagenesis or other techniques may be used to achieve amino acid substitution. Deletions may be achieved by removal of one or more amino acids.
Substitution of amino acids may be conservative by replacing an amino acid with a residue of similar properties. For example, the amino acid substitution may be in accordance with Table 1.
Figure imgf000012_0001
Table 1
Suitable residues for amino acid substitutions
Original Residue Exemclarv Substitutions
Ala Ser
Arg Lys
Figure imgf000013_0001
Asp Glu
Cys Ser
Figure imgf000013_0002
Glu Ala
Gly Pro
Figure imgf000013_0003
He Leu; Val
Leu He; Val
Lys Arg; Gin; Glu
Met Leu; He
Phe Met; Leu; Tyr
Ser Thr
Thr Ser
Trp Tyr
Tyr Trp; Phe
Val lie; Leu
Alternatively substitutions may be with an amino acid of different chemical characteristics imparting a different character to the molecule when compared to a native Fc receptor.
In a preferred embodiment the invention relates to an Fc receptor-like molecule having enhanced ability to bind immunoglobulin wherein the enhanced ability is brought about by alteration of one or more amino acid residues which affect immunoglobulin binding ability.
The phrase "enhanced ability to bind immunoglobulin1' means that the molecule has an immunoglobulin binding activity higher than, or increased compared to, a native Fc receptor in a given class.
The alteration of one or more amino acid residues may be in the first or second domain.
Where the Fc receptor-like molecule has an enhanced ability to bind IgG, preferably alterations in the first domain to included changes to the A/B, C/C and/or E/F loops and/or G/A strand. The loops referred to hereafter are the loops identified in the putative 3-D structures or their equivalents for the receptors discussed earlier and identified in the Examples. The term
"equivalents" means amino acid residues that occur in the same position on the native Fc receptor which comprise the putative loops. It also includes eqivalent loop structures in other native Fc receptors. In addition all of the amino acid residue positions discussed herein are relative to the amino acid sequences of FCγRII or FcεRI.
The loops of FeγRH are as follows:
Domain 1 A/B Glu" - Ser"
C/C ' Asn42 - lie44
E/F Asn" - Asp62
Domain 2 B/C Ser109 - Valllβ
C ' /E Phe129 - Pro134
F/G Asn154 - Ser"1
G/A strand val79 - Pro93
Loops for F..RI are:
Domain 1 A/B Asn" - Asn21
C/C ' Asn42 - Leu45
E/F Lye59 - Glu61
Domain 2 B/C Trp110 - Lys117
C ' /E Tyr129 - His134
F/G Lys154 - He"9
G/A strand Val79 - Ser93 Alterations to the second domain of a Fc receptor-like molecule specific for IgG include changes in the B/C, C'/E and/or F/G loops, and/or β/λ strand which connects domains 1 and 2. Preferably the changes comprise substitution of one or more amino acids especially a conservative substitution. Such changes include but are not limited to replacement by alanine, glycine, serine, asparagine or email synthetic neutrally charged amino acids. Most preferably the replacement is alanine.
More preferably the alterations are at the following positions 133, 134, 158, 159 and/or 160.
Still more preferably the Asp133 and/or Pro134 residues of FcγRII are replaced by alanine. Where the Fc receptor-like molecule has an enhanced ability to bind IgE preferably the alterations in the first domain include changes in A/B, C/C and/or E/F loops and/or the G/A strand that connects domain 1 and domain 2. Alterations to the second domain of a Fc receptor-like molecule specific for IgE include changes in the B/C, C'/E and/or F/G loops.
More preferably the changes are at the following positions 130, 156, 160 and/or 161. Still more preferably the Trp130, Trp156, Tyr"0 and/or Glu161 is/are replaced by alanine.
In another preferred embodiment the invention relates to an Fc receptor-like molecule having reduced ability to bind immunoglobulin wherein the reduced ability is brought about by the alteration of one or more amino acid residueβ which affect immunoglobulin binding ability.
The phrase "reduced ability to bind immunoglobulin" means that the molecule has an immunoglobulin binding activity lower than, or decreased compared to, a native Fc receptor in a given class. This includes a reduced activity for binding of one form of immunoglobulin such as, for example, dimeric immunoglobulin.
The reduced binding ability may be brought about by deletionβ, insertions or substitutions of amino acid residueβ in the firβt or the second domain. Preferably the reduced binding ability will be the result of substitution or deletion of one or more amino acid residueβ although insertions are also clearly contemplated.
Preferably substitutions will be with an amino acid residue (natural or synthetic) which has different chemical characteristics to the corresponding amino acid in the relevant native Fc receptor in question. Such as for example the substituted amino acid may have different charge, acidity or basicity.
The additions, substitutions and/or deletions may be made in accordance with standard methods as described above.
Where Fc receptor-like molecule has a reduced ability to bind IgG preferably alterations in the first domain include replacement of that domain or changes to the A/B, C/C or B/F loops or G/A strand.
More preferably the changes are at the following positions 10 to 21, 42 to 48 and/or 59 to 62.
Alterations to the second domain of a Fc receptor-like molecule specific for IgG preferably include changes to the F/G, B/C, or C/C loops.
More preferably the changes are at the following positions 113, 114, 115, 116, 129, 131, 155 and/or 156.
Still more preferably the firβt domain is deleted or replaced by a domain from an Fc receptor for another inBnunoglobulin.
Alternatively still more preferably the Lys113, Pro114, Leu115, Val1", Phe129 and/or Arg/His131 of FCγRII iβ/are replaced by alanine.
Where the Fc receptor-like molecule has a reduced ability to bind IgE preferably alterations in the first domain include the A/B, C/C or E/F loops. More preferably the changes are at the following positions in the first domain 10 to 21, 42 to 48 and/or 59 to 62.
Alterations in the second domain of a Fc receptor-like molecule specific for IgE preferably include changes to the F/G, C'/E or B/C loops.
More preferably changes are at one or more of the following positions: 131, 132, 155, 158 and/or 159.
Still more preferably the B/C loop (Ser109 to Val1") of Fc-RI is deleted or replaced by a B-C loop from a receptor for another immunoglobulin.
Alternatively still more preferably the C'/E loop (Ser130 to Thr135) of FcεRI is deleted or replaced by a C/E loop from a receptor from another immunoglobulin. Still more preferably Tyr131, Glu132, Val155, Leu1" and/or Asp159 of FcεRI is/are replaced by alanine.
In addition to the alteration discussed earlier the alterations contemplated may be other alterations which make the polypeptide useful as a therapeutic or reagent Thus the alteration may be in the form of an addition deletion or subtraction. For example where addition is contemplated a polypeptide or other suitable molecule may be added to a native Fc receptor in order to increase the size of the molecule or to provide a linker which links a native Fc receptor with a reporter molecule.
In a second embodiment the invention relates to a polypeptide with Fc binding ability wherein the polypeptide is altered compared to a native Fc receptor such that the size of the polypeptide is larger than said native Fc receptor.
The inventors have surprisingly found that the addition of an amino acid sequence to a polypeptide with Fc binding ability not only resultβ in an extended life in the body of an animal but also retains biological activity of the Fc binding component. Thus, the augmented polypeptide has a greater serum half life compared to soluble protein with Fc binding ability and is therefore capable of being more effective as a therapeutic than an altered soluble native Fc receptor.
Preferably the polypeptide with Fc binding ability is in an isolated form such as that described earlier in relation to the Fc receptor-like molecule.
Preferably the polypeptide of the invention is in soluble form where it is to be used in serum or other administration routes requiring solubility. This would generally mean that the tranβmembrane region is not included however the intracellular region may be included.
Preferably the augmentation of the Fc binding polypeptide iβ achieved by linking an amino acid sequence, such aβ a βecond polypeptide or other suitable molecule to a peptide with Fc binding ability. The peptide with Fc binding ability may be a native receptor, a modified native receptor (for example a receptor without the transmembrane or cytoplaβmic regionβ) or a Fc receptor-like molecule aβ described earlier.
Preferably the polypeptide with Fc binding ability iβ of a βize larger than about 67 kD βince proteinβ below this size are excreted by the kidneys. More preferably the polypeptide is in the βize range of 67 to 1000 kD. Still more preferably the polypeptide iβ approximately 100 kD. Preferably the augmentation iβ achieved by adding a peptide, polypeptide or other molecule which iβ well tolerated in an animal. Such pe ides or polype tides include human serum albumin (HSA), bovine serum albumin, other Fc receptors, immunoglobulin from any specieβ, cytokineβ, complement regulating molecules (eg. CD46, CD55, CD59), complement receptors and cytokine receptors. Such additions could include more than one molecule of the same or a different type. The other molecules suitable include dextranβ, carbohydrates, polyethylene glycoland synthetic polymers.
The polypeptide may be directed against any class of Ig. Preferably the polypeptide is directed against IgG or IgE. Even more preferably the polypeptide iβ HSA.FcγRll aβ herein described.
The polypeptide with Fc binding ability may be produced by any convenient means such as through recombinant DNA technology as a fusion protein, or alternatively the two components may be produced separately (by recombinant DNA or other means) and then linked. Alternatively one or both components may be made via peptide synthesis. These methods are described in more detail later on.
In a third embodiment the invention relates to a polypeptide with Fc binding ability comprising a component capable of detection.
The term "component capable of detection" means that the polypeptide is linked to or contains a detectable signal such aβ a reporter molecule, a bioβenβor or a molecule which may be directly or indirectly detected. The reporter or label iβ a component which iβ capable of detection such as by radio labelling, chemiluminescent labelling, fluorometric labelling, chromophoric labelling or labelled antibody binding. Detection may be achieved by direct labelling of the polypeptide with a ligand such as, for example, biotin which specifically binds to streptavidin linked covalently to horβeradiβh peroxidaβe or another enzyme such as alkaline phosphataβe. The actual component capable of detection may be suitably chosen by those skilled in the art.
Preferably the polypeptide is in an isolated form as described above. Preferably the polypeptide comprising a component capable of detection comprises the polypeptide described in the first or second embodiments of the invention. Preferably the component capable of detection is present on, or comprised part of the augmentation. Alternatively, the component capable of detection may be present on the Fc binding portion of the molecule provided this does not inhibit Fc binding ability. Preferably the component capable of detection iβ an enzyme such as horβeradiβh peroxidaβe.
In another embodiment the preβent invention relateβ to a method of testing a compound for its ability act as an antagonist of an Fc receptor said method comprising contacting the compound with a polypeptide with Fc binding ability or a native Fc receptor under conditions and for a time βufficient to allow binding of the compound to the polypeptide or receptor and determining whether binding has occurred.
The term "Fc receptor" used directly above includes any native or non-native Fc receptor or a portion thereof which binds Fc.
The compound tested may be any compound which could possibly be useful as an Fc receptor antagonist.
Such compounds may be antibodies, including polyclonal and monoclonal antibodies, or fragments of antibodies, such as βcantibodieβ, antibody mimeticβ (Smythe & von Itzβtein) and the like. The compounds may be extracts from produced from plants or animals such aβ rain forest plants, corals and the like. The compounds may be peptides or peptide-like substances or other organic substances such as thoβe derived from combinational libraries (βeysen et al 1995; Stratton-Thomas et al 1995, Lome Conference on Protein Structure and Function, Australia) .
The method of the invention may be conducted in any suitable manner known to those skilled in the art. The polypeptide with Fc binding ability or the Fc receptor may be attached to a support leaving the Fc binding site free. Then the immunoglobulin and compound under investigation may be added to the attached polypeptide or Fc receptor. Alternatively Ig or the Fc fragment thereof may be attached to a support. The polypeptide or the Fc receptor and compound under investigation may be added to the bound ligand.
Thoβe skilled in the art will also be familiar with the conditions and time needed to allow any binding of the polypeptide or native Fc receptor to the compound being tested.
Determination of whether binding has taken place may be made by any convenient means. This may be achieved by common detection method such as by using a labelled polypeptide or labelled FcR or by using a labelled Ig. Such detection methods are well known by those skilled in the art and are discussed elsewhere in this document.
The method may be used to screen compounds which are potential inhibitors of receptors for any class of imunoglobulin. Preferably the method is used to screen compounds for their ability to block binding of Ig to the Fcγ receptor or the Fcε receptor.
In another embodiment the preβent invention relateβ to antagonist compounds identified by the above method which interfere with the amino acid residues in Fc receptors which are involved in immunoglobulin binding. Such compounds embrace any compound which interact with theβe amino acid reβidueβ or regions of residueβ so as to interfere with or reduce immunoglobulin binding and include compounds which bind to these reβidueβ or regions of residues by hydrophobic, electrostatic or other chemical interaction. This also includes compounds which interfere with the structural integrity of the molecule thereby reducing its affinity for immunoglobulin aβ well aβ compounds which directly interfere with the amino acids involved in immunoglobulin binding. Also included are compounds that bind to Ig, as opposed to its receptor, and thereby inhibit the receptor-Ig interaction. The antagoniβtβ may be antibodies, peptides, peptide-like βubβtances or any other compound aβ described above. Preferably the antagonist once identified, is in an isolated form. As such, the Fc receptor antagoniβtβ may be used in the treatment of asthma, rheumatoid arthritis, lupus , glomerulonephritiβ, IgA nephropathies, etc. and a host of immune complex and other diseases including but not limited to autoiinmune diseases. Where the antagoniβt iβ intended to block or reduce IgG binding then the compound will preferably interact with the A/B, C/C or E/F loops in the firβt domain or with the F/G, B/C or C'/E loops in the second domain or the G/A strand. Preferably the compounds will be capable of binding to or blocking the function of one or more of the following reβidueβ in the native Fc receptors 10-21, 42-48, 59-62, 113, 114, 115, 116, 129 131, 133, 156, 158, 159 and/or 160 or their functional equivalents. Where the antagoniβt iβ intended to block or reduce IgE binding in disease such as asthma or allergy then the compound will preferably interact with the A/B, C/C or E/F loops in the firβt domain and/or the F/G, C'/E or B/C loops of the second domain or the G/A strand. Preferably the compounds will be capable of binding to or blocking the function of the following residueβ: 10-21, 42-48, 59-62, 131, 132, 155, 158 and/or 159.
In another embodiment the present invention contemplates pharmaceutical compositions containing as an active ingredient the polypeptide with Fc binding ability including the Fc receptor-like molecules or the antagoniβt compounds described above, depending on the condition to be treated, together with a pharmaceutically appropriate carrier or diluent. For example, polypeptide with Fc binding ability or Fc receptor-like molecule with enhanced immunoglobulin binding ability may be uβed to treat diβeaβeβ including by not limited to glomerulonephritiβ, lupus, arthritis, heparin induced thrombocytopoenia thrombosis syndrome (HITTS) or idiopathic thrombocytopoenia pupuera (ITP), asthma, allergy, eczema, Ig nephropathies and rheumatoid arthritis. Fc receptor-like molecule with reduced binding ability may be used to treat disease where it is desirable to remove only some or one particular kind of iimminoglobulin. Antagoniβt compounds may be used in the treatment of inappropriate or excessive immunoglobulin levels or aggregates or immune complexes are part of the symptoms of the disease such as aβthma, allergy, rheumatoid arthritis, etc. For the purpose of describing the pharmaceutical compositions, all of the above molecules and compounds will be referred to herein aβ "active moleculeβ". The uβe of the term "active moleculeβ" therefore should be read aβ one or more of the above moleculeβ depending on the condition to be treated.
The active moleculeβ of the pharmaceutical compositionβ are contemplated to exhibit therapeutic activity when administered in an amount which depends on the particular case. The variation depends, for example, on the animal and the active molecule. For example, from about 0.05 μg to about 100 mg of Fc receptor-like molecule or antagonist compound may be administered per kilogram of body weight per day to alter Fc receptor-immunoglobulin interaction. Doβageβ may be adjusted to provide the optimum therapeutic response. For example, βeveral divided doses may be administered daily, weekly, monthly, or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. The active molecules may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intraperitoneal, intramuscular, subcutaneous, topical, intranasal, intradermal or suppository routes or implanting (e.g. using slow release moleculeβ) . Depending on the route of adminiβtration, the active moleculeβ may be required to be coated in a material to protect said molecules from the action of enzymes, acids and other natural condition which may inactivate said ingredients.
The active molecules may also be administered in dispersions prepared in glycerol, liquid polyethylene glycol, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In another embodiment the preβent invention relateβ to a nucleic acid molecule encoding a polypeptide with Fc binding ability wherein the structure of the polypeptide iβ altered compared to a native Fc receptor by addition, deletion and/or substitution of the amino acids encoded by the nucleic acid βuch that βaid alteration reβultβ in improved characteriβticβ compared to βaid native receptor.
The term "nucleic acid molecule" refers to molecule made up of natural or synthetic purines and pyrimidineβ. The nucleic acid molecule may be DNA or RNA, single or double stranded, linear or circular and may form a part of a larger nucleic acid molecule.
The term "polypeptide with Fc binding ability" the meaning given earlier.
The terms "the polypeptide is altered compared to a native Fc receptor" and "improved characteristics" have the same meaning as given earlier.
Preferably the nucleic acid molecule is in isolated form meaning it has undergone some purification away from other nucleic acids and/or non-nucleic acid moleculeβ. The purity of the preparation may be represented by at least 40% nucleic acid molecule encoding a polypeptide with Fc binding ability, preferably at least 60% nucleic acid molecule, more preferably at least 75% nucleic acid molecule, even more preferably at least 85% nucleic acid molecule, even more preferably at leat 95% nucleic acid molecule relative to nucleic acid molecules not encoding a polypeptide with Fc binding ability as determined by nucleic acid homology, sequence or any other convenient means.
In a preferred embodiment the present invention relates to a nucleic acid molecule encoding an Fc receptor¬ like molecule comprising an altered ability to bind Fc wherein said ability iβ brought about by alteration of one or more amino acid residueβ which affect immunoglobulin binding ability. The phrase "Fc receptor-like molecule" has the meaning given earlier.
The phraβes "altered ability to bind immunoglobulin", "the alteration of one or more amino acid reβidueβ which affect immunoglobulin binding ability" have the same meanings aβ given earlier.
The nucleic acid molecule may encode an Fc receptor-like molecule which functions aβ a receptor for any type of immunoglobulin βuch aβ IgG, IgE, IgA, IgM, or IgD. The Fc receptor-like molecule encoded may be derived from any species, such as human, mouse, rat, bovine, ovine, caprine etc and may comprise a combination of different sources. The term "derived from" means that the original coding sequence providing the basiβ for the nucleic acid molecule prior to alteration comes from the species specified.
Those skilled in the art will know which techniques may be used to alter the amino acids encoded by a nucleic acid in order to produce a nucleic acid molecule in accordance with the invention. The nucleic acid molecule may be made by site mutageneβiβ of DNA encoding native Fc receptor, splice extension overlap PCR, de novo syntheβiβ, etc.
Preferably the nucleic acid molecule encodes a mutant, derivative or variant of a native Fc receptor aβ described earlier.
Preferably the nucleic acid molecule encodes an Fc receptor like peptide which has enhanced ability to bind IgG or IgE. The phrase "enhanced ability" has the same meaning aβ given earlier.
More preferably where the nucleic acid molecule encodeβ an Fc receptor-like molecule with an enhanced ability to bind IgG the molecule compriβeβ codonβ reβulting in one or more altered amino acids in the A/B, C/C and/or B/F loops of the first domain or B/C, C'/E and/or F/G loops of the βecond domain and/or the G/A strand that connects the two domains. Still more preferably the codonβ result in altered amino acids at positions 158, 159, 160, 133 and/or 13 . Most preferably the altered amino acids comprise alanine, glycine, βerine, aβparagine or small synthetic neutrally charged amino acids. Most preferably the codon specifies the amino acid alanine.
Still more preferably the nucleic acid molecule compriβes a cDNA encoding FCγRII with the codon for Asp133 and/or Pro134 specifying alanine. Even more preferable the nucleic acid molecule is Asp133-Ala or Pro134-Ala aβ described in the Examples.
Alternatively more preferably the nucleic acid molecule encodeβ an Fc receptor-like molecule with an enhanced ability to bind IgE. The molecule compriβeβ codonβ reβulting in one or more altered amino acids in the A/B, C/C and/or E/F loops of the first domain or the F/G, C'/E and/or B/C loops of the βecond domain or the G/A strand.
Still more preferably the codons result in altered amino acids at poβitionβ 130, 156, 160 and/or 161.
Still more preferably the nucleic acid molecule compriβeβ a cDNA encoding Fc.RI with the codon for Trp130, Trp154, Tyr1<0 and/or Glu141 specifying alanine. Even more preferably the nucleic acid molecule is Trp130-Ala, Asp159- Ala, Tyr1*0-Ala or Glu1(1-Ala as described in the Examples.
Alternatively preferably the nucleic acid molecule encodeβ an Fc receptor like peptide which haβ reduced ability to bind IgG or IgE. The phrase "reduced ability" has the same meaning as given earlier. The amino acid alterations specified by the codons will generally be amino acids with different chemical characteriβticβ βuch aβ that described earlier.
More preferably where the nucleic acid molecule encodes an Fc receptor-like molecule with a reduced ability to bind igβ the molecule comprises codons which result in one or more altered amino acids in the A/B, C/C and/or E/F loops in the first domain and/or the B/C, C'/E and/or F/G loopβ in the βecond domain and/or the G/A strand.
Still more preferably the codons result in altered amino acids at positionβ 10-21, 42-48, 59-62, 113, 114, 115, 116, 129, 131 155 and/or 156. Even more preferably the codons for the first domain of FCγRII are removed or replaced by thoβe for a receptor for another inrmunoglobulin.
Alternatively even more preferably the codonβ for Lye113, Pro114, Leu115, Val1", Phe129, Arg/Hiβ131 and He155 and/or Gly1" are replaced by the codon for alanine in the FCγRII. Still more preferably the nucleic acid molecule compriβeβ the conβtructβ DleD2r, Lye113-Ala, Pro11 -Ala, Leu115-Ala, Val116-Ala, Phe129-Ala and/or Arg/Hiβ131-Ala described in the Examples. Alternatively more preferably where the nucleic acid molecule encodes an Fc receptor-like molecule with a reduced ability to bind IgE the molecule compriβeβ codonβ which reβult in one or more altered amino acidβ in the A/B, C/C and/or E/F loopβ in the firβt domain or the F/G, C'/E and/or B/C loopβ in the second domain or the G/A strand.
Still more preferably the codons result in altered amino acidβ at poβitionβ 10-21, 42-48, 59-62, 129, 131, 132, 155, 158, 159.
Even more preferably the codons for the firβt domains of FcεRI are removed or replaced by those for a receptor for another iπrπninoglobulin.
Alternatively even more preferably the codons for Tyr129, Tyr131, Glu132, Val155, Leu1" and/or Asp159 is/are replaced by the codon for alanine in FcεRI. Still more preferably the nucleic acid molecule of the invention comprises the constructs γl09-116ε, γl30-135ε, Tyr131-Ala, Glu132-Ala, Val155-Ala, Leu15β-Ala and Asp159-Ala aβ deβcribed in the Examples.
In another preferred embodiment the invention relates to a nucleic acid molecule encoding a polypeptide with Fc binding ability wherein the polypeptide is altered compared to native Fc receptor such that the size of the polypeptide is larger than said native Fc receptor.
Preferably the nucleic acid molecule encodes a polypeptide that is soluble.
Preferably the nucleic acid compriβeβ a component encoding naive Fc receptor, the extracellular region thereof or the Fc receptor-like molecule deβcribed earlier and a component encoding an amino acid sequence that resultβ in the protein being larger than about 67 kD. Preferably the protein encoded is in the range of 67 kD to 1000 kD.
Preferably the non-Fc binding component encoded is a peptide well tolerated by an animal βuch aβ HSA, other Fc receptors, Igs from any species, cytokines and complement regulating moleculeβ βuch aβ thoβe discussed earlier. Even more preferably the nucleic acid has the same sequence as HSA : FcγRII or is substantially similar thereto.
In a further preferred embodiment the invention relateβ to a nucleic acid molecule encoding a polypeptide with Fc binding ability comprising a component capable of detection.
The term "component capable of detection" has the βame meaning aβ given earlier.
Preferably the nucleic acid molecule encodeβ the polypeptide deβcribed in the firβt or βecond embodiments of the invention and preferably the component capable of detection iβ encoded by the appropriate nucleotide sequence βuch aβ a nucleotide sequence encoding an immunoglobulin, HRP, Alk-Phos or other detectable component. The invention alβo extends to the nucleic acid molecules used as primers to produce the nucleic acid molecule of the invention. The primers described in the Examples are particularly preferred.
The invention further extends to a method of making the nucleic acid molecule of the invention comprising producing a nucleic acid encoding a polypeptide with Fc binding ability the structure of which is altered compared to a native Fc receptor by addition, deletion or substitution of one or more amino acids such that said alteration resultβ in improved characteriβticβ compared to βaid native receptor. The term "producing a nucleic acid molecule" encompasβeβ direct mutageneβiβ of a native Fc receptor gene by chemical means, SOE-PCR, de novo synthesis or addition of a nucleic acid such that a fusion protein is encoded. The different methods of effecting mutations will be well known to those skilled in the art.
The invention also extends to vectors comprising the nucleic acid molecules encoding the polypeptide with Fc binding ability described above and host cells expressing the nucleic acid molecules. Suitable vectors and host cells will be well known to thoβe skilled in the art. In a preferred from the invention relates to the cDNA constructs and host cells containing them described in the Examples.
The invention also relateβ to a method of producing the polypeptidβs of the invention by recombinant means. The method comprises causing the nucleic acid molecule of the invention to be expressed and isolating or purifying the polypeptide to at least some degree. Generally the nucleic acid molecule will be present on a suitable vector or integrated into a host genome. Suitable hosts, vectors and purification methods will be known to those skilled in the art. However for the purposes of illustration only, some discussion of hosts and vectors is given below.
Suitable prokaryotic hosts include but not are limited to Escherichia, Streptomyces, Bacillus and the like. Suitable eukaryotic host include but are not limited to yeast, such aβ Pichia and Saccharomyces and animal cells in culture βuch aβ VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, BHK, COS, MDCK, NS1, J558 and insect cell lines. Such recombinant techniques have now become well known and are described in Methods of Enzymology, (Academic Press) Volumes 65 and 69 (1979), 100 and 101 (1983), and the references cited therein. An extensive technical discussion embodying most commonly uβed recombinant DNA methodologies can be found in Maniatis et al . , Molecular Cloning, Cold Spring Harbor Laboratory (1982) or Current Protocols in Molecular Biology, Greene Publishing (1988, 1991).
Once the nucleic acid encoding the polypeptide has been produced, the DNA may be introduced into an expression vector and that construction uβed to transform an appropriate host cell. An expression vector is characterised as having expression control sequences such that when a DNA sequence of interest is operably linked thereto, the vector is capable of directing the production of the product encoded by the DNA βequence of intereβt in a host cell containing the vector.
After the recombinant product is produced it is desirable to recover the product. If the product is exported by the cell producing it, the product can be recovered directly from the cell culture medium. If the product is retained intracellularly, the cells must be physically disrupted by mechanical, chemical or biological means in order to obtain the intracellular product.
With a protein product, it is desirable that the purification protocol provides a protein product that is essentially free of other proteins, and eliminates or reduces to acceptable levels other host cell contaminants, such as DNA, RNA, potential pyrogenβ and the like. Thus it may be desirable to use a commercially available system such as FLAG™ peptide system to allow easy purification. Alternatively the inherent ig binding property of the polypeptide may be used to affinity purify it or anti-Fc receptor antibodies may be used.
As mentioned above, a variety of host cells may be uβed for the production of the polypeptide of the invention. The choice of a particular host cell is well within the knowledge of the ordinary skilled person taking into account, inter alia, the nature of the receptor, its rate of synthesis, its rate of decay and the characteristics of the recombinant vector directing the expression of the receptor. The choice of the host cell expresβion system dictates to a large extent the nature of the cell culture procedures to be employed. The selection of a particular mode of production be it batch or continuous, spinner or air lift, liquid or immobiliβed can be made once the expression system has been selected. Accordingly, fluidiβed bed bioreactors, hollow fibre bioreactors, roller bottle cultures, or stirred tank bioreactors, with or without cell microcarrier may variously be employed. The criteria for βuch selection are appreciated in the cell culture art.
In another embodiment the invention relates to a method of determining the presence of and/or amount of Immunoglobulin in a sample said method comprising contacting said sample with the polypeptide of the present invention, or an Fc receptor or a part thereof, for a time and under conditions sufficient to allow the polypeptide or Fc receptor or part thereof and any immunoglobulin present in said βample to bind and detecting the presence of and/or determining the amount of βaid bound polypeptide- immunoglobulin, Fc receptor-immunoglobulin or part Fc receptor-iimαunoglobin. The βample may be from any source where it is desired to determine the preβence of immunoglobulin. Samples from body fluids and βecretions βuch aβ blood, βaliva, sweat, semen, vaginal secretions may be uβed. Solid tisβue samples such as biopβy βpecimenβ from kidneys, etc, are alβo contemplated.
The term "an Fc receptor" refers to any native or non-native Fc receptor or a portion thereof whether derived from natural sources or by recombinant means. Preferably the Fc receptor iβ at least partly purified. Detection of the bound polypeptide or Fc receptor can be determined by any convenient means. Preferably presence of immunoglobulin is detected by a reporter molecule. Alternatively the bound antibody-receptor may be detected by an anti-polypeptide labelled with a label, reporter molecule anti-Ig or other detectable signal. Determination of the amount of immunoglobulin may be made by comparison to a standard curve obtained using known quantities of Ig under identical conditions.
The polypeptide of the preβent invention or Fc receptor may be soluble or bound to a solid support βuch aβ nitrocellulose, paper, matrices or resins which will be known to those skilled in the art.
Another embodiment of the invention relates to a kit for detecting immunoglobulin including immune complexes in a βample, βaid kit comprising in compartmentalised form a firβt compartment adapted to receive the polypeptide of the invention or an Fc receptor and at least one other compartment adapted to contain a detector means.
The phrase "detector means" refers to means for detecting iπnminoglobulin bound to Fc receptor-like molecule and includes the appropriate substrates, buffers, etc required for detection of the bound immunoglobulin- receptor.
In this connection the polypeptide of the invention in the form of an Fc receptor-like molecule with enhanced ability to bind immunoglobulin of the present invention provides a useful laboratory reagent. This iβ particularly so with an Fc receptor-like molecule specific for IgG because the Fc receptor-like molecule iβ capable of βelectively binding immunoglobulin complex. Thus the Fc receptor-like molecule including one with enhanced Ig binding ability may be used in immunoprecipitation as a replacement for protein A, for example, which does not exhibit a selective binding ability.
In a related embodiment the present invention provides a method of detecting immune complex in a βample comprising contacting βaid βample with the polypeptide of the invention or an Fc receptor specific for IgG for a time and under conditions sufficient for any complex present in the sample and the polypeptide or Fc receptor to form a further complex and detecting βaid further complex.
The above method utilises the ability of the polypeptide of the invention and the Fc receptor for IgG to bind complexes as they do not recognise monomeric IgG. Further the use of the Fc receptor-like molecule with enhanced activity provides a more βenβitive aββay aβ it will detect lower levelβ of complex in the βample and also be selective for the same. The above method may be a useful tool in diagnosis of diβeaβeβ where immune complexes are implicated such as, for example, glomerulonephritis, lupus, arthritis, heparin induced thrombocytopoenia thrombosis syndrome (HITTS), Gullien-Bare syndrome or idiopathic thrombocytopoenia pupuera (ITP) .
In a further embodiment relateβ to a method of removing immunoglobulin from a βample comprising contacting said sample with the polypeptide of the invention or an Fc receptor for a time and under conditions suitable for any immunoglobulin in the sample to form a complex with said polypeptide or Fc receptor and separating said complex from the remainder of the sample.
The sample used in the method may be any sample such aβ that deβcribed above or may be a βample continuously taken from a patient βuch aβ blood or plasma which is withdrawn, treated by the method and then returned to the patient as part of a closed syβtem.
Preferably the polypeptide or Fc receptor used is specific for IgG and/or IgA. It has been noticed by the present inventors that FcγRH described herein is able to bind IgA. Thus, use of FcγRH would be particularly advantageous in the treatment of diseases involving immune complexes of IgG and/or IgA such as IgA nephropathies. Preferably the method is directed at removing immune complex existing in the sample and the polypeptide used iβ capable of binding immune complexes containing IgG or IgA. Separation of the complex may be achieved by any convenient means such as by standard haemoperfusion or plasmaphoreβiβ technologies but utilising a device containing the polypeptide of the preβent invention or a Fc receptor or a portion thereof bound to a solid support.
Such a solid support includes silica, βephoroβe™, agarose, celluloβe membranes, etc. Such a device would preferably comprise a container enclosing the polypeptide or receptor or part thereof attached to a support, an inlet through which the βample can flow in and an outlet through which the βample can be returned to the patient.
In yet another embodiment the preβent invention relateβ to a method of removing immunoglobulin from a body fluid comprising taking body fluid from a patient, contacting the body fluid with the polypeptide of the invention or an Fc receptor, for a time and under conditions sufficient to allow the polypeptide to bind said immunoglobulin, removing βaid bound immunoglobulin from the body fluid and replacing βaid body fluid in the patient. Preferably the method involves removal of immune complex. This may be used in the treatment of diseases where it is desirable to remove immune complex such as in lupus, IPT, HITTS, rheumatoid arthritis or after infection in a glomerulonephritiβ patient. More preferably the method iβ uβed in plaβmaphoreβiβ in the treatment of immune complex diseases. Even more preferably the method utilised an Fc receptor¬ like molecule with enhanced ability to bind IgG.
Preferably the Fc receptor-like molecule is bound to a solid support such as a membrane when used in plasmaphoreβiβ. Any suitable support could be used βuch aβ silica, agarose, βepharoβe™ or cellulose derivatives and will be known to thoβe skilled in the art.
In another embodiment the present invention relateβ to a method of treatment of disease where the disease involves immune complexes or antigen-antibody interactions, βaid method comprising administering an effective amount of the polypeptide of the invention, an Fc receptor or an antagoniβt compound of the invention to a subject.
The subject may be a human or animal, preferably a mammal.
Preferably the polypeptide with an increased serum half life is used in the method of the invention. More preferably this polypeptide comprises the Fc receptor¬ like molecule with enhanced immunoglobulin binding ability is used in the method. In some diβeaβeβ however an Fc receptor-like molecule with reduced immunoglobulin, or differential immunoglobulin binding ability may be indicated βuch aβ where it iβ desirable bind one form of immunoglobulin and not another. For example, an Fc receptor-like molecule with altered IgG binding ability such that it binds complexes and not monomers may be useful.
Preferably the polypeptides used in the method are soluble. More preferably they are administered in a pharmaceutical composition. The polypeptide of the invention optionally comprising the Fc receptor-like moleculeβ with enhanced IgG binding ability may be uβed in the treatment of diseases where an excess of immunoglobulin is implicated as a causative agent of the inflammation or diseaβe such as immune complex diseases, glomerulonephritis, lupus, rheumatoid arthritis, diseases involving inappropriate production of IgG after infection, heparin induced thrombocytopoenia thrombosis syndrome (HITTS) hyperacute graft rejection and idiopathic thrombocytopoenia pupuera (ITP) .
In addition, the polypeptides of the preβent invention, Fc receptor-like moleculeβ with enhanced IgG binding ability may be uβed in the treatment of any diβeaβe involving IgE, where IgE iβ one of the causative agents of disease. Such diseases include asthma, allergy and eczema.
Such a method comprises administering an effective amount of the polypeptide of the invention, or an Fc receptor, to a patient.
It iβ enviβaged that the polypeptide of the invention, particularly a soluble one comprising IgE specific Fc receptor-like molecule with enhanced activity according to the invention will be particularly useful as a competitive inhibitor of IgE binding when adminiβtered to a subject. The polypeptide will function in two ways. First, it will absorb unbound IgE and βecond it will diβplace already bound IgE or prevent rebinding of IgE by virtue of its strong affinity for IgE. In this way the action of IgE in an asthma attack or allergic reaction such aβ in food allegy or bee sting may be reduced or alleviated.
Similar comments apply to a soluble IgG specific polypeptide of the invention. It is enviβaged that particularly a soluble IgG specific Fc receptor-like molecule with enhanced activity according to the invention will be useful as a competitive inhibitor of IgG binding when adminiβtered to patientβ. Firβt it will absorb to immune complexes aggregates or IgG which will prevent binding to cell surface FeγR, e.g. FcγRI, FeγRII, FcγRIII which will prevent or reduce activation of inflammation.
In this way irasune complex induced inflammation, e.g. in rheumatoid arthritis, Good pastures syndrome, hyperacute graft rejection or lupus will be reduced or alleviated.
The invention will now be described with reference to the following non-limiting Examples.
Example 1 Materials and Methods
Chimeric FCγRII/FcεRl and mutant FCγRII receptor cDNAs and expression constructs.
Chimeric FCγRII/FcεRIa chain or mutant FCγRII cDNAs were constructed by Splice Overlap Extension (SOE) PCR (27) using the FCγRIIa"* cDNA (7) as template. SOE PCR was performed as follows: Two PCR reactions were used to amplify the FCγRII-FcεRI or FCγRII fragments to be spliced together. The reactions were performed on lOOng of the FCγRIIaNR cDNA in the presence of 500ng of each oligonucleotide primer, 1.25nM dNTPs, 50nM KC1, lOmM Tris- Cl pH 8.3 and 1.5nM MgCl2 using 2.5 units of Taq polymerase (Amplitaq, Cetus) for 25 amplification cycles. A third PCR reaction was performed to splice the two fragments and amplify the spliced product. lOOng of each fragment (purified by size fractionation through an agarose gel) (28) was used with the appropriate oligonucleotide primers under the above PCR conditions.
The chimeric FCγRII/FceRI a chain receptors were generated as follows. Chimera g, el09-116: oligonucleotide pairβ (NRl + CHM10) and (CHM09 + EG5) were uβed to produce two fragments which were spliced together using oligonucleotides NRl and EG5. Chimera g, el30-135: oligonucleotide pairβ (NRl + PM12) and (PM11 + EG5) followed NRl and BG5. The sequence of the oligonucleotide uβed and their positions of hybridisation with the FCγRIIaNR cDNA are:
NRl, 5' - TACGAATTCCTATGGAGACCCAAATGTCTC-3', (nucleotide position 10-30);
EG5, 5' - TTTGTCGACCACATGGCATAACG-3', (967-981);
CHM09, 5' - CACATCCCAGTTCCTCCAACCGTGGCACCTCAGCATG-3', (419- 437 with nucleotides 442-462 of FcεRI a chain) ;
CHM10, 5' - AGGAACTGGGATGTGTACAAGGTCACATTCTTCCAG-3',
(462-487 with 446-462 of FcεRI a chain) ,
PM11, 5' - GTGGTTCTCATACCAGAATTTCTGGGGATTTTCC-3', (473-490 with 492-506 of FcεRI a chain) ; PM12, 5' - CTGGTATGAGAACCACACCTTCTCCATCCCAC-3" (516-531 with 491-506 of FcεRI a chain) .
Sequences derived from Fc.RI a chain are underlined, FCγRII not underlined; non-homologous sequences including restriction enzyme sites used in cloning of the PCR products are in bold type. Nucleotide positionβ refer to the previously published FCγRIIa and FcεRl a chain cDNA sequences (7, 13).
The FCγRII Alanine point mutant cDNAs were generated using the following oligonucleotide combinations. Pro114-Ala, (GBC01 + EG5) and (GBC02 + NRl); Lys113-Ala:
(GBC03 + EG5) and (GBC04 + NRl); Leu115-Ala, (BGC05 + EG5) and (GBC06 + NRl); Val116-Ala, (GBC07 + EG5) and GBC08 + NRl); Phe129-Ala, (GCEOl + EG5) and (GCE02 + NRl); Ser130- Ala, (GCE03 -l- EG5) and GCE04 + NRl); Arg/His131-Ala (GCE05 + EG5) and GCE06 + NRl); Leu132-Ala, (GCE07 + EG5) and GCE08 + NRl); Asp133-Ala, (GCE09 + EG5) and (GCE10 + NRl); Pro134- Ala, (GCE11 + EG5) and (GCE12 + NRl) . Oligonucleotide NRl and EG5 were uβed to splice together the two component fragments of each mutant to produce the point substituted cDNAs. The βequence of the oligonucleotides used and their positions of hybridisation with the FCγRIIaNR cDNA are: NRl and EG5 as deβcribed above;
GBCOl, 5'-GAAGGACAAGGCTCTGGTCAAG-3', (nucleotide position 443-464); GBC02, 5'-CTTGACCAGAGCCTTGTCCTTC-3', (443-464)
GBC03, 5'-CTβGAAGGACGCTCCTCTββTC-3', (440-461)
GBC04, 5'-GACCAGAGGAGCGTCCTTCCAG-3', (440-461)
GBC05, 5'-ββACAAGCCTGCTGTCAAββTC-3', (446-467)
GBC06, 5'-GACCTTGACλβCAGGCTTGTCC-3', (446-467) GBC07, 5'-GACAAGCCTCTGGCTAAGGTCAC-3', (447-469);
GBC08, 5'-GTGACCTTAGCCAGAGGCTTGTC-3', (447-469);
GCEOl, 5'-CCCAGAAAGCTTCCCGTTTGG-3', (490-611);
GCE02, 5'-CCAAACGGGAAGCTTTCTGββ-3', (490-611);
GCE03, 5'-CAGAAATTCGCTCGTTTββλTC-3', (492-614) GCE04, 5'-GATCCAAACGAGCGAATTTCTG-3', (492-614)
GCE05, 5'-GAAATTCTCCGCTTTGGATCCC-3', (494-616)
GCE06, 5'-GGGATCCAAAGCGGAGAATTTC-3', (494-616)
GCE07, 5'-ATTCTCCCGTGCTGATCCCACC-3', (497-619)
GCE08, 5'-GβTGβGATCAGCACGGGAβAAT-3', (497-619) GCE09, 5'-CTCCCGTTTGGCTCCCACCTTC-3', (500-622)
GCE10, 5'-GAAGGTGGGAGCCAAACGGGAβ-3', (500-622) GCE11, 5'-CCGTTTGGATGCTACCTTCTCC-3', (503-625) ; GCE12, 5'-GGAGAAGGTAGCATCCAAACGG-3', (503-625).
The Ala codon or itβ complement are shown in bold type.
Chimeric and mutant receptor cDNA expression constructs were produced by subcloning the cDNAs into the eukaryotic expression vector pKC3 (29) . Each cDNA was engineered in the PCR reactions to have an EcoRI site at their 5' end (the 5'-flanking oligonucleotide primer NRl containing an EcoRI recognition site), and a Sail site at their 3' end (the 3'-flanking oligonucleotide primer EG5, containing a Sail recognition site), which enabled the cDNAs to be cloned into the EcoRI and Sail sites of pKC3. The nucleotide sequence integrities of the chimeric cDNAs were determined by dideoxynucleotide chain-termination sequencing (30) using SequenaseTM (United States
Biochemical Corp., Cleveland, OH) aβ described (31).
Transfectionβ-COS-7 cells (30-50% confluent per 5cm2 Petri-dish) were transiently transfected with FcR cDNA expression constructs by the DEAE-dextran method (32). Cells were incubated with a transfaction mixture (lml/5cm2 dish) consisting of 5-10mg/ml DNA, 0.4mg/ml DEAE-dextran (Pharmacia, Uppsala, Sweden) and lmM chloroquine (Sigma, St Louis, Mo) in Dulbecco'β Modified Eagleβ Medium (DME) (Flow Laboratories, Australia) containing 10% (v:v) Nuβerum (Flow Laboratories, Australia), for 4hr. The transfeetion mixture was then removed, cells treated with 10% (v:v) dimethysulphoxide in Phosphate buffered saline (PBS, 7.6mM Na3HP04/3.25mM NaH3P04/145mN NaCl) pH7.4 for 2 min, washed and returned to fully βupplemented culture medium for 48-72 hr before use in assays. COS-7 cells were maintained in DME supplemented with 10% (v:v) heat inactivated foetal calf serum, lOOU/ml penicillin, lOOmg/ml streptomycin, 2mM glutamine (Commonwealth Serum Laboratories, Australia) and 0.05mM-2-mercaptoethanol (2mE) (Kock Light Ltd., UK). Monoclonal antibodies and Ig reagents - The anti- FCγRII mλb 8.2 waβ produced in this laboratory (19) . The mouse IgE anti-TNP mλb (TIB142) waβ produced from a hybridoma cell line obtained from the American Type Culture Collection (Rockville, Ma) ; the mouse IgGl anti-TNP mλb (A3) waβ produced from a hybridoma cell line which waβ a gift of Dr A Lopez (33) . Human IgGl myeloma protein waβ purified from the βerum of a myeloma patient aβ deβcribed (34) . Human IgGl oligomers were prepared by chemical crosβlinking using S-acetylmercaptoβuccinic anhydride (SAMSA) (Sigma, St Louie, Mo) and N-Succinimidly 3-(2- pyridyldithio) propionate (SPDP) (Pierce Chemical Company, Rockford, IL) aβ follows: hlgGl myeloma protein (5mg at lOmg/ml) in phosphate buffer (0.01M sodium phosphate pH 7.5/0.15M NaCl) was treated with a 5-fold molar excess of SPDP in dioxine, for 30 min. Excess reagents were removed by dialysis into PBS pH 7.0 / 2mM EDTA. The SAMSA modified hlgβl waβ treated with 200ml hydroxylamine (lmM in PBS pH 7.0) for 30 min, then mixed with SPDP modified hlgGl (1:1 molar ratio) and incubated for a further hr. The reaction waβ terminated with N-ethylmalemide (Sigma, St Louie, Mo) added to a final concentration of 6.6mM (35). All reactions were performed at room temperature. Dimeric hlgGl was purified from monomeric and oligomeric hlgGl by size fractionation chromatography on Sephacryl S-300 HR (Pharmacia LKB Biotechnology) .
Erythrocyte-Antibody resetting - COS-7 cell monolayers transfected with FcR expression constructs were incubated with EA complexes, prepared by coating sheep-red blood cells (SRBC) with trinitrobenzene βulphonate (TNBS) (Fluka Chemika, Switzerland) and then sensitising these cells with mouse IgGl or IgE anti-TNBS mAb (36). Two ml of 2% EAs (v:v) were added per 5cm2 dish of transfected cells and incubated for 5 minutes at 37°C. Plates were then centrifuged at 500g for 3 min and placed on ice for 30 min. Unbound EA were removed by washing with L-15 medium modified with glutamine (Flow Laboratories, Australia) and containing 0.5% Bovine serum albumin (BSA) .
Direct binding of dimeric-hlgβl or dimeric-mlgGl - COS-7 cells transfected with FcR expression constructs were harvested, washed in PBS/0.5% BSA and reβuβpended at 107/ml in L-15 medium/0.5% BSA. 50ml of cells were incubated with 50ml serial dilutions of 125I-dimeric-hlgGl for 120 min at 4°C. 125I-dimeric-Ig was prepared by the chloramine-T method aβ deβcribed (37) and shown to compete equally with unlabelled dimeric-Ig in binding to Fc receptor expressing COS-7 cells. Cell bound 125I-dimeric- Igβl was determined following centrifugation of cells through a 3:2 (v:v) mixture of dibutylphthalate and dioctylphthalate oilβ (Fluka Chemika, Switzerland) and cell bound 125I-dimer determined. Non-specific dimer binding was determined by assaying on mock transfected cells and subtracted from total binding to give specific dimeric-IgGl bound. Levels of cell surface FCγRII expression were determined using the anti-FCγRII mAb 8.2, shown to bind distantly to the binding site (19), and uβed to correct for variable cell surface receptor expression between the mutant FCγRII COS-7 cell transfectantβ. The binding of 8.2 was determined in a direct binding assay as described for the human IgGl-dimer binding assays.
RESULTS Chimeric receptors identify multiple regions of FCγRII involved in IgG binding.
In order to determine the roles of domain 1 and the B-C or C'-E loop regions of domain 2 in the binding of IgG by human FCγRII, chimeric receptors were generated whereby each of these regions in FCγRII were replaced with the equivalent regions of the human FcεRI a chain. Chimeric receptor cDNAs were constructed by SOE PCR, subcloned into the eukaryotic expression vector pKC3 and transiently transfected into COS-7 cells. The IgG binding capacities of the chimeric receptors were determined by both EA rosetting and the direct binding of dimeric hlgGl. The substitution of FCγRII domain 1 with that of the FcεRI a chain produced a receptor (designated DlεD2γ) which aβ expected retained the capacity to bind the highly sensitised IgG-EA complexes (Fig. la), however in contrast to the wild-type receptor did not bind dimeric-hlgGl (Fig. 2) . Similarly, the replacement of the region of the FcεRl α chain comprising residueβ Ser109-Val1" (B-C loop) or Ser130-Thr135 (C'-E loop) of FCγRII domain 2 with the equivalent regions of the FcERI a chain (producing chimeras γl09-116ε and γl30-135ε reβpectively), alβo reβulted in the loss of hlgGl-dimer binding (Fig. 2), yet these receptors retained the ability to bind IgG-EA complexes (Fig. lb,c) . COS-7 cells transfected with an expressible form of the Fc-RI α chain (17) did not bind either hlgGl dimers of IgG- EA (Fig. Id, Fig. 2). Thus the ability of chimeric FCγRII containing domain 1 or B-C, C'-E domain 2 substitutions to bind the highly substituted EA complexes but not dimeric- hlgGl, suggests that these receptors bind IgG with a lower affinity than wild-type FCγRII. These findings demonstrate that although the domain 1 and domain 2 B-C, C'-E regions do not seem to directly bind IgG, they do appear to make a contribution to the binding of IgG by FCγRII.
Fine structure analysis of the B-C and C'-E loops of FCγRII domain 2. The contribution of the B-C and C'-E loop regions of FCγRII to the binding of IgG waβ determined uβing a point mutageneβiβ strategy where individual residueβ in both the B-C (residues Lyβ113-Valx") and C'-E (reβidues Phe129-Pro134) loops were replaced with alanine. cDNAs encoding the mutant receptors were alβo generated uβing SOE PCR and subcloned into the eukaryotic expression vector pKC3. The resultant expreβsion constructs were transiently transfected into COS-7 cells and the Ig binding capacity of the mutant receptors determined by assessing the binding of dimeric hlgGl. The levels of cell membrane expression of the mutants on the COS-7 cell transfectantβ were determined uβing the anti-FCγRII mAb 8.2 (shown to detect an epitope distant to the binding site) and were comparable to the of the wild-type receptor (βee legend Fig. 3) . The relative capacity of the mutant receptorβ to bind hlgβl were determined uβing the direct binding assay following correction for variation in cell surface expression levels, and expressed aβ percentage of wild-type FCγRII binding.
The replacement of the B-C loop reβidueβ (Lye113, Val114, Leu115, Pro114) in turn with Ala, in each case reβulted in diminished hlgGl-dimer binding (Fig. 3) . The most dramatic effect waβ seen on substitution of Lys113 and Leu115, which exhibited only 15.9 + 3.4 (mean + SD) and 20.6 -i- 4.0 percent binding compared to wild-type FCγRII. The replacement of Val114 or Pro115 with Ala had a lesser effect, these receptors displaying 53.5 + 13.5 and 73.5 + 7.9 percent wild-type binding reβpectively. Theβe reβultβ suggest that each of these residueβ in the B-C loop contribute to the binding of IgG by FCγRII, whether aβ direct contact reβidueβ or indirectly by maintaining the correct conformation of the binding site. Alanine replacement of residueβ 129 to 134 of the C'-E loop (Phe129, Ser130, Arg/Hiβ131, Leu132, Asp133, Pro134) also suggeβtβ thiβ region playβ a role in the binding of IgG by FCγRII. Substitution of Phe129 and Arg/His131 decreased hlgGl-dimer binding by over 90% and 80% reβpectively to 8.2+ 4.4 and 21.9 + 3.9 compared to that of wild-type FCγRII (Fig. 3). In contraβt, replacement of reβidueβ Asp133 and Pro134 increased binding to 113.5 + 8.8 and 133.5 + 0.2 percent of the wild-type receptor. The substitution of Ser130 or Leu132 had no significant effect on the binding of hlgGl, as these mutants exhibited comparable binding to wild-type FCγRII (Fig. 3). Theβe findings suggeβt Phe129 and Arg/Hiβ131 may play an important role in the binding of hlgβl, and the observation that the substitution of Asp133 and Pro134 increaβe binding alβo suggeβt an important role for these reβidueβ, which appears different from Phe129 and Arg/His131. Again, a distinction between a posβible direct binding role or contribution to structural integrity of the receptor cannot be made, however these findings clearly identify both the B-C and C'-E loopβ aβ playing a role in the binding of IgG by FCγRII. The positions of the residueβ proposed to have binding roles on the putative domain 2 model suggests that it is the region of the B-c-C-E-F-β face forming the interface with domain 1 that is involved in the contact of FCγRII with IgG (Fig. 4).
DISCUSSION The findings presented herein provide evidence to suggest that the interaction of IgG with hFCγRII involves multiple regions of the receptor. Of the entire extracellular region, only the 154-161 segment was demonstrated to directly bind IgG, since insertion of only this region into the corresponding region of the human FcεRl a chain, imparted IgG binding function to FcεRl. Moreover, replacement of this region in FCγRII with that of FcεRIa resulted in loss of IgG binding, implying that residueβ Aβn"4 to Ser141 of FCγRII compriβeβ the key IgGl interactive site of hFCγRII. However, the generation of further chimeric hFCγRII/FcεRIa receptors aβ deβcribed in thiβ application haβ suggested that two additional regions of hFCγRII domain 2, although not directly capable of binding IgG, also influence the binding of IgG by hFCγRII. The replacement of the regions encompassing Ser109 to Val116 (B-C loop) and Phe129 to Pro134 (C'-E loop) of hFCγRII with the equivalent regions of the FcεRI a chain, produced receptors which despite containing the putative binding site (Asn154 to Ser"1) and retaining the ability to bind Igβ-EA, lost the capacity to bind dimeric hlgGl. Indeed, site-directed mutagenesis performed on each individual residue of the 109-116 and 129-134 regions identified a number of residues which appear to play crucial roles in hlgβl binding by FCγRII. The replacement of Lys113, Pro114, Leu115 and Val1" of the B-C loop, and Phe129 and Arg/His131 of the C'-E loop with alanine, all resulted in diminished hlgβl binding. Therefore, theβe findings provide strong evidence to suggeβt that the B-C and C'-E loops of hFCγRII also contribute to the binding of IgG.
The findings described herein suggeβt the nature of the reβidue at 131 playβ a role in the binding of hlgβl, aβ replacement with alanine reβultβ in a marked reduction in binding of thiβ iβotype to hFCγRII. Thus, although the F-β loop of hFCγRII iβ clearly the major region involved in the direct interaction with Igβ, aβ demonβtrated in that only thiβ region haβ been definitively shown to directly bind Igβ (20), residue 131 alβo appears to play a binding role.
The molecular model of the entire FcγRII shows that the regions involved in Ig binding are located on the βame face of domain 2 and at the interface between domains 1 and 2. Furthermore, this also indicates that the A/B and E/F loops of domain 1 aβ well aβ the strand connecting domains 1 and 2 (β/A strand) are located in the βame region (intβrdomain interface) and contribute to the binding area of the domain. Thiβ area forms a hydrophobic pocket and development of receptor antagoniβtβ would be targeted at thiβ region.
Furthermore βince FcγRH and FcεRl aβ well aβ other FCR are homologous then their overall structure and general principles of the location of the binding βiteβ would be similar to that discloβed in thiβ application.
The studies described herein demonstrate that domain 1 of hFCγRII, although does not appear to play a direct role in Igβ binding, does play an important role in the affinity of Igβ binding by hFCγRII. This is suggested as replacement of domain 1 of hFCγRII with domain 1 of hFcceRI, reduced the capacity to bind IgG, as shown by the failure of this receptor to bind dimeric hlgβl. Theβe data imply that the Igβ binding role of domain 1 iβ likely to be an influence on receptor conformation, stabilizing the structure of domain 2 to enable efficient Igβ binding by hFCγRII. This proposal is consistent with the localisation of the Igβ binding site of hFCγRII to loop regions in domain 2 at the interface with domain 1. The binding site is therefore in close proximity to domain 1 and as βuch predicted to be influenced in conformation, presumably by the loop and βtrand region at the bottom of domain 1 i.e. G βtrand, and the λ-B, E-F and C'-C loopβ.
Further support for the involvement of the B-C and C'-E loops of hFCγRII domain 2 in the binding of Igβ haβ been provided in the cloning and subsequent Ig binding studies of rat FCγRIII (38), which is structurally and functionally homologous to FCγRII. Two rat FCγRIII isoformβ, IIIA and IIIH, which have extensive amino acid differences in their βecond extracellular domains, have been shown to bind rat and mouse IgG subclasses differently. Both isoformβ bind rtlgβl rtlgβ2b and mlgGl, however differ in that only the IIIH form bindβ rtlgβ2b and mlgβ2b. Significantly, the amino acid differences between rat FCγRIIIλ and IIIH isoforms are βituated predominantly in the predicted B-C and C'-E loopβ of domain 2 (Fig. 5). However, it should be noted that the F-G loop regions of rat FCγRIIIA and IIIH are almost totally conserved, which together with the observation that both forms bind rtlgGl rtIgG2a and migβl, is conβiβtent with the propoβal that the F-G loop region iβ the major Igβ interactive region, and that the B-C and C'-E loop regions provide supporting binding roles.
It is interesting to note that a number of parallels are alβo apparent in the molecular basis of the interaction of hFCγRII with Igβ and that of hFcεRI with IgE. The Ig binding roles of the two extracellular domains of hFc.RI are similar to hFCγRII, with domain 2 responsible for the direct binding of IgE and domain 1 playing a supporting structural role (17,26). Furthermore, aβ described for hFCγRII, we have also identified multiple IgE binding regions in domain 2 of hFc.RI. Using chimeric hFCγRII/FcERI receptorβ we have demonβtrated that domain 2 of hFc.RI contains at least 3 regions each capable of directly binding IgE, aβ the introduction of the FcεRI regionβ encompassed by residueβ Trp*7 to Lys12*, Tyr129 to Asp135 and Lys154 to Gin141 into the corresponding regions of hFCγRII waβ found to impart IgE binding to hFCγRII (17, 20) . Theβe data suggeβt at leaβt 4 regionβ of hFcεRI domain 2 contribute to the binding of IgE, Ser93 to Phe104, Arg111 to Glu12S, Tyr129 to Asp135 and Lys154 to He"1. Three of theβe regionβ correspond to the 3 regions identified herein aβ important in the binding of Igβ by FCγRII, Arg111 to βlu125, Tyr129 to Aβp135 and Lye154 to He"1, which encompass the B-C, C'-E and F-β loopβ reβpectively. Thus, as described herein for hFCγRII, theβe findings implicate the B-C, C'-E and F-β loops juxtaposed in domain 2 at the domain 1 interface, as the crucial IgE interactive region of hFcεRI.
EXAMPLE 2 Characterisation of Domain 2 of FcYRH MATERIALS AND METHODS
Mutants were constructed and constructs used to transfect COS cells as in Example 1.
RESULTS AND DISCUSSION
Additional mutants of domain 2 of FcγRH were made. Three point mutations where a single amino acid residue was changed to alanine were conetrueted. The mutant cDNAs were used to transfect COS cells and tested for the ability of the proteins encoded by the mutants to bind human Igβl dimers. Mutations at λsn123 and Gly124 has no effect on binding whereas mutation at Lys135 was found to decrease binding (data not shown) . The amino acid residueβ tested are found in the space between the C and the C loopβ. The results indicate that the 123 and 124 positions do not contribute to binding site and that the 125 position iβ involved in binding. Construction of C - C hFcγRII Ala point mutant CDNAs
Asn123-Ala, CC-01 + EG5 and CC-02 + NRl βly12*-Ala, CC-03 + Bβ5 and CC-04 + NRl Lys125-Ala, CC-05 + Eβ5 and CC-06 + NRl
Oligonucleotide sequences and their positions of hybridization with the FcγRII a1"1 cDNA are as follows:
CC-01, 5'-CATTCTTCCAββCAββAAAATCCCAβ-3', (nucleotide position 467-498);
CC-02 5'-CTβββATTTTCCTβCCTββAAGAATβ-3' , (467-494) CC-03 5'-CTTCCAβAATβCAAAATCCCAβAAATTC-3', (473-500) ; CC-04 5'-GAATTTCTGββATTTTβCATTCTββAAβ-3', (473-500) ; CC-05 5' -CCAβAATββAβCATCCCAβAAATTC-3', (476-500); CC-06 5' -βAATTTCTβββATβCTCCATTCTββ-3', (476-500).
EXAMPLE 3 Comparison of the binding of human Igβl and IgG2 to the Alanine mutants of FcYRH
The binding of human Igβ2 waβ alβo assessed and some βimilaritieβ and differences in the nature of mutations that affect binding of Igβl or IgG2 were observed (Fig.7). Mutations of Lys113, Pro114, Leu115, Phe129, Hie131,
I155, G156 decrease Igβl and Igβ2 binding.
Mutation of Val11* decreases Igβl binding only. Mutation of Ser130, Leu132, Asp133, Pro134, Tyr157 reduces Igβ2 binding only. Mutation of Thr1" and Leu159 alβo enhances Igβl and IgG2 binding.
EXAMPLE 4 The IgE Binding Site of Fc.RI
Similar experiments to those described for the
Igβ receptor FCγRII were performed on the IgE receptor, FcεRI.
Three regionβ of the IgE receptor were the target of mutagenesis experiments. Theβe regionβ defined by reβidueβ 112 to 116, 129 to 134 and 154 to 161 are located in the βecond domain of Fc-RI. The experiments where performed wherein individual amino acid reβidueβ were mutated to alanine and the effect on IgE binding measured. Mutation of the FcεRI was performed by splice overlap extension on described for the FCγRII uβing the oligonucleotideβ βhown in Fig. 5.
Mutation of Tyr131 or Glu132 profoundly decreased the capacity of Fc.RI to bind IgE (Fig. 6) . By contrast mutation of Trp130 resulted in enhancement or improvement of IgE binding by Fc.RI.
Mutation of the residueβ in the segment from (and including) residue 154-161 alβo showed that mutation of Val155 completely ablated binding and mutation of Leu1" or Asp1" alβo decreased IgE binding. Furthermore mutation of Trp156, Tyr"0 or Glu"1 enhanced IgE binding to FcεRI. Since domain 1 is alβo involved in Ig binding and βince we have developed a molecular model of FCγRII and since we know FCγRII and FcεRI are highly related proteins it is likely that similar regions of FceRI domain 1 to those of FCγRII will be involved in binding i.e. in Fc.RI the, A/B loop residues λsn10 - Aβn21, C/C loop, reβidueβ Aβn42 - Glu47 and the E/F loop reβidueβ Lye59 - Asp*2.
On the basis of these studies it is clear that certain residueβ have a major role in FcεR interaction and that manipulation of theβe residues would be useful in the production of uβeful pharmaceutical or diagnoβtic reagentβ. Thuβ mutation of Tyr131, Glu132, Val155, Leu1", Aβp1" all decrease IgE binding. Conversely mutation of Trp130, Trp154, Tyr160 or Glu161 all improve FcεRI function since these mutant receptors are able to bind IgE more effectively than the wild type receptor.
EXAMPLE 5 Effect of Chimeric Receptors on IgE Binding MATERIALS AND METHODS
Chimeric receptors were made as described in Example 1. Chimeric receptors were produced which have Domain 2 of the FcεRII but have varying components in Domain 1. The terminology is as follows:
εεγ : denoteβ a receptor with Domainβ 1 & 2 from FcεRI and a tranβmembrane region from FcγRII. This wa used aβ a control. γεγ : denoteβ a receptor with Domain 1 from FcγRII,
Domain 2 from FcεRII and a tranβmembrane region from FcγRII. G : denotes γεγ which contains the β strand from FcεRl
EF : denoteβ γεγ which contains the E/F loop from
FcεRl CC : denotes γεγ which contains the CC loop from
FcεRl
The oligonucleotides used to create the above chimeric receptors were as follows :
CC NRl + LR3
LR4 + EG5
EF NRl + EG32
EG33 + EG5
NRl + LR1
LR2 + EG5
NRl and EG5 are aβ deβcribed in Example 1.
Antiβenβe LR1 5 ' - ββTTCACTβAββCTββTCTββC-3 '
Sense LR2 5 ' - CAβCCTCλβTβAACCTβTβTACC-3 '
Antisenβe LR3 5 ' - CβTCTCTTCTβACAββCTβCCATTβTββAACCAC-3
Sense LR4 5 ' - βTCAβAλβAβACβAATTCACCCAβCTACAββTCC-3
Antiβenβe EG32 5 ' - AJU.τ τααcAττcACAATAττcAAcκ:ταGGCταcoτoτoo-3 ' Sense EG 33 5 ' -
AATATTGTβAATβCCAAATTTβAAβACAβCββββAβTACAC- 3 ' The efficiency of binding of the chimeric receptors to IgE was asβayed uβing IgE coated erythrocytes on monolayers of COS cells transfected with cDNA encoding the constructβ deβcribed directly above. Radiolabelled Fc portion of IgE waβ uβed in the study of the chimeric receptors.
RESULTS & DISCUSSION
The resultβ of the rosetting assay showed that the cells transfected with the CC chimeric construct rosette lees well (data not shown) than the other transfectants.
The chimeric receptors were subjected to a quantitative assay using radiolabelled Fc portion of IgE
(see Figure 8) . The chimeric receptor γεγ restores binding to the βame level aβ that βeen in the normal receptor (εεγ in thiβ case) . This implies that the EF and the β regions are important in binding in FcεRII.
EXAMPLE 6 Production of a soluble polypeptide with Fc binding ability and production of the FCYRH Fusion Protein
Two examples of the genetically engineered polypeptide of the invention are recombinant soluble FcγRII (which consists only of the extracellular domains of FcγRII) and a fusion protein consisting of human serum albumin genetically fused to the extracellular domainβ of FcγRII.
The recombinant soluble Fc receptor (rec. sFCγRII) can be generated using standard mutagenesis techniques including splice overlap extension (SOE) as described earlier. The FcγRIIcDNA or genomic DNA or a combination thereof iβ mutated βuch that a translation termination codon (e.g. TAA,τβA OR TAG) is inserted into the DNA in a position that will terminate the translation of RNA derived from such mutant DNA to yield proteins containing the Ig binding extracellular region without the tranβmembrane anchoring segment.
Thus a molecule was generated by using SOE to introduce the codon, TAG, 3' of the residue 170. This mutated DNA was introduced into several expression systems and a polypeptide with Fc binding ability was obtained. The expression systems included CHO cells, fibroblasts, a yeast ( Pichia pastor is) and bacculovirus. The molecular weight of the rec.sFcγRII varies according to the expression system, ie. 30 KD from CHO cells or 26 KD from Pichia pastor is . Thiβ is due to differences in glycosylation. Clearly many other expression systems could be used including bacteria, plants and mammals.
The second example of a polypeptide of the present invention is a fusion protein which is produced by fusing DNA encoding a polypeptide with Fc binding ability to DNA encoding a different protein to generate a new protein which retains Fc binding ability. Such new protein would include human serum albumin fused to FcγRII. This protein can be generated using SOE to fuse the DNA encoding HSA to FcγRII. This is done in such a way that the residues near the C terminus of HSA are fused to amino acid residues in the amino terminus of FcγRII. It iβ important to note that although in this example FcγRII encoding DNA is uβed in the fusion protein, it is alβo possible to use DNA encoding other proteinβ βuch aβ the DNA encoding the Fc receptor-like moleculeβ deβcribed earlier.
MATERIALS & METHODS
The HSA:FCγRII fusion protein was produced according to the following method. Oligonucleotides HT4 an HT7 were used to amplify the HSA DNA. HT4 contains the restriction site (Eco Rl) for cloning and HT7 containβ a βequence that overlapβ with FcγRII. The sequences are as follows:
HT4 5' ATCGATGAATTCATβAλβAAβTββTβββTAAC 3' HT7 5' βββββAβC/βCCTAAββCAβCTTβAC 3' The Eco Rl restriction site is shown in bold in HT4 above. Just adjacent to this iβ the ATβ which iβ the HSA βtart codon. A slash in the HT7 sequence shown above denotes the FcγRII-HSA junction. Oligonucleotides HT8 and HT5 were used to amplify the required segment (extracellular domains) of FcγRII. HT8 containβ a βequence that overlapβ with the HSA βequence (and alβo oligonucleotide HT7). HT5 alβo containβ a translation termination codon as well as a reβtriction βite (Eco Rl) for cloning purposes. The sequences of the oligonucleotides are as follows :
HT8 5'S CCTTAββC/βCTCCCCCAAAββCTβ 3'
HT5 5' CCCCATCATGAATTCCTATTββACAβTβATβ 3'
The slash in the HT8 sequence shown above denotes the junction between HSA and FcγRII encoding DNA.
The Eco Rl site in HT5 iβ denoted by bold type. The termination codon, CTA iβ adjacent to the Eco Rl βite. Note that HT7 and HT5 are antiβenβe sequences.
The constructs made were used to transform Pichia pastoris cells. Western blots of the proteins expressed were conducted.
RESULTS & DISCUSSION
A Western blot was performed using a polyclonal anti-FcγRII antibody. The supernatants from the transformed yeasts were tested with the antibody and the resultβ demonstrated that only the supernatants from HSA:FcγRII transfected cellβ and the cell tranβfected with a construct encoding soluble FcγRII reacted with the antibody. The controls did not react (reβultβ not shown) . The Western blotting detected a protein of approximately 100KD which is of the expected molecular weight being 67KD from HSA plus 30kD from FcγRII extracellular domains. A recombinant FcγRII of 30kD was alβo detected by the antibody. The 100KD protein produced bound to immunoglobulin coated beads but not to Fab'2 coated beads indicating that it haβ specificity for the Fc portion of IgG. In addition sequencing of the SOE produce confirmed the predicted sequence of the fusion protein as shown in Fig. 12.
It is clear that FcγR extracellular domains can be attached to additional moleculeβ and still retain Fc receptor activity. Since there are a number of Fc receptors closely related to the FcγRII, especially in their Ig binding extracellular regionβ, it iβ clear that modifications of the type described for FcγRII would alβo be possible for these other Fc receptors such as FcγRI, FcεRl, FcγRIII and FcαRI. This appears to be particularl the case when the receptors mentioned immediately above have essentially the same number of amino acids in the extracellular regionβ. In addition the FcεRl, FcγRII, FccxR and FcεRIII all have extracellular regionβ that are organised into two di-sulphide bonded domains that are members of the immunoglobulin super family. Furthermore, the ligands for FcγRII, FcγRHI, FcεRl and FcαR are all homologous.
It is alβo clear that the non-Fc binding portion of the fusion protein may be attached to the other species receptors discussed above. The "foreign" component of the fusion protein may be an immunoglobulin provided that the immunogolobulin would be a type unable to bind the Fc binding portion of the fusion peptide. For example, the extracellular portion of FcγRII could be attached to IgM o the extracellular portion of FcεRl could be attached to IgG. Other foreign protein components could include ovalbumin, other Fc receptors, compliment, other recombinant derived proteinβ including CD46, CD59, DAF, CRI, CR3 and proteinβ especially those involved in regulating inflammation including cytokines and complement regulating proteins. The receptor could also be attached t other high molecular weight entities. Although the above experiments contemplate production of polypeptides according to the invention via recombinant means it is alβo possible that polypeptides according to the invention could be generated by other non- recombinant means. This could be achieved by chemical means βuch aβ attaching the Fc binding portion of the protein to other molecules such as dextrans, lipidβ, and carbohydrates with the proviso that the moleculeβ produced retain Fc binding ability. Figure 9 shows that HSA-FcγRII iβ specific for immunoglobulin, and that the fusion protein iβ correctly folded βince the epitopes detected by the monoclonal antireceptor antibodies are intact. It also demonstrates that HSA-FcγRII binds mouse IgGl (mγl), Igβ2b (γ2b) and human Igβ (HAGG) but it does not bind IgG lacking an Fc portion (1302) .
EXAMPLE 7 HSA:FcYRII adminiβtered to an animal.
Figure 10a deplete curves showing the clearance of the HSA:FcγRII fusion protein from the blood of mice. The animals were injected with either HSA:FcγRII fusion protein or soluble FcγRII and the disappearance from the circulation measured. The conclusions are that the half life of the receptor FcγRII is approximately 40 minutes whilst that of HSA:FcγRII is 140 minutes. Also the HSA:FcγRII persists for many hours, eg. 9% of the dose was present after 8 hours and 7% at 24 hours, in contrast, all the soluble FcγRII was excreted.
The appearance of any receptor or fusion protein in urine was monitored (Fig. 10b) . The soluble FcγRII appeared very rapidly whereas there was no detectable fusion protein in the urine, ie. this was not excreted.
EXAMPLE 8 Method of Removing Immunoglobulin From a
Sample The FcR or a mutant or fusion protein thereof is attached to a solid support. When this method iβ uβed in plasmaphoresis the solid support will be a membrane or the like. The substrate may be silica βuch aβ in thiβ Example. Human albumin (native) and HSA:FcγRII were coupled to βilica beads in two separate preparations. The coupling of the protein to produce a reagent in accordance with the preβent invention may be achieved by standard methods. In the present Example the hydroxyl groups on the silica beads were replaced by amino groups via an exchange reaction with 3-aminopropyltriethyoxysilane (APTS) . This activates the βilica beads. The protein was mixed with a carbodimide (such as EDC) and added to the activated silica beads. Carboxyl groups on the protein combine with the carbodiimide to form an O-acylisourea derivative which in turn reacts with the amino groups on the βilica beads to form an amide with elimination of the urea derivative.
In a different version of preparing the reagent, the protein and carbodiimide were reacted in the presence of N-hydroxysuccinimide to form a more stable amino- reactive intermediate, β-mercaptoethanol was added to quench the unreacted carbodiimide. The protein succinimide derivative was then added to the activated βilica beads.
The preparation of human albumin attached to silica and HSA:FcγRII attached to βilica waβ carried out as follows:
50 mg NH2-silica beads
0.9 mg of HSA OR HSA-FcγRII
30 mg of EDC in mPBS pH6 (4ml) incubated o/n at 4°C Table 2
In 2 parallel tubeβ with HSA (plus 12bl HSA)
3 waβheβ mPBS 3 waβheβ 0.1m NaHC03 (PH 7.4) (pH 8.3)
+EDC 85% bound 72% bound -EDC 30% bound 14% bound
Table 2 shows that after conjugation of HSA to βilica (meaβured by the uβe of tracer labelled HSA in mixture), three waβheβ with NaHC03 were required to remove non-specifically bound material.
EXAMPLE 9 Ability oF HSA:FcγRII to Bind Immune
Complexes MATERIALS & METHODS
Similar to Example 7. Each tube 2μg of βilica matrix conjugated with either l.βμg of the HSA: cγRII fusion protein or HSA in a volume of 1ml of PBS and 0.5% BSA. Three hundred nanograms of either iodinated HAGG or monomeric IgG was added. Additional controls included tubeβ with no βilica to determine non-specific depletion. Samples were taken at the indicated time points and the quantity of label HAGG or monomeric Ig remaining in the supernatant after removal of silica beads waβ determined.
In thiβ Example the ability of one of the proteins of the present invention, HSA:FcγRII to bind immune complexes as represented by HAββ is illustrated.
The ability of the proteins of the present invention to bind one form of immunoglobulin and not another form has important therapeutic implications. The proteins of the present invention have been found to specifically bind immunoglobulin complex as opposed to monomeric Ig.
The binding of immune complexes in the form of HAGG waβ to HSA:FcγRII waβ tested. These reβultβ are described in Table 3.
Table 3
Support Tracer Ligand % Ligand Bound* HSA-FcγRI Hagg 35.5 37 .5 HSA Hagg 4 . 0 5.4
♦bound after overnight at 4°C PBS+0.5 BSA
Table 3 describee the binding of immune complexes in the form of aggregated Ig (HAGG) to the HSA:FcγRIla fusion protein but not to HSA on βilica. The interaction of HAGβ with HSA:FcγRII waβ studied. This iβ shown in Figure 11.
The resultβ shown in Figure 11 indicate that there is a clear difference in the binding of labelled HAGG to HSA:FcγRII compared to binding to HSA. In addition they show that as the concentration of unlabelled competitor HAGβ iβ added, the binding of labelled HAGG iβ progressively inhibited to the level βeen in HSA-βilica.
EXAMPLE 10 Immune Complex Asβay
The polypeptideβ of the present invention are useful in detecting the presence of immune complexes. In this example it iβ clear that the polypeptideβ of the present invention can be uβed to detect immune complexes and that certain modifications may be made to optimise the assays. Two approaches are used in the development of the immune complex assays. The first utilises recombinant soluble (rec.βFcγRII) in combination with anti-Fc receptor antibodies. The second approach uses the HSA fusion protein. The assays described in this example use an ELISA format but the principles apply to any format βuch as chemiluminescence, biosensor, agglutination, etc. MATERIALS AND METHODS IMMUNE COMPLEX ASSAY (ICA)
Coating Microtitre Stripwells with 8.26 Monoclonal Antibody 8.26 monoclonal antibody (mλb) diluted to 5 μg/ml in carbonate buffer pH 10.0. Aliquot 50 ul volumes of diluted 8.26 mλb were placed into Nunc maxiβorp microtitre stripwells and incubated at 4°C for 12 hours. 8.26 mλb coated microtitre βtripwβlls are βtable for at least two weeks.
Binding Capture of Recombinant FcRII
Thiβ βtep iβ performed just prior to aββay. Stripwells were decanted prior to asβay and wash x2 with PBS/0.2%BSA pH7.4. Wells are blocked by adding 200 μl PBS/2%BSA pH7.4 then incubated for 30 min at room temperature. Thiβ waβ decanted and 100 μl recombinant
FcRII waβ added, lμg/ml per well. Thiβ waβ then incubated at 37°C for 30 min. Welle were then washed x4 with PBS/0.2%BSA.
Elisa Assay Standard (100 μl), control or test sample were added per well. A standard curve was prepared by diluting heat aggregated Igβ in PBS. This was incubated at 37°C for 30 min. then waβhed x4 with PBS/0.2%BSA. Working dilution of goat anti-human Igβ alkaline phosphatase conjugate (100 μl) (Sigma) waβ added and then incubated at room temperature for on hour then waβhed x4 with PBS/0.2%BSA. p-nitrophenyl phosphate substrate (Sigma 104 phosphatase tablets:-2.5mg.ml carbonate buffer) (100 μl) was added and this was incubated at room temperature in the dark for 30 min. then the reading waβ taken at OD 405 nm. Note: Sampleβ tested for anti-mouse reactivity by substituting mouse IgG2b (Sigma MOPC-141) for 8.26 mλb.
Fig. 13 shows that ELISA plates were coated with rec.sFcγRII denoted in the figure as rsFcγRH or with HSA:FcγRII fusion protein (denoted in the figure aβ rsHSA- FCR) . λggregated immunoglobulin (HAGG) waβ titrated and bound immunoglobulin detected uβing HRP conjugated anti- human Ig.
Using standard protocols for attachment of proteins to ELISA plates it is clear that "spacing" the protein with Fc binding ability away from the surface improves the activity of the protein. Thiβ can be accomplished by standard methods βuch aβ by uβing an antibody that binds to the polypeptide of the invention or by attaching the extracellular domains of the polypeptide to another molecule βuch aβ a protein, dextran, etc. A uβeful antibody for a spacer is antibody 8.2 or 8.26. The detection of immune complexes in the form of HAGG or in serum of patientβ with rheumatoid arthritiβ iβ improved by uβing theβe approaches. Table III below shows that rec.sFcγRII bound to anti-FcR antibody bindβ preferentially to HAGβ over monomeric Ig (measured OD 405nm) . The monomeric Ig is contaminated with 10-20% aggregates.
Table 4
Monomeric V Heat Aggregated IgG (OD 405 nm) cone RFcRII RFcRII Only RFcRII Igσ* RFCRII + BλOOO ng/ l
750 33 204 1230
500 23 204 1136
250 15 202 1444
125 18 158 1030
62.5 24 122 906
31.3 24 102 80S
Blank 28 59 456
Mostly moncnoric Ig (known contain 10-20% aggregated Ig)
In this connection Fig 14 shows Elisa plates were either coated with anti-FcγRII antibody 8.2 and then with rec.sFcγRII (A) or with rec.sFcγRII (B) . After blocking with BSA serum from a patient with rheumatoid arthritis waβ added and bound immunocomplexeβ resolved uβing HRP conjugated anti-human Ig. Uβing either of the above approaches immune complexes can be detected. Clearly variations on the above methods may be used.
EXAMPLE 11 Immunophoresis Device & Methodβ of Uβe Immune complexes may be removed from the circulation using the polypeptideβ of the preβent invention attached to a βolid βupport in a plaβmaphoreβiβ device, for example. Attachment of βuch polypeptideβ to a βolid βupport βuch aβ βilica waβ discussed earlier in respect of HSA:FcγRII.
To demonstrate that the HSA:FcγRII protein is functional the following tests were conducted. It has been demonstrated that immune complexes (in the form of HAGG) bind to HSA:FcRII and not to HSA or HSA:βilica. See
Figures 11, 14, 15 and 16. Figure 14 demonstrateβ that 1 5I labelled HAGG (A) or monomeric Ig (B) was incubated with HSA:FcγRII-βilica or HSA βilica for up to 20 hourβ at room temperature. Sampleβ were removed at various time points and HAGG or Ig remaining after removal of the silica complexes waβ determined. Figure 15 shows immune complexes are depleted from liquid by incubation with HSA:FcγRII protein-silica resin but not by HSA-βilica resin. We have also demonstrated that monomeric immunoglobulin does not bind to HSA-FcγRII. In thiβ connection βee Fig 16 in which monomeric radio-labelled immunoglobulin does not bind to HSA-FcγRII silica or to HSA-βilica.
EXAMPLE 12 Assay for the Discovery of Antagoniβtβ to
Fc Receptors A cell free system has been devised to detect the presence of compounds that inhibit the activity of Fc receptors. In the present example FcγRII is exemplified but the strategy is equally applicable to other Fc receptors. The principle of the invention iβ to use known or unknown compounds to attempt to inhibit the binding of polypeptideβ with Fc binding ability to immune complexes. The polypeptides of the preβent invention may be labelled directly or indirectly. Theβe polypeptides may be rec.sFcγRII or HSA:FcRII. In the format deβcribed, an ELISA assay is used wherein iimαune complexes are attached to a surface under standard incubation conditions. Polypeptides of the invention are directly labelled with a reporting enzyme, horseradish peroxidase (HRP) and mixed with the putative antagoniβtβ. Thiβ mixture iβ added to the immune complexes and any inhibition of binding of the polypeptideβ of the invention to immune complexes resultβ in a decrease in the colour development when HRP-subβtrate is added as per a standard ELISA.
It is important to note that any reporting substance could be used, eg. radioiodine, other enzymes βuch aβ alkaline phoβphataβe, beadβ or erythrocyte to which the receptor had been attached, flurogenic substances, etc. In the present format HRP is attached to HSA-FcγRII. Our resultβ indicated that when HRP iβ uβed as a label it is necessary to employ a spacer in order to preserve Fc binding ability.
An alternative strategy which requires use of an indirect assay may be employed. In such an asβay the polypeptide of the invention is added to a mixture of putative inhibitors and the mixture is then added to the iπrmune complexes which are attached to a surface. Following an incubation period the surface iβ waβhed and any Fc receptor that iβ bound iβ detected uβing anti- receptor antibody. Any antagonists of the Fc binding ability of the polypeptides inhibit the binding to immune complexes and reduce potential signal.
Specifically the following protocol waβ uβed. HAGG plates were prepared by incubating 50 μl-well HAGβ at 25 μg/ml in coating buffer (0.5M carbonate/bicarbonate, pH9.6), for 16 hours at 37°. Some wells contained no HAAG as a negative control. To prevent non-specific binding to the surface, the wellβ of the plateβ were treated with mPBS containing 1% (w/v) bovine βerum albumin at 3 hourβ at 37°. The wellβ were then rinsed three times by immerβion in mPBS. Sampleβ containing βoluble FcγRII were diluted aβ required and added in a volume of 30 μl. Dilutions of a standard of rec.sFcγRII were made and added in a volume of 30 μl to generate a standard curve. Last, 30 μl of a detection reagent (consisting of a 1/1000 dilution of Amersham (#9310) anti-mouse IgFab'2 fragment HRP conjugate and the anti-FcγRII antibody 8.2 at 0.6 μg/μl (in PBS, 1% BSA) was added and incubated for 1 hour at 37°. The plates were then waβhed by immersion 8 times in PBST. Subsequently ABTS reagent waβ added (100 ml) and read at a 405 nm. The data in Figure 17 demonstrates that rec.sFcγRII produced in iiiammalian cells (CMOrsFcR) or in bacteria (C2rsFcγR2) or even as a fusion protein with a bacterial maltose binding protein (C2MBPrsFcR) can be uβed in thiβ assay. The specificity of the asβay is demonstrated by the fact that the molecule comprising a single FcγRII domain (d2) βhowβ no detectable binding to immune complexes.
It should be noted that in both examples it is posβible that other receptors could be used to detect binding to other immunoglobulin classes and immune complexes βuch aβ IgE and FcεR, IgM and FcμR or FcγRIII or FcγRII and Igβ complexes.
We have been able to demonstrate that the above method and variations thereof are able to usefully detect compound that inhibit the interaction of FcγRII with immune complexes.
Specifically the following method has been uβed. HAGG plateβ were prepared by incubating 50 μl/well at 25 μg/ml in coating buffer for 16 hourβ at 37°C. A negative control containing no HAAG waβ alβo prepared. To prevent non-specific binding to the βurface, the wellβ of the plateβ were treated with mPBS containing .5% (w/v) Tween 20 (for library screening) or 1% (w/v) bovine serum albumin for 3 hours at 37°C.
The specificity tests for inhibition of binding of rec.sFcγRII were conducted as follows. Wellβ were rinβed 3 times by immersion in mPBS containing 0.05% (w/v) Tween 20 (PBST). Serial 1:2 dilutions in a volume of 25 μl of rec.βFcγRII (purified from supernatants of CHO cells tranβfected with DNA encoding rec.sFcRII) with βtarting concentration of 45 μg per μl. The HRP conjugated HSA:FcγRII fuβion protein waβ added (25 μl at 1:100 dilution) . Thiβ corresponds to approximately 4 μg/μl or 40nM wrt rsHSA-FcγRII fusion HRP-conjugate. Thiβ waβ incubated for 1 hour at 37°C.
Screening of the libraries of compounds or biological preparations the inhibition of Fc binding activity were conducted as followβ. Wellβ were rinβed three times by immmersion in mPBS containing .05% w/v Tween 20 (PBST) . Solutions (2 μl) containing compounds were added to a solution containing HRP conjugated HSA:FcγRII fusion protein (100 μl at 1:200 dilution). This corresponds to approximately 4 μg/μl or 40 nM wrt rsHSA- FcγRII fusion HRP-co jugate) . Thiβ was incubated for 1 hour at 37°C then 90 μl was transferred to a plate containing HAGG as defined above. Screening biological preparations or libraries for inhibition of Fc binding ability (second version) . Wells were rinsed by immersion of PBS as described above. Serial dilutions of the solution (patients sera or libraries of compounds) in 100 μl of mPBS containing 1.0% BSA (w/v) were incubated for 1 hour at 37°C, plateβ were washed 4 times in PBS and then the HRP conjugated HSA:FcγRII fusion protein was added (50 μl at 1:100 dilution) . This corresponds to approximately 8 μg/μl or 80 nM wrt rsHSA:FcγRII fusion protein HRP-conjugate. This waβ incubated for one hour at 37°C. The plateβ were then waβhed by 5 times immersion in PBST. ABTS reagent (100 μl) was added and this was read at A405nm. Data (not shown) was generated by using rec.FcγRII to specifically inhibit the binding of HRP conjugated HSA:FcγRII protein to immune complexes that were attached to the plate surface. As increasing quantities of the rec.sFcRII were added to the assay the amount of HRP- HSA:FcγRII binding to HAGG decreased. Theβe results indicated that the binding of the HRP-HSA:FcγRII fusion protein to immune complexes iβ specific and that inhibitorβ of the interactions between FcγRII and immune complexes can be detected.
In another experiment (Fig 18) the presence of inhibitors of FcγRII:immune complex interactions were identified in the sera of patients. In theβe caβeβ the βera were titrated in the HAGG coated eliβa plateβ and HRP- HSA:FcγRII fusion protein was added. Clearly the βera of the patientβ containing rheumatoid factors inhibit the binding of the HRP-HSA:FcγRII protein to immune complexes. Thiβ iβ indicated by a reduction in the abβorbence compared to that obtained uβing normal βera (column 15) . In another experiment the HRP-HSA:FcγRII waβ uβed to βcreen a library of organic compounds. Thiβ library waβ produced by standard chemistry aβ deβcribed in Simon et al PNAS 89 :9367 (1992) "Peptoids A Modular Approach to Drug Discovery". In this a collection of synthesised compounds is produced and the capacity of individual compounds (or sets of compounds) to inhibit the binding of HRP-HSA: cγRII to immunogoblin iβ assessed by preincubating the library components (the compounds) with HRP-HSA:FcγRII fuβion protein or any other polypeptide of the preβent invention. The polypeptideβ may be specific for other classes of immunoglobulin βuch aβ IgE or IgA. The HRP-HSA:FcγRII iβ mixed with the compounds and the effect on binding to HAGβ (or any immune complex) is determined aβ described directly above. Inhibition of binding iβ indicated by decreased absorbence compared to the control (no inhibitor) . The resultβ of βuch an experiment are given in Fig 19. This shows a di-peptoid library which was screened as deβcribed above. As an example of the type of results obtained, the maximum binding is indicated by an absorbance (at 540 nm) of .619 units. In the presence of compound TCI this absorbance value falls to .3085 which iβ equivalent to the background value, .304. TCI completely inhibits the interaction with immune complexes of the HRP polypeptide conjugate. In addition some compounds clearly do not inhibit the interaction, for example RBI. Incubation of the conjugate with RBI does not inhibit the interaction since an absorbance of .597 waβ obtained which iβ similar to the maximum binding (.619) obtained by the conjugate binding to HAGG in the absence of any inhibitor. It should be noted that theβe functional aββayβ can be uβed to βcreen for inhibitors of Fc receptor function either by binding to the Fc receptor or by binding to the immune complex (IgA, IgE, IgG, IgM, IgD) at the site where the Fc receptors bind. Thiβ βecond type of antagoniβt does not fit the classical definition of an antagonist of Fc receptor function, however, it iβ still within the scope of the present invention in as far as the preβent invention relateβ to a method of testing compounds for their ability to inhibit Fc receptor function and to the antagonists per βe identified by βuch a method.
REFERENCES
1. Unkeleββ, J.C., & Frββdman V.H. Ann. Rev. Immunol., 1988 j6_ 251-281.
2. Van de Winkel, J.β.J. & Anderson, CL. J. Leuk. Biol., 1991 49.511-524.
3. Ravetch, J.V. & Kinet, J.-P.
Ann. Rev. Immunol., 1991.9 457-492.
4. βraziano, R.F. & Fanger, M.W.
J. Immunol., 1987 1313536-3541. 5. Anderβon, C.L., Shen, L., Eicher, D.M., Wewerβ, M.D. &
Gill, J. K.
J. Exp. Med., 1990 171 1333-1345. 6. Rigley, K.P. & Klaus, G.B.
Bur. J. Immunol., 1989 JL9.481 7. Stuart, S.G., Trouβtine, M., Vaux, T., Koch, T.,
Martens, C, Mellman, I. & Moore, K. W.
J. Exp. Med., 1988 166 1668-1684.
8. Hibbs, M.L., Bonadonna, L. Scott, B.M., McKenzie, I.F.C & Hogarth, P.M. Proc. Natl. Acad. Sci. (USA), 1988 85.2240-2244.
9. Stengelin, S., Stamenkovic, I. & Seed, B. . EMBO J., 1988 T_ 1053-1059.
10. Brooke, D.G., Qiu, W.Q., Luster, A.D. & Ravetch, J.V. J. Exp. Med., 1989 17_0.1369-1385. 11. Stuart, S.G., Simister, N.E., Clarkson, S.B.,
Shapino, M. & Mellman, I.
EMBO J., 1989 3657-3666. 12. Allen, J.M. & B. Seed.
Science, 1989 243 378-381. 13. Simmons, D. & Seed B.
Nature, 1988 333 568-570.
14. Ravetch, J.V. & Perusβia, B.
J. Exp. Med., 1989 170 481-491.
15. Shimizu, A., Tepler, I., Bemfrey, P.N., Berenstein, E.H. and Leder P.
Proc. Natl. Acad. Sci. (USA), 1988 JJ5_ 1907-1911. 16. Maliszewβki, C.R., March, C.J., Shoenborn, M.A., Gimpel, S. & Li, S.
J. Exp. Med., 1990 17 1665-1672.
17. Hulett, M.D., McKenzie, I.F.C. 6 Hogarth, P.M. Bur. J. Immunol., 1993 23.640-645.
18. Hogarth, P.M., Hulett, M.D., lerino, F.L. Tate, B., Powell, M.S. & Brinkworth, R.I.
Immunol. Rev., 1992 125 21-35.
19. lerino, F.L., Hulett, M.D., McKenzie, I.F.C. & Hogarth, P. M.
J. Immunol., 1993 150.1794-1799.
20. Hulett, M.D., Witort, E., Brinkworth, R.I., McKenzie, I.F.C. & Hogarth, P.M.
J. Biol. Chem., 1994 269.15287-15293. 21. Tax, W.J.M., Willems, H.W., Reekerβ, R.W. Capel, P.J.A. & Koene R.A.P. Nature, 1983104.445-447.
22. Warmerdam, P.A., Van de Winkel, J.β.J., Vlug, A., Westerdaal, N.λ.L. & Capel, P. J. A. J. Immunol., 1992 1411338-1343.
23. Tate, B.J., Witort, E., McKenzie, I.F.C. & Hogarth, P.M.
Immunol, and Cell Biol., 1992 70.79-87.
24. Hibbβ, M.L., Hogarth, P.M. & McKenzie, I.F.C. (1985) Immunogenetics, 1985 22.335-348.
25. Lah, M., Quelch, K., Deacon, N.J., McKenzie, I.F.C. & Hogarth, P.M.
Immunogenetics, 1990 21_ 202-206.
26. Robinson, M.W. J. Biol. Chem., 1993 268.12736-12743.
27. Horton, R.M., Hunt, H.D., Ho, S.N., Pullin, .K. & Pearβe, L.R.
Oene, 1988 11_ 61-68.
28. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 29. Van Doren, K., Hanahan, D., & βluzman, Y J. Virol., 1984 50.606-614 .
30. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. (USA), 1977 74.5463-5467. 31. Kraft, R., Tardiff, J., Krauter, K.S. and Leinward, L.A.
Biotechniques, 1988 6., 544-547. 32. Seed, B., and Aruffo, A.
Proc. Natl. Acad. Sci. (USA), 1987 84 3365. 33. Lopez, A.F., Strath, M. and Sanderson, C.J. Immunology, 1983 48.503-509.
34. Ey, P.L., Prowse, S.J. and Jenkins, C.R. Immunochemistry, 1978.15.429-435.
35. Pietersz, G.A., Kanelloβ, J. & McKenzie, I.F.C. Cancer Res., 48.4469-4476.
36. Parish, C.R. and Hayward, J.A.
Proc. R. Soc. Lond. (Biol.), 1974 187 47-56.
37. Harlow, E. and Lane, D. (1988)
Labelling antibodies. In Antibodies - A Laboratory Manual. Cold Spring Harbor Laboratories. Cold Spring Harbor, NY.
38. Farber, D.L., βiorda, R., Nettleton, M.Y., Trucco, M., Kochan, J.P. & Sears, D.W.
J. Immunol., 1993 50.4364-4361. 39. Hibbβ, M.L., Tolvanen, M. 6 Carpen, O.
J. Immunol., 1994 152 4466-4474. 40. Mallimaci, M.A., Chizzonite, R., βriffen, M.,
Nettleton, M., Hakimi, J., Tβien, W-H. & Kochan, J. P.
J. Biol. Chem., 1993168.22079-22083. 41. Riβke, F., Hakimi, J., Mallamaci, M., βriffen, M.,
Pilβon, B., Tobkeβ, N., Lin, P., Danho, W., Kochan, J.
& Chizzonite, R.
J. Biol. Chem., 1991 266 11245-11251.

Claims

1. An isolated polypeptide with Fc binding ability, wherein the polypeptide is altered compared to a native Fc receptor by addition, deletion and/or substitution of one or more amino acids compared to βaid native receptor and βaid alteration reβultβ in improved characteriβticβ compared to βaid native receptor.
2. The polypeptide of claim 1 which iβ an Fc receptor-like molecule with an altered ability to bind Fc wherein βaid altered ability iβ brought about by alteration of one or more amino acidβ which affect immunoglobulin binding ability.
3. The polypeptide of claim 1 or claim 2 which iβ able to bind Igβ, IgE, IgA, IgM or IgD.
4. The polypeptide of claim 3 wherein the alterationβ are in the firβt and/or βecond domain.
5. The polypeptide of claim 4 wherein the alterationβ are in A/B, C/C and/or E/F loopβ of domain 1 and/or β/A βtrand and where the polypeptide iβ able to bind Igβ or IgE.
6. The polypeptide of claim 4 wherein the alterationβ are in B/C, C'/E, and/or F/G loopβ of domain 2 and where the polypeptide iβ able to bind IgG or IgE.
7. The polypeptide of claim 5 or claim 6 having enhanced ability to bind Fc compared to a native Fc receptor in a given class.
8. The polypeptide of claim 7 wherein the alterations are in the firβt domain at amino acid poβitionβ 133, 134, 158, 159 and/or 160 compared to a native Fc receptor.
9. The polypeptide of claim 8 wherein the amino acids are changed to alanine.
10. The polypeptide of claim 9 wherein Asp133 and/or Pro134 are changed to alanine.
11. The polypeptide of claim 7 wherein the alterations are in the second domain at amino acid positions 130, 156, 160 and/or 161 compared to a native Fc receptor .
12. The polypeptide of claim 11 wherein the amino acids altered are changed to alamine.
13. The polypeptide of claim 12 wherein Trp130, Trp156, Tyr160 and/or Glu 161 are changed to alanine.
14. The polypeptide of claim 4 having a reduced ability to bind immunoglobulin compared to a native Fc receptor in a given class.
15. The polypeptide of claim 1 wherein the polypeptide is altered compared to a native Fc receptor such that the size of the polypeptide iβ larger than βaid native Fc receptor.
16. The polypeptide of any one of claims 1 to 15 which is βoluble.
17. The polypeptide of claim 15 or claim 16 wherein βaid βize is 67 to 1000 kD.
18. The polypeptide of claim 15 in the form of a fusion protein comprising an Fc binding component and a fusion component.
19. The polypeptide of claim 18 wherein the Fc binding component iβ an extracellular region of a native Fc receptor, a portion of βaid native Fc receptor or the polypeptide of any one of claims 1 to 7.
20. The polypeptide of claim 19 wherein the fusion component iβ a physiologically tolerated protein or other molecule selected from the group of human serum albumin, Fc receptor, complement regulating molecules, complement receptors, cytokine receptors, dextran, carbolydrate, polyetheylene glycol and synthetic polymers.
21. The polypeptide of claim 20 comprising HSA:FcγRII.
22. The polypeptide of claim 1 comprising a component capable of detection.
23. The polypeptide of claim 22 wherein the component capable of detection compriβeβ a direct or indirect label.
24. The polypeptide of claim 23 wherein βaid component capable of detection iβ a radiolabel, chemiluminescent label, chromophoric label, a labelled antibody, or a detectable enzyme βuch as horse radish peroxidaβe or alkaline phoβphataβe.
25. A method of testing a compound for its ability to act as an antagonist of an Fc receptor βaid method comprising contacting the compound with a polypeptide with Fc binding ability or a Fc receptor or part thereof under conditions and for a time sufficient to allow any binding of the compound and the polypeptide or Fc receptor or part thereof to take place, and then determining whether bindin has occurred.
26. The method of claim 25 wherein the polypeptide of any one of claims 1 to 7, 14, 15 and 22.
27. The method of claim 25 wherein βaid compound iβ tested for its ability to inhibit binding of Igβ or IgE.
28. An antagoniβt compound iβolated by the method of claim 26.
29. The antagonist of claim 28 wherein said compound is capable of blocking the function of the A/B, C/C, and/or B/F loopβ in the first domain and/or the B/C, C'/E and/or F/β loops in the second domain and/or the β/A stran of an Igβ or an IgE Fc receptor.
30. The antagonist of claim 28 which acts by binding Ig rather than Fc receptor.
31. A pharmaceutical composition comprising the polypeptide of any one of claims 1 to 21 or the antagoniβt of claim 28 together with a pharmaceutically appropriate carrier or diluent.
32. An iβolated nucleic acid molecule encoding a polypeptide with Fc binding ability wherein the polypeptid iβ altered compared to a native Fc receptor by addition, deletion and/or substitution of the amino acids encoded by the nucleic acid compared to a native Fc receptor and wherein said alteration results in improved characteristics compared to said native receptor.
33. The molecule of claim 32 which encodeβ an Fc receptor-like molecule comprising an altered ability to bind immunoglobulin wherein said ability iβ brought about by alteration of one or more amino acid reβidueβ which affect immunoglobulin binding ability.
34. The molecule of claim 32 or claim 33 wherein said polypeptide encoded binds Igβ, IgE, IgA, igM or IgD.
35. The molecule of claim 32 which encodes a soluble polypeptide.
36. The molecule of claim 33 wherein the polypeptide encoded has alterationβ in A/B, C/C and/or E/F loopβ of domain 1 and/or β/A βtrand and where the polypeptide iβ able to bind Igβ or IgE.
37. The molecule of claim 33 wherein the polypeptide encoded haβ alterationβ in the B/C, C'/E and/or F/β loopβ of domain 2 and where the polypeptide iβ able to bind Igβ or IgE.
38. The molecule of claim 33 which encodes a polypeptide with an enhanced ability to bind immunoglobulin compared to a native Fc receptor in a given class.
39. The molecule of claim 36 wherein the alterations are in the first domain at amino acid positions 133, 134,
158, 159 and/or 160 compared to a native Fc receptor.
40. The molecule of claim 39 wherein the amino acid altered are changed to alanine.
41. The molecule of claim 40 wherein Asp133 and/or Pro134 are changed to alanine.
42. The molecule of claim 37 wherein the alterations are in the second domain at amino acid poβitionβ 130, 156, 160 and/or 161.
43. The molecule of claim 42 where in the amino acidβ altered are changed to alanine.
44. The molecule of claim 43 wherein Trp130, Trp156, Tyr160 and/or βlu161 are changed ot alanine.
45. A molecule of claim 33 encoding a polypeptide with a reduced ability to bind immunoglobulin compared to a native Fc receptor.
46. The molecule of claim 32 wherein the polypeptide iβ altered compared to a native Fc receptor βuch that the βize of the polypeptide is larger than said native Fc receptor.
47. The molecule of any one of claims 32 to 46 wherein the polypeptide iβ βoluble.
48. The molecule of claim 46 or claim 47 wherein the βize of the polypeptide iβ 67 to 1000 kD
49. The molecule of claim 46 wherein βaid polypeptide iβ a fuβion protein comprising an Fc binding component and a fusion component.
50. The molecule of claim 49 wherein said Fc binding component is provided by a nucleotide sequence which encodeβ a polypeptide having enhanced Fc binding ability compared to a native Fc receptor or by a nucleotide βequence encoding a native Fc receptor or a portion thereof.
51. The molecule of claim 50 wherein the fuβion component encoded iβ a physiologically tolerated protein selected from the group of human serum albumin, Fc receptors, complement receptors, complement regulating proteins and cytokine receptors.
52. The molecule of claim 51 being the construct encoding HSA:FcγRII.
53. A vector comprising the molecule of any one of claims 32 to 52.
54. A host cell transformed or transfected with the vector of claim 53.
55. A method of making a nucleic acid molecule encoding a polypeptide with Fc binding ability wherein the polypeptide iβ altered compared to a native Fc receptor by addition, deletion and/or βubβtitution of one or more amino acidβ encoded by βaid molecule compared to a native Fc receptor and wherein βaid alteration reβultβ in improved characteriβticβ compared to βaid native receptor, βaid method comprising producing a nucleic acid molecule encoding the polypeptide by addition, deletion and/or substitution of one or more codons βpecific for amino acids affecting immunoglobulin binding ability of the polypeptide.
56. A method of producing the polypeptideβ of any one of claims 1 to 24 compriβing obtaining expreββion of the polypeptide in the host cell of claim 54.
57. A method of determining the presence and/or amount of immunoglobulin in a βample βaid method compriβing contacting βaid βample with the polypeptide of any one of claims 1 to 24, or an Fc receptor or part thereof, for a time and under conditions sufficient to allow the polypeptide or the Fc receptor or part thereof and any immunoglobulin present in said sample to bind, and detecting presence of and/or determining the amount of said bound polypeptide - immunoglobulin, bound Fc receptor- immunoglobulin or bound part Fc receptor-immunoglobulin.
58. A kit for detecting immunoglobulin, including for detecting immune complexes, in a βample, βaid kit compriβing in compartmentalised form, a first compartment adapted to receive the polypeptide of any one of claims 1 to 24 or an Fc receptor or a part thereof and at least one other compartment adapted to contain a detector means.
59. The method of claim 57 or the kit of claim 58 wherein βaid polypeptide iβ βpecific for igβ or IgE.
60. A method of removing immunoglobulin from a βample comprising contacting βaid βample with the polypeptide of any one of claims 1 to 21 or an Fc receptor or part thereof for a time and under conditions sufficient for any immunoglobulin present in the βample to form a complex with βaid polypeptide or Fc receptor or part thereof and separating said complex from the remainder of the βample.
61. A method of removing immunoglobulin from a body fluid compriβing taking body fluid from a patient, contacting the body fluid with the polypeptide of any one of claims 1 to 21 or an Fc receptor or part thereof, for a time and under conditions sufficient to allow the polypeptide, Fc receptor or part thereof to bind said immunoglobulin, removing said bound immunoglobulin from the body fluid and replacing said body fluid in the patient.
62. The method of claim 60 or claim 61 wherein βaid immunoglobulin removed iβ immunoglobulin complex.
63. The method of claim 62 wherein the polypeptide uβed iβ βpecific for Igβ or IgE.
64. A method of treatment of diβeaβe where an exceββ of immunoglobulin iβ implicated aβ a cauβative agent of the disease said method compriβing adminiβtering an effective amount of the polypeptide according to any one of claimβ 1 to 21 to βaid patient.
PCT/AU1995/000606 1994-09-16 1995-09-15 POLYPEPTIDES WITH Fc BINDING ABILITY WO1996008512A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP95932563A EP0773960A4 (en) 1994-09-16 1995-09-15 POLYPEPTIDES WITH Fc BINDING ABILITY
JP8509765A JPH10508463A (en) 1994-09-16 1995-09-15 Polypeptide having Fc binding ability
AU35572/95A AU697387C (en) 1994-09-16 1995-09-15 Polypeptides with Fc binding ability

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AUPM8232A AUPM823294A0 (en) 1994-09-16 1994-09-16 FC receptor-like molecules
AUPM8232 1994-09-16
US332,562 1994-10-31
US08/332,562 US5985599A (en) 1986-05-29 1994-10-31 FC receptor for immunoglobulin

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US08/332,562 Continuation-In-Part US5985599A (en) 1986-05-29 1994-10-31 FC receptor for immunoglobulin

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US08809105 A-371-Of-International 1997-05-23
US63314700A Division 1994-09-16 2000-08-04

Publications (1)

Publication Number Publication Date
WO1996008512A1 true WO1996008512A1 (en) 1996-03-21

Family

ID=25644773

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU1995/000606 WO1996008512A1 (en) 1994-09-16 1995-09-15 POLYPEPTIDES WITH Fc BINDING ABILITY

Country Status (5)

Country Link
US (1) US5985599A (en)
EP (2) EP0773960A4 (en)
JP (1) JPH10508463A (en)
CA (1) CA2198248A1 (en)
WO (1) WO1996008512A1 (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999005271A1 (en) * 1997-07-23 1999-02-04 Hannah Jane Gould Soluble variants of the ige receptor fc-epsilon-ri-alpha with increased affinity
WO2003104459A1 (en) * 2002-06-07 2003-12-18 Arthron Limited Fcyriia transgenic animal model for autoimmune disease
US7553809B2 (en) 1998-02-06 2009-06-30 Ilexus Pty Limited Fc receptor modulators and uses thereof
EP2492689A1 (en) * 2011-02-22 2012-08-29 Bernhard-Nocht-Institut für Tropenmedizin Detection of antibodies using an improved immune complex (IC) ELISA
US8993517B2 (en) 2001-12-21 2015-03-31 Human Genome Sciences, Inc. Albumin fusion proteins
EP3192806A1 (en) 2016-01-13 2017-07-19 Affiris AG Alpha chain of the high-affinity ige receptor (fceria)
EP3517609A4 (en) * 2016-09-23 2020-05-27 Tosoh Corporation IMPROVED RECOMBINANT Fc GAMA RII

Families Citing this family (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6194551B1 (en) * 1998-04-02 2001-02-27 Genentech, Inc. Polypeptide variants
US6528624B1 (en) 1998-04-02 2003-03-04 Genentech, Inc. Polypeptide variants
ATE395598T1 (en) * 1998-04-14 2008-05-15 Otsuka Pharma Co Ltd METHOD AND DEVICE FOR DETECTING ANTIBODIES
US20040043948A1 (en) * 2001-09-24 2004-03-04 Isis Pharmaceuticals Inc. Antisense modulation of interleukin 8 expression
JP3820105B2 (en) 1998-10-23 2006-09-13 キリン−アムジエン・インコーポレーテツド Dimeric thrombopoietin peptidomimetic that binds to MP1 receptor and has platelet-forming activity
US7488590B2 (en) * 1998-10-23 2009-02-10 Amgen Inc. Modified peptides as therapeutic agents
US6660843B1 (en) * 1998-10-23 2003-12-09 Amgen Inc. Modified peptides as therapeutic agents
KR101155191B1 (en) * 1999-01-15 2012-06-13 제넨테크, 인크. Polypeptide Variants with Altered Effector Function
US6737056B1 (en) * 1999-01-15 2004-05-18 Genentech, Inc. Polypeptide variants with altered effector function
US7183387B1 (en) 1999-01-15 2007-02-27 Genentech, Inc. Polypeptide variants with altered effector function
IL133866A0 (en) * 2000-01-03 2001-04-30 Yeda Res & Dev Consensus binding structures for ligands
AU5345901A (en) * 2000-04-13 2001-10-30 Univ Rockefeller Enhancement of antibody-mediated immune responses
EP1278778A2 (en) * 2000-05-03 2003-01-29 Amgen Inc., Modified peptides, comprising an fc domain, as therapeutic agents
EP1201681A1 (en) * 2000-10-30 2002-05-02 Millennium Pharmaceuticals, Inc. "Fail" molecules and uses thereof
US6911321B2 (en) * 2001-12-19 2005-06-28 Genentech, Inc. Non-human primate Fc receptors and methods of use
US7425331B2 (en) * 2002-04-10 2008-09-16 Protalex, Inc. Protein A methods of use
US7211258B2 (en) * 2002-04-10 2007-05-01 Protalex, Inc. Protein A compositions and methods of use
BR0311471A (en) * 2002-05-30 2007-04-27 Macrogenics Inc anti-cd16a antibody, and methods for reducing a deleterious immune response in a mammal and treating a deleterious immune response in a mammal
US8044180B2 (en) * 2002-08-14 2011-10-25 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8530627B2 (en) * 2002-08-14 2013-09-10 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8193318B2 (en) * 2002-08-14 2012-06-05 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8946387B2 (en) * 2002-08-14 2015-02-03 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
US8968730B2 (en) 2002-08-14 2015-03-03 Macrogenics Inc. FcγRIIB specific antibodies and methods of use thereof
US8187593B2 (en) * 2002-08-14 2012-05-29 Macrogenics, Inc. FcγRIIB specific antibodies and methods of use thereof
ES2897506T3 (en) * 2003-01-09 2022-03-01 Macrogenics Inc Identification and modification of antibodies with variant Fc regions and methods of using them
US7960512B2 (en) * 2003-01-09 2011-06-14 Macrogenics, Inc. Identification and engineering of antibodies with variant Fc regions and methods of using same
US7700100B2 (en) * 2003-01-13 2010-04-20 Macrogenics, Inc. FcγRIIB fusion proteins and compositions thereof
WO2004108950A2 (en) * 2003-06-06 2004-12-16 The Regents Of The University Of Michigan Methods for incorporating non-perfectly matched oligonucleotides into target-specific hybridization sequences
WO2005110474A2 (en) 2004-05-10 2005-11-24 Macrogenics, Inc. HUMANIZED FcϜRIIB SPECIFIC ANTIBODIES AND METHODS OF USE THEREOF
EP2213683B1 (en) 2004-08-04 2013-06-05 Mentrik Biotech, LLC Variant Fc regions
KR20070057839A (en) * 2004-08-19 2007-06-07 제넨테크, 인크. Polypeptide variants with altered effector function
CA2580796C (en) * 2004-09-24 2013-03-26 Amgen Inc. Modified fc molecules having peptides inserted in internal loop regions
CA2587766A1 (en) * 2004-11-10 2007-03-01 Macrogenics, Inc. Engineering fc antibody regions to confer effector function
EP1674479A1 (en) * 2004-12-22 2006-06-28 Memorial Sloan-Kettering Cancer Center Modulation of Fc Gamma receptors for optimizing immunotherapy
US11254748B2 (en) 2005-04-15 2022-02-22 Macrogenics, Inc. Covalent diabodies and uses thereof
US9284375B2 (en) 2005-04-15 2016-03-15 Macrogenics, Inc. Covalent diabodies and uses thereof
US9889197B2 (en) 2005-04-15 2018-02-13 Macrogenics, Inc. Covalently-associated diabody complexes that possess charged coil domains and that are capable of enhanced binding to serum albumin
AU2006236439B2 (en) 2005-04-15 2012-05-03 Macrogenics, Inc. Covalent diabodies and uses thereof
US9963510B2 (en) * 2005-04-15 2018-05-08 Macrogenics, Inc. Covalent diabodies and uses thereof
WO2007021841A2 (en) * 2005-08-10 2007-02-22 Macrogenics, Inc. Identification and engineering of antibodies with variant fc regions and methods of using same
US8008453B2 (en) 2005-08-12 2011-08-30 Amgen Inc. Modified Fc molecules
WO2007106707A2 (en) * 2006-03-10 2007-09-20 Macrogenics, Inc. Identification and engineering of antibodies with variant heavy chains and methods of using same
CA2660592C (en) 2006-05-26 2016-07-12 Macrogenics, Inc. Humanized fc.gamma.riib-specific antibodies and methods of use thereof
ES2599319T3 (en) 2006-06-26 2017-02-01 Macrogenics, Inc. Fc RIIB specific antibodies and their methods of use
EP2032159B1 (en) 2006-06-26 2015-01-07 MacroGenics, Inc. Combination of fcgammariib antibodies and cd20-specific antibodies and methods of use thereof
US20080112961A1 (en) * 2006-10-09 2008-05-15 Macrogenics, Inc. Identification and Engineering of Antibodies with Variant Fc Regions and Methods of Using Same
WO2008140603A2 (en) 2006-12-08 2008-11-20 Macrogenics, Inc. METHODS FOR THE TREATMENT OF DISEASE USING IMMUNOGLOBULINS HAVING FC REGIONS WITH ALTERED AFFINITIES FOR FCγR ACTIVATING AND FCγR INHIBITING
US8795667B2 (en) * 2007-12-19 2014-08-05 Macrogenics, Inc. Compositions for the prevention and treatment of smallpox
AU2009231991B2 (en) 2008-04-02 2014-09-25 Macrogenics, Inc. HER2/neu-specific antibodies and methods of using same
JP5785490B2 (en) 2008-04-02 2015-09-30 マクロジェニクス，インコーポレーテッド BCR complex-specific antibody and method of use thereof
US20110081347A1 (en) * 2008-06-04 2011-04-07 Macrogenics, Inc. Antibodies with Altered Binding to FcRn and Methods of Using Same
AU2010303415B2 (en) 2009-10-07 2015-02-19 Macrogenics, Inc. Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use
MX345232B (en) 2010-03-04 2017-01-20 Macrogenics Inc Antibodies reactive with b7-h3, immunologically active fragments thereof and uses thereof.
US8802091B2 (en) 2010-03-04 2014-08-12 Macrogenics, Inc. Antibodies reactive with B7-H3 and uses thereof
ES2692268T3 (en) 2011-03-29 2018-12-03 Roche Glycart Ag Antibody Fc variants
SG195073A1 (en) 2011-05-21 2013-12-30 Macrogenics Inc Deimmunized serum-binding domains and their use for extending serum half-life
RS62509B1 (en) 2012-07-13 2021-11-30 Roche Glycart Ag Bispecific anti-vegf/anti-ang-2 antibodies and their use in the treatment of ocular vascular diseases
US9487587B2 (en) 2013-03-05 2016-11-08 Macrogenics, Inc. Bispecific molecules that are immunoreactive with immune effector cells of a companion animal that express an activating receptor and cells that express B7-H3 and uses thereof
RS62304B1 (en) 2013-03-14 2021-09-30 Macrogenics Inc Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor
US11384149B2 (en) 2013-08-09 2022-07-12 Macrogenics, Inc. Bi-specific monovalent Fc diabodies that are capable of binding CD32B and CD79b and uses thereof
UA116479C2 (en) 2013-08-09 2018-03-26 Макродженікс, Інк. Bi-specific monovalent fc diabodies that are capable of binding cd32b and cd79b and uses thereof
EP2839842A1 (en) 2013-08-23 2015-02-25 MacroGenics, Inc. Bi-specific monovalent diabodies that are capable of binding CD123 and CD3 and uses thereof
EP2840091A1 (en) 2013-08-23 2015-02-25 MacroGenics, Inc. Bi-specific diabodies that are capable of binding gpA33 and CD3 and uses thereof
AU2015323860B2 (en) 2014-09-29 2021-05-27 Duke University Bispecific molecules comprising an HIV-1 envelope targeting arm
WO2017180813A1 (en) 2016-04-15 2017-10-19 Macrogenics, Inc. Novel b7-h3 binding molecules, antibody drug conjugates thereof and methods of use thereof
AU2018332475B2 (en) 2017-09-15 2020-12-17 Kookmin University Industry Academy Cooperation Foundation Fc-gamma receptor mutants

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4579840A (en) * 1983-08-12 1986-04-01 Immunetech Pharmaceuticals Method of blocking immune complex binding to immunoglobulin Fc receptors
WO1987007277A1 (en) * 1986-05-29 1987-12-03 The University Of Melbourne Fc receptor for immunoglobulin
US4752571A (en) * 1985-06-03 1988-06-21 Pharmacia Ab Method for determining certain bacterial polypeptides and antibodies directed against them
US5084398A (en) * 1987-11-20 1992-01-28 Creative Biomolecules Selective removal of immune complexes
WO1994029351A2 (en) * 1993-06-16 1994-12-22 Celltech Limited Antibodies

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5189014A (en) * 1979-12-03 1993-02-23 Cowan Jr Fred M Method of treating cellular Fc receptor mediated hypersensitivity immune disorders
SE451596B (en) * 1983-06-22 1987-10-19 Excorim Kb PROCEDURE FOR RECOVERY OF PROTEIN G
US4551435A (en) * 1983-08-24 1985-11-05 Immunicon, Inc. Selective removal of immunospecifically recognizable substances from solution
SE8505922D0 (en) * 1985-12-13 1985-12-13 Kabigen Ab CONSTRUCTION OF AN IGG BINDING PROTEIN TO FACILITATE DOWNSTREAM PROCESSING USING PROTEIN ENGINEERING
US4962035A (en) * 1987-12-01 1990-10-09 President And Fellows Of Harvard College DNA encoding IgE receptor alpha-subunit or fragment thereof
AU3284289A (en) * 1987-12-04 1989-07-05 Schering Biotech Corporation Human fc-gamma receptor
FR2650598B1 (en) * 1989-08-03 1994-06-03 Rhone Poulenc Sante DERIVATIVES OF ALBUMIN WITH THERAPEUTIC FUNCTION
WO1991006570A1 (en) * 1989-10-25 1991-05-16 The University Of Melbourne HYBRID Fc RECEPTOR MOLECULES
WO1994003598A1 (en) * 1992-08-04 1994-02-17 The Green Cross Corporation Antiallergic agent

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4579840A (en) * 1983-08-12 1986-04-01 Immunetech Pharmaceuticals Method of blocking immune complex binding to immunoglobulin Fc receptors
US4752571A (en) * 1985-06-03 1988-06-21 Pharmacia Ab Method for determining certain bacterial polypeptides and antibodies directed against them
WO1987007277A1 (en) * 1986-05-29 1987-12-03 The University Of Melbourne Fc receptor for immunoglobulin
US5084398A (en) * 1987-11-20 1992-01-28 Creative Biomolecules Selective removal of immune complexes
WO1994029351A2 (en) * 1993-06-16 1994-12-22 Celltech Limited Antibodies

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
J. BIOL. CHEM., Vol. 269, No. 21, 27 May 1994, M.D. HULETT et al., "Identification of the IgG Binding Site of the Human Low Affinity Receptor for IgG Fc alpha RII", pp. 15287-15293. *
J. IMMUNOL., Vol. 152, 1994, M.L. HIBBS et al., "Membrane-Proximal Ig-Like Domain of Fc alpha RIII (CD16) Contains Residues Critical for Ligand Binding", pp. 4466-4474. *
See also references of EP0773960A4 *

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999005271A1 (en) * 1997-07-23 1999-02-04 Hannah Jane Gould Soluble variants of the ige receptor fc-epsilon-ri-alpha with increased affinity
US7553809B2 (en) 1998-02-06 2009-06-30 Ilexus Pty Limited Fc receptor modulators and uses thereof
US8993517B2 (en) 2001-12-21 2015-03-31 Human Genome Sciences, Inc. Albumin fusion proteins
US9296809B2 (en) 2001-12-21 2016-03-29 Human Genome Sciences, Inc. Albumin fusion proteins
US9221896B2 (en) 2001-12-21 2015-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
WO2003104459A1 (en) * 2002-06-07 2003-12-18 Arthron Limited Fcyriia transgenic animal model for autoimmune disease
US7351875B2 (en) 2002-06-07 2008-04-01 Trillium Therapeutics, Inc. FcγRIIa transgenic animal model for autoimmune disease
EP2492689A1 (en) * 2011-02-22 2012-08-29 Bernhard-Nocht-Institut für Tropenmedizin Detection of antibodies using an improved immune complex (IC) ELISA
US20140080120A1 (en) * 2011-02-22 2014-03-20 Bernhard-Nocht-Institut Fuer Tropenmedizin Detection of antibodies using an improved immune complex (ic) elisa
CN103460048A (en) * 2011-02-22 2013-12-18 伯恩哈德－诺策热带医学研究所 Detection of antibodies using an improved immune complex (IC) ELISA
WO2012113801A1 (en) * 2011-02-22 2012-08-30 Bernhard-Nocht-Institut Fuer Tropenmedizin Detection of antibodies using an improved immune complex (ic) elisa
US9945846B2 (en) * 2011-02-22 2018-04-17 Bernhardt-Nocht-Institut Fuer Tropenmedizin Detection of antibodies using an improved immune complex (IC) ELISA
EP3192806A1 (en) 2016-01-13 2017-07-19 Affiris AG Alpha chain of the high-affinity ige receptor (fceria)
WO2017121842A1 (en) 2016-01-13 2017-07-20 Affiris Ag Alpha chain of the high-affinity ige receptor (fceria)
CN108473551A (en) * 2016-01-13 2018-08-31 阿费里斯股份公司 The α chains (FceRIa) of high-cutting slope along road
EP3517609A4 (en) * 2016-09-23 2020-05-27 Tosoh Corporation IMPROVED RECOMBINANT Fc GAMA RII
US11414475B2 (en) 2016-09-23 2022-08-16 Tosoh Corporation Recombinant FcγRII

Also Published As

Publication number Publication date
US5985599A (en) 1999-11-16
JPH10508463A (en) 1998-08-25
EP1612223A2 (en) 2006-01-04
EP0773960A4 (en) 2000-08-23
CA2198248A1 (en) 1996-03-21
EP0773960A1 (en) 1997-05-21
EP1612223A3 (en) 2006-05-24

Similar Documents

Publication Publication Date Title
WO1996008512A1 (en) POLYPEPTIDES WITH Fc BINDING ABILITY
KR100496063B1 (en) Novel protein and process for producing the same
Basu et al. Purification and characterization of human recombinant IgE-Fc fragments that bind to the human high affinity IgE receptor
US8198030B2 (en) Recombinant platelet collagen receptor glycoprotein VI and its pharmaceutical use
Chintalacharuvu et al. Hybrid IgA2/IgG1 antibodies with tailor-made effector functions
WO1991006570A1 (en) HYBRID Fc RECEPTOR MOLECULES
IL180967A (en) Nucleic acid molecule encoding a toll like receptor homologue and a chimeric molecule comprising same
JP2008537874A (en) sRAGE mimetibody, compositions, methods and uses
CN107074928A (en) New cat erythropoietin receptor agonists
WO1997002290A1 (en) ANTIFas LIGAND ANTIBODIES AND ASSAY METHOD BY USING THE SAME
EP0341290B1 (en) Immunoglobulin e competitor
Petranka et al. Structure-function relationships of the complement regulatory protein, CD59
WO1994013312A1 (en) Mucosal vascular addressin, dna and expression
AU697387C (en) Polypeptides with Fc binding ability
US6043345A (en) IgE isoforms and methods of use
US20040213781A1 (en) Polypeptides with Fc binding ability
WO1994011028A1 (en) Compounds having reduced immunogenicity and a method of reducing the immunogenicity of compounds
Nayak et al. Channel catfish soluble FcμR binds conserved linear epitopes present on Cμ3 and Cμ4
EP2198304B1 (en) Molecules and methods for treatment and detection of diabetes
WO1998053062A1 (en) A human edg-6 receptor homologue
Chan et al. The novel human IgE epsilon heavy chain, epsilon tailpiece, is present in plasma as part of a covalent complex
KR20030074805A (en) Neurotonin and use thereof
ES2201547T3 (en) ICAM-4 AND DIAGNOSTIC USES OF THE SAME.
AU6609690A (en) Hybrid fc receptor molecules
KR20000016598A (en) Novel protein and process for producing the same

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP SG US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2198248

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1995932563

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1995932563

Country of ref document: EP

ENP Entry into the national phase

Ref country code: US

Ref document number: 1997 809105

Date of ref document: 19970523

Kind code of ref document: A

Format of ref document f/p: F