Connect public, paid and private patent data with Google Patents Public Datasets

Alpha anomer oligonucleotide compounds which inhibit retrovirus replication


Publication number
WO1990015813A1 PCT/FR1990/000412 FR9000412W WO1990015813A1 WO 1990015813 A1 WO1990015813 A1 WO 1990015813A1 FR 9000412 W FR9000412 W FR 9000412W WO 1990015813 A1 WO1990015813 A1 WO 1990015813A1
Grant status
Patent type
Prior art keywords
Prior art date
Application number
Other languages
French (fr)
Jean-Louis Imbach
Bernard Rayner
Original Assignee
Centre National De La Recherche Scientifique (Cnrs)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date



    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/337Chemical structure of the base in alpha-anomeric form


The invention relates to oligonucleotide or oligodeoxynucleotide compounds with an alpha anomer structure and to their therapeutic applications. These compounds are used to inhibit RNA virus replication, in particular the alpha oligonucleotide d5'(ACCGCGGGCTTGTCCCTG)3' is used to inhibit the replication of AIDS virus HIV.



La présente invention concerne des composés chimiques constitués par un oligonucleotide ou un oligodésoxynucléotide comportant un enchaînement de nucléotides possédant la configuration anomerique non naturelle alpha par opposition à la configuration anomerique naturelle bêta. The present invention relates to chemical compounds consisting of an oligonucleotide or an oligodeoxynucleotide having a nucleotide chain possessing the non-natural alpha anomeric configuration as opposed to the natural beta anomeric configuration.

De tels composés chimiques ont fait l'objet de demandes de brevets, en particulier les demandes FR S7 04339 (PCT WO 88/04301 ) et FR 88 12264 au nom de la demanderesse auxquelles il conviendra de se reporter en particulier pour y trouver la description de leurs procédés de préparation. Such chemicals have been the subject of patent applications, particularly the S7 applications FR 04339 (WO 88/04301 PCT) and FR 88 12264 in the name of the plaintiff which reference should be made in particular to find the description their methods of preparation.

Plus précisément, la présente invention concerne de tels composés oligonucléotidiques utiles pour inhiber la replication d'un rétrovirus et, en particulier, un composé oligonucléotidique utile pour inhiber la replication du virus VIH. More specifically, the present invention relates to such compounds useful oligonucleotide for inhibiting replication of a retrovirus, in particular, an oligonucleotide compound useful to inhibit replication of HIV virus.

Selon leurs caractéristiques essentielles, les composés selon l'invention consistent en une séquence d'oligoribonucléotide ou oligodésoxyribonuciéotide d'anomerie non naturelle alpha, ladite séquence étant complémentaire d'une séquence comprise dans la séquence dite TBS ou PBS (ARNt binding site ou primer binding site) consistant dans le site de fixation de l'amorce ARNt de replication de l'ARN viral ou dans une séquence de l'ARN viral en amont de la séquence TBS. According to its essential characteristics, the compounds according to the invention consist of an oligoribonucleotide sequence oligodésoxyribonuciéotide or non-natural alpha anomeric, said sequence being complementary to a sequence included in said sequence TBS or PBS (tRNA primer binding site or binding site?) consisting of the primer binding site tRNA replication of viral RNA or a viral RNA sequence upstream of the sequence TBS.

Parmi ces séquences en amont de la séquence TBS ou PBS, on peut citer notamment la séquence CAP. Among these sequences upstream of the sequence TBS or PBS that may be mentioned in particular the sequence CAP.

Les composes oligonucléotidiques alpha selon l'invention peuvent éventuellement être liés de façon covaiente à un agent effecteur, tel qu'un agent intercalant, in radical chimique réactif ou photoactivable. Compounds alpha oligonucleotide according to the invention may optionally be linked so as covalent to an effector agent such as an intercalating agent, in chemical radical or photoactivatable reagent.

Dans un mode de réalisation des composés selon l'invention, ceux-ci présentent la formule suivante : In one embodiment of the compounds according to the invention, they have the following formula:

Figure imgf000003_0001
dans laquelle : in which :

Les radicaux B peuvent être identiques ou différents et représentent chacun une base d'un acide nucléique éventuellement modifiée et rattachée au cycle glycosidique selon une configuration anomerique alpha non naturelle. The radicals B can be identical or different and each represent a base of a nucleic acid optionally modified and attached to the glycoside ring according to a non-natural alpha anomeric configuration.

Les radicaux B étant complémentaires un à un des bases de la séquence oligonucléotidiques cibles comprise dans la séquence TBS ou une séquence en amont de l'ARN proviral ; The B radicals being complementary one to one of the bases of the target oligonucleotide sequence comprised in the sequence TBS or a sequence upstream of the proviral RNA;

Les radicaux X peuvent être identiques ou différents et représentent chacun un oxoanion Q , un thioanion S , un groupe alkyie, un groupe alcoxy, aryloxy, un groupe aminoalkyle, un groupe aminoalcoxy, un groupe thioalkyle ; The radicals X may be identical or different and each represents an oxoanion Q ⊝, a thioanion S ⊝, an alkyl group, alkoxy, aryloxy, aminoalkyl group, an aminoalkoxy group, a thioalkyl group;

R et R', qui peuvent être identiques ou différents, représentent chacun un atome d'hydrogène ou un groupement -YZ ; R and R ', which may be identical or different, each represent a hydrogen atom or a -YZ group; Y représente un radical alcoylène droit ou ramifié -alk- ou un radical choisi parmi Y represents an alkylene radical -alk-, straight or branched or a radical selected from

Figure imgf000004_0001
avec U = O, N ou S ou bien un radical -Y"-OY' où Y" ou Y' peuvent avoir les significations données pour Y ; with U = O, N or S, or a radical -Y "-OY where Y" or Y 'can have the meanings given for Y;

E peut avoir les mêmes significations que X ; I can have the same meanings as X;

J représente un atome d'hydrogène ou un groupe hydroxy ; J represents a hydrogen atom or a hydroxy group;

Z est un radical correspondant à un agent effecteur ; Z is a radical corresponding to an effector agent; n est un nombre entier y compris O ; n is an integer including O; L représente un atome d'oxygène, un atome de soufre ou un groupe L represents an oxygen atom, a sulfur atom or a group

-NH-. -NH-. Dans cette formule I, on utilise la représentation condensée des nucléosides suivante : In this formula I, one uses the condensed representation of the following nucleosides:

Figure imgf000005_0001
qui correspond à la formule développée : which corresponds to the structural formula:

Figure imgf000005_0002
sur laquelle ont été mentionnées les extrémités (3') et (5'). on which have been mentioned the ends (3 ') and (5').

Il convient de remarquer que la formule I représente un enchaînement de nuciéotides qui peuvent être identiques ou différents, n indiquant simplement le nombre de nuciéotides compris dans la molécule ; It should be noted that the formula I represents a sequence of nuciéotides which may be identical or different, n simply indicating the number of nuciéotides included in the molecule; n est de préférence un nombre compris entre 1 et 30, et de préférence encore entre 1 et 20 et dépend de la taille de la séquence cible de l'ARN du rétrovirus. n is preferably a number between 1 and 30 and preferably between 1 and 20 and depends on the size of the target sequence of the RNA retrovirus. En général, par exemple, les séquences TBS ont une vingtaine de nuciéotides. Generally, for example, sequences TBS have twenty nuciéotides.

Les radicaux effecteurs correspondent à des agents effecteurs qui sont des composés connus dans les techniques touchant aux acides nucléiques. Radical effectors match effector agents which are compounds known in the techniques relating to nucleic acids. Il s'agit par exemple des composés capables de "s'intercaler" dans la structure des ADN ou des ARN. This is for example the compounds capable of "insert" in the structure of DNA or RNA.

Ces agents d'intercalation sont notamment constitués par des composés polycycliques ayant une configuration plane tels que i'acridine, la furocoumarine, la daunomycine, la 1,10-phénanthroline, la phénanthridinium, les prophyrines, les dérivés de la dipyrido (1,2-a : 3', 2'-d) imidazole, l'ellipticine ou i'eliipticinium et leurs dérivés. These include intercalating agents consist of polycyclic compounds having a planar configuration such as acridine, furocoumarin, daunomycin, 1,10-phenanthroline, phenanthridinium, the porphyrins, derivatives dipyrido (1,2 -a: 3 ', 2'-d) imidazole, ellipticine or i'eliipticinium and derivatives thereof. Ces agents effecteurs peuvent aussi être des radicaux chimiques réactifs tels que des radicaux chimiques de scission, c'est-à-dire que ces radicaux peuvent directement ou indirectement réagir pour scinder une chaîne de nuciéotides. Such effector agents may also be reactive chemical radicals such as chemical radicals split, that is to say that these radicals can react directly or indirectly to split a nuciéotides chain. De préférence, ces radicaux chimiques réactifs seront activables, par exemple par voie chimique ou photochimique. Preferably, these reactive chemical groups are activated, for example by chemical or photochemical means.

Les groupes réactifs de scission activables sont, par exemple, des dérivés de composés tels que : activatable cleavage The reactive groups are, for example, compounds derivatives such as:

- l'acide éthylène-diamine-tétracétique, - ethylene diamine tetraacetic acid,

- l'acide diéthylène-triamine-pentaacétique, - les porphyrines, - diethylene triamine pentaacetic acid, - porphyrins,

- la 1,10-phénanthroIine, le psoralène et autres groupes aromatiques absorbant les radiations du proche UV et du visible. - 1,10-phénanthroIine, psoralen and other aromatic groups absorbing radiation of the near UV and the visible.

Ces groupements chimiquement activables en présence d'ions métalliques, d'oxygène et d'un agent réducteur, induisent des coupures dans des séquences d'acides nucléiques situées dans leur voisinage. These chemically activated groups in the presence of metal ions, oxygen and a reducing agent, induce breaks in nucleic acid sequences located in their vicinity.

Le radical B est constitué par une base d'un acide nucléique liée à la partie sucre du nucléotide par une configuration anomerique alpha. The radical B is formed by a base of a nucleic linked to the sugar moiety of the nucleotide acid with an alpha anomeric configuration. Ce peut être la thymine, l'adénine, la cytosine, la guanine ou l'uracile. This may be thymine, adenine, cytosine, guanine and uracil. Mais il est également possible d'utiliser des bases d'acides nucléiques modifiées, notamment halogénées ou azidées, par exemple la But it is also possible to use nucleic acid modified bases, including halogenated or azidées, eg

5-bromo-uracile ou la 8-azidoadénine ; 5-bromo-uracil or 8-azidoadenine; ou des dérivés aminés comme la 2-amino-adénine et ses dérivés substitués, par exemple sur le N par un groupe aminoalkylène ou par un groupe azidophénylalkyiène ; or amine derivatives such as 2-amino adenine and substituted derivatives thereof, for example on N by an aminoalkylene group or a azidophénylalkyiène group; ou la guanine substituée sur le O , par exemple par un groupe (ω-alkylène)-9-acridine ou la 8-(ω-aminoalkyl)-ammo-adénine et ses dérivés substitués sur le NH 2 en u) par un groupe acridine. or guanine substituted on the O ⊝, for example with a (ω-alkylene) -9-acridine or 8- (ω-aminoalkyl) -amino-adenine and its derivatives substituted on the NH 2 u) by a group acridine.

Selon la présente invention, sont donc considérées les bases usuelles, ainsi que la possibilité d'introduction de bases modifiées. According to the present invention are therefore considered the usual bases, as well as the possibility of introduction of modified bases. Des. Of. bases "effectrices", susceptibles de se lier par covalence à un brin bêta complémentaire, pourront être introduites. bases "effector", capable of covalently binding to a complementary strand beta, may be introduced. Ainsi, la fonctionnalisation de C ou T par un groupement aziridine en position 4 conduit à la formation de pontages covaients CH 2 -CH 2 entre les deux brins complémentaires sur respectivement G et A. Donc, plus particulièrement, le radical B est choisi parmi la thymine, l'adénine, la cytosine, la guanine, la 4-azido-cytosine ou la 4-azιdo-thymine et la 8-azido-adénine, l'uracile, la 5 bromo-uracile. Thus, the C or T functionalization with an aziridine group in position 4 led to the formation of bridges covaients CH 2 -CH 2 between the two complementary strands respectively G and A. Thus, in particular, the radical B is selected from thymine, adenine, cytosine, guanine, 4-azido-cytosine or 4-azιdo thymine-and 8-azido adenine, uracil, 5-bromouracil.

Le radical X, bien qu'il représente de préférence un oxoanion, peut avoir d'autres significations ; The radical X, although it is preferably an oxoanion, may have other meanings; lorsque le radical X représente un groupement alkyle, il s'agit de préférence d'un groupement alkyle inférieur en C 1 à C 7 et, par exemple, les groupements éthyle, méthyle ou propyle ; when the radical X represents an alkyl group, this is preferably a lower alkyl of C 1 to C 7 and, e.g., ethyl groups, methyl or propyl; lorsque le radical X représente un groupe alcoxy, il s'agit de préférence d'un groupement alcoxy inférieur C 1 à C 7 , par exemple le groupement méthoxy ou éthoxy ; when the radical X represents an alkoxy group, this is preferably a lower alkoxy group C 1 -C 7, for example methoxy or ethoxy group; lorsque X représente un groupement amino-alkyle ou amino-alcoxy ; when X represents an amino group or alkyl amino alkoxy; il peut s'agir d'un groupement amino-alkyle mono-substitué, disubstitué ou bien d'un radical amino sous forme de sel d'ammonium quaternaire. it may be a group mono-substituted amino-alkyl, di-substituted or an amino radical in the form of quaternary ammonium salt. Dans ces conditions, les substituants sont, de préférence, des radicaux aikyles inférieurs comme définis précédemment ; Under these conditions, the substituents are preferably the lower aikyles radicals as defined above; quant à la chaîne alkyle ou alcoxy reliant le radical amino au phosphore, il s'agit de préférence d'une chaîne droite ramifiée comportant de 1 à 10 atomes de carbone. on the alkyl or alkoxy chain linking the amino group to the phosphorus, it is preferably a branched straight chain having from 1 to 10 carbon atoms. Lorsque le radical alkyle ou alcoxy est substitué par un hétérocycle azoté, il s'agit notamment de cycle saturé à 5-6 chaînons comportant un atome d'azote qui peut être quaternaire. When the alkyl or alkoxy radical substituted with a nitrogenous heterocycle, it is in particular saturated ring, 5-6 membered ring having one nitrogen atom which may be quaternary. Enfin, lorsque le radical X est un radical thioalkyle, il s'agit de préférence d'un radical thioalkyle inférieur, c'est-à-dire qui comporte entre 1 et 7 atomes de carbone. Finally, when the group X is a thioalkyl radical, it is preferably a lower thioalkyl radical, that is to say which comprises between 1 and 7 carbon atoms.

Le radical -alk- est de préférence un radical alcoylène droit ou ramifié ayant de 1 à 10 atomes de carbone. The radical -alk- is preferably an alkylene radical straight or branched having 1 to 10 carbon atoms. En particulier, à partir des fonctions alcool terminales 3' ou 5' de l'oligomère alpha, l'effecteur peut donc être introduit via une chaîne In particular, from the terminal alcohol functional 3 'or 5' end of the oligomer alpha, the effector may be introduced via a chain

(CH 2 ) n liée à une fonctionnalisation Z' de natures diverses à la partie osidique de l'oligomère. (CH 2) n bonded to a functionalization Z 'of various kinds to the saccharide portion of the oligomer.

A partir de la formule 3' ou -O-Z'-(CH 2 ) n -effecteur (Z) on obtiendra, selon ce que représente Z', par exemple From the formula 3 'or -O-Z' - (CH 2) n -effecteur (Z) will be obtained, depending on what is Z ', e.g.

- un phosphate ou méthyl phosphonate de formule - a phosphate or methyl phosphonate of formula

Figure imgf000008_0001
U = O, N ou S U = O, N or S

- un éther de formule générale - an ether of the general formula

Figure imgf000008_0002

- un ester de formule générale - an ester of general formula

Figure imgf000008_0003
ou encore or

- un carbamate de formule générale - a carbamate of general formula

Figure imgf000008_0004
Selon la présente invention sont concernés également les composés précédents sous forme de sel avec des bases ou des acides, et les composés sous forme racemique, ou sous forme d'isomères R ou S optiques purifiés ou en mélange. According to the present invention are also concerned the foregoing compounds in salt form with bases or acids, and the compounds in racemic form or in the form of R or S optical isomers purified or in a mixture.

Selon la présente invention sont concernés également les composés précédents cans les séries D ou L. According to the present invention are also concerned the foregoing cans D or L series

Dans un wode de réalisation de l'invention, on utilise des oiigodésoxynucléotides aipna. In a wode embodiments of the invention are used aipna oiigodésoxynucléotides. II s'agit des composés pour lesquels X = O ; II are the compounds for which X = O ⊝; J, R et R' = H ; J, R and R '= H; B est choisi parmi A, C, T et G, et L est un atome d'oxygène dans la f ormule I. La présente imention a également pour objet des compositions pharmaceutiques antiwraies contenant à titre de substance active lesdits composés, et notamment des compositions utiles pour le traitement des affections virales des virus à ARN, tels que le virus VIH1 du SIDA. B is selected from A, C, T and G, and L is an oxygen atom in the ormule f I. The present imention also concerns pharmaceutical compositions antiwraies containing as active substance the said compounds, and in particular compositions useful for treating viral infections of RNA viruses, such as HIV-1 virus that causes AIDS.

Enfin, la présente invention a pour objet l'utilisation des composés selon l'invention à la préparation de compositions pharmaceutiques antivirales notamment utiles pour le traitement du SIDA. Finally, the present invention relates to the use of compounds of the invention in the preparation of antiviral pharmaceutical compositions especially useful for the treatment of AIDS. Comme mentionné ci-dessus, l'application des composés oligonucléotidiques alpha selon la présente invention consiste à inhiber la replication des rétrovirus et notamment du virus de l'immunodéficience humaine VIH1 du SIDA. As mentioned above, the application of alpha oligonucleotide compounds of the present invention to inhibit the replication of retroviruses and in particular virus HIV1 human immunodeficiency of AIDS. Le rétrovirus associé à des iymphadénopathies (LAV), également appelé virus HTLV III (HTLV - human T leukemia virus) ou AIDS - related virus (ARV) a été baptisé plus récemment VIHI et est en effet reconnu comme l'agent responsable du SIDA. The retrovirus associated with iymphadénopathies (AVL), also called HTLV III (HTLV - human T leukemia virus) or AIDS - related virus (ARV) has been baptized recently Vihi and indeed is recognized as the causative agent of AIDS.

Les virus à ARN et notamment le virus du SIDA ont un mécanisme de multiplication qui fait effectivement intervenir l'enzyme RNA viruses, including the AIDS virus have a multiplication mechanism that actually involves the enzyme

ADN polymérase - ARN dépendante encore appelée transcriptase inverse ou plus communément réverse transcriptase. DNA polymerase - still dependent RNA called reverse transcriptase or more commonly reverse transcriptase. Cette enzyme copie en ADN monobrin dit complémentaire (ADNc), l'ARN viral. This enzyme copy stranded DNA complementary to said (cDNA), the viral RNA. Il faut pour cela qu'elle trouve une amorce oligonucléotidique appariée à l'extrémité 3' de la matrice d'ARN à copier. This requires that an oligonucleotide primer is paired with the 3 'end of the RNA template to be copied.

La transcriptase réverse est à la fois nécesaire à l'établissement de l'état provirai, au démarrage de la replication du virus, et à l'éventuelle transformation de la cellule. The reverse transcriptase is both necesary for the establishment of the proviral state, when starting the replication of the virus, and the possible transformation of the cell.

Chez les rétrovirus, l'amorce est un ARNt d'origine cellulaire présent à l'intérieur des virions. In retroviruses, the primer is a cellular origin tRNA present in virions. Précisément, quand le virus infecte une cellule, la transcriptase reverse (RT) se fixe à l'ARN virale et l'ARNt-3' de la lysine sert de début à l'ADN qui sera synthétisé. Specifically, when the virus infects a cell, reverse transcriptase (RT) binds to the viral RNA and tRNA 3 'lysine serves Start DNA to be synthesized. Le brin synthétisé est guidé par le sillon d'amorce. The synthesized strand is guided by the seed furrow. Le brin d'ADN ainsi synthétisé est alors sous forme de monobrin, suite à l'activité RNasique liée à la RT et un brin complémentaire d'ADN est synthétisé via l'activité polymerasique DNA dépendante de la RT. The DNA strand is then synthesized as well as single-stranded following the RNAse activity associated with the RT and a complementary strand of DNA is synthesized via DNA polymerase activity dependent on the RT.

La structure d'un rétrovirus avant et après sont intégration dans le DNA d'une cellule-hôte peut se schématiser comme suit : a) Intégration du rétrovirus dans le DNA de la cellule-hôte The structure of a retrovirus are before and after integration into the DNA of a host cell can be depicted as follows: a) Integration of retroviral DNA into the host cell

ARN viral viral RNA

Figure imgf000010_0001

transcriptase reverse reverse transcriptase

Figure imgf000010_0002

DNA 2 brins 2 DNA strands

Figure imgf000010_0003
Figure imgf000010_0004

DNA cellule-hôte Host cell DNA

Figure imgf000010_0005
Figure imgf000010_0006
b) Structure moléculaire du génome du rétrovirus durant les différentes phases de l'intégration * ARN génomique b) Molecular structure of the genome of the retrovirus during the different phases of the integration * genomic RNA

5' RU 5 -UU - TBS- NC -région codante- NC - Pur -AA-U 3 -R 3' 5 'RU 5 -uu - -region codante- TBS- NC NC - Pure -AA-U 3 -R 3'

(ARN) Le ARN d'un rétrovirus est un ARN simple brin dans lequel les régions codantes sont flanquées de séquences essentielles pour la replication et l'expression virales. (RNA) The RNA of a retrovirus is a single-stranded RNA in which the coding regions are flanked by sequences essential for viral replication and expression. Ces séquences sont, de l'extrémité 5' vers 3' : These sequences are the 5 'to 3':

- R (short "repeat") : une courte séquence à l'extrémité 5' qui comprend en début de séquence une séquence CAP nécessaire pour que puisse s'effectuer la traduction. - R (short "repeat"): a short sequence at the 5 'end that comprises a start sequence CAP sequence necessary for that can be carried out the translation. (Les mêmes nuciéotides seront répétés à l'extrémité 3'), (The same nuciéotides will be repeated at the 3 'end)

- U 5 : séquence iinique de l'extrémité 5' (constituée d'environ 80 nuciéotides), - U 5: iinique sequence of the 5 'end (consisting of about 80 nuciéotides)

- UU : 2 nuciéotides à uracile, - UU 2 nuciéotides to uracil

- TBS ("tRNA binding site"). - TBS ( "tRNA binding site"). Il s'agit du site où se lie (par son extrémité 3') l'ARNt qui servira d'amorce lors de la replication. This is the site where bind (by its 3 'end) that will serve tRNA primer during replication. Les liaisons complémentaires et antiparallèles porteront sur 20 pdb environ, Complementary and antiparallel connections will cover approximately 20 bps,

- NC : une séquence non codante, - NC: non-coding sequence,

- région codante : elle est située au centre, elle contient très peu de gènes. - coding region: it is situated in the center, it contains very few genes. Ce sont : Those are :

"gag", (pour "group spécifie antigen") ou gène de l'antigène de groupe, qui code pour une polyprotéine qui, découpée, donne les protéines du nuciéoîde. "Gag" (for "group specifies antigen") or gene group antigen, which encodes a polyprotein, which cut gives the proteins nuciéoîde. Parmi ces protéines internes, l'une d'entre elles porte i'antigénicité du groupe, These internal proteins, one of them i'antigénicité door group

"pol" (pour "poiymérase") qui code pour la transcriptase réverse et "env" (pour "enveloppe") qui code pour les giycoprotéines de l'enveloppe. "Pol" (for "poiymérase") which encodes reverse transcriptase and "env" (for "envelope") which codes for the glycoproteins of the envelope. Une d'entre elles porte I'antigénicité de chaque sérotype viral. One of them carries I'antigénicité each viral serotype. Dans la région codante peut se trouver aussi un gène codant pour une protéine (ou un segment de protéine) virale spécifique du rétrovirus (Par exemple, chez les rétrovirus oncogenes, on trouve un gène onc. Ce n'est pas le cas du virus du SIDA qui n'est pas un rétrovirus oncogène, il ne cancérise pas les cellules mais les détruit). In the coding region can also find a gene encoding a protein (or protein segment) specific retrovirus virus (For example, in oncogenic retroviruses, there is a onc gene. This is not the case of virus AIDS is not an oncogenic retroviruses, it does not cancérise cells but destroyed). - NC : une région non codante, - NC: non-coding region

- Pur : une séquence riche en bases puriques, - Pure: a sequence rich in purine bases,

- AA : 2 nuciéotides à adénine, - AA: 2 nuciéotides to adenine,

- U 3 : séquence jjnique de l'extrémité 3' (environ 300 nuciéotides), - U 3: jjnique sequence of the 3'-end (about 300 nuciéotides)

- R : (short "repeat"), à l'extrémité 3'. - R: (short "repeat") at the 3 'end. * DNA virai après action de la transcriptase réverse : DNA viral non intégré * DNA virai after the action of reverse transcriptase: unintegrated viral DNA

5' AA-U 3 -RU 5 -TT-TBS-NC- région codante -NC-Pur-AA-U 3 -RU 5 -TT 3' (DNA) 5 'AA-U 3 -RU 5 -TT-TBS-NC- coding region -NC-Pur-AA-U 3 -RU 5 -TT 3' (DNA)

3' TT-U 3 -RU 5 -AA-TBS-NC- région codante-NC-Pyr-TT-U 3 -RU _-AA 5' Après action de la transcriptase réverse, la molécule de DNA double brin transcrite est plus longue que le DNA génomique correspondant. 3 'TT-U 3 -RU 5 -AA-TBS-NC- region coding-NC-Pyr-TT-3 -RU U _-AA 5' After the action of reverse transcriptase, the DNA molecule is transcribed double-stranded longer than the corresponding genomic DNA. En effet, il y a addition aux 2 extrémités de 2 séquences : Indeed, there are addition to two ends of two sequences:

- à l'extrémité 5' est ajoutée une séquence U 3 , - in the 5 'end is added a sequence U 3,

- à l'extrémité 3' est ajoutée une séquence U 5 . - at the 3 'end is added a 5 U sequence. On appelle "LTR" (long terminal repeat) l'ensemble : U 3 -R- U 5 . The term "LTR" (long terminal repeat) Overall: U 3 U -R 5.

Il y a donc 1 LTR à chacune des 2 extrémités. There is thus 1 LTR at each of two ends. * DNA viral intégré (provirus) * Integrated viral DNA (the provirus)

' '

Figure imgf000012_0001
Le DNA linéaire double brin devient circulaire clos, puis il est à nouveau ouvert pour être intégré dans le DNA de la cellule-hôte. The linear double-stranded circular DNA is closed, then opened again to be integrated into the DNA of the host cell. On appelle "provirus" le DNA viral intégré. The term "provirus" the integrated viral DNA. Lors de l'intégration, les dinuciéotides (TT, AA) situés aux extrémités du DNA transcrit (et faisant partie de U 3 ou U 5 ) sont éliminés. During integration, dinuciéotides (TT AA) located at the ends of the DNA transcript (and part of U 3 or U 5) are eliminated. La jonction au niveau du site d'intégration implique : The junction at the site of integration implies:

- au niveau du DNA hôte, une séquence directe répétée : DR ("direct repeat"), à la jonction donc avec le provirus. - at the host DNA, repeated direct sequence: DR ( "direct repeat"), at the junction with the provirus so.

Toutes les DR sont longues de 4 à 6 pdb. All CDs are long from April to June bps. Leurs séquences sont différentes. Their sequences are different. Pour un même provirus, on trouve d'ailleurs différentes DR dans le DNA d'une cellule-hôte. For the same provirus, there are also different CD in the DNA of a host cell. Le site d'intégration du virus n'est donc pas sepcifique, le virus peut être intégré dans le génome de l'hôte à plusieurs endroits différents. The virus integration site is not sepcifique, the virus can be integrated into the host genome in several different places.

- au niveau du DNA viral, une séquence inverse répétée ; - at the level of the viral DNA, repeated reverse sequence; IR ("inverted repeat") aux extrémités du rétrovirus. IR ( "inverted repeat") at the ends of retrovirus. Deux séquences sont dites "inverses répétées" quand l'une est à la fois l'inverse et le complément de l'autre. Two sequences are said to "repeated reverse" when one is both the reverse and complement of the other.

On a essayé de lutter contre la replication du virus du SIDA, avec des oligonucléotides antisens, c'est-à-dire des segments d'ADN complémentaires d'une portion de l'ARN messager du virus qui code directement les protéines devant être synthétisées par le ribosome. We tried to fight against the replication of the AIDS virus, with antisense oligonucleotides, that is to say the complementary DNA segments of a portion of the messenger RNA of the virus that directly encodes the protein to be synthesized by the ribosome.

Compte tenu du fait que les oligonucléotides alpha forment des hétéroduplex avec leurs oligonucléotides complémentaires bêta et que ceux-ci ne sont pas substrats pour l'enzyme RNase H, on pouvait penser que l'inhibition de l'expression de protéines par l'oligonucléotide alpha pouvait peut-être s'effectuer par un empêchement du ribosome à traduire l'ARNm en protéine virale. Given the fact that alpha oligonucleotides form heteroduplexes with their beta oligonucleotides complementary and that they are not substrates for the enzyme RNase H, one could think that the inhibition of the expression of proteins by oligonucleotide alpha could perhaps be done by preventing the ribosome to translate mRNA into viral protein.

Toutefois, les expériences qui ont été entreprises en ce sens n'ont pas été concluantes. However, the experiments that have been undertaken in this direction have not been conclusive.

En revanche, l'approche selon la présente invention visant à utiliser des oligonucléotides complémentaires d'une séquence initiale de l'ARN viral et notamment du site initial de fixation de l'ARNt de la lvsine sur l'ARN provirai, s'est avérée efficace. In contrast, the approach according to the present invention aimed at using oligonucleotides complementary to an initial sequence of the viral RNA including the initial site of attachment of the tRNA lvsine on proviral RNA, proved effective.

Ainsi, la présente invention a pour objet un oligonucleotide alpha dont ia séquence est complémentaire du site 182- 199 de la séquence PBS de l'ARN proviral du virus VIH, soit l'oiigodésoxynucleotide alpha d 5' (ACCGCGGGCTTGTCCCTG) 3' ou plus généralement un oligonucleotide alpha de formule ACCGCGGGCXXGXCCCXG avec X = T pour un oligodésoxyribonuciéotide alpha ou X = U pour un oligoribonucléotide alpha ou une séquence complémentaire en interchangeant X et A d'une part et C et G d'autre part. Thus, the present invention relates to an alpha oligonucleotide whose sequence is complementary ia Site 182- 199 PBS sequence of proviral HIV RNA virus or the alpha oiigodésoxynucleotide d 5 (ACCGCGGGCTTGTCCCTG) 3 'or more generally an alpha oligonucleotide ACCGCGGGCXXGXCCCXG formula with X = T or an alpha oligodésoxyribonuciéotide X = U for alpha oligoribonucleotide or a complementary sequence by interchanging a and X on the one hand and C and G on the other. D'autres caractéristiques et avantages de la présente invention apparaîtront à la lumière des exemples qui vont suivre. Other features and advantages of the present invention appear in the light of the examples that follow.

La figure 1 représente l'inhibition de la production virale de cellule MT4 par l'oligonucléotide alpha d 5 '(ACCGCGGGCTTGTCCCTG) 3 ' (oligo alpha "PBS") par dosage de l'activité (cpm) de transcriptase inverse. Figure 1 shows the inhibition of viral production from MT4 cell by the oligonucleotide of alpha 5 (ACCGCGGGCTTGTCCCTG) 3 '(oligo alpha "PBS") by activity assay (cpm) of reverse transcriptase. EXEMPLE 1 : Cytotoxicité des oligonucléotides alpha EXAMPLE 1 Cytotoxicity of alpha oligonucleotides

Quel que soit le type d 'oligonucleotide utilisé, ceux-ci finissent plus ou moins rapidement par être dégradés par les enzymes cellulaires. Whatever type of oligonucleotide used, they end up more or less quickly be degraded by cellular enzymes. On montre ci-après que les oligonucléotides alpha et leur catabolites nucléosides al pha et nucléotide alpha ne présentent pas de cytotoxicité. The following shows that alpha oligonucleotides and nucleoside catabolites al pha and alpha nucleotide show no cytotoxicity.

Ainsi, l 'ol igonucléotide alpha-d(CCTCTCGTTCTTTAC) oligo alpha Tat (complémentaire) de la séquence Tat dirigé, à priori, contre aucun site du génome des cellules MT-4, présente une CD 50 supérieure à 250 μg/ml. Thus, the alpha-ol igonucléotide d (CCTCTCGTTCTTTAC) oligo alpha Tat (Complementary) Tat sequence directed a priori against any site of the genome of MT-4 cells, has a CD 50 of more than 250 mcg / ml. De même, des alpha oligothymidylates alpha-(dT) n (2 ≤ n ≤ 12) se sont révélés non cytotoxiques vis-à-vis de la même lignée cellulaire. Similarly, alpha oligothymidylates alpha- (dT) n (2 ≤ n ≤ 12) were found non-cytotoxic vis-à-vis the same cell line.

Enfin, des al pha nucléosides et alpha nuciéotides pouvant résulter de l'hydrol yse len te d'oligonucleotides sont également dépourvus de cytotoxicité contre diverses lignées cellulaires (Hela, Vero, cellules primaire de rein de lapin. MT-4). Finally, al pha nucleosides and alpha nuciéotides may result from the hydrol ysis len oligonucleotide you are also devoid of cytotoxicity against various cell lines (Hela, Vero, primary cells of rabbit kidney. MT-4).

Figure imgf000014_0001

EXEMPLE 2 : Evaluation de l'effet antiviral de l'oligo alpha EXAMPLE 2: Evaluation of the antiviral effect of the oligo alpha


1. Protocole a) méthode L'évaluation est basée sur l'étude de l'effet cytopathogène du virus VIH1 sur la lignée cellulaire MT4, après infection par le virus VIH1, la formation des syncitia est observée 4 à 6 jours après l'infection, suivie par une production de particules virales, puis par la mort des cellules. 1. Protocol) method The assessment is based on studying the cytopathogenic effect of HIV-1 virus in the MT4 cell line after infection with HIV-1 virus, the formation of syncytia was observed 4-6 days after infection followed by production of viral particles, then cell death.

La destruction de lymphocytes T4 indispensables à la défense immunitaire est la première cause de la déficience immunitaire caractéristique de l'infection par le VIH. The destruction of T4 cells essential for immune defense is the primary cause of immune deficiency characteristic of HIV infection. On sait que ce virus tue les cellules en s'y multipliant ; We know that the virus kills the cells by multiplying them; lorsqu'il s'en échappe, il endommage la membrane cellulaire. when it escapes, it damages the cell membrane. Le VIH tue peut-être aussi les lymphocytes T4 indirectement, par la protéine gp l 20 présente sur la membrane des cellules infectées. HIV may also kills CD4 T cells indirectly by the protein gp l 20 present on the membrane of infected cells. En effet, les lymphocytes T4 portent une molécule de surface, le récepteur CD4, à laquelle la protéine GP120 se lie ; Indeed, the T4 lymphocytes carry a surface molecule, the CD4 receptor to which the gp120 protein binds; les lymphocytes T4 sains se fixent à la protéine et fusionnent avec la cellule infectée. healthy T4 cells bind to the protein and fuse with the infected cell. L'amas cellulaire qui se forme est un "syncytiuni", incapable de survivre, et toutes les cellules saines qui le composent meurent avec la cellule infectée. The cell clusters formed is a "syncytiuni", unable to survive, and all the healthy cells that make up the die with the infected cell. Le VIH peut aussi déclencher des réactions immunitaires normales contre les lymphocytes infectés. HIV can also trigger the normal immune response against infected cells. Avec ou sans l'aide des anticorps, les cellules cytotoxiques de défense détruisent une cellule infectée portant à sa surface des protéines virales. With or without the help of antibodies, cytotoxic defensive cells destroy an infected cell carrying on its surface viral proteins. Enfin, la protéine gp120 circule parfois librement en solution dans le sang des sujets infectés ; Finally, gp120 may circulate freely in solution in the blood of infected individuals; elle se lie au récepteur CD4 des cellules saines, simulant une infection et déclenchant une réaction de destruction de cellules non infectées. it binds to the CD4 receptor of healthy cells, simulating infection and triggering a destruction reaction uninfected cells.

Les syncytia sont des structures formées de plusieurs noyaux entourés par une seule membrane cellulaire ; The syncytia are structures formed of multiple cores surrounded by a single cell membrane; Ce sont des signes d'infection par le VIH dans les cultures cellulaires; These are signs of HIV infection in cell cultures; Les syncytia se forment lorsque les cellules infectées qui synthétisent la molécule gp120 et la transportent à leur surface fusionnent avec des cellules saines portant la molécule CD4. Syncytia form when infected cells which synthesize the gp120 molecule and carrying on their surface merging with healthy cells bearing the CD4 molecule. b) Composé testé alpha-d 5 ' ACCGCGGGCTTGTCCCTG 0,54 U solution mère à 1 mg/ml en eau bidistillée stérile et conservée à-80°C. b) Test compound alpha-d 5 'ACCGCGGGCTTGTCCCTG 0.54 U stock solution containing 1 mg / ml in sterile double distilled water and stored at -80 ° C. c) Test MT4 Les cellules MT4 au jour 2 après le dernier passage sont pré-incubées 1 heure à 37°C avec les dilutions successives du composé à raison de 3.10 cellules pour 100 μl de composé (en micropaque à 96 puits). c) Test MT4 MT4 cells at day 2 after the last passage were pre-incubated 1 hour at 37 ° C with serial dilutions of the compound in an amount of 3.10 cells per 100 .mu.l of compound (in 96-well Micropaque).

L'infection est réalisée en micropuits en ajoutant 100 μl d'une dilution 10 - 4 du virus VIH1 (la dilution de virus a été déterminée pour induire la formation de syncitia en 4 jours). The infection is carried into microwell by adding 100 .mu.l of a dilution 10-4 HIV-1 virus (the virus dilution was determined to induce syncytia formation in 4 days).

Après une incubation de 1 heure à 37°C, les cellules MT4 infectées sont lavées 5 fois avant d'être mises en cultures à la concentration de 3.10 cellules par ml, en microplaque à 24 puits, en présence des différentes dilutions choisies. After incubation for 1 hour at 37 ° C, the infected MT4 cells were washed 5 times before being placed in culture at a concentration of 3.10 cells per ml, in 24 well microplate in the presence of different selected dilutions. Tous les 3 ou 4 jours, les cellules sont diluées 3 ou 4 fois et ajustées à la concentration de 3.10 cellules/ml avec le milieu RPM 1 10 % FCS 1 % PSN 1 % Gluta toujours en présence de l'oligo alpha PBS. Every 3 or 4 days, the cells are diluted 3 or 4 times and adjusted to the concentration of 3.10 cells / ml with the medium RPM 1 10% FCS 1% 1% PSN Gluta always in the presence of oligo alpha PBS.

Tous les 2 ou 3 jours, l'apparition des syncitia est observée dans les cultures. Every 2 or 3 days, the appearance of syncytia is observed in the cultures. d) Dosage de la transcriptase inverse d) Reverse Transcriptase Assay

Le suivi de la production virale des cellules MT4 est réalisé par dosage de l'activité de la transcriptase inverse (figure 1 RT) dans la culture tous les 3 ou 4 jours. Monitoring the viral production MT4 cells is performed by assaying the activity of reverse transcriptase (RT 1) in the culture every 3 or 4 days. Brièvement, l'activité enzymatique est testée en utilisant une amorce synthétique et un substrat radiomarque au H 3 "in vitro". Briefly, the enzyme activity is tested using synthetic primer and a radiolabeled substrate H 3 "in vitro". La quantité de matériel radiomarque précipité, exprimée en coups par minute, est proportionnelle à l'activité de la transcriptase inverse elle-même proportionnelle à la quantité de virus produit par les cellules MT4 infectées. The amount of radiolabeled material precipitated, expressed in counts per minute is proportional to the activity of reverse transcriptase itself proportional to the amount of virus produced by infected MT4 cells.



J3 J 4 J5 J7 J10 J11 J12 J14 J18 J3 J4 J5 J7 J10 J11 J12 J14 J18

100 μg/ml - - - - - - - - - (+) - (-) (+) ++ ++ T 100 g / ml - - - - - - - - - (+) - (-) (+) ++ ++ T

25 μg/ml (+) - (+) - (+) - (+) (+) ( +) ++ + ++ + -+ ++ ++ TT 25 mcg / ml (+) - (+) - (+) - (+) (+) (+) + ++ ++ ++ ++ ++ TT

10 μg/ml - (+) ( 4 ) ( 4 ) + + + ++ ++ ++ ++ + + ++ ++ ++ ++ ++ TT 10 mg / ml - (+) (4) (4) + + + ++ ++ ++ ++ + + ++ ++ ++ ++ ++ TT

5 μg/ml (+)+(+) + + ++ + ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ 5 .mu.g / ml (+) + (+) + + ++ + ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++

I μg/ml (+) (+) (+) (+) + (+) ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ I mg / ml (+) (+) (+) (+) + (+) ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++

100 ng/ml (+) (+) (+) ++ + ++ +- ++ ++ ++ ++ ++ ++ ++ ++ ++ T ++ 100 ng / ml (+) (+) (+) ++ + ++ + - ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ T

50 ng/ml (+) (+) + + + + + + + + + ++ + + ++ ++ + + ++ ++ ++ ++ T 50 ng / ml (+) (+) + + + + + + + + + ++ + + ++ ++ + + ++ ++ ++ ++ T

VIH 1 (+) (+) + + ++ + + ++ ++ + + ++ ++ ++ ++ ++ ++ ++ TT HIV 1 (+) (+) + + ++ + + ++ ++ + + ++ ++ ++ ++ ++ ++ ++ TT

Légende : - : absence de syncitia ( + ) : syncitia en formation + : apparition de syncitia + + : syncitia T : cel lules tuées Legend: -: no syncytia (+): syncytia formation +: + appearance of syncytia: syncytia T: cel Lules killed

3. Conclusions 3. Conclusions

Lors de l'évaluation de l'inhibition de l'effet cytopathogène du virus VIH1 sur la lignée MT4 par l'oligo alpha "PBS", un retard dans la formation des syncitia est observé pour les doses non toxiques de 100 μg/ml à 10 μg/ml, ce retard pouvant atteindre le 12ème jour après l'infection à la concentration de 100 μg/ml. In evaluating the inhibition of the cytopathic effect of HIV-1 virus on MT4 line by alpha oligo "PBS", a delay in the formation of syncytia was observed for the non-toxic doses of 100 ug / ml to 10 mcg / ml, the delay up to the 12th day after infection at a concentration of 100 mcg / ml.

Parallèlement, le suivi de la production virale par les cellules Meanwhile, the monitoring of viral production by cells

MT4 infectées montre (figure 1 ) que quelques soient les doses d'oligo alpha Infected MT4 shows (Figure 1) that whatever alpha oligo doses

"PBS" utilisées, la production virale reste inférieure à celle obtenue en présence du virus VIH1 , avec un pic de production virale maximale retardée. "PBS" used, viral production is still lower than that obtained in the presence of HIV-1 virus, with a peak of delayed maximal virus production.

L'ensemble de ces résultats indiquent que l'oligo alpha PBS présente un effet antiviral sur le virus VIHI . All these results indicate that the oligo alpha PBS has an antiviral effect on the virus Vihi.

EXEMPLE 3 : Comparaison de l'effet antiviral d'oligonucleotides "alpha PBS", "alpha Tat", "alpha random" La production de particules virales par les cellules CEM, infectées par VIH1 BRU et cultivées en présence d'oligonucleotides, est suivie par dosage de la Reverse Transcriptase (cpm). EXAMPLE 3: Comparison of the antiviral effect of oligonucleotides "alpha PBS", "alpha Tat", "alpha random" The production of viral particles by the CEM cells infected with HIV-1 BRU and cultured in the presence of oligonucleotides is followed by assaying the Reverse Transcriptase (cpm).

L'oligonucléotide "alpha Tat" correspond à l'oligonucléotide alpha d 5 GTAAAAGTCTTAACCCAC 3' . The oligonucleotide "alpha Tat" is the alpha oligonucleotide to 5 GTAAAAGTCTTAACCCAC 3 '. Il est complémentaire de la séquence du gène Tat du virus du SIDA. It is complementary to the sequence of the Tat gene of the AIDS virus.

L'oligo nucléotide "alpha random" correspond à un oligonucléotide quelconque alpna d 5' ACTGACTGACTGACTGAC 3' . The oligonucleotide "alpha random" refers to any oligonucleotide of alpna 5 'ACTGACTGACTGACTGAC 3'.

Les résultats de la Reverse Transcriptase en coups par minute comparés à un contrôle Random sont les suivants. The results of the Reverse Transcriptase in counts per minute compared to a random control are as follows.

Figure imgf000019_0001

L'oligonucléotide "alpha PBS" montre une inhibition de la production virale pour des concentrations de 100 μg/ml et 50 μg/mi. The oligonucleotide "alpha PBS" shows inhibition of virus production at concentrations of 100 mcg / ml and 50 mcg / mi.

A la concentration de 6,25 μ/ml on remarque que l'oligonucléotide "alpha Tat" ne présente pas de production virale au jour 1 1. Il en est de même pour le Random à 3,1. At the concentration of 6.25 μ / ml is noted that the oligonucleotide "Tat alpha" shows no viral production on day 1 1. It is the same for Random to 3.1.

L'ensemble de ces résultats indique l'oligonucléotide "alpha PBS" présente un effet antiviral sur le virus HIV1 à des concentrations de 100 μg/ml et 50 μg/ML, alors que l'oligonucléotide "alpha Tat" et l'oligonucléotide "alpha Random" ne présentent aucun effet antiviral. All these results indicate the oligonucleotide "alpha PBS" has an antiviral effect on HIV-1 virus at concentrations of 100 mcg / ml and 50 mcg / ml, whereas the oligonucleotide "alpha Tat" and oligonucleotide " alpha Random "do not have any antiviral effect.


1. Composé oiigonucléotidique utile pour inhiber la replication d'un rétrovirus, caractérisé en ce qu'il consiste en une séquence d'oligoribonucléotide ou oligodésoxyribonucléotide d'anomerie non naturelle alpha, ladite séquence étant complémentaire d'une séquence initiale de l'ARN viral comprise dans la séquence TBS ou une séquence en amont de l'ARN viral, notamment la séquence CAP. 1. A compound useful oiigonucléotidique for inhibiting replication of a retrovirus, characterized in that it consists of an oligoribonucleotide or oligodeoxyribonucleotide sequence of non-natural alpha anomeric, said sequence being complementary to a sequence of original viral RNA TBS comprised in the sequence or a sequence upstream of the viral RNA, in particular the sequence CAP.
2. Composé oiigonucléotidique selon la revendication 1, caractérisé en ce qu'il est en outre lié de façon covalente à un agent effecteur. 2. A compound oiigonucléotidique according to claim 1, characterized in that it is further covalently bonded to an effector agent.
3. Composé oiigonucléotidique selon l'une des revendications I ou 2, caractérisé en ce que les composés ont pour formule 3. A compound oiigonucléotidique according to one of claims I or 2, characterized in that the compounds have the formula
Figure imgf000021_0001
dans laquelle : in which :
Les radicaux B peuvent être identiques ou différents et représentent chacun une base d'un acide nucléique éventuellement modifiée et rattachée au cycle glycosidique selon une configuration anomerique alpha non naturelle, The radicals B can be identical or different and each represent a base of a nucleic acid optionally modified and attached to the glycoside ring according to a non-natural alpha anomeric configuration,
les radicaux B étant complémentaires un à un des bases de la séquence oligonucléotidiques cibles de la séquence TBS ou d'un séquence en amont de l'ARN viral ; the B radicals being complementary one to one of the bases of the target oligonucleotide sequence from the sequence TBS or a sequence upstream of the viral RNA;
Les radicaux X peuvent être identiques ou différents et représentent chacun un oxoanion O , un thioanion S , un groupe alkyle, un groupe alcoxy, aryloxy, un groupe aminoalkyle, un groupe aminoalcoxy, un groupe thioalkyle ; The radicals X may be identical or different and each represents an oxoanion O ⊝, a thioanion S ⊝, alkyl, alkoxy, aryloxy, aminoalkyl group, an aminoalkoxy group, a thioalkyl group; R et R', qui peuvent être identiques ou différents, représentent chacun un atome d'hydrogène ou un groupement -YZ ; R and R ', which may be identical or different, each represent a hydrogen atom or a -YZ group;
Y représente un radical alcoylène droit ou ramifié -alk- ou un radical choisi parmi Y represents an alkylene radical -alk-, straight or branched or a radical selected from
Figure imgf000022_0001
Figure imgf000022_0002
Figure imgf000022_0003
Figure imgf000022_0004
et and
Figure imgf000022_0005
Figure imgf000022_0006
Figure imgf000022_0007
avec U = O, N ou S with U = O, N or S
ou bien un radical -Y"-OY' où Y" ou Y' peuvent avoir les significations données pour Y ; or a radical -Y "-OY where Y" or Y 'can have the meanings given for Y;
E peut avoir les mêmes significations que X ; I can have the same meanings as X;
J représente un atome d'hydrogène ou un groupe hydroxy ; J represents a hydrogen atom or a hydroxy group;
Z est un radical correspondant à un agent effecteur ; Z is a radical corresponding to an effector agent;
n est un nombre entier y compris O ; n is an integer including O;
L représente un atome d'oxygène, un atome de soufre ou un groupe -NH-. L represents an oxygen atom, a sulfur atom or an -NH- group.
4. Composé selon l'une des revendications précédentes utile pour l'inhibition de la replication du virus du SIDA VIH dont la séquence est complémentaire du site 182-199 de l'ARN proviral du virus, soit comporte l'oligonucléotide alpha ACCGCGGGCXXGXCCCXG avec X = T ou U ou sa séquence complémentaire en interchangeant X et A d'une part, et C et G d'autre part. 4. A compound according to one of the preceding claims useful for inhibiting replication of the AIDS virus HIV whose sequence is complementary Site 182-199 proviral virus RNA or oligonucleotide comprises alpha ACCGCGGGCXXGXCCCXG with X = T or U or its complementary sequence by interchanging a and X on the one hand and C and G on the other.
5. Composé selon l'une des revendications précédentes, caractérisé en ce que les composés sont des oligodésoxynucléotides alpha pour lesquels dans la formule IX = O ; 5. A compound according to one of the preceding claims, characterized in that the compounds are alpha oligodeoxynucleotides for which in formula IX = O; 3, R, R' = H ; 3, R, R '= H; B est choisi parmi A, B is selected from A,
C, T et G ; C, T and G; et L est un atome d'oxygène. and L is an oxygen atom.
6. Composition pharmaceutique antivirale caractérisée en ce qu'elle comporte à titre de substance active un composé selon l'une des revendications précédentes. 6. antiviral pharmaceutical composition characterized in that it comprises as active substance a compound according to one of the preceding claims.
7. Composition pharmaceutique utile pour le traitement du 7. Pharmaceutical composition useful for the treatment of
SIDA caractérisée en ce qu'elle comporte à titre de substance active l'oligonucléotide d'anomerie alpha d 5 '(ACCGCGGGCTTGTCCCTG) 3 '. AIDS characterized in that it comprises as active ingredient the alpha-anomeric oligonucleotide of 5 '(ACCGCGGGCTTGTCCCTG) 3'.
8. Utilisation des composés selon l'une des revendications précédentes pour la préparation d'une composition pharmaceutique utile pour le traitement des affections virales des virus à ARN contenant lesdits composés à titre de substance active. 8. Use of compounds according to one of the preceding claims for the preparation of a pharmaceutical composition useful for the treatment of viral infections of RNA viruses containing said compounds as active substance.
9. Utilisation selon la revendication précédente pour la préparation d'une composition pharmaceutique utile pour le traitement du 9. Use according to the preceding claim for the preparation of a pharmaceutical composition useful for the treatment of
10. Utilisation de l'oligonucléotide alpha 10. Use of the oligonucleotide alpha
d 5 '(ACCGCG GGGGCCTTTTGGTTCCCCCCTTGG) 3 ' pour la préparation d'une composition pharmaceutique utile pour le traitement du SIDA d 5 (ACCGCG GGGGCCTTTTGGTTCCCCCCTTGG) 3 'for the preparation of a pharmaceutical composition useful for the treatment of AIDS
PCT/FR1990/000412 1989-06-13 1990-06-12 Alpha anomer oligonucleotide compounds which inhibit retrovirus replication WO1990015813A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
FR8907782A FR2648045B1 (en) 1989-06-13 1989-06-13 OLIGONUCLEOTIDE alpha anomeric compounds inhibiting the replication of retroviruses
FR89/07782 1989-06-13

Publications (1)

Publication Number Publication Date
WO1990015813A1 true true WO1990015813A1 (en) 1990-12-27



Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR1990/000412 WO1990015813A1 (en) 1989-06-13 1990-06-12 Alpha anomer oligonucleotide compounds which inhibit retrovirus replication

Country Status (4)

Country Link
JP (1) JPH04506074A (en)
EP (1) EP0477248A1 (en)
FR (1) FR2648045B1 (en)
WO (1) WO1990015813A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0527916A1 (en) * 1990-05-11 1993-02-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus
FR2717081A1 (en) * 1994-03-14 1995-09-15 Centre Nat Rech Scient Retropeptides, antibodies directed against the latter, and their use for immunization and the in vitro diagnosis.
EP1016715A1 (en) * 1992-09-29 2000-07-05 Isis Pharmaceuticals, Inc. Oligonucleotides having a conserved G4 core sequence
US6776986B1 (en) 1996-06-06 2004-08-17 Novartis Ag Inhibition of HIV-1 replication by antisense RNA expression
WO2008037924A2 (en) 2006-09-28 2008-04-03 Biomerieux Novel labelled oligonucleotide
US8663923B2 (en) 2008-07-04 2014-03-04 Biomerieux Detection probe

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988004301A1 (en) * 1986-12-02 1988-06-16 Centre National De La Recherche Scientifique (Cnrs alpha OLIGONUCLEOTIDES
WO1988008001A1 (en) * 1987-04-16 1988-10-20 Aktiebolaget Astra Nucleosides and nucleoside analogues, pharmaceutical composition and processes for the preparation of the compounds
WO1989003217A1 (en) * 1987-10-14 1989-04-20 Centre National De La Recherche Scientifique (Cnrs ANTIVIRAL APPLICATION OF alpha OLIGONUCLEOTIDES

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988004301A1 (en) * 1986-12-02 1988-06-16 Centre National De La Recherche Scientifique (Cnrs alpha OLIGONUCLEOTIDES
WO1988008001A1 (en) * 1987-04-16 1988-10-20 Aktiebolaget Astra Nucleosides and nucleoside analogues, pharmaceutical composition and processes for the preparation of the compounds
WO1989003217A1 (en) * 1987-10-14 1989-04-20 Centre National De La Recherche Scientifique (Cnrs ANTIVIRAL APPLICATION OF alpha OLIGONUCLEOTIDES

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Nucleosides & Nucleotides, Volume 8, No 5&6, 1989, Marcel Dekker, Inc., R. PAUWELS et al.: "Alpha-Oligodeoxynucleotides as Inhibitors of HIV Reserve Transcriptase", pages 995-1000 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0527916A1 (en) * 1990-05-11 1993-02-24 Isis Pharmaceuticals, Inc. Antisense inhibitors of the human immunodeficiency virus
EP0527916A4 (en) * 1990-05-11 1994-04-06 Isis Pharmaceuticals, Inc.
EP1016715A1 (en) * 1992-09-29 2000-07-05 Isis Pharmaceuticals, Inc. Oligonucleotides having a conserved G4 core sequence
FR2717081A1 (en) * 1994-03-14 1995-09-15 Centre Nat Rech Scient Retropeptides, antibodies directed against the latter, and their use for immunization and the in vitro diagnosis.
WO1995024916A1 (en) * 1994-03-14 1995-09-21 Centre National De La Recherche Scientifique Retropeptides, antibodies thereto, and uses thereof for vaccination and in vitro diagnosis
US6776986B1 (en) 1996-06-06 2004-08-17 Novartis Ag Inhibition of HIV-1 replication by antisense RNA expression
WO2008037924A2 (en) 2006-09-28 2008-04-03 Biomerieux Novel labelled oligonucleotide
FR2906532A1 (en) * 2006-09-28 2008-04-04 Biomerieux Sa New brand oligonucleotide
WO2008037924A3 (en) * 2006-09-28 2008-07-31 Eloy Bernal-Mendez Novel labelled oligonucleotide
US8158345B2 (en) 2006-09-28 2012-04-17 Biomerieux Labeled oligonucleotide
US8663923B2 (en) 2008-07-04 2014-03-04 Biomerieux Detection probe

Also Published As

Publication number Publication date Type
FR2648045A1 (en) 1990-12-14 application
EP0477248A1 (en) 1992-04-01 application
FR2648045B1 (en) 1991-09-27 grant
JPH04506074A (en) 1992-10-22 application

Similar Documents

Publication Publication Date Title
Zon Oligonucleotide analogues as potential chemotherapeutic agents
Crise et al. CD4 is retained in the endoplasmic reticulum by the human immunodeficiency virus type 1 glycoprotein precursor.
Goodchild et al. Inhibition of human immunodeficiency virus replication by antisense oligodeoxynucleotides
Tor Targeting RNA with small molecules
US4880782A (en) Method of treating viral infections in humans and compositions therefor
Wyatt et al. Combinatorially selected guanosine-quartet structure is a potent inhibitor of human immunodeficiency virus envelope-mediated cell fusion.
Zhang et al. Pharmacokinetics and tissue distribution in rats of an oligodeoxynucleotide phosphorothioate (GEM 91) developed as a therapeutic agent for human immunodeficiency virus type-1
US5264423A (en) Inhibitors for replication of retroviruses and for the expression of oncogene products
Zack et al. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle.
Wilson et al. Targeting RNA with small molecules
Schinazi et al. Activities of the four optical isomers of 2', 3'-dideoxy-3'-thiacytidine (BCH-189) against human immunodeficiency virus type 1 in human lymphocytes.
Schinazi et al. Synthesis and virucidal activity of a water-soluble, configurationally stable, derivatized C60 fullerene.
Matthes et al. Inhibition of HIV-associated reverse transcriptase by sugar-modified derivatives of thymidine 5′-triphosphate in comparison to cellular DNA polymerases α and β
Shih et al. Catalytic strategies of the hepatitis delta virus ribozymes
US6107062A (en) Antisense viruses and antisense-ribozyme viruses
US4806463A (en) Inhibition of HTLV-III by exogenous oligonucleotides
Loya et al. Illimaquinone, a selective inhibitor of the RNase H activity of human immunodeficiency virus type 1 reverse transcriptase.
US5550111A (en) Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
McShan et al. Inhibition of transcription of HIV-1 in infected human cells by oligodeoxynucleotides designed to form DNA triple helices.
Meier Pro-nucleotides-recent advances in the design of efficient tools for the delivery of biologically active nucleoside monophosphates
US4880779A (en) Method of prevention or treatment of AIDS by inhibition of human immunodeficiency virus
Leonetti et al. Antiviral activity of conjugates between poly (L-lysine) and synthetic oligodeoxyribonucleotides
Yamaguchi et al. Inhibitory effects of (−)-epigallocatechin gallate on the life cycle of human immunodeficiency virus type 1 (HIV-1)
Lisziewicz et al. Long-term treatment of human immunodeficiency virus-infected cells with antisense oligonucleotide phosphorothioates.
US5637573A (en) Influenza virus replication inhibiting oligonucleotide analogues and their pharmaceutical compositions

Legal Events

Date Code Title Description
AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LU NL SE

AK Designated states

Kind code of ref document: A1

Designated state(s): CA JP US

WWE Wipo information: entry into national phase

Ref document number: 1990909462

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1990909462

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: CA

WWR Wipo information: refused in national office

Ref document number: 1990909462

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1990909462

Country of ref document: EP