WO1994003611A2 - Ptp-d subfamily of protein tyrosine phosphatases - Google Patents

Ptp-d subfamily of protein tyrosine phosphatases Download PDF

Info

Publication number
WO1994003611A2
WO1994003611A2 PCT/EP1993/002086 EP9302086W WO9403611A2 WO 1994003611 A2 WO1994003611 A2 WO 1994003611A2 EP 9302086 W EP9302086 W EP 9302086W WO 9403611 A2 WO9403611 A2 WO 9403611A2
Authority
WO
WIPO (PCT)
Prior art keywords
ptp
protein
glycoprotein
nucleic acid
seq
Prior art date
Application number
PCT/EP1993/002086
Other languages
French (fr)
Other versions
WO1994003611A3 (en
Inventor
Axel Ullrich
Nils Peter Hundahl MØLLER
Karin BACH-MØLLER
Original Assignee
MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. filed Critical MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.
Priority to JP6505020A priority Critical patent/JPH08501934A/en
Priority to DE69332883T priority patent/DE69332883T2/en
Priority to AU47077/93A priority patent/AU4707793A/en
Priority to EP93917752A priority patent/EP0654083B1/en
Priority to AT93917752T priority patent/ATE237688T1/en
Priority to DK93917752T priority patent/DK0654083T3/en
Publication of WO1994003611A2 publication Critical patent/WO1994003611A2/en
Publication of WO1994003611A3 publication Critical patent/WO1994003611A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/42Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the invention pertains to the field of biochemistry and cell and molecular biology.
  • the invention relates to PTP-D proteins or glycoproteins that are members of a novel subfamily (PTP-D) of protein tyrosine phosphatases (PTPases), nucleic acid constructs coding for PTP-D proteins or glycoproteins, recombinant expression vectors carrying the nucleic acid constructs, cells containing the recombinant expression vectors, methods for production and identification of PTP-D proteins and glycoproteins and DNA constructs coding therefor, antibodies specific for PTP-D proteins and glycoproteins, and methods for screening compounds capable of binding to and inhibiting or stimulating protein tyrosine phosphatase enzymatic activity of PTP-D proteins or glycoproteins.
  • PTP-D proteins or glycoproteins that are members of a novel subfamily (PTP-D) of protein tyrosine phosphatases (PTPases), nucleic acid constructs coding for PTP-D proteins or glycoproteins
  • PTKases protein tyrosine kinases
  • the protein tyrosine kinases are a large family of proteins that includes many growth factor receptors and potential oncogenes. (Hanks et al., Science 241:42-52 (1988)). Many PTKases have been linked to initial signals required for induction of the cell cycle (Weaver et al., Mol. and Cell. Biol. 11 (9): 4415-4422 (1991)). PTKases comprise a discrete family of enzymes having common ancestry with, but major differences from, serine/threonine-specific protein kinases (Hanks et al., supra).
  • PTKases The mechanisms leading to changes in activity of PTKases are best understood in the case of receptor-type PTKases having a transmembrane topology (Ullrich et al. (1990) supra).
  • the binding of specific ligands to the extracellular domain of members of receptor-type PTKases is thought to induce their oligomerization leading to an increase in tyrosine kinase activity and activation of the signal transduction pathways (Ullrich et al., (1990) supra).
  • Deregulation of kinase activity through mutation or overexpression is a well-established mechanism for cell transformation (Hunter et al., (1985) supra; Ullrich et al., (1990) supra).
  • the protein phosphatases are composed of at least two separate and distinct families (Hunter, T.(1989) supra) the protein serine/threonine phosphatases and the protein tyrosine phosphatases (PTPases).
  • the protein tyrosine phosphatases are a family of proteins that have been classified into two subgroups.
  • the first subgroup is made up of the low molecular weight, intracellular enzymes that contain a single conserved catalytic phosphatase domain. All known intracellular type PTPases contain a single conserved catalytic phosphatase domain. Examples of the first group of PTPases include (1) placental PTPase 1B (Charbonneau et al., Proc. Natl. Acad. Sci. USA 86:5252-5256 (1989); Chernoff et al., Proc. Natl. Acad. Sci.
  • the second subgroup is made up of the high molecular weight, receptor-linked PTPases, termed R-PTPases.
  • R-PTPases consist of a) an intracellular catalytic region, b) a single transmembrane segment, and c) a putative ligand-binding extracellular domain (Gebbink et al., supra).
  • R-PTPases The structures and sizes of the c) putative ligand-binding extracellular "receptor" domains of R-PTPases are quite divergent. In contrast, the a) intracellular catalytic regions of R-PTPases are highly homologous. All R-PTPases have two tandemly duplicated catalytic phosphatase homology domains, with the prominent exception of an R-PTPase termed HPTP ⁇ , which has only one catalytic phosphatase domain. (Tsai et al., Journal of Biol. Chem. 266(16): 10534-10543 (1991)).
  • LCA leukocyte common antigens
  • T-cell clones that were mutagenized by NSG and selected for their failure to express CD45 had impaired responses to T-cell receptor stimuli (Weaver et al., (1991) supra). These T-cell clones were functionally defective in their responses to signals transmitted through the T cell antigen receptor, including cytolysis of appropriate targets, proliferation, and tymphokine production (Weaver et al. , (1991) supra).
  • R-PTPases Another example of R-PTPases is the leukocyte common antigen related molecule (LAR) (Streuli et al., J. Exp. Med. 168: 1523-1530 (1988)).
  • LAR leukocyte common antigen related molecule
  • LAR was initially identified as a homologue of LCA (Streuli et al., supra). Although the a) intracellular catalytic region of the LAR molecule contains two catalytic phosphatase homology domains (domain I and domain II), mutational analyses suggest that only domain I has catalytic phosphatase activity, whereas domain II is enzymatically inactive (Streuli et al., EMBO J. 9(5J:2399-2407 (1990)). Chemically induced LAR mutants having tyrosine at amino acid position 1379 changed to a phenylalanine are temperature-sensitive (Tsai et al., J. Biol. Chem. 266(16): 10534-10543 (1991)).
  • mRPTP ⁇ A new mouse R-PTP, designated mRPTP ⁇ , has been cloned which has a) an extracellular domain that shares some structural motifs with LAR. (Gebbink et al., (1991) supra). In addition, these authors have cloned the human homologue of RPTP ⁇ and localized the gene on human chromosome 18.
  • Drosophila PTPases Two Drosophila PTPases, termed DLAR and DPTP, have been predicted based on the sequences of cDNA clones (Streuli et al., Proc. Natl. Acad. Sci. USA 86:8698-8702 (1989)).
  • cDNAs coding for another Drosophila R-PTPase termed DPTP 99A, have been cloned and characterized (Hariharan et al., Proc. Natl. Acad. Sci. USA 88: 11266-11270 (1991)).
  • R-PTPases include R-PTPase- ⁇ , ⁇ , y, and ⁇ (Krueger et al., EMBO J. 9:3241-3252 (1990), Sap et al. Proc. Natl. Acad. Sci. USA 87::6112-6116 (1990), Kaplan et al., Proc. Natl. Acad. Sci. USA 87:7000-7004 (1990), Jirik et al., FEBS Lett. 273:239-242 (1990), Mathews et al., Proc. Natl. Acad. Sci. USA 87:4444-4448 (1990), Ohagi et al., Nucl. Acids Res.
  • the 142 amino acid extracellular domain (including signal peptide of R-PTPase- ⁇ ) has a high serine and threonine content (32%) and 8 potential N-glycosylation sites.
  • cDNA clones have been produced that code for the R-PTPase- ⁇ , and R-PTPase- ⁇ has been expressed from eukaryotic hosts.
  • Northern analysis has been used to identify the natural expression of R-PTPase- ⁇ in various cells and tissues.
  • a polyclonal antibody to R-PTPase- ⁇ has been produced by immunization with a synthetic peptide of R-PTPase- ⁇ , which identifies a 130 kDa protein in cells transfected with a cDNA clone encoding a portion of R-PTPase- ⁇ .
  • R-PTPases Another example of R-PTPases is HePTP. (Jirik et al., FASEB J.
  • HePTP a cDNA library derived from a hepatoblastoma cell line, HepG2, with a probe encoding the two PTPase domains of LCA, and discovered a cDNA clone encoding a new R-PTPase, named HePTP.
  • the HePTP gene appeared to be expressed in a variety of human and murine cell lines and tissues.
  • Krueger et al. aligned the catalytic phosphatase domain sequences of PTP1B, TCPTP, LAR, LCA, HPTP ⁇ , ⁇ , 8, ⁇ and ⁇ , and DLAR and DPTP.
  • This alignment includes the following "consensus sequences: (Krueger et al., supra, Figure 7, lines 1 and 2):
  • PTPases are needed to gain important understanding of the mechanisms of signal transduction, cell cycle progression and cell growth, and neoplastic transformation.
  • PTP-D protein tyrosine phosphatases.
  • the novel subfamily hereinafter "PTP-D subfamily, " differs significantly in structure from previously reported PTPases.
  • the present invention thus provides a PTP-D protein or glycoprotein which is a PTPase from the PTP-D subfamily.
  • a PTP-D protein or glycoprotein comprises a PTPase from the PTP-D subfamily of PTPases having catalytic phosphatase domains in which amino acid sequences are selected from:
  • amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids having the amino acid sequences selected from amino acids
  • PTP-D G Y I N A S/N [SEQ. ID NO. 5] Consensus D Y I N A S/N [SEQ. ID NO. 1]
  • a PTP-D protein or glycoprotein of the invention When a PTP-D protein or glycoprotein of the invention is one which occurs in nature, it is substantially free of other proteins or glycoproteins with which it is natively associated.
  • a substantially pure PTP-D protein or glycoprotein of the invention may be produced by biochemical purification of the glycoprotein.
  • a PTP-D protein or glycoprotein of the invention may be prepared by chemical means or by recombinant means in the prokaryotic or eukaryotic hosts, and is provided substantially free of other proteins with which it is natively associated and/or has modified amino acids.
  • the invention is further directed to a fragment of a PTP-D protein or glycoprotein, to a PTP-D protein or glycoprotein having additional amino acids, and to a PTP-D protein or glycoprotein having substituted amino acids, and to a PTP-D protein or glycoprotein having any combination of deleted, additional, or substituted amino acids, such that the PTP-D protein or glycoprotein possesses the desired biological activity.
  • the invention is further directed to a nucleic acid construct comprising a nucleotide sequence encoding a PTP-D protein or glycoprotein according to the invention in the form of cDN A or genomic DNA.
  • the invention is further directed to a nucleic acid construct in the form of an expression vehicle, as well as prokaryotic and eukaryotic host cells containing the expression vehicle.
  • Also included in the present invention is a process for preparing a PTP-D protein or glycoprotein of this invention, comprising:
  • the invention is also directed to an antibody, polyclonal antibody, monoclonal antibody, or chimeric antibody, specific for a PTP-D protein or glycoprotein or for an epitope of a PTP-D protein or glycoprotein.
  • the invention is further directed to a method for detecting the presence, or measuring the quantity, of a PTP-D protein or glycoprotein in cell or in a subject comprising:
  • the invention is also directed to a method for detecting the presence of a nucleic acid construct encoding a normal or mutant PTP-D protein or glycoprotein in a cell or a subject comprising:
  • the nucleic acid of the cell can be selectively amplified, using the polymerase chain reaction, prior to assay.
  • the present invention is also directed to a method for identifying and isolating in a chemical or biological preparation a compound capable of binding to a PTP-D protein or glycoprotein, said method comprising:
  • the invention includes a method for identifying a molecule capable of stimulating or inhibiting the enzymatic activity of a PTP-D protein or glycoprotein, comprising:
  • step (b) incubating the mixture in step (a) for a sufficient interval; (c) measuring the enzymatic activity of the PTP-D protein or glycoprotein;
  • Figure 1 presents the partial cDNA sequence and the deduced amino acid sequence of PTP-D 1, which is a PCR fragment.
  • Figure 2 presents the partial cDNA sequence and the deduced amino acid sequence of PTP-D2, which is a PCR fragment.
  • Figure 3A shows a comparison of the deduced amino acid sequences of PTP-D 1 and PTP-D2 with the amino acid sequence of PTPase IB.
  • CLUSTAL program is used (Higgins, C, Fuch, R. and Bleasby, D., Multiple Sequence Alignment; CABIOS (1991) (in press)).
  • Figure 3B shows a comparison of the nucleotides between PTP-D 1 and PTP-D2.
  • Figure 3C shows a comparison of the amino acids between PTP-D 1 and PTP-D2.
  • Figure 4 shows the partial cDNA sequence and the deduced amino acid sequence of PTP-D 1.
  • This partial cDNA sequence includes the cDNA sequence of the PCR fragment shown in Figure 1.
  • PTP-D subfamily protein tyrosine phosphatases
  • PTPases protein tyrosine phosphatases
  • PTPases protein tyrosine phosphatases
  • subfamily is used to indicate a group of PTPases which are structurally related at specific amino acid residues as specified above.
  • amino acid consensus sequences is meant the conserved amino acid sequences in the catalytic phosphatase domains of known
  • the present invention relates to a PTP-D protein or glycoprotein comprising a PTPase from the PTP-D subfamily of PTPases having a catalytic phosphatase domain having one, two, or three amino acid sequences selected from:
  • the invention is directed to a naturally occurring mammalian PTP-D protein or glycoprotein. In another aspect, the invention is directed to a recombinant mammalian PTP-D protein or glycoprotein. In another aspect, the invention is directed to a chemically synthesized mammalian PTP-D protein or glycoprotein.
  • the preferred PTP-D protein or glycoproteins of the present invention are of human origin.
  • the invention provides a naturally occurring PTP-D protein or glycoprotein substantially free of other proteins or glycoproteins with which it is natively associated. "Substantially free of other proteins or glycoproteins" indicates that the PTP-D protein or glycoprotein has been purified away from at least 90 per cent (on a weight basis), and from even at least 99 per cent if desired, of other proteins and glycoproteins with which it is natively associated, and is therefore substantially free of them. That can be achieved by subjecting the cells, tissue or fluids containing the PTP-D protein or glycoprotein to standard protein purification techniques such as immunoadsorbent columns bearing monoclonal antibodies reactive against the protein.
  • affinity purification can utilize solid-phase substrates which can bind the catalytic phosphatase domain, or a ligand that will bind to the receptor domain that may be present in a PTP-D protein or glycoprotein.
  • the purification can be achieved by a combination of standard methods, such as ammonium sulfate precipitation, molecular sieve chromatography, and ion exchange chromatography.
  • a mammalian PTP-D protein or glycoprotein of the present invention can be biochemically purified from a variety of cell or tissue sources.
  • tissues such as skeletal muscle, especially of human origin, are preferred.
  • Cell lines such as rhabdemyosarcoma cell lines (RD) may be used.
  • RD rhabdemyosarcoma cell lines
  • a PTP-D protein can be synthesized substantially free of other proteins or glycoproteins of mammalian origin in a prokaryotic organism or in a non-mammalian eukaryotic organism, if desired.
  • a recombinant PTP-D protein or glycoprotein produced in mammalian cells is either a naturally occurring protein sequence or is a modified protein sequence wherein there are amino acid deletions and/or insertions and/or substitutions.
  • a naturally occurring PTP-D protein or glycoprotein is produced by recombinant means, it is provided substantially free of the other proteins and glycoproteins with which it is natively associated.
  • the invention provides a fragment of a PTP-D protein or glycoprotein.
  • fragment is used to indicate a polypeptide which is derived from a PTP-D protein or glycoprotein having a naturally occurring protein sequence by appropriately modifying the DNA sequence encoding the PTP-D protein or glycoprotein, resulting in deletion of one or more amino acids at one or more sites of the C-terminal, N-terminal, and within the native sequence. Fragments of a PTP-D protein or glycoprotein are useful for screening for compounds that are antagonists or agonists (as defined below). It is understood that such fragments of a PTP-D protein or glycoprotein may retain characterizing portion(s) of the native PTP-D or glycoprotein.
  • PTP-D fragments of PTP-D proteins or glycoproteins should retain one or more biological activities or functions which are characteristic for the intact PTP-D proteins or glycoproteins.
  • Examples, which are not intended to be in any way limiting to the scope of the invention claimed, of PTP-D fragments are: a) the catalytic domain; b) regions of the PTP-D proteins or glycoproteins which interact with other molecules in the intact cell; c) regulatory parts of PTP-D.
  • the invention provides a PTP-D protein or glycoprotein having additional amino acids that is derived from a naturally occurring PTP-D protein or glycoprotein by appropriately modifying the DNA sequence encoding the PTP-D protein or glycoprotein, resulting in addition of one or more amino acids at one or more sites of the C-terminal, N-terminal, and within the native sequence. It is understood that such PTP-D protein or glycoprotein having additional amino acids may retain characterizing portion(s) of the native PTP-D protein or glycoprotein. In particular, such PTP-D proteins or glycoproteins with additional amino acids should retain one or more biological activities or functions which are characteristic for the intact PTP-D proteins or glycoproteins.
  • the invention provides a PTP-D protein or glycoprotein having substituted amino acids that is derived from a naturally occurring PTP-D protein or glycoprotein by appropriately modifying or mutating the DNA sequence encoding the PTP-D protein or glycoprotein, resulting in substitution of one or more amino acids at one or more sites of the C-terminal, N-terminal, and within the native amino acid sequence. It is understood that such PTP-D protein or glycoprotein having substituted amino acids may retain characterizing portion(s) of the PTP-D protein or glycoprotein.. In particular, such PTP-D proteins or glycoproteins having substituted amino acids should retain one or more biological activities or functions which are characteristic for the intact PTP-D proteins or glycoproteins.
  • deletion, insertion, and substitution may also be made to arrive at the final construct of a PTP-D protein or glycoprotein, provided that the final construct possesses the desired activity or function present in the intact PTP-D proteins or glycoproteins.
  • activities and functions are: a) the catalytic activity; b) substrate specificity; c) interaction with. other molecules in vitro and in vivo; d) regulatory functions. Only one of such activities or functions needs to be retained after any combination of deletion, insertion, and substitution.
  • these PTP-D proteins or glycoproteins having deletions from, and/or insertions to, and/or substitutions of amino acids ordinarily are prepared by site-directed mutagenesis (as exemplified by
  • the PTP-D protein or glycoproteins having amino acid deletions and/or insertions and/or additions typically exhibit the same qualitative biological activity as a native PTP-D protein or glycoprotein.
  • a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions may be conveniently prepared by direct chemical synthesis, using methods well-known in the art.
  • the invention provides so-called chimeric molecules which are made up of other PTPases in which one or more specific amino acid sequences are replaced with homologous sequence(s) from a PTP-D protein or glycoprotein.
  • Chimeric molecules include, for example, a PTP-D protein or glycoprotein having a ligand-binding extracellular domain from another PTPase that is grafted onto a portion of the PTP-D protein or glycoprotein.
  • Other chimeric molecules a) other PTPases in which the catalytic phosphatase domain has been replaced with the phosphatase domain from a PTP-D protein.
  • the preferred number of amino acids is between 220 and 260.
  • PTP-D protein or glycoprotein in which part or parts of the catalytic domain has been replaced with homologous part(s) from other PTPases.
  • chimeric molecules consisting of one member of the PTP-D subfamily in which a part or parts have been replaced with homologous parts. from one (or more) other member(s) from the PTP-D subfamily.
  • “Homologous sequences” are defined as sequences in two or more PTPases which are similarly positioned in the primary sequence and which may exhibit sequence homology. It should be emphasized that “homologous sequences” should not be limited to cases with high degree of homology. Chimeric molecules are important tools for elucidating structure-function relationships and for identifying specific compounds (drugs). Therefore, the most useful chimeras are often, but not always, molecules in which a certain portion of one molecule has been replaced with the similarly positioned, but divergent, sequence from another, otherwise homologous, molecule. Thus, the exchanged portions will quite often represent the parts of the molecules where they differ the most.
  • a PTP-D protein or glycoprotein may contain additional chemical moieties not normally a part of the PTP-D protein or glycoprotein.
  • Covalent modifications are included within the scope of this invention. Such modifications may be introduced into the PTP-D protein or glycoprotein by reacting targeted amino acid residues of the PTP-D protein or glycoprotein with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues.
  • Cysteinyl residues most commonly are reacted with alpha-haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxylmethyl or carboxyamidomethyl derivatives. Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, alpha-bromo-beta-(5-imidozoyl) propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole.
  • Histidyl residues are derivatized by reaction with diethylprocarbonate at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain.
  • Para-bromophenacyl bromide also is useful; the reaction is preferably performed in 0.1 M sodium cacodylate at pH 6.0.
  • Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivadzation with these agents has the effect or reversing the charge of the lysinyl residues.
  • Other suitable reagents for derivatizing alpha-amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trin ⁇ trobenzenesulfonic acid; O-methylisourea; .2,4 pentanedione; and transaminase-catalyzed reaction with glyoxylate.
  • Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatizadon of arginine residues requires that the reaction be performed in alkaline conditions because of the high pK. of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.
  • Carboxyl side groups are selectively modified by reaction carbodiimide (R'-N-C-N-R') such as 1-cyclohexyl-3-(2-morpholinyl-(4-ethyl) carbodiimide or 1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide.
  • carbodiimide R'-N-C-N-R'
  • aspartyl and glutamyl residue are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions.
  • Glutaminyl and asparaginyl residues are frequently deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.
  • Derivatization with bifunctional agents is useful for cross-linking the peptide to a water-insoluble support matrix or to other macromolecular carriers.
  • Commonly used cross-linking agents include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane,glutaraIdehyde,N-hydroxysuccinimideesters, for example, esters with 4-azidosalicycIic acid, homobifunctional imidoesters, including dissuccinimidyl esters such as 3,3'-dithiobis(succinimidyl-propionate), and bifunctional maleimides such as bis-N-maleimido-1,8-octane.
  • Derivatizing agents such as methyl-3-[p-azidophenyl)dithio]propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light.
  • reactive water-insoluble matrices such as cyanogen bromide-activated carbo hydrates and the reactive substrates described in U.S. Patent Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.
  • Such derivatized moieties may improve the solubility, absorption, biological half life, and the like.
  • the moieties may alternatively eliminate or attenuate any undesirable side effect of the protein and the like.
  • Moieties capable of mediating such effects are disclosed, for example, in Remington 's Pharmaceutical Sciences, 16th ed., Mack Publishing Co., Easton, PA (1980).
  • the present invention relates to a PTP-D protein or glycoprotein as defined above having domains which show 70% or more identity to the amino acid sequences of PTP-D 1 or PTP-D2, as provided in Figures 1 and 2, respectively.
  • PTP-D1 and PTP-D2 are PTP-D proteins that are members of the PTP-D subfamily that are expressed in human skeletal muscle.
  • the present invention relates to a PTP-D protein or glycoprotein comprising PTP-D 1 or PTP-D2.
  • PTP-D1 and PTP-D2 have been shown to be expressed in human skeletal muscle.
  • the present invention relates to but is not in any way limited to such members of the PTP-D 1 and PTP-D2 PTP-D subfamily expressed in this tissue.
  • the present invention relates to a nucleic acid construct which comprises a nucleotide sequence encoding a PTP-D protein or glycoprotein, or encoding a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions.
  • the invention is further directed to the nucleic acid sequence in the form of an expression vector such as a recombinant expression vector, as well as prokaryotic and eukaryotic host cells containing the expression vector.
  • PTP-D protein or glycoproteins may be produced by culturing cells in a suitable nutrient medium under conditions which are conducive to the expression of such PTP-D protein or glycoproteins.
  • a suitable nutrient medium under conditions which are conducive to the expression of such PTP-D protein or glycoproteins.
  • One of ordinary skill in the art will know how to identify and clone additional PTP-D protein or glycoproteins, of human or other mammalian species, which have sequence homology to me PTP-D protein or glycoproteins described herein, using the nucleic acid construct and oligonucleotides of the present invention without undue experimentation.
  • manipulation of the nucleic acid of the present invention allow the grafting of a particular ligand-binding extracellular domain from a particular PTPase onto portions of a PTP-D protein or glycoprotein resulting in chimeric PTP-D proteins or glycoproteins.
  • Non-limiting examples of such chimeric molecules- include the PTP-D protein or glycoprotein having a ligand-binding extracellular domain that is an epidermal growth factor receptor, a fibroblast growth factor receptor, and the like.
  • Genetically engineered chimeric receptors are known in the art (see, for example, Riedel et al., Nature 324:628-670 (1986)).
  • Nucleic acid constructs encoding a PTP-D protein or glycoprotein, and encoding a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions, and encoding chimeric PTP-D proteins or glycoproteins such as those described above, can be used in gene therapy.
  • An abnormal or dysfunctional PTP-D protein or glycoprotein which results in disease may be replaced by infusion of cells of the desired lineage (such as hemopoietic cells, for example) transfected with a normal PTP-D protein or glycoprotein.
  • cells carrying a chimeric PTP-D protein or glycoprotein having a receptor to a ligand of choice e.g. EGF
  • nucleic acid constructs that are recombinant DNA molecules of the present invention can be produced through any of a variety of means, such as, for example, DNA or RNA synthesis, or more preferably, by recombinant DNA techniques. Techniques for synthesizing such molecules are disclosed by, for example, Wu et al (Prog. Nucl. Acid. Res. Molec. Biol. 21: 101-141 (1978)). Procedures for constructing recombinant molecules in accordance with the above-described method are disclosed by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989).
  • the 3' terminus of the recombinant DNA molecule of this invention is preferably treated to render it unsuitable for polymerization.
  • Such treatment may be accomplished by blocking the terminus by chemical means, or by modifying the terminal bases such that they sterically interfere with polymerase action.
  • such treatment is accomplished by immobilizing the 3' terminus, such as by coupling it to a solid support (such as, for example, glass, plastic, latex, etc.).
  • the support may be of any form, (for example, a sheet, rod, sphere, ovoid, etc. Procedures for such immobilization are well known to these of ordinary skill.
  • the 3' end of the recombinant DNA molecule is covalently bound to the solid support.
  • a spacer region may be used to extend the probe outward from the solid support as long as (1) it will not sterically hinder any function or characteristic of the recombinant molecule, and (2) the sequence of the spacer region does not participate in the hybridization or polymerization reactions of me assay. It is typically desirable to immobilize several, and preferably, a large number of such recombinant DNA molecules to the support.
  • Oligonucleotides representing a portion of a PTP-D protein or glycoprotein are useful for screening for the presence of genes encoding such PTP-D proteins and glycoproteins and for the cloning of PTP-D genes. Techniques for synthesizing such oligonucleotides are disclosed by, for example, Wu et al. (supra).
  • Protein molecules are fragmented as with cyanogen bromide, or with proteases such as papain, chymotrypsin, trypsin, etc. (Oike et al , J. Biol. Chem. 257:9751-9758 (1982); Liu et al., Int. J. Pept. Protein Res. 21:209-215 (1983)). Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid (Watson, J.D., In: Molecular Biology of the Gene, 4th Ed., Benjamin/Cummings Publishing Co., Inc., Menlo Park, CA (1987)).
  • oligonucleotides can be identified, each of which would be capable of encoding the amino acid.
  • the probability that a particular oligonucleotide will, in fact, constitute the actual XXX-encoding sequence can be estimated by considering abnormal base pairing relationships and the frequency with which a particular codon is actually used (to encode a particular amino acid) in eukaryotic cells.
  • Such "codon usage rules" are disclosed by Lathe et al., J. Molec. Biol. 183: 1-12 (1985).
  • a single oligonucleotide, or a set of oligonucleotides, that contains a theoretical "most probable" nucleotide sequence capable of encoding the PTP-D sequences is identified.
  • an amino acid sequences may be encoded by only a single oligonucleotide, frequently the amino acid sequence may be encoded by any of a set of similar oligonucleotides.
  • the members of this set contain oligonucleotides which are capable of encoding the peptide fragment and, thus, potentially contain the same oligonucleotide sequence as the gene which encodes the peptide fragment
  • only one member of the set contains the nucleotide sequence that is identical to the nucleotide sequence of the gene. Because this member is present within the set, and is capable of hybridizing to DNA even in the presence of the other members of the set, it is possible to employ the unfractionated set of oligonucleotides in the same manner in which one would employ a single oligonucleotide to clone the gene that encodes the peptide.
  • the oligonucleotide, or set of oligonucleotides, containing the theoreti cal "most probable" sequence capable of encoding the PTP-D fragment is used to identify the sequence of a complementary oligonucleotide or set of oligonucleotides which is capable of hybridizing to the "most probable" sequence, or set of sequences.
  • An oligonucleotide containing such a complementary sequence can be employed as a probe to identify and isolate a PTP-D gene (Sambrook et al., supra).
  • a suitable oligonucleotide, or set of oligonucleotides, which is capable of encoding a fragment of a PTP-D gene (or which is complementary to such an oligonucleotide, or set of oligonucleotides) is identified (using the above-described procedure), synthesized, and hybridized by means well known in the art, against a DNA or, more preferably, a cDNA preparation derived from cells which are capable of expressing a PTP-D gene.
  • Single stranded oligonucleotide molecules complementary to the "most probable" PTP-D peptide encoding sequences can be synthesized using procedures which are well known to those of ordinary skill in the art (Belagaje et al., J. Biol Chem. 254:5765-5780 (1979); Maniatis et al., In: Molecular Mechanisms in the Control of Gene Expression, Nierlich et al. Ed., Acad. Press, NY (1976); Wu et al., Prog. Nucl Acid Res. Molec. Biol. 21:101-141 (1978); Khorana, R.G., Science 203:614-625 (1979)).
  • DNA synthesis may be achieved through the use of automated synthesizers.
  • Techniques of nucleic acid hybridization are disclosed by Sambrook et al., (supra), and by Haymes et al., (In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985)), which references are herein incorporated by reference. Techniques such as, or similar to, those described above have successfully enabled the cloning of genes for human aldehyde dehydrogenases (Hsu et al., Proc. Natl. Acad. Sci. USA 82:3771-3775 (1985)), fibronectin (Suzuki et al., EMBO J.
  • a library of expression vectors is prepared by cloning DNA or, more preferably, cDNA (from a cell capable of expressing PTP-D) into an expression vector.
  • the library is then screened for members capable of expressing a protein which binds to anti-PTP-D antibody, and which has a nucleotide sequence that is capable of encoding potypeptides that have the same amino acid sequence as PTP-D, or fragments thereof.
  • DNA, or more preferably cDNA is extracted and purified from a cell which is capable of expressing PTP-D protein.
  • the purified cDNA is fragmented (by shearing, endonuclease digestion, etc.) to produce a pool of DNA or cDNA fragments. DNA or cDNA fragments from this pool are then cloned into an expression vector in order to produce a genomic library of expression vectors whose members each contain a unique cloned DNA or DNA fragment.
  • an "expression vector” is a vector which (due to the presence of appropriate transcriptional and/or translational control sequences) is capable of expressing a DNA (or cDNA) molecule which has been cloned into the vector and of thereby producing a polypeptide or protein. Expression of the cloned sequences occurs when the expression vector is introduced into an appropriate host cell. If a prokaryotic expression vector is employed, then the appropriate host cell would be any prokaryotic cell capable of expressing the cloned sequences. Similarly, if a eukaryotic expression vector is employed, then the appropriate host cell would be any eukaryotic cell capable of expressing the cloned sequences.
  • eukaryotic DNA may contain intervening sequences, and since such sequences cannot be correctly processed in prokaryotic cells, it is preferable to employ cDNA from a cell which is capable of expressing PTP-D in order .to produce a prokaryotic genomic expression vector library.
  • Procedures for preparing cDNA and for producing a genomic library are disclosed by Sambrook et al (supra).
  • a DNA sequence encoding a PTP-D protein or glycoprotein of the invention, or encoding a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions of the invention, or encoding a chimeric molecule of the invention may be recombined with vector DNA in accordance with conventional techniques, including blunt-ended or staggered-ended termini for ligation, restriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Techniques for such manipulations are disclosed by Sambrook et al. (supra), and are well known in the art.
  • a nucleic acid construct, such as DNA, is said to be “capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are “operably linked” to nucleotide sequences which encode the polypeptide.
  • An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene expression.
  • the precise nature of the regulatory regions needed for gene expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal the initiation of protein synthesis.
  • Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
  • the non-coding region 3' to the gene sequence coding for the protein may be obtained by the above-described methods.
  • This region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation.
  • the transcriptional termination signals may be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell may be substituted.
  • Two DNA sequences are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of the PTP-D gene sequence, or (3) interfere with the ability of the PTP-D gene sequence to be transcribed by the promoter region sequence.
  • a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence.
  • a promoter is a double-stranded DNA or RNA molecule which is capable of binding RNA polymerase and promoting the transcription of an "operably linked" nucleic acid sequence.
  • a "promoter sequence” is the sequence of the promoter which is found on that strand of the DNA or RNA which is transcribed by the RNA polymerase.
  • a “promoter sequence complement” is a nucleic acid molecule whose sequence is the complement of a "promoter sequence.” Hence, upon extension of a primer DNA or RNA adjacent to a single-stranded “promoter sequence complement” or, of a “promoter sequence,” a double-stranded molecule is created which will contain a functional promoter, if that extension proceeds towards the "promoter sequence” or the “promoter sequence complement. " This functional promoter will direct the transcription of a nucleic acid molecule which is operably linked to that strand of the double-stranded molecule which contains the "promoter sequence” (and not that strand of the molecule which contains the "promoter sequence complement”).
  • RNA polymerases exhibit a high specificity for such promoters.
  • the RNA polymerases of the bacteriophages T7, T3, and SP-6 are especially well characterized, and exhibit high promoter specificity.
  • the promoter sequences which are specific for each of these RNA polymerases also direct the polymerase to utilize (i.e. transcribe) only one strand of the two strands of a duplex DNA template. The selection of which strand is transcribed is determined by the orientation of the promoter sequence. This selection determines the direction of transcription since RNA is only polymerized enzymatically by the addition of a nucleotide 5' phosphate to a 3' hydroxyl terminus.
  • Two sequences of a nucleic acid molecule are said to be "operably linked” when they are linked to each other in a manner which either permits both sequences to be transcribed onto the same RNA transcript, or permits an RNA transcript, begun in one sequence to be extended into the second sequence.
  • two sequences such as a promoter sequence and any otiier "second" sequence of DNA or RNA are operably linked if transcription commencing in the promoter sequence will produce an RNA transcript of the operably linked second sequence.
  • two sequences such as a promoter sequence and any otiier "second" sequence of DNA or RNA are operably linked if transcription commencing in the promoter sequence will produce an RNA transcript of the operably linked second sequence.
  • a promoter sequence in order to function as a promoter, a promoter sequence must be present as a double-stranded molecule.
  • the two strands of a functional promoter sequence are referred to as a "transcript" strand and a "complementary” strand.
  • the "transcript” strand is that strand of the duplex which will be transcribed by the RNA polymerase (i.e. which serves as the template for transcription).
  • the "complementary” strand is the strand which has a sequence complementary to the "transcript” strand, and which must be present, and hybridized to the "transcript” strand, in order for transcription to occur.
  • RNA transcript when the "transcript" strand of a promoter sequence is operably linked to a second sequence, hybridization of the "transcript" strand with the "complement” strand, will, in the presence of a polymerase, result in the transcription of die “transcript” strand, and will produce an RNA transcript using the sequence of the "transcript” strand as a template.
  • the promoter sequences of the present invention may be either prokaryotic, eukaryotic or viral. Suitable promoters are repressible, or, more preferably, constitutive. Examples of suitable prokaryotic promoters include promoters capable or recognizing the T4 (Malik et al., J. Biol. Chem. 263: 1174-1181 (1984); Rosenberg et al., Gene 59:191-200 (1987); Shinedling et al., J. Molec. Biol.
  • subtilis (Gilman et al., Gene 32: 11-20 (1984)); the promoters of the bacteriophages of Bacillus (Gryczan, T.J., In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982)); Streptomyces promoters (Ward et al., Mol Gen. Genet. 203:468-478 (1986)); the int promoter of bacteriophage lambda; the bla promoter of the ⁇ -lactamase gene of pBR322, and the CAT promoter of die chloramphenicol acetyl transferase gene of pPR325, etc.
  • Prokaryotic promoters are reviewed by Glick, B.R. (J.
  • Preferred eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al., J. Mol. Appl. Gen.
  • Strong promoters are preferred. Examples of such preferred promoters are those which recognize the T3, SP6 and T7 polymerases, the P L promoter of the mouse metallothionein I gene.
  • a most preferred promoter for eukaryotic expression of PTP-D is SV40 promoter such as that driving transcription in the pLSV vector (Livneh et al., (1986) J. Biol Chem. 261, 12490-12497). The sequences of such polymerase recognition sites are disclosed by Watson et al. (In: Molecular Biology of the Gene, Fourth Edition, Benjamin/Cummings Publishing Co., Inc., Menlo Park, CA, (1987)).
  • the present invention relates to an antibody which is capable of specifically recognizing a PTP-D protein or glycoprotein or of specifically recognizing an epitope of a PTP-D protein or glycoprotein.
  • the recombinantly expressed or naturally occurring PTP-D protein or glycoprotein, and/or the antibodies recognizing the PTP-D protein or glycoprotein may be used in a method of diagnosing diseases or conditions with abnormal expression or activation of PTP-D protein or glycoproteins.
  • the present invention provides methods for evaluating the presence and the level of normal or mutant PTP-D protein or glycoprotein in a subject. Absence, or more typically, low expression of the PTP-D protein or glycoprotein, or presence of a mutant PTP-D protein or glycoprotein, in an individual may serve as an important predictor of susceptibility to oncogenic transformation and the development of cancer.
  • over-expression of a PTP-D protein or glycoprotein may serve as an important predictor of susceptibility to diabetes.
  • the invention is also directed to the use of such antibodies to detect the presence of, or measure the quantity or concentration of, a PTP-D protein or glycoprotein in a cell, a cell or tissue extract, or a biological fluid.
  • the present invention relates to a method for detecting the presence of or measuring the quantity of a PTP-D protein or glycoprotein in a cell, comprising:
  • antibody is meant to include polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, and anti-idiotypic (anti-Id) antibodies.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen.
  • Monoclonal antibodies are a substantially homogeneous population of antibodies to specific antigens.
  • MAbs may be obtained by methods known to those skilled in the art. See, for example, Kohler et al., Nature 256:495-497 (1975) and U.S. Patent No. 4,376,110.
  • Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, GILD and any subclass thereof.
  • the hybridoma producing the mAbs of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo production makes this the presently preferred method of production.
  • MAbs of isotype IgM or IgG may be purified from such ascites fluids, or from culture supernatants, using column chromatography methods well known to those of skill in the art.
  • Chimeric antibodies are molecules in which different portions are derived from different animal species, such as those having variable region derived from a murine MAb and a human immunoglobulin constant region. Chimeric antibodies and methods for their production are known in the art (Cabilly et al., Proc. Natl. Acad. Sci. USA 71:3273-3277 (1984); Morrison et al , Proc. Natl Acad. Sci.
  • An anti-idiotypic (anti-Id) antibody is an antibody which recognizes unique determinants generally associated with the antigen-binding site of an antibody.
  • An anti-Id antibody can be prepared by immunizing an animal of the same species and genetic type (e.g. mouse strain) as the source of the mAb with the mAb to which an anti-Id is being prepared. The immunized animal will recognize and respond to me idiotypic determinants of the immunizing antibody by producing an antibody to these idiotypic determinants (the anti-Id antibody).
  • the anti-Id antibody may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti-anti-Id antibody.
  • the anti-anti-ld may be epitopically identical to the original mAb which induced the anti-Id.
  • mAbs generated against a PTP-D protein or glycoprotein of the present invention may be used to induce anti-Id antibodies in suitable animals, such as BALB/c mice.
  • Spleen cells from such immunized mice are used to produce anti-Id hybridomas secreting anti-Id mAbs.
  • the anti-Id mAbs can be coupled to a carrier such as keyhole limpet hemocyanin (KLH) and used to immunize additional BALB/c mice.
  • KLH keyhole limpet hemocyanin
  • Sera from these mice will contain anti-anti-ld antibodies that have the binding properties of the original mAb specific for a PTP-D epitope.
  • the anti-Id mAbs thus have their own idiotypic epitopes, or"idiotopes" structurally similar to the epitope being evaluated, such as a PTP-D protein or glycoprotein.
  • antibody is also meant to include both intact molecules as well as fragments thereof, such as, for example, Fab and F(ab') 2 , which are capable of binding antigen.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding than an intact antibody (Wahl et al., J. Nucl Med. 24:316-325 (1983)).
  • Fab and F(ab') 2 and other fragments of the antibodies useful in the present invention may be used for the detection and quantitation of a PTP-D protein or glycoprotein according to the methods disclosed herein for intact antibody molecules.
  • Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • the antibodies, or fragments of antibodies, useful in the present invention may be used to quantitatively or qualitatively detect the presence of cells which express a PTP-D protein or glycoprotein. This can be accomplished by immunofluorescence techniques employing a fluorescently labeled antibody (see below) coupled with light microscopic, flow cytometric, or fluori metric detection.
  • the antibodies (or fragments thereof) useful in the present invention may be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of a PTP-D protein or glycoprotein.
  • In situ detection may be accomplished by removing a histological specimen from a patient, and providing the labeled antibody of the present invention to such a specimen.
  • the antibody (or fragment) is preferably provided by applying or by overlaying the labeled antibody (or fragment) to a biological sample.
  • Such assays for a PTP-D protein or glycoprotein typically comprise incubating a biological sample, such as a biological fluid, a tissue extract, freshly harvested cells such as lymphocytes or leukocytes, or cells which have been incubated in tissue culture, in the presence of a detectably labeled antibody capable of identifying a PTP-D protein or glycoprotein, and detecting the antibody by any of a number of techniques well-known in the art.
  • the biological sample may be treated with a solid phase support such as nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles or soluble proteins.
  • a solid phase support such as nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles or soluble proteins.
  • the support may then be washed with suitable buffers followed by treatment with the detectably labeled PTP-D specific antibody.
  • the solid phase support may then be washed with the buffer a second time to remove unbound antibody.
  • the amount of bound label on said solid support may then be detected by conventional means.
  • solid phase support any support capable of binding antigen or antibodies.
  • supports, or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetitite.
  • the nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention.
  • the support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody.
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc.
  • Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
  • binding activity of a given lot of anti-PTP-D antibody may be determined according to well known methods. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.
  • PTP-D-specific antibody can be detectably labeled is by linking the same to an enzyme and use in an enzyme immunoassay (EIA).
  • EIA enzyme immunoassay
  • This enzyme when later exposed to an appropriate substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometnc, fiuorimetric or by visual means.
  • Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • the detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
  • Detection may be accomplished using any of a variety of other immunoassays.
  • a radioimmunoassay RIA
  • the radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
  • fluorescent labeling compounds fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • the antibody can also be detectably labeled using fluorescence emitting metals such as 152 Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTP A) or ethylenediaminetetraacetic acid (EDTA).
  • DTP A diethylenetriaminepentacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • the antibody also can be detectably labeled by coupling it to a chemiluminescent compound.
  • the presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction.
  • chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aeluorin.
  • the present invention also relates to a method for detecting the presence of a nucleic acid construct encoding a PTP-D protein or glycoprotein, or a nucleic acid construct encoding a mutant PTP-D protein or glycoprotein, in a subject, comprising:
  • the method may comprise an additional step (c) before step (a).
  • Step (c) provides selectively amplifying the amount of nucleic acid of said cell encoding said PTP-D protein or glycoprotein, which may be by the polymerase chain reaction.
  • Oligonucleotide probes encoding various portions of PTP-D protein or glycoproteins are used to test cells from a subject for the presence of DNA or RNA sequence encoding a PTP-D protein or glycoprotein. Techniques for synthesizing such probes are disclosed by for example, Wu et al., Prog. Nucl Acid. Res. Molec. Biol 21:101-141 (1978). A preferred probe would be one directed to the nucleic acid sequence encoding at least four amino acid residues, and preferably at least five amino acid residues, of a PTP-D protein or glycoprotein of the present invention (see Example 4 below). Qualitative or quantitative assays can be performed using such probes.
  • Northern analysis is used to measure expression of a PTP-D mRNA, such as PTP-D1 mRNA and PTP-D2 mRNA, in a cell or tissue preparation.
  • PTP-D mRNA such as PTP-D1 mRNA and PTP-D2 mRNA
  • Such methods can be used even with very small amounts of DNA obtained from an individual, following use of selective amplification techniques.
  • Recombinant DNA methodologies capable of amplifying purified nucleic acid fragments have long been recognized. Typically, such methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by Cohen et al (U.S. Patent No. 4,237,224); and Sambrook et al., (supra), which documents are herein incorporated by reference.)
  • the present invention also relates to a method for identifying in a chemical or biological preparation a compound capable of binding to a PTP-D protein or glycoprotein, said method comprising:
  • the present invention also relates to a method for isolating from a complex mixture a compound capable of binding to a PTP-D protein or glycoprotein, comprising: (a) attaching said PTP-D protein or glycoprotein, or a compound-binding portion thereof, to a solid phase matrix;
  • compound capable of binding to a PTP-D protein or glycoprotein is meant a naturally occurring or synthetically produced molecule which interacts with PTP-D outside of the catalytic site of the phosphatase domain.
  • catalytic site is meant the smallest, contiguous part of PTP-D which contains phosphatase activity.
  • Such compounds may directly or indirectly modulate the enzymatic activity of the PTP-D protein or glycoprotein. Examples of such compounds are (i) intracellular proteins which interact with and may be dephosphorylated by a PTP-D protein or glycoprotein; (ii) naturally occurring molecules produced by other cell types.
  • a “compound-binding portion” of a PTP-D protein or glycoprotein is meant a part of the molecule which is outside of the catalytic site. Any part of the PTP-D proteins or glycoproteins which are not part of the catalytic site may be a compound-binding portion.
  • a "compound-binding portion” may be prepared from naturally occurring or recombinantly expressed PTP-D proteins or glycoproteins by proteolytical cleavage followed by conventional purification procedures known to those of skill in the art. Alternatively, the compound-binding portion of a PTP-D protein or glycoprotein may be produced by recombinant technology known to those of skill in the art by expressing only these parts of PTP-D in suitable cells.
  • the present invention relates to a method of screening for antagonists which are defined as molecules which directly or indirectly inhibit the enzymatic activity or activation of a PTP-D protein or glycoprotein.
  • the present invention relates to a method of screening for agonists which are defined as molecules which directly or indirectly increase the enzymatic activity or activation of a PTP-D protein or glycoprotein.
  • PTP-D proteins or glycoproteins of the present invention are useful in methods for screening drugs and other agents which are capable of activating or inhibiting the phosphatase activity, and thereby affecting major pathways of cellular metabolism.
  • an affinity probe is created which can be used to screen biological products or chemical agents for their capacity to interact with a PTP-D protein or glycoprotein on the basis of their binding activity. Bound material can then be eluted from the affinity probe in purified form.
  • a PTP-D protein or glycoprotein, or a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions and having enzymatic activity can be used for testing of compounds capable of enhancing or inhibiting the phosphatase activity.
  • the ability of a compound under test to modify phosphatase activity can be tested in an in vitro system wherein the test compound is added to a purified PTP-D protein or glycoprotein, or to a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions and having enzymatic activity, and the effects on enzyme activity measured using standard enzymological procedures well known to those of skill in the art.
  • a suitable fragment of a PTP-D protein or glycoprotein for use in screening may be prepared by limited proteolytic treatment of the naturally occurring or recombinantly expressed PTP-D protein or glycoprotein.
  • suitable fragment(s) of PTP-D may be produced by recombinant technology.
  • Such catalytic domains which consist only of the minimum number of amino acids needed for enzymatic activity, could be produced either alone or as part of a fusion protein in suitable hosts (e.g., E. col ⁇ ) by recombinant technology well known to those of skill in the art.
  • the action of a compound on PTPase activity can be measured in a whole cell preparation using live or fixed cells, or a membrane fraction derived from live or fixed cells.
  • This method is useful for screening compounds acting directly on the enzymatic portion of a PTP-D protein or glycoprotein. If a PTP-D molecule or glycoprotein has an extracellular receptor portion, then this method is useful for screening compounds acting via the extracellular receptor portion.
  • a test compound is incubated with cells, or with a membrane preparation derived therefrom, which express high amounts of a PTP-D protein or glycoprotein of this invention, such as transfected COS or NIH-3T3 cells.
  • the amount of cellular phosphotyrosine is then measured, using methods well-known in the art (Honegger, et al., Cell 51: 199-209 (1987); Margolis et al., Cell 57: 1101-1107 (1989)).
  • the results are compared to results obtained in the absence of the test compound, or in me absence or presence of a known activator of a PTP-D protein or glycoprotein. In such studies, the action of the test compound in the presence of an activator of tyrosine kinase can also be measured.
  • a compound which stimulates PTPase activity will result in a net decrease in the amount of phosphotyrosine, whereas a compound which inhibits PTPase activity will result in a net increase in the amount of phosphotyrosine.
  • tyrosine kinases such as the receptors for epidermal growth factor (EGF) and for platelet-derived growth factor (PDGF)
  • tyrosine phosphorylation is linked to cell growth and to oncogenic transformation.
  • Activation of a PTPases, leading to dephosphorylation, would serve as a counter regulatory mechanism to prevent or inhibit growth, and might serve as an endogenous regulatory mechanism against cancer.
  • mutation or dysregulation of this receptor enzyme system may promote susceptibility to cancer.
  • the insulin receptor is also a tyrosine kinase, and phosphorylation of tyrosine in cells bearing insulin receptors would be associated with normal physiological function.
  • PTPase In contrast to the case of cell growth and cancer, activation of a PTPase would counteract insulin effects. Subnormal PTPase levels or enzymatic activity would act to remove a normal counter regulatory mechanism. Perhaps more important, though, over-activity, or inappropriate activation, of a PTPase would be expected to inhibit or totally prevent the action of insulin on cells, leading to diabetes (of an insulin-resistant variety). Thus, susceptibility to diabetes may be associated with PTPase dysregulation.
  • the methods of the present invention for identifying normal or mutant PTP-D genes, or for measuring the amount or activity of PTP-D protein or glycoprotein associated with a cell or tissue can serve as methods for identifying susceptibility to cancer, diabetes, or other diseases associated with alterations in cellular phosphotyrosine metabolism.
  • the invention also relates to the use of such identified antagonists or agonists in pharmaceutical compositions intended for treatment of diseases or conditions with either normal or abnormal expression of a PTP-D protein or glycoprotein.
  • the composition may typically be in a form for systemic or topical injection or infusion and may, as such, be formulated with a suitable carrier for injection or infusion.
  • the present invention also relates to a method for preventing or treating diseases or conditions involving the activation of a PTP-D protein or glycoprotein, the method comprising administering, to a patient in need thereof, an effective dosage of a PTP-D protein or glycoprotein of the invention or an antibody of the invention or a molecule that stimulates or inhibits enzymatic activity of a PTP-D protein or glycoprotein of the invention.
  • cDNA corresponding to PTPases expressed in skeletal muscle were isolated by the polymerase chain reaction (Saiki et al., Science 239:487-491 (1988)).
  • human muscle first strand cDNA from above (corresponding to about 50 ng) was amplified with the following set of degenerative oligonucleotide primers using me Gene Amp kit (Perkin Elmer Cetus, Norwalk, CT, U.S.A.).
  • Sense prime (oligonucleotide no. 58)
  • Anti-sense primer (oligonucleotide no. 57)
  • the primers correspond to the following amino acid consensus sequences:
  • Antisense primer (oligonucleotide #57) H C S A G ( S / I / V ) G.
  • Each PCR cycle comprise a denaturation step at 94°C for 1 minute, an annealing step at 37°C for 2 minutes, and an extension step at 72°C for 2 minutes. Thirty to 40 cycles were carried out.
  • the reaction products were subjected to agarose gel electrophoresis.
  • the fragments of the expected size (based on the structure of already described PTPases) were isolated, subcloned using the TA cloning system (Invitrogen, San Diego, California) and sequenced by the enzymatic chain termination method described by Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)), (Sequenase, U.S.
  • PTP-D 1 and PTP-D2 The partial DNA sequence and the deduced amino acid sequence of two PCR fragments, termed PTP-D 1 and PTP-D2, are shown in Figure 1 and Figure 2, respectively.
  • the deduced amino acid sequences were compared with PTPase 1B in Figure 3 A using the CLUSTAL program (Higgins, C, Fuch, R., and Bleasby, D., Multiple Sequence Alignment; CABIOS (1991) (in press)).
  • PTP-D 1 and PTP-D2 are shown below in comparison with the consensus sequences of the previously described known PTPases (differences are underlined):
  • cDNA Cloning of a Member of the PTP-D Subfamily mRNA was prepared from human skeletal muscle as described in EXAMPLE 1.
  • a cDNA library was constructed using the methods described by Okayama and Berg, Mol. Cell. Biol. 2: 161-170 (1982); Okayama and Berg, Mol. Cell. Biol. 3:280-289 (1983).
  • the pCDVI-PL vector was used for preparation of the primer fragment (Noma et al., Nature 319:640-646 (1986).
  • a short synthetic adapter was used as second strand primer as recently described (Boel et al., BioTechniques 11:XX (1991)).
  • coli DH5 ⁇ (Gibco BRL, Gaithersburg, MD 20877, U.S.A.) was used for transformation according to the protocols by H. Inuoue et al., Gene 96:23-28 (1990). After transformation, the cells were plated onto LB plates (containing 50 ⁇ g ampicillin/ml) at a density of 15,000-20,000 colonies per plate.
  • Nitrocellulose replica filters (Scleicher & Schuell, BA85) were screened with standard colony hybridization technique ((Maniatis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition (1988). The following oligonucleotide was synthesized, labeled at the 5' end using T 4 polynucleotide kinase and [ ⁇ - 32 P]ATP (Amersham) and used for screening of the cDNA library:
  • This oligonucleotide corresponds to the amino acid sequence Ile-Ala- Met-Val-Thr-Ala-Glu of the PCR fragment no. 1 from EXAMPLE 1.
  • PTP-D 1 The partial sequence of one positive clone, denoted PTP-D 1, and the deduced amino acid sequence is shown in Figure 4.
  • This partial sequence includes the sequence of the PCR fragment no. 1 from above and thus confirms the identity of the isolated cDNA clone. Further, comparison with previously described PTPases indicates at least one additional unique feature of PTP-D 1 (the difference is underlined):
  • RNA Fifteen ⁇ g poly(A) + RNA were loaded in the lane probed for PTP-D1 expression, and 7.5 ⁇ g were loaded in the lane analyzed for PTP-D2 expression, the RNA was separated in an agarose-formaldehyde gel and blotted to nitrocellulose filters using standard techniques (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York (1988)). The filters were hybridized with 32 P-labeled cDNA fragments corresponding to the sequences shown for PTP-D 1 and PTP-D2. The 32 P-labeling was done with the Random Primers DNA Labeling System (Cat. no.
  • RNA is isolated from each of the following tissues and cell lines: skeletal muscle, liver, placenta, Hep G2 (American Type Culture Collection (ATCC) HB8065), RD (ATCC CCL 136) (Puissant et al., BioTechniques 8: 148-149 (1990)).
  • Poly(A) + RNA is isolated on an oligo (dT) column (Aviv et al., Proc. Natl. Acad. Sci. USA 69: 1408-1412 (1972)).
  • First strand cDNA synthesis is performed as described in Example 1.
  • cDNA preparations from the above-mentioned tissues and cell lines are individually subjected to the polymerase chain reaction using standard conditions (PCR Technology - Principles and Applications for DNA Amplification, Erlich, H.E., ed., Stockton Press, New York, (1989)).
  • the following primers are used for the amplifications:
  • Oligonucleotide no. 250 (corresponding to the amino acid sequence
  • Oligonucleotide no. 251 (corresponding to the amino acid sequence QERTVW [SEQ. ID NO. 17] of PTP-D1):
  • RNA Total RNA is isolated from the cell lines Hep G2 (American Type Culture Collection (ATCC) HB8065) and RD (ATCC CCL 136) (Puissant et al., Biotechniques 8:148-149 (1990)). Poly(A) + RNA is isolated on an oligo(dT) column (Aviv & Leder, Proc. Natl. Acad. Sci. USA 69: 1408-1412
  • the cDNA is subjected to the polymerase chain reaction using standard conditions (PCR Technology - Principles and Applications for DNA
  • the cloning sites of the pGEX2T vector (Pharmacia, Uppsala, Sweden) is changed using standard techniques (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York, 1988).
  • the pGEX2T vector is digested with the restriction enzymes BamHI and EcoRI and isolated. The following oligonucleotides are ligated into the digested pG ⁇ X2T vector.
  • the cD ⁇ A encoding PTP D1 (EXAMPLE 2) is digested with the restriction enzymes EcoRI and BglII. After digestion, a fragment of about 1600 bp is isolated and ligated into the pG ⁇ X-AK2 (digested with EcoRI and BamHI) using standard techniques (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York, 1988). The inserted fragment corresponds to the coding region of PTP D1 shown in Figure 4 of the present invention (i.e., it is coding for 272 amino acids) and about 800 bp of the 3' untranslated region.
  • the pG ⁇ X-AK2/PTP D1 vector construct which encodes a fusion protein of glutathione S-transferase and PTP D1 (Smith et al., Proc. Natl. Acad. Sci. USA 83:87-3-8707 (1988)), is introduced into the E. coli strains DH5 ⁇ (Cat. No. 8263SA, Bethesda Research Laboratories, Gaithersburg, MD) and SURETM (Cat. No. 200294, Stratagene, La Jolla, CA 92037).
  • IPTG Isopropyl-1-thio- ⁇ -D-galactopyranoside
  • the GST-PTP D1 fusion protein is isolated either as an insoluble product from inclusion bodies (using 3 washes in 50 mM N-2-Hydroxyethylpiperazine-N'-2-ethanesulphonic acid (HEPES) buffer pH 7.5 containing 1.0 percent (vol/vol) Triton X100) or as a soluble protein using glutathione-Sepharose 4B affinity chromatography (Cat. No. 17-0756-01, Pharmacia, Uppsala, Sweden) according to the manufacturer's instructions.
  • HEPES N-2-Hydroxyethylpiperazine-N'-2-ethanesulphonic acid
  • the serum is passed over a glutathione-Sepharose 4B column which has been saturated with glutathione S-transferase using the procedure described above ("Expression of GST-PTP D1 fusion protein in E. coli).
  • the pGEX-AK2 construct is used to produce the GST protein.
  • the serum is passed three times over the column to ensure complete removal of the anti-GST antibodies. The efficiency of the removal is assessed by Western blotting as described below ("Detection of the Presence and Measurement of the Quantity of PTP-Dl in a Cell Line").
  • the anti-PTP D1 antibody can be used to detect the expression of PTP D1 in mammalian cells. Immunofluorescence according to standard procedures will provide information abut expression in specific cell lines and tissues. Even more importantly, this antibody preparation can be used to determine the quantity in cell lines and tissues. As an example of the latter application of the anti-PTP D1 antibody, the detection of PTP D1 in the RD cell line (American Type Culture Collection CCL 136) is described below. It should be emphasized that this EXAMPLE should not in any way limit the use of the antibody which can be used for detection of PTP D1 in other cells and tissues as well. Likewise, the antibody preparation can be useful in purification of PTP D1 and for establishing other types of detection assays.
  • the RD (embryonal rhabdomyosarcoma; human) cell line is cultured in minimum essential medium (Eagle; Cat. No.
  • the cells are washed twice in phosphate buffered saline and the supernatant removed.
  • the cells from one 10 cm tissue culture plate are lysed in 800 ⁇ l of Triton X100 lysis buffer (20 mM HEPES pH 7.5, 50 mM NaCl, 10 percent glycerol, 1.0 percent Triton X100, 1.5 mM MgCl 2 , 4 mM Ethylene Glycol-bis( ⁇ -aminoethylethyl ether) N,N,N',N'-tetraacetate (EGTA; Sigma ED2SS), 10 ⁇ g/ml aprotinin, 1 mM phenyl methylsulfonyl fluoride (PMSF)), centrifuged and the supernatant is stored in aliquots at -80°C until use.
  • Triton X100 lysis buffer (20 mM HEPES pH 7.5, 50 mM NaCl, 10
  • SDS sample buffer (62.5 mM Tris-Cl pH 7.0, 3.0 percent (w/v) SDS, 10 percent (v/v) glycerol, 10 percent 2-mercaptoethanol, and 0.05 percent (w/v) bromophenol blue), boiled for 5 minutes, separated by SDS-polyacrylamide gel electrophoresis (7.5 percent) and blotted onto nitrocellulose using standard techniques (Burnette, W.N. (1981) Anlyt. Biochem. 112:195-201). A standard curve for quantitative determination of PTP D1 is produced by using defined amounts of the E.
  • coli-produced GST-PTP D1 fusion protein from above in parallel with the RD cell lysates.
  • the nitrocellulose filters are incubated for 30 minutes with 2 grams milk powder (Carnation, Non fat dry milk, Carnation, Los Angeles) per liter phosphate buffered saline (PBS) to block unspecific binding, washed once in PBS containing 0.02 percent (v/v) Tween 20 (Sigma P1379) (PBS-Tween) and 0.2 percent (w/v) gelatin (BioRad Cat. No.
  • PTP-D Protein or Glycoprotein Stimulates or Inhibits Enzymatic Activity of a PTP-D Protein or Glycoprotein
  • the cDNA containing the entire coding region of PTP D1 or a functional portion thereof is inserted into the mammalian expression vector pcDNA I (Cat.. No. V490-20, Invitrogen, San Diego) using standard techniques (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1988)).
  • the 293 cell transient expression system described by Gorman et al., Virology 171:377-385 (1989) is used for production of enzymatically active PTP D1.
  • the 293 cells are cultured in 5% CO 2 at 37°C in Dulbecco's Modified Eagle Medium (Cat. No. a041-02430, Gibco, Life Technologies Ltd., Paisley, Scotland) supplemented with 10 percent (v/v) fetal calf serum (Gibco).
  • Dulbecco's Modified Eagle Medium Cat. No. a041-02430, Gibco, Life Technologies Ltd., Paisley, Scotland
  • 10 percent (v/v) fetal calf serum Gibco.
  • the cells are incubated 24 hours at 37°C under 3 % CO 2 after the addition of the Ca-phosphate-DNA precipitate, then washed once in DMEM supplemented with 10 percent fetal calf serum and incubated in fresh medium for additional 24 hours at 37°C under 5 % CO 2 .
  • the medium is removed and the cells lysed in 1.0 ml of lysis buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 10 percent glycerol, 1.0 percent Triton X100, 1.5 mM MgCl 2 , 4 mM Ethylene Glycol-bis( ⁇ -aminoethyIethyl ether) N,N,N',N'-tetraacetate (EGTA; Sigma ED2SS), 10 ⁇ g/ml aprotinin, 1 mM PMSF).
  • the cell lysates are centrifuged at 2500xg for 2 minutes at 4°C. The supernatant is removed and 100 ⁇ l aliquots are quick-frozen in liquid nitrogen and stored at -70° C until use.
  • PTP-D 1 phosphatase activity Three different substrates are used for the evaluation of potential inhibitors or stimulators of PTP-D 1 phosphatase activity: 1) p-nitrophenyl phosphate (pNP-P; Sigma 104-0); 2) 32 P-labeled Raytide (Oncogene Science Inc., Manhasset, NY); 3) 32 P-labeIed bovine myelin basic protein (MBP). Substances which either decrease or increase the activity of PTP-D1 against one or more of these substrates are analyzed further.
  • pNP-P p-nitrophenyl phosphate
  • MBP 32 P-labeled Raytide
  • MBP bovine myelin basic protein
  • the activity of PTP-Dl towards pNP-P is measured essentially as described by N.K. Tonks et al., J. Biol. Chem. 263:6131-6131 (1988)). Using microtiter plates, ten ⁇ l of the 293 lysate from above are incubated with 100 ⁇ l of pNP-P (30 and 100 mM, respectively) at room temperature. The absorbance is read with one minute intervals in Dynatech MR5000 reader. The substances to be analyzed for stimulatory or inhibitory activities are added to the PTP-D1/293 cell lysate 5 minutes prior to the addition of pNP-P.
  • the activity of PTP-D1 towards 32 P-labeled RaytideTM is measured essentially as described by Krueger et al. (EMBO J. 9:3241-3252 (1990)).
  • the synthetic peptide Raytide is labeled with 32 P using the tyrosine kinase p60 c-arc according to the manufacturer's instructions (Oncogene Science) with minor modifications.
  • 2 ⁇ l of p60 c-arc are mixed with 20 ⁇ l Raytide (1 mg/ml) and 108 ⁇ l of kinase buffer (50 mM HEPES pH 7.5 containing 10 mM MgCl 2 , 0.2% (v/v) ⁇ -mercaptoethanol, 30 ⁇ M ATP and 50 ⁇ Ci [ ⁇ - 22 P]ATP).
  • the mixture is incubated at 37°C for 16 hours, and the reaction is stopped by addition of 500 ⁇ l of 20 percent (w/v) trichloroacetic acid (TCA) in 20 mM NaH 2 PO 4 and 100 ⁇ l of 5 mg/ml of acetylated bovine serum albumin.
  • TCA trichloroacetic acid
  • the mixture is centrifuged, the precipitate is washed three times in 20 percent TCA/20 mM NaH 2 PO 4 , and finally redissolved in 0.2 M Tris-Cl pH 8.0.
  • Myelin basic protein (Sigma) is labeled with a procedure similar to that used for labeling of Raytide as described by Guan et al., Nature 350:359-362 (1991). Thirty ⁇ g of MBP is labeled in a 60 ⁇ l reaction containing the following components: 50 mM HEPES buffer pH 7.5,- 10 mM MgCl 2 , 0.067% ⁇ -mercaptoethanol, 0.05 mM ATP including 150 ⁇ Ci [ ⁇ - 32 P]ATP and 4U p43 v-abl kinase (Oncogene Science).
  • the mixture is incubated for 60 minutes at 30°C, and the reaction is stopped by addition of ice-cold trichloroacetic acid to a final concentration of 20 percent. After 30 minutes on ice, the precipitate is washed three times in 20 percent TCA and redissolved in 100 ⁇ l H 2 O.
  • the substances to be analyzed for stimulatory or inhibitory activities are added to the PTP-D1/293 cell lysate 5 minutes prior to initiation of the assays.
  • MOLECULE TYPE DNA
  • SEQUENCE DESCRIPTION SEQ ID NO : 11 :
  • MOLECULE TYPE DNA (xi ) SEQUENCE DESCRI PTION : SEQ ID NO : 37 :

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

A novel subfamily (PTP-D) of protein tyrosine phosphatases is identified. Included in this family are PTP-D proteins or glycoproteins having one, two, or three identified amino acid changes in previously defined consensus sequences in the catalytic phosphatase domains of known protein tyrosine phosphatases. The PTP-D proteins or glycoproteins may be produced by recombinant means. Antibodies to PTP-D proteins or glycoproteins and nucleic acid constructs coding therefor, and methods for screening molecules which can bind to PTP-D proteins or glycoproteins and inhibit or stimulate their enzymatic activity, are provided.

Description

PTD-D SUBFAMILY OF PROTEIN TYROSINE PHOSPHATASES
BACKGROUND OF THE INVENTION
Field of the Invention
The invention pertains to the field of biochemistry and cell and molecular biology. The invention relates to PTP-D proteins or glycoproteins that are members of a novel subfamily (PTP-D) of protein tyrosine phosphatases (PTPases), nucleic acid constructs coding for PTP-D proteins or glycoproteins, recombinant expression vectors carrying the nucleic acid constructs, cells containing the recombinant expression vectors, methods for production and identification of PTP-D proteins and glycoproteins and DNA constructs coding therefor, antibodies specific for PTP-D proteins and glycoproteins, and methods for screening compounds capable of binding to and inhibiting or stimulating protein tyrosine phosphatase enzymatic activity of PTP-D proteins or glycoproteins.
Description of the Background Technology Phosphorylation of proteins is a fundamental mechanism for regulating diverse cellular processes. While the majority of protein phosphorylation occurs at serine and threonine residues, phosphorylation at tyrosine residues is attracting a great deal of interest since the discovery that many oncogene products and growth factor receptors possess intrinsic protein tyrosine kinase activity. The importance of protein tyrosine phosphorylation in growth factor signal transduction, cell cycle progression and neoplastic transformation is now well established (Hunter et al., Ann. Rev. Biochem. 54:987-930 (1985), Ullrich et al., Cell 61 :203-212 (1990), Nurse, Nature 344:503-508 (1990), Cantley et al., Cell 64:281-302 (1991)).
Biochemical studies have shown that phosphorylation on tyrosine residues of a variety of cellular proteins is a dynamic process involving competing phosphorylation and dephosphorylation reactions. The regulation of protein tyrosine phosphorylation is mediated by the reciprocal actions of protein tyrosine kinases (PTKases) and protein tyrosine phosphatases (PTPases). The tyrosine phosphorylation reactions are catalyzed by PTKases. Tyrosine phosphorylated proteins can be specifically dephosphorylated through the action of PTPases. The level of protein tyrosine phosphorylation of intracellular substances is determined by the balance of PTKase and PTPase activities. (Hunter, T., Cell 58: 1013-1016 (1989)).
PTKases
The protein tyrosine kinases (PTKases) are a large family of proteins that includes many growth factor receptors and potential oncogenes. (Hanks et al., Science 241:42-52 (1988)). Many PTKases have been linked to initial signals required for induction of the cell cycle (Weaver et al., Mol. and Cell. Biol. 11 (9): 4415-4422 (1991)). PTKases comprise a discrete family of enzymes having common ancestry with, but major differences from, serine/threonine-specific protein kinases (Hanks et al., supra). The mechanisms leading to changes in activity of PTKases are best understood in the case of receptor-type PTKases having a transmembrane topology (Ullrich et al. (1990) supra). The binding of specific ligands to the extracellular domain of members of receptor-type PTKases is thought to induce their oligomerization leading to an increase in tyrosine kinase activity and activation of the signal transduction pathways (Ullrich et al., (1990) supra). Deregulation of kinase activity through mutation or overexpression is a well-established mechanism for cell transformation (Hunter et al., (1985) supra; Ullrich et al., (1990) supra). PTPases
The protein phosphatases are composed of at least two separate and distinct families (Hunter, T.(1989) supra) the protein serine/threonine phosphatases and the protein tyrosine phosphatases (PTPases).
The protein tyrosine phosphatases (PTPases) are a family of proteins that have been classified into two subgroups. The first subgroup is made up of the low molecular weight, intracellular enzymes that contain a single conserved catalytic phosphatase domain. All known intracellular type PTPases contain a single conserved catalytic phosphatase domain. Examples of the first group of PTPases include (1) placental PTPase 1B (Charbonneau et al., Proc. Natl. Acad. Sci. USA 86:5252-5256 (1989); Chernoff et al., Proc. Natl. Acad. Sci. USA 87:2735-2789 (1989)), (2) T-cell PTPase (Cool et al. Proc. Natl. Acad. Sci. USA 86:5257-5261 (1989)), (3) rat brain PTPase (Guan et al., Proc. Natl. Acad. Sci. USA 87:1501-1502 (1990)), (4) neuronal phosphatase (STEP) (Lombroso et al.,Proc. Natl. Acad. Sci. USA 88:7242-7246 (1991)), and (5) cytoplasmic phosphatases that contain a region of homology to cytoskeletal proteins (Gnet al., Proc. Natl. Acad. Sci. USA 88:5867-57871 (1991); Yang et al., Proc. Natl. Acad. Sci. USA 88:5949-5953 (1991)).
The second subgroup is made up of the high molecular weight, receptor-linked PTPases, termed R-PTPases. R-PTPases consist of a) an intracellular catalytic region, b) a single transmembrane segment, and c) a putative ligand-binding extracellular domain (Gebbink et al., supra).
The structures and sizes of the c) putative ligand-binding extracellular "receptor" domains of R-PTPases are quite divergent. In contrast, the a) intracellular catalytic regions of R-PTPases are highly homologous. All R-PTPases have two tandemly duplicated catalytic phosphatase homology domains, with the prominent exception of an R-PTPase termed HPTPβ, which has only one catalytic phosphatase domain. (Tsai et al., Journal of Biol. Chem. 266(16): 10534-10543 (1991)). One example of R-PTPases are the leukocyte common antigens (LCA) (Ralph, S.J., EMBO J. 6: 1251-1257 (1987)). LCA is a family of high molecular weight glycoproteins expressed on the surface of all leukocytes and their hemopoietic progenitors (Thomas, Ann. Rev. Immunol. 7:339-369 (1989)). A remarkable degree of similarity is detected with the sequence of LCA from several species (Charbonneau et al., Proc. Natl. Acad. Sci. USA 85:7182-7186 (1988)). LCA is referred to in the literature by different names, including T200 (Trowbridge et al., Eur. J. Immunol. 6:557-562 (1962)), B220 for the B cell form (Coffman et al., Nature 289:681-683 (1981)), the mouse allotypic marker Ly-5 (Komuro et al., Immunogenetics 1:452-456 (1975)), and more recently CD45 (Cobbold et al., Leucocyte Typing III, ed. A.J. McMichael et al., pp. 788-803 (1987)).
Several studies suggest that CD45 plays a critical role in T cell activation. These studies are reviewed in Weiss A., Ann. Rev. Genet. 25:487-510 (1991). In one study, T-cell clones that were mutagenized by NSG and selected for their failure to express CD45 had impaired responses to T-cell receptor stimuli (Weaver et al., (1991) supra). These T-cell clones were functionally defective in their responses to signals transmitted through the T cell antigen receptor, including cytolysis of appropriate targets, proliferation, and tymphokine production (Weaver et al. , (1991) supra).
Other studies indicate that the PTPase activity of CD45 plays a role in the activation of pp56lck, a lymphocyte-specific PTKase (Mustelin et al., Proc. Natl. Acad. Sci. USA 56:6302-6306 (1989); Ostergaard et al., Proc. Natl. Acad. Sci. USA 86:8959-8963 (1989)). These authors hypothesized that the phosphatase activity of CD45 activates pp56Ick by dephosphorylation of a C-terminal tyrosine residue, which may, in turn, be related to T-cell activation.
Another example of R-PTPases is the leukocyte common antigen related molecule (LAR) (Streuli et al., J. Exp. Med. 168: 1523-1530 (1988)).
LAR was initially identified as a homologue of LCA (Streuli et al., supra). Although the a) intracellular catalytic region of the LAR molecule contains two catalytic phosphatase homology domains (domain I and domain II), mutational analyses suggest that only domain I has catalytic phosphatase activity, whereas domain II is enzymatically inactive (Streuli et al., EMBO J. 9(5J:2399-2407 (1990)). Chemically induced LAR mutants having tyrosine at amino acid position 1379 changed to a phenylalanine are temperature-sensitive (Tsai et al., J. Biol. Chem. 266(16): 10534-10543 (1991)).
A new mouse R-PTP, designated mRPTPμ, has been cloned which has a) an extracellular domain that shares some structural motifs with LAR. (Gebbink et al., (1991) supra). In addition, these authors have cloned the human homologue of RPTPμ and localized the gene on human chromosome 18.
Two Drosophila PTPases, termed DLAR and DPTP, have been predicted based on the sequences of cDNA clones (Streuli et al., Proc. Natl. Acad. Sci. USA 86:8698-8702 (1989)). cDNAs coding for another Drosophila R-PTPase, termed DPTP 99A, have been cloned and characterized (Hariharan et al., Proc. Natl. Acad. Sci. USA 88: 11266-11270 (1991)).
Other examples of R-PTPases include R-PTPase-α, β, y, and ζ (Krueger et al., EMBO J. 9:3241-3252 (1990), Sap et al. Proc. Natl. Acad. Sci. USA 87::6112-6116 (1990), Kaplan et al., Proc. Natl. Acad. Sci. USA 87:7000-7004 (1990), Jirik et al., FEBS Lett. 273:239-242 (1990), Mathews et al., Proc. Natl. Acad. Sci. USA 87:4444-4448 (1990), Ohagi et al., Nucl. Acids Res. 18:7159 (1990)). Published application WO92/01050 discloses human R-PTPase-α, β and γ, and reports on the nature of the structural homologies found among the conserved domains of these three R-PTPases and other members of this protein family. The murine R-PTPase-α has 794 amino acids, whereas the human R-PTPase-α has 802 amino acids. R-PTPase-α has an intracellular domain homologous to the catalytic domains of other tyrosine phosphatases. The 142 amino acid extracellular domain (including signal peptide of R-PTPase-α) has a high serine and threonine content (32%) and 8 potential N-glycosylation sites. cDNA clones have been produced that code for the R-PTPase-α, and R-PTPase-α has been expressed from eukaryotic hosts. Northern analysis has been used to identify the natural expression of R-PTPase-α in various cells and tissues. A polyclonal antibody to R-PTPase-α has been produced by immunization with a synthetic peptide of R-PTPase-α, which identifies a 130 kDa protein in cells transfected with a cDNA clone encoding a portion of R-PTPase-α.
Another example of R-PTPases is HePTP. (Jirik et al., FASEB J.
4:82082 (1990) Abstract 2253). Jirik et al. screened a cDNA library derived from a hepatoblastoma cell line, HepG2, with a probe encoding the two PTPase domains of LCA, and discovered a cDNA clone encoding a new R-PTPase, named HePTP. The HePTP gene appeared to be expressed in a variety of human and murine cell lines and tissues.
Since the initial purification, sequencing, and cloning of a PTPase, additional potential PTPases have been identified at a rapid pace. The number of different PTPases that have been identified is increasing steadily, leading to speculations that this family may be as large as the PTKase family (Hunter (1989) supra).
Conserved amino acid sequences in the catalytic domains of known PTPases have been identified and defined (Krueger et al., EMBO J. 9:3241-3252 (1990) and Yi et al., Mol. Cell. Biol. 12:836-846 (1992), which are incorporated herein by reference.) These amino acid sequences are designated "consensus sequences" herein.
Yi et al. aligned the catalytic phosphatase domain sequences of the following PTPases: LCA, PTP1B, TCPTP, LAR, DLAR, and HPTPα, HPTPβ, and HPTPγ. This alignment includes the following "consensus sequences" (Yi et al., supra, Figure 2(A), lines 1 and 2):
1. D Y I N A S/N [SEQ. ID NO: 1]
2. C X X Y W P [SEQ. ID NO. 2]
3. I/V V M X X X X E [SEQ. ID NO. 3]
Krueger et al., aligned the catalytic phosphatase domain sequences of PTP1B, TCPTP, LAR, LCA, HPTPα, β, 8,∈ and ζ, and DLAR and DPTP. This alignment includes the following "consensus sequences: (Krueger et al., supra, Figure 7, lines 1 and 2):
1. D/N Y I N A S/N [SEQ. ID NO. 4]
2. C X X Y W P [SEQ. ID NO. 2]
3. I/V V M X X X X E [SEQ. ID NO. 3]
It is becoming clear that dephosphorylation of tyrosine residues can by itself function as an important regulatory mechanism. Dephosphorylation of a C-terminal tyrosine residue has been shown to activate tyrosine kinase activity in the case of the src family of tyrosine kinases (Hunter, T. Cell 49: 1-4 (1987)). Tyrosine dephosphorylation has been suggested to be an obligatory step in the mitotic activation of the maturation-promoting factor (MPF) kinase (Morla et al., Cell 58:193-203 (1989)). These observations point out the need in the an for understanding the mechanisms that regulate tyrosine phosphatase activity.
It is clear that further analysis of structure-function relationships among
PTPases are needed to gain important understanding of the mechanisms of signal transduction, cell cycle progression and cell growth, and neoplastic transformation.
DEFINITIONS Table I gives the single-letter abbreviations for amino acids that are in common use among protein chemists and are used herein. Amino Acid Name Symbol
Glycine G
Alanine A
Valine V
Leucine L
Isoleucine I
Serine S
Threonine T
Cysteine C
Methionine M
Aspartic Acid D
Asparagine N
Glutamic Acid E
Glutamine Q
Arginine R
Lysine K
Histidine H
Phenylalanine F
Tyrosine Y
Tryptophan W
Proline P
Serine or Asparagine S/N
Aspartic Acid or Asparagine D/N
Isoleucine or Valine I/V
(Amino Acid Not Specified) X
SUMMARY OF THE INVENTION
The inventors describe herein the identification of a novel subfamily (PTP-D) of protein tyrosine phosphatases. The novel subfamily, hereinafter "PTP-D subfamily, " differs significantly in structure from previously reported PTPases. The present invention thus provides a PTP-D protein or glycoprotein which is a PTPase from the PTP-D subfamily. Preferably, a PTP-D protein or glycoprotein comprises a PTPase from the PTP-D subfamily of PTPases having catalytic phosphatase domains in which amino acid sequences are selected from:
1. G Y I N A S/N [SEQ ID NO. 5]
2. S X X Y W P [SEQ. ID NO. 6]
3. I A M V X X X X E [SEQ. ID NO. 7]
The amino acid sequences selected from
1. G Y I N A S/N [SEQ. ID NO. 5]
2. S X X Y W P [SEQ. ID NO. 6]
3. I A M V X X X X E [SEQ. ID NO. 7]
have the following amino acid differences in comparison with the previously defined amino acid consensus sequences in the catalytic phosphatase domains of PTPases (differences are underlined):
1. PTP-D: G Y I N A S/N [SEQ. ID NO. 5] Consensus D Y I N A S/N [SEQ. ID NO. 1]
N Y I N A S/N [SEQ. ID NO. 8]
2. PTP-D 1/D2 S X X Y W P [SEQ. ID NO. 6] Consensus C X X Y W P [SEQ. ID NO. 2]
3. PTP-D 1/D2 I A M V X X X X E [SEQ. ID NO. 7] Consensus (I/V/L) V (M/I/L) (V/L/I/M) X X X X E
[SEQ. ID NO. 9]
When a PTP-D protein or glycoprotein of the invention is one which occurs in nature, it is substantially free of other proteins or glycoproteins with which it is natively associated. A substantially pure PTP-D protein or glycoprotein of the invention may be produced by biochemical purification of the glycoprotein. Alternatively, a PTP-D protein or glycoprotein of the invention may be prepared by chemical means or by recombinant means in the prokaryotic or eukaryotic hosts, and is provided substantially free of other proteins with which it is natively associated and/or has modified amino acids.
The invention is further directed to a fragment of a PTP-D protein or glycoprotein, to a PTP-D protein or glycoprotein having additional amino acids, and to a PTP-D protein or glycoprotein having substituted amino acids, and to a PTP-D protein or glycoprotein having any combination of deleted, additional, or substituted amino acids, such that the PTP-D protein or glycoprotein possesses the desired biological activity.
The invention is further directed to a nucleic acid construct comprising a nucleotide sequence encoding a PTP-D protein or glycoprotein according to the invention in the form of cDN A or genomic DNA. The invention is further directed to a nucleic acid construct in the form of an expression vehicle, as well as prokaryotic and eukaryotic host cells containing the expression vehicle.
Also included in the present invention is a process for preparing a PTP-D protein or glycoprotein of this invention, comprising:
(a) culturing a host capable of expressing a PTP-D protein or glycoprotein under culturing conditions,
(b) expressing the PTP-D protein or glycoprotein; and
(c) recovering the PTP-D protein or glycoprotein from the culture. The invention is also directed to an antibody, polyclonal antibody, monoclonal antibody, or chimeric antibody, specific for a PTP-D protein or glycoprotein or for an epitope of a PTP-D protein or glycoprotein.
The invention is further directed to a method for detecting the presence, or measuring the quantity, of a PTP-D protein or glycoprotein in cell or in a subject comprising:
(a) contacting said cell or an extract thereof with an antibody specific for an epitope of a PTP-D protein or glycoprotein; and
(b) detecting the binding of the antibody to the cell or extract thereof, or measuring the quantity of antibody bound, thereby detecting the presence or measuring the quantity of the PTP-D protein or glycoprotein. The invention is also directed to a method for detecting the presence of a nucleic acid construct encoding a normal or mutant PTP-D protein or glycoprotein in a cell or a subject comprising:
(a) contacting a cell or an extract thereof from the subject with an oligonucleotide probe encoding at least a portion of a normal or mutant PTP-D protein or glycoprotein under hybridizing conditions; and
(b) measuring the hybridization of the probe to nucleic acid of the cell,
thereby detecting the presence of the nucleic acid construct.
The nucleic acid of the cell can be selectively amplified, using the polymerase chain reaction, prior to assay.
The present invention is also directed to a method for identifying and isolating in a chemical or biological preparation a compound capable of binding to a PTP-D protein or glycoprotein, said method comprising:
(a) attaching a PTP-D protein or glycoprotein or the compound- binding portion thereof to a solid phase matrix;
(b) contacting the chemical or biological preparation with the solid phase matrix allowing the compound to bind, and washing away any unbound material;
(c) detecting the presence of the compound bound to the solid phase; and, for purposes of isolation,
(d) eluting the bound compound,
thereby isolating the compound.
Finally, the invention includes a method for identifying a molecule capable of stimulating or inhibiting the enzymatic activity of a PTP-D protein or glycoprotein, comprising:
(a) contacting the compound with a PTP-D protein or glycoprotein in pure form, in a membrane preparation, or in a whole live or fixed cell;
(b) incubating the mixture in step (a) for a sufficient interval; (c) measuring the enzymatic activity of the PTP-D protein or glycoprotein;
(d) comparing the enzymatic activity to that of the PTP-D protein or glycoprotein incubated without the compound, thereby determining whether the molecule stimulates or inhibits the activity. A fragment of a PTP-D protein or glycoprotein may be used in this method for identifying a molecule capable of stimulating or inhibiting the activity.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 presents the partial cDNA sequence and the deduced amino acid sequence of PTP-D 1, which is a PCR fragment.
Figure 2 presents the partial cDNA sequence and the deduced amino acid sequence of PTP-D2, which is a PCR fragment.
Figure 3A shows a comparison of the deduced amino acid sequences of PTP-D 1 and PTP-D2 with the amino acid sequence of PTPase IB. The CLUSTAL program is used (Higgins, C, Fuch, R. and Bleasby, D., Multiple Sequence Alignment; CABIOS (1991) (in press)).
Figure 3B shows a comparison of the nucleotides between PTP-D 1 and PTP-D2.
Figure 3C shows a comparison of the amino acids between PTP-D 1 and PTP-D2.
Figure 4 shows the partial cDNA sequence and the deduced amino acid sequence of PTP-D 1. This partial cDNA sequence includes the cDNA sequence of the PCR fragment shown in Figure 1.
DETAILED DESCRIPTION OF THE INVENTION The inventors have identified a new subfamily ('PTP-D subfamily') of protein tyrosine phosphatases (PTPases) which structurally differs significantly from previously reported PTPases. Members of this PTP-D subfamily are characterized by having one, two, or three of the following amino acid differences in comparison with the previously defined amino acid consensus sequences in the catalytic phosphatase domains of PTPases (differences are underlined): 1. PTP-D: G Y I N A S/N [SEQ. ID NO. 5] Consensus D Y I N A S/N [SEQ. ID NO. 1]
N Y I N A S/N [SEQ. ID NO. 8]
2. PTP-D 1/D2 S X X Y W P [SEQ. ID NO. 6]
Consensus C X X Y W P [SEQ. ID NO. 2] 3. PTP-D1/D2 I A M V X X X X E
[SEQ. ID NO. 7]
Consensus (I/V/L) V (M/I/L) (V/L/I/M) X X X X E
[SEQ. ID NO. 9]
The term "subfamily" is used to indicate a group of PTPases which are structurally related at specific amino acid residues as specified above.
By previously defined amino acid consensus sequences is meant the conserved amino acid sequences in the catalytic phosphatase domains of known
PTPases described in Krueger et al., EMBO J. 9:3241-3252 (1990) and Yi et al., Mol. Cell. Biol. 12:836-846 (1992), which are incorporated herein by reference.
Accordingly, the present invention relates to a PTP-D protein or glycoprotein comprising a PTPase from the PTP-D subfamily of PTPases having a catalytic phosphatase domain having one, two, or three amino acid sequences selected from:
1. G Y I N A S/N [SEQ. ID NO. 5]
2. S X X Y W P [SEQ. ID NO. 6]
3. I A M V X X X X E [SEQ. ID NO. 7] At present it is not known whether the PTP-D proteins and glycoproteins of the new PTP-D subfamily of PTPases are receptor-linked PTPases or intracellular PTPases.
In one aspect, the invention is directed to a naturally occurring mammalian PTP-D protein or glycoprotein. In another aspect, the invention is directed to a recombinant mammalian PTP-D protein or glycoprotein. In another aspect, the invention is directed to a chemically synthesized mammalian PTP-D protein or glycoprotein. The preferred PTP-D protein or glycoproteins of the present invention are of human origin.
The invention provides a naturally occurring PTP-D protein or glycoprotein substantially free of other proteins or glycoproteins with which it is natively associated. "Substantially free of other proteins or glycoproteins" indicates that the PTP-D protein or glycoprotein has been purified away from at least 90 per cent (on a weight basis), and from even at least 99 per cent if desired, of other proteins and glycoproteins with which it is natively associated, and is therefore substantially free of them. That can be achieved by subjecting the cells, tissue or fluids containing the PTP-D protein or glycoprotein to standard protein purification techniques such as immunoadsorbent columns bearing monoclonal antibodies reactive against the protein. Other forms of affinity purification can utilize solid-phase substrates which can bind the catalytic phosphatase domain, or a ligand that will bind to the receptor domain that may be present in a PTP-D protein or glycoprotein. Alternatively, the purification can be achieved by a combination of standard methods, such as ammonium sulfate precipitation, molecular sieve chromatography, and ion exchange chromatography.
It will be understood that a mammalian PTP-D protein or glycoprotein of the present invention can be biochemically purified from a variety of cell or tissue sources. For preparation of a naturally occurring PTP-D protein or glycoprotein, tissues such as skeletal muscle, especially of human origin, are preferred. Cell lines, such as rhabdemyosarcoma cell lines (RD) may be used. Alternatively, because the gene for a PTP-D protein or glycoprotein can be isolated or synthesized, a PTP-D protein can be synthesized substantially free of other proteins or glycoproteins of mammalian origin in a prokaryotic organism or in a non-mammalian eukaryotic organism, if desired. As intended by the present invention, a recombinant PTP-D protein or glycoprotein produced in mammalian cells, such as transfected COS, NIH-3T3, or CHO cells, for example, is either a naturally occurring protein sequence or is a modified protein sequence wherein there are amino acid deletions and/or insertions and/or substitutions. Where a naturally occurring PTP-D protein or glycoprotein is produced by recombinant means, it is provided substantially free of the other proteins and glycoproteins with which it is natively associated.
Alternatively, methods are well known for the synthesis of polypeptides of desired sequence on solid phase supports and their subsequent separation from the support.
In a further aspect, the invention provides a fragment of a PTP-D protein or glycoprotein. The term "fragment" is used to indicate a polypeptide which is derived from a PTP-D protein or glycoprotein having a naturally occurring protein sequence by appropriately modifying the DNA sequence encoding the PTP-D protein or glycoprotein, resulting in deletion of one or more amino acids at one or more sites of the C-terminal, N-terminal, and within the native sequence. Fragments of a PTP-D protein or glycoprotein are useful for screening for compounds that are antagonists or agonists (as defined below). It is understood that such fragments of a PTP-D protein or glycoprotein may retain characterizing portion(s) of the native PTP-D or glycoprotein. In particular, such fragments of PTP-D proteins or glycoproteins should retain one or more biological activities or functions which are characteristic for the intact PTP-D proteins or glycoproteins. Examples, which are not intended to be in any way limiting to the scope of the invention claimed, of PTP-D fragments are: a) the catalytic domain; b) regions of the PTP-D proteins or glycoproteins which interact with other molecules in the intact cell; c) regulatory parts of PTP-D.
In a further aspect, the invention provides a PTP-D protein or glycoprotein having additional amino acids that is derived from a naturally occurring PTP-D protein or glycoprotein by appropriately modifying the DNA sequence encoding the PTP-D protein or glycoprotein, resulting in addition of one or more amino acids at one or more sites of the C-terminal, N-terminal, and within the native sequence. It is understood that such PTP-D protein or glycoprotein having additional amino acids may retain characterizing portion(s) of the native PTP-D protein or glycoprotein. In particular, such PTP-D proteins or glycoproteins with additional amino acids should retain one or more biological activities or functions which are characteristic for the intact PTP-D proteins or glycoproteins. Examples of such characteristics, of which at least one should be retained: a) the catalytic activity; b) the substrate specificity; c) interaction with other molecules in the intact cell; d) regulatory functions of PTP-D. These examples are not intended to be in any way limiting to the scope of the invention claimed.
In a further aspect, the invention provides a PTP-D protein or glycoprotein having substituted amino acids that is derived from a naturally occurring PTP-D protein or glycoprotein by appropriately modifying or mutating the DNA sequence encoding the PTP-D protein or glycoprotein, resulting in substitution of one or more amino acids at one or more sites of the C-terminal, N-terminal, and within the native amino acid sequence. It is understood that such PTP-D protein or glycoprotein having substituted amino acids may retain characterizing portion(s) of the PTP-D protein or glycoprotein.. In particular, such PTP-D proteins or glycoproteins having substituted amino acids should retain one or more biological activities or functions which are characteristic for the intact PTP-D proteins or glycoproteins. Examples of such characteristics, of which at least one should be retained: a) the catalytic activity; b) the substrate specificity; c) interaction with other molecules in the intact cell; d) regulatory functions of PTP-D. These examples are not intended to be in any way limiting to the scope of the invention claimed.
Any combination of deletion, insertion, and substitution may also be made to arrive at the final construct of a PTP-D protein or glycoprotein, provided that the final construct possesses the desired activity or function present in the intact PTP-D proteins or glycoproteins. Examples of such activities and functions are: a) the catalytic activity; b) substrate specificity; c) interaction with. other molecules in vitro and in vivo; d) regulatory functions. Only one of such activities or functions needs to be retained after any combination of deletion, insertion, and substitution. These examples are not intended to be in any way limiting to the scope of the invention claimed. Obviously, the modifications or mutations that will be made in the DNA encoding the PTP-D protein or glycoprotein must not alter the reading frame and preferably will not create complementary regions that could produce secondary mRNA structure (see European Patent Publication No. EP 75,444).
At the genetic level, these PTP-D proteins or glycoproteins having deletions from, and/or insertions to, and/or substitutions of amino acids, ordinarily are prepared by site-directed mutagenesis (as exemplified by
Adelman et al., DNA 2: 183 (1983)) of nucleotides in the DNA encoding the peptide molecule, thereby producing DNA encoding the PTP-D protein or glycoprotein, and thereafter expressing the DNA in recombinant cell culture (see below). The PTP-D protein or glycoproteins having amino acid deletions and/or insertions and/or additions typically exhibit the same qualitative biological activity as a native PTP-D protein or glycoprotein.
Alternatively, a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions may be conveniently prepared by direct chemical synthesis, using methods well-known in the art.
In a further aspect, the invention provides so-called chimeric molecules which are made up of other PTPases in which one or more specific amino acid sequences are replaced with homologous sequence(s) from a PTP-D protein or glycoprotein. Chimeric molecules include, for example, a PTP-D protein or glycoprotein having a ligand-binding extracellular domain from another PTPase that is grafted onto a portion of the PTP-D protein or glycoprotein. Other chimeric molecules: a) other PTPases in which the catalytic phosphatase domain has been replaced with the phosphatase domain from a PTP-D protein. In this case, the preferred number of amino acids is between 220 and 260. b) A PTP-D protein or glycoprotein in which part or parts of the catalytic domain has been replaced with homologous part(s) from other PTPases. c) chimeric molecules consisting of one member of the PTP-D subfamily in which a part or parts have been replaced with homologous parts. from one (or more) other member(s) from the PTP-D subfamily.
"Homologous sequences" are defined as sequences in two or more PTPases which are similarly positioned in the primary sequence and which may exhibit sequence homology. It should be emphasized that "homologous sequences" should not be limited to cases with high degree of homology. Chimeric molecules are important tools for elucidating structure-function relationships and for identifying specific compounds (drugs). Therefore, the most useful chimeras are often, but not always, molecules in which a certain portion of one molecule has been replaced with the similarly positioned, but divergent, sequence from another, otherwise homologous, molecule. Thus, the exchanged portions will quite often represent the parts of the molecules where they differ the most.
A PTP-D protein or glycoprotein may contain additional chemical moieties not normally a part of the PTP-D protein or glycoprotein. Covalent modifications are included within the scope of this invention. Such modifications may be introduced into the PTP-D protein or glycoprotein by reacting targeted amino acid residues of the PTP-D protein or glycoprotein with an organic derivatizing agent that is capable of reacting with selected side chains or terminal residues.
Cysteinyl residues most commonly are reacted with alpha-haloacetates (and corresponding amines), such as chloroacetic acid or chloroacetamide, to give carboxylmethyl or carboxyamidomethyl derivatives. Cysteinyl residues also are derivatized by reaction with bromotrifluoroacetone, alpha-bromo-beta-(5-imidozoyl) propionic acid, chloroacetyl phosphate, N-alkylmaleimides, 3-nitro-2-pyridyl disulfide, methyl 2-pyridyl disulfide, p-chloromercuribenzoate, 2-chloromercuri-4-nitrophenol, or chloro-7-nitrobenzo-2-oxa-1,3-diazole.
Histidyl residues are derivatized by reaction with diethylprocarbonate at pH 5.5-7.0 because this agent is relatively specific for the histidyl side chain. Para-bromophenacyl bromide also is useful; the reaction is preferably performed in 0.1 M sodium cacodylate at pH 6.0.
Lysinyl and amino terminal residues are reacted with succinic or other carboxylic acid anhydrides. Derivadzation with these agents has the effect or reversing the charge of the lysinyl residues. Other suitable reagents for derivatizing alpha-amino-containing residues include imidoesters such as methyl picolinimidate; pyridoxal phosphate; pyridoxal; chloroborohydride; trinϊtrobenzenesulfonic acid; O-methylisourea; .2,4 pentanedione; and transaminase-catalyzed reaction with glyoxylate.
Arginyl residues are modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butanedione, 1,2-cyclohexanedione, and ninhydrin. Derivatizadon of arginine residues requires that the reaction be performed in alkaline conditions because of the high pK. of the guanidine functional group. Furthermore, these reagents may react with the groups of lysine as well as the arginine epsilon-amino group.
The specific modification of tyrosyl residues per se has been studied extensively, with particular interest in introducing spectral labels into tyrosyl residues by reaction with aromatic dizonium compounds or tetranitromethane. Most commonly, N-acetylimidizol and tetranitromethane are used to form O-acetyl tyrosyle specie and 3-nitro derivatives, respectively.
Carboxyl side groups (aspartyl or glutamyl) are selectively modified by reaction carbodiimide (R'-N-C-N-R') such as 1-cyclohexyl-3-(2-morpholinyl-(4-ethyl) carbodiimide or 1-ethyl-3-(4-azonia-4,4-dimethylpentyl) carbodiimide. Furthermore, aspartyl and glutamyl residue are converted to asparaginyl and glutaminyl residues by reaction with ammonium ions. Glutaminyl and asparaginyl residues are frequently deamidated to the corresponding glutamyl and aspartyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Either form of these residues falls within the scope of this invention.
Derivatization with bifunctional agents is useful for cross-linking the peptide to a water-insoluble support matrix or to other macromolecular carriers. Commonly used cross-linking agents include, e.g., 1,1-bis(diazoacetyl)-2-phenylethane,glutaraIdehyde,N-hydroxysuccinimideesters, for example, esters with 4-azidosalicycIic acid, homobifunctional imidoesters, including dissuccinimidyl esters such as 3,3'-dithiobis(succinimidyl-propionate), and bifunctional maleimides such as bis-N-maleimido-1,8-octane. Derivatizing agents such as methyl-3-[p-azidophenyl)dithio]propioimidate yield photoactivatable intermediates that are capable of forming crosslinks in the presence of light. Alternatively, reactive water-insoluble matrices such as cyanogen bromide-activated carbo hydrates and the reactive substrates described in U.S. Patent Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.
Other modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains {Creighton, T.E., Proteins: Structure and Molecule Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)), acetylation of the N-terminal amine, and, in some instances, amidation of the C-terminal carboxyl groups.
Such derivatized moieties may improve the solubility, absorption, biological half life, and the like. The moieties may alternatively eliminate or attenuate any undesirable side effect of the protein and the like. Moieties capable of mediating such effects are disclosed, for example, in Remington 's Pharmaceutical Sciences, 16th ed., Mack Publishing Co., Easton, PA (1980).
In a further aspect, the present invention relates to a PTP-D protein or glycoprotein as defined above having domains which show 70% or more identity to the amino acid sequences of PTP-D 1 or PTP-D2, as provided in Figures 1 and 2, respectively. PTP-D1 and PTP-D2 are PTP-D proteins that are members of the PTP-D subfamily that are expressed in human skeletal muscle.
In another aspect, the present invention relates to a PTP-D protein or glycoprotein comprising PTP-D 1 or PTP-D2.
Members of the PTP-D subfamily, PTP-D1 and PTP-D2, have been shown to be expressed in human skeletal muscle. Thus, the present invention relates to but is not in any way limited to such members of the PTP-D 1 and PTP-D2 PTP-D subfamily expressed in this tissue.
In another aspect, the present invention relates to a nucleic acid construct which comprises a nucleotide sequence encoding a PTP-D protein or glycoprotein, or encoding a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions. The invention is further directed to the nucleic acid sequence in the form of an expression vector such as a recombinant expression vector, as well as prokaryotic and eukaryotic host cells containing the expression vector.
In additional aspects of the present invention, methods for expressing a nucleic acid construct encoding a PTP-D protein or glycoprotein are provided. PTP-D protein or glycoproteins may be produced by culturing cells in a suitable nutrient medium under conditions which are conducive to the expression of such PTP-D protein or glycoproteins. One of ordinary skill in the art will know how to identify and clone additional PTP-D protein or glycoproteins, of human or other mammalian species, which have sequence homology to me PTP-D protein or glycoproteins described herein, using the nucleic acid construct and oligonucleotides of the present invention without undue experimentation. Furthermore, manipulation of the nucleic acid of the present invention allow the grafting of a particular ligand-binding extracellular domain from a particular PTPase onto portions of a PTP-D protein or glycoprotein resulting in chimeric PTP-D proteins or glycoproteins. Non-limiting examples of such chimeric molecules- include the PTP-D protein or glycoprotein having a ligand-binding extracellular domain that is an epidermal growth factor receptor, a fibroblast growth factor receptor, and the like. Genetically engineered chimeric receptors are known in the art (see, for example, Riedel et al., Nature 324:628-670 (1986)).
Nucleic acid constructs encoding a PTP-D protein or glycoprotein, and encoding a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions, and encoding chimeric PTP-D proteins or glycoproteins such as those described above, can be used in gene therapy. An abnormal or dysfunctional PTP-D protein or glycoprotein which results in disease, may be replaced by infusion of cells of the desired lineage (such as hemopoietic cells, for example) transfected with a normal PTP-D protein or glycoprotein. Alternatively, or additionally, cells carrying a chimeric PTP-D protein or glycoprotein having a receptor to a ligand of choice (e.g. EGF) can be used for such gene therapy.
The nucleic acid constructs that are recombinant DNA molecules of the present invention can be produced through any of a variety of means, such as, for example, DNA or RNA synthesis, or more preferably, by recombinant DNA techniques. Techniques for synthesizing such molecules are disclosed by, for example, Wu et al (Prog. Nucl. Acid. Res. Molec. Biol. 21: 101-141 (1978)). Procedures for constructing recombinant molecules in accordance with the above-described method are disclosed by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989).
The 3' terminus of the recombinant DNA molecule of this invention is preferably treated to render it unsuitable for polymerization. Such treatment may be accomplished by blocking the terminus by chemical means, or by modifying the terminal bases such that they sterically interfere with polymerase action. In a preferred embodiment, such treatment is accomplished by immobilizing the 3' terminus, such as by coupling it to a solid support (such as, for example, glass, plastic, latex, etc.). The support may be of any form, (for example, a sheet, rod, sphere, ovoid, etc. Procedures for such immobilization are well known to these of ordinary skill. In the most preferred embodiment, the 3' end of the recombinant DNA molecule is covalently bound to the solid support. A spacer region may be used to extend the probe outward from the solid support as long as (1) it will not sterically hinder any function or characteristic of the recombinant molecule, and (2) the sequence of the spacer region does not participate in the hybridization or polymerization reactions of me assay. It is typically desirable to immobilize several, and preferably, a large number of such recombinant DNA molecules to the support.
Oligonucleotides representing a portion of a PTP-D protein or glycoprotein are useful for screening for the presence of genes encoding such PTP-D proteins and glycoproteins and for the cloning of PTP-D genes. Techniques for synthesizing such oligonucleotides are disclosed by, for example, Wu et al. (supra).
Protein molecules are fragmented as with cyanogen bromide, or with proteases such as papain, chymotrypsin, trypsin, etc. (Oike et al , J. Biol. Chem. 257:9751-9758 (1982); Liu et al., Int. J. Pept. Protein Res. 21:209-215 (1983)). Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid (Watson, J.D., In: Molecular Biology of the Gene, 4th Ed., Benjamin/Cummings Publishing Co., Inc., Menlo Park, CA (1987)). Using the genetic code, one or more different oligonucleotides can be identified, each of which would be capable of encoding the amino acid. The probability that a particular oligonucleotide will, in fact, constitute the actual XXX-encoding sequence can be estimated by considering abnormal base pairing relationships and the frequency with which a particular codon is actually used (to encode a particular amino acid) in eukaryotic cells. Such "codon usage rules" are disclosed by Lathe et al., J. Molec. Biol. 183: 1-12 (1985). Using the "codon usage rules" of Lathe, a single oligonucleotide, or a set of oligonucleotides, that contains a theoretical "most probable" nucleotide sequence capable of encoding the PTP-D sequences is identified. Although occasionally an amino acid sequences may be encoded by only a single oligonucleotide, frequently the amino acid sequence may be encoded by any of a set of similar oligonucleotides. Importantly, whereas all of the members of this set contain oligonucleotides which are capable of encoding the peptide fragment and, thus, potentially contain the same oligonucleotide sequence as the gene which encodes the peptide fragment, only one member of the set contains the nucleotide sequence that is identical to the nucleotide sequence of the gene. Because this member is present within the set, and is capable of hybridizing to DNA even in the presence of the other members of the set, it is possible to employ the unfractionated set of oligonucleotides in the same manner in which one would employ a single oligonucleotide to clone the gene that encodes the peptide.
The oligonucleotide, or set of oligonucleotides, containing the theoreti cal "most probable" sequence capable of encoding the PTP-D fragment is used to identify the sequence of a complementary oligonucleotide or set of oligonucleotides which is capable of hybridizing to the "most probable" sequence, or set of sequences. An oligonucleotide containing such a complementary sequence can be employed as a probe to identify and isolate a PTP-D gene (Sambrook et al., supra).
A suitable oligonucleotide, or set of oligonucleotides, which is capable of encoding a fragment of a PTP-D gene (or which is complementary to such an oligonucleotide, or set of oligonucleotides) is identified (using the above-described procedure), synthesized, and hybridized by means well known in the art, against a DNA or, more preferably, a cDNA preparation derived from cells which are capable of expressing a PTP-D gene. Single stranded oligonucleotide molecules complementary to the "most probable" PTP-D peptide encoding sequences can be synthesized using procedures which are well known to those of ordinary skill in the art (Belagaje et al., J. Biol Chem. 254:5765-5780 (1979); Maniatis et al., In: Molecular Mechanisms in the Control of Gene Expression, Nierlich et al. Ed., Acad. Press, NY (1976); Wu et al., Prog. Nucl Acid Res. Molec. Biol. 21:101-141 (1978); Khorana, R.G., Science 203:614-625 (1979)). Additionally, DNA synthesis may be achieved through the use of automated synthesizers. Techniques of nucleic acid hybridization are disclosed by Sambrook et al., (supra), and by Haymes et al., (In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985)), which references are herein incorporated by reference. Techniques such as, or similar to, those described above have successfully enabled the cloning of genes for human aldehyde dehydrogenases (Hsu et al., Proc. Natl. Acad. Sci. USA 82:3771-3775 (1985)), fibronectin (Suzuki et al., EMBO J. 4:2519-2524 (1985)), the human estrogen receptor gene (Walter et al., Proc. Natl Acad. Sci. USA 82:7889-7893 (1985)), tissue-type plasminogen activator (Pennica et al , Nature 301:214-221 (1983)) and human term placental alkaline phosphatase complementary DNA (Kam et al., Proc. Natl Acad. Sci. USA 82:(715-8719 (1985)).
In an alternative way of cloning a PTP-D gene, a library of expression vectors is prepared by cloning DNA or, more preferably, cDNA (from a cell capable of expressing PTP-D) into an expression vector. The library is then screened for members capable of expressing a protein which binds to anti-PTP-D antibody, and which has a nucleotide sequence that is capable of encoding potypeptides that have the same amino acid sequence as PTP-D, or fragments thereof. In this embodiment, DNA, or more preferably cDNA, is extracted and purified from a cell which is capable of expressing PTP-D protein. The purified cDNA is fragmented (by shearing, endonuclease digestion, etc.) to produce a pool of DNA or cDNA fragments. DNA or cDNA fragments from this pool are then cloned into an expression vector in order to produce a genomic library of expression vectors whose members each contain a unique cloned DNA or DNA fragment.
An "expression vector" is a vector which (due to the presence of appropriate transcriptional and/or translational control sequences) is capable of expressing a DNA (or cDNA) molecule which has been cloned into the vector and of thereby producing a polypeptide or protein. Expression of the cloned sequences occurs when the expression vector is introduced into an appropriate host cell. If a prokaryotic expression vector is employed, then the appropriate host cell would be any prokaryotic cell capable of expressing the cloned sequences. Similarly, if a eukaryotic expression vector is employed, then the appropriate host cell would be any eukaryotic cell capable of expressing the cloned sequences. Importantly, since eukaryotic DNA may contain intervening sequences, and since such sequences cannot be correctly processed in prokaryotic cells, it is preferable to employ cDNA from a cell which is capable of expressing PTP-D in order .to produce a prokaryotic genomic expression vector library. Procedures for preparing cDNA and for producing a genomic library are disclosed by Sambrook et al (supra).
A DNA sequence encoding a PTP-D protein or glycoprotein of the invention, or encoding a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions of the invention, or encoding a chimeric molecule of the invention, may be recombined with vector DNA in accordance with conventional techniques, including blunt-ended or staggered-ended termini for ligation, restriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and ligation with appropriate ligases. Techniques for such manipulations are disclosed by Sambrook et al. (supra), and are well known in the art.
A nucleic acid construct, such as DNA, is said to be "capable of expressing" a polypeptide if it contains nucleotide sequences which contain transcriptional and translational regulatory information and such sequences are "operably linked" to nucleotide sequences which encode the polypeptide. An operable linkage is a linkage in which the regulatory DNA sequences and the DNA sequence sought to be expressed are connected in such a way as to permit gene expression. The precise nature of the regulatory regions needed for gene expression may vary from organism to organism, but shall in general include a promoter region which, in prokaryotes, contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal the initiation of protein synthesis. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.
If desired, the non-coding region 3' to the gene sequence coding for the protein may be obtained by the above-described methods. This region may be retained for its transcriptional termination regulatory sequences, such as termination and polyadenylation. Thus, by retaining the 3'-region naturally contiguous to the DNA sequence coding for the protein, the transcriptional termination signals may be provided. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3' region functional in the host cell may be substituted.
Two DNA sequences (such as a promoter region sequence and a PTPase-encoding sequence) are said to be operably linked if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region sequence to direct the transcription of the PTP-D gene sequence, or (3) interfere with the ability of the PTP-D gene sequence to be transcribed by the promoter region sequence. A promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence. Thus, to express the protein, transcriptional and translational signals recognized by an appropriate host are necessary.
A promoter is a double-stranded DNA or RNA molecule which is capable of binding RNA polymerase and promoting the transcription of an "operably linked" nucleic acid sequence. As used herein, a "promoter sequence" is the sequence of the promoter which is found on that strand of the DNA or RNA which is transcribed by the RNA polymerase. A "promoter sequence complement" is a nucleic acid molecule whose sequence is the complement of a "promoter sequence." Hence, upon extension of a primer DNA or RNA adjacent to a single-stranded "promoter sequence complement" or, of a "promoter sequence," a double-stranded molecule is created which will contain a functional promoter, if that extension proceeds towards the "promoter sequence" or the "promoter sequence complement. " This functional promoter will direct the transcription of a nucleic acid molecule which is operably linked to that strand of the double-stranded molecule which contains the "promoter sequence" (and not that strand of the molecule which contains the "promoter sequence complement").
Certain RNA polymerases exhibit a high specificity for such promoters. The RNA polymerases of the bacteriophages T7, T3, and SP-6 are especially well characterized, and exhibit high promoter specificity. The promoter sequences which are specific for each of these RNA polymerases also direct the polymerase to utilize (i.e. transcribe) only one strand of the two strands of a duplex DNA template. The selection of which strand is transcribed is determined by the orientation of the promoter sequence. This selection determines the direction of transcription since RNA is only polymerized enzymatically by the addition of a nucleotide 5' phosphate to a 3' hydroxyl terminus.
Two sequences of a nucleic acid molecule are said to be "operably linked" when they are linked to each other in a manner which either permits both sequences to be transcribed onto the same RNA transcript, or permits an RNA transcript, begun in one sequence to be extended into the second sequence. Thus, two sequences, such as a promoter sequence and any otiier "second" sequence of DNA or RNA are operably linked if transcription commencing in the promoter sequence will produce an RNA transcript of the operably linked second sequence. In order to be "operably linked" it is not necessary that two sequences be immediately adjacent to one another.
Thus, as indicated above, in order to function as a promoter, a promoter sequence must be present as a double-stranded molecule. For the purposes of the present invention, the two strands of a functional promoter sequence are referred to as a "transcript" strand and a "complementary" strand. The "transcript" strand is that strand of the duplex which will be transcribed by the RNA polymerase (i.e. which serves as the template for transcription). The "complementary" strand is the strand which has a sequence complementary to the "transcript" strand, and which must be present, and hybridized to the "transcript" strand, in order for transcription to occur. Thus, when the "transcript" strand of a promoter sequence is operably linked to a second sequence, hybridization of the "transcript" strand with the "complement" strand, will, in the presence of a polymerase, result in the transcription of die "transcript" strand, and will produce an RNA transcript using the sequence of the "transcript" strand as a template.
The promoter sequences of the present invention may be either prokaryotic, eukaryotic or viral. Suitable promoters are repressible, or, more preferably, constitutive. Examples of suitable prokaryotic promoters include promoters capable or recognizing the T4 (Malik et al., J. Biol. Chem. 263: 1174-1181 (1984); Rosenberg et al., Gene 59:191-200 (1987); Shinedling et al., J. Molec. Biol. 195:471-480 (1987); Hu et al., Gene 42:21-30 (1986)), T3, Sp6, and T7 (Chamberlin et al Nature 228:221 -231 (1970); Bailey et al., Proc. Natl Acad. Sci. (U.S.A.) 80:2814-2818 (1983); Davanlook et al., Proc. Natl. Acad. Sci. (U.S.A.) 81:2035-2039 (1984)) polymerases; the PR and PL promoters of bacteriophage lambda (The Bacteriophage Lambda, Hershey, A.D., Ed., Cold Spring Harbor Press, Cold Spring Harbor, NY (1973); Lambda II, Hendrix, R.W., Ed., Cold Spring Harbor Press, Cold Spring Harbor, NY (1980)); the trp, recA, heat shock, and lacZ promoters of E. coli; the α-amylase (Ulmanen et al., J. Bateriol 162:176-182 (1985)) and the ς-28-specific promoters of B. subtilis (Gilman et al., Gene 32: 11-20 (1984)); the promoters of the bacteriophages of Bacillus (Gryczan, T.J., In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982)); Streptomyces promoters (Ward et al., Mol Gen. Genet. 203:468-478 (1986)); the int promoter of bacteriophage lambda; the bla promoter of the β-lactamase gene of pBR322, and the CAT promoter of die chloramphenicol acetyl transferase gene of pPR325, etc. Prokaryotic promoters are reviewed by Glick, B.R. (J. Ind. Microbiol. 1:277-282 (2987)); Cenatiempo, Y. (Biochimie 65:505-516 (1986)); Watson et al (In: Molecular Biology of the Gene, Fourth Edition, Benjamin Cummins, Menlo Park, CA (1987)); and Gottesman, S. (Ann. Rev. Genet. 18:415-442) (1984)). Preferred eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer et al., J. Mol. Appl. Gen. 1:273-288 (1982)); the SV40 early promoter (Benoist et al , Nature (London) 290:304-310 (1981)); and the yeast ga14 gene promoter (Johnston et al., Proc. Natl Acad. Sci (USA) 79:6971-6975 (1982); Silver et al , Proc. Natl. Acad. Sci. (USA) 81:5951-5955 (1984)). All of the above listed references are incorporated by reference herein.
Strong promoters are preferred. Examples of such preferred promoters are those which recognize the T3, SP6 and T7 polymerases, the PL promoter of the mouse metallothionein I gene. A most preferred promoter for eukaryotic expression of PTP-D is SV40 promoter such as that driving transcription in the pLSV vector (Livneh et al., (1986) J. Biol Chem. 261, 12490-12497). The sequences of such polymerase recognition sites are disclosed by Watson et al. (In: Molecular Biology of the Gene, Fourth Edition, Benjamin/Cummings Publishing Co., Inc., Menlo Park, CA, (1987)).
In a further aspect, the present invention relates to an antibody which is capable of specifically recognizing a PTP-D protein or glycoprotein or of specifically recognizing an epitope of a PTP-D protein or glycoprotein.
The recombinantly expressed or naturally occurring PTP-D protein or glycoprotein, and/or the antibodies recognizing the PTP-D protein or glycoprotein may be used in a method of diagnosing diseases or conditions with abnormal expression or activation of PTP-D protein or glycoproteins. The present invention provides methods for evaluating the presence and the level of normal or mutant PTP-D protein or glycoprotein in a subject. Absence, or more typically, low expression of the PTP-D protein or glycoprotein, or presence of a mutant PTP-D protein or glycoprotein, in an individual may serve as an important predictor of susceptibility to oncogenic transformation and the development of cancer. Alternatively, over-expression of a PTP-D protein or glycoprotein,, possibly due to a mutant receptor/enzyme system insensitive to negative regulation, or due to overabundance of a stimulatory ligand in the body, may serve as an important predictor of susceptibility to diabetes.
The invention is also directed to the use of such antibodies to detect the presence of, or measure the quantity or concentration of, a PTP-D protein or glycoprotein in a cell, a cell or tissue extract, or a biological fluid.
In one aspect, the present invention relates to a method for detecting the presence of or measuring the quantity of a PTP-D protein or glycoprotein in a cell, comprising:
(a) contacting said cell or an extract thereof with an antibody specific for an epitope of a PTP-D protein or glycoprotein; and
(b) detecting the binding of said antibody to said cell or extract thereof, or measuring the quantity of antibody bound,
thereby determining the presence of or measuring the quantity of said PTP-D protein or glycoprotein.
The term "antibody" is meant to include polyclonal antibodies, monoclonal antibodies (mAbs), chimeric antibodies, and anti-idiotypic (anti-Id) antibodies.
Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen.
Monoclonal antibodies (mAbs) are a substantially homogeneous population of antibodies to specific antigens. MAbs may be obtained by methods known to those skilled in the art. See, for example, Kohler et al., Nature 256:495-497 (1975) and U.S. Patent No. 4,376,110. Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, GILD and any subclass thereof. The hybridoma producing the mAbs of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo production makes this the presently preferred method of production. Briefly, cells from the individual hybridomas are injected intraperitoneally into pristane-primed BALB/c mice to produce ascites fluid containing high concentrations of the desired mAbs. MAbs of isotype IgM or IgG may be purified from such ascites fluids, or from culture supernatants, using column chromatography methods well known to those of skill in the art.
Chimeric antibodies are molecules in which different portions are derived from different animal species, such as those having variable region derived from a murine MAb and a human immunoglobulin constant region. Chimeric antibodies and methods for their production are known in the art (Cabilly et al., Proc. Natl. Acad. Sci. USA 71:3273-3277 (1984); Morrison et al , Proc. Natl Acad. Sci. USA 81:6851-6855 (1984); Boulianne et al., Nature 312:643-646 (1984); Cabilly et al., European Patent Application 125023 (published November 14, 1984); Neuberger et al., Nature 314:268-270 (1985); Taniguchi et al., European Patent Application 171496 (published February 19, 1985); Morrison et al., European Patent Application 173494 (published March 5, 1986); Neuberger et al., PCT Application WO 86/01533 (published March 13, 1986); Kudo et al., European Patent Application 184187 (published June 11 , 1986); Sahagan et al., J. Immunol. 137:1066-1074 (1986); Robinson et al., International Patent Publication #PCT/US86/02269 (published May 7, 1987); Liu et al., Proc. Natl. Acad. Sci. USA 84:3439-3443 (1987); Sun et al., Proc. Natl. Acad. Sci. USA 84:214-218 (1987); Better et al., Science 140: 1041-1043 (1988)). These documents are hereby incorporated by reference.
An anti-idiotypic (anti-Id) antibody is an antibody which recognizes unique determinants generally associated with the antigen-binding site of an antibody. An anti-Id antibody can be prepared by immunizing an animal of the same species and genetic type (e.g. mouse strain) as the source of the mAb with the mAb to which an anti-Id is being prepared. The immunized animal will recognize and respond to me idiotypic determinants of the immunizing antibody by producing an antibody to these idiotypic determinants (the anti-Id antibody).
The anti-Id antibody may also be used as an "immunogen" to induce an immune response in yet another animal, producing a so-called anti-anti-Id antibody. The anti-anti-ld may be epitopically identical to the original mAb which induced the anti-Id. Thus, by using antibodies to the idiotypic determinants of a mAb, it is possible to identify other clones expressing antibodies of identical specificity.
Accordingly, mAbs generated against a PTP-D protein or glycoprotein of the present invention may be used to induce anti-Id antibodies in suitable animals, such as BALB/c mice. Spleen cells from such immunized mice are used to produce anti-Id hybridomas secreting anti-Id mAbs. Further, the anti-Id mAbs can be coupled to a carrier such as keyhole limpet hemocyanin (KLH) and used to immunize additional BALB/c mice. Sera from these mice will contain anti-anti-ld antibodies that have the binding properties of the original mAb specific for a PTP-D epitope.
The anti-Id mAbs thus have their own idiotypic epitopes, or"idiotopes" structurally similar to the epitope being evaluated, such as a PTP-D protein or glycoprotein.
The term "antibody" is also meant to include both intact molecules as well as fragments thereof, such as, for example, Fab and F(ab')2, which are capable of binding antigen. Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding than an intact antibody (Wahl et al., J. Nucl Med. 24:316-325 (1983)).
It will be appreciated that Fab and F(ab')2 and other fragments of the antibodies useful in the present invention may be used for the detection and quantitation of a PTP-D protein or glycoprotein according to the methods disclosed herein for intact antibody molecules. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
The antibodies, or fragments of antibodies, useful in the present invention may be used to quantitatively or qualitatively detect the presence of cells which express a PTP-D protein or glycoprotein. This can be accomplished by immunofluorescence techniques employing a fluorescently labeled antibody (see below) coupled with light microscopic, flow cytometric, or fluori metric detection.
The antibodies (or fragments thereof) useful in the present invention may be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of a PTP-D protein or glycoprotein. In situ detection may be accomplished by removing a histological specimen from a patient, and providing the labeled antibody of the present invention to such a specimen. The antibody (or fragment) is preferably provided by applying or by overlaying the labeled antibody (or fragment) to a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of a PTP-D protein or glycoprotein but also its distribution on the examined tissue. Using the present invention, those of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified in order to achieve such in situ detection. Such assays for a PTP-D protein or glycoprotein typically comprise incubating a biological sample, such as a biological fluid, a tissue extract, freshly harvested cells such as lymphocytes or leukocytes, or cells which have been incubated in tissue culture, in the presence of a detectably labeled antibody capable of identifying a PTP-D protein or glycoprotein, and detecting the antibody by any of a number of techniques well-known in the art.
The biological sample may be treated with a solid phase support such as nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles or soluble proteins. The support may then be washed with suitable buffers followed by treatment with the detectably labeled PTP-D specific antibody. The solid phase support may then be washed with the buffer a second time to remove unbound antibody. The amount of bound label on said solid support may then be detected by conventional means.
By "solid phase support" is intended any support capable of binding antigen or antibodies. Well-known supports, or carriers, include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetitite. The nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
The binding activity of a given lot of anti-PTP-D antibody may be determined according to well known methods. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.
Other steps as washing, stirring, shaking, filtering and the like may be added to the assays as is customary or necessary for the particular situation.
One of the ways in which the PTP-D-specific antibody can be detectably labeled is by linking the same to an enzyme and use in an enzyme immunoassay (EIA). This enzyme, in turn, when later exposed to an appropriate substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometnc, fiuorimetric or by visual means. Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. The detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
Detection may be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibodies or antibody fragments, it is possible to detect a PTP-D protein or glycoprotein through the use of a radioimmunoassay (RIA) (see, for example, Work et al., Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, New York, (1978), which is incorporated by reference herein). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
It is also possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wave length, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
The antibody can also be detectably labeled using fluorescence emitting metals such as 152Eu, or others of the lanthanide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTP A) or ethylenediaminetetraacetic acid (EDTA).
The antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
Likewise, a bioluminescent compound may be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aeluorin.
The present invention also relates to a method for detecting the presence of a nucleic acid construct encoding a PTP-D protein or glycoprotein, or a nucleic acid construct encoding a mutant PTP-D protein or glycoprotein, in a subject, comprising:
(a) contacting a cell or an extract thereof from said subject with an oligonucleotide probe encoding at least a portion of said normal or mutant PTP-D protein or glycoprotein under hybridizing conditions; and
(b) measuring the hybridization of said probe to the nucleic acid of said cell,
thereby detecting the presence of said nucleic acid construct.
The method may comprise an additional step (c) before step (a). Step (c) provides selectively amplifying the amount of nucleic acid of said cell encoding said PTP-D protein or glycoprotein, which may be by the polymerase chain reaction.
Oligonucleotide probes encoding various portions of PTP-D protein or glycoproteins (see above) are used to test cells from a subject for the presence of DNA or RNA sequence encoding a PTP-D protein or glycoprotein. Techniques for synthesizing such probes are disclosed by for example, Wu et al., Prog. Nucl Acid. Res. Molec. Biol 21:101-141 (1978). A preferred probe would be one directed to the nucleic acid sequence encoding at least four amino acid residues, and preferably at least five amino acid residues, of a PTP-D protein or glycoprotein of the present invention (see Example 4 below). Qualitative or quantitative assays can be performed using such probes. For example, Northern analysis (see Example 3 below) is used to measure expression of a PTP-D mRNA, such as PTP-D1 mRNA and PTP-D2 mRNA, in a cell or tissue preparation. Such methods can be used even with very small amounts of DNA obtained from an individual, following use of selective amplification techniques. Recombinant DNA methodologies capable of amplifying purified nucleic acid fragments have long been recognized. Typically, such methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by Cohen et al (U.S. Patent No. 4,237,224); and Sambrook et al., (supra), which documents are herein incorporated by reference.)
Recently, an in vitro, enzymatic method has been described which is capable of increasing the concentration of such desired nucleic acid molecules. This method has been referred to as the "polymerase chain reaction" or "PCR" (Mullis et al., Cold Spring Harbor Symp. Quant. Biol 51:263-273 (1986); Erlich, EP 50,424; EP 84,796, EP 258,017, EP 237,362; Mullis, K., EP 201,184; Mullis et al., U.S. 4,683,202; Erlich, H., U.S. 4,582,788; and Saiki et al., U.S. 4,683,194).
The present invention also relates to a method for identifying in a chemical or biological preparation a compound capable of binding to a PTP-D protein or glycoprotein, said method comprising:
(a) attaching said PTP-D protein or glycoprotein or a compound-binding portion thereof to a solid phase matrix;
(b) contacting said chemical or biological preparation with said solid phase matrix allowing said compound to bind, and washing away any unbound material; and
(c) detecting the presence of said compound bound to said solid phase.
The present invention also relates to a method for isolating from a complex mixture a compound capable of binding to a PTP-D protein or glycoprotein, comprising: (a) attaching said PTP-D protein or glycoprotein, or a compound-binding portion thereof, to a solid phase matrix;
(b) contacting said complex mixture with said solid phase matrix allowing said compound to bind, and washing away any unbound material; and
(c) eluting said bound compound,
thereby isolating said compound.
By "compound capable of binding to a PTP-D protein or glycoprotein" is meant a naturally occurring or synthetically produced molecule which interacts with PTP-D outside of the catalytic site of the phosphatase domain. By the "catalytic site" is meant the smallest, contiguous part of PTP-D which contains phosphatase activity. Such compounds may directly or indirectly modulate the enzymatic activity of the PTP-D protein or glycoprotein. Examples of such compounds are (i) intracellular proteins which interact with and may be dephosphorylated by a PTP-D protein or glycoprotein; (ii) naturally occurring molecules produced by other cell types.
By a "compound-binding portion" of a PTP-D protein or glycoprotein is meant a part of the molecule which is outside of the catalytic site. Any part of the PTP-D proteins or glycoproteins which are not part of the catalytic site may be a compound-binding portion. A "compound-binding portion" may be prepared from naturally occurring or recombinantly expressed PTP-D proteins or glycoproteins by proteolytical cleavage followed by conventional purification procedures known to those of skill in the art. Alternatively, the compound-binding portion of a PTP-D protein or glycoprotein may be produced by recombinant technology known to those of skill in the art by expressing only these parts of PTP-D in suitable cells.
In a still further aspect, the present invention relates to a method of screening for antagonists which are defined as molecules which directly or indirectly inhibit the enzymatic activity or activation of a PTP-D protein or glycoprotein. In a further aspect, the present invention relates to a method of screening for agonists which are defined as molecules which directly or indirectly increase the enzymatic activity or activation of a PTP-D protein or glycoprotein.
PTP-D proteins or glycoproteins of the present invention are useful in methods for screening drugs and other agents which are capable of activating or inhibiting the phosphatase activity, and thereby affecting major pathways of cellular metabolism. By attaching an intact PTP-D protein or glycoprotein or a fragment of a PTP-D protein or glycoprotein, to a solid phase matrix, an affinity probe is created which can be used to screen biological products or chemical agents for their capacity to interact with a PTP-D protein or glycoprotein on the basis of their binding activity. Bound material can then be eluted from the affinity probe in purified form.
A PTP-D protein or glycoprotein, or a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions and having enzymatic activity can be used for testing of compounds capable of enhancing or inhibiting the phosphatase activity. The ability of a compound under test to modify phosphatase activity can be tested in an in vitro system wherein the test compound is added to a purified PTP-D protein or glycoprotein, or to a PTP-D protein or glycoprotein having amino acid deletions and/or insertions and/or substitutions and having enzymatic activity, and the effects on enzyme activity measured using standard enzymological procedures well known to those of skill in the art.
A suitable fragment of a PTP-D protein or glycoprotein for use in screening may be prepared by limited proteolytic treatment of the naturally occurring or recombinantly expressed PTP-D protein or glycoprotein. Alternatively, suitable fragment(s) of PTP-D may be produced by recombinant technology. As an example, which is not intended to be in any way limiting to the scope of the invention claimed, it may be preferable to use only the catalytic domains for screening purposes. Such catalytic domains, which consist only of the minimum number of amino acids needed for enzymatic activity, could be produced either alone or as part of a fusion protein in suitable hosts (e.g., E. colϊ) by recombinant technology well known to those of skill in the art.
Alternatively, the action of a compound on PTPase activity can be measured in a whole cell preparation using live or fixed cells, or a membrane fraction derived from live or fixed cells. This method is useful for screening compounds acting directly on the enzymatic portion of a PTP-D protein or glycoprotein. If a PTP-D molecule or glycoprotein has an extracellular receptor portion, then this method is useful for screening compounds acting via the extracellular receptor portion. A test compound is incubated with cells, or with a membrane preparation derived therefrom, which express high amounts of a PTP-D protein or glycoprotein of this invention, such as transfected COS or NIH-3T3 cells. The amount of cellular phosphotyrosine is then measured, using methods well-known in the art (Honegger, et al., Cell 51: 199-209 (1987); Margolis et al., Cell 57: 1101-1107 (1989)). The results are compared to results obtained in the absence of the test compound, or in me absence or presence of a known activator of a PTP-D protein or glycoprotein. In such studies, the action of the test compound in the presence of an activator of tyrosine kinase can also be measured.
A compound which stimulates PTPase activity will result in a net decrease in the amount of phosphotyrosine, whereas a compound which inhibits PTPase activity will result in a net increase in the amount of phosphotyrosine.
In the case of growth factor receptors which are tyrosine kinases, such as the receptors for epidermal growth factor (EGF) and for platelet-derived growth factor (PDGF), tyrosine phosphorylation is linked to cell growth and to oncogenic transformation. Activation of a PTPases, leading to dephosphorylation, would serve as a counter regulatory mechanism to prevent or inhibit growth, and might serve as an endogenous regulatory mechanism against cancer. Thus, mutation or dysregulation of this receptor. enzyme system may promote susceptibility to cancer. The insulin receptor is also a tyrosine kinase, and phosphorylation of tyrosine in cells bearing insulin receptors would be associated with normal physiological function. In contrast to the case of cell growth and cancer, activation of a PTPase would counteract insulin effects. Subnormal PTPase levels or enzymatic activity would act to remove a normal counter regulatory mechanism. Perhaps more important, though, over-activity, or inappropriate activation, of a PTPase would be expected to inhibit or totally prevent the action of insulin on cells, leading to diabetes (of an insulin-resistant variety). Thus, susceptibility to diabetes may be associated with PTPase dysregulation.
Therefore, the methods of the present invention for identifying normal or mutant PTP-D genes, or for measuring the amount or activity of PTP-D protein or glycoprotein associated with a cell or tissue, can serve as methods for identifying susceptibility to cancer, diabetes, or other diseases associated with alterations in cellular phosphotyrosine metabolism.
The invention also relates to the use of such identified antagonists or agonists in pharmaceutical compositions intended for treatment of diseases or conditions with either normal or abnormal expression of a PTP-D protein or glycoprotein. The composition may typically be in a form for systemic or topical injection or infusion and may, as such, be formulated with a suitable carrier for injection or infusion.
The present invention also relates to a method for preventing or treating diseases or conditions involving the activation of a PTP-D protein or glycoprotein, the method comprising administering, to a patient in need thereof, an effective dosage of a PTP-D protein or glycoprotein of the invention or an antibody of the invention or a molecule that stimulates or inhibits enzymatic activity of a PTP-D protein or glycoprotein of the invention.
The present invention is further illustrated in the examples shown below which are not intended to be in any way limiting to the scope of the invention as claimed. EXAMPLE 1
Identification of a New PTPase Subfamily Using the Polymerase Chain Reaction (PCR)
Total RNA was isolated from human skeletal muscle by the guanidinium thiocyanate/CsCl procedure (Chirgwin et al., Biochem. 18:5293-5299 (1979)). Poly(A)+ RNA was isolated on an oligo(dT) cellulose column (Aviv et al., Proc. Natl. Acad. Sci. USA 58: 1408-1412 (1972)). First strand cDNA was synthesized from 2 μg poly(A)+ using ligo(dT) priming and Moloney Murine Leukemia Virus RNase H- Reverse Transcriptase from Gibco BRL (Gaithersburg, MD 20877, U.S.A.) in accordance with the manufacturer's recommendations.
cDNA corresponding to PTPases expressed in skeletal muscle were isolated by the polymerase chain reaction (Saiki et al., Science 239:487-491 (1988)). In short, human muscle first strand cDNA from above (corresponding to about 50 ng) was amplified with the following set of degenerative oligonucleotide primers using me Gene Amp kit (Perkin Elmer Cetus, Norwalk, CT, U.S.A.).
Sense prime (oligonucleotide no. 58)
5' A(CT)TT(CT)TGG(ACG)(AG)(AG)ATG(AG)T(TCGA)TGG 3'
[SEQ. ID NO. 10]
Anti-sense primer (oligonucleotide no. 57)
5' CC(TCGA)A(CT)(AGT)CC(ATC)GC(AG)CT(GA)CAGTG 3'
[SEQ. ID NO. 11]
The primers correspond to the following amino acid consensus sequences:
Sense primer (oligonucleotide #58) F W X M X W
[SEQ. ID NO. 12]
Antisense primer (oligonucleotide #57) H C S A G ( S / I / V ) G.
[SEQ. ID NO. 13] Each PCR cycle comprise a denaturation step at 94°C for 1 minute, an annealing step at 37°C for 2 minutes, and an extension step at 72°C for 2 minutes. Thirty to 40 cycles were carried out. The reaction products were subjected to agarose gel electrophoresis. The fragments of the expected size (based on the structure of already described PTPases) were isolated, subcloned using the TA cloning system (Invitrogen, San Diego, California) and sequenced by the enzymatic chain termination method described by Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)), (Sequenase, U.S. Biochemicals) using standard techniques (as described in Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York, 1988). The partial DNA sequence and the deduced amino acid sequence of two PCR fragments, termed PTP-D 1 and PTP-D2, are shown in Figure 1 and Figure 2, respectively. The deduced amino acid sequences were compared with PTPase 1B in Figure 3 A using the CLUSTAL program (Higgins, C, Fuch, R., and Bleasby, D., Multiple Sequence Alignment; CABIOS (1991) (in press)).
It appears that both fragments are clearly homologous to other known PTPases, but, surprisingly, have features not yet described for this class of enzymes (analysis by the University of Wisconsin, Genetics Computer Group program).
These unique features of PTP-D 1 and PTP-D2 are shown below in comparison with the consensus sequences of the previously described known PTPases (differences are underlined):
1. PTP-D 1/D2 S X X Y W P [SEQ. ID NO. 6]
Consensus C X X Y W P [SEQ. ID NO. 2]
2. PTP-D 1/D2 I A M V X X X X E [SEQ. ID NO. 7]
Consensus (I/V/L) V (M/I/L) (V/L/I/M) X X X X E
[SEQ. ID NO. 9] EXAMPLE 2
cDNA Cloning of a Member of the PTP-D Subfamily mRNA was prepared from human skeletal muscle as described in EXAMPLE 1. A cDNA library was constructed using the methods described by Okayama and Berg, Mol. Cell. Biol. 2: 161-170 (1982); Okayama and Berg, Mol. Cell. Biol. 3:280-289 (1983). The pCDVI-PL vector was used for preparation of the primer fragment (Noma et al., Nature 319:640-646 (1986). A short synthetic adapter was used as second strand primer as recently described (Boel et al., BioTechniques 11:XX (1991)). E. coli DH5α (Gibco BRL, Gaithersburg, MD 20877, U.S.A.) was used for transformation according to the protocols by H. Inuoue et al., Gene 96:23-28 (1990). After transformation, the cells were plated onto LB plates (containing 50 μg ampicillin/ml) at a density of 15,000-20,000 colonies per plate.
Nitrocellulose replica filters (Scleicher & Schuell, BA85) were screened with standard colony hybridization technique ((Maniatis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition (1988). The following oligonucleotide was synthesized, labeled at the 5' end using T4 polynucleotide kinase and [γ-32P]ATP (Amersham) and used for screening of the cDNA library:
5' ATA GCA ATG GTG ACA GCA GAA 3' ISEQ. ID NO. 14]
This oligonucleotide corresponds to the amino acid sequence Ile-Ala- Met-Val-Thr-Ala-Glu of the PCR fragment no. 1 from EXAMPLE 1. Ten pmoles of the labeled oligonucleotide in 50 ml of hybridization solution (6 ×
SSC, 5× Denhardt's solution, 0.05 % SDS (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York, (1988)) were added to replica nitrocellulose filters and allowed to hybridize at 42°C for 3 hours. Then the filters were washed in 6 × SSC, 0.05 % SDS three times at room temperature, once at 42°C and finally once at 48°C. Positive colonies identified by autoradiography were isolated by standard techniques ((Maniatis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition (1988)). The partial sequence of one positive clone, denoted PTP-D 1, and the deduced amino acid sequence is shown in Figure 4. This partial sequence includes the sequence of the PCR fragment no. 1 from above and thus confirms the identity of the isolated cDNA clone. Further, comparison with previously described PTPases indicates at least one additional unique feature of PTP-D 1 (the difference is underlined):
3. PTP-D1 G Y I N A S [SEQ. ID NO. 5]
Consensus N/D Y I N A S/N [SEQ. ID NO. 4]
EXAMPLE 3
Northern Blot Analysis of PTP-D1 and PTP-D2
Total RNA was isolated from human skeletal muscle by the acid guanidium thiocyanate-phenol-chloroform extraction procedure as described by Puissant et al., BioTechniques 8: 148-149 (1990)). Poly(A)+ RNA was isolated on an oligo(dT) column (Aviv et al., Proc. Natl Acad. Sci. USA 69:1408-1412 (1972)). Fifteen μg poly(A)+ RNA were loaded in the lane probed for PTP-D1 expression, and 7.5 μg were loaded in the lane analyzed for PTP-D2 expression, the RNA was separated in an agarose-formaldehyde gel and blotted to nitrocellulose filters using standard techniques (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York (1988)). The filters were hybridized with 32P-labeled cDNA fragments corresponding to the sequences shown for PTP-D 1 and PTP-D2. The 32P-labeling was done with the Random Primers DNA Labeling System (Cat. no. 8187SA, Bethesda Research Laboratories, Gaithersburg, MD 20877, U.S.A.) according to the manufacturer's instructions. Subsequently, the filters were applied to X-ray films. An analysis of the Northern Blot shows that the major transcripts of PTP-D 1 and PTP-D2 in skeletal muscle were 6.5 kb and 11 kb, respectively. EXAMPLE 4
Identification of New Members of the PTP-D Subfamily
Total RNA is isolated from each of the following tissues and cell lines: skeletal muscle, liver, placenta, Hep G2 (American Type Culture Collection (ATCC) HB8065), RD (ATCC CCL 136) (Puissant et al., BioTechniques 8: 148-149 (1990)). Poly(A)+ RNA is isolated on an oligo (dT) column (Aviv et al., Proc. Natl. Acad. Sci. USA 69: 1408-1412 (1972)). First strand cDNA synthesis is performed as described in Example 1. The cDNA preparations from the above-mentioned tissues and cell lines are individually subjected to the polymerase chain reaction using standard conditions (PCR Technology - Principles and Applications for DNA Amplification, Erlich, H.E., ed., Stockton Press, New York, (1989)). The following primers are used for the amplifications:
Sense primer:
(oligonucleotide no. 58, see Example 1 of the present invention) in combination with either of the two anti-sense primers:
Oligonucleotide no. 250 (corresponding to the amino acid sequence
Figure imgf000049_0001
Oligonucleotide no. 251 (corresponding to the amino acid sequence QERTVW [SEQ. ID NO. 17] of PTP-D1):
5' GGT(TCGA)AC(TCGA)GT(TCGA)C(TG)(TC)TC(TC)T
[SEQ. ID NO. 18] Thirty to 40 PCR cycles are carried out. The reaction products are subjected to agarose gel electrophoresis. The fragments of the expected size (around 190 bp for the combination of oligonucleotides nos. 58 and 250; around 235 bp for the combination of oligonucleotides nos. 58 and 251) are isolated, blunt-ended and subcloned into the pGEM3 vector (Promega) using standard techniques (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, (1988)). The subcloned PCR products are sequenced by the enzymatic chain termination method (Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)) using Sequenase (United States Biochemical, Cleveland, Ohio 44122, U.S.A.). The nucleotide sequences and the corresponding amino acid sequences are compared to the sequences of PTP-D 1 and PTP-D2. Clones which exhibit 70% or more identity to PTP-D1/PTP-D2 and/or the PTP-D 1/D2 sequences shown in Examples 1 and 2 are identified as members of the PTP-D subfamily according to the present invention.
EXAMPLE 5
Detection of the Presence of a
Nucleic Acid for a PTP-D Protein
Total RNA is isolated from the cell lines Hep G2 (American Type Culture Collection (ATCC) HB8065) and RD (ATCC CCL 136) (Puissant et al., Biotechniques 8:148-149 (1990)). Poly(A)+ RNA is isolated on an oligo(dT) column (Aviv & Leder, Proc. Natl. Acad. Sci. USA 69: 1408-1412
(1972)). First strand cDNA synthesis is performed as described in Example
1. The cDNA is subjected to the polymerase chain reaction using standard conditions (PCR Technology - Principles and Applications for DNA
Amplification, Erlich, H.E. ed., Stockton Press, New York (1989)). The following primers are used for the amplifications:
Sense primer: 5' ATAGCAATGGTGACAGCAGAA 3'
[SEQ. ID NO. 19] Anti-sense primer:
5 ' CGCCC(A/G)A(C/T)(T/C/G/A)CC(T/C/G/A)GC(T/C/G/A)CT
(G/A)CAGTG [SEQ. ID NO. 20] 3'
Thirty-five cycles are carried out. The reaction products are subjected to agarose gel electrophoresis. The fragments of the expected size (360 bp) are isolated, blunt-ended and subcloned into the pGEM3 vector (Promega) using standard techniques (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1988)). The PTP-D identity of the subcloned PCR fragments is verified by sequencing using the enzymatic chain termination method (Sanger et al. , Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)) using Sequenase (United States Biochemical, Cleveland, Ohio 44122, U.S.A.). EXAMPLE 6
Detection of the Presence of and Measurement of the Quantity of a PTP-D Protein or Glycoprotein in a Cell
Change of the prokaryotic expression vector pGEX
To accommodate a cDNA fragment from PTP D1 (see below) the cloning sites of the pGEX2T vector (Pharmacia, Uppsala, Sweden) is changed using standard techniques (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York, 1988). The pGEX2T vector is digested with the restriction enzymes BamHI and EcoRI and isolated. The following oligonucleotides are ligated into the digested pGΕX2T vector.
5'GATCTCCGAATTCCATGGATCCAGGCCTCTAGAAGCTTAC 3' [SEQ. ID NO . 21]
3' AGGCTTAAGGTACCTAGGTCCGGAGATCTTCGAATGTTAA 5' [SEQ. ID NO. 22] thereby giving rise to the vector pGEX-AK2 with the following cloning sites:
5' EcoRI, NcoI, BamHI, StuI, XbaI, HindIII 3' Expression of GST-PTP D1 fusion protein in E. coli
The cDΝA encoding PTP D1 (EXAMPLE 2) is digested with the restriction enzymes EcoRI and BglII. After digestion, a fragment of about 1600 bp is isolated and ligated into the pGΕX-AK2 (digested with EcoRI and BamHI) using standard techniques (Current Protocols in Molecular Biology, eds. F.M. Ausubel et al., John Wiley & Sons, New York, 1988). The inserted fragment corresponds to the coding region of PTP D1 shown in Figure 4 of the present invention (i.e., it is coding for 272 amino acids) and about 800 bp of the 3' untranslated region. The pGΕX-AK2/PTP D1 vector construct, which encodes a fusion protein of glutathione S-transferase and PTP D1 (Smith et al., Proc. Natl. Acad. Sci. USA 83:87-3-8707 (1988)), is introduced into the E. coli strains DH5α (Cat. No. 8263SA, Bethesda Research Laboratories, Gaithersburg, MD) and SURE™ (Cat. No. 200294, Stratagene, La Jolla, CA 92037).
Overnight cultures of the transformed E. coli are grown in LB medium and diluted 1: 10 in fresh medium and grown for 1 hour. Isopropyl-1-thio-β-D-galactopyranoside (IPTG) is added to a final concentration of 0.5 mM (DH5α) and 5 mM (SURE) and the cultures are incubated for a further 4 hours. Controls: 1) pGEX-AK2 with and without IPTG; 2) pGEX-AK2/PTP D1 without addition of IPTG. The GST-PTP D1 fusion protein is isolated either as an insoluble product from inclusion bodies (using 3 washes in 50 mM N-2-Hydroxyethylpiperazine-N'-2-ethanesulphonic acid (HEPES) buffer pH 7.5 containing 1.0 percent (vol/vol) Triton X100) or as a soluble protein using glutathione-Sepharose 4B affinity chromatography (Cat. No. 17-0756-01, Pharmacia, Uppsala, Sweden) according to the manufacturer's instructions.
Production of antibodies with specificity for PTP DI Antiserum with specificity for PTP D1 is produced by standard techniques (Practical Immunology 3rd Edition, L. Hudson & F.C. Hay, Blackwell, Oxford (1989)). In brief, 200 μg of the GST-PTP D1 fusion protein in 200 μl phosphate buffered saline are combined with an equal volume of Freund's complete adjuvant (Sigma, Cat. No. F5881) and injected intramuscularly into the thigh muscle of two New Zealand rabbits. Each rabbit receives 100 μg of the fusion protein. Two weeks after the first injection, boost injections are performed (same procedure as the initial immunization but without Freund's adjuvant). After further two weeks 20 ml of blood are obtained from each rabbit. The blood is allowed to clot at room temperature for 1 hour in glass tubes, which are centrifuged after loosening the clot from the well of the tubes. The serum is transferred to a new tube and stored in aliquots at -20°C until use.
To remove the antibodies which react with the glutathione S-transferase (GST) the serum is passed over a glutathione-Sepharose 4B column which has been saturated with glutathione S-transferase using the procedure described above ("Expression of GST-PTP D1 fusion protein in E. coli). The pGEX-AK2 construct is used to produce the GST protein. The serum is passed three times over the column to ensure complete removal of the anti-GST antibodies. The efficiency of the removal is assessed by Western blotting as described below ("Detection of the Presence and Measurement of the Quantity of PTP-Dl in a Cell Line").
Detection of the Presence and Measurement of the Quantity of PTP-D1 in a Cell Line The anti-PTP D1 antibody can be used to detect the expression of PTP D1 in mammalian cells. Immunofluorescence according to standard procedures will provide information abut expression in specific cell lines and tissues. Even more importantly, this antibody preparation can be used to determine the quantity in cell lines and tissues. As an example of the latter application of the anti-PTP D1 antibody, the detection of PTP D1 in the RD cell line (American Type Culture Collection CCL 136) is described below. It should be emphasized that this EXAMPLE should not in any way limit the use of the antibody which can be used for detection of PTP D1 in other cells and tissues as well. Likewise, the antibody preparation can be useful in purification of PTP D1 and for establishing other types of detection assays.
Using standard techniques, the RD (embryonal rhabdomyosarcoma; human) cell line is cultured in minimum essential medium (Eagle; Cat. No.
041-022570, Gibco, Life Technologies Ltd., Paisley, Scotland) with twice the normal concentrations of amino acids and vitamins with Hanks' balanced salt solution and 10 percent (v/v) fetal calf serum (Gibco-BRL).
The cells are washed twice in phosphate buffered saline and the supernatant removed. The cells from one 10 cm tissue culture plate are lysed in 800 μl of Triton X100 lysis buffer (20 mM HEPES pH 7.5, 50 mM NaCl, 10 percent glycerol, 1.0 percent Triton X100, 1.5 mM MgCl2, 4 mM Ethylene Glycol-bis( β-aminoethylethyl ether) N,N,N',N'-tetraacetate (EGTA; Sigma ED2SS), 10 μg/ml aprotinin, 1 mM phenyl methylsulfonyl fluoride (PMSF)), centrifuged and the supernatant is stored in aliquots at -80°C until use. One to fifty μl of this lysate is mixed with 25 μl SDS sample buffer (62.5 mM Tris-Cl pH 7.0, 3.0 percent (w/v) SDS, 10 percent (v/v) glycerol, 10 percent 2-mercaptoethanol, and 0.05 percent (w/v) bromophenol blue), boiled for 5 minutes, separated by SDS-polyacrylamide gel electrophoresis (7.5 percent) and blotted onto nitrocellulose using standard techniques (Burnette, W.N. (1981) Anlyt. Biochem. 112:195-201). A standard curve for quantitative determination of PTP D1 is produced by using defined amounts of the E. coli-produced GST-PTP D1 fusion protein from above in parallel with the RD cell lysates. The nitrocellulose filters are incubated for 30 minutes with 2 grams milk powder (Carnation, Non fat dry milk, Carnation, Los Angeles) per liter phosphate buffered saline (PBS) to block unspecific binding, washed once in PBS containing 0.02 percent (v/v) Tween 20 (Sigma P1379) (PBS-Tween) and 0.2 percent (w/v) gelatin (BioRad Cat. No. 170-6537, Richmond, California), washed 3 times in PBS-Tween and finally incubated for 4 hours with a 1:200 dilution (in PBS-Tween) of the anti-PTP D1 antibody preparation from above. After three washings in PBS-Tween, the filters are incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (Cat. No. 170-6525, BioRad). The filters are washed three times in PBS-Tween and the amount of rabbit antibody, and thereby the amount of PTP D1, is determined by the enhanced chemiluminescence (ECL) technique according to the manufacturer's instructions (Cat. No. RPN 2106, Amersham, UK). By comparing the signals obtained from the RD cell line with the standard curve obtained with the E. coli produced GST-PTP D1 fusion protein it is possible to determine the amount of PTP D1 produced by the RD cell line. EXAMPLE 7
Identification of a Molecule That
Stimulates or Inhibits Enzymatic Activity of a PTP-D Protein or Glycoprotein The cDNA containing the entire coding region of PTP D1 or a functional portion thereof is inserted into the mammalian expression vector pcDNA I (Cat.. No. V490-20, Invitrogen, San Diego) using standard techniques (Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1988)). The 293 cell transient expression system described by Gorman et al., Virology 171:377-385 (1989) is used for production of enzymatically active PTP D1. Using standard techniques, the 293 cells are cultured in 5% CO2 at 37°C in Dulbecco's Modified Eagle Medium (Cat. No. a041-02430, Gibco, Life Technologies Ltd., Paisley, Scotland) supplemented with 10 percent (v/v) fetal calf serum (Gibco).
Ten μg of the plasmid construct PTP-D1/pcDNA I are mixed with 0.5 ml 0.25 M CaCl2 and 0.5 ml 2xBBS (50 mM N,N-bis(2-hydroxyethyl)-2-aminoethane-sulfonic acid (BES), 280 mM NaCl, 1.5 mM Na2HPO4) and used for transfection of 1.5 × 106 203 cells in a 10 cm Petri dish as described by Chen & Okayama (Mol. Cell. Biol. 7:2745-2752 (1987)). The cells are incubated 24 hours at 37°C under 3 % CO2 after the addition of the Ca-phosphate-DNA precipitate, then washed once in DMEM supplemented with 10 percent fetal calf serum and incubated in fresh medium for additional 24 hours at 37°C under 5 % CO2. The medium is removed and the cells lysed in 1.0 ml of lysis buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 10 percent glycerol, 1.0 percent Triton X100, 1.5 mM MgCl2, 4 mM Ethylene Glycol-bis( β-aminoethyIethyl ether) N,N,N',N'-tetraacetate (EGTA; Sigma ED2SS), 10 μg/ml aprotinin, 1 mM PMSF). The cell lysates are centrifuged at 2500xg for 2 minutes at 4°C. The supernatant is removed and 100 μl aliquots are quick-frozen in liquid nitrogen and stored at -70° C until use.
Three different substrates are used for the evaluation of potential inhibitors or stimulators of PTP-D 1 phosphatase activity: 1) p-nitrophenyl phosphate (pNP-P; Sigma 104-0); 2) 32P-labeled Raytide (Oncogene Science Inc., Manhasset, NY); 3) 32P-labeIed bovine myelin basic protein (MBP). Substances which either decrease or increase the activity of PTP-D1 against one or more of these substrates are analyzed further.
The activity of PTP-Dl towards pNP-P is measured essentially as described by N.K. Tonks et al., J. Biol. Chem. 263:6131-6131 (1988)). Using microtiter plates, ten μl of the 293 lysate from above are incubated with 100 μl of pNP-P (30 and 100 mM, respectively) at room temperature. The absorbance is read with one minute intervals in Dynatech MR5000 reader. The substances to be analyzed for stimulatory or inhibitory activities are added to the PTP-D1/293 cell lysate 5 minutes prior to the addition of pNP-P.
Labeling of Raytide and myeln basic protein with 32P
The activity of PTP-D1 towards 32P-labeled Raytide™ is measured essentially as described by Krueger et al. (EMBO J. 9:3241-3252 (1990)). The synthetic peptide Raytide is labeled with 32P using the tyrosine kinase p60c-arc according to the manufacturer's instructions (Oncogene Science) with minor modifications. In brief, 2 μl of p60c-arc are mixed with 20 μl Raytide (1 mg/ml) and 108 μl of kinase buffer (50 mM HEPES pH 7.5 containing 10 mM MgCl2, 0.2% (v/v) β-mercaptoethanol, 30 μM ATP and 50 μCi [γ-22P]ATP). The mixture is incubated at 37°C for 16 hours, and the reaction is stopped by addition of 500 μl of 20 percent (w/v) trichloroacetic acid (TCA) in 20 mM NaH2PO4 and 100 μl of 5 mg/ml of acetylated bovine serum albumin. The mixture is centrifuged, the precipitate is washed three times in 20 percent TCA/20 mM NaH2PO4, and finally redissolved in 0.2 M Tris-Cl pH 8.0.
Myelin basic protein (Sigma) is labeled with a procedure similar to that used for labeling of Raytide as described by Guan et al., Nature 350:359-362 (1991). Thirty μg of MBP is labeled in a 60 μl reaction containing the following components: 50 mM HEPES buffer pH 7.5,- 10 mM MgCl2, 0.067% β-mercaptoethanol, 0.05 mM ATP including 150 μCi [γ-32P]ATP and 4U p43v-abl kinase (Oncogene Science). The mixture is incubated for 60 minutes at 30°C, and the reaction is stopped by addition of ice-cold trichloroacetic acid to a final concentration of 20 percent. After 30 minutes on ice, the precipitate is washed three times in 20 percent TCA and redissolved in 100 μl H2O.
The PTPase activity assay using Raytide or MBP
Five μl 10x PTPase buffer (25 mM HEPES pH 7.3, 5 mM EDTA, 10 mM dithiothreitol) are mixed with a) 5 μl 32P-labeled Raytide or MBP (corresponding to 10-20 × 104 counts per minutes), b) 5, 10 and 25 μl, respectively, of the PTP-D1/293 cell lysate, and c) H2O to a final volume of 50 μl. The reaction is stopped after incubation for 30 minutes at 37°C. In the case of Raytide, the reaction is stopped by addition of 0.75 ml acidic charcoal mixture (Krueger et al, EMBO J. 9:3241-3252 (1990)): 0.9 M HCl, 90 mM sodium pyrophosphate, 2 mM NaH2PO4, 4% (v/v) Norit A (Sigma)). After mixing and centrifugation, 400 μl of the supernatant are removed and the amount of radioactivity measured. When using MBP as a substrate, the reaction is stopped by 20 percent TCA (final volume). The amount of 32P in the supernatant is then measured.
The substances to be analyzed for stimulatory or inhibitory activities are added to the PTP-D1/293 cell lysate 5 minutes prior to initiation of the assays. SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Ullrich, Axel
Moller, Niels P.H.
Moller, Karin B.
(ii) TITLE OF INVENTION: PTP-D SUBFAMILY OF PROTEIN TYROSINE
PHOSPHATASES
(iii) NUMBER OF SEQUENCES: 38
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Sterne, Kessler, Goldstein 4 Fox
(B) STREET: 1225 Connecticut Avenue, M.W.
(C) CITY: Washingtion
(D) STATE: D.C
(E) COUNTRY: U.S.A.
(F) ZIP: 20036
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) COMPUTER: IBM PC comestible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25
(vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: To be assigned
(B) FILING DATE: herewith
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Shaffer, Robin E.
(B) REGISTRATION NUMBER: 34,249
(C) REFERENCS/DOCKET NUMBER: 1406.0150000
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (202) 833-7533
(B) TELEFAX: (202) 833-8716
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS :
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE :
(A) NAME/KEY: Peptide
(B) LOCATION: 6
(D ) OTHER INFORMATION : /note= "This amino acid may be substituted with Asparagine"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
Asp Tyr Ile Asn Ala Ser
1 5 (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Cys Xaa Xaa Tyr Trp Pro
1 5
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS :
(A) LENGTH: 8 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 1
(D) OTHER INFORMATION: /note= "This amino acid may be substituted with Valine."
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3
Ile Val Met Xaa Xaa Xaa Xaa Glu
1 5
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Pepcide
(B) LOCATION: 1
(D) OTHER INFORMATION: /note= "This amino acid may be substituced with Asparagine."
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 6
(D) OTHER INFORMATION: /note= "This amino acid may be substituted with Asparagine."
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Asp Tyr Ile Asn Ala Ser
1 5 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 6
(D) OTHER INFORMATION: /notes "This amino acid may be substituted with Asparagine"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
Gly Tyr Ile Asn Ala Ser
1 5
(2) INFORMATION FOR SEQ ID NO : δ :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
Ser Xaa Xaa Tyr Trp Pro
1 5
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:
Ile Ala Met Val Xaa Xaa Xaa Xaa Glu
1 5
(2) INFORMATION FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 6
(D) OTHER INFORMATION: /note= "This amino acid may be substituted with Asparagine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 8 :
Asn Tyr Ile Asn Ala Ser
1 5
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 1
(D) OTHER INFORMATION: /note= "This amino acid may be substituted with either Valine or Leucine."
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 3
(D) OTHER INFORMATION: /note= "This amino acid may be substituted with either Isoleucine or Leucine."
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 4
(D) OTHER INFORMATION: /note= "This amino acid may be either Leucine, Isoleucine or Methionine."
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
Ile Val Met Val Xaa Xaa Xaa Xaa Glu
1 5
(2) INFORMATION FOR SEQ ID NO : 10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
ACTTTCTTGG ACGAGAGATG AGTTCGATGG 30
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 11 :
CCTCGAACTA GTCCATCGCA GCTGACAGTG 30
(2) INFORMATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12
Phe Trp Xaa Met Xaa Trp
1 5
(2) INFORMATION FOR SEQ ID NO: 13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(ix) FEATURE:
(A) NAME/KEY: Peptide
(B) LOCATION: 6
(D) OTHER INFORMATION: /note= "This amino acid may be substituted with either Isoleucine or Valine"
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 13:
His Cys Ser Ala Gly Ser Gly
1 5
(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
ATAGCAATGG TGACAGCAGA A 21
(2) INFORMATION FOR SEQ ID NO: 15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15:
Cys Tyr Ala Thr Thr Gly
1 5
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 16:
AGTCGACCTC GAGTTCGAGT TCGAGCAGTA AGCA 34
(2) INFORMATION FOR SEQ ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:
Gln Glu Arg Thr Val Trp
1 S
(2) INFORMATION FOR SEQ ID NO: 18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: bot
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
GGTTCGAACT CGAGTTCGAC TGTCT.CTCT 29
(2) INFORMATION FOR SEQ ID NO: 19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19 ATAGCAATGG TGACAGCAGA A 21
(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(B) LOCATION: 6
(D) OTHER INFORMATION: /note= "This nucleotide may be substituted with Guanine"
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(B) LOCATION: 8
(D) OTHER INFORMATION: /note= "This nucleotide may be substituted with Thymine."
(ix) FEATURE:
(A) NAME/KEY: misc_featuτe
(B) LOCATION: 9
(D) OTHER INFORMATION: /note= "This nucleotide may be substituted with Cytosine, Guanine or Adenine."
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(B) LOCATION: 12
(D) OTHER INFORMATION: /note= "This nucleotide may be substituted with Cytosine, Guanine or Adenine."
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(B) LOCATION: 15
(D) OTHER INFORMATION: /note= "This nucleocide may be substituted with Cytosine, Guanine or Adenine."
(ix) FEATURE:
(A) NAME/KEY: misc_feature
(B) LOCATION: 18
(D) OTHER INFORMATION: /note= "This nucleotide may be substituted with Adenine."
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
CGCCCAACTC CTGCTCTGCA GTG 23
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: GATCTCCGAA TTCCATGGAT CCAGGCCTCT AGAAGCTTAC 40
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
AATTGTAAGC TTCTAGAGGC CTGGATCCAT GGAATTCGGA 40
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 261
base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION; SEQ ID NO:23:
TTTTGGCAGA TGGTATGGGA ACAGGGAATT GCAATTATAG CAATGGTGAC AGCAGAAGAG 60
GAGGGTNGAN NGGAGAAGAG CTTTAGGTAC TGGCCACGAC TTGGTTCCAG GCACAACACT 120
GTCACCTATG GAAGGTTTAA GATCACGACC CGGTTCCGCA CAGACTCTGG CTGCTATGCC 180
ACCACAGGCC TGAAGATGAA GCACCTCCTT ACCGGGCAAG AGAGGACCGT CTGGCNNCTC 240
CAATACACAG ACTGGCCTGA A 261 (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 87 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Phe Trp Gln Met Val Trp Glu Gln Gly Ile Ala Ile Ile Ala Met Val 1 5 10 15
Thr Ala Glu Glu Glu Gly Xaa Xaa Glu Lys Ser Phe Arg Tyr Trp Pro
20 25 30
Arg Leu Gly Ser Arg His Asn Thr Val Thr Tyr Gly Arg Phe Lys Ile
35 40 45
Thr Thr Arg Phe Arg Thr Asp Ser Gly Cys Tyr Ala Thr Thr Gly Leu 50 55 60
Lys Met Lys His Leu Leu Thr Gly Gln Glu Arg Thr Val Trp Xaa Leu 65 70 75 80 Gln Tyr Thr Asp Trp Pro Glu
85
(2) INFORMATION FOR SEQ ID NO: 25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 270 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
TTCTGGCGGA TGATCTGGGA GCAGGGAGTG AATGTGATTG CCATGGTCAC TGCAGAGGAG 60
GAGGGTGGAC GAACCAAAAG CCACCGATAC TGGCCCAAAC TAGGTTCAAA GCACAGCTCA 120
GCCACCTATG GCAAGTTCAA GGTCACCACG AAGTTTCGAA CGGATTCTGT TTGCTATGCA 180
ACCACGGGCT TGAAGGTCAA GCACCTTTTG TCTGGGNAAG AAAGGACGGT GTGGCATTTA 240
CAATATACTG ACTGGCCTGA CTTCGGCGCC 270 (2) INFORMATION FOR SEQ ID NO: 26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 90 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO-.26:
Phe Trp Arg Met Ile Trp Glu Gln Gly Val Asn Val Ile Ala Met Val 1 5 10 15
Thr Ala Glu Glu Glu Gly Gly Arg Thr Lys Ser His Arg Tyr Trp Pro
20 25 30
Lys Leu Gly Ser Lys His Ser Ser Ala Thr Tyr Gly Lys Phe Lys Val
35 40 45
Thr Thr Lys Phe Arg Thr Asp Ser Val Cys Tyr Ala Thr Thr Gly Leu
50 55 60
Lys Val Lys His Leu Leu Ser Gly Xaa Glu Arg Thr Val Trs His Leu 65 70 75 80 Gln Tyr Thr Asp Trp Pro Asp Phe Gly Ala
85 90
(2) INFORMATION FOR SEQ ID NO: 27:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 60 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
Met Val Trp Glu Gln Lys Ser Arg Gly Val Val Met Leu Asn Arg Val 1 5 10 15
Met Glu Lys Gly Ser Leu Lys Cys Ala Gln Tyr Trp Pro Gln Lys Glu
20 25 30
Glu Lys Glu Met Ile Phe Glu Asp Thr Asn Leu Lys Leu Thr Leu Ile
35 40 45
Ser Glu Asp Ile Lys Ser Tyr Tyr Thr Val Arg Gln
50 55 60
(2) INFORMATION FOR SEQ ID NO: 28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
Met Val Trp Glu Gln Gly Ile Ala Ile Ile Ala Met Val Thr Ala Glu 1 5 10 15
Glu Glu Gly Xaa Xaa Glu Lys Ser Phe Arg Tyr Tro Pro Arg Leu Gly
20 25 30
Thr Arg His Asn Thr Val Thr Tyr Gly Arg Phe Lys Ile Thr Thr Arg
3S 40 45
Phe Arg Thr Asp Ser Gly Cys Tyr Ala Thr Thr Gly
50 55 60
(2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29:
Met Ile Trp Glu Gln Gly Val Asn Val Ile Ala Met Val Thr Ala Glu 1 5 10 15
Glu Glu Gly Gly Arg Ile Lys Ser His Arg Tyr Trp Pro Lys Leu Gly
20 25 30
Ser Lys His Ser Ser Ala Thr Tyr Gly Lys Phe Lys Val Thr Thr Lys 35 40 45
Phe Arg Thr Asp Ser Val Cys Tyr Ala Thr Thr Gly
50 55 60
(2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
Leu Glu Leu Glu Asn Leu Thr Thr Gln Glu Thr Arg Glu Ile Leu His 1 5 10 15
Phe His Tyr Thr Thr Trp Pro Asp Phe Gly Val Pro Glu Ser Pro Ala
20 25 30
Ser Phe Leu Asn Phe Leu Phe Lys Val Arg Glu Ser Gly Ser Leu Ser
35 40 45
Pro Glu His Gly Pro Val Val Val His Cys Ser Ala
SO 55 60
(2) INFORMATION FOR SEQ ID NO: 31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
Leu Lys Met Lys His Leu Leu Thr Gly Gln Glu Arg Thr Val Trp Xaa
1 5 10 15
Leu Gln Tyr Thr Asp Trp Pro Glu His Gly Cys Pro Glu
20 25
(2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
Leu Lys Val Lys His Leu Leu Ser Gly Xaa Glu Arg Thr Val Trp His 1 5 10 15
Leu Gln Tyr Thr Asp Trp Pro Asp Phe Gly Ala
20 25 (2) INFORMATION FOR SEQ ID NO: 33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 300 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
GATTTTTGGC AGATGGTATG GGAACAGGGA ATTGCAATTA TAGCAATGGT GACAGCAGAA 60
GAGGAGGGTN GANNGGAGAA GAGCTTTAGG TACTGGCCAC GACTTGGTTC CAGGCACAAC 120
ACTGTCACCT ATGGAAGGTT TAAGATCACG ACCCGGTTCC GCACAGACTC TGGCTGCTAT 180
GCCACCACAG GCCTGAAGAT GAAGCACCTC CTTACCGGGC AAGAGAGGAC CGTCTGGCNN 240
CTCCAATACA CAGACTGGCC TGAACATGGC TGTCCAGAAG ACCTCAAGGG ATTTTTATCA 300
(2) INFORMATION FOR SEQ ID NO: 34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 270 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34:
TTCTGGCGGA TGATCTGGGA GCAGGGAGTG AATGTGATTG CCATGGTCAC TGCAGAGGAG 60
GAGGGTGGAC GAACCAAAAG CCACCGATAC TGGCCCAAAC TAGGTTCAAA GCACAGCTCA 120
GCCACCTATG GCAAGTTCAA GGTCACCACG AAGTTTCGAA CGGATTCTGT TTGCTATGCA 180
ACCACGGGCT TGAAGGTCAA GCACCTTTTG TCTGGGNAAG AAAGGACGGT GTGGCATTTA 240
CAATATACTG ACTGGCCTGA CTTCGGCGCC 270 (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 150 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 35 :
Glu Trp Asp Tyr Ile Ala Thr Gln Gly Pro Leu Gln Asn Thr Cys Gln 1 5 10 15
Asp Phe Trp Gln Met Val Trp Glu Gln Gly Ile Ala Ile Ile Ala Met
20 25 30 Val Thr Ala Glu Glu Glu Gly Xaa Xaa Glu Lys Ser Phe Arg Tyr Trp 35 40 45
Pro Arg Leu Gly Ser Arg His Asn Thr Tyr Thr Tyr Gly Arg Phe Lys 50 55 60
Ile Thr Thr Arg Phe Arg Thr Asp Ser Gly Cys Tyr Ala Thr Thr Gly 65 70 75 80
Leu Lys Met Lys His Leu Leu Thr Gly Gln Glu Arg Thr Val Trp Xaa
35 90 95
Leu Gln Tyr Thr Asp Trp Pro Glu His Gly Cys Pro Glu Asp Leu Lys
100 105 110
Gly Phe Leu Ser Tyr Leu Glu Glu Ile Gln Ser Val Arg Arg His Thr
115 120 125
Asn Ser Thr Ser Asp Pro Gln Ser Pro Asn Pro Pro Leu Leu Val Xaa 130 135 140
Cys Ser Ala Gly Val Gly
145 ISO
(2) INFORMATION FOR SEQ ID NO: 36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 90 amino acids
(B) TYPE: amino acid
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: peptide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 36:
Phe Trp Arg Met Ile Trp Glu Gln Gly Val Asn Val Ile Ala Met Val 1 5 10 15
Thr Ala Glu Glu Glu Gly Gly Arg Thx Lys Ser His Arg Tyr Trp Pro
20 25 30
Lys Leu Gly Ser Lys His Ser Ser Ala Thr Tyr Gly Lys Phe Lys Val
35 40 45
Thr Thr Lys Phe Arg Thr Asp Ser Val Cys Tyr Ala Thr Thr Gly Leu 50 55 60
Lys Val Lys His Leu Leu Ser Gly Xaa Glu Arg Thr Val Trp His Leu 65 70 75 80 Gln Tyr Thr Asp Trp Pro Asp Phe Gly Ala
85 90
(2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 877 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: both
(D) TOPOLOGY: both
(ii) MOLECULE TYPE: DNA (xi ) SEQUENCE DESCRI PTION : SEQ ID NO : 37 :
GAATTCTTAA GAAACGGCTA GTTGATGGGG AGTGCTCAAC AGCACGACTC CCTGAAAATG 60
CAGAAAGAAA TCGATTCCAA GATGTTCTTC CTTATGATGA TGCGAGAGTG GAGTTGGTCC 120
CAACTAAAGA AAACAACACT GGTTACATCA ACGCATCACA TATTAAGGTC TCTGTCAGTG 180
GAATCGAATG GGATTATATT GCCACACAGG GACCATTACA GAATACCTGT CAAGATTTTT 240
GGCAGATGGT ATGGGAACAG GGAATTGCAA TTATAGCAAT GGTGACAGCA GAAGAGGAGG 300
GTNGANNGGA GAAGAGCTTT AGGTACTGGC CACGACTTGG TTCCAGGCAC AACACTGTCA 360
CCTATGGAAG GTTTAAGATC ACGACCCGGT TCCGCACAGA CTCTGGCTGC TATGCCACCA 420
CAGGCCTGAA GATGAAGCAC CTCCTTACCG GGCAAGAGAG GACCGTCTGG CNNCTCCAAT 480
ACACAGACTG GCCTGAACAT GGCTGTCCAG AAGACCTCAA GGGATTTTTA TCATATCTTG 540
AAGAGATCCA GTCTGTTCGA CGCCATACAA ATAGCACAAG TGATCCCCAA AGCCCCAACC 600
CTCCGTTGTT GGTCCACTGC AGTGCTGGGG TAGGAAGGAC TGGCGTGGTG ATTTTGTCGG 660
AGATCATGAT CGCCTGCCTG GAACACAATG AGGTGCTGGA CATCCCGAGA GTGCTGGACA 720
TGCTGAGGCA ACAGAGAATG ATGCTGGTGC AGACTCTCTG CCAGTACACA TTTGTGTACA 780
GAGTCCTCAT CCAGTTCCTG AAAAGCTCCA GGCTCATCTA AGCTCCCACA ATTTCTTACG 840
GGGCCAGTCA TGTGAAGCGT TTACAGCTTA AAAAAAAA 878 (2 ) INFORMATION FOR SEQ ID NO : 38 :
( i ) SEQUENCE CHARACTERISTI CS :
(A) LENGTH : 272 amino acids
(B) TYPE : amino acid
(D) TOPOLOGY : boch
( ii ) MOLECULE TYPE : pept ide
(xi ) SEQUENCE DESCRIPTION : SEQ ID NO : 38 :
Ile Leu Lys Lys Arg Leu Val Asp Gly Glu Cys Ser Thr Ala Arg Leu 1 5 10 15
Pro Glu Asn Ala Glu Arg Asn Arg Phe Gln Asp Val Leu Pro Tyr Asp
20 25 30
Asp Ala Arg Val Glu Leu Val Pro Thr Lys Glu Asn Asn Thr Gly Tyr
35 40 45
Ile Asn Ala Ser His Ile Lys Val Ser Val Ser Gly Ile Glu Trs Asp
50 55 60
Tyr Ile Ala Thr Gln Gly Pro Leu Gln Asn Thr Cys Gln Asp Phe Trp 65 70 75 80 Gln Met Val Trp Glu Gln Gly Ile Ala Ile Ile Ala Met Val Thr Ala
85 90 95
Glu Glu Glu Gly Xaa Xaa Glu Lys Ser Phe Arg Tyr Tro Pro Arg Leu
100 105 110
Gly Ser Arg His Asn Thr Val Thr Tyr Gly Arg Phe Lys Ile Thr Thr 115 120 125
Arg Phe Arg Thr Asp Ser Gly Cys Tyr Ala Thr Thr Gly Leu Lys Met 130 135 140
Lys His Leu Leu Thr Gly Gln Glu Arg Thr Val Trp Xaa Leu Gln Tyr 145 150 155 160
Thr Asp Trp Pro Glu His Gly Cys Pro Glu Asp Leu Lys Gly Phe Leu
165 170 175
Ser Tyr Leu Glu Glu Ile Gln Ser Val Arg Arg His Thr Asn Ser Thr
180 185 190
Ser Asp Pro Gln Ser Pro Asn Pro Pro Leu Leu Val His Cys Ser Ala
195 200 205
Gly Val Gly Arg Thr Gly Val Val Ile Leu Ser Glu Ile Met Ile Ala 210 215 220
Cys Leu Glu His Asn Glu Val Leu Asp Ile Pro Arg Val Leu Asp Met 225 230 235 240
Leu Arg Gln Gln Arg Met Met Leu Val Gln Thr Leu Cys Gln Tyr Thr
245 250 255
Phe Val Tyr Arg Val Leu Ile Gln Phe Leu Lys Ser Ser Arg Leu Ile
260 265 270

Claims

What is claimed is:
1. A PTP-D protein or glycoprotein, wherein when said PTP-D protein or glycoprotein is one which occurs in nature, said PTP-D protein or glycoprotein is substantially free of other proteins or glycoproteins with which it is natively associated.
2. The PTP-D protein or glycoprotein according to claim 1 comprising a catalytic phosphatase domain comprising one, two, or three amino acid sequences selected from
1. G Y I N A S/N [SEQ. ID NO. 5],
2. S X X Y W P [SEQ. ID NO. 6], and
3. I A M V X X X X E [SEQ. ID NO. 7].
3. The PTP-D protein or glycoprotein according to claim 1, which does not occur in nature.
4. The PTP-D protein or glycoprotein according to claim 3, which has deleted amino acids.
5. The PTP-D protein or glycoprotein according to claim 3, which has additional amino acids.
6. The PTP protein or glycoprotein according to claim 3, which has substituted amino acids.
7. The PTP-D protein or glycoprotein according to claim 1 , which occurs in nature and is substantially free of other proteins or glycoproteins with which it is natively associated.
8. The PTP-D protein or glycoprotein according to claim 1 comprising an amino acid sequence that has 70% or more homology with the amino acid sequence shown in Figure 1 of PTP-Dl.
9. The PTP-D protein or glycoprotein according to claim 8, which is PTD-D1.
10. The PTP-D protein or glycoprotein according to claim 1, comprising an amino acid sequence that has 70% or more identity with the amino acid sequence shown in Figure 2 of PTP-D2.
11. The PTP-D protein or glycoprotein according to claim 10, which is PTD-D2.
12. A recombinant nucleic acid construct comprising a nucleotide sequence encoding a PTP-D protein or glycoprotein.
13. The recombinant nucleic acid construct according to claim 12, which is a cDNA sequence.
14. The recombinant nucleic acid construct according to claim 12, which is a genomic DNA sequence.
15. The recombinant nucleic acid construct according to claim 12 having the nucleotide sequence of SEQ. ID: No. 23 (Figure 1).
16. The recombinant nucleic acid construct according to claim 12 having the nucleotide sequence of SEQ. ID: No. 25 (Figure 2).
17. The recombinant nucleic acid construct according to claim 12, which is an expression vehicle.
18. The recombinant nucleic acid construct of claim 17, which is a vector.
19. The recombinant nucleic acid construct of claim 17, which is a plasmid.
20. An isolated and purified nucleic acid construct comprising a nucleotide sequence encoding a PTP-D protein or glycoprotein.
21. The isolated and purified nucleic acid construct according to claim 20, having the nucleotide sequence of SEQ. ID: No. 23 (Figure 1).
22. The isolated and purified nucleic acid construct according to claim 20, having the nucleotide sequence of SEQ. ID: No. 25 (Figure 2).
23. A procaryotic host cell transformed with the nucleic acid construct of claim 17.
24. The prokaryotic host cell according to claim 23, which is a bacterium.
25. A eukaryotic host cell transformed with the nucleic acid construct of claim 17.
26. The eukaryotic host cell according to claim 25, which is a yeast cell or a mammalian cell.
27. A method for preparing a PTP-D protein or glycoprotein, comprising:
(a) culturing a host cell capable of expressing said PTP-D protein or glycoprotein under culturing conditions; (b) expressing said PTP-D protein or glycoprotein; and
(c) recovering said PTP-D protein or glycoprotein from said culture.
28. The method according to claim 27 wherein said host cell is a prokaryote.
29. The method according to claim 27 wherein said host cell is a eukaryote.
30. An antibody specific for a PTP-D molecule.
31. The antibody according to claim 30 which is monoclonal.
32. The antibody according to claim 30 which is polyclonal.
33. A method for detecting the presence of or measuring the quantity of a PTP-D protein or glycoprotein in a cell, said method comprising:
(a) contacting said cell or an extract thereof with an antibody specific for an epitope of a PTP-D protein or glycoprotein; and (b) detecting the binding of said antibody to said cell or extract thereof, or measuring the quantity of antibody boudd, thereby determining the presence of or measuring the quantity of said PTP-D protein or glycoprotein.
34. A method for detecting the presence of a nucleic acid sequence encoding a PTP-D protein, or a nucleic acid construct encoding a mutant PTP- D protein or glycoprotein, in a cell or a subject, comprising: (a) contacting a cell or an extract thereof from said subject with an oligonucleotide probe encoding at least a portion of said PTP-D protein or glycoprotein or at least a portion of said mutant PTP- D protein or glycoprotein under hybridizing conditions; and (b) measuring the hybridization of said probe to nucleic acid of said cell,
thereby detecting the presence of said nucleic acid construct.
35. The method of claim 34, additionally comprising before step (a):
(c) selectively amplifying the amount of said nucleic acid of said cell encoding said PTP-D protein or glycoprotein.
36. A method for identifying in a chemical or biological preparation a compound capable of binding to a PTP-D protein or glycoprotein, said method comprising:
(a) attaching said PTP-D protein or glycoprotein, or the compound- binding portion thereof to a solid phase matrix;
(b) contacting said chemical or biological preparation with said solid phase matrix allowing said compound to bind, and washing away any unbound material; and
(c) detecting the presence of said compound bound to said solid phase.
37. A method for isolating from a complex mixture a compound capable of binding to a PTP-D protein or glycoprotein, said method comprising:
(a) attaching said PTP-D protein or glycoprotein, or a compound- binding portion thereof, to a solid phase matrix; (b) contacting said complex mixture with said solid phase matrix allowing said compound to bind, and washing away any unbound material; and
(c) eluting said bound compound,
thereby isolating said compound.
38. A method for identifying a molecule capable of stimulating or inhibiting the enzymatic activity of a PTP-D protein or glycoprotein, said method comprising:
(a) contacting said compound with said PTP-D protein or glycoprotein in pure form, in a membrane preparation, or in a whole live or fixed cell;
(b) incubating said mixture of step (a) for a sufficient interval;
(c) measuring the enzymatic activity of said PTP-D protein or glycoprotein;
(d) comparing said enzymatic activity to that of said PTP-D protein or glycoprotein incubated without said compound,
thereby determining whether said PTP-D protein or glycoprotein stimulates or inhibits said activity.
39. The method according to claim 38, wherein said PTP-D protein or glycoprotein in step (a) is a fragment of a PTP-D protein or glycoprotein.
40. A pharmaceutical composition for treating or preventing a disease with abnormal PTP-D protein or glycoprotein, said composition comprising a PTP-D protein or glycoprotein and a pharmaceutically acceptable carrier.
41. A pharmaceutical composition for treating or preventing a disease with abnormal PTP-D protein or glycoprotein, said composition comprising a molecule in an amount effective to stimulate or inhibit enzymatic activity of a PTP-D protein or glycoprotein.
42. A method for treating or preventing a disease with abnormal PTP-D protein or glycoprotein in a subject, comprising administering to said subject said composition according to claim 40.
43. A method for treating or preventing a disease with abnormal PTP-D protein or glycoprotein in a subject, comprising administering to said subject said composition according to claim 41.
44. A pharmaceutical composition comprising a PTP-D protein or glycoprotein and a pharmaceutically acceptable carrier.
45. A pharmaceutical composition comprising a molecule in an amount effective to stimulate or inhibit enzymatic activity of a PTP-D protein or glycoprotein.
46. A method for treating or preventing a disease in a subject, comprising administering to said subject said composition according to claim
44.
47. A method for treating or preventing a disease in a subject, comprising administering to said subject said composition according to claim 45.
PCT/EP1993/002086 1992-08-05 1993-08-05 Ptp-d subfamily of protein tyrosine phosphatases WO1994003611A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
JP6505020A JPH08501934A (en) 1992-08-05 1993-08-05 PTP-D subfamily of protein tyrosine phosphatases
DE69332883T DE69332883T2 (en) 1992-08-05 1993-08-05 PTP-D SUBCLASS OF THE PROTEIN TYROSIN PHOSPHATASEN
AU47077/93A AU4707793A (en) 1992-08-05 1993-08-05 Ptp-d subfamily of protein tyrosine phosphatases
EP93917752A EP0654083B1 (en) 1992-08-05 1993-08-05 Ptp-d subfamily of protein tyrosine phosphatases
AT93917752T ATE237688T1 (en) 1992-08-05 1993-08-05 PTP-D SUBCLASS OF PROTEIN TYROSINE PHOSPHATASES
DK93917752T DK0654083T3 (en) 1992-08-05 1993-08-05 PTP-D subfamily of protein tyrosine phosphatases

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US92374092A 1992-08-05 1992-08-05
US07/923,740 1992-08-05

Publications (2)

Publication Number Publication Date
WO1994003611A2 true WO1994003611A2 (en) 1994-02-17
WO1994003611A3 WO1994003611A3 (en) 1994-03-31

Family

ID=25449193

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1993/002086 WO1994003611A2 (en) 1992-08-05 1993-08-05 Ptp-d subfamily of protein tyrosine phosphatases

Country Status (13)

Country Link
US (2) US5955592A (en)
EP (1) EP0654083B1 (en)
JP (1) JPH08501934A (en)
CN (1) CN1091139A (en)
AT (1) ATE237688T1 (en)
AU (1) AU4707793A (en)
CA (1) CA2141847A1 (en)
DE (1) DE69332883T2 (en)
DK (1) DK0654083T3 (en)
ES (1) ES2196010T3 (en)
MX (1) MX9304769A (en)
PT (1) PT654083E (en)
WO (1) WO1994003611A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000018890A2 (en) * 1998-09-30 2000-04-06 Millennium Pharmaceuticals, Inc. Protein phosphatase molecules and uses therefor
US6436685B1 (en) 1998-09-30 2002-08-20 Millennium Pharmaceuticals, Inc. CSAPTP protein molecules and uses therefor
WO2012000976A1 (en) * 2010-07-02 2012-01-05 Topogen Inc. Method for diagnosis of bladder cancer and related kits

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6200807B1 (en) 1999-07-21 2001-03-13 Isis Pharmaceuticals Inc. Antisense inhibition of SHP-2 expression
US7313542B1 (en) * 1999-10-06 2007-12-25 Paymentech, L.P. System and method for processing retrieval requests
EP1244672B1 (en) * 1999-12-21 2005-07-20 Sugen, Inc. 4-substituted 7-aza-indolin-2-ones and their use as protein kinase inhibitors
CA2397502A1 (en) * 2000-03-02 2001-09-07 Human Genome Sciences, Inc. Serine/threonine phosphatase polynucleotides, polypeptides, and antibodies
CA2413156C (en) * 2000-07-03 2009-08-18 Gala Design, Inc. Expression vectors
US20030224415A1 (en) * 2001-06-29 2003-12-04 Gala Design, Inc. Selection free growth of host cells containing multiple integrating vectors
US6852510B2 (en) 2000-07-03 2005-02-08 Gala Design Inc Host cells containing multiple integrating vectors
MXPA03008959A (en) 2001-04-02 2004-10-15 Wyeth Corp Pd-1, a receptor for b7-4, and uses therefor.
EP1448587B1 (en) * 2001-10-01 2009-09-02 Mount Sinai School of Medicine Noonan syndrome gene
US20040038304A1 (en) * 2002-03-28 2004-02-26 Gala Design, Inc. Antibody libraries
US7384738B2 (en) * 2002-03-28 2008-06-10 Bremel Robert D Retrovirus-based genomic screening
US20050221429A1 (en) * 2004-01-16 2005-10-06 Cardinal Health Pts, Llc Host cells containing multiple integrating vectors comprising an amplifiable marker
US20090111786A1 (en) * 2004-12-03 2009-04-30 Glass Christopher K Compounds that Prevent Macrophage Apoptosis and Uses Thereof
WO2014022759A1 (en) 2012-08-03 2014-02-06 Dana-Farber Cancer Institute, Inc. Agents that modulate immune cell activation and methods of use thereof
CN108350030B (en) * 2015-09-10 2022-12-13 汉阳大学校产学协力团 Skin permeable peptides and methods of use thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991013173A1 (en) * 1990-03-02 1991-09-05 Applied Biotechnology, Incorporated PTPase DIAGNOSTICS AND USES THEREOF
WO1991013989A1 (en) * 1990-03-14 1991-09-19 Washington Research Foundation Methods and compositions for the treatment of malignancies in which a protein kinase is associated

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0538401B1 (en) * 1990-07-11 1999-07-28 New York University Novel receptor-type phosphotyrosine phosphatase

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991013173A1 (en) * 1990-03-02 1991-09-05 Applied Biotechnology, Incorporated PTPase DIAGNOSTICS AND USES THEREOF
WO1991013989A1 (en) * 1990-03-14 1991-09-19 Washington Research Foundation Methods and compositions for the treatment of malignancies in which a protein kinase is associated

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
EMBO JOURNAL vol. 9, no. 10 , 1990 , EYNSHAM, OXFORD GB pages 3241 - 3252 KRUEGER N. X. ET AL. 'Structural diversity and evolution of human receptor-like protein tyrosine phosphatases' cited in the application *
IMMUNOGENETICS vol. 33, no. 1 , January 1991 pages 33 - 41 MATTHEWS R. J. ET AL. 'Protein tyrosine phosphatase domains from the protochordate Styela plicata' & EMBL Database, entry SPPTPAO Accession number M38000; 01 May 1991 *
JOURNAL OF BIOLOGICAL CHEMISTRY. (MICROFILMS) vol. 263, no. 14 , May 1988 , BALTIMORE, MD US pages 6731 - 6737 TONKS, N. K. ET AL. 'Characterization of the major protein-tyrosine-phosphatases of human placenta' cited in the application *
NATURE vol. 350 , 28 March 1991 , LONDON GB pages 359 - 362 GUAN K. ET AL. 'A Tyr/Ser protein phosphatase encoded by vaccinia virus' cited in the application *
SCIENCE vol. 259 , 12 March 1993 , LANCASTER, PA US pages 1611 - 1614 VOGEL, W. ET AL. 'Activation of a phosphotyrosine phosphatase by tyrosine phosphorylation' *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000018890A2 (en) * 1998-09-30 2000-04-06 Millennium Pharmaceuticals, Inc. Protein phosphatase molecules and uses therefor
WO2000018890A3 (en) * 1998-09-30 2000-09-28 Millennium Pharm Inc Protein phosphatase molecules and uses therefor
US6436685B1 (en) 1998-09-30 2002-08-20 Millennium Pharmaceuticals, Inc. CSAPTP protein molecules and uses therefor
WO2012000976A1 (en) * 2010-07-02 2012-01-05 Topogen Inc. Method for diagnosis of bladder cancer and related kits

Also Published As

Publication number Publication date
ATE237688T1 (en) 2003-05-15
MX9304769A (en) 1994-05-31
US5831009A (en) 1998-11-03
JPH08501934A (en) 1996-03-05
EP0654083B1 (en) 2003-04-16
WO1994003611A3 (en) 1994-03-31
ES2196010T3 (en) 2003-12-16
DE69332883T2 (en) 2004-01-22
PT654083E (en) 2003-08-29
CN1091139A (en) 1994-08-24
DE69332883D1 (en) 2003-05-22
AU4707793A (en) 1994-03-03
US5955592A (en) 1999-09-21
CA2141847A1 (en) 1994-02-17
EP0654083A1 (en) 1995-05-24
DK0654083T3 (en) 2003-08-11

Similar Documents

Publication Publication Date Title
US6548641B1 (en) PTP 1D: a novel protein tyrosine phosphatase
EP0654083B1 (en) Ptp-d subfamily of protein tyrosine phosphatases
EP1038963B1 (en) Cyclic GMP-binding, cyclic GMP-specific phosphodiesterase materials and methods
EP0690918B1 (en) Protein tyrosine phosphatase ptp-s31
EP0538401B1 (en) Novel receptor-type phosphotyrosine phosphatase
US5856162A (en) Receptor-type phosphotyrosine phosphatase-κ
US5538886A (en) Receptor-type phosphotyrosine phosphatase-alpha
US5604094A (en) Receptor-type phosphotyrosine phosphatase-β
US5888794A (en) Receptor-type phosphotyrosine phosphatase-alpha
US5532123A (en) Receptor-type phosphotyrosine phosphatase-γ
US20050036999A1 (en) Novel receptor-type phosphotyrosine phosphatase-alpha
WO1998001475A1 (en) Growth factor receptor-binding insulin receptor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AT AU BB BG BR BY CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU MG MN MW NL NO NZ PL PT RO RU SD SE SK UA

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

AK Designated states

Kind code of ref document: A3

Designated state(s): AT AU BB BG BR BY CA CH CZ DE DK ES FI GB HU JP KP KR KZ LK LU MG MN MW NL NO NZ PL PT RO RU SD SE SK UA

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2141847

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1993917752

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1993917752

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 1993917752

Country of ref document: EP