WO1993020214A1 - Heterologous gene expression in bacillus subtilis: fusion approach - Google Patents

Heterologous gene expression in bacillus subtilis: fusion approach Download PDF

Info

Publication number
WO1993020214A1
WO1993020214A1 PCT/US1993/003018 US9303018W WO9320214A1 WO 1993020214 A1 WO1993020214 A1 WO 1993020214A1 US 9303018 W US9303018 W US 9303018W WO 9320214 A1 WO9320214 A1 WO 9320214A1
Authority
WO
WIPO (PCT)
Prior art keywords
lipase
apre
bacilluε
gene
mature
Prior art date
Application number
PCT/US1993/003018
Other languages
French (fr)
Inventor
Scott D. Power
Johanna M. A. Van Kimmenade
Louann P. Carlomagno
Original Assignee
Genencor International, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genencor International, Inc. filed Critical Genencor International, Inc.
Priority to DK93908693T priority Critical patent/DK0646177T3/en
Priority to DE69333341T priority patent/DE69333341T2/en
Priority to JP51766293A priority patent/JP3432224B2/en
Priority to EP93908693A priority patent/EP0646177B1/en
Priority to CA002133338A priority patent/CA2133338C/en
Publication of WO1993020214A1 publication Critical patent/WO1993020214A1/en
Priority to FI944524A priority patent/FI944524A0/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C12N9/20—Triglyceride splitting, e.g. by means of lipase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the present invention relates to the expression of lipase (cutinase) from Bacillus microorganisms and the purification of cutinase from the fermentation broth.
  • the present invention describes the expression of the gram- negative Pseudomonas mendocina. lipase (cutinase) in Bacillus subtili ⁇ , a gram-positive organism.
  • the enzyme is produced as a fusion with aprE (prepro Bacillus subtilis subtilisin) .
  • aprE prepro Bacillus subtilis subtilisin
  • the mature coding sequence for lipase as described in commonly owned US Application SN 07/932,950 incorporated herein by reference, was fused to the prosequence of aprE at (and including) prosequence residues A(-l) , Al, G2, K3, S4, S5, T6, E7, K8, K9, 111 and K27.
  • the resulting constructions were integrated into the chromosome of a Bacillus subtilis production host (BB8) and after transduction or transformation to SacU(Hy) phenotype, the production efficiency of each strain was measured as described herein.
  • the present invention relates to the expression of heterologous genes in a Bacillus microorganism wherein one or more fusions are sequentially made, said fusions comprising a host signal sequence, a host pro sequence and a target gene sequence. Further provided is the expression of lipase (cutinase) in Bacillus .using a pro otor derived from Bacillus subtilis and terminator derived from Bacillus amyloliquefacien ⁇ .
  • Figure 1 shows the key elements of signal sequence secondary structure.
  • Figure 2 shows lipase production rate of certain fusions (G2 and K3) in B. subtilis .
  • Figure 3 shows expression of Pseudomona ⁇ mendocina lipase (cutinase) in B . subtilis .
  • Figure 4 describes the construction of: ( Figure 4a) pApr-cut- 1; ( Figure 4b) pAK-K3; ( Figure 4c) pAK-G2, pAK-Al, pAK-A(-l) ; ( Figure 4d) pAK-K9, pAK-K27; ( Figure 4e) pAK-S4, S5, T6, E7, K8, 111.
  • Figure 5 shows the plasmid ap of pAK-K3.
  • the secretion of proteins from bacteria is an ATP-dependent process which involves the translocation of a pre-protein and the subsequent proteolytic cleavage of the pre-protein on the outside surface of the membrane, into the mature enzyme.
  • the pre-protein consists of an N-terminal, signal peptide of 20 (gram-negative) to 40 amino acids [Mountain, A. (1989) Bacillus (C.R. Harwood, ed.). Plenum, New York, 73-114] and a C-terminal mature protein. Signal sequences exhibit only restricted, if any primary sequence homology, even within a single organism, yet conserve secondary structural homology as shown in Figure 1.
  • the three domains of the signal peptide are first the N- terminal, positively charged region, the hydrophobic central region, and the non-helical, carboxy terminal domain.
  • gram-positive organisms tend to have larger N and C-terminal domains than those of gram-negative organisms, such as E. coli, maintaining the central hydrophobic core of approximately the same length.
  • This signal sequence is thought to contain all of the information necessary to target the protein to the membrane for translocation.
  • a key feature of the pre-enzyme is that it must be in a translocation-competent form, perhaps loosely folded, which can be maintained via an interaction with chaperonin proteins [see: Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Kumamoto, CA. , and Beckwith, J. (1983) J.Bacteriol. 154:253-260; Kumamoto, CA. and Nault, A.K.
  • the aprE, signal/pro sequence junction occurs between codons 29(Ala) and 30(Ala).
  • the fusion of the mature lipase (cutinase) to aprE codon 29 is thus called pAK-A(-l) indicating that the lipase (cutinase) has been fused to the last residue of the signal peptide.
  • pAK-Al the fusion of mature lipase (cutinase) to aprE codon 30 is called pAK-Al indicating that the lipase (cutinase) has been fused to the first residue of the prosequence.
  • the lipase (cutinase) gene (as described in US Patent Nos. 4,933,287 and 5,030,240 and US Patent Application Serial No. 629,308, all incorporated herein by reference) was cloned into a M13 plasmid as a Hindlll SphI fragment (M131ip) ; a PstI site and three codons (A,G,K) were introduced at the beginning of the mature coding sequence by site-directed mutagenesis (T.A. Kunkel, PNAS (1985), Vol. 82, pp. 488-492) using single- stranded synthetic primer IB (Seq ID No: 2) .
  • the aprE gene from pS168-l (M.L.
  • pJHIOl E. Ferrari, et al., J.Bact. Vol. 154, pp. 1513-1515
  • Bacillus amyloliquefacien ⁇ subtilisin transcriptional terminator Wells, et al., Nucleic Acid Research (1983), Vol. 11, pp. 7911-7925 on a Hindlll- BamHI fragment (pJHIOl-term) ) .
  • the EcoRI-PvuII DNA fragment containing the aprE promoter, signal sequence and the 5' end of the lipase gene and the PvuII-Aval DNA fragment containing the 3* end of the lipase gene were isolated from pApr-cut-1.
  • the Aval 5 1 overhang of the PvuII-Aval fragment of the lipase gene was filled in by T4 polymerase prior to the PvuII digest (Sambrook, et al. , Molecular Cloning, a Laboratory Manual, ibid) .
  • the plasmid pJHIOl-term (with the terminator) was digested with EcoRI-Hindlll and the Hindlll 5' overhang was also filled in with T4 polymerase prior to the EcoRI digest.
  • the EcoRI-PvuII fragment, the PvuII-Aval fragment and the EcoRI-Hindlll digested vector were ligated to create pAK-K3.
  • the EcoRI-Asp718 DNA fragment from pAK-K3 was cloned into an M13 plasmid and the codons coding for K, the 3rd amino acid of the prosequence of aprE (K3) , G and K, the 2nd and 3rd amino acid of the prosequence of aprE (G2-K3) and A, G and K, the 1st, 2nd and 3rd amino acid of the prosequence of aprE (A1-G2- K3) were deleted by site-directed mutagenesis using the single-stranded synthetic primers 2,3 and 4 respectively (Seq ID Nos: 3, 4 and 5 respectively).
  • the lipase (cutinase) gene was cloned into an M13 plasmid as an Hindlll- SphI fragment (M13lip) and five codons (S,T,E,K,K) and a Sad site were introduced in front of the mature lipase gene using primer 6B (Seq ID No: 7 in the mutagenesis procedure.
  • the aprE gene from pS168-l (M.L. Stahl, et. al., J.Bact. (1984), Vol. 158, pp.
  • the resulting EcoRI-SacI fragment of the aprE gene and the Sacl-Asp718 fragment of lipase (cutinase) were isolated from the M13 plasmids and cloned into EcoRI-Asp718 digested pAK-K3 vector.
  • the resulting plasmid (AK-K9) contains the mature lipase (cutinase) gene fused to the 9th amino acid (K9) in the prosequence of the aprE gene.
  • the Sad site was introduced at the 22nd codon of the prosequence of aprE (S22) using single-stranded synthetic primer 7A (Seq ID No: 8) .
  • Five codons (S,A,K,K,K) and a Sad site were introduced in front of the mature lipase gene using single- stranded synthetic primer 7B (Seq ID No: 9) .
  • the resulting EcoRI-SacI fragment of the aprE gene and the Sacl-Asp718 fragment of lipase (cutinase) were isolated from the M13 plasmids and cloned into an EcoRI-Asp718 digested pAK- K3 vector.
  • the resulting plasmid (AK-K27) contains the mature lipase (cutinase) gene fused to the 27th amino acid (K27) in the prosequence of the aprE gene.
  • Two complementary single-stranded synthetic DNA strands coding for the fusion junction were synthesized for each construction, containing the 21 bp of the upstream aprE gene sequence followed by the 20 bp of the downstream lipase (cutinase) gene sequence.
  • Primer 13 (Seq ID No: 20) , a single-stranded synthetic primer which codes for the positive strand, is complementary to the aprE promoter and contains an EcoRI site.
  • Primer 14 (Seq ID No: 21) , a single-stranded synthetic primer which codes for the negative strand, is complementary to the lipase (cutinase) gene and contains an Asp718 site.
  • Primers 13 (Seq ID No: 20) and 14 (Seq ID No: 21) were used in all constructions.
  • a set of three PCR reactions were done as follows. DNA between the promoter and fusion point was amplified using primer 13 (Seq ID No: 20) and the single-stranded synthetic primer coding for the negative strand of the fusion junction (A); the template was an EcoRI-Hindlll fragment from pS168-l, containing the aprE promoter, signal sequence, pro sequence and the 5' of the mature gene (reaction 1).
  • the DNA between the fusion point and mature lipase gene was amplified using primer 14 (Seq ID No: 21) and the single-stranded synthetic primer coding for the positive strand of the fusion junction (B) ; the template was a 1:100 dilution of a standard DNA miniscreen of plasmid pAK-K3 (reaction 2) .
  • the DNA fragments from reaction 1 were fused to the DNA fragments from reaction 2 by amplification with primers 13 (Seq ID No: 20) and 14 (Seq ID No: 21) , using 1 ul of each reaction 1 and 2 (reaction 3) .
  • the A and B pairs of fusion primers used for the S4, S5, T6, K8, 111 and E7 constructions were numbers 8A&B, 9A&B, 10A&B, 11A&B, 12A&B and 15A&B respectively (Seq ID Nos: 10-19 and 22 and 23 respectively) .
  • Transformation into Bacillus ⁇ ubtili ⁇ The plasmids containing the different fusions were transformed into Bacillu ⁇ ⁇ ubtili ⁇ (Anagnostopoulos, C. , J.Bact. (1961) 81:741-746) and integrated into the chromosome specifically within the aprE locus by a Campbell-type mechanism (Young, M. , J.Gen.Microbiol.
  • the Bacillu ⁇ strain (BB8) was a derivative of 1168 which had been deleted for 5 proteases, and estB (delta apr, delta npr, delta bpF, delta epr, isp-1, delta estB) . Deletion of the genes indicated were introduced using the method as described in Stahl, M.L., J.Bact. (1984) 158:411-4181 After transformation with the fusion gene, the sacU(Hy) (Henner, D.J., Ferrari, E. , Perego, M. and Hoch, J.A. , J.Bact.
  • P ⁇ eudomona ⁇ mendocina lipase (cutinase) is assayed with ImM p-nitrophenylbutyrate in 0.2M Hepes buffer at pH 7.0.
  • the results were converted to mg/ml based upon a specific activity of .060(mg/mL) /Unit.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

There are described processes for expressing a lipase in a heterologous host. Further described are transformed cells comprising heterologous DNA and particular plasmids containing heterologous fusion DNA constructs.

Description

HETEROLOGOUS GENE EXPRESSION IN BACILLUS SUBTILIS: FUSION APPROACH
Cross-Reference to Related Applications
This application is related to US Application Serial No. 07/800,365 filed November 27, 1991, which is a continuation-in- part of US Application Serial No. 07/600,836 filed October 22, 1990, which is a continuation of US Patent Application Serial No. 07/341,200 filed March 29, 1989, now US Patent No. 4,981,611, which, in turn, is derived from PCT Application Serial No. PCT/US88/01844 filed May 31, 1988, which, in turn, claims priority under 35 USC §120 from US Patent Application Serial No. 07/056,500 filed May 29, 1987 (now abandoned). Each of the above applications are incorporated herein by reference in their entirety.
Field of the Invention
The present invention relates to the expression of lipase (cutinase) from Bacillus microorganisms and the purification of cutinase from the fermentation broth.
Background of the Invention
The secretion of heterologous proteins from any host requires the precise matching of signal peptide and mature target gene. Although gram-positive signal sequences are known to function well in gram-negative systems, the inverse is not true [Mountain, A. (1989) Bacillus (Biotechnology Handbooks 2, C.R. Harwood, ed.), Plenum Press, pp. 73-114]. In the case of Bacillus subtilis, it has been possible to secrete proteins derived from other gram-positive organisms; however, even in these situations, the best yields have been obtained with hybrid sequences. There has been no documented success in Bacillus for expressing large quantities of gram-negative derived proteins utilizing their own signal sequences; in addition, success with hybrid sequences has been minimal. [Mountain, A. (1989) Bacillus (Biotechnology Handbooks 2, C.R. Harwood, ed.), Plenum Press, pp. 73-114.]
There have been various attempts in the literature to optimize signal peptide: ature gene fusions (cf. Doi, R.H., Wong, S. and awamura, F. (1986) Trends Biotechnol. Sept. :232-235; Fahnestock, S.R. and Fisher, K.E. (1986) J.Bact. 165:796-804; Fahnestock, S.R. and Fisher, K.E. (1987) Appl.Env.Microbiol. 53:379-384; Sarvas, M. (1986) Curr.TopicsMicro.Immun. 125:103- 125; Ulmanen, I., Lundstrom, K. , Lehtovaara, P., Sarvas, M. , Ruohonen, M. and Palva, I. (1985) J.Bact. 162:176-182; Vasantha, N. and Thompson, L.D. (1986) J.Bact. 165:837-842); however, in all cases, the points of fusion were chosen on the basis of either convenient restriction sites or by merely mating the gram-positive signal sequence to the target gene directly at the signal cleavage site.
The present invention describes the expression of the gram- negative Pseudomonas mendocina. lipase (cutinase) in Bacillus subtiliε, a gram-positive organism. The enzyme is produced as a fusion with aprE (prepro Bacillus subtilis subtilisin) . Using polymerase chain reaction techniques, the mature coding sequence for lipase, as described in commonly owned US Application SN 07/932,950 incorporated herein by reference, was fused to the prosequence of aprE at (and including) prosequence residues A(-l) , Al, G2, K3, S4, S5, T6, E7, K8, K9, 111 and K27. The resulting constructions were integrated into the chromosome of a Bacillus subtilis production host (BB8) and after transduction or transformation to SacU(Hy) phenotype, the production efficiency of each strain was measured as described herein.
Summary of the Invention
The present invention relates to the expression of heterologous genes in a Bacillus microorganism wherein one or more fusions are sequentially made, said fusions comprising a host signal sequence, a host pro sequence and a target gene sequence. Further provided is the expression of lipase (cutinase) in Bacillus .using a pro otor derived from Bacillus subtilis and terminator derived from Bacillus amyloliquefacienε .
Still further provided are specific fusions of the mature lipase gene with the Bacillus subtilis aprE gene. These specific fusions may be introduced into plasmid vectors which are then transformed into B . subtilis .
Brief Description of the Drawings
Figure 1 shows the key elements of signal sequence secondary structure.
Figure 2 shows lipase production rate of certain fusions (G2 and K3) in B. subtilis .
Figure 3 shows expression of Pseudomonaε mendocina lipase (cutinase) in B . subtilis .
Figure 4 describes the construction of: (Figure 4a) pApr-cut- 1; (Figure 4b) pAK-K3; (Figure 4c) pAK-G2, pAK-Al, pAK-A(-l) ; (Figure 4d) pAK-K9, pAK-K27; (Figure 4e) pAK-S4, S5, T6, E7, K8, 111.
Figure 5 shows the plasmid ap of pAK-K3.
Detailed Description of the Invention A. Secretion of Proteins from Bacteria
The secretion of proteins from bacteria is an ATP-dependent process which involves the translocation of a pre-protein and the subsequent proteolytic cleavage of the pre-protein on the outside surface of the membrane, into the mature enzyme. The pre-protein consists of an N-terminal, signal peptide of 20 (gram-negative) to 40 amino acids [Mountain, A. (1989) Bacillus (C.R. Harwood, ed.). Plenum, New York, 73-114] and a C-terminal mature protein. Signal sequences exhibit only restricted, if any primary sequence homology, even within a single organism, yet conserve secondary structural homology as shown in Figure 1. The three domains of the signal peptide are first the N- terminal, positively charged region, the hydrophobic central region, and the non-helical, carboxy terminal domain. As will be discussed below, gram-positive organisms tend to have larger N and C-terminal domains than those of gram-negative organisms, such as E. coli, maintaining the central hydrophobic core of approximately the same length. This signal sequence is thought to contain all of the information necessary to target the protein to the membrane for translocation. [See: Mountain, A. (1989) Bacillus (C.R. Harwood, ed.) , Plenum, New York, 73-114; Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Schatz, P.J. and Beckwith, J. (1983) J.Bacteriol. 154:253-260.]
In the first step of secretion, as documented for the gram- negative E. coli, the newly synthesized pre-protein, potentially with a chaperonin (secB, groEL, etc.), is thought to be recognized by the membrane bound receptor ATP-ase (secA) , which couples the hydrolysis of ATP to the translocation of the protein through an integral membrane complex (secE/Y) [cf. Mountain, A. (1989) Bacillus (C.R. Harwood, ed.), Plenum, New York, 73-114; Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Schatz, P.J. and Beckwith, J. (1990) Annu. ev.Genet. 24:215-248 and references therein]. A key feature of the pre-enzyme is that it must be in a translocation-competent form, perhaps loosely folded, which can be maintained via an interaction with chaperonin proteins [see: Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Kumamoto, CA. , and Beckwith, J. (1983) J.Bacteriol. 154:253-260; Kumamoto, CA. and Nault, A.K. (1989) Gene 75:167-175.] It is this complex which must contain all of the information for the recognition and translocation of a protein by the secretory apparatus. One potential role of the signal sequence may be in facilitating chaperonin binding by preventing folding of the enzyme into its final mature form [Park, S., Liu, G. , Topping, T.B., Cover, W.H. and Randall, L.L. (1988) Science 239:1033-1035; Laminet, A.A. and Pluckthun, A. (1989) EMBO J. 8:1469-1477]. B. Heterologous Secretion in Gram-Positive Organisms Although secretion in Bacillus subtilis is not as well understood as secretion in E . coli , it is generally assumed that it proceeds by the same mechanism [Saier, M.H. , Jr. , Werner, P.K. and Muller, M. (1989) Microbiol.Rev 53:333-366; Overhoff, B. , Klein, M. , Spies, M. and Freudl, R. (1991) Mo1.Gen.Genet. 228:417-423]. One difference between the two sets of secreted proteins is the length of their signal peptides which tend to be up to 20 amino acids longer in gram- positives than their corresponding gram-negative counterparts. Whereas gram-positive signal peptides function in gram-negative systems, the converse is not true [Mountain, A. (1989) Bacillus (C. Harwood, ed.). Plenum Press, New York, 73-114; Borchert, T.V. and Nagarajan, V. (1991) J.Bacteriol. 173:276-282; Perlman, D. and Halvorson,*Η.O. (1983) J.Mol.Biol. 167:391- 409]. Thus, the general strategy for the expression of heterologous proteins in gram-positive organisms such as Bacillus subtilis has involved mating the target protein to the secretory apparatus of the host (for a review see Mountain, A. (1989) Bacillus (C Harwood, ed.), Plenum Press, New York, 73- 114) . Typically, in successful experiments, investigators have mated a major exoenzy e promoter and signal sequence to the mature domain of the target. Such systems have been devised for Bacillus subtilis employing elements from alpha amylase (Shiroza, T., Nakazawa, K. , Tashiro, N. , Yamane, K. , Yanagi, K. , Yamasaki, M. , Tamura, G. , Saito, H. , Kawade, Y. and Taniguchi, T. (1985) Gene 34:1-8; Yamane, K. , Nakazawa, K. , Nakamura, K. , Minekura, H. , Mori, T., Takano, J. , Shiroza, T. , Sohma, A. and Fujita, T. (1986) in Bacillus Molecular Genetics and Biotechnology Applications (A.T. Ganesan and J.A. Hochs eds.) Academic Press, New York, pp. 411-422; Palva, I. (1982) Gene 19:81-87; Ulmanen, I., Lundstrom, K. , Lehtovaara, P., Sarvas, M. , Ruohonen, M. and Palva, I. (1985) J.Bacteriol. 162:176-182), alkaline and neutral protease (Fahnestock, S.R. and Fisher, K.E. (1986) J.Bacteriol. 165:796-804; Vasantha, N. and Thompson, L.D. (1986) J.Bacteriol. 165:837-842; Wong, S.L., Kawamura, F. and Doi, R.H. (1986) J.Bacteriol. 168:1005-1009), beta lactamase (Chang, S., Gray, 0. , Ho, D., Kroyer, J. , Chang, S.Y., McLaughlin, J. and Mark, D. (1984) in Molecular Cloning and Gene Regulation in Bacilli, pp. 159-169) and levansucrase (Borchert, T.V. and Nagarajan, V. (1991) J.Bacteriol. 173:276- 282) . In positioning the fusion of the donor promoter/signal sequence with the mature target gene, the investigators have typically considered the linear organization of signal peptide, peptide cleavage site and mature gene and have most often linked the target to the donor signal sequence directly at the proteolytic junction (see Figure l) or just after it, adding at most one or two amino acids from the mature gene of the signal sequence donor (see Mountain, A. (1989) Bacillus (c. Harwood, ed.), Plenum Press, New York, 73-114 and references therein). In general, the results have been mediocre, with accumulation levels of non-gram-positive, heterologous proteins seldom exceeding mg/L amounts (Mountain, A. (1989) Bacillus (C Harwood, ed.), Plenum Press, New York, 73-114).
These methods do not take into account a possible association of the signal peptide with the mature protein. As discussed above, one possible role of the signal peptide is to facilitate binding of the required chaperonins prior to acquisition and translocation by the secretory apparatus. As a consequence of this requirement as well as other possible structures required for efficient translocation, the signal peptide may be required to interact specifically with the mature protein. This has been suggested most conclusively by the work of Lehnhardt and coworkers who demonstrated that different mature sequences (TEM beta-lactamase and Staphylococcus aureus nuclease A) worked in very different ways with the same heterologous signal (OmpA) and its variants in E. coli (Lenhardt, S., Pollitt, S. and Inouye, M. (1987) J.Biol.Chem. 262:1716-1719). In addition, Breitling and coworkers have made similar observations in the secretion of human interferon alpha 1 in Bacillus subtilis using staphylokinase and Bacillus subtilis alpha amylase secretion vectors (Breitling, R. , Gerlach, D., Hartmann, M. and Behnke, D. (1989) Mol.Gen.Genet 217:384-391) . Despite the observations described, no one has attempted toa optimize heterologous secretion through systematically changing the fusion junction between the donor gene and the target mature gene.
Experimental Although the following examples are all related to the expression of Pεeudomonas mendocina ATCC 53552 lipase (cutinase) in Bacillus subtilis , the examples are offered . merely to illustrate the present invention and should not be construed in any way as limiting the scope of this invention.
In this example, the expression of Pseudomonas mendocina lipase (cutinase) as described in commonly owned US Patent No. 4,933,287, incorporated herein by reference, in Bacillus subtilis is carried out through the fusion of the mature lipase gene with the Bacillus subtilis aprE gene from the last residue of the signal sequence (Ala-1) through the ninth residue of the aprE prosequence (K9) . In addition, fusions at positions 111 and K27 were also obtained.
Nomenclature:
In this example, the full length, mature gene for the Pseudomonas mendocina lipase (cutinase) described in US Serial No. 932,950, filed November 19, 1986, incorporated herein by reference, has been fused in frame to several positions within the Bacillus subtilis aprE promoter/signal/prosequence. The aprE, signal/pro sequence junction occurs between codons 29(Ala) and 30(Ala). The fusion of the mature lipase (cutinase) to aprE codon 29 is thus called pAK-A(-l) indicating that the lipase (cutinase) has been fused to the last residue of the signal peptide. Likewise, the fusion of mature lipase (cutinase) to aprE codon 30 is called pAK-Al indicating that the lipase (cutinase) has been fused to the first residue of the prosequence.
Construction of aprE/Lipase (Cutinase) Fusions
The following synthetic primers were used for the utagenesis:
1A. 5 ' GCAGGCTGCAGGAAAAAGCA 3 ' Seq ID
No: 1 B. 5' CCACTGTCGCTGCAGGAAAAGCTCCCCTGC 3 ' Seq ID : 2
2. 5' GGCTGCCGGAGCTCCCCTGC 3" Seq ID : 3
3. 5* GCAGGCTGCCGCTCCCCTGC 3' Seq ID : 4
4. 5' TGCGCAGGCTGCTCCCCTGC 3* Seq ID : 5
6A. 5 * CTGCCGGAAAGAGCTCTACAGAAAAG 3' Seq ID : 6
B. 5' TGTCGCGGCGGAGCTCTACAGAAAAGAAAGCTCCCCTGC 31 Seq ID : 7
7A. 5' GTGCCATGAGCTCCGCCAAGA 3» Seq ID : 8
B. 5' TGTCGCGGCGGAGCTCCGCCAAGAAAAAGGCTCCCCTGC 3' Seq ID : 9
8A. 51 GGTGTATCCGGCAGGGGAGCGCTTTTTCCGGCAGCCTGCGC 3' Seq ID : 10
B. 5' GCGCAGGCTGCCGGAAAAAGCGCTCCCCTGCCGGATACACC 3' Seq ID : 11
9A. 5' GGTGTATCCGGCAGGGGAGCACTGCTTTTTCCGGCAGCCTG 3' Seq ID : 12
B. 5' CAGGCTGCCGGAAAAAGCAGTGCTCCCCTGCCGGATACACC 3' Seq ID : 13 0A. 5' GGTGTATCCGGCAGGGGAGCTGTACTGCTTTTTCCGGCAGC 3" Seq ID : 14
B. 5• GCTGCCGGAAAAAGCAGTACAGCTCCCCTGCCGGATACACC 3 ' Seq ID : 15 1A. 5• GGTGTATCCGGCAGGGGAGCCTTTTCTGTACTGCTTTTTCC • Seq ID : 16
B. 51 GGAAAAAGCAGTACAGAAAAGGCTCCCCTGCCGGATACACC 3' Seq ID o: 17
12A. 5• GGTGTATCCGGCAGGGGAGCAATGTATTTCTTTTCTGTACT 3 • Seq ID o: 18
B. 5' AGTACAGAAAAGAAATACATTGCTCCCCTGCCGGATACACC 3' Seq ID o: 19
13. 5' AAGCCTATGAATTCCTCCATTTTCTTCT 3 • Seq ID o: 20 14. 5 ' TTCCCGCCCGGTACCGGCATTGG 3 ' Seq ID
No: 22
15A. 5' GGTGTATCCGGCAGGGGAGCTTCTGTACTGCTTTTTCCGGC 3' Seq ID No: 23
B. 5• GCCGGAAAAAGCAGTACAGAAGCTCCCCTGCCGGATACACC 3 • Seq ID No: 24
Construction of fusion K3:
The lipase (cutinase) gene (as described in US Patent Nos. 4,933,287 and 5,030,240 and US Patent Application Serial No. 629,308, all incorporated herein by reference) was cloned into a M13 plasmid as a Hindlll SphI fragment (M131ip) ; a PstI site and three codons (A,G,K) were introduced at the beginning of the mature coding sequence by site-directed mutagenesis (T.A. Kunkel, PNAS (1985), Vol. 82, pp. 488-492) using single- stranded synthetic primer IB (Seq ID No: 2) . The aprE gene from pS168-l (M.L. Stahl, et. al., J.Bact. (1984), Vol. 158, pp. 411-418) was cloned into another M13 plasmid as an EcoRI- Hindlll fragment (M13apr) and a PstI site was introduced at codon position Alal (first.a ino acid following the signal sequence cleavage site) with single-stranded synthetic primer 1A (Seq ID No: 1) using the same technique. The method of cloning the DNA fragments is provided in Sambrook, et al., Molecular Cloning, a Laboratory Manual (1989) pp. 1.53-1.73 and pp. 4.3-4.51. The EcoRI-PstI fragment of aprE and the Pstl-SphI fragment of lipase were isolated from the M13 plasmids and cloned into EcoRI SphI digested pJ l02 (E. Ferrari, et al. , J.Bact. (1983) Vol. 154, pp. 1513-1515), creating pApr-cut-1.
To introduce a strong transcriptional terminator, the aprE- lipase fusion from pApr-cut-1 was cloned into pJHIOl (E. Ferrari, et al., J.Bact. Vol. 154, pp. 1513-1515) which had been constructed to contain the Bacillus amyloliquefacienε subtilisin transcriptional terminator (Wells, et al., Nucleic Acid Research (1983), Vol. 11, pp. 7911-7925 on a Hindlll- BamHI fragment (pJHIOl-term) ) . The EcoRI-PvuII DNA fragment containing the aprE promoter, signal sequence and the 5' end of the lipase gene and the PvuII-Aval DNA fragment containing the 3* end of the lipase gene were isolated from pApr-cut-1. The Aval 51 overhang of the PvuII-Aval fragment of the lipase gene was filled in by T4 polymerase prior to the PvuII digest (Sambrook, et al. , Molecular Cloning, a Laboratory Manual, ibid) . The plasmid pJHIOl-term (with the terminator) was digested with EcoRI-Hindlll and the Hindlll 5' overhang was also filled in with T4 polymerase prior to the EcoRI digest. The EcoRI-PvuII fragment, the PvuII-Aval fragment and the EcoRI-Hindlll digested vector were ligated to create pAK-K3.
Construction of fusions G2, Al and A(-l) .
The EcoRI-Asp718 DNA fragment from pAK-K3 was cloned into an M13 plasmid and the codons coding for K, the 3rd amino acid of the prosequence of aprE (K3) , G and K, the 2nd and 3rd amino acid of the prosequence of aprE (G2-K3) and A, G and K, the 1st, 2nd and 3rd amino acid of the prosequence of aprE (A1-G2- K3) were deleted by site-directed mutagenesis using the single-stranded synthetic primers 2,3 and 4 respectively (Seq ID Nos: 3, 4 and 5 respectively). The EcoRI-Asp718 fragments from the M13 plasmids containing the deletions were cloned into EcoRI-Asp718 digested pAK-K3 vector, constructing pAK-G2, pAK-Al and pAK-A(-l) respectively.
Construction of fusion K9.
The lipase (cutinase) gene was cloned into an M13 plasmid as an Hindlll- SphI fragment (M13lip) and five codons (S,T,E,K,K) and a Sad site were introduced in front of the mature lipase gene using primer 6B (Seq ID No: 7 in the mutagenesis procedure. The aprE gene from pS168-l (M.L. Stahl, et. al., J.Bact. (1984), Vol. 158, pp. 411-418) was cloned into another M13 plasmid as an EcoRI-Hindlll fragment (M13apr) and a Sad site was introduced within codons 3-5 of the aprE prosequence (K3-S4-S5) , using the oligonucleotide primer 6A (Seq ID No: 6) in the mutagenesis procedure.
The resulting EcoRI-SacI fragment of the aprE gene and the Sacl-Asp718 fragment of lipase (cutinase) were isolated from the M13 plasmids and cloned into EcoRI-Asp718 digested pAK-K3 vector. The resulting plasmid (AK-K9) contains the mature lipase (cutinase) gene fused to the 9th amino acid (K9) in the prosequence of the aprE gene.
Construction of fusion K27.
This fusion was made using the same procedure using the same M13 plasmids as described above for the K9 fusion. The Sad site was introduced at the 22nd codon of the prosequence of aprE (S22) using single-stranded synthetic primer 7A (Seq ID No: 8) . Five codons (S,A,K,K,K) and a Sad site were introduced in front of the mature lipase gene using single- stranded synthetic primer 7B (Seq ID No: 9) .
The resulting EcoRI-SacI fragment of the aprE gene and the Sacl-Asp718 fragment of lipase (cutinase) were isolated from the M13 plasmids and cloned into an EcoRI-Asp718 digested pAK- K3 vector. The resulting plasmid (AK-K27) contains the mature lipase (cutinase) gene fused to the 27th amino acid (K27) in the prosequence of the aprE gene.
Construction of fusions S4, S5, T6, E7, K8 and 111
These constructions were made by the fusion PCR method (R.M. Horton, et.al. (1989) Gene Vol. 77, pp. 61-68) . The polymerase chain reaction (PCR) was carried out in 100 ul PCR buffer (Perkin Elmer/Cetus) with 50 pmol of each primer and 2.5 units of Taq polymerase (Perkin Elmer/Cetus). The reaction mixture was covered with mineral oil to prevent evaporation. The temperature program consisted of: 1 cycle of 10 min. 95C, 1 min. 50C, 1 min. 70C 28 cycles of 1 min. 95C, 1 min. 50C, 1 min. 70C 1 cycle of 1 min. 95C, l min. 50C, 15 min. 70C
Two complementary single-stranded synthetic DNA strands coding for the fusion junction were synthesized for each construction, containing the 21 bp of the upstream aprE gene sequence followed by the 20 bp of the downstream lipase (cutinase) gene sequence. Primer 13 (Seq ID No: 20) , a single-stranded synthetic primer which codes for the positive strand, is complementary to the aprE promoter and contains an EcoRI site. Primer 14 (Seq ID No: 21) , a single-stranded synthetic primer which codes for the negative strand, is complementary to the lipase (cutinase) gene and contains an Asp718 site. Primers 13 (Seq ID No: 20) and 14 (Seq ID No: 21) were used in all constructions.
A set of three PCR reactions were done as follows. DNA between the promoter and fusion point was amplified using primer 13 (Seq ID No: 20) and the single-stranded synthetic primer coding for the negative strand of the fusion junction (A); the template was an EcoRI-Hindlll fragment from pS168-l, containing the aprE promoter, signal sequence, pro sequence and the 5' of the mature gene (reaction 1). The DNA between the fusion point and mature lipase gene was amplified using primer 14 (Seq ID No: 21) and the single-stranded synthetic primer coding for the positive strand of the fusion junction (B) ; the template was a 1:100 dilution of a standard DNA miniscreen of plasmid pAK-K3 (reaction 2) . The DNA fragments from reaction 1 were fused to the DNA fragments from reaction 2 by amplification with primers 13 (Seq ID No: 20) and 14 (Seq ID No: 21) , using 1 ul of each reaction 1 and 2 (reaction 3) . After 30 cycles half of the amplified DNA was cleaned with phenol/chloroform extraction, followed by spin-column purification (Worthington Mini-Spin) according to the manufacturer's directions. The EcoRI-Asp718 fragments were isolated from the amplified DNA and cloned into M13-mpl9 EcoRI-Asp718 digested vector. After sequence confirmation (Sanger, et al. , 1977) the EcoRI-Asp718 fragments were cloned into EcoRI-Asp718 digested pAK-K3 vector.
The A and B pairs of fusion primers used for the S4, S5, T6, K8, 111 and E7 constructions were numbers 8A&B, 9A&B, 10A&B, 11A&B, 12A&B and 15A&B respectively (Seq ID Nos: 10-19 and 22 and 23 respectively) . Transformation into Bacillus εubtiliε The plasmids containing the different fusions were transformed into Bacilluε εubtiliε (Anagnostopoulos, C. , J.Bact. (1961) 81:741-746) and integrated into the chromosome specifically within the aprE locus by a Campbell-type mechanism (Young, M. , J.Gen.Microbiol. (1984) 130:1613-1621). The Bacilluε strain (BB8) was a derivative of 1168 which had been deleted for 5 proteases, and estB (delta apr, delta npr, delta bpF, delta epr, isp-1, delta estB) . Deletion of the genes indicated were introduced using the method as described in Stahl, M.L., J.Bact. (1984) 158:411-4181 After transformation with the fusion gene, the sacU(Hy) (Henner, D.J., Ferrari, E. , Perego, M. and Hoch, J.A. , J.Bact. (1988) 170:296-300) mutation was introduced by either transformation or PBS-1 mediated transduction (Hoch, J.A. , Barat, M. and Anagnostopoulos, C, J.Bact. (1983) 154:1513-1515) creating the different final Bacilluε εubtiliε strains carrying the different fusions.
Cultivation and Evaluation of aprE/Lipase Fusion Strains The final Bacilluε εubtiliε strains were assayed for the production of lipase (cutinase) in the culture supernatant using the following assay:
Assay: Pεeudomonaε mendocina lipase (cutinase) is assayed with ImM p-nitrophenylbutyrate in 0.2M Hepes buffer at pH 7.0. The activity is expressed as change in absorbance at 410nm/min/10ul sample in a lmL reaction volume; 1 unit = a change of lAU410/min/10uL sample in a lmL reaction volume. The results were converted to mg/ml based upon a specific activity of .060(mg/mL) /Unit.
The Bacillus strains were grown overnight in Medium A at 37°C with shaking and then inoculated 5% into Medium B and the production of lipase (cutinase) followed using the above assay. Mediums A and B are described in Table I. The strains were evaluated on the basis of their production rate over the initial linear production interval (Figure 2) and expressed as mg/ L/hr. Table I:
Medium A
Penassay broth (Difco)
Figure imgf000016_0001
Maltodextrin (CPC M150) 0.1%
As shown in Figure 3, the different fusions produced dramatically different expression levels. The relative production rates varied as much as 5 fold (K3/S4) and the best (K3) produced 5 fold better than the simple direct signal sequence junction hookup (A-l) .

Claims

WHAT IS CLAIMED IS:
1. A process for expressing a lipase in a Bacillus , said process comprising:
a) constructing a series of plasmids each plasmid comprising a mature lipase gene fused to one of the first through ninth amino acids of a Bacilluε gene;
b) integrating the construction of step a) into the chromosome of a Bacilluε production host;
c) introducing a mutation, by transformation or transduction, into the product of step b) ; and
d) optionally isolating the transformants of step c) .
2. A process of Claim 1 wherein said Bacilluε is Bacilluε subtilis .
3. A process of Claim 1 wherein the lipase is derived from Pseudomonas mendocina ATCC 53552.
4. A process of Claim 2 wherein the lipase is derived from Pseudomonas mendocina ATCC 53552.
5. A process of Claim 3 wherein the lipase is a cutinase.
6. A process of Claim 4 wherein the lipase is a cutinase.
7. A process of Claim 1 wherein the plasmid of step a) comprises a mature Pεeudomonaε mendocina lipase gene fused to the third amino acid of the Bacilluε subtiliε aprE prosequence.
8. A process of Claim 1 wherein the plasmid of step a) comprises a mature Pεeudomonaε mendocina lipase gene fused to the sixth amino acid of the Bacilluε εubtiliε aprE prosequence.
9. A process of Claim 1 wherein the mutation introduced in step c) is sacU(Hy) .
10. Transformed Bacilluε εubtiliε cells comprising heterologous DNA which produces lipase wherein said transformed cells comprise a plasmid wherein the mature lipase gene is fused to one of the first through ninth amino acids of the Bacillus gene.
11. Transformed cells of Claim 10 wherein the mature lipase gene is fused to the third amino acid of the Bacilluε εubtiliε aprE prosequence.
12. Transformed cells of Claim 10 wherein the mature lipase gene is fused to the sixth amino acid of the Bacilluε εubtiliε aprE prosequence.
13. A recombinant DNA construct which contains all or part of a Pseudomonas mendocina lipase gene fused to one of the first through ninth amino acids of the Bacilluε εubtiliε aprE prosequence.
14. A plasmid which contains the recombinant construct of Claim 13.
15. A recombinant DNA construct which contains all or part of a Pseudomonas mendocina lipase gene fused to the third amino acid of the Bacillus εubtiliε aprE prosequence.
16. A plasmid which contains the recombinant construct of Claim 15.
17. A recombinant DNA construct which contains all or part of a Pεeudomonaε mendocina lipase gene fused to the sixth amino acid of the Bacilluε εubtiliε aprE prosequence.
18. A plasmid which contains the recombinant construct of Claim 17. 19. A protein composition comprising heterologous DNA which produces lipase, said protein obtained by the process of Claim 1.
PCT/US1993/003018 1992-03-30 1993-03-30 Heterologous gene expression in bacillus subtilis: fusion approach WO1993020214A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
DK93908693T DK0646177T3 (en) 1992-03-30 1993-03-30 Heterologous gene expression in Bacillus subtilis: fusion procedure
DE69333341T DE69333341T2 (en) 1992-03-30 1993-03-30 Heterologous gene expression in Bacillus subtilis: the fusion approach
JP51766293A JP3432224B2 (en) 1992-03-30 1993-03-30 Expression of heterologous genes in Bacillus subtilis: fusion method
EP93908693A EP0646177B1 (en) 1992-03-30 1993-03-30 HETEROLOGOUS GENE EXPRESSION IN $i(BACILLUS SUBTILIS): FUSION APPROACH
CA002133338A CA2133338C (en) 1992-03-30 1993-03-30 Heterologous gene expression in bacillus subtilis: fusion approach
FI944524A FI944524A0 (en) 1992-03-30 1994-09-29 Heterologous gene expression in Bacillus subtilis: fusion application

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US07/860,468 US5429950A (en) 1992-03-30 1992-03-30 Heterologous gene expression in bacillus subtilis: fusion approach
US07/860,468 1992-03-30

Publications (1)

Publication Number Publication Date
WO1993020214A1 true WO1993020214A1 (en) 1993-10-14

Family

ID=25333288

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/003018 WO1993020214A1 (en) 1992-03-30 1993-03-30 Heterologous gene expression in bacillus subtilis: fusion approach

Country Status (8)

Country Link
US (1) US5429950A (en)
EP (1) EP0646177B1 (en)
JP (1) JP3432224B2 (en)
CA (1) CA2133338C (en)
DE (1) DE69333341T2 (en)
DK (1) DK0646177T3 (en)
FI (1) FI944524A0 (en)
WO (1) WO1993020214A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997013847A1 (en) * 1995-10-12 1997-04-17 Genencor International, Inc. Expression system, vector and cell transformed thereby
WO2023192953A1 (en) 2022-04-01 2023-10-05 Danisco Us Inc. Pro-region mutations enhancing protein production in gram-positive bacterial cells

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6723550B1 (en) * 1997-07-15 2004-04-20 Genencor International, Inc. Proteases from gram-positive organisms
US6961567B1 (en) 2000-12-07 2005-11-01 Palm, Inc. Generic activation and registration framework for wireless devices
US7208585B2 (en) * 2002-09-18 2007-04-24 Genencor International, Inc. Protein purification
US7070035B2 (en) * 2003-03-28 2006-07-04 Honda Motor Co., Ltd. Two-way coupling apparatus and method
EP1692159B1 (en) * 2003-11-06 2010-09-29 Danisco US Inc. Tgf-beta1 binding and supported peptides
CN1875029B (en) * 2003-11-06 2010-06-16 金克克国际有限公司 Expression in filamentous fungi of protease inhibitors and variants thereof
US9084734B2 (en) 2005-05-05 2015-07-21 Danisco Us Inc. Peptide personal care compositions and methods for their use
US7803902B2 (en) 2008-10-15 2010-09-28 Danisco Us Inc. Modified variant bowman birk protease inhibitors
WO2010044786A1 (en) 2008-10-15 2010-04-22 Danisco Us Inc., Genencor Division Modified variant bowman birk protease inhibitors
US7772181B2 (en) * 2008-10-15 2010-08-10 Danisco Us Inc. Personal care compositions comprising modified variant Bowman Birk Protease Inhibitors
JP5806897B2 (en) * 2011-09-22 2015-11-10 花王株式会社 Polypeptides and recombinant microorganisms
US9109212B2 (en) * 2012-07-05 2015-08-18 Jiangnan University Method for enhancing extracellular secretion of recombinant proteins in Escherichia coli by co-expressing Thermobifida fusca cutinase

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0268456A2 (en) * 1986-11-19 1988-05-25 The Clorox Company Enzymatic peracid bleaching system
EP0407225A1 (en) * 1989-07-07 1991-01-09 Unilever Plc Enzymes and enzymatic detergent compositions
WO1992019721A1 (en) * 1991-04-26 1992-11-12 Genencor International, Inc. Gene expression in bacilli

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3079276B2 (en) * 1988-02-28 2000-08-21 天野製薬株式会社 Recombinant DNA, Pseudomonas sp. Containing the same, and method for producing lipase using the same
EP0334462B2 (en) * 1988-03-25 2002-04-24 Genencor International, Inc. Molecular cloning and expression of genes encoding lipolytic enzymes
CA2003078A1 (en) * 1988-11-18 1990-05-18 Alan Sloma Protease deletion
EP0464922A1 (en) * 1990-07-06 1992-01-08 Unilever N.V. Production of active pseudomonas glumae lipase in homologous or heterologous hosts

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0268456A2 (en) * 1986-11-19 1988-05-25 The Clorox Company Enzymatic peracid bleaching system
EP0407225A1 (en) * 1989-07-07 1991-01-09 Unilever Plc Enzymes and enzymatic detergent compositions
WO1992019721A1 (en) * 1991-04-26 1992-11-12 Genencor International, Inc. Gene expression in bacilli

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF BACTERIOLOGY vol. 170, no. 1, January 1988, AMERICAN SOCIETY FOR MICROBIOLOGY pages 296 - 300 HENNER, D.J. ET AL. 'Location of the targets of the hpr-97, sacU32(Hy), and sacQ36(Hy) mutations in upstream regions of the subtilisin promoter' cited in the application *
JOURNAL OF CELLULAR BIOCHEMISTRY, Supplement 15D; 1991, page 184, Abstract K232; VAN KIMMENADE, A. et al.: 'The optimization of heterologous gene expression in Bacillus' *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997013847A1 (en) * 1995-10-12 1997-04-17 Genencor International, Inc. Expression system, vector and cell transformed thereby
BE1009650A5 (en) * 1995-10-12 1997-06-03 Genencor Int Expression system, and cell transformed by vector vector ec.
WO2023192953A1 (en) 2022-04-01 2023-10-05 Danisco Us Inc. Pro-region mutations enhancing protein production in gram-positive bacterial cells

Also Published As

Publication number Publication date
FI944524A (en) 1994-09-29
CA2133338A1 (en) 1993-10-14
DE69333341D1 (en) 2004-01-22
DE69333341T2 (en) 2004-10-07
JPH07505292A (en) 1995-06-15
EP0646177A1 (en) 1995-04-05
DK0646177T3 (en) 2004-04-13
FI944524A0 (en) 1994-09-29
US5429950A (en) 1995-07-04
JP3432224B2 (en) 2003-08-04
CA2133338C (en) 2006-06-13
EP0646177B1 (en) 2003-12-10

Similar Documents

Publication Publication Date Title
EP0244042B1 (en) Secretory signal selection vectors for extracellular protein synthesis in bacilli
US5217878A (en) Molecular cloning and expression of genes encoding proteolytic enzymes
US6783970B2 (en) System for expressing hyperthermostable protein
US7179634B2 (en) Methods for producing a polypeptide in a Bacillus cell
EP0646177B1 (en) HETEROLOGOUS GENE EXPRESSION IN $i(BACILLUS SUBTILIS): FUSION APPROACH
Doi et al. Potential use of Bacillus subtilis for secretion and production of foreign proteins
EP0686195B1 (en) Method and system for enhanced production of commercially important exoproteins in gram-positive bacteria
JPH0829091B2 (en) Method for producing hybrid PMA sequence and vector used in the method
Nagarajan Protein secretion
WO1996034963A1 (en) Alkaline protease and process for its production
Freudl Protein secretion in gram-positive bacteria
EP1187925A1 (en) Pectate lyase fusion for expression and secretion of polypeptides
EP0133756A2 (en) Vector for expression of polypeptides
JP3154720B2 (en) Inducible expression vector
EP0151760A1 (en) Novel DNA and use thereof
GB2171703A (en) Expression-secretion vector
EP0600893B1 (en) Gene expression in bacilli
US5084383A (en) Bacillus subtilis strain whose extracellular protease activities are reduced, method for obtaining the strain and method for secreting proteins by using the strain
US7081359B2 (en) Recombinant bacillus proteases and uses thereof
Sarvas Gene expression in recombinant Bacillus
JPS63501053A (en) Methods for producing heterologous proteins
EP1557467B1 (en) Expression system derived from the lipase regulation cascade of Pseudomonas alcaligenes
JPH0156756B2 (en)
US5212070A (en) Secretory signal selection vectors for extracellular protein synthesis in Bacilli
DE102017215015A1 (en) Method for improved expression of enzymes

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): CA FI JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2133338

Country of ref document: CA

Ref document number: 944524

Country of ref document: FI

WWE Wipo information: entry into national phase

Ref document number: 1993908693

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1993908693

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1993908693

Country of ref document: EP