WO1995003404A1 - Dna virus ribozymes - Google Patents

Dna virus ribozymes Download PDF

Info

Publication number
WO1995003404A1
WO1995003404A1 PCT/EP1993/001946 EP9301946W WO9503404A1 WO 1995003404 A1 WO1995003404 A1 WO 1995003404A1 EP 9301946 W EP9301946 W EP 9301946W WO 9503404 A1 WO9503404 A1 WO 9503404A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
ribozyme
virus
complementary
dna
Prior art date
Application number
PCT/EP1993/001946
Other languages
French (fr)
Inventor
Philippe Lenee
Véronique Gruber
Sylvie Baudino
John Mason
David Comeau
Mohamad Ali Rezaian
Ian Barry Dry
Justin Ellis Rigden
Original Assignee
Gene Shears Pty Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gene Shears Pty Limited filed Critical Gene Shears Pty Limited
Priority to PCT/EP1993/001946 priority Critical patent/WO1995003404A1/en
Publication of WO1995003404A1 publication Critical patent/WO1995003404A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/111Antisense spanning the whole gene, or a large part of it
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/121Hammerhead

Abstract

The invention relates to a ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target mRNA sequence transcribed from a DNA molecule associated with a DNA virus capable of infecting plant cells, wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantially reducing replication, infection and/or assembly of said DNA virus.

Description

DNA VIRUS RIBOZYMES

The present invention is directed generally to synthetic ribozymes and their mutants and derivatives capable of catalysing cleavage of virus specified mRNA and, more particulary, DNA virus specified mRNA. The present invention further contemplates the use of these ribozymes in the generation of transgenic cells and, in particular, transgenic plant cells and plants capable of inhibiting infection by the viruses.

Viruses are the causative agents of a large number of serious and potentially serious diseases in humans, animals and plant. Plant viruses in particular have the potential to destroy or reduce crop yield and to otherwise have a deleterious effect on agricultural and horticultural industries to economically significant levels.

Particularly important viruses in this regard are the DNA viruses, including the Caulimo- and the Geminiviruses and two unclassified viruses, the subterranean Clover Stunt Virus (SCSV, Shu and helms, Virology, 1986, 167, 38-49) and Coconut Foliar Decay Virus (CFDV, Rohde et al, Virology, 1990, 176, 648-51) . The geminiviruses are a group of small viruses which infect plant cells. They contain a single stand of circular DNA referred to as "virion- sense" or "positive-sense" DNA of less than about 2900 base pairs. Upon infection of a host cell by a geminivirus, the viral coat protein is removed and a double stranded replicative form of DNA is synthesised comprising the virion-sense strand and a "complementary-sense" strand. Transcription occurs from both the virion-sense strand and from the "complementary sense" strand, giving rise to (+) and (-) sense RNA transcripts respectively.

Examples of geminiviruses include Maize Streak Virus (MSV) , Bean Golden Mosaic Virus (BGMV) , African Cassava Mosaic Virus (ACMV) , Chloris Striate Mosaic Virus (CSMV) , Tomato Yellow Leaf Curl Virus (TYLCV) , Tomato Golden Mosaic Virus (TGMV) , Beet Curly Top Virus (BCTV) and Tomato Leaf Curl Virus (TLCV) amongst many others (see also the viruses mentioned in table 1 below) . These viruses cause economically important diseases in cultivated plants including leaf curling and other leaf distortion. TLCV in particular causes severe crop damage in northern parts of Australia and infected plants show symptoms similar to those caused by TYLCV in the Middle East and Europe. These tomato viruses are transmitted by the white-fly Bemisia tabaci and constitute a major disease problem world¬ wide. For convenience, and unless otherwise specified, TLCV and TYLCV are used interchangeably and reference herein to Israeli and Sardinian isolates of TLCV should be taken as TYLCV isolates. In general, "TLCV" refers to the Australian isolate.

Geminiviruses replicate in the nucleus of the infected cell and are thought to employ a rolling- circle mechanism similar to one used by the single- stranded DNA containing coliphages (e.g. QX174) and certain Staphylococcus aureus and Bacillus subtilis plas ids. The other known plant viruses, including other plant DNA viruses, replicate via RNA intermediates.

Geminivirus particles accumulate in the nuclei of infected cells where DNA replication and virus assembly probably take place (Davies et al., J. Cell. Sci (Suppl) (1987) 7 : 95-107). Their putative replicative forms are double-stranded covalently closed circular DNA Ca. 2,7 Kb in chromatine-like structures and are likely to be the transcriptionally active forms of the virus (Abouzid et al., Mol. Gen. Genet. (1988) 212 : 252-258) . Based on host range and insect vectors, they may be conveniently divided into three subgroups : the viruses which infect dicotyledonous hosts, have bipartite genomes and are transmitted by white-fly vectors Bemisia tabaci (Genn.) (ACMV, African Cassava Mosaic Virus (Stanley and Gay, Nature (1983) 301 : 260) ; TGMV, Tomato Golden Mosaic Virus (Hamilton et al, EMBO J. (1984) 3 : 2197) ; BGMV, Bean Golden Mosaic Virus (Horwarth et al., PNAS (1985) 82 : 3512) ; those which have monopartite genomes infect graminaceous hosts, and are transmitted by leafhopper vectors (MSV, Maize Streak Virus (Nigeria strain, Mullinaux et al., EMBO J. (1984) 3 : 3063 ; Kenyan strain, Havel NAR (1984) 12 : 7359) ; DSV, Digitarian Streak Virus (Donson et al.. Virology (1987) 161 : 160) ; WDV Wheat Dwarf Virus (Mac Powell et al., EMBO J. (1985) 4 : 2173)) and those which possess monopartite genomes and have members which can be transmitted by leafhoppers (BCTV, Beet Curly Top Virus (Stanley et al. , EMBO J. (1986) 5 : 1761) ; ToYDV, Tobacco Yellow Dwarf Virus (Maris et al. , Virology (1992) 187 : 633)) or by whiteflies (TYLCV, Tomato Yellow Leaf Curl Virus (Israeli isolate, Navet et al.. Virology (1991) 185 : 151 ; Sardinian isolate, Kheyr-Pour et al. NAT (1991) 19 : 6763) , TLCV, Tomato Leaf Curl Virus (Australian isolate. Dry et al. , J. Gen. Virol. (1993) 74 : 147)).

Due to economic importance of plant DNA viruses and, in particular, geminiviruses, there is a need for disease resistance strategy to be developed.

One approach is to artificially suppress gene expression by antisense RNA which targets complementary RNA (Helene, C. & Tolume, J. J. Biochim. Biophys. Acta 1049:99-125, 1990 ; Vander Kro et al Biotechniques 6:958-976, 1988). Although antisense RNA has been successfully used in suppressing viral infection in bacteria and animal tissue (Helene, C & Tolume, J. J. Supra) , its use in plants has met with only limited success (Van Del Elzen, P. J. M. et al Plant Mol. Biol. 13:337-346, 1989 ; Powell, P A et al Proc. Nad. Acad. Sci. USA 86:6949-6952, 1989).

Indeed, transgenic plants expressing Cucumber Mosaic Virus (CMV) antisense RNA to different regions were generally not resistant to CMV infection, except one line, which paradoxically produced only very low levels of antisense RNA (Rezaian et al., Plant Mol. Biol. (1988) 11 : 463). There was no proof that antisense was the cause of this resistance. In potato, antisense to PVX coat protein RNA sequence in transgenic plants protected against PVX only at low levels of inoculum (Hemenway et al., EMBO J. (1988) 7 : 1273).

Two major problems appear to be the quantity of antisense needed to cope with a replicating system that can rapidly produce large amounts of viral nucleic acid, and viral RNA is largely in the cytoplasm whereas antisense transcripts are produced in the nucleus.

With respect to geminiviruses, antisense technology has been applied to tobacco plants expressing an antisense DNA sequence of virally encoded AL1 gene of TGMV transcriptionally fused to a drug resistance gene (Day, A. G. et al Proc. Nad. Acad. Sci. USA 88:6721-6725, 1991). Although transgenic plant lines expressing the antisense transcript showed reduced symptom development, it is possible that the transgenic plants were infertile which would prevent large scale production of virus resistant plants.

In work leading up to the present invention, the inventors sought to overcome the disadvantages of the antisense approach to generating plant DNA virus- resistant plants by employing the strategy of ribozymes.

Ribozymes are synthetic RNA molecules which possess highly specific endoribonuclease activity. In particular, they comprise a hybridising region which is complementary, in nucleotide sequence to at least part of a target RNA and a catalytic region which is adapted to cleave the target RNA. Ribozymes are well described by Haseloff J. and Gerlach L. Nature 334:586-591, 1988 and in International Patent Application No. WO89/05852.

Howewer, despite the existence of ribozyme technology, heretofore, it has not been used on plant DNA viruses and in particular plant single stranded DNA viruses like geminiviruses. In fact, the success of the use of ribozymes on DNA viruses was unpredictable in view of their extremely complex replication and transcription mechanism, and the lack of information presently available concerning the compartmentalization of these different operations and the precise level of intervention of the different target sequences in the virus life cycle. For example, it is postulated that the replicase C, intervenes in the "rolling circle" replication step but not in the preceding step of the formation of the double-stranded replicative form of the virus (Elmer et al, Nucl. Acid. Res., 1988, 16, p 7043-7060).

In accordance with the present invention, the inventors have successfully developed ribozymes capable of targeting plant DNA viruses thereby providing an economically viable and efficient means of controlling such viruses.

Accordingly, one aspect of the present invention contemplates a ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target RNA transcribed from a DNA molecule associated with a DNA virus, wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantially reducing replication, infection and/or assembly of said DNA virus.

More particulary, the present invention is directed to a ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target mRNA sequence transcribed from a virion-sense DNA strand or a complementary-sense DNA strand of a plant single stranded DNA virus, wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantially reducing replication, infection and/or assembly of said DNA virus.

For convenience, reference to a plant single stranded DNA virus, includes reference to its double stranded replicative form.

In a preferred embodiment, the plant single stranded DNA virus is a geminivirus and the target mRNA encodes a protein essential for replication. By "essential" is meant a protein specified by the viral genome (or a complementary form thereof) and required or substantially required for a particular function such as replication, infection and/or viral assembly. A decrease in the level of the essential protein results in a reduction in the level of that function. The decrease in the level of the particular function. Preferably, the level of essential protein (or level of particular function) is 20 % less, more preferably at least 30 % less, even more preferably at least 45 % less, still more preferably at least 55 % less and still even more preferably 65-7 5% less and yet more preferably more than 85-90 % less relative to the level of essential protein (or level of particular function) in the absence of the ribozyme.

Conveniently, the level of essential protein (or level of particular function) can be tested in vitro within the limits of biological variation in vivo. Such a test, for. example, can be by analysis of mRNA degradation products in vitro.

According to one preferred aspect of the present invention, there is provided a ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target mRNA sequence transcribed from a virion-sense DNA molecule of a geminivirus or a DNA molecule complementary to said virion-sense DNA molecule, said mRNA encoding a protein essential for replication of said geminivirus in a plant cell wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantially reducing replication of said geminivirus.

In an even more preferred embodiment, the target mRNA sequence is present in low abundance within the cell. An example of such a mRNA molecule is the transcript of the Cl gene or its equivalent in geminiviruses, such as in TLCV or TYLCV and its mutants, derivatives and variants. The single stranded DNA of TLCV contains six open reading frames (ORFs) , two on the virion-sense strand and four on the complementary-sense strand of the replicative form DNA produced in leaf curl infected plants. Analysis of the viral mRNAs in infected plant cells reveal that the mRNA encoding the Cl gene, which is essential for replication, occurs at lower abundance than the other mRNA transcripts specified by the TLCV genome. Equivalent forms of the Cl gene include the genes LI, ALl and ACl and reference herein to the "Cl gene" is taken as including equivalents thereof.

Other targets include the C2, C3 and C4 transcripts which play roles in transactivation of virion-sense gene expression and spread of the virus, expression of the disease phenotype, and development of the disease respectively.

According to another preferred embodiment, the present invention is directed to a ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target mRNA sequence encoding the Cl gene of geminivirus and in particular TLCV and wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantialy reducing replication of said geminivirus (e, g, TLCV) .

In a preferred variant, the ribozymes of the present invention can be defined as nucleic acid compounds having endoribonuclease activity and being capable of inhibiting the replication, infection or assembly of a DNA virus, said compound comprising at least one unit, "R", having the general formula :

5' (X-Y-X') 3'

in which :

- X and X' each represent, independently, a nucleotide sequence having at least 4 bases and being complementary to at least a part of either the viral genome, or the (-)sense RNA transcript of a DNA virus ; Y represents the catalytic region of a ribozyme.

According to this variant, the target RNA is preferably the (-)sense RNA transcript, i.e. the mRNA originating from the transcription of the complementary sense strand of the double-stranded replicative form of the DNA virus genome, particularly a geminivirus. The sequences X and X* are therefore complementary to at least a part of the (-)sense RNA transcript (which is equivalent to being complementary to at least a part of the single stranded genomic DNA) .

The sequences X and X', hereinafter referred to as "hybridising arms" are sufficiently long to allow both stable hybridisation of the ribozyme to the substrate RNA, and efficient cleavage of the substrate. Normally, X and X1 will have a length of at least 4 nucleotides each, and preferably at least 6. The upper limit of the lengths of the hybridising arms is generally determined by the length of the targetted substrate and can be as long as 800 or 1000 bases or more. Preferred lengths are between 6 and 300 bases, for example 10 to 150. The complementarity of the hybridising arm to the substrate or to a part of the substrate, normally extends along the entire length of the hybridisisng arm.

The catalytic region of the ribozyme, "Y" is derived from any type of suitable ribozyme, for example "hammerhead" or "hairpin". These ribozymes are described in patent applications EP-A-321201 and EP- A-360257 respectively. Particularly preferred are "hammerhead" catalytic regions (see for example, figure 7) , and which will be described in detail hereafter. The ribozymes may be either "monoribozymes" possessing one single "R" unit of the formula [X-Y- X'], and having only one catalytic region.

Alternatively, the ribozymes may be "polyribozymes" comprising a plurality of "R" units and having the general formula : R-*-R2 R„, wherein n > 1, and may have a value as high as 50 or 100. In practice, a value for "n" of about 5 to 10 is frequent. The polyribozymes are thus constituted by a head-to-tail series of ribozymes, the monoribozyme "R" or [X-Y-X'] unit, being the unit motif. In other words, it is a series of catalytic regions connected together by hybridising arms. Hereinafter, unless otherwise indicated, the aggregate of the X and X' motifs contributed by all the "R" units of a polyribozyme, will be designated collectively as the "complementary" or "hybridising" sequence. The polyribozyme normally acts as a "uni-molecule" against a single transcript, i.e. the cleavage sites of each of the catalytic regions are located on the same transcript.

The precise structure of the polyribozyme is in fact primarily determined by the nature of the substrate it is designed to cleave. The number of catalytic regions, their position in the complementary sequence and the distance between two consecutive catalytic regions are dependent to a large degree on the position of the "three-base target" sites in the substrate.

The "hammerhead" ribozymes cleave the substrate immediately downstream from a "target" site XXX, preferably XUX, in which X represents one of the 4 bases A, C, G, U and U represents uracil. One particularly preferred target sequence is X°UY in which X° is any ribonucleotide, U is uracil and Y represents adenine, cytosine or uracil. X°UY forms part of a base pair flanking region and Y is not base paired. Preferred triplets defining X+OUY include, but are not limited to GUC, GUA, GUU, UUC and CUC. Other target sites are possible , but less efficient, for example CAC, UAC and AAC. Perriman et al (Gene, 1992, 113:157) have studied extended target sites for hammerhead ribozymes. It has been found that GUC, UUC, CUC, GUA and GUU targets show equivalent rates of studies. For GUG, the normal ribozyme cannot induce cleavage, but an alteration of the stem-loop in the catalytic domain leads to the formation of a weakly active ribozyme. There are some targets with nucleotides other than U in the center position which show significant, discernable cleavage.

In the case of the ribozymes of the "hairpin" type, a preferred target sequence is AGUC.

These target sequences are important in the construction and functioning of the polyribozymes, not only because they indicate the positions of cleavage of the substrate but also because they define the position at which the catalytic region must be inserted in the complementary sequence. In fact, each catalytic region of the polyribozyme must be situated at a site in the complementary sequence which corresponds to a XUX site of the transcript. For example, if one XUX site is situated at position 412 of the C, gene and another at position 711, a catalytic region is inserted at the position corresponding to 412 in the complementary sequence, and another at 711. In other words, the X and X' hybridising sequences which flank the catalytic domain in each "R" unit, are chosen so as to be complementary to the bases surrounding the XUX site targeted in the substrate. The motif XUX is a motif which occurs very frequently in the RNA sequences. For example, on average there is a GUC motif every 64 bases in a sequence having a random and equal distribution of bases. This signifies that the substrate usually contains a plurality of XUX cleavage sites. As indicated above, the catalytic regions of the polyribozymes are situated at positions of the complementary sequence which correspond to the XUX sites. However, it is not necessary to include a catalytic region for each XUX target sequence of the substrate in order to obtain an efficient cleavage according to the invention. The total number of catalytic regions included in the polyribozyme is normally equal to or smaller than the total number of XUX sites present in the transcript target. The polyribozyme variant of the invention may thus contain a very variable number of catalytic regions. For example, in the case of Cj of TLCV, the polyribozyme may contain from about 2 to about 6 catalytic regions, when the target sequence is GUC. In the case in which it is decided to include a smaller number of catalytic regions in the complementary sequence than the number of XUX sites in the substrate, the choice of the sites selected may be made by respecting the following criteria :

a) the distance between the 2 XUX sites targeted and, consequently, between 2 catalytic regions in the polyribozyme must be long enough to enable the hybridizing arms of the polyribozyme situated between the corresponding catalytic regions to hybridize with the substrate in a stable manner and to prevent the catalytic regions hybridizing with themselves. A distance of at least 8 bases, and preferably at least 14 bases, for example about 20 bases is particularly advantageous. Of course, this criterion must only be taken into consideration when the substrate contains XUX sites very close together. Otherwise, if the XUX sites of the substrate are separated from each other by more than 8 to 20 bases, this selection criterion is not important.

b) the XUX sites targeted are preferably situated in a part of the substrate which does not have significant secondary structure. This facilitates the access of the polyribozyme to the substrate and increases its efficacy. Three-dimensional folding analyses may be carried out.

c) the XUX sites targeted may form part of the regions of homology conserved between different strains or variants or mutants of one and the same virus, or between different related viruses. This aspect of the invention is considered in detail later.

d) another selection criterion of the XUX sites targeted is the absence of homology with endogenous genes of the plant to be transformed. In fact, although they are rare, some viruses possess sequences which find a homology in the genome of plants. It is thus important to avoid XUX sites situated within such a sequence.

In the ribozymes of the invention, the hybridising X* and X motifs within any one "R" unit are often complementary to adjacent, contiguous partions of the substrate. In this case, the ribozyme can be thought of as "symetric", and the catalytic domain acts at a unique site determined by the complementarity of its two flanking arms. A preferred example of this symetric type of ribozyme is the "purely complementary" polyribozyme in which the 3• hybridising arm of a given "R" unit and the 5' hybridising arm of the adjacent "R" unit are complementary to sequences which are contiguous in the (-)sense RNA transcript or in the DNA genome.

In other words, in this embodiment, the aggregate of the hybridising arms gives a sequence of uninterrupted complementarity to the target sequence. This type of polyribozyme may be considered as a complementary sequence having, inserted at distinct sites in that sequence, a plurality of ribozyme catalytic regions. The complementary sequence may hybridise with the entire length of the target transcript. On the other hand, it may hybridise with only a fragment of the targeted transcript. The fragment in question must be long enough to allow the inclusion of at least 2 catalytic regions in the corresponding sequence of the polyribozyme. In general, for this variant, the length of the complementary sequence, not counting the catalytic regions (the sum of the hybridising arms) , may vary from about 40 to 2000 bases. Lengths of 400 to 1000 is particularly preferred.

According to a variant of the invention, rather than being "symetrical" as described above, the ribozyme may be, or may possess at least one "R" unit which is "asy etrical". This signifies that the X and X1 hybridising arms within a given "R" unit are complementary to two sequences which are non¬ contiguous in the substrate. This in fact means that the catalytic domain of the "asymetric" "R" unit can act at two distinct XUX sites in the substrate, one being the XUX site flanked by the sequence complementary to its 51 arm, and the other being the XUX site flanked by the sequence complementary to its 3' arm. This type of ribozyme may be specifically constructed, or may be the result of a spontaneous re-arrangement during synthesis. The locations of the sequence to which, on the one hand, the 3' flanking arm hybridises, and the sequence to which, on the other hand, the 51 flanking arm hybridises, may be separated by hundreds of bases or by as little as 10 or 20 bases. This type of structure is advantageous since it allows a significant "economy" in catalytic regions : for example five "asymetric" "R" units can achieve the same result as 10 symetric units.

According to another highly preferred embodiment of the invention, in the polyribozyme having the formula :

Figure imgf000017_0001
the 3* hybridising arm (X') of a given "R" unit and the 5' hybridising arm of the adjacent "R" unit are complementary to non-contiguous portions of the genome or of the (-)sense RNA transcript. This type of polyribozyme will be referred to hereinafter as a "short arm polyribozyme".

The structure of these polyribozymes is basically a sequence complementary to the target sequence in which ribozyme catalytic regions are embedded and which has undergone deletions in the complementary sequence. The distance between two catalytic regions in the polyribozyme is shorter than the distance between the two corresponding XUX sites in the target sequence. The distance between ribozymes can be reduced significantly with respect to the distance between the corresponding target sites in the substrate, for example, if two adjacent targeted XUX sites in the substrate are separated by a distance of 1000 nucleotides, the distance between the catalytic regions of the "short arm ribozyme" may be as little as 30 or 40 nucleotides. Reductions of over 90 % of the length of the hybridising sequence may therefore be made. The minimum length between two adjacent catalytic regions is normally about 8 nucleotides and preferably at least 20. The present inventors have shown that such shortened hybridising sequences do not, surprisingly, prevent the polyribozyme from efficiently cleaving the substrate and can, in fact, in many cases improve the efficiency of the inactivation.

For example, the reduction in the length of the complementary sequence avoids problems associated with the formation of secondary structure leading to the inactivation of the ribozyme. Thus, for a given length of ribozyme molecule, more catalytic regions may be inserted targeting more cleavage sites in the substrate.

Furthermore, the use of the short arm polyribozyme means that efficient polyribozymes may be constructed even if only parts of the sequence of the substrate are known. It is sufficient to know the 10 or 15 bases surrounding an XUX target site.

Another important advantage is the possibility to use, as the shortened hybridising arms, exclusively those sequences which are conserved in different viruses, for example viruses of the same type. In this way, different viruses may be inactivated by the same polyribozyme even if the sequences between the conserved regions are totally dissimilar.

Finally the smaller molecule allows an easier and more economical synthesis. The functional nature of the "short arm" ribozymes of the invention prove that. in a polyribozyme, the different catalytic regions can act independently of each other.

Any one polyribozyme of the invention may include a mixture of "long arm" and "short arm" ribozymes, and also of "symetric" and asymetric" ribozymes. Alternatively, it may include only long arm ribozymes, or only short arm, or only asymetric, etc... The structure of the ribozyme can therefore be optimised, and tested.

According to yet a further embodiment of the invention, the hybridising arms of the polyribozyme may be derived from at least two different types of virus. Such polyribozymes are referred to hereinafter as "chimeric polyribozymes". As an example of this type of construction, mixtures of TLCV and TYLCV derived sequences can be cited, for example : the Sardinian, Israeli or Tunisian strain. This type of polyribozyme ensures the inactivation of both types of virus, if present together, or allows the use of a single construction in different geographical areas.

According to a further variant of the invention, the polyribozymes may include, between two consecutive "R" units, a non-complementary sequence (A) which has a length of at least 4 bases, and which is non- complementary to the (-)sense RNA transcript or DNA genome.

The non-complementary sequence of the polyribozyme may have a precise function, for example, it may be constituted by a coding sequence which can be used to select transformants or also a sequence containing a ribozyme which acts on a substrate other than the primary target of the DNA virus or which is cis acting on a part of the polyribozyme. It typically contains a polylinker for cloning, or an adaptor to facilitate construction of chimeric polyribozyme. The non-complementary sequence usually has a length comprised between 4 and 500 bases, for example 20 to 100 bases. When there is a plurality of non- complementary sequences, they may together constitute as much as about 90% of the length of the polyribozyme, for example 50%. These non-complementary sequences normally replace portions of the complementary sequences X and X' , but leave at least 4 complementary bases immediately next to the catalytic domain.

According to a most preferred embodiment, the ribozymes of the invention are constructed so that the hybridising arms are complementary to a region or to regions which is (are) highly conserved between variants or mutants of the same strain, between strains of the same virus type or even between viruses of different types.

Comparisons of deduced amino-acid sequences encoded by a different open-reading frames of geminiviruses, that is VI, V2, Cl, C2, C3 and C4, has been made (see for example references cited in table 1) . For the Cl replicase polypeptide, the highest homology occurs between TLCV and TYLCV-I with a homology of 83 %. Between TLCV and TYLCV-S there is 79 % amino-acid identity over the Cl open-reading frame.

If this comparison is made for the Israeli, Sardinian and Tunisian isolates of TYLCV against TLCV, similar homologies are found (see table 1) . TABLE 1 : PAIRWISE COMPARISONS OF DEDUCED AMINO-ACID SEQUENCES ENCODED BY Cl ORF OF GEMINIVIRUSES :

Virus Amino-acid identity

(%)

1 : TYLCV-S/TYLCV-I 77

2 : TYLCV-S/TYLCV-T 75

3 : TYLCV-S/ACMVA 74

4 : TYLCV-S/ICMVA 76

5 : TYLCV-S/ABMVA 67

6 : TYLCV-S/TGMVA 67

7 : TYLCV-S/BGMVA 63

8 TYLCV-S/SqLCV 53

9 ! TYLCV-I/TYLCV-T 78

10 : TYLCV-1/ACMVA 73

11 : TYLCV-I/ICMVA 75

12 : TYLCV-T/ACMVA 72

13 TYLCV-T/ICMVA 77

14 : : ACMVA/ICMVA 74

15 ' : TLCV/TYLCV-I 83

16 : TLCV/TYLCV-S 79

17 : TLCV/BGMVA 64

18 : TLCV/PYMVA 68

19 : TLCV/ABMVA 68

20 : TLCV/TGMVA 69

21 : TLCV/ACMVA 78

22 : TLCV/BCTV 61

23 : TLCV/TobYDV 25

24 : TLCV/MSV 25

25 : TLCV/WDV 24

Lege ≥nd for Table 1 :

For 1 to 14, amino-acid identity is given in percent derived with the program BestFit of the UWGCG-Sequence analysis package. The word size (K- tuple) was 2, the gap weight was 2.0 and gaplength weight was 0.1. The program FastA yielded the same relationship.

For 15 to 25, amino-acid identity was calculated using PALIGN program of the PC/GENE sequence analysis package using the structure-genetic comparison matrix (open gap cost value, 10 ; unit gap cost value, 10) .

ABMVA : Abutilon Mosaic Virus DNA A ; ACMVA : African Cassava Mosaic Virus DNA A ; BGMVA : Bean Golden Mosaic Virus DNA A ; ICMV : Indian Cassava Mosaic Virus DNA A ; SqlCV : Squash Leaf Curl Virus DNA A ; PYMVA : Potato Yellow Mosaic Virus DNA A ; TGMVA : Tomato Golden Mosaic Virus DNA A TYLCV-I : Tomato Yellow Leaf Curl Virus Israeli isolate ; TYLCV-S : Tomato Yellow Leaf Curl Virus Thai isolate ; TLCV : Tomato Leaf Curl Virus ; BCTV : Beet Curly Top Virus ; TobYDV : Tobacco Yellow Dwarf Virus ; MSV : Maize Streak Virus ; WDV :' Wheat Dwarf Virus.

The results summarized in the table have been given by Dry et al (J. Gen. Virol. (1993) 74:147) and Kheyr-pour et al. (Nucl. Acid. Res. (1991) 19:6763).

The degree of sequence diversity between the 3 isolates of TYLCV and TLCV is in pronounced constrast to the usual very high sequence similarity between different geminivirus isolates or strains, for example : the DNA sequences of the Kenyan and Nigerian isolates of ACMV show 96 % identity and Kenyan, Nigerian and South African isolates of MSV vary maximally by about 2 %. In spite of the pronounced sequence diversity between the 3 isolates of TYLCV and TLCV, the present inventors carried out a comparison of the Cl RNA transcript and identified three very highly conserved regions, two of which are shown in figure 9. These regions are the following (the following numerotation is the TLCV numerotation of the complementary sense transcript) :

1. 365 to 435 approximately

2. 634 to 737 "

3. 895 to 972 "

The nucleotide sequences of the Cl gene in three TLCV isolates (from Australia, Israel and Sardinia, respectively) are shown in Figure 1. The complete nucleotide sequence of the Cl gene from TLCV is disclosed in Mullineaux et al.. Virology, 193 : 414-423, 1993 and Dry et al. J. Gen. Virol., 74 : 147-151, 1993. The Israeli isolate is disclosed by Navot et al in Virology, 185 : 151-161, 1991 and the Sardinian isolate is disclosed by Khyer-Pour et al, Nucl. Acid. Res. 19 : 6763-6769, 1991.

Polyribozymes constructed with target sites in these conserved regions may therefore be used to ensure that all related strains or variants are inactivated. As pointed out above, if the polyribozyme is the deleted short arm version, whose hybridising arms correspond exclusively to the conserved regions, wide sequence diversity between the conserved regions does not affect the efficient hybridisation of the polyribozyme to the substrate.

According to this aspect of the invention, a "conserved region" is considered as having a 100 % homology over a distance of about 20 bases. Generally speaking, the homology may be around 90 % over 30 bases. Ribozymes Rl, R4, R5 and R2 are designed so that the target sites lie within these conserved regions, as shown in the examples below.

According to this embodiment, therefore, the present invention further relates to a ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least one part of a target mRNA sequence encoding the Cl gene of at least two variants of particular geminivirus and in particular at least two variants of TLCV, and wherein said catalytic region is capable of cleaving said target mRNA sequence from each of said variants thereby susbtantially reducing replication of said geminivirus (e.g. TLCV, TYLC and their mutants, derivatives and variants) .

The polyribozymes of the invention are usually constituted of RNA. Nonetheless, it is possible to replace some parts of the polyribozyme by DNA, for example the hybridizing arms or parts of these arms, or also a part of the catalytic region, in particular the "loop", provided that the catalytic activity is maintained (see, for example, the substitution of the RNA by DNA described in the international patent application wo-9119789) .

As far as the catalytic region is concerned, the ribozymes of the present invention can be represented as a molecule of formula (I) :

3' 5»

(X)n Y Y Wn'

A C

A U

G 1A G

Figure imgf000024_0001

5« 3' (I)

wherein, (X)n and (X)n' represent ribonucleotide sequences substantially complementary to a mRNA sequence of a DNA virus; the sum of n and n1 may be the same or different; an (*) represents a base pair between complementary ribonucleotides ; Y represents any ribonucleotide and each Y may be the same or different ; Y' and Y" represent ribonucleotides of complementary sequence along at least part of their length to allow base pairing between the oligoribonucleotides, or Y' and Y" together form a single RNA sequence wherein at least part of said sequence comprises a stem formed by base pairing between complementary nucleotides; and optionally, an additional nucleotide selected from any one of A, G, C or U is inserted after 1A.

In another embodiment, the ribozyme is as set forth in formula (II) : 3 I

(X) πA Y (X) n.

A C

A U

G 1A G

C * G G A

Y * Y Y

Y * Y

(Y) m * (Y) m.

Y Y

B (II)

wherein (X)n and (X)n' represent ribonucleotide sequences substantially complementary to a mRNA of a DNA virus and in particular a geminivirus such as TLCV ; Y represents any ribonucleotide and each Y residue may be the same or different ; an (*) represents a base pair between complementary ribonucleotides; n and n' are as previously defined; B represents a bond, a base pair, a ribonucleotide, or an oligoribonucleotide containing at least 2 ribonucleotides ; m and m' are 1 or more and may be the same or different ; and optionally, an additional nucleotide selected from any one of A, G, C or U is inserted after 1A.

In a preferred embodiment, the ribozyme is as set forth in formula (III) :

3 '

(X) πA Y (X) n

A C

A u

G A G

C * G G A

A * U U

G * C

G * C

A G

G U (III)

wherein (X)n and (X)n' represent a ribonucleotide sequence substantially complementary to a mRNA of a DNA virus and in particular a geminivirus such a TLCV ; Y represents any ribonucleotide and each Y residue may be the same or different an (*) represents a base pair between complementary ribonucleotides ; n and n' are as previously defined.

Preferably, the DNA virus is a single stranded DNA virus. Preferably, the single stranded DNA virus is a geminivirus. Most preferably, the geminivirus is TLCV and (X)n and (X)n- represent a sequence capable of hybridising to a region of Cl gene mRNA.

In a most preferred embodiment, (X)n and (X)n« hybridise to the Cl gene mRNA transcript of TLCV or TYLCV as set forth in Figure 1.

Particulary preferred ribozymes of the present invention are specifie to the Cl gene of TLCV and its variants and comprise the nucleotide sequences set forth below :

3'- GUCCAGUCGUGUAAAAAGCAGGAGUGCCUGAGUAGUCGUAGGCUU GUAAGUC-5' ;

3•- GAGGAAAAAAUAGAAAAGCAGGAGUGCCUGAGUAGUCAAGAAAAC UAGCUCA-5• ;

3'- GAGUUGUAAACUACAAAGCAGGAGUGCCUGAGUAGUCUAACUUCU AGUACUA-5' . and

5•- GATTTAGCTCCCTCTGATGAGTCCGTGAGGACGAAAATGTTCGGATG

GAAATGTGCTCTGATGAGTCCGTGAGGACGAAACCTGGTTGGGGAT-3•

Although the catalytic regions illustrated above and in Figure 7 have a conserved structure and sequence, it has been observed that some nucleotides may be deleted, inserted, substituted or modified without prejudice to the activity of the ribozyme. The invention comprises the use of these modified catalytic regions in the polyribozyme provided that their catalytic activity is conserved. This activity can be verified by using the tests described below. For example, one or more nucleotides of the catalytic region II illustrated in formula I, II and III may be replaced by nucleotides containing bases such as adenine, guanine, cytosine, methylcytosine, uracil, thymine, xanthine, hypoxanthine, inosine or other methylated bases. The "conserved" bases C-G which together form the first base pair of the catalytic loop, can be replaced by U-A (Koizumi et al. , FEBS Letts. 228, 2, 228-230, 1988).

The nucleotides of the catalytic region illustrated in Figure 7 can also be modified chemically. The nucleotides are composed of a base, a sugar and a monophosphate group. Each of these groups can thus be modified. Such modifications are described in "Principles of Nucleic Acid Structure" (Ed. Wolfram Sanger, Springer Verlag, New York, 1984) . For example, the bases may bear substituents such as halogeno, hydroxy, amino, alkyl, azido, nitro, phenyl groups, etc.. The sugar moiety of the nucleotide may also be subjected to modifications such as the replacement of the secondary hydroxyl groups by halogeno, amino or azido groups or even to 2* methylation.

The phosphate group of the nucleotides may be modified by the replacement of an oxygen by N, S or C, giving rise to a phosphoramidate, phosphorothioate and phosphonate, respectively. These latter may exhibit useful pharmacokinetic properties.

The bases and/or the nucleotides of the catalytic region may also bear substituents such as amino acids, for example, tyrosine or histidine.

According to a variant of the invention, the ribozyme may comprise as catalytic region one or more structures such as those illustrated in Figure 17. This structure, called "minizyme", is described in the international patent application WO-A-9119789. It represents a catalytic region of the "hammerhead" type, the "loop" of which has been replaced by a "P" group. P may be a covalent link between G and 1A, one or more nucleotides (RNA or DNA, or a mixture, or even derivatives described above) or any atom or group of atoms other than a nucleotide which does not- affect the catalytic activity. When P represents a plurality of nucleotides, it may contain internal base pairings. The sequence and the . number of nucleotides constituting the group "P" is not critical and may vary from 1 to 20 nucleotides for example, and preferably from 1 to 6. It is preferable to select a sequence lacking internal base pairings of the Watson-Crick type.

The catalytic activity of the ribozymes of the invention may be verified in vitro by placing the ribozyme, or a sequence which after transcription will give rise to the ribozyme, in contact with the substrate, followed by demonstration of the cleavage. The experimental conditions for the in vitro cleavage reaction are the following : a temperature comprised between 4 and 60°C, and preferably between 20 and 55βC, a pH comprised between about 7.0 and 9.0, in the presence of divalent metals, such as Mg2+, at a concentration of 1 to 100 mM (preferably 1 to 20 mM) . The polyribozyme is usually present in an equimolar ratio with the substrate, or in excess. The in vitro cleavage reactions are advantageously carried out according to the procedure described by Lamb and Hay (J. Gen. Virol., 1990, 71, 2257-2264). This article also describes suitable conditions for in vitro transcription for the production of ribozymes from oligodeoxyribonucleotides inserted into plasmids.

The in vivo cleavage conditions are those existing naturally in the cell. In accordance with the embodiments and aspects of the invention as set forth above, the ribozyme is said to "hybridise" to a target mRNA sequence or to have "complementarity" hybridising arms. Such hybridisation and complementarity is definied herein as an extent of duplex formation sufficient to form a stable enough structure so that cleavage with the target triplet can occur. Depending on the target sequence, the ribozyme and the secondary structure of the mRNA, preferably less than about 5-10, more preferably less than about 3 to 5 and even more preferably less than 1 to 3 bases would be mismatched between the target mRNA sequence and one or both hybridising arms of the ribozyme. Over the whole length of the hybridising arm, not more than 10 % of mismatches should occur. Accordingly, the present invention extends to ribozymes described herein and in particular Rzl, Rz2, Rz3, Rz4 and Rz5, to the polyribozymes containing them, and to any or all functional mutants, derivatives, parts, homologues or analogues thereof. Examples of such mutants include single or multiple nucleotide substitutions, deletions and/or additions to the hybridising regions and/or catalytic regions of the ribozymes provided such modified ribozymes are still functional in cleaving the target mRNA sequence.

Put in alternative terms, the present invention extends to a ribozyme having a hybridising domain and a catalytic domain, wherein the hybridising domain comprises a sequence of nucleotides substantially complementary to a sequence of nucleotides in a mRNA molecule encoding the Cl gene of TLCV or TYLCV or which hybridises to said TLCV or TYLCV mRNA sequence in vitro under high stringency conditions and wherein said catalytic region is capable of cleaving said target mRNA sequence. This aspect of the present invention is conveniently determined by the extent of cleavage of the target mRNA sequence in vitro.

For the purposes of the present invention, the stringency conditions set forth in Sambrook et al, Molecular Cloning : A laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY, USA, pages 387-389 at paragraph 11 are considered high stringent conditions. Alternatively, medium stringency may be used involving 0.25-0.5 % w/v SDS at 45° C for 2-3 hours. The alternative conditions are applicable depending on concentration, purity and source of nucleic acid molecules.

The present invention extends to genetic constructs comprising the ribozymes herein described. These genetic constructs generally comprise a vector sequence as a vehicle for transferring the ribozyme to a host cell and a promoter sequence to direct transcription of the ribozyme and a terminator. A preferred promoter includes but is not limited to a 35S Cauliflower Mosaic Virus (CaMV) or to a double 35S CaMV promoter. The CaMV promoter is described by Odell et al, Nature 313 : 810-812, 1985. The ribozymes are generally in the complementary form such that upon transcription, the ribozyme is produced. The genetic constructs of the present invention are used to generate transgenic plants capable of constitutively, developmentally or inducibly (e.g. in response to certain stimuli) expressing the ribozymes herein described. Most preferred transgenic cells are rendered substantially resistant to TLCV infection.

The ribozymes and genetic constructs of the present invention can be conveniently tested in vivo using virus-sensitive plants. A particularly useful indicator plant is the tobacco plant. The analysis may be qualitative such as by screening for severity of symptoms or quantitative where samples are analysed, for example, by measuring the level ribozyme expression or level of target mRNA. A combination of qualitative or quantitative analyses may also be employed.

All of the known means for introducing foreign DNA into plants may be used, for example Aqrobacterium, electroporation, protoplast fusion, bombardment with a particle gun, or penetration of DNA into cells such as pollen, the microspore, the seed and the immature embryo, viral vectors such as the Geminiviruses or the satellite viruses. Aqrobacterium tumefaciens and rhizo enes constitute the preferred means. In this case, the sequence coding for the polyribozyme is introduced into a suitable vector together with all of the regulatory sequences necessary such as promoters, terminators, etc....as well as any sequence necessary for selecting the transfor ants.

In one approach, tobacco cells are transformed using standard procedures employing Aqrobacterium with the genetic construct to be tested. Generally, Aqrobacterium tumefaciens mediated transformation of tobacco is carried out essentially as described by Horsch et al. , Science 227 : 1229-1231, 1985, although conveniently strain LBA 4404 is used and the plantlets are selected on Kanamycin at a concentration of 250 μl/ml. The transformed cells are regenerated into small plants and samples removed to screen for expression. The plants are allowed to self-fertilise and to seed and the transgenic seeds are then used to generate new plants. The transgenic plants along with suitable controls are then exposed to the virus and the degree of symptom development analysed. Alternatively or in addition to, a quantitative assessment is made by biochemical analysis. This approach is particularly useful for screening for ribozymes against geminiviruses and in particular TLCV. Once suitable ribozyme genetic constructs are identified using this procedure, these particular constructs can then be used to generate, for example, in the case of TLCV and TYLCV, transgenic tomato plants. Similar transformation and screening procedures are employed.

The resistant nature of the transgenic plants can be tested by carrying out a self-fertilisation, or a cross with a non transformed genotype, on a primary descendant to obtain T.,. Subsequently, T-, plants are inoculated with the DNA virus by Agroinoculation. Degree of resistance (i.e. "complete resistance" meaning total absence of symptoms, "tolerance" meaning that the plant can be infected and shows symptoms but recovers, "sensitive" meaning that the plant exhibits symptoms and replicates the virus) is then noted.

The present invention is particularly directed to transgenic tomato plants which exhibit at least some resistance to TLCV and TYLCV infection. By resistance to infection is meant a qualitative reduction in symptoms (generally due to inhibition of virus replication) by more than approximately 30 %, preferably more than approximately 50 % and even more than approximately 70 %. Due to the variability of biological systems, 100 % inhibition of TLCV replication is difficult to achieve although the effectiveness of the ribozyme can be enhanced by various molecular biological techniques.

According to this aspect of the present invention, there is provided a method of generating transgenic tomato plants exhibiting reduced symptoms following exposure to TLCV compared to non-transgenic plants, said method comprising transforming tomato plant cells with a genetic construct encoding a ribozyme as hereinbefore described capable of cleaving Cl mRNA from TLCV, regenerating plants from said transformed cells, self-fertilising said regenerated plants and obtaining seeds there from and then growing transgenic plants from said seeds.

The present invention extends to transgenic plants exhibiting resistance to a plant DNA virus, more particularly a geminivirus and even more particularly TLCV. In one preferred embodiment, the transgenic plants are tomato plants. The subject invention also extends to reproductive material and seeds from such transgenic plants (e.g. tomato plants) . The ribozymes may be expressed constitutively, developmentally or inducibly.

The present invention is further described by reference to the following non-limiting figures and examples.

In the figures :

- Figure 1 is a representation of the nucleotide sequences of the complementary-sense DNA strands from three different isolates of TLCV : top row, TLCV (Australia) ; middle row, TLCV (Israel) ; bottom row TLCV (Sardinia) . The sequence is represented in a 5'->3' direction.

Figure 2 is a schematic representation of PRIB05BIN comprising a CaMV35S-1568bp TLCV fragment (containing Rzl, Rz2 and Rz3)-CaMVpolyA expression cassette cloned into BamHI cut Binl9. The insertion sites of the 3 ribozymes Rzl, Rz2 and Rz3 are indicated at positions 1111, 2056 and 2355. This numbering is the virion-sense numbering and corresponds to positions 1654, 711 and 412, respectively, using the (-)sense numbering as illustrated in figures 8 and 10.

Figure 3 is a schematic representation of pRIB05BINDel comprising a CaMV35S-1346bp TMCV fragment (containing Rzl, Rz2 and Rz3)-CaMVpolyA expression cassette cloned into BamHI cut Binl9.

Figure 4 is a schematic representation of pRIB07BIN comprising a CaMV35S-396bp TLCV fragment (containing Rzl and Rz2)-CaMVpolyA expression cassette cloned into BamHI cut Binl9.

- Figure 5 is a schematic representation of pRIB02BIN comprising a CaV35S-30bp TLCV fragment (containing Rzl)-CaMVpolyA expression cassette cloned into BamHI cut Binl9.

- Figure 6 is a schematic representation of the location of primers used for RT-PCR analysis of ribozyme construct expression in transgenic tobacco.

- Figure 7 is a schematic representation of a ribozyme model (from Haselhoff and Gerlach, Nature, 1988) . Substrate RNA can have any sequence (X) flanking GUC at the cleavage site, as long as base pairing forms with the ribozyme as shown. The arrow indicates the cleavage site. Conserved bases in ribozymes are boxed. In naturally ocσuring hammerheads, the substrate and ribozyme portions are connected by a loop, resulting in an intramolecular cleavage.

- Figure 8 shows the nucleotide sequence of the complementary-sense strand of TYLCV-S. Lower case letters indicate the ribozyme cleavage site. The sequence of TYLCV-S was published by Kher-Pour et al. (Nucl. Acid Res. (1991) 19 : 6763)

- Figure 9 shows the regions conserved in the Replicase gene, between TLCV and TYLCV-S : Figure 9(a) shows the regions highly conserved around ribozymes Rl, R4 and R5 ; Figure 9(b) shows the regions highly conserved around ribozyme R2. ":" means a mismatch, a gap means no nucleotide. Lower case letters indicate the ribozyme cleavage site.

- Figure 10 illustrates the nucleotide sequence of the complementary strand of TLCV. Dry et al. (J. Gen. Virol. (1993) 74 : 147) Lower case letters indicate the ribozyme cleavage site.

- Figure 11 shows the target sequences for polyribozymes D, F and E. Lower case letters indicate the ribozyme cleavage site. Upper case letters correspond to the complementary sequences of ribozyme arms.

- Figure 12 is a schematic representation of ribozyme constructs. A hatched line represents the TYLCV-S complementary-sense strand, and a solid line represents TLCV complementary sense strand. R •= ribozyme.

- Figure 13 is a schematic physical map of binary vector pGAZE.

- Figure 14 is a schematic physical map of ribozyme plasmids, pGAZE-RzA, pGAZE-polyRzC, pGAZE- polyRzD, pGAZE-polyRzE, pGAZE-polyRzF.

- Figure 15(a) is a schematic representation of pRIBOSBS : 1690bp TLCV C1/C2/C3 complementary fragment (containing 3 ribozymes) blunted into EcoRV cut Bluescript SK+ ; Figure 15(b) is a schematic representation of pRIBOSBIN : 2660bp Bgl II 35S- C1/C2/C3 complementary (containing 3 ribozymes) , CaMVpolyA cassette cloned into BamHI cut BIN 19; open triangles show the position of 22bp ribozyme insertions, E : EcoRI ; H : Hindlll ; K : Kpnl ; P : PstI ; Sm : Smal ; B : BamI ; SI : Sail ; St : SstI ; X : Xhol ; Xb : Xbal ; C : Clal. - Figure 16 is a schematic representation of the ribozyme constructs, showing their inter-relationship and the deletions carried out to obtain the "Short- arm" ribozymes, polyE, polyF and polyD.

- Figure 17 illustrates the "Minizyme" structure (WO-A-9119789) wherein the loop of the catalytic region is replaced by an element "P". P may be at least 1 nucleotide (ribonucleotides, deoxyribo- nucleotides, derivatives or a mixture) , provided that the ribonucleotides of the "P" group are not base paired by "Watson -Crick" base pairings when the sequences (X')n and (X)n. and P are constituted exclusively of ribonucleotides. "P" may also be a bond or any atom or group of atoms which do not affect the catalytic activity of the ribozyme. X has the same meaning as in formula I, II, III.

EXAMPLES

EXAMPLE I - SELECTION OF TARGET mRNA OF TLCV :

To enable selection of a suitable target RNA, the major mRNA transcripts were identified and mapped on the circular genome of an Australian isolate of TLCV [TLCV (Australia) , Mullineaux et al., Supra ; Dry et al, Supra] . One of the viral mRNAs derived from the complementary sense strand of the viral DNA occurred at a lower abundance than the other TLCV transcripts. This low abundance mRNA transcript was identified as encoding the Cl gene, the product of which, is essential for replication of the virus. rDavies et al. Trends in Genetics, 5 : 77-81, 1989) . The mRNA transcript also encodes three other gene products, designated C2, C3 and C4, whose functions are not conclusively known. Accordingly, the low abundance mRNA encoding the Cl gene was selected as the target mRNA. The low abundance of this transcript means a higher ratio of ribozyme target sequence, thereby potentially permitting a more substantial decrease in Cl gene product.

EXAMPLE II - SELECTION OF RIBOZYMES BASED ON CONSERVED REGIONS OF Cl GENE BETWEEN TLCV ISOLATES :

The nucleotide sequences of the complementary sense strands of three TLCV isolates [TLVC (Australia) , TLCV (Israel) and TLVC (Sardinia) ] were compared in order to identify conserved regions for targeting by ribozymes. The sequence comparison is shown in figure 1. Three conserved regions were identified for design of ribozymes. Two of these conserved regions are shown in figure 1. In addition to sequence comparisons, a computer program can be used to predict secondary structure of the target site to enable greater efficacy of the ribozyme.

EXAMPLE III - SYNTHESIS OF RIBOZYMES TARGETING CONSERVED SEQUENCES OF Cl GENE OF TLCV :

Ribozyme 1 (Rzl) :

3•- GUCCAGUCGUGUAAAAAGCAGGAGUGCCUGAGUAGUCGUAGGCUU GUAAGUC - 5'

Ribozyme 2 (Rz2) :

3'- GAGGAAAAAAUAGAAAAGCAGGAGUGCCUGAGUAGUCAAGAAAACU AGCUCA - 51

Ribozyme 3 (Rz3) :

3•- GAGUUGUAAACUACAAAGCAGGAGUGCCUGAGUAGUCUAACUUCUA GUACUA - 5• EXAMPLE IV - GENETIC CONSTRUCTS CARRYING Rzl, Rz2 and/or Rz3 : pRIBOSBIN :

A 1568 fragment of TLCV from nucleotide 1075-2643 covering the Cl, C2, C3 & C4 reading frames (ORPS) was cloned into pALTER-1 (Promega) . Ribozyme sequences 1, 2 & 3 (Rzl, Rz2 and Rz3, respectively) were chemically synthesised as described in Example III and introduced into the, TLCV sequence using the Altered sites in vitro mutagenesis system (Promega) . The integrity of introduced ribozyme sequences was confirmed by sequencing using the dideoxy chain termination method. Rzl, Rz2 and Rz3 were shown to catalyse in vitro cleavage of a complementary-sense viral RNA transcript generated with 57 RNA polymerase at 50" C and 37" C.

The modified 1634 bp complementary-sense TLCV fragment containing Rzl, Rz2 and Rz3 was cloned in the antisense orientation (relative to Cl ORF transcription) between a double 35S CaMV promoter and a CaMV polyA termination sequence and the whole expression cassette introduced into the BamHI site of the multiple cloning site of the binary vector Binl9. The resulting construct is pRIBOSBIN and is shown in figure 2.

EXAMPLE V - GENETIC CONSTRUCTS CARRYING Rzl, Rz2 and/or Rz3 : pRIB05BINDel :

This construct was derived from pRIBOSBIN (Example IV) by deletion of a 216 bp region from the BstBI site (nucleotide 2424) to the 3'-end of the TLCV fragment (nucleotide 2643) . The resulting construction is pRIB05BINDel and is shown in figure 3. EXAMPLE VI - GENETIC CONSTRUCTS CARRYING Rzl, Rz2 and/or Rz3 : PRIB07BIN :

This construct was derived from pRIBOSBINDel (Example V) by removal of a 950 bp region from the 5•-end of the TLCV fragment (nucleotide 1075) to the Xhol site (nucleotide 2025) . The resulting construct is pRIB07BIN and is shown in figure 4.

EXAMPLE VII - GENETIC CONSTRUCTS CARRYING Rzl, Rz2 and/or Rz3 : pRIB02BIN :

A 52 bp fragment containing Rzl was amplified by polymerase chain reaction (PCR) from pRIBOSBIN (Example IV) and cloned in the antisense orientation (relative to Cl ORF transcription) between a double 35S CaMV promoter and a CaMV polyA termination sequence and the whole expression cassette introduced into the BamHI site of the multiple cloning site of the binary vector Binl9. The resulting construct is pRIB02BIN and is shown in figure 5.

EXAMPLE VIII - EXPRESSION OF RIBOZYME GENETIC CONSTRUCTS IN TRANSGENIC TOBACCO CELL LINES :

The ribozyme constructs described in Examples 5 to 8 were tested for expression in transgenic tobacco plants using PCR analysis.

Leaf samples (150 mg) were collected from transgenic tobacco lines prior to potting out in the glasshouse and frozen in liquid N2. Samples were ground to a fine powder and vortexed for 30s with 0.5 ml extraction buffer (containing 0.1 M Tris-HCl (pH 9), 0.1 M NaCl, 10 mM EDTA, 1 % w/v SDS and 1 % v/v beta-mercaptoethanol) and 0.5 ml phenol. The extract was centrifuged at 12 000 g for 10 mn and the supernatant fraction collected. The supernatant fraction was extracted a further time with phenol and then with phenol/chloroform (1:1). The total nucleic acid fraction was precipitated at -20° C with sodium acetate/ethanol and centrifuged at 12 000 g for 10 mn. The pellet was washed with 80 % v/v ethanol, dried and resuspended in 50 μl sterile water.

First strand cDNA reactions were carried as follows. Nucleic acid samples were annealed at 65" C for 5 mn with 100 mg of CaMV Term primer (51- TTTACAAATACAAATACATACTAAGGGT in a total volume of 5 μl. This primer is complementary to a region within the CaMV termination sequence present in all ribozyme construct (see figure 6) transcripts produced from these transcriptions.

To the annealed template was added 5 μl of reverse trascriptase mix containing 50 mg Tris-HCl (pH 8.3), 50 mM KC1, 10 mM MgGl2, 0.5 mM spermidine, 10 mM DTT, 1 unit ribonuclease inhibitor and 2.25 units AMV reverse transcriptase. The mixture was incubated at 42" C for 60 mn followed by 94° C for 2 mn. Where indicated, control reactions were performed in which the AMV reverse transcriptase was omitted from the reaction mM Tris-HCl (pH 9), 1.5 mM MgCl2, 1.5 mM MgCl2, 0.1 % v/v Triton X-100, 200 μM dNTPs, 250 μM CaMV Term primer (see figure 6), 0.5 units of Taq DNA polymerase and 2 μl of first strand cDNA reaction mix. Two alternative 5*-end primers were used, the positions of which are shown in the attached figure :

C3 primer : 5-ACTGATCTAATTACATTGTTAATGC

RIB primer : 5'-GCAAGCTTCCTGAATGTTCGGAT PCR cycling conditions were 94° C for 1 mn, 50-55" C for 1 mn, 72° C for 3 mn for 15-30 cycles. PCR products were analysed on 1.2-1.8 % w/v agarose gels.

Reverse transcriptase (RT)-PCR analysis of RIB05BIN and RIBOSBINDel lines using the C3/CaMV Term primer combination produces DNA products approximately the predicted sizes i.e. 1690bp and 1450bp respectively.

RT-PCR analysis of RIB05BIN, RIBOSBINDel and RIB02BIN lines using the RlB/CaMV Term primer combination produces DNA products approximating the predicted sizes i.e. 504bp, 264bp and 235 bp, respectively.

No PCR products were observed in control reactions : (a) no reverse transcriptase (b) nucleic acid samples from plants transformed with vector sequences alone i.e. not containing ribozyme sequences. This demonstrates that the PCR products observed with these primers were derived specifically from RNA transcripts of the introduced ribozyme constructs.

Predicted PCR product sizes using the C3/CaMV Term primer combination are as follows :

1. RIB05BIN 1690 bp

2. RIB05BINDel 1450 bp

3. RIB07BIN

4. RIB02BIN

Predicted PCR product sizes using the RIB/CaMV Term primer combination are as follows : 1. RIB05BIN 504 bp

2. RIB05BINDel 264 bp

3. RIB07BIN 264 bp

4. RIB02BIN 235 bp

EXAMPLE IX - CONSTRUCTION OF RIBOZYME GENES

Pairwise comparisons of deduced amino-acid sequences encoded by Cl ORF of geminiviruses were investigated (table 1) .

Alignment of nucleotide sequences of TYLCV genomes isolates from Sardinia (Kheyr-Pour et al., NAR (1991) 19 : 6763) , Thai (Rochester et al. , Virology (1990) 178 : 520), Israeli (Navot et al. , Virology (1991) 185 : 151), Australia (Dry et al. , J. Gen. Vir. (1993) 74 : 147) shows that there are three conserved regions in an internal fragment of the Cl transcript encoding the polypeptide essential to replication of the virus. This BstBI / Eco 01091 internal fragment (nt 346 to nt 982) of TYLCV-S genome was cloned into a Dra 11/ Sma I digested pBluescript II SK+ phagemid (STRATAGENE) . This clone was used as template for the introduction of 2 ribozymes in the most highly conserved region. Two and three dimensional folding analyses were also made to retain the more theoretical accessible target sites for cleavage with ribozyme.

The catalytic domain of hammerhead-type RNA (figure 1) , in this case satellite RNA of tobacco ringspot virus (STobRV) , was used to design ribozymes that form, with a completely unrelated substrate RNA, a hammerhead structure in trans, so that the target RNA is specifically cleaved at the predicted site (Haseloff and Gerlach (1989), Gene, 82 : 43-52). According to the general rules described by these authors, the only requirements for a substrate RNA to be cleaved by hammerhead-type ribozymes is the presence of the trinucleotide sequence for which self-cleavage has been described (Perriman et al., Gene (1992) 113 : 157) . The two positions for the hammerhead-type ribozymes retained on the most highly conserved region of the Cl transcript of TYLCV-S are shown in figures 2 and 3 :

* position R4, nucleotide 407 (target site GUC) ;

* position R5, nucleotide 430 (target site UUC) ; To introduce the 22 bases of the hammerhead sequence of the satellite RNA of TobRV at these positions, the strategy of rapid insertional mutagenesis of DNA by polymerase chain reaction (PCR) described by Kam ann et al. (Nucl. Acid. Res. (1989) 17 : 5404) was used.

This method requires the following synthetic oligonucleotides :

Oligo R4-R5 carrying the 2 hammerhead-type ribozymes :

5• GATTTAGCTCCCTCTGATGAGTCCGTGAGGACGAAAATGTTCGGATG

GAAATGTGCTCTGATGAGTCCGTGAGGACGAAACCTGGTTGGGGAT 3

The underlined sequences correspond to the hammerhead structure of the satellite of ToRSV. Bold letters correspond to the target site.

This oligo R4-R5 was synthesized on an Applied Biosystems Model 380B DNA synthesizer.

Oligo T7 sequencing primer (Pharmacia) : 5' TTAATACGACTCACTAT 3'

Oligo T3 sequencing primer (Pharmacia) : 5» ATTAACCCTCACTAAAG 3' In the first PCR (PCR I) step, the sequence between oligo R4-R5 and oligo T3 sequencing primer was amplified. The amplified fragment was purified on a molecular sieving column (PrimeErase Quick ™ kit, STRATAGENE) . In the second PCR (PCR II) step, this amplified fragment was used itself as a primer in combination with oligo T7 sequencing primer. The PCR conditions were as follows :

PCR was carried out in a total reaction volume of 100 μl containing 50 mM KC1, 10 mM Tris-HCl pH 8.3,1.5 mM MgCl2, 300 μM dNTP each, 2 U Taq polymerase (Perkin Elmer Cetus) , 40 pg template DNA, 100 pM primer each. PCR II was the same as PCR I, except that 5 μl (300 ng of amplified fragment estimated from agarose gel) assay volume of PCR I was directly used for priming. Denaturation : 2 min 94°C ; annealing 2 min 40°C ; synthesis ; 3 min 72"C with 30 cycles for each step.

After purification using agarose electrophoresis, the PCR product was digested with BstBI, filled in using Klenow polymerase and finally digested with Eco0109I. The resulting 679 nt fragment was cloned into a Sma I /Dra II digested Bluescript SK+ vector. The cloning vector containing the cloned sequences was transformed into, and propagated in, the bacterial host XL1 Blue (STRATAGENE) , using techniques known in the art (Maniatis, Molecular cloning, A laboratory guide, 2nd edition, 1989, Cold Spring Harbor Laboratory publishers) .

The presence of the 2 hammerhead sequences of the satellite RNA of TobRV was verified by sequence analysis using T7 sequencing kit (Pharmacia) . The result shows a perfect insertion of catalytic R4 and R5 sites. EXAMPLE X - CONSTRUCTION OF RIBOZYME PLASMIDS :

Plasmid pRIBOSBS shown in figure 15 was the base point for the construction of the other plasmids. This plasmid is a pBluescript SK+ vector carrying a 1690 bp 51 end - Ase I fragment which corresponds to the C1/C4/C2/C3 complementary fragment of TLCV (figure 4) bearing 3 hammerhead-type ribozymes at positions :

- Rl (nucleotide 412, target site CUU) ,

- R2 (nucleotide 711, target site CUU) and,

- R3 (nucleotide 1654, target site GUA). Plasmid pPolyribozyme E is derived from plasmid pRIB05BS by deleting the 877bp "filled-in using Klenow Polymerase Xho I - Bel I" fragment corresponding to the region between 2 hammerhead-type sequences at positions R2 and R3, and the 264 bp "5' end - Tth 1111" fragment. The Tth 1111 site was filled-in using klenow polymerase. The "Tth III I - Hindlll (site of pBluescript SK+ vector") fragment was isolated after separation by electrophoresis on agarose gel. This fragment was cloned into EcoRI filled-in using Klenow Polymerase and Hind III sites of pBluescript SK+ vector, deleted previously from Sac I-Xba I digested using Mung Bean Nuclease fragment.

The polyribozyme E contains 434 bases and includes 3 ribozymes : Rl (position 28) , R2 (position 327) and R3 (position 399) as shown in figures 5 and 6 (polyR2E-R2) . The size of the arms flanking the catalytic domains of the ribozymes is :

* 27 nucleotides from 5' end to ribozymeRl ;

* 298 nucleotides between Rl and R2 ;

* 71 nucleotides between R2 and R3 ;

* 35 nucleotides from ribozyme R3 to 3'end.

The polyribozyme F plasmid is derived from pPolyribozyme E plasmid. The 56bp "Smal (site in pBluescript SK + vector near 51 end) - Sac I" fragment of the replicase gene of TLCV containing the ribozyme Rl was replaced with the 98bp "BstBI filled-in using klenow polymerase - Sac I" fragment of replicase gene of TYLCV - Sardinian isolate bearing the two ribozymes R4 and R5 as described previously. The exchanged fragments possess a region which is very highly conserved between different strains of TYLCV and TLCV. The nucleotide sequence identity corresponds to 97 % between the 365 nt to 435 nt region of TLCV and the 370 nt to 440 nt region of TYLCV-Sardinian isolate (Figure 3) .

The chimeric polyribozyme F contains replicase gene fragments which have two different origins : TYLCV-Sardinian isolate and TLCV-australian isolate. The assembly of these fragments was made at the Sac I site. It is also possible to assemble the two fragments using an artificial polylinker. The inclusion of this non-complementary sequence has no deleterious effect on the catalytic activity of the polyribozyme.

The polyribozyme F contains 479 bases and includes 4 ribozymes : R4 (position 59) , R5 (position 83), R2 (position 372) and R3 (position 444), as shown in figures 5 and 6.

The size of the arms flanking the catalytic domains of the ribozymes is :

* 59 nucleotides from 5' end to ribozyme R4 ;

* 22 nucleotides between ribozymes R4 and R5 ;

* 288 nucleotides between ribozymes R5 and R2 ;

* 71 nucleotides between ribozymes R2 and R3 ;

* 35 nucleotides from ribozyme R3 to 3' end.

The chimeric pPolyribozyme D is derived from pPolyribozyme F. The 206bp "Sacl-Swal" fragment originating from TLCV was deleted. The Sac I site was destroyed by action of T4-DNA polymerase. The polyribozyme D contains 270 bases and includes 4 ribozymes, R4 (position 59) , R5 (position 83) , R2 (position 163) and R3 (position 235) as shown in figures 5 and 6.

The size of the arms flanking the catalytic domains of the ribozymes is :

* 59 nucleotides from 5' end to ribozyme R4 ;

* 22 nucleotides between ribozymes R4 and R5 ;

* 79 nucleotides between ribozymes R5 and R2 ;

* 71 nucleotides between ribozymes R2 and R3 ;

* 35 nucleotides from ribozyme R3 to 3' end.

The sequences of polyribozyme E, F and D were verified using the T7 sequencing kit supplied by Pharmacia.

The functioning of polyribozymes E, F and D was tested in vitro in accordance with the protocol described in "Protocol and Application Book" from Promega.

No expression signals are contained in the polyribozymes. For this reason, they were placed under the control of double 35S promoter and poly(A) of 35S RNA of CaMV.

To realize these constructions, the expression cassette composed of a double 35S promoter, monoribozyme Rl and poly (A) of 35S of CaMV was isolated from pRIB02BIN plasmid described above.

The pRIB02BIN plasmid was digested with Sac I. The Sac I sites were made blunt-ended using T4-DNA polymerase.

The linearized pRIB02BIN plasmid was then digested with Sal I, the "Sac I filled-in Sal I" fragment which contains the expression cassette was purified on agarose gel and cloned into pBluescript SK+ vector in "Xba I filled-in using Klenow Polymerase and Sal I" sites.

The Hind III - Bam HI fragment corresponding to monoribozyme Rl was then replaced with Hindlll - BamHI fragments containing the polyribozymes E, F and D isolated from pPolyribozym.es E, F and D respectively. The Hind III - BamHI fragment is in inverse orientation in the expression vector.

The expression cassette with polyribozymes E, F or D were cloned into the binary vector pGAZE (figure 7) derived from pGA492 (An, Plant Physiol. (1986) 81 : 86) . The pGA 492 vector was double digested with Sac I and Sea I, made blunt-ended using T4-DNA polymerase and ligated after agarose gel purification.

The eliminated fragment corresponds to nearly the entire chloramphenicol acetyl transferase gene. The Hind III site was also converted into EcoRI site with HinduI - EcoRI adaptors supplied by Stratagene. As for pGA492, pGAZE contains the cis-acting elements required for plant transformation, including T-DNA border, a selectable marker expressible in plants (kanamycin resistance) , cloning sites, and a wide host range replicon. The kanamycin resistant marker is constructed from nopaline synthase control regions and neomycin phosphotransferase coding region of Tn5.

The pGAZE vector was digested with EcoRI and filled-in using Klenow-polymerase. The "Sad filled-in - Sal I" fragments containing the expression cassettes with polyribozymes E, F or D were cloned into the. EcoRI filled-in site of pGAZE.

The obtained recombinant binary vectors, pGAZE- polyribozyme E, pGAZE-polyribozyme F and pGAZE- polyribozyme D (figure 7) were introduced into the desarmed strain LBA4404 of Aqrobacterium tumefaciens (Hoeke a et al.. Nature (1983) 303 : 179) by direct transformation (protocol derived from Holsters et al., Mol. Gen. Genet. (1978) 163 : 181)

For ribozyme A, which corresponds to monoribozyme Rl including the catalytic domainand flanking arms 15 bases long, and polyribozyme C described above (example V) expression cassettes were introduced in pGAZE and/or pGA492 as mentioned above.

Thus, pGAZE-ribozyme A, pGA492-ribozyme A and pGAZE-polyribozyme C (Figure 8) were obtained. The genes of interest of all the constructions described above were transferred into tomato using Agrobacterium based co-cultivation system. Tomato transformation and regeneration was carried out as described by Fillatti et al (Biotechnology (1987) 5 : 726) .

EXAMPLE XI - MOLECULAR ANALYSIS OF TRANSGENIC PLANTS

* RNA analysis :

Total RNA is isolated from young leaves of transgenic and non-transgenic plants grown in the greenhouse according to Chandler et al. (Plant Physiol. (1983) 74 : 47) . RNA is separated on agarose-formaldehyde gels and transferred to a nitrocellulose membrane. The blot is hybridized with labelled fragment or entire gene of interest. To check whether equal amounts of RNA were applied to each line, the nitrocellulose membrane is stained with methylene blue.

* DNA analysis :

For Southern blot analysis, total DNA is isolated from young leaves of transgenic and non-transgenic plants grown in the greenhouse according to Dellaporta et al. (Plant Mol. Biol. Rep. (1983) 1 : 19), digested with restriction enzymes according to the manufacturer's instructions, separated by electrophoresis on agarose gel and transferred to nitrocellulose by capillary action. The blot is probed with labelled fragment or entire gene of interest.

EXAMPLE XII - EVALUATION OF RESISTANCE TO TYLCV FOR TRANSFORMED TOMATO PLANTS WITH THE DIFFERENT CONSTRUCTIONS BY AGROINOCULATIONS

Since TYLCV or its cloned DNA are not transmitted mechanically, the agroinoculation technique (Grimsley et al. , Plant DNA Infections Agents, Hohn and Schell

(eds) Springer, Wien, New York (1987) pp 87-107) is used to assay to infectivity of the cloned DNA.

The TYLCV-Sardinian strain genome was inserted into Sst I site of the binary plant transformation vector pBin 19 (Stanley et al., EMBO J. (1986)5 : 1761) and a BamHI-fragment of about 600 bp extending from polylinker of pBin 19 through the intergenic region of TYLCV to the BamHI site at map position 152 of TYLCV was deleted. Subsequently a complete genome unit of TYLCV was inserted into the remaining Sst I site yielding a 1,8 mer of the TYLCV-genome in pBin 19. This plasmid was introduced directly into

Agrobacterium tumefaciens strain LBA4404.

Agrobacterium tumefaciens cultures were grown at 28"C for about 48 hours. The cells were pelleted and washed twice with water and resuspended in 1/10 th of the initial volume of sterile water.

Young transformed tomato plants, at the 3 to 4 leaf stage, are inoculated into the petioles of the three youngest leaves with the concentrated Agrobacteria using a 18-gauge needle. The plants are placed in a closed growth chamber with 16 h - day light at 24°C under 70 % relative humidity.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

Claims

1. A ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target mRNA sequence transcribed from a DNA molecule associated with a DNA virus capable of infecting plant cells, wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantially reducing replication, infection and/or assembly of said DNA virus.
2. A ribozyme according to claim 1 wherein the plant DNA virus is a single stranded DNA virus.
3. A ribozyme according to claim 2 wherein the single stranded DNA virus is a geminivirus.
4. A ribozyme according to claim 3 wherein the geminivirus is selected from the group consisting of Maize Streak Virus (MSV) , Bean Gold Mosaic Virus (BGMV) , African Cassava Mosaic Virus (ACMV) , Chloris Striate Mosaic Virus (CSMV) , Tomato Yellow Leaf Curl Virus (TYLCV) , Tomato Golden Mosaic Virus (TGMV) , Tomato Leaf Curl Virus (TLCV) and Beet Curly Top Virus (BCTV) .
5. A ribozyme according to claim 4 wherein the geminivirus is Tomato Leaf Curl Virus (TLCV) , Tomato Yellow Leaf Curl Virus (TYLCV) or a mutant, derivative or variant thereof.
6. A ribozyme comprising a hybridising region and a catalytic region wherein the hybridising region is capable of hybridising to at least part of a target mRNA sequence transcribed from a virion-sense DNA molecule of a geminivirus or a DNA molecule complementary to said virion-sense DNA molecule, wherein said catalytic region is capable of cleaving said target mRNA sequence thereby substantially reducing replication of said geminivirus.
7. A ribozyme according to claim 6 wherein the mRNA transcript is in low abundance compared to other mRNA transcripts directed by the virus.
8. A ribozyme according to claim 7 wherein the mRNA transcript is from the Cl, LI, ALl, ACl, or other gene involved in the replication of a geminivirus gene.
9. A ribozyme according to claim 8 wherein the Cl gene is specified by the complementary-sense DNA strand of said geminivirus.
10. A ribozyme according to claim 9 wherein the geminivirus is selected from the group consisting of Maize Streak Virus (MSV) , Bean Gold Mosaic Virus (BGMV) , African Cassava Mosaic Virus (ACMV) , Chloris Striate Mosaic Virus (CSMV) , Tomato Yellow Leaf Curl Virus (TYLCV) , Tomato Golden Mosaic Virus (TGMV) , Tomato Leaf Curl Virus (TLCV) and Beet Curly Top Virus (BCTV) preferably TLCV, TYLCV or a mutant, derivative or variant thereof.
11. A ribozyme according to claim 10 wherein the hybridising region of said ribozyme is capable of hybridising to a sequence of ribonucleotides flanking a sequence X°UY, wherein X is any ribonucleotide, U is uracil and Y is adenine, cytosine or uracil, said hybridising region comprising a sequence of nucleotides having substantial identity with a part or region of the sequence illustrated in figure 1.
12. A ribozyme according to claim 11 selected from the group consisting of :
3'- GUCCAGUCGUGUAAAAAGCAGGAGUGCCUGAGUAGUCGUAGGCUU GUAAGUC-5' ;
3'- GAGGAAAAAAUAGAAAAGCAGGAGUGCCUGAGUAGUCAAGAAAAC UAGCUCA-5• ; 3'- GAGUUGUAAACUACAAAGCAGGAGUGCCUGAGUAGUCUAACUUCU AGUACUA-5' . and
5'- GATTTAGCTCCCTCTGATGAGTCCGTGAGGACGAAAATGTTCGGATG
GAAATGTGCTCTGATGAGTCCGTGAGGACGAAACCTGGTTGGGGAT-3'
13. Nucleic acid compound having endoribonuclease activity and being capable of inhibiting the replication, infection or assembly of a DNA virus, said compound comprising at least one unit, "R", having the general formula :
5' [X-Y-X'] 3'
in which :
- X and X* each represent, independently, a nucleotide sequence having at least 4 bases and being complementary to at least a part of either the viral genome, or the (-)sense RNA transcript of a DNA virus ;
Y represents the catalytic region of a ribozyme.
14. Nucleic acid compound according to claim 13 comprising one "R" unit only and having the general formula :
[X-Y-X']
X, X1 and Y being as previously defined.
15. Nucleic acid compound according to claim 13, comprising a plurality of "R" units and having the general formula :
R.-R2 Rn R being as previously defined, and n > 1.
16. Nucleic acid compound according to claim 14 or 15 wherein the X and X1 sequences within any one "R" unit are complementary to adjacent, contiguous portions of the DNA virus genome or (-)sense RNA transcript.
17. Nucleic acid compound according to claims 15 and 16 wherein the 3' X' sequence of a given "R" unit and the 5' X sequence of the adjacent "R" unit are complementary to sequences which are contiguous in the DNA genomes or (-)sense RNA transcript.
18. Nucleic acid compound according to claim 14 or 15 characterised in that the X and X' sequences within any one "R" unit are complementary to non¬ contiguous portions of the genome or of the (-)sense RNA transcript.
19. Nucleic acid compound according to claim 15 wherein the 3• X• sequence of a given "R" unit and the 5' X sequence of the adjacent "R" unit are complementary to non-contiguous portions of the genome or of the (-)sense RNA transcript.
20. Nucleic acid compound according to any one of claims 13 to 19 wherein a sequence "A" having at least 4 bases and being non-complementary to the viral genome or the (-)sense RNA transcript, is included between 2 consecutive "R" units.
21. Nucleic acid compound according to claim 20 wherein the non-complementary sequence "A" is a polylinker or a spacer.
22. Nucleic acid compound according to any of claims 15 to 21 comprising X and X' sequences complementary to the genome or to the (-) sense transcripts of at least 2 different types or isolates of DNA virus.
23. Nucleic acid compound according to any of claims 15 to 21 wherein at least one of the "R" units contains X and X' sequences which are complementary to regions highly conserved between DNA viruses, for example between DNA viruses of the same type.
24. Nucleic acid compound according to any of the preceding claims wherein the ribozyme catalytic region "Y" is a hammerhead catalytic region.
25. A ribozyme of Formula (I) :
(X)n Y Y (X)n. A C
A U G G C * A yι yιι 5' 3' (I)
wherein, (X)n and (X)n> represent ribonucleotide sequences substantially complementary to a mRNA sequence of a DNA virus ; the sum of n and n' may be the same or different ; an (*) represents a base pair between complementary ribonucleotides ; Y represents any ribonucleotide and each Y may be the same or different ; Y' and Y' ' represent ribonucleotides of complementary sequence along at least part of their length to allow base pairing between the oligoribonucleotides, or Y1 and Y1' together form a single RNA sequence wherein at least part of said sequence comprises a stem formed by base pairing between complementary nucleotides ; and optionally, an additional nucleotide selected from any one of A, G, C or U is inserted after 1A.
26. A ribozyme according to claim 25 of formula (II) : 3 ' 5 1
(X) nA Y (X) „.
A C
A U
G 1A G
C * G G A
Y * Y Y
Y * Y
(Y) . * (Y) m.
Y Y
B (II)
wherein, (X)n and (X)n. represent ribonucleotide sequences substantially complementary to a mRNA of a DNA virus and in particular a geminivirus such as TLCV or TYLCV ; Y represents any ribonucleotide and each Y residue may be the same or different ; an (*) represents a base pair between complementary ribonucleotides ; n and n* are as previously defined ; B represents a bond, a base pair, a ribonucleotide or an oligoribonucleotide containing at least 2 ribonucleotides ; m and m' are 1 or more and may be the same or different ; and optionally, an additional nucleotide selected from any one of A, G, C or U is inserted after 1A.
27. A ribozyme according to claim 26 of Formula (III) :
3' 5'
( )πA Y(X)„.
A C
A U
G A G C * G G A A * U U G * C G * C A G
G U (III)
wherein, (X)n and (X)n. represent ribonucleotide sequences substantially complementary to a mRNA of a DNA virus and in particular a geminivirus such as TLCV ; Y represents any ribonucleotide and each Y residue may be the same or different ; an (*)represents a base pair between complementary ribonucleotides ; n and n' are as previously defined.
28. A ribozyme according to claim 27 selected from the group consisting of :
3'- GUCCAGUCGUGUAAAAAGCAGGAGUGCCUGAGUAGUCGUAGGCUU GUAAGUC-5» ;
3'- GAGGAAAAAAUAGAAAAGCAGGAGUGCCUGAGUAGUCAAGAAAAC UAGCUCA-5' ;
3«- GAGUUGUAAACUACAAAGCAGGAGUGCCUGAGUAGUCUAACUUCU AGUACUA-5' . and
5'- GATTTAGCTCCCTCTGATGAGTCCGTGAGGACGAAAATGTTCGGATG
GAAATGTGCTCTGATGAGTCCGTGAGGACGAAACCTGGTTGGGGAT-3•
29. A genetic construct comprising a complementary sequence of the ribozyme according to claim 1, 6, 13, 25 or 28 and a vector sequence.
30. A genetic construct according to claim 29 further comprising a promoter operably linked to said complementary ribozyme sequence.
31. A genetic sequence selected from the group consisting Of pRIB05BIN, pRIB05BINDel, pRIB07BIN, pRIB02BIN, pGAZE-RzA, pGAZE-polyRzC, pGAZE-polyRzD, pGAZE-polyRzE, pGAZE-polyRzF, pGA492-RzA and pGA492polyRzC.
32. A transgenic plant comprising cells capable of reducing replication, infection and/or assembly of a plant DNA virus, said plant cells expressing a ribozyme according to any one of claims l, 6, 13, 25 or 28.
33. A transgenic plant according to claim 32 wherein said plant DNA virus is a single stranded DNA virus.
34. A transgenic plant according to claim 33 wherein said single stranded DNA virus is a geminivirus.
35. A transgenic plant according to claim 34 wherein said geminivirus is TLCV or TYLCV.
36. A transgenic plant according to claim 35 wherein the ribozyme expressed is selected from the group consisting of RIB05, RIBOSDel, RIB07, RIB02, RzA, polyRzC, polyRzD, polyRzE, polyRzF.
37. A transgenic plant according to any one of claims 3 to 36 wherein said plant is a tomato plant.
38. Process for conferring resistance to a DNA virus on a plant, by the introduction into the plant of a ribozyme according to any one of claims 1, 6, 13, 25 or 28, for example by stable genetic transformation of a part of the plant by a DNA sequence encoding the ribozyme, followed by regeneration of a transgenic plant.
PCT/EP1993/001946 1993-07-22 1993-07-22 Dna virus ribozymes WO1995003404A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP1993/001946 WO1995003404A1 (en) 1993-07-22 1993-07-22 Dna virus ribozymes

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
KR1019960701748A KR960705036A (en) 1993-07-22 1993-07-22 Dna virus ribozyme
AU47014/93A AU694093B2 (en) 1993-07-22 1993-07-22 DNA virus ribozymes
EP19930917617 EP0728199A1 (en) 1993-07-22 1993-07-22 Dna virus ribozymes
JP50486595A JPH09505461A (en) 1993-07-22 1993-07-22 Dna virus ribozyme
PCT/EP1993/001946 WO1995003404A1 (en) 1993-07-22 1993-07-22 Dna virus ribozymes
IL11040694A IL110406D0 (en) 1993-07-22 1994-07-21 DNA virus ribozymes
ZA9405414A ZA9405414B (en) 1993-07-22 1994-07-22 DNA virus ribozymes

Publications (1)

Publication Number Publication Date
WO1995003404A1 true WO1995003404A1 (en) 1995-02-02

Family

ID=8165745

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1993/001946 WO1995003404A1 (en) 1993-07-22 1993-07-22 Dna virus ribozymes

Country Status (7)

Country Link
EP (1) EP0728199A1 (en)
JP (1) JPH09505461A (en)
KR (1) KR960705036A (en)
AU (1) AU694093B2 (en)
IL (1) IL110406D0 (en)
WO (1) WO1995003404A1 (en)
ZA (1) ZA9405414B (en)

Cited By (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996008573A1 (en) * 1994-09-15 1996-03-21 Centre National De La Recherche Scientifique Phytopathogenic dna virus resistant transgenic plants and seeds and methods for obtaining same
WO1999028485A2 (en) * 1997-12-03 1999-06-10 Gene Shears Pty. Ltd. Ribozymes capable of conferring resistance to potyvirus infection, and plants expressing said ribozymes
US6107078A (en) * 1994-06-24 2000-08-22 Gene Shears Pty Limited Ribozymes with optimized hybridizing arms, stems, and loops, tRNA embedded ribozymes and compositions thereof
US6350934B1 (en) 1994-09-02 2002-02-26 Ribozyme Pharmaceuticals, Inc. Nucleic acid encoding delta-9 desaturase
US6473739B1 (en) 1999-04-27 2002-10-29 Robert S. Showghi Remote ordering system
US6747188B2 (en) 1998-10-01 2004-06-08 North Carolina State University Transgenic plants expressing a mutant geminivirus AL3/C3 coding sequence
US7120996B2 (en) 1995-11-06 2006-10-17 Matsushita Electric Industrial Co., Ltd. Component mounting apparatus having component supply tables provided on opposite sides of a component transfer path
WO2007054522A1 (en) 2005-11-08 2007-05-18 Cropdesign N.V. Plants having improved growth characteristics and a method for making the same
WO2007064724A2 (en) 2005-12-01 2007-06-07 Cropdesign N.V. Plants having improved growth characteristics and methods for making the same
WO2007113237A2 (en) 2006-03-31 2007-10-11 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2008015263A2 (en) 2006-08-02 2008-02-07 Cropdesign N.V. Plants having improved characteristics and a method for making the same
WO2008062049A1 (en) 2006-11-24 2008-05-29 Cropdesign N.V. Transgenic plants comprising as transgene a class i tcp or clavata 1 (clv1) or cah3 polypeptide having increased seed yield and a method for making the same
WO2008093283A2 (en) * 2007-01-29 2008-08-07 University Of The Witwatersrand, Johannesburg Use of double stranded rna hairpin duplexes in gene silencing
WO2008092935A2 (en) 2007-01-31 2008-08-07 Basf Plant Science Gmbh Plants having enhanced yield-related traits and/or increased abiotic stress resistance, and a method for making the same
WO2009013263A2 (en) 2007-07-20 2009-01-29 Basf Plant Science Gmbh Plants having increased yield-related traits and a method for making the same
WO2009016232A2 (en) 2007-07-31 2009-02-05 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2009034188A1 (en) 2007-09-14 2009-03-19 Basf Plant Science Gmbh Plants having increased yield-related traits and a method for making the same
WO2009056566A2 (en) 2007-10-29 2009-05-07 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2009068564A1 (en) 2007-11-26 2009-06-04 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2009080802A2 (en) 2007-12-20 2009-07-02 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2009092772A2 (en) 2008-01-25 2009-07-30 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112008001730T5 (en) 2007-06-29 2010-06-02 Basf Plant Science Gmbh Plants having enhanced yield-related traits and processes for their preparation
EP2199397A2 (en) 2002-12-24 2010-06-23 CropDesign N.V. Plants having modified growth characteristics and a method for making the same
EP2204384A1 (en) 2003-04-01 2010-07-07 CropDesign N.V. Plant haemoglobin
WO2010086221A1 (en) 2009-01-28 2010-08-05 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112008001044T5 (en) 2007-05-03 2010-09-02 Basf Plant Science Gmbh Plants having enhanced yield-related traits and processes for their preparation
WO2010097343A1 (en) 2009-02-25 2010-09-02 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2010124953A1 (en) 2009-04-29 2010-11-04 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011020746A1 (en) 2009-08-19 2011-02-24 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
EP2302062A1 (en) 2003-10-20 2011-03-30 CropDesign N.V. Identification of E2F target genes and uses thereof
WO2011036232A1 (en) 2009-09-25 2011-03-31 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011036160A1 (en) 2009-09-25 2011-03-31 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011048009A1 (en) 2009-10-22 2011-04-28 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011058029A1 (en) 2009-11-13 2011-05-19 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112009000705T5 (en) 2008-04-16 2011-06-16 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
DE112009000934T5 (en) 2008-05-05 2011-07-14 BASF Plant Science GmbH, 67063 Plants with improved yield-related traits and methods for their production
DE112009001405T5 (en) 2008-06-26 2011-07-28 BASF Plant Science GmbH, 67063 Plants with increased yield-related properties and process for their preparation
EP2361985A1 (en) 2010-02-26 2011-08-31 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP2361927A1 (en) 2010-02-26 2011-08-31 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
WO2011104128A2 (en) 2010-02-24 2011-09-01 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011104155A2 (en) 2010-02-24 2011-09-01 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011114312A1 (en) 2010-03-19 2011-09-22 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making same
WO2011114279A1 (en) 2010-03-18 2011-09-22 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making the same
WO2011114313A1 (en) 2010-03-19 2011-09-22 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making the same
DE112009001459T5 (en) 2008-06-20 2011-09-29 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
WO2011117800A1 (en) 2010-03-22 2011-09-29 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making the same
DE112009001667T5 (en) 2008-07-17 2011-09-29 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
EP2371965A1 (en) 2006-05-30 2011-10-05 CropDesign N.V. Plants with increased expression of F-box WD40 polypeptide having increased yield and a method for making the same
DE112008001837T5 (en) 2007-07-31 2012-01-05 Basf Plant Science Gmbh Plants with improved yield-related traits and methods for their production
DE112009000221T5 (en) 2008-01-31 2012-01-05 National Institute For Biological Sciences Plants with altered growth and / or evolution and process for their production
DE112009001860T5 (en) 2008-07-31 2012-01-12 Basf Plant Science Gmbh Plants with modified growth characteristics and process for their preparation
DE112009002224T5 (en) 2008-09-24 2012-01-19 Basf Plant Science Gmbh Plants with increased yield-related properties and process for their preparation
DE112009001560T5 (en) 2008-07-04 2012-01-26 Basf Plant Science Gmbh Plants with increased yield-related traits and methods of making same
DE112009001927T5 (en) 2008-08-20 2012-01-26 Basf Plant Science Gmbh Plants with increased yield-related properties and process for their preparation
DE112009003515T5 (en) 2008-12-03 2012-05-24 Basf Plant Science Gmbh Plants with increased abiotic stress tolerance and / or increased yield-related traits and methods for producing the same
DE112010001805T5 (en) 2009-04-29 2012-09-06 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2012117368A1 (en) 2011-03-01 2012-09-07 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and producing methods thereof
WO2012143545A1 (en) 2011-04-22 2012-10-26 Vib Vzw Methods and means to produce abiotic stress tolerant plants
DE112009003749T5 (en) 2008-12-17 2012-11-15 Basf Plant Science Gmbh Plants with enhanced yield-related traits and / or increased abiotic resistance to stress and methods of making the same
EP2543733A1 (en) 2006-08-02 2013-01-09 CropDesign N.V. Plants having improved characteristics and a method for making the same
DE112011100940T5 (en) 2010-03-18 2013-01-24 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112011102113T5 (en) 2010-06-24 2013-03-28 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112011102378T5 (en) 2010-07-16 2013-04-18 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods of making the same
DE112009002731T5 (en) 2008-11-12 2013-05-08 Basf Plant Science Gmbh Plants with increased abiotic stress tolerance and / or increased yield-related traits and methods for producing the same
DE112010002275T5 (en) 2009-05-06 2013-06-20 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and / or increased tolerance to abiotic stress and methods for their production
DE112011102151T5 (en) 2010-06-25 2013-07-11 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112011103723T5 (en) 2010-11-10 2013-08-08 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112012000525T5 (en) 2011-01-20 2013-10-24 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112012001020T5 (en) 2011-02-28 2013-12-19 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112012001017T5 (en) 2011-02-28 2013-12-19 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
EP2677035A1 (en) 2012-06-22 2013-12-25 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP2835427A2 (en) 2010-08-24 2015-02-11 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP2896698A1 (en) 2014-01-17 2015-07-22 BASF Plant Science Company GmbH Plants having one or more enhanced yield-related traits and a method for making the same
EP2955229A1 (en) 2009-06-19 2015-12-16 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0421376A1 (en) * 1989-10-06 1991-04-10 Hoechst Schering AgrEvo GmbH Multifunctional RNA with self-processing activity, its production and use
WO1991014699A1 (en) * 1990-03-21 1991-10-03 The University Of Colorado Foundation, Inc. Site specific cleavage of single-stranded dna
WO1992006693A1 (en) * 1990-10-22 1992-04-30 Fox Chase Cancer Center Dna construct for providing rna therapy
EP0558944A2 (en) * 1992-02-06 1993-09-08 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. RNA and DNA molecules for producing virus resistance
WO1993023569A1 (en) * 1992-05-11 1993-11-25 Ribozyme Pharmaceuticals, Inc. Method and reagent for inhibiting viral replication

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0421376A1 (en) * 1989-10-06 1991-04-10 Hoechst Schering AgrEvo GmbH Multifunctional RNA with self-processing activity, its production and use
WO1991014699A1 (en) * 1990-03-21 1991-10-03 The University Of Colorado Foundation, Inc. Site specific cleavage of single-stranded dna
WO1992006693A1 (en) * 1990-10-22 1992-04-30 Fox Chase Cancer Center Dna construct for providing rna therapy
EP0558944A2 (en) * 1992-02-06 1993-09-08 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. RNA and DNA molecules for producing virus resistance
WO1993023569A1 (en) * 1992-05-11 1993-11-25 Ribozyme Pharmaceuticals, Inc. Method and reagent for inhibiting viral replication

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BEJARANO, E.R., ET AL.: "Prospects for engineering virus resistance in plants with antisense RNA", TIBTECH, vol. 10, November 1992 (1992-11-01), pages 383 - 388, XP023572105, DOI: doi:10.1016/0167-7799(92)90279-5 *
CHEN, C-J., ET AL.: "Multitarget-ribozyme directed to cleave at up to nine highly conserved HIV-1 env RNA regions inhibits HIV-1 replication ----- potential effectiveness against most presently sequenced HIV-1 isolates", NUCLEIC ACIDS RESEARCH, vol. 20, no. 17, 11 September 1992 (1992-09-11), ARLINGTON, VIRGINIA US, pages 4581 - 4589, XP002111362 *
DAY, A.G., ET AL.: "Expression of an antisense viral gene in transgenic tobacco confers resistance to the DNA virus tomato golden mosaic virus", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 88, August 1991 (1991-08-01), WASHINGTON US, pages 6721 - 6725 *
EDINGTON, B.V., ET AL.: "Utilization of ribozymes in plants. Plant viral resistance", RAVEN PRESS SERIES ON MOLECULAR AND CELL BIOLOGY, VOL. 1. GENE REGULATION: BIOLOGY OF ANTISENSE RNA AND DNA. 1992., pages 209 - 221 *
GERLACH, W.L., ET AL.: "Ribozymes for the control of gene activity in-vivo", ANTISENSE NUCLEIC ACIDS AND PROTEINS: FUNDAMENTALS AND APPLICATIONS. EDITED BY MOL, J.N.M., ET AL., 1991, pages 157 - 168 *
NELSON, R.S., ET AL.: "Protection against tobacco mosaic virus challenge through expression of a ribozyme", J. CELL. BIOCHEM. SUPPL., vol. 15A, 1991, pages 59 *
VON WEIZSÄCKER, F., ET AL.: "Cleavage of hepatitis B virus RNA by three ribozymes transcribed from a single DNA template", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 189, no. 2, 15 December 1992 (1992-12-15), DULUTH, MINNESOTA US, pages 743 - 748, XP024838384, DOI: doi:10.1016/0006-291X(92)92264-X *
YOUNG, M., ET AL.: "Using plant virus and related RNA sequences to control gene expression", STADLER GENETICS SYMPOSIA SERIES: GENE MANIPULATION IN PLANT IMPROVEMENT, II. 19TH STADLER GENETICS SYMPOSIUM, COLUMBIA, MISSOURI, USA, MARCH 13-15, 1989. PLENUM PRESS. EDITED BY GUSTAFSON, J.P., 1990, pages 313 - 330 *

Cited By (148)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6107078A (en) * 1994-06-24 2000-08-22 Gene Shears Pty Limited Ribozymes with optimized hybridizing arms, stems, and loops, tRNA embedded ribozymes and compositions thereof
US6350934B1 (en) 1994-09-02 2002-02-26 Ribozyme Pharmaceuticals, Inc. Nucleic acid encoding delta-9 desaturase
WO1996008573A1 (en) * 1994-09-15 1996-03-21 Centre National De La Recherche Scientifique Phytopathogenic dna virus resistant transgenic plants and seeds and methods for obtaining same
US6133505A (en) * 1994-09-15 2000-10-17 Centre National De La Recherche Scientifique Phytopathogenic geminivirus resistant transgenic plants and seeds and methods for obtaining same by introduction of mutated C1 gene
US7120996B2 (en) 1995-11-06 2006-10-17 Matsushita Electric Industrial Co., Ltd. Component mounting apparatus having component supply tables provided on opposite sides of a component transfer path
WO1999028485A3 (en) * 1997-12-03 1999-09-02 Gene Shears Pty Ltd Ribozymes capable of conferring resistance to potyvirus infection, and plants expressing said ribozymes
EP0922767A1 (en) * 1997-12-03 1999-06-16 Gene Shears Pty Limited Ribozymes capable of conferring resistance to potyvirus infection, and plants expressing said ribozymes
WO1999028485A2 (en) * 1997-12-03 1999-06-10 Gene Shears Pty. Ltd. Ribozymes capable of conferring resistance to potyvirus infection, and plants expressing said ribozymes
US6747188B2 (en) 1998-10-01 2004-06-08 North Carolina State University Transgenic plants expressing a mutant geminivirus AL3/C3 coding sequence
US6473739B1 (en) 1999-04-27 2002-10-29 Robert S. Showghi Remote ordering system
EP2199397A2 (en) 2002-12-24 2010-06-23 CropDesign N.V. Plants having modified growth characteristics and a method for making the same
EP2204384A1 (en) 2003-04-01 2010-07-07 CropDesign N.V. Plant haemoglobin
EP2316953A2 (en) 2003-10-20 2011-05-04 CropDesign N.V. Identification of novel E2F target genes and use thereof
EP2302062A1 (en) 2003-10-20 2011-03-30 CropDesign N.V. Identification of E2F target genes and uses thereof
WO2007054522A1 (en) 2005-11-08 2007-05-18 Cropdesign N.V. Plants having improved growth characteristics and a method for making the same
WO2007064724A2 (en) 2005-12-01 2007-06-07 Cropdesign N.V. Plants having improved growth characteristics and methods for making the same
EP2441844A1 (en) 2006-03-31 2012-04-18 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2439280A1 (en) 2006-03-31 2012-04-11 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
WO2007113237A2 (en) 2006-03-31 2007-10-11 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
EP2439277A1 (en) 2006-05-30 2012-04-11 CropDesign N.V. Plants overexpressing SYR polypeptide having enhanced yield-related traits and a method for making the same
EP2410059A2 (en) 2006-05-30 2012-01-25 CropDesign N.V. Plants overexpressing Golden2-like protein (GLK) having enhanced yield-related traits and a method for making the same
EP2441839A1 (en) 2006-05-30 2012-04-18 CropDesign N.V. Plants with reduced expression of REVOLUTA (REV) having enhanced yield-related traits and a method for making the same
EP2423317A2 (en) 2006-05-30 2012-02-29 CropDesign N.V. Plants with modulated expression of RAN binding protein (RANB) having enhanced yield-related traits and a method for making the same
EP2371965A1 (en) 2006-05-30 2011-10-05 CropDesign N.V. Plants with increased expression of F-box WD40 polypeptide having increased yield and a method for making the same
EP2377937A1 (en) 2006-05-30 2011-10-19 CropDesign N.V. Plants with reduced expression of a CLE-like gene having enhanced yield-related traits and a method for making the same
EP2540832A1 (en) 2006-08-02 2013-01-02 CropDesign N.V. Plants transformed with a small inducible kinase having improved yield related traits and a method for making the same
EP2189533A1 (en) 2006-08-02 2010-05-26 CropDesign N.V. Plants having improved characteristics and a method for making the same
EP2189534A2 (en) 2006-08-02 2010-05-26 CropDesign N.V. Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same
WO2008015263A2 (en) 2006-08-02 2008-02-07 Cropdesign N.V. Plants having improved characteristics and a method for making the same
EP2543732A1 (en) 2006-08-02 2013-01-09 CropDesign N.V. Plants transformed with a nucleic acid encoding chloroplastic fructose-1,6-bisphosphatase having increased yield, and a method for making the same
EP2199394A1 (en) 2006-08-02 2010-06-23 CropDesign N.V. Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same
EP2199396A1 (en) 2006-08-02 2010-06-23 CropDesign N.V. Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same
EP2199395A1 (en) 2006-08-02 2010-06-23 CropDesign N.V. Plants transformed with SYT-polypeptide having increased yield under abiotic stress and a method for making the same
EP2543733A1 (en) 2006-08-02 2013-01-09 CropDesign N.V. Plants having improved characteristics and a method for making the same
EP2546262A1 (en) 2006-08-02 2013-01-16 CropDesign N.V. Modifying the content of storage compounds in seeds by expression of a Class II HD-Zip transcription factor
EP2599871A2 (en) 2006-11-24 2013-06-05 CropDesign N.V. Transgenic plants comprising as transgene A class I TCP or clavata 1 (CLV1) or CAH3 polypeptide having increased seed yield and a method for making the same
WO2008062049A1 (en) 2006-11-24 2008-05-29 Cropdesign N.V. Transgenic plants comprising as transgene a class i tcp or clavata 1 (clv1) or cah3 polypeptide having increased seed yield and a method for making the same
US8293974B2 (en) 2007-01-29 2012-10-23 University Of Witwatersrand Use of double stranded RNA hairpin duplexes in gene silencing
WO2008093283A2 (en) * 2007-01-29 2008-08-07 University Of The Witwatersrand, Johannesburg Use of double stranded rna hairpin duplexes in gene silencing
AP2851A (en) * 2007-01-29 2014-02-28 Univ Witwatersrand Jhb Use of double stranded RNA hairpin duplexes in gene silencing
WO2008093283A3 (en) * 2007-01-29 2008-11-13 Univ Witwatersrand Jhb Use of double stranded rna hairpin duplexes in gene silencing
WO2008092935A2 (en) 2007-01-31 2008-08-07 Basf Plant Science Gmbh Plants having enhanced yield-related traits and/or increased abiotic stress resistance, and a method for making the same
EP2615174A2 (en) 2007-01-31 2013-07-17 BASF Plant Science GmbH Plants having enhanced yield-related traits and/or increased abiotic stress resistance, and a method for making the same
EP2275560A2 (en) 2007-01-31 2011-01-19 BASF Plant Science GmbH Trangenic plants wherein the transgene is a memeber of the REMORIN gene family or a consensus sequence thereof having enhanced yield-related traits and a method for making the same
DE112008000275T5 (en) 2007-01-31 2009-12-31 Basf Plant Science Gmbh Plants having enhanced yield-related traits and / or increased abiotic stress resistance, and process for their preparation
EP2230310A1 (en) 2007-05-03 2010-09-22 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112008001044T5 (en) 2007-05-03 2010-09-02 Basf Plant Science Gmbh Plants having enhanced yield-related traits and processes for their preparation
EP2228386A1 (en) 2007-05-03 2010-09-15 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2316956A2 (en) 2007-05-03 2011-05-04 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2508610A1 (en) 2007-06-29 2012-10-10 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112008001730T5 (en) 2007-06-29 2010-06-02 Basf Plant Science Gmbh Plants having enhanced yield-related traits and processes for their preparation
EP2535417A1 (en) 2007-07-20 2012-12-19 BASF Plant Science GmbH Plants having increased yield-related traits and a method for making the same
DE112008001879T5 (en) 2007-07-20 2010-07-29 Basf Plant Science Gmbh Plants having enhanced yield-related traits, and methods for producing IRER
WO2009013263A2 (en) 2007-07-20 2009-01-29 Basf Plant Science Gmbh Plants having increased yield-related traits and a method for making the same
WO2009016232A2 (en) 2007-07-31 2009-02-05 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112008001837T5 (en) 2007-07-31 2012-01-05 Basf Plant Science Gmbh Plants with improved yield-related traits and methods for their production
DE112008002020T5 (en) 2007-07-31 2010-10-28 Basf Plant Science Gmbh Plants having enhanced yield-related traits and processes for their preparation
EP2503000A1 (en) 2007-07-31 2012-09-26 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112008002458T5 (en) 2007-09-14 2011-06-01 Basf Plant Science Gmbh Plants with increased yield-related traits and methods of making the same
EP2537940A2 (en) 2007-09-14 2012-12-26 BASF Plant Science GmbH Plants having increased yield-related traits and a method for making the same
WO2009034188A1 (en) 2007-09-14 2009-03-19 Basf Plant Science Gmbh Plants having increased yield-related traits and a method for making the same
DE112008002848T5 (en) 2007-10-29 2010-11-25 Basf Plant Science Gmbh Plants having enhanced yield-related traits and processes for their preparation
WO2009056566A2 (en) 2007-10-29 2009-05-07 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
EP2570426A1 (en) 2007-11-26 2013-03-20 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2574622A1 (en) 2007-11-26 2013-04-03 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2574621A1 (en) 2007-11-26 2013-04-03 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
WO2009068564A1 (en) 2007-11-26 2009-06-04 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112008003225T5 (en) 2007-11-26 2012-06-06 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
EP2581385A1 (en) 2007-11-26 2013-04-17 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112008003316T5 (en) 2007-12-20 2011-05-05 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
WO2009080802A2 (en) 2007-12-20 2009-07-02 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
EP2599873A2 (en) 2008-01-25 2013-06-05 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2599875A2 (en) 2008-01-25 2013-06-05 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
WO2009092772A2 (en) 2008-01-25 2009-07-30 Basf Plant Science Gmbh Plants having enhanced yield-related traits and a method for making the same
EP2599874A2 (en) 2008-01-25 2013-06-05 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009000148T5 (en) 2008-01-25 2011-04-14 Basf Plant Science Gmbh Plants with improved yield-related traits and methods for their production
EP2599872A2 (en) 2008-01-25 2013-06-05 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009000221T5 (en) 2008-01-31 2012-01-05 National Institute For Biological Sciences Plants with altered growth and / or evolution and process for their production
DE112009000705T5 (en) 2008-04-16 2011-06-16 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
EP3029143A1 (en) 2008-04-16 2016-06-08 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009000934T5 (en) 2008-05-05 2011-07-14 BASF Plant Science GmbH, 67063 Plants with improved yield-related traits and methods for their production
EP2711424A2 (en) 2008-06-20 2014-03-26 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009001459T5 (en) 2008-06-20 2011-09-29 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
DE112009001405T5 (en) 2008-06-26 2011-07-28 BASF Plant Science GmbH, 67063 Plants with increased yield-related properties and process for their preparation
EP2975130A2 (en) 2008-06-26 2016-01-20 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009001560T5 (en) 2008-07-04 2012-01-26 Basf Plant Science Gmbh Plants with increased yield-related traits and methods of making same
EP2657341A2 (en) 2008-07-17 2013-10-30 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009001667T5 (en) 2008-07-17 2011-09-29 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
DE112009001860T5 (en) 2008-07-31 2012-01-12 Basf Plant Science Gmbh Plants with modified growth characteristics and process for their preparation
DE112009001927T5 (en) 2008-08-20 2012-01-26 Basf Plant Science Gmbh Plants with increased yield-related properties and process for their preparation
EP2441773A1 (en) 2008-08-20 2012-04-18 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
EP2910639A1 (en) 2008-09-24 2015-08-26 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009002224T5 (en) 2008-09-24 2012-01-19 Basf Plant Science Gmbh Plants with increased yield-related properties and process for their preparation
EP2716762A2 (en) 2008-09-24 2014-04-09 BASF Plant Science GmbH Plants having enhanced yield-related traits and a method for making the same
DE112009002731T5 (en) 2008-11-12 2013-05-08 Basf Plant Science Gmbh Plants with increased abiotic stress tolerance and / or increased yield-related traits and methods for producing the same
EP2960335A1 (en) 2008-12-03 2015-12-30 BASF Plant Science GmbH Plants having enhanced abiotic stress tolerance and/or enhanced yield-related traits and a method for making the same
DE112009003515T5 (en) 2008-12-03 2012-05-24 Basf Plant Science Gmbh Plants with increased abiotic stress tolerance and / or increased yield-related traits and methods for producing the same
DE112009003749T5 (en) 2008-12-17 2012-11-15 Basf Plant Science Gmbh Plants with enhanced yield-related traits and / or increased abiotic resistance to stress and methods of making the same
DE112010000838T5 (en) 2009-01-28 2012-11-29 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods of making the same
EP2845903A2 (en) 2009-01-28 2015-03-11 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
WO2010086221A1 (en) 2009-01-28 2010-08-05 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2010097343A1 (en) 2009-02-25 2010-09-02 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112010000887T5 (en) 2009-02-25 2012-09-27 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112010001805T5 (en) 2009-04-29 2012-09-06 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2010124953A1 (en) 2009-04-29 2010-11-04 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112010002842T5 (en) 2009-04-29 2012-09-27 Basf Plant Science Company Gmbh Plants with improved yield-related traits and methods for their production
EP2957637A2 (en) 2009-04-29 2015-12-23 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
DE112010002275T5 (en) 2009-05-06 2013-06-20 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and / or increased tolerance to abiotic stress and methods for their production
EP2955229A1 (en) 2009-06-19 2015-12-16 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP2949661A1 (en) 2009-08-19 2015-12-02 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
WO2011020746A1 (en) 2009-08-19 2011-02-24 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
EP3118320A1 (en) 2009-09-25 2017-01-18 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
DE112010003793T5 (en) 2009-09-25 2012-11-22 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2011036232A1 (en) 2009-09-25 2011-03-31 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011036160A1 (en) 2009-09-25 2011-03-31 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011048009A1 (en) 2009-10-22 2011-04-28 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112010003738T5 (en) 2009-10-22 2013-08-14 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2011058029A1 (en) 2009-11-13 2011-05-19 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
DE112010004383T5 (en) 2009-11-13 2012-08-23 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112011100641T5 (en) 2010-02-24 2012-12-20 Basf Plant Science Gmbh Plants with enhanced yield-related traits and methods for their production
DE112011100643T5 (en) 2010-02-24 2013-01-10 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2011104155A2 (en) 2010-02-24 2011-09-01 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011104128A2 (en) 2010-02-24 2011-09-01 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
EP2361927A1 (en) 2010-02-26 2011-08-31 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP2361985A1 (en) 2010-02-26 2011-08-31 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
WO2011104143A1 (en) 2010-02-26 2011-09-01 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011104141A1 (en) 2010-02-26 2011-09-01 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and a method for making the same
WO2011114279A1 (en) 2010-03-18 2011-09-22 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making the same
DE112011100940T5 (en) 2010-03-18 2013-01-24 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
WO2011114313A1 (en) 2010-03-19 2011-09-22 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making the same
WO2011114312A1 (en) 2010-03-19 2011-09-22 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making same
WO2011117800A1 (en) 2010-03-22 2011-09-29 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and method for making the same
EP2371845A1 (en) 2010-03-22 2011-10-05 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
DE112011102113T5 (en) 2010-06-24 2013-03-28 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
EP2998401A2 (en) 2010-06-24 2016-03-23 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
DE112011102151T5 (en) 2010-06-25 2013-07-11 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112011102378T5 (en) 2010-07-16 2013-04-18 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods of making the same
EP2835427A2 (en) 2010-08-24 2015-02-11 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
DE112011103723T5 (en) 2010-11-10 2013-08-08 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112012000525T5 (en) 2011-01-20 2013-10-24 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112012001017T5 (en) 2011-02-28 2013-12-19 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
DE112012001020T5 (en) 2011-02-28 2013-12-19 Basf Plant Science Company Gmbh Plants with enhanced yield-related traits and methods for their production
EP2995622A1 (en) 2011-02-28 2016-03-16 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP3091079A1 (en) 2011-02-28 2016-11-09 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and producing methods thereof
WO2012117368A1 (en) 2011-03-01 2012-09-07 Basf Plant Science Company Gmbh Plants having enhanced yield-related traits and producing methods thereof
WO2012143545A1 (en) 2011-04-22 2012-10-26 Vib Vzw Methods and means to produce abiotic stress tolerant plants
EP2677035A1 (en) 2012-06-22 2013-12-25 BASF Plant Science Company GmbH Plants having enhanced yield-related traits and a method for making the same
EP2896698A1 (en) 2014-01-17 2015-07-22 BASF Plant Science Company GmbH Plants having one or more enhanced yield-related traits and a method for making the same

Also Published As

Publication number Publication date
JPH09505461A (en) 1997-06-03
IL110406D0 (en) 1994-10-21
KR960705036A (en) 1996-10-09
ZA9405414B (en) 1995-03-01
AU4701493A (en) 1995-02-20
EP0728199A1 (en) 1996-08-28
AU694093B2 (en) 1998-07-16

Similar Documents

Publication Publication Date Title
Chen et al. Viral virulence protein suppresses RNA silencing–mediated defense but upregulates the role of microRNA in host gene expression
Vaucheret et al. AGO1 homeostasis entails coexpression of MIR168 and AGO1 and preferential stabilization of miR168 by AGO1
Baulcombe Fast forward genetics based on virus-induced gene silencing
Vanitharani et al. Differential roles of AC2 and AC4 of cassava geminiviruses in mediating synergism and suppression of posttranscriptional gene silencing
Elmayan et al. Expression of single copies of a strongly expressed 35S transgene can be silenced post‐transcriptionally
AU747872B2 (en) Gene silencing
CA2381921C (en) Means and methods for modifying gene expression using unpolyadenylated rna
EP1857549B1 (en) Control of gene expression
de Haan et al. Characterization of RNA–mediated resistance to tomato spotted wilt virus in transgenic tobacco plants
Bonfim et al. RNAi-mediated resistance to Bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris)
US6777588B2 (en) Methods and means for producing barley yellow dwarf virus resistant cereal plants
Van Blokland et al. Transgene‐mediated suppression of chalcone synthase expression in Petunia hybrida results from an increase in RNA turnover
Stark et al. Protection against potyvirus infection in transgenic plants: evidence for broad spectrum resistance
Dean et al. Influence of flanking sequences on variability in expression levels of an introduced gene in transgenic tobacco plants
Mlynarova et al. The MAR-mediated reduction in position effect can be uncoupled from copy number-dependent expression in transgenic plants.
Wenkel et al. A feedback regulatory module formed by LITTLE ZIPPER and HD-ZIPIII genes
Crespi et al. enod40, a gene expressed during nodule organogenesis, codes for a non‐translatable RNA involved in plant growth.
Kalantidis et al. The occurrence of CMV-specific short RNAs in transgenic tobacco expressing virus-derived double-stranded RNA is indicative of resistance to the virus
AU753727B2 (en) Gene silencing materials and methods
Bendahmane et al. Engineering resistance against tomato yellow leaf curl virus (TYLCV) using antisense RNA
Pang et al. Post‐transcriptional transgene silencing and consequent tospovirus resistance in transgenic lettuce are affected by transgene dosage and plant development
Asad et al. Transgenic tobacco expressing geminiviral RNAs are resistant to the serious viral pathogen causing cotton leaf curl disease
JP2012523850A (en) Multiple virus resistance in plants
Gal et al. Agroinfection of transgenic plants leads to viable cauliflower mosaic virus by intermolecular recombination
Rajamäki et al. Control of nuclear and nucleolar localization of nuclear inclusion protein a of picorna-like Potato virus A in Nicotiana species

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase in:

Ref country code: CA

Ref document number: 2167701

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2167701

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1993917617

Country of ref document: EP

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase in:

Ref country code: US

Ref document number: 1996 592414

Date of ref document: 19960703

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1993917617

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993917617

Country of ref document: EP