HETEROLOGOUS GENE EXPRESSION IN BACILLUS SUBTILIS: FUSION APPROACH
Cross-Reference to Related Applications
This application is related to US Application Serial No. 07/800,365 filed November 27, 1991, which is a continuation-in- part of US Application Serial No. 07/600,836 filed October 22, 1990, which is a continuation of US Patent Application Serial No. 07/341,200 filed March 29, 1989, now US Patent No. 4,981,611, which, in turn, is derived from PCT Application Serial No. PCT/US88/01844 filed May 31, 1988, which, in turn, claims priority under 35 USC §120 from US Patent Application Serial No. 07/056,500 filed May 29, 1987 (now abandoned). Each of the above applications are incorporated herein by reference in their entirety.
Field of the Invention
The present invention relates to the expression of lipase (cutinase) from Bacillus microorganisms and the purification of cutinase from the fermentation broth.
Background of the Invention
The secretion of heterologous proteins from any host requires the precise matching of signal peptide and mature target gene. Although gram-positive signal sequences are known to function well in gram-negative systems, the inverse is not true [Mountain, A. (1989) Bacillus (Biotechnology Handbooks 2, C.R. Harwood, ed.), Plenum Press, pp. 73-114]. In the case of Bacillus subtilis, it has been possible to secrete proteins derived from other gram-positive organisms; however, even in these situations, the best yields have been obtained with hybrid sequences. There has been no documented success in Bacillus for expressing large quantities of gram-negative derived proteins utilizing their own signal sequences; in addition, success with hybrid sequences has been minimal.
[Mountain, A. (1989) Bacillus (Biotechnology Handbooks 2, C.R. Harwood, ed.), Plenum Press, pp. 73-114.]
There have been various attempts in the literature to optimize signal peptide: ature gene fusions (cf. Doi, R.H., Wong, S. and awamura, F. (1986) Trends Biotechnol. Sept. :232-235; Fahnestock, S.R. and Fisher, K.E. (1986) J.Bact. 165:796-804; Fahnestock, S.R. and Fisher, K.E. (1987) Appl.Env.Microbiol. 53:379-384; Sarvas, M. (1986) Curr.TopicsMicro.Immun. 125:103- 125; Ulmanen, I., Lundstrom, K. , Lehtovaara, P., Sarvas, M. , Ruohonen, M. and Palva, I. (1985) J.Bact. 162:176-182; Vasantha, N. and Thompson, L.D. (1986) J.Bact. 165:837-842); however, in all cases, the points of fusion were chosen on the basis of either convenient restriction sites or by merely mating the gram-positive signal sequence to the target gene directly at the signal cleavage site.
The present invention describes the expression of the gram- negative Pseudomonas mendocina. lipase (cutinase) in Bacillus subtiliε, a gram-positive organism. The enzyme is produced as a fusion with aprE (prepro Bacillus subtilis subtilisin) . Using polymerase chain reaction techniques, the mature coding sequence for lipase, as described in commonly owned US Application SN 07/932,950 incorporated herein by reference, was fused to the prosequence of aprE at (and including) prosequence residues A(-l) , Al, G2, K3, S4, S5, T6, E7, K8, K9, 111 and K27. The resulting constructions were integrated into the chromosome of a Bacillus subtilis production host (BB8) and after transduction or transformation to SacU(Hy) phenotype, the production efficiency of each strain was measured as described herein.
Summary of the Invention
The present invention relates to the expression of heterologous genes in a Bacillus microorganism wherein one or more fusions are sequentially made, said fusions comprising a host signal sequence, a host pro sequence and a target gene sequence.
Further provided is the expression of lipase (cutinase) in Bacillus .using a pro otor derived from Bacillus subtilis and terminator derived from Bacillus amyloliquefacienε .
Still further provided are specific fusions of the mature lipase gene with the Bacillus subtilis aprE gene. These specific fusions may be introduced into plasmid vectors which are then transformed into B . subtilis .
Brief Description of the Drawings
Figure 1 shows the key elements of signal sequence secondary structure.
Figure 2 shows lipase production rate of certain fusions (G2 and K3) in B. subtilis .
Figure 3 shows expression of Pseudomonaε mendocina lipase (cutinase) in B . subtilis .
Figure 4 describes the construction of: (Figure 4a) pApr-cut- 1; (Figure 4b) pAK-K3; (Figure 4c) pAK-G2, pAK-Al, pAK-A(-l) ; (Figure 4d) pAK-K9, pAK-K27; (Figure 4e) pAK-S4, S5, T6, E7, K8, 111.
Figure 5 shows the plasmid ap of pAK-K3.
Detailed Description of the Invention A. Secretion of Proteins from Bacteria
The secretion of proteins from bacteria is an ATP-dependent process which involves the translocation of a pre-protein and the subsequent proteolytic cleavage of the pre-protein on the outside surface of the membrane, into the mature enzyme. The pre-protein consists of an N-terminal, signal peptide of 20 (gram-negative) to 40 amino acids [Mountain, A. (1989) Bacillus (C.R. Harwood, ed.). Plenum, New York, 73-114] and a C-terminal mature protein. Signal sequences exhibit only restricted, if any primary sequence homology, even within a single organism, yet conserve secondary structural homology as shown in Figure
1. The three domains of the signal peptide are first the N- terminal, positively charged region, the hydrophobic central region, and the non-helical, carboxy terminal domain. As will be discussed below, gram-positive organisms tend to have larger N and C-terminal domains than those of gram-negative organisms, such as E. coli, maintaining the central hydrophobic core of approximately the same length. This signal sequence is thought to contain all of the information necessary to target the protein to the membrane for translocation. [See: Mountain, A. (1989) Bacillus (C.R. Harwood, ed.) , Plenum, New York, 73-114; Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Schatz, P.J. and Beckwith, J. (1983) J.Bacteriol. 154:253-260.]
In the first step of secretion, as documented for the gram- negative E. coli, the newly synthesized pre-protein, potentially with a chaperonin (secB, groEL, etc.), is thought to be recognized by the membrane bound receptor ATP-ase (secA) , which couples the hydrolysis of ATP to the translocation of the protein through an integral membrane complex (secE/Y) [cf. Mountain, A. (1989) Bacillus (C.R. Harwood, ed.), Plenum, New York, 73-114; Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Schatz, P.J. and Beckwith, J. (1990) Annu. ev.Genet. 24:215-248 and references therein]. A key feature of the pre-enzyme is that it must be in a translocation-competent form, perhaps loosely folded, which can be maintained via an interaction with chaperonin proteins [see: Wickner, W. , Driessen, A.J.M. and Hartl, F.U. (1991) Annu.Rev.Biochem. 60:101-124; Kumamoto, CA. , and Beckwith, J. (1983) J.Bacteriol. 154:253-260; Kumamoto, CA. and Nault, A.K. (1989) Gene 75:167-175.] It is this complex which must contain all of the information for the recognition and translocation of a protein by the secretory apparatus. One potential role of the signal sequence may be in facilitating chaperonin binding by preventing folding of the enzyme into its final mature form [Park, S., Liu, G. , Topping, T.B., Cover, W.H. and Randall, L.L. (1988) Science 239:1033-1035; Laminet, A.A. and Pluckthun, A. (1989) EMBO J. 8:1469-1477].
B. Heterologous Secretion in Gram-Positive Organisms Although secretion in Bacillus subtilis is not as well understood as secretion in E . coli , it is generally assumed that it proceeds by the same mechanism [Saier, M.H. , Jr. , Werner, P.K. and Muller, M. (1989) Microbiol.Rev 53:333-366; Overhoff, B. , Klein, M. , Spies, M. and Freudl, R. (1991) Mo1.Gen.Genet. 228:417-423]. One difference between the two sets of secreted proteins is the length of their signal peptides which tend to be up to 20 amino acids longer in gram- positives than their corresponding gram-negative counterparts. Whereas gram-positive signal peptides function in gram-negative systems, the converse is not true [Mountain, A. (1989) Bacillus (C. Harwood, ed.). Plenum Press, New York, 73-114; Borchert, T.V. and Nagarajan, V. (1991) J.Bacteriol. 173:276-282; Perlman, D. and Halvorson,*Η.O. (1983) J.Mol.Biol. 167:391- 409]. Thus, the general strategy for the expression of heterologous proteins in gram-positive organisms such as Bacillus subtilis has involved mating the target protein to the secretory apparatus of the host (for a review see Mountain, A. (1989) Bacillus (C Harwood, ed.), Plenum Press, New York, 73- 114) . Typically, in successful experiments, investigators have mated a major exoenzy e promoter and signal sequence to the mature domain of the target. Such systems have been devised for Bacillus subtilis employing elements from alpha amylase (Shiroza, T., Nakazawa, K. , Tashiro, N. , Yamane, K. , Yanagi, K. , Yamasaki, M. , Tamura, G. , Saito, H. , Kawade, Y. and Taniguchi, T. (1985) Gene 34:1-8; Yamane, K. , Nakazawa, K. , Nakamura, K. , Minekura, H. , Mori, T., Takano, J. , Shiroza, T. , Sohma, A. and Fujita, T. (1986) in Bacillus Molecular Genetics and Biotechnology Applications (A.T. Ganesan and J.A. Hochs eds.) Academic Press, New York, pp. 411-422; Palva, I. (1982) Gene 19:81-87; Ulmanen, I., Lundstrom, K. , Lehtovaara, P., Sarvas, M. , Ruohonen, M. and Palva, I. (1985) J.Bacteriol. 162:176-182), alkaline and neutral protease (Fahnestock, S.R. and Fisher, K.E. (1986) J.Bacteriol. 165:796-804; Vasantha, N. and Thompson, L.D. (1986) J.Bacteriol. 165:837-842; Wong, S.L., Kawamura, F. and Doi, R.H. (1986) J.Bacteriol. 168:1005-1009), beta lactamase (Chang, S., Gray, 0. , Ho, D., Kroyer, J. , Chang,
S.Y., McLaughlin, J. and Mark, D. (1984) in Molecular Cloning and Gene Regulation in Bacilli, pp. 159-169) and levansucrase (Borchert, T.V. and Nagarajan, V. (1991) J.Bacteriol. 173:276- 282) . In positioning the fusion of the donor promoter/signal sequence with the mature target gene, the investigators have typically considered the linear organization of signal peptide, peptide cleavage site and mature gene and have most often linked the target to the donor signal sequence directly at the proteolytic junction (see Figure l) or just after it, adding at most one or two amino acids from the mature gene of the signal sequence donor (see Mountain, A. (1989) Bacillus (c. Harwood, ed.), Plenum Press, New York, 73-114 and references therein). In general, the results have been mediocre, with accumulation levels of non-gram-positive, heterologous proteins seldom exceeding mg/L amounts (Mountain, A. (1989) Bacillus (C Harwood, ed.), Plenum Press, New York, 73-114).
These methods do not take into account a possible association of the signal peptide with the mature protein. As discussed above, one possible role of the signal peptide is to facilitate binding of the required chaperonins prior to acquisition and translocation by the secretory apparatus. As a consequence of this requirement as well as other possible structures required for efficient translocation, the signal peptide may be required to interact specifically with the mature protein. This has been suggested most conclusively by the work of Lehnhardt and coworkers who demonstrated that different mature sequences (TEM beta-lactamase and Staphylococcus aureus nuclease A) worked in very different ways with the same heterologous signal (OmpA) and its variants in E. coli (Lenhardt, S., Pollitt, S. and Inouye, M. (1987) J.Biol.Chem. 262:1716-1719). In addition, Breitling and coworkers have made similar observations in the secretion of human interferon alpha 1 in Bacillus subtilis using staphylokinase and Bacillus subtilis alpha amylase secretion vectors (Breitling, R. , Gerlach, D., Hartmann, M. and Behnke, D. (1989) Mol.Gen.Genet 217:384-391) . Despite the observations described, no one has attempted toa optimize heterologous secretion through systematically changing the
fusion junction between the donor gene and the target mature gene.
Experimental Although the following examples are all related to the expression of Pεeudomonas mendocina ATCC 53552 lipase (cutinase) in Bacillus subtilis , the examples are offered . merely to illustrate the present invention and should not be construed in any way as limiting the scope of this invention.
In this example, the expression of Pseudomonas mendocina lipase (cutinase) as described in commonly owned US Patent No. 4,933,287, incorporated herein by reference, in Bacillus subtilis is carried out through the fusion of the mature lipase gene with the Bacillus subtilis aprE gene from the last residue of the signal sequence (Ala-1) through the ninth residue of the aprE prosequence (K9) . In addition, fusions at positions 111 and K27 were also obtained.
Nomenclature:
In this example, the full length, mature gene for the Pseudomonas mendocina lipase (cutinase) described in US Serial No. 932,950, filed November 19, 1986, incorporated herein by reference, has been fused in frame to several positions within the Bacillus subtilis aprE promoter/signal/prosequence. The aprE, signal/pro sequence junction occurs between codons 29(Ala) and 30(Ala). The fusion of the mature lipase (cutinase) to aprE codon 29 is thus called pAK-A(-l) indicating that the lipase (cutinase) has been fused to the last residue of the signal peptide. Likewise, the fusion of mature lipase (cutinase) to aprE codon 30 is called pAK-Al indicating that the lipase (cutinase) has been fused to the first residue of the prosequence.
Construction of aprE/Lipase (Cutinase) Fusions
The following synthetic primers were used for the utagenesis:
1A. 5 ' GCAGGCTGCAGGAAAAAGCA 3 ' Seq ID
No: 1
B. 5' CCACTGTCGCTGCAGGAAAAGCTCCCCTGC 3 ' Seq ID : 2
2. 5' GGCTGCCGGAGCTCCCCTGC 3" Seq ID : 3
3. 5* GCAGGCTGCCGCTCCCCTGC 3' Seq ID : 4
4. 5' TGCGCAGGCTGCTCCCCTGC 3* Seq ID : 5
6A. 5 * CTGCCGGAAAGAGCTCTACAGAAAAG 3' Seq ID : 6
B. 5' TGTCGCGGCGGAGCTCTACAGAAAAGAAAGCTCCCCTGC 31 Seq ID : 7
7A. 5' GTGCCATGAGCTCCGCCAAGA 3» Seq ID : 8
B. 5' TGTCGCGGCGGAGCTCCGCCAAGAAAAAGGCTCCCCTGC 3' Seq ID : 9
8A. 51 GGTGTATCCGGCAGGGGAGCGCTTTTTCCGGCAGCCTGCGC 3' Seq ID : 10
B. 5' GCGCAGGCTGCCGGAAAAAGCGCTCCCCTGCCGGATACACC 3' Seq ID : 11
9A. 5' GGTGTATCCGGCAGGGGAGCACTGCTTTTTCCGGCAGCCTG 3' Seq ID : 12
B. 5' CAGGCTGCCGGAAAAAGCAGTGCTCCCCTGCCGGATACACC 3' Seq ID : 13 0A. 5' GGTGTATCCGGCAGGGGAGCTGTACTGCTTTTTCCGGCAGC 3" Seq ID : 14
B. 5• GCTGCCGGAAAAAGCAGTACAGCTCCCCTGCCGGATACACC 3 ' Seq ID : 15 1A. 5• GGTGTATCCGGCAGGGGAGCCTTTTCTGTACTGCTTTTTCC • Seq ID : 16
B. 51 GGAAAAAGCAGTACAGAAAAGGCTCCCCTGCCGGATACACC 3' Seq ID o: 17
12A. 5• GGTGTATCCGGCAGGGGAGCAATGTATTTCTTTTCTGTACT 3 • Seq ID o: 18
B. 5' AGTACAGAAAAGAAATACATTGCTCCCCTGCCGGATACACC 3' Seq ID o: 19
13. 5' AAGCCTATGAATTCCTCCATTTTCTTCT 3 • Seq ID o: 20
14. 5 ' TTCCCGCCCGGTACCGGCATTGG 3 ' Seq ID
No: 22
15A. 5' GGTGTATCCGGCAGGGGAGCTTCTGTACTGCTTTTTCCGGC 3' Seq ID No: 23
B. 5• GCCGGAAAAAGCAGTACAGAAGCTCCCCTGCCGGATACACC 3 • Seq ID No: 24
Construction of fusion K3:
The lipase (cutinase) gene (as described in US Patent Nos. 4,933,287 and 5,030,240 and US Patent Application Serial No. 629,308, all incorporated herein by reference) was cloned into a M13 plasmid as a Hindlll SphI fragment (M131ip) ; a PstI site and three codons (A,G,K) were introduced at the beginning of the mature coding sequence by site-directed mutagenesis (T.A. Kunkel, PNAS (1985), Vol. 82, pp. 488-492) using single- stranded synthetic primer IB (Seq ID No: 2) . The aprE gene from pS168-l (M.L. Stahl, et. al., J.Bact. (1984), Vol. 158, pp. 411-418) was cloned into another M13 plasmid as an EcoRI- Hindlll fragment (M13apr) and a PstI site was introduced at codon position Alal (first.a ino acid following the signal sequence cleavage site) with single-stranded synthetic primer 1A (Seq ID No: 1) using the same technique. The method of cloning the DNA fragments is provided in Sambrook, et al., Molecular Cloning, a Laboratory Manual (1989) pp. 1.53-1.73 and pp. 4.3-4.51. The EcoRI-PstI fragment of aprE and the Pstl-SphI fragment of lipase were isolated from the M13 plasmids and cloned into EcoRI SphI digested pJ l02 (E. Ferrari, et al. , J.Bact. (1983) Vol. 154, pp. 1513-1515), creating pApr-cut-1.
To introduce a strong transcriptional terminator, the aprE- lipase fusion from pApr-cut-1 was cloned into pJHIOl (E. Ferrari, et al., J.Bact. Vol. 154, pp. 1513-1515) which had been constructed to contain the Bacillus amyloliquefacienε subtilisin transcriptional terminator (Wells, et al., Nucleic Acid Research (1983), Vol. 11, pp. 7911-7925 on a Hindlll- BamHI fragment (pJHIOl-term) ) . The EcoRI-PvuII DNA fragment containing the aprE promoter, signal sequence and the 5' end
of the lipase gene and the PvuII-Aval DNA fragment containing the 3* end of the lipase gene were isolated from pApr-cut-1. The Aval 51 overhang of the PvuII-Aval fragment of the lipase gene was filled in by T4 polymerase prior to the PvuII digest (Sambrook, et al. , Molecular Cloning, a Laboratory Manual, ibid) . The plasmid pJHIOl-term (with the terminator) was digested with EcoRI-Hindlll and the Hindlll 5' overhang was also filled in with T4 polymerase prior to the EcoRI digest. The EcoRI-PvuII fragment, the PvuII-Aval fragment and the EcoRI-Hindlll digested vector were ligated to create pAK-K3.
Construction of fusions G2, Al and A(-l) .
The EcoRI-Asp718 DNA fragment from pAK-K3 was cloned into an M13 plasmid and the codons coding for K, the 3rd amino acid of the prosequence of aprE (K3) , G and K, the 2nd and 3rd amino acid of the prosequence of aprE (G2-K3) and A, G and K, the 1st, 2nd and 3rd amino acid of the prosequence of aprE (A1-G2- K3) were deleted by site-directed mutagenesis using the single-stranded synthetic primers 2,3 and 4 respectively (Seq ID Nos: 3, 4 and 5 respectively). The EcoRI-Asp718 fragments from the M13 plasmids containing the deletions were cloned into EcoRI-Asp718 digested pAK-K3 vector, constructing pAK-G2, pAK-Al and pAK-A(-l) respectively.
Construction of fusion K9.
The lipase (cutinase) gene was cloned into an M13 plasmid as an Hindlll- SphI fragment (M13lip) and five codons (S,T,E,K,K) and a Sad site were introduced in front of the mature lipase gene using primer 6B (Seq ID No: 7 in the mutagenesis procedure. The aprE gene from pS168-l (M.L. Stahl, et. al., J.Bact. (1984), Vol. 158, pp. 411-418) was cloned into another M13 plasmid as an EcoRI-Hindlll fragment (M13apr) and a Sad site was introduced within codons 3-5 of the aprE prosequence (K3-S4-S5) , using the oligonucleotide primer 6A (Seq ID No: 6) in the mutagenesis procedure.
The resulting EcoRI-SacI fragment of the aprE gene and the Sacl-Asp718 fragment of lipase (cutinase) were isolated from
the M13 plasmids and cloned into EcoRI-Asp718 digested pAK-K3 vector. The resulting plasmid (AK-K9) contains the mature lipase (cutinase) gene fused to the 9th amino acid (K9) in the prosequence of the aprE gene.
Construction of fusion K27.
This fusion was made using the same procedure using the same M13 plasmids as described above for the K9 fusion. The Sad site was introduced at the 22nd codon of the prosequence of aprE (S22) using single-stranded synthetic primer 7A (Seq ID No: 8) . Five codons (S,A,K,K,K) and a Sad site were introduced in front of the mature lipase gene using single- stranded synthetic primer 7B (Seq ID No: 9) .
The resulting EcoRI-SacI fragment of the aprE gene and the Sacl-Asp718 fragment of lipase (cutinase) were isolated from the M13 plasmids and cloned into an EcoRI-Asp718 digested pAK- K3 vector. The resulting plasmid (AK-K27) contains the mature lipase (cutinase) gene fused to the 27th amino acid (K27) in the prosequence of the aprE gene.
Construction of fusions S4, S5, T6, E7, K8 and 111
These constructions were made by the fusion PCR method (R.M. Horton, et.al. (1989) Gene Vol. 77, pp. 61-68) . The polymerase chain reaction (PCR) was carried out in 100 ul PCR buffer (Perkin Elmer/Cetus) with 50 pmol of each primer and 2.5 units of Taq polymerase (Perkin Elmer/Cetus). The reaction mixture was covered with mineral oil to prevent evaporation. The temperature program consisted of: 1 cycle of 10 min. 95C, 1 min. 50C, 1 min. 70C 28 cycles of 1 min. 95C, 1 min. 50C, 1 min. 70C 1 cycle of 1 min. 95C, l min. 50C, 15 min. 70C
Two complementary single-stranded synthetic DNA strands coding for the fusion junction were synthesized for each construction, containing the 21 bp of the upstream aprE gene sequence followed by the 20 bp of the downstream lipase (cutinase) gene sequence. Primer 13 (Seq ID No: 20) , a
single-stranded synthetic primer which codes for the positive strand, is complementary to the aprE promoter and contains an EcoRI site. Primer 14 (Seq ID No: 21) , a single-stranded synthetic primer which codes for the negative strand, is complementary to the lipase (cutinase) gene and contains an Asp718 site. Primers 13 (Seq ID No: 20) and 14 (Seq ID No: 21) were used in all constructions.
A set of three PCR reactions were done as follows. DNA between the promoter and fusion point was amplified using primer 13 (Seq ID No: 20) and the single-stranded synthetic primer coding for the negative strand of the fusion junction (A); the template was an EcoRI-Hindlll fragment from pS168-l, containing the aprE promoter, signal sequence, pro sequence and the 5' of the mature gene (reaction 1). The DNA between the fusion point and mature lipase gene was amplified using primer 14 (Seq ID No: 21) and the single-stranded synthetic primer coding for the positive strand of the fusion junction (B) ; the template was a 1:100 dilution of a standard DNA miniscreen of plasmid pAK-K3 (reaction 2) . The DNA fragments from reaction 1 were fused to the DNA fragments from reaction 2 by amplification with primers 13 (Seq ID No: 20) and 14 (Seq ID No: 21) , using 1 ul of each reaction 1 and 2 (reaction 3) . After 30 cycles half of the amplified DNA was cleaned with phenol/chloroform extraction, followed by spin-column purification (Worthington Mini-Spin) according to the manufacturer's directions. The EcoRI-Asp718 fragments were isolated from the amplified DNA and cloned into M13-mpl9 EcoRI-Asp718 digested vector. After sequence confirmation (Sanger, et al. , 1977) the EcoRI-Asp718 fragments were cloned into EcoRI-Asp718 digested pAK-K3 vector.
The A and B pairs of fusion primers used for the S4, S5, T6, K8, 111 and E7 constructions were numbers 8A&B, 9A&B, 10A&B, 11A&B, 12A&B and 15A&B respectively (Seq ID Nos: 10-19 and 22 and 23 respectively) .
Transformation into Bacillus εubtiliε The plasmids containing the different fusions were transformed into Bacilluε εubtiliε (Anagnostopoulos, C. , J.Bact. (1961) 81:741-746) and integrated into the chromosome specifically within the aprE locus by a Campbell-type mechanism (Young, M. , J.Gen.Microbiol. (1984) 130:1613-1621). The Bacilluε strain (BB8) was a derivative of 1168 which had been deleted for 5 proteases, and estB (delta apr, delta npr, delta bpF, delta epr, isp-1, delta estB) . Deletion of the genes indicated were introduced using the method as described in Stahl, M.L., J.Bact. (1984) 158:411-4181 After transformation with the fusion gene, the sacU(Hy) (Henner, D.J., Ferrari, E. , Perego, M. and Hoch, J.A. , J.Bact. (1988) 170:296-300) mutation was introduced by either transformation or PBS-1 mediated transduction (Hoch, J.A. , Barat, M. and Anagnostopoulos, C, J.Bact. (1983) 154:1513-1515) creating the different final Bacilluε εubtiliε strains carrying the different fusions.
Cultivation and Evaluation of aprE/Lipase Fusion Strains The final Bacilluε εubtiliε strains were assayed for the production of lipase (cutinase) in the culture supernatant using the following assay:
Assay: Pεeudomonaε mendocina lipase (cutinase) is assayed with ImM p-nitrophenylbutyrate in 0.2M Hepes buffer at pH 7.0. The activity is expressed as change in absorbance at 410nm/min/10ul sample in a lmL reaction volume; 1 unit = a change of lAU410/min/10uL sample in a lmL reaction volume. The results were converted to mg/ml based upon a specific activity of .060(mg/mL) /Unit.
The Bacillus strains were grown overnight in Medium A at 37°C with shaking and then inoculated 5% into Medium B and the production of lipase (cutinase) followed using the above assay. Mediums A and B are described in Table I. The strains were evaluated on the basis of their production rate over the initial linear production interval (Figure 2) and expressed as mg/ L/hr.
Table I:
Medium A
Penassay broth (Difco)
Maltodextrin (CPC M150) 0.1%
As shown in Figure 3, the different fusions produced dramatically different expression levels. The relative production rates varied as much as 5 fold (K3/S4) and the best (K3) produced 5 fold better than the simple direct signal sequence junction hookup (A-l) .