WO1994012657A1 - Direct-phenol pcr, rt and rt-pcr methods - Google Patents

Direct-phenol pcr, rt and rt-pcr methods Download PDF

Info

Publication number
WO1994012657A1
WO1994012657A1 PCT/US1993/011315 US9311315W WO9412657A1 WO 1994012657 A1 WO1994012657 A1 WO 1994012657A1 US 9311315 W US9311315 W US 9311315W WO 9412657 A1 WO9412657 A1 WO 9412657A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
phenol
process
buffer
pcr
rt
Prior art date
Application number
PCT/US1993/011315
Other languages
French (fr)
Inventor
Harold L. Katcher
Original Assignee
Katcher Harold L
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Abstract

The present invention provides a process for amplifying a nucleic acid containing a DNA sequence of interest which comprises (a) lysing cells from a sample containing the nucleic acid; (b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer; (c) removing the aqueous layer containing the nucleic acid; and (d) adding the aqeous layer so removed to a polymerase chain reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs), sense and antisense primers, an amplification buffer, and between an amount of a DNA polymerase effective to catalyze polymerase chain reaction, under standard polymerase chain reaction conditions, thereby, thereby amplifying the DNA sequence of interest. The present invention also provides processes for converting RNA into cDNA and for amplifying a nucleic acid containing an RNA sequence of interest. Lastly, the present invention provides a process for determining a false positive signal from RT-PCR.

Description

DIRECT-PHENOL PCR. RT and RT-PCR METHODS

Background of the Invention

The concept of in vitro amplification of specific DNA sequences using a DNA polymerase, primers and thermal cycling (PCR) became widely useful when coupled with available thermostable DNA polymerases. To amplify RNA in a similar manner, RNA is reverse transcribed into DNA using an oligonucleotide primer, followed by PCR amplification of the resultant single-stranded DNA (RT- PCR) . The widespread use of PCR has been limited because of difficulties in sample preparation. The widespread use of RT and RT-PCR has been restricted by the lability of RNA caused by ubiquitous RNases (1) ; the inhibition of reverse transcription by higher order RNA structures (2) ; the inhibition of PCR by the presence of active reverse transcriptase (3) ; the loss of nucleic acid during precipitation procedures (4) ; and the extensive time and costs associated with their use (5) . These problems have been partially addressed by employing RNase inhibitors (e.g., SDS, RNasin and Vanadyl- ribonucleoside complexes) (4,5); boiling the resultant material after reverse transcription to inactivate the reverse transcriptase; and using denaturants such as methylmercury (6) , dimethyl sulfoxide (7) , formamide, guanidiniu salts, and DEPC during RT reactions. It also has been found that RT performed at high temperatures inhibits thermo-sensitive RNase activity and disrupts higher order RNA structures, thus obviating the need for the addition of RNasin and formamide to the reactions. Degradation of RNA during sample preparation, the loss of nucleic acid during partition and precipitation procedures, and the extensive time and costs associated with these methods, however, remain a problem. The use of phenol extraction for separating nucleic acid from nucleases is well known. However, phenol is thought to denature proteins and inhibit enzymatic reactions involved in these procedures. Accordingly, when DNA or RNA was purified using phenol extraction, the DNA or RNA was precipitated or otherwise treated to remove the phenol before being used in PCR, RT, and RT-PCR. U.S. Patent Nos. 4,683,202 and 4,683,195 disclose PCR and its use for amplifying nucleic acid sequences to facilitate detection (8, 9). The amplification was carried out in buffers containing dimethylsulfoxide, tris-acetate, sodium acetate, magnesium acetate, dithiotreitol, sodium chloride, magnesium chloride, and/or potassium phosphate. The use of phenol in an aqueous buffer solution during PCR was not disclosed. The Perkin Elmer/Cetus PCR kit protocol sheet discloses commercial PCR and is consistent with Patent Nos. 4,683,202 and 4,683,195 in not disclosing the use of phenol during PCR.

U.S. Patent No. 4,767,699 discloses a method for detecting nucleic acid in a sample employing hybridization and enzymatic detection (10) . Although this patent discloses phenol extraction of nucleic acid, the phenol was removed by ethanol prior to hybridization.

U.S. Patent No. 4,900,677 discloses a rapid process for isolating high molecular weight DNA (11) . This patent points out the disadvantages associated with phenol extraction including four hours of dialysis to remove phenol before proceeding (col. 3, lines 10-20) and the requirement for skilled technicians and extensive equipment (col. 3, lines 16 through col. 4, line 28). This patent overcame these disadvantages by avoiding phenol altogether. Instead, the cells were digested with enzyme in the presence of aprotic solvents such as DMF and DMSO and buffers such as sodium borate, sodium phosphate, tris (hydroxymethyl) amino-methane, EDTA, and sodium chloride. The nucleic acid from the cells was then treated with RNase or DNase, followed by treatment with a chaotropic agent such as sodium trifluoroacetate, sodium perchlorate, and sodium iodate. U.S. Patent No. 4,996,144 discloses a microassay for detecting DNA and RNA (12) . This patent discloses protein extraction using an organic solvent (col. 2, lines 9-15), preferably phenol (col. 3, lines 33-55). Specifically, the patent discloses adding excess phenol to a drop containing deproteinated debris, to form a separate phenol phase between the aqueous drop and the liquid paraffin. During the extraction, shrinkage and darkening of the drop occurred with the movement of the cell debris into the phenol layer. Following the observation of bubbles in the phenol layer, most of the phenol was removed and the drop was washed extensively with chloroform/isoamyl alcohol. During the wash, the phenol layer was gradually dispersed in the surrounding oil resulting in clearing and expansion of the aqueous drop. When the phenol layer was completely dispersed into the surrounding oil, the aqueous drop containing the nucleic acid was removed for hybridization or further treatment with DNase. It is apparent that the phenol was removed prior to hybridization.

U.S. Patent No. 5,047,345 discloses a composition and an improved method for purifying nucleic acid from cell culture medium (13) . The improvement lies in performing lysing and deproteinization, simultaneously. Although this patent discloses phenol/chloroform extraction, the phenol was removed following isolation of nucleic acid (col. 3, lines 64-68; col. 5, lines 35-44).

U.S. Patent No. 5,114,858 discloses a process for isolating nucleic acid from solids and a disposable filtration vessel for use therein (14) . This patent mentions using phenol as an organic solvent for extraction, with chloroform being the preferred solvent, and the separation of the organic phase from the aqueous phase utilizing a filter. This patent also discloses in Example 3 the amplification of DNA from the aqueous phase using PCR (col. 16, lines 41-68 and col. 17, lines 1-25). The buffer employed was prepared as specified in the brochure from Cetus Corp. and did not contain phenol.

Virology, 7:241-243 (1959) discloses the extraction of nucleic acid with hot phenol (15) . The phenol was removed following extraction.

Boris Boddinghaus, et al., Journal of Clinical Microbioloσv 28(8) .1751-1759 (1990) discloses the detection and identification of Mycobacteria using reverse transcription PCR (16) . The nucleic acids were extracted from the culture using phenol-chloroform-isoamyl alcohol then precipitated by acrylamide, sodium acetate and ethanol to remove the phenol. The sequences were amplified using standard buffers (Perkin Elmer/Cetus) . Phenol was not used during amplification. Panaccio and Andrew Lew, Nucleic Acids Research

19(5):1151 (1991) discloses improvement in PCR using the tTh polymerase and the T4 gene 32 protein (17) . By using tTh polymerase, the need for extracting nucleic acid from body products such as blood was avoided. This application does not teach or suggest that the presence of phenol would help in the amplification process.

The subject invention is based on the discovery that certain enzymatic reactions involved in PCR, RT, and RT-PCR can be performed on DNA or RNA samples containing phenol in the aqueous phase. Thus, RNA or DNA which is subjected to a purification procedure involving a phenol extraction step, need not be precipitated or otherwise treated to remove the phenol from the aqueous phase in order to be used in PCR, RT, or RT-PCR. It was surprising that some of the polymerases involved in these reactions are effective in a buffer containing phenol.

It was even more unexpected that with adjustments in the reaction conditions, such as increasing the polymerase concentration, and employing a total reaction volume containing phenol at a concentration of 0.2% or less, the direct phenol methods (dpPCR, dpRT, and dpRT-PCR) performed better than standard PCR, RT, and RT- PCR procedures. The methods involving phenol are more sensitive and reliable in part because of the reduction or elimination of nucleic acid loss and degradation associated with phenol removal and precipitation procedures. The direct phenol, PCR, RT and RT-PCR methods may therefore be performed on samples containing lower levels of nucleic acid with the degree of sensitivity associated with samples containing higher levels. With respect to RT and RT-PCR, the use of phenol itself reduces RNA target losses by inactivating RNases.

The direct phenol method also speeds up, makes less expensive and safer many procedures involving PCR, RT, and RT-PCR. Specifically, the use of the direct phenol method eliminates 90% of the preparation time and costs by eliminating the requirement for phenol removal, precipitation of the nucleic acid, skilled technicians and extensive clean-up, as well as the labor and material costs associated with these extraction procedures. The ease of use of the direct phenol method also permits the application of RT, RT-PCR, and PCR in a clinical setting and assures a more sensitive and rapid diagnosis, and therefore earlier treatment. Another advantage to the present method is that phenol is a germicide which renders infectious material safe. Accordingly, the method can be used on infectious materials such as blood containing the HIV virus.

References 1. Chirgwin, J. M. , et al. Biochem. 18(24) :5294-5299 (1979). 2. Buell, G. N. , et al. J. Biol. Chem.

253:2471-2482 (1978).

3. Sellner, L. N. Nucleic Acids Res. 20(7) :1487-1490 (1992).

4. Chigg, A., et al. J. Bacterium 127:1550- 1557 (1976).

5. Kotewics, M. L., et al. Nucleic Acids Res. 16:265-277 (1988). 6. Bailey, J. M. and Davidson, N. Anal. Bio. Che . 70:75-85 (1976).

7. Bassel-Duby, R. , et al. J. Virology 60:64- 67 (1986). 8. Mullis, U.S. Patent No. 4,863,202, issued

July 28, 1987.

9. Mullis, et al., U.S. Patent No. 4,683,195, issued July 28, 1987.

10. Vary, et al., U.S. Patent No. 4,767,699, issued August 30, 1988.

11. Hewitt, U.S. Patent No. 4,900,677, issued February 13, 1990.

12. Crossway, et al., U.S. Patent No. 4,996,144, issued February 26, 1991. 13. DeBonville, et al., U.S. Patent No.

5,047,345, issued September 10, 1991.

14. Williams, et al., U.S. Patent No. 5,114,858, issued May 19, 1982.

15. Virology. 7:241-243 (1959). 16. Boris Boddinghaus, et al., Journal of

Clinical Microbiology 28(8) :1751-1759 (1990).

17. Panaccio and Andrew Lew, Nucleics Acid Research 19(5) :1151 (1990).

18. Wormser, G.P., et al., J. Am. Med. Ass. 268(10) :1311-1313 (1992).

Summary of the Invention

The present invention provides a process for amplifying a nucleic acid containing a DNA sequence of interest which comprises:

(a) lysing cells from a sample containing the nucleic acid;

(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer; (c) removing the aqueous layer containing the nucleic acid; and

(d) adding the aqueous layer so removed to a polymerase chain reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , sense and antisense primers, an amplification buffer, and an amount of a DNA polymerase effective to catalyze polymerase chain reaction in the presence of phenol, under standard polymerase chain reaction conditions, thereby amplifying the DNA sequence of interest.

The present invention also provides a process for converting RNA into cDNA which comprises:

(a) lysing cells from a sample containing RNA;

(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the RNA is extracted into the aqueous layer;

(c) removing the aqueous layer containing the RNA; and

(d) adding the aqueous layer so removed to a reverse transcriptase reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , a primer complementary to the RNA, a reverse transcriptase buffer, and an amount of a reverse transcriptase effective to catalyze reverse transcription in the presence of phenol, under standard reverse transcription conditions, thereby converting the RNA into cDNA.

The present invention further provides a process for amplifying a nucleic acid containing an RNA sequence of interest which comprises:

(a) lysing cells from a sample containing the nucleic acid;

(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer; (c) removing the aqueous layer containing the nucleic acid;

(d) adding the aqueous layer so removed to a reverse transcriptase reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , a primer complementary to the nucleic acid, a reverse transcriptase buffer, and an amount of a reverse transcriptase effective to catalyze reverse transcription in the presence of phenol, under standard reverse transcription conditions, thereby converting the RNA into cDNA; and

(e) adding to the reverse transcriptase mixture an amplification buffer, a primer complementary to the converted cDNA, and an amount of a DNA polymerase between 0.1 and 3 times the amount of the reverse transcriptase added in step (d) , under standard PCR conditions, thereby amplifying the cDNA. Lastly, the present invention provides a process for determining a false positive signal from RT-PCR which comprises comparing the signal produced by performing RT- PCR on nucleic acid from a sample with a signal produced by performing reverse RT-PCR on nucleic acid from the same sample and under equivalent conditions as for RT-PCR with the primers for RT and PCR being reversed, the presence of equal signals being indicative of a false positive signal.

Brief Description of the Figures

Figure l. Comparison of the abilities of thermostable reverse transcriptases to catalyze RT-PCR in the presence of phenol. Lanes 1-4, Standard rRNA-based RT-PCR reactions using rTth polymerase and the rTth buffer system and protocols, with the addition of 0, 1, 2, and 3 μl of buffer-saturated-phenol. Lanes 5-8, same as lanes 1-4, but using tet-z polymerase in rTth buffer system and protocols; Lanes 9-12, same as 1-4, but using tet-z polymerase using the tet-z reverse transcriptase buffer supplied by the manufacturer; Lanes 13-16, same b-s-p amounts as above but using Hot Tub polymerase in the rTth buffer system; Lane 17, molecular weight markers 1353 bp, 1078 bp, 870 bp, 603 bp, 310 bp, 271 bp, 231 bp, 118 bp, and 72 bp. The MW of interest is 259 bp.

Detailed Description of the Invention

The present invention provides a process for amplifying a nucleic acid containing a DNA sequence of interest which comprises: (a) lysing cells from a sample containing the nucleic acid;

(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer;

(c) removing the aqueous layer containing the nucleic acid; and

(d) adding the aqueous layer so removed to a polymerase chain reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , sense and antisense primers, an amplification buffer, and an amount of a DNA polymerase effective to catalyze polymerase chain reaction in the presence of phenol, under standard polymerase chain reaction conditions, thereby amplifying the DNA sequence of interest.

The DNA sequence of interest is defined as the portion of nucleic acid for which amplification is desired. The portion may be as short as a 10-20 oligonucleotides or as long as the entire nucleic acid sequence.

The DNA is isolated from a sample from a native source. Examples of native sources from which the DNA may be isolated include but are not limited to tissues or cultured cells, blood cells, bacterial cells, viruses, mammalian cells, yeast cells, nuclei, leukocytes, macrophages, granulocytes, oocytes, fertilized eggs, and embryo of frogs, sea urchins, truncates, worms, or flies. The nucleic acids are liberated from the tissues or cells by methods known to those skilled in the art including mechanical, chemical, or enzymatic digestion. For example, the tissue or cells may be treated with a detergent such as sodium dodecyl sulfate (SDS) , NP40 and Tween 20, and/or enzymes such as lysozyme, proteinase K, endo-N-acetylmuraminidase, achromopeptidase, lipase, lysopeptase, endo-N-acetylglucosaminidase D or H, dextranase, cellulase, glucoamylase, hyaluronidase, N- acetylmuramyl-C-alanine amidase, streptomyces KM endopeptidase, streptomyces SA endopeptidase, and Strepomyces ML endopeptidase, among others (see U.S. Patent No. 4,900,677). In the preferred embodiment, the cells are lysed by treatment with lysozyme or proteinase K. The lysing is preferably performed in the presence of one or more detergents such as SDS.

The digested sample of lysed cells containing the nucleic acids are then deproteinated or extracted by the hot phenol method (15) . Using the hot phenol method, a suspension of the digested sample is mixed with an equal volume of a buffer- saturated-phenol in a pH between about 5 and about 8 and at a temperature between about 55°C and about 70°C. Preferably, the pH is about 7.4 and the temperature is about 65°C. The suspension and phenol buffer solution is mixed between about 1 and about 5 minutes and allowed to stand until an organic and an aqueous layer are formed. The material may be centrifuged to effectuate the separation of the organic and aqueous layers. The aqueous layer which contains the nucleic acid is then removed and added directly to the polymerase chain reaction mixture. This differs from prior art procedures where the nucleic acid is precipitated out (e.g. with ethanol) or otherwise treated to remove the phenol before proceeding further, a time-consuming and laborious task. The direct use of the aqueous layer from the phenol extraction in PCR also prevents degradation and partial loss of nucleic acid which generally occurs during precipitation and phenol removal procedures. The aqueous layer may even be stored for weeks before being added to the PCR mixture if this is desired. The buffer-saturated-phenol comprises up to 11% phenol in a buffer consisting of one or more of the following: PBS, sodium phosphate, acetate, tris hydrochloric acid, or sodium chloride. Hydroxyquinoline may be added to stabilize the phenol. The buffer- saturated-phenol also may comprise chloroform and/or isoamyl alcohol in volumes equal to the volume of phenol in the buffer-saturated-phenol. The phenol in the buffer- saturated-phenol also may be substituted with butanol or any other organic solvent which does not interfere with the particular enzyme to be used during PCR amplification and/or reverse transcription. Usually only one extraction need be performed. For some biological samples such as serum, however, two or more extractions may be required.

It is also within the confines of the present invention that the lysing and phenol partition steps (i.e., steps (a) and (b) ) may be performed simultaneously. This is accomplished by adding the sample containing the nucleic acid to a mixture containing one or more of the lysing agents described above and the buffer-saturated- phenol. This is especially effective when the sample is serum.

Polymerase chain reaction is performed by methods similar or identical to those disclosed in U.S. Patent Nos. 4,683,202 and 4,683,195 and in PCR kit protocols (Perkin Elmer/Cetus) . The primers used in PCR are oligonucleotides at least 16 nucleotides and preferably 20-24 nucleotides in length. The particular primers used will depend upon the sequence to be amplified. The enzyme employed as a catalyst for the reaction is preferably a Tth DNA polymerase such as rTth, Tth, or tet-z polymerases, or a Hot Tub polymerase. However, any enzyme which is effective as a catalyst for PCR and works in the presence of phenol may be used. The amount of polymerase is from about 1 to about 5 times the amount suggested in the kit protocols. The optimal amount will depend on the concentration of the sequence to be amplified as well as the amount of phenol present in the aqueous layer. The optimal amount will generally be greater than the amount suggested in kit protocols. The deoxyribonucleotide triphosphates (dNTPs) are those normally used in PCR and include dATP, dCTP, dTTP, and dGTP. The amplification buffer employed is standard in the art and contains one or more of the following: tris- hydrochloric acid, potassium chloride, magnesium chloride, manganese chloride, gelatin, SDS, dimethylsulfoxide, tris- acetate, magnesium acetate, dithiotreitol, sodium chloride, potassium phosphate, glycerol, EGTA and/or Tween 20. Preferably, the amplification buffer comprises glycerol, tris-hydrochloric acid, potassium chloride, Tween 20, and magnesium chloride. The PCR reaction may be performed as many cycles as desired. The present invention also provides a process for converting RNA into cDNA which comprises:

(a) lysing cells from a sample containing RNA;

(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the RNA is extracted into the aqueous layer;

(c) removing the aqueous layer containing the RNA; and

(d) adding the aqueous layer so removed to a reverse transcriptase reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , a primer complementary to the RNA, a reverse transcriptase buffer, and an amount of a reverse transcriptase effective to catalyze reverse transcription in the presence of phenol, under standard reverse transcription conditions, thereby converting the RNA into cDNA. The RNA may be isolated from cells or tissues by methods known to those skilled in the art and described hereinabove. Steps (a)-(c) are identical to the procedures described above for DNA. Reverse transcription is performed by methods described in RT and RT-PCR kit protocols (Perkin Elmer/Cetus) . The deoxyribonucleotide triphosphates (dNTPs) are those normally used in RT procedures and include dATP, dCTP, dTTP, and dGTP. The primer may be as few as 16 nucleotides and preferably is 20-24 nucleotides in length. The reverse transcriptase is preferably a Tth polymerase such as rTth, Tth, or tet-z polymerase, or a Hot Tub polymerase. However, any polymerase which is effective as a catalyst for reverse transcription and works in the presence of phenol may be used. The amount of transcriptase is about 1 to about 5 times the amount suggested in the kit protocols. The optimal amount will depend on the concentration of the sequence to be amplified as well as the amount of phenol present in the aqueous layer. The transcriptase buffer employed is standard in the art and contains one or more of the following: tris hydrochloric acid, potassium chloride, manganese chloride and magnesium chloride. The reaction may be stopped by placing the transcriptase mixture on ice.

The present invention further provides a process for amplifying a nucleic acid containing an RNA sequence of interest which comprises:

(a) lysing cells from a sample containing the nucleic acid;

(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer; (c) removing the aqueous layer containing the nucleic acid; (d) adding the aqueous layer so removed to a reverse transcriptase reaction mixture comprising standard amounts of deoxyribonucleotide triphosphates (dNTPs) , a primer complementary to the nucleic acid, a reverse transcriptase buffer, and an amount of a reverse transcriptase effective to catalyze reverse transcription in the presence of phenol, under standard reverse transcription conditions, thereby converting the RNA into cDNA; and (e) adding to the reverse transcriptase mixture an amplification buffer, a primer complementary to the converted cDNA, and an amount of a DNA polymerase between 0.1 and 3 times the amount of the reverse transcriptase added in step (d) , under standard PCR conditions, thereby amplifying the cDNA.

The RT-PCR process is performed by methods described in the RT-PCR protocol (Perkins Elmer/Cetus) . Steps (a)-(d) are performed as described hereinabove. The amplification buffer in step (e) is the same as described previously and preferably includes magnesium chloride, glycerol, tris-hydrochloric acid, potassium chloride, EGTA, and Tween 20. The DNA polymerase is identical to the reverse transcriptase added in step (d) (e.g. a Tth- polymerase such as rTth, Tth or tet-z polymerase or a Hot Tub polymerase) . The amount of DNA polymerase is about 0.1 to about 3 times the amount of reverse transcriptase added in step (d) , and preferably is about an equivalent amount.

Lastly, the present invention provides a process for determining a false positive signal from RT-PCR which comprises comparing the signal produced by performing RT- PCR on nucleic acid from a sample with a signal produced by performing reverse RT-PCR on nucleic acid from the same sample and under equivalent conditions as for RT-PCR with the primers for RT and PCR being reversed, the presence of equal signals being indicative of a false positive signal. For the process above, RT-PCR may be performed as described hereinabove for the direct phenol methods or may be performed using RT-PCR known to those skilled in the art without using phenol. The reverse RT-PCR step is performed under identical conditions and with identical reactants and solvents as described herein or as known in the art, except that the sense and anti-sense primers are reversed. That is, for RT-PCR, the anti-sense primer is added for RT while the sense primer is added" for PCR. For reverse RT-PCR, the sense primer is added for RT while the anti-sense primer is added for PCR.

The present invention is described in the following Experimental Details section, which sets forth specific examples to aid in an understanding of the invention, and should not be construed to limit in any way the invention as defined in the claims which follow thereafter.

Experimental Details A. Materials and Methods.

Phenol. Phenol (UltraPure, Bethesda Research Laboratories) was melted, equilibrated with 1M Tris buffer, pH 7.4, and stored frozen in 0.1 M Tris buffer, pH 7.4, and 0.1% 8-hydroxyquinoline, at -20°C until needed. RT. RT-PCR and PCR Kits. rTth RT-PCR and

Amplitaq kits were purchased from Perkin Elmer/Cetus. Tet-z polymerase and Hot Tub polymerase and their associated DNA polymerase and buffer and Reverse Transcription buffer kits were obtained from Amersham International Corporation; Tth polymerase was obtained from US Biochemicals. The protocols and reagents used were those provided with the GeneAmp, Thermostable rTth Reverse Transcriptase RNA PCR Kit (Perkin Elmer/Cetus) . All amplifications were carried out in an ISS Programmable Oven, using a thermal cycling program, F-G. Enzymes for Cell Lysis. Lysozyme and Proteinase K may be obtained from a commercial source such as Sigma or U.S. Biochemicals.

B . buradorferi DNA. Borellia burgdorferi was obtained from New York Medical College and may also be obtained from the American Lyme Disease Foundation. Primers. JS1 and JS2 were synthesized to have the following sequences: 5' AGAAGTGCTGGAGTCGA (SEQ ID No. 1) and 5' TAGTGCTCTACCTCTATTAA (SEQ ID No. 2) , "respectively. JS1 and JS2 are the upstream and downstream primers specific to B . burgdorferi 23 S rRNA sequences. JS2 hybridizes to a sequence on 23 S rRNA and is complementary to that sequence (18) .

Proteinase K Digestion. Samples of B . burgdoferi culture were diluted in PBS, 0.5% NP40, 0.5% Tween 20, and 0.1 mg/ml proteinase K, then incubated at 55°C for about one hour. The solution was then heated to 95°C for about 10-15 minutes. The samples were then frozen and thawed as needed. Lysozyme Digestion. Samples of B . burgdorferi culture were adjusted to 10 mg/ml with lysozyme and frozen at 20°C. Frozen solutions were adjusted to 1% (v/v) with SDS and incubated for 10 minutes at 55°C to 75°C prior to phenol extraction. Hot Phenol Partition. A buffered sample containing nucleic acids in the presence of salt was vigorously mixed with an equal volume of buffer-saturated- phenol at temperatures between 55°C and 70°C several times over four minutes and allowed to cool on ice. Direct-Phenol Reverse Transcription fdpRT) . In this procedure, the aqueous phase of each hot phenol partition was added directly to RT reactions using the protocols and reagents of the tet-z reverse transcription buffer kit (Amersham) or the rTth RT-PCR Kit (Perkin Elmer/Cetus), and their corresponding polymerases (e.g., tet-z, Tth or rTth polymerases). Fixed amounts of B . burgdorferi rRNA, 1 μl of complementary downstream primer JS2, 2 μl 10X rTh Reverse Transcriptase Buffer (100 mM Tris-HCl, pH 8.3, 900 mM KC1) , 2 μl 10 mM MnCl2 solution and 0.4 μl of each of 10 mM dGTP, dATP, dTTP, and dCTP, and 2 μl of rTth DNA polymerase were added to obtain a total RT reaction mixture of 20 μl. After a 5-15 minute incubation at 65°C, the reaction mixture was placed on ice.

In the case of tet-z polymerase, the RT buffer was provided in concentrated form to which water, dNTPs and downstream primer, JS2, were added to make 20 μl RT reactions.

Direct-Phenol PCR (dpPCR) . In this procedure, the aqueous phase from the hot phenol partition was added directly to the PCR reactions following standard PCR kit protocols and reagents.

Fixed amounts of B . burgdorferi DNA and the primers JS1 and JS2 were added to the tet-z and rTth RT- PCR kits (Perkin Elmer/Cetus) . The reactions were amplified according to protocols provided with the tet-z and rTth RT-PCR kits.

The other enzymes were assayed by the Amplitaq protocols, but using the lOx concentrated buffers provided with each of the enzymes. Thermal cycling was done with an ISS ProOven using the "F-G" program consisting of three (3) cycles of (94°C for one minute, 55°C for 30 seconds, and 72°C for 30 seconds) followed by 27 cycles of (94°C, 55°C, and 72°C for 15 seconds each) . (Note: Since this "cycler" works on a different principle from the Perkin Elmer models, the times and temperatures are not strictly comparable) . After thermal cycling, 8 μls of each reaction were electrophoresed on 1.5% agarose gel (Seakem, 3:1) in the presence of 0.15% ethidium bromide at 150 volts for an hour. Direct-Phenol RT-PCR (dpRT-PCR) . The aqueous phase of the hot phenol partition was added directly to RT reactions using the protocols and reagents of the tet-z reverse transcription buffer kit (Amersham) or the rth RT- PCR kit (Perkin Elmer/Cetus) , and their corresponding polymerases (e.g., tet-z, Tth, or rTth polymerases). The RT reactions were performed as described in kit protocols (see dpRT method above) . The RT reaction was stopped by placing the mixture on ice. The PCR step was followed exactly as described in the protocols (e.g., the addition of 8 μl of 10X chelating buffer (50% glycerol (v/v) , 10 mM Tris-HCl, pH 8.3, 1M KC1, 7.5mM EGTA, 0.5% Tween 20), 6-10 μl of 25 mM MgCl2, and 1 μl of JS1 sense primer) except that additional DNA polymerase was added following the RT step and preceding the PCR step.

For tet-z polymerase, the RT buffer (which contained magnesium chloride in place of manganese chloride) was provided in concentrated form to which water, dNTPs and downstream primer JS2 were added to make 20 μl RT reactions. The supplied reverse transcriptase buffer alone (IX) was used to adjust the volume of the reactions to 100 μl for subsequent PCR.

Assay of the Inhibition of PCR. RT and RT-PCR to Phenol♦ In order to keep nucleic acid composition of PCR and RT-PCR reactions constant, the inhibition of the enzymatic reactions to the presence of phenol was determined by adding various amounts of buffer-saturated- phenol (b-s-p) to standardized PCR reactions containing identical quantities of nucleic acids and measuring the effect on the synthesis of the amplification product. B- s-p is the upper aqueous phase resulting from mixing equal volumes of equilibrated phenol with PBS buffer at 55-65°C and allowing the phases to separate. In order to assess the inhibition of the RT and PCR phases of RT-PCR to phenol, equal volumes of b-s-p were added to standard RT- PCR reactions, either before or after the reverse transcription incubation, but preceding the PCR step. Results

A. Comparison Of Thermostable DNA Polymerases In Their Ability To Amplify DNA And RNA Templates

In The Presence Of Buffer-Saturated Phenol

It was surprising to find that when the nucleic acids of B . burgdorferi were prepared by a modification of the hot phenol method and the opalescent aqueous emulsion in the top (aqueous) phase of the first phenol extraction was added directly to RT-PCR reactions, -both reverse transcription and DNA polymerization occurred. This suggested that RT-PCR could be carried out even in the presence of significant amounts of phenol. In order to test this further, the effect of buffer-saturated-phenol on PCR and RT-PCR was tested. The results show that DNA- PCR reactions using Tth polymerase tolerated the addition of up to 5% (v/v) buffer-saturated-phenol (b-s-p) per total reaction volume and still showed specific amplification products on an ethidium bromide stained agarose electrophoresis gel. Furthermore, rTth, Tth and Hot Tub DNA polymerases also catalyzed RT-PCR in the presence of b-s-p. This implies that both the RT reactions and the PCR reactions are separately refractory to the presence of phenol. In addition, tet-z apparently worked better in the rTth buffer system than with the buffer supplied by the manufacturer (tet-z reverse transcription buffer) . Hot Tub polymerase was more sensitive to phenol than the Tth polymerases.

Further analysis of the concentrations of b-s-p which permit RT-PCR, showed that RT-PCR reactions catalyzed by rTth and Tth polymerases exhibited activity at up to 3% (v/v) buffer-saturated-phenol per total reaction volume, while Hot Tub polymerase tolerated the addition of up to 2% (v/v) buffer-saturated-phenol per total reaction volume under identical conditions (Figure 1) . In order to assess whether inhibition of RT-PCR by b- s-p occurs at the RT or the PCR stage, b-s-p was added to standardized RT-PCR reactions either before or after reverse transcription, but preceding PCR. In all cases, the inhibitory effect was greater or identical when b-s-p was added after RT than when added before RT. This implies that phenol limits RT-PCR at the DNA-PCR phase. The largest sample size permitting RT-PCR amplification was equivalent to 3 μl of the aqueous phase of a phenol phase partition. This suggests that the final b-s-p concentration during RT-PCR represents 3.0% (v/v) (3 μl b- s-p sample per 100 μl total reaction volume) , but constitutes 15% (v/v) (3 μl b-s-p sample per 20 μl total reaction volume) in the initial RT step. Since b-s-p contains approximately 10% phenol, the final phenol concentration during RT-PCR represents 0.3% (v/v) phenol per lOOμl total reaction volume, and 1.5% (v/v) phenol per 20μl total reaction volume in the initial RT step.

B- Comparison of Various Lysing Agents

Various combinations of freeze-thawing, detergent and enzymatic digestion of identical samples containing 500 spirochaetes/microliter, grown in vitro and diluted into PBS buffer, were sampled directly by dpRT-PCR and dpPCR assays. In each case the diluted Borrelia were brought to either 0.5% (v/v) each to Tween 20 and NP40, or to 1% (v/v) SDS. To the diluted organism was added either no enzyme, protease K, (to a final concentration of 0.1 mg/ml) , or lysozyme, (to a final concentration of 10 mg/ml) . The samples were frozen at -20°C thawed and incubated for 15 minutes at 55-65°C. The results show that all preparation methods terminating with hot phenol partition step, yield signal while additional enzyme treatment with either lysozyme or proteinase K yields bands of higher intensity approximating those of samples prepared by proteinase K lysis in the absence of phenol partitioning, when added to dpPCR or dpRT-PCR reactions in this non-optimized system. In subsequent experiments lysozyme lysis was used. The ability of directly added aqueous phases of various phenol extractions (i.e. phenol extract, phenol chloroform extract, phenol/ chloroform/ isoamyl alcohol extracts) in dpPCR and dpRT-PCR, was measured by the intensity of a band of the proper molecular weight on an ethidium bromide containing gel under ultraviolet irradiation. The aqueous phases of the various organic partitions all allow DNA amplification to take place when added directly to direct phenol PCR reaction mixtures.

C. Comparison of Buffer Solutions and pHs for Phenol Partition

Various buffers (PBS, saline phosphate, and acetate) at various pHs (5.0, 6.0, and 7.4) were inoculated with lysed borrelia and extracted with phenol by vigorous shaking at 55 - 70°C. After cooling on ice, the aqueous phases were sampled directly into direct phenol RT-PCR and direct-phenol PCR reactions. The aqueous phases of all samples permitted PCR amplification, while the PCR signal produced using PBS at near neutral pH (7.4) gave the greatest signal intensity.

D. Direct Phenol Partition Of Human Blood Serum Since PBS buffer resembles the ionic strength and pH of human blood, serum spiked with known amounts of B . burgdorferi was phenol extracted directly. The serum was brought to 10 mg/ml lysozyme and freeze-thawed. Thawed samples were brought to 1% SDS and incubated at temperatures between 55 and 70°C for 10 minutes. Equal volumes of phenol at the same temperature ("hot phenol") , were added and the tubes mixed vigorously several times during 4 minutes. The two phase system was spun at 14,000 rpm on a microcentrifuge for 1 minute and a sample of the upper, gel-like, aqueous phase was removed, sampled and added to an equal volume of hot phenol and partitioned again. 4800 and 400 spirochetes were detected. E. Dilution Study of Spirochaetes Assayed by Lysozyme Lysis Followed By Either dpRT-PCR or dpPCR

Dilutions of 2000, 200, 20, 2, and 0.2 spirochaetes/rxn of B . burgdorferi were hot phenol extracted followed by dpRT-PCR and dpPCR. While RT reactions were incubated for 3-15 minutes, the equivalent dpPCR reactions were kept on ice. 2000, 200, and 20 spirochaetes/rxn were detected for both dpRT-PCR and dpPCR. DpRT-PCR was 10-100 fold more sensitive than dpPCR. This represents the first time that as few as 20 spirochaetes has ever been detected using RT-PCR and PCR.

F. Determination of the Contribution of RNA to the Final Signal

In order to discount the possibility that the additional amplification was dependent on DNA carryover during RT incubation, rather than or in addition to RNA,

RT-PCR and reverse-RT-PCR reactions were performed under identical conditions but with the order of the amplimers reversed. Thus in the reverse RT-PCR reaction (basically PCR because only DNA will be amplified) , the sense primer was added during the RT incubation and the anti-sense primer following RT and prior to PCR. In the RT-PCR reactions, the anti-sense primer was added during RT and the sense primer was added prior to the PCR step. In the JS1/JS2 system, JS2 is the anti-sense primer, complementary to the 3' portion of the 23 S ribosomal RNA of B . burgdorferi , while JS1 is the sense primer bracketing the 5' end of this species-specific amplimer set.

When pure samples of RNA were assayed by this procedure, no signal was produced by reactions in which only sense primer was present during the RT incubation while DNA samples were amplified in both cases.

All publications mentioned hereinabove are hereby incorporated by reference in their entirety. While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be appreciated by one skilled in the art from a reading of the disclosure that various changes in form and detail can be made without departing from the true scope of the invention in the appended claims.

SEQUENCE LISTING (1) GENERAL INFORMATION:

(i) APPLICANT: KATCHER, HAROLD L.

(ii) TITLE OF INVENTION: DIRECT-PHENOL PCR, RT AND

RT- PCR METHODS

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: MORGAN & FINNEGAN

(B) STREET: 345 PARK AVE.

(C) CITY: NEW YORK

(D) STATE: NEW YORK

(E) COUNTRY: USA

(F) ZIP: 10154

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: FLOPPY DISK

(B) COMPUTER: IBM PC COMPATIBLE

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: WORD PERFECT 5.1

(Vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: UNKNOWN

(B) FILING DATE: HEREWITH

(vii) PRIOR APPLICATION DATA

(A) U.S. 07/980,522

(B) 20-NOV-1993

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: MARIA C.H. LIN

(B) REGISTRATION NUMBER: 29,323

(C) REFERENCE/DOCKET NUMBER: 2127-4000 PCT

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (212) -758-4800

(B) TELEFAX: (212) 751-6849

(C) TELEX: 421792

(2) INFORMATION FOR SEQ ID NO. 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: UNKNOWN (ϋ) MOLECULE TYPE:

(A) DESCRIPTION: OLIGONUCLEOTIDE

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO

(vi) ORIGINAL SOURCE:

(A) ORGANISM: BORELLIA BURGDORFERI

(B) STRAIN:

(C) INDIVIDUAL ISOLATE:

(D) DEVELOPMENTAL STAGE:

(E) HAPLOTYPE:

(F) TISSUE TYPE:

(G) CELL TYPE: (H) CELL LINE: (I) ORGANELLE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

AGAAGTGCTG GAGTCGA 17

(2) INFORMATION FOR SEQ ID NO. 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: UNKNOWN

(ii) MOLECULE TYPE:

(A) DESCRIPTION: OLIGONUCLEOTIDE

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES

(vi) ORIGINAL SOURCE:

(A) ORGANISM: BORELLIA BURGDORFERI

(B) STRAIN:

(C) INDIVIDUAL ISOLATE:

(D) DEVELOPMENTAL STAGE:

(E) HAPLOTYPE:

(F) TISSUE TYPE:

(G) CELL TYPE: (H) CELL LINE: (I) ORGANELLE:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

TAGTGCTCTA CCTCTATTAA 20

Claims

What is claimed is:
1. A process for amplifying a nucleic acid containing a DNA sequence of interest which comprises: (a) lysing cells from a sample containing the nucleic acid;
(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer;
(c) removing the aqueous layer containing the nucleic acid; and
(d) adding the aqueous layer so removed to a polymerase chain reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs), sense and antisense primers, an amplification buffer, and an amount of a DNA polymerase effective to catalyze polymerase chain reaction in the presence of phenol, under standard polymerase chain reaction conditions, thereby amplifying the DNA sequence of interest.
2. The process of claim 1, wherein the lysing step and the phenol partition step (steps (a) and (b) ) are performed simultaneously.
3. The process of claim 1, wherein the lysing comprises digesting the cells with an enzyme selected from the group consisting of lysozyme and proteinase K.
4. The process of claim 3, wherein the lysing is performed in the presence of one or more detergents selected from the group consisting of SDS, NP40, and Tween 20.
5. The process of claim 1, wherein the buffer- saturated-phenol comprises phenol and a buffer selected from the group consisting of PBS, sodium phosphate and acetate. r
-27-
6. The process of claim 5, wherein the buffer- saturated-phenol further comprises hydroxyquinoline, tris hydrochloric acid, or sodium chloride.
7. The process of claim 5, wherein the buffer- saturated-phenol further comprises chloroform.
8. The process of claim 7, wherein the buffer- saturated-phenol further comprises isoamyl alcohol.
9. The process of claim 1, wherein the DNA polymerase is selected from the group consisting of a Tth polymerase and a hot tub polymerase.
10. The process of claim 9, wherein the Tth polymerase is selected from the group consisting of rTth, Tth, and tet-z polymerase.
11. A process for converting RNA into cDNA which comprises:
(a) lysing cells from a sample containing RNA;
(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the RNA is extracted into the aqueous layer;
(c) removing the aqueous layer containing the RNA; and
(d) adding the aqueous layer so removed to a reverse transcriptase reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , a primer complementary to the RNA, a reverse transcriptase buffer, and an amount of a reverse transcriptase effective to catalyze reverse transcription in the presence of phenol, under standard reverse transcription conditions, thereby converting the RNA into cDNA.
12. The process of claim 11, wherein the lysing step and the phenol partition step (steps (a) and (b) ) are performed simultaneously.
13. The process of claim 11, wherein the lysing comprises digesting the cells with an enzyme selected from the group consisting of lysozyme and proteinase K.
14. The process of claim 13, wherein the lysing is performed in the presence of one or more detergents selected from the group consisting of SDS, NP40, and Tween 20.
15. The process of claim 11, wherein the buffer-saturated-phenol comprises phenol and a buffer selected from the group consisting of PBS, sodium phosphate, and acetate.
16. The process of claim 15, wherein the buffer-saturated-phenol further comprises hydroxyquinoline, tris hydrochloric acid, or sodium chloride.
17. The process of claim 15, wherein the buffer-saturated-phenol further comprises chloroform.
18. The process of claim 17, wherein the buffer-saturated-phenol further comprises isoamyl alcohol.
19. The process of claim 11, wherein the reverse transcriptase is selected from the group consisting of a Tth polymerase and a Hot Tub polymerase.
20. The process of claim 19, wherein the Tth polymerase is selected from the group consisting of rTth,
Tth, and tet-z polymerase.
21. A process for amplifying a nucleic acid containing an RNA sequence of interest which comprises:
(a) lysing cells from a sample containing the nucleic acid;
(b) mixing the lysed cells with about an equal volume of a buffer-saturated-phenol until an aqueous layer and an organic layer are formed and the nucleic acid is extracted into the aqueous layer;
(c) removing the aqueous layer containing the nucleic acid;
(d) adding the aqueous layer so removed to a reverse transcriptase reaction mixture comprising deoxyribonucleotide triphosphates (dNTPs) , a primer complementary to the nucleic acid, a reverse transcriptase buffer, and an amount of a reverse transcriptase effective to catalyze reverse transcription in the presence of phenol, under standard reverse transcription conditions, thereby converting the RNA into cDNA; and (e) adding to the reverse transcriptase mixture an amplification buffer, a primer complementary to the converted cDNA, and an amount of a DNA polymerase between 0.1 and 3 times the amount of the reverse transcriptase added in step (d) , under standard PCR conditions, thereby amplifying the cDNA.
22. The process of claim 21, wherein the lysing step and the phenol partition step (steps (a) and (b) ) are performed simultaneously.
23. The process of claim 21, wherein the lysing comprises digesting the cells with an enzyme selected from the group consisting of lysozyme and proteinase K.
24. The process of claim 23, wherein the lysing is performed in the presence of one or more detergents selected from the group consisting of SDS, NP40, and Tween 20.
25. The process of claim 21, wherein the buffer-saturated-phenol comprises phenol and a buffer selected from the group consisting of PBS, sodium phosphate and acetate.
26. The process of claim 25, wherein the buffer-saturated-phenol further comprises hydroxyquinoline, tris-hydrochloric acid, or sodium chloride.
27. The process of claim 25, wherein the buffer-saturated-phenol further comprises chloroform.
28. The process of claim 27, wherein the buffer-saturated-phenol further comprises isoamyl alcohol.
29. The process of claim 21, wherein the reverse transcriptase and the DNA polymerase are selected from the group consisting of a Tth polymerase and a hot tub polymerase.
30. The process of claim 29, wherein the Tth polymerase is selected from the group consisting of rTth, Tth, and tet-Z polymerase.
31. A process for determining a false possible signal from RT-PCR which comprises comparing the signal produced by performing RT-PCR on nucleic acid from a sample with a signal produced by performing reverse RT-PCR on nucleic acid from the same sample and under equivalent conditions as for RT-PCR, wherein RT-PCR and reverse RT- PCR are performed by the process of claim 21 with the limitation that in RT-PCR, an anti-sense primer is added during RT and a sense primer is added during PCR, and in reverse RT-PCR, the sense primer is added during RT and the anti-sense primer is added during PCR, the presence of equal signals being indicative of a false positive signal.
PCT/US1993/011315 1992-11-20 1993-11-19 Direct-phenol pcr, rt and rt-pcr methods WO1994012657A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US98052292 true 1992-11-20 1992-11-20
US07/980,522 1992-11-20

Publications (1)

Publication Number Publication Date
WO1994012657A1 true true WO1994012657A1 (en) 1994-06-09

Family

ID=25527625

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/011315 WO1994012657A1 (en) 1992-11-20 1993-11-19 Direct-phenol pcr, rt and rt-pcr methods

Country Status (1)

Country Link
WO (1) WO1994012657A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000228A1 (en) * 1994-06-23 1996-01-04 Dade International Inc. Method for the rapid isolation of nucleic acid
WO1996003528A2 (en) * 1994-07-27 1996-02-08 Cambridge University Technical Services Limited Oligonucleotides and their use
WO1996032501A1 (en) * 1995-04-11 1996-10-17 Boehringer Mannheim Gmbh Process for reducing the formation of artefacts during transcription of rebonucleic acids to deoxynucleic acids
EP0821059A2 (en) * 1996-07-25 1998-01-28 THE INSTITUTE OF PHYSICAL & CHEMICAL RESEARCH Method for reverse transcription

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NUCLEIC ACIDS RESEARCH, Volume 17, No. 24, issued 1989, T.A. BECHTEREVA et al., "DNA Sequencing with Thermostable Tet DNA Polymerase from Thermus Thermophilus", page 10507. *
NUCLEIC ACIDS RESEARCH, Volume 19, No. 5, issued 1991, M. PANACCIO et al., "PCR Based Diagnosis in the Presence of 8% (v/v) Blood", page 1151. *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000228A1 (en) * 1994-06-23 1996-01-04 Dade International Inc. Method for the rapid isolation of nucleic acid
WO1996003528A2 (en) * 1994-07-27 1996-02-08 Cambridge University Technical Services Limited Oligonucleotides and their use
WO1996003528A3 (en) * 1994-07-27 1996-04-18 Allain Jean Pierre Oligonucleotides and their use
WO1996032501A1 (en) * 1995-04-11 1996-10-17 Boehringer Mannheim Gmbh Process for reducing the formation of artefacts during transcription of rebonucleic acids to deoxynucleic acids
EP0821059A2 (en) * 1996-07-25 1998-01-28 THE INSTITUTE OF PHYSICAL & CHEMICAL RESEARCH Method for reverse transcription
EP0821059B1 (en) * 1996-07-25 2005-12-21 Hayashizaki, Yoshihide Method for reverse transcription

Similar Documents

Publication Publication Date Title
Zoller et al. [32] Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors
US5731171A (en) Sequence independent amplification of DNA
US5808041A (en) Nucleic acid purification using silica gel and glass particles
US5028525A (en) Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ
US5985572A (en) Quaternary amine surfactant and methods of using same in isolation of RNA
US4959312A (en) Full spectrum mutagenesis
US6383393B1 (en) Chromatographic purification and separation process for mixtures of nucleic acids
US5393672A (en) Non toxic compositions and methods useful for the extraction of nucleic acids
US5334499A (en) Methods of extracting, amplifying and detecting a nucleic acid from whole blood or PBMC fraction
US5658764A (en) Method and kits for detection of fragile X specific, GC-rich DNA sequences
US5300635A (en) Quaternary amine surfactants and methods of using same in isolation of nucleic acids
Belyavsky et al. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells
US5824517A (en) Method for amplifying nucleic acid sequences by strand displacement using DNA/RNA chimeric primers
US5231015A (en) Methods of extracting nucleic acids and pcr amplification without using a proteolytic enzyme
US6001558A (en) Amplification and detection of HIV-1 and/or HIV 2
US5578467A (en) Use of deoxyinosine containing primers to balance primer efficiency in the amplification of nucleic acid molecules
US4483920A (en) Immobilization of message RNA directly from cells onto filter material
US5518900A (en) Method for generating single-stranded DNA molecules
US5569582A (en) Rapid amplification and detection of nucleic acids
US7005266B2 (en) Nucleic acid isolation from stool samples and other inhibitor-rich biological materials
US6291166B1 (en) Nucleic acid archiving
JP5150829B2 (en) Nucleic acid detection and amplification method
US6218531B1 (en) Method of isolating RNA
US5409818A (en) Nucleic acid amplification process
US6503716B1 (en) Compositions and methods for extracting a nucleic acid

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: CA