WO1989009940A1 - Human papilloma virus typing method and nucleic acid probes used therein - Google Patents

Human papilloma virus typing method and nucleic acid probes used therein

Info

Publication number
WO1989009940A1
WO1989009940A1 PCT/US1989/001318 US8901318W WO1989009940A1 WO 1989009940 A1 WO1989009940 A1 WO 1989009940A1 US 8901318 W US8901318 W US 8901318W WO 1989009940 A1 WO1989009940 A1 WO 1989009940A1
Authority
WO
Grant status
Application
Patent type
Prior art keywords
dna
hpv
specific
papilloma
human
Prior art date
Application number
PCT/US1989/001318
Other languages
French (fr)
Inventor
Albert L. George, Jr.
Dennis E. Groff
Original Assignee
Oncor, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/708Specific hybridization probes for papilloma

Abstract

The present invention relates to a human papilloma virus typing method to detect specific human papilloma virus genotypes based on human papilloma virus DNA restriction fragment length comprising: (a) digesting human papilloma virus DNA with a site specific reagent or combination of reagents which are able to cleave said human papilloma virus DNA to produce a digestion pattern of a specific genotype of human papilloma virus; (b) detecting in the digest of (a), a specific human papilloma virus genotype using a labeled nucleic acid probe that is complementary to a sequence of the specific genotype of said human papilloma virus DNA, said labeled nucleic acid probe being not able to substantially cross-hybridize with other genotypes of human papilloma virus DNA under stringent conditions; and (c) comparing the pattern obtained in (b) with a standard pattern for said human papilloma virus DNA sequence obtained using said site specific reagent and an equivalent labeled nucleic acid probe. It is also directed to a method for the simultaneous analysis of two or more infectious diseases states including the various genotypes of HPV.

Description

HUMAN PAPILLOMA VIRUS TYPING METHOD AND NUCLEIC ACID PROBES USED THEREIN

This application is a Continuation-in-Part of U.S. Serial No. 07/177,404 filed April 4, 1988. The present invention is in the field of genetic engineering and viral identification. The invention is concerned with a method for human papilloma virus typing and to novel complementary nucleic acid probes that are used in such methods. At the present time, the search for viruses involved in the induction of human cancer has been frustrating. In early studies, there was no direct indication that viruses were associated with cancer; however, in the 1930's, experimental evidence indicated that the cottontail rabbit papilloma virus was oncogenic in its host species. Other animal papilloma viruses were subsequently shown to produce tumors in laboratory animals and some were capable of morphologic transformation of cells in culture. With the advent of more sophisticated techniques in molecular biology, a number of viruses have been identified as possible human cancer viruses; one such virus is the human papilloma virus (HPV) . Recent molecular virologic and immunologic studies have shown a relationship between HPV infection and dysplasia of the uterine cervix. The significance of these observations is underscored by the fact that dysplasias are considered precursor lesions to cervical cancer. Although HPV was one of the first viruses to be visualized by the electron microscope, little information was available on the biology of the virus until recently. The etiology of cervical cancer is unknown, however, epidemiological studies have indicated that cervical cancer and its precursor lesions, dysplasia and carcinoma in situ, behave as sexually trans- mitted diseases- In the last few years, evidence has been accumulating that human papilloma virus is not only the causal agent of the long recognized condyloma (raised genital wart) but is also associated with about 85% of cervical intraepithe- lial neoplasms, as well as invasive cancers.

Atypical cells from these lesions are generally detected in the exfoliative cervical cytology test or Pap test.

The Pap test has been proven to be an effective method for detecting dysplasias and malignant cells and has become the. ost widely used cancer screening test. However, one cannot predict how a lesion will behave on the basis of morphology alone. This lack of predictability is compounded by the propensity of early dysplasias to regress or persist. There is increasing evidence that some dysplasias are highly aggressive and rapidly progress to cervical cancer. Women with rapidly progressive lesions are rarely identified by Pap smear screening prior to development of invasive cancer. While large scale screening programs have reduced the incidence of cervical cancer, there are still a significant number of women who have undetected lesions despite regular screening. In addition, a single Pap smear from a patient with a cervical lesion may be negative due to either an inadequate sampling or incorrect cytologic inter¬ pretation. The false negative rate for a single Pap smear in women with histologically proven lesions can be as high as 50%.

The human papilloma viruses (HPV) are a remarkably heterogeneous group of small DNA viruses with a circular double-stranded genome that infect squamous epithelium and produce a variety of proliterative diseases. Seven HPVs have been associated with genital tract lesions. HPV-6 and 11 are associated with condylomas of the vulva, vagina, and cervix. These lesions generally have a low malignant potential but 5-15% of long-standing condylomata do undergo carcinomatous changes. HPV types 16, 18, 31, 33, and 35 are associated with dysplasia of the uterine cervix, a condition considered to be premalignant. Dysplasias containing HPV-16 DNA sequences have been shown to be associated with abnormal mitotic activity and aneuploidy. In addition, DNA from these viruses has been detected in a high proportion of invasive cervical cancers. Since approximately 50% of invasive cervical cancers contain HPV-16 DNA sequences, it would appear that infection with this virus may be a risk factor in the development of cervical cancer. Although types 6 and 11 can infect the cervix, they are not associated with invasive disease to any significant extent. Based on these preliminary observations, it would appear that HPV-6 and 11 are associated with benign disease whereas the other genital tract HPVs may have a greater oncogenic potential.

If cervical cancer develops with greater frequency in women infected with specific HPV types, then the early detection of such infections by DNA hybridization could serve to identify those women at risk for the development of an invasive lesion. Preliminary studies have shown the utility of DNA hybridization on cells exfoliated from the cervix for the detection of HPV sequences. Those studies describe detection of HPV sequences by collecting cells on filters and performing hybridization using full-length genomic probes after cell lysis and immobilization of DNA. The results showed that 69 to 83% of Class II-IV Pap smears were positive for HPV DNA using defined HPV probes. Recently, Lorincz et al. reported detection of HPV DNA by Southern blot analysis in 94% of women with Pap smears showing atypia in the Workshop on Papilloma Viruses in Kuopio, Finland (1985) . Most of these DNAs were from unclassified HPVs and could only be detected under low stringency, thus emphasizing the need in this art for probe development.

Many advances have been made for detection of infectious agents in human clinical samples.

However, most of these infectious agents are still detected by cumbersome culturing or immunological techniques. Human papilloma viruses do not replicate in culture and their presence can only be determined by either pathology, expression of structural polypeptides, or detection of nucleic acids. The latter is the only reliable method of detection, since HPV can be present in "normal" tissues showing no pathology and HPV may also exist as a latent viral infection. Structural polypep¬ tides are expressed in fully differentiated cells of early premalignant lesions, but this has not been a consistent finding. It is apparent that the need for a rapid and reliable diagnostic test for HPV infection of the female genital tract is required. Molecular hybridization probes for the detection of HPV sequences in cervical samples have at least two advantages over simple cytologic tests. First, the number of cells screenable by hybridization would be significantly greater than those generally de¬ tectable by manual screening. And, secondly, data interpretation using hybridization would be less subjective than visualization of atypical cells.

Full genomic HPV DNA probes are known in the art. For instance, Giss ann, L. et al, "Molecular Cloning and Characterization of Human Papilloma Virus DNA Derived from a Laryngeal

Papilloma", Journal of Virology. Oct. 1982, pp. 393- 400, discloses the preparation of full genomic HPV- 11a DNA probes. Durst, M. et al, "A Papillomavirus DNA From a Cervical Carcinoma and its Prevalence in Cancer Biopsy Samples from Different Geographic Regions", Proc. Natl. Acad. Sci. USA. June 1983, vol. 80, pp. 3812-3815, discloses the preparation of full genomic HPV-16 DNA probes. Boshart, M. et al, "A New Type of Papillomavirus DNA, Its Presence in Genital Cancer Biopsies and in Cell Lives Derived from Cervical Cancer", The EMBO Journal. 1984, vol. 3, no. 5, pp. 1151-1157, discloses the preparation of full genomic HPV-18 DNA probes.

Unfortunately, such full genomic probes have significant disadvantages when used in diagnostic procedures. Electrophoresis is currently used to detect the presence of HPV in a biological sample. When full genomic probes are used in electrophoresis, a significant amount of cross- hybridization results among the various types of papilloma viruses. That is, there is a great likelihood that a full genomic probe specific for one HPV type will cross-hybridize with another HPV type. Thus, a type specific probe is necessary due to the high degree of homology between different HPV genotypes. There is about 75% homology between HPV 6 and 11, and in specific regions, the homology exceeds 90%; and a similar degree of homology exists between regions of HPV 16 and 31. This high degree of similarity between the different HPV types renders the full length genomic probes undesirable reagents for testing clinical specimens. The need for a type specific probe that will not substan¬ tially cross-hybridize with other HPV genotypes is therefore apparen .

Furthermore, in most present diagnostic procedures for testing HPV genotypes using genomic probes, multiple hybridizations are required to distinguish between the major genital HPV types, such as HPV 6, 11, 16, 18, 31, 33, and 35. This requires a fair amount of specimen from the patient, as well as being a very time consuming procedure. The need for the simultaneous analysis of HPV DNA using probes that will not substantially cross- hybridize in clinical samples is therefore apparent.

In August 1984, at the International Workshop on Papilloma Viruses in Kyoto, Japan and at the UCLA Symposium on Molecular and Cellular Biology "Papilloma viruses: Molecular and Clinical Aspects" held in April 1985, Thomas R. Broker was co-author with Louise T. Chow on two abstracts describing regions of homology between human papilloma virus genomes using electron microscopical heteroduplex analysis. Broker showed that there were regions of homology and non-homology between the human papilloma virus genomes and that electron microscopy may be used to select those regions. Broker and Chow also co-authored a paper entitled, "Human Papillomaviruses of the Genital Mucosa: Electron Microscopic Analysis of DNA Heterocomplexes Formed with HPV Types 6, 11, and 18", Cancer Cells. (1986) pp. 589-594. At the Fourth Cold Spring Harbor Meeting on Cancer Cells "International Workshop on Papilloma Viruses" held at the Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, in September 1986, Broker was co-author on two abstracts describing sub-genomic HPV probes and their use in in situ hybridizations. Broker did not succeed in producing type specific probes. The nucleic acid sequences present in Broker's probes were homologous to several genotypes or species of HPV. A significant amount of cross-hybridization resulted even under stringent conditions. Thus, the probes considered by Broker and Chow were not useful to identify specific HPV genotypes. The need still exists in the art for type specific HPV nucleic acid probes which will not substantially cross-hybridize with other HPV genotypes undergoing molecular hybridization.

Two other research teams have considered the possibility of using probes to detect HPV.

PCT/US86/05816 suggests using the open reading frame encoding the capsid protein (LI) as a template from which to build probes for the detection of papilloma virus.

European Patent Publication No. 0 235 004 discloses two new types of papilloma viruses, namely, HPV-IP5 and HPV-IP6. Also described are HPV DNA's which are suitable for use in the virological diagnosis of papilloma virus infections. These DNA's are mixtures of DNA from various types of HPV. The present invention offers significant advantages over anything heretofore known in the art.

Hιιτnnarγ of the Invention

A general object of the present invention is to provide a method of identifying a specific genotype or genotypes of human papilloma virus in a biological sample.

A primary object of the present invention is to develop a method using in situ hybridization for detection of specific genotypes of human papilloma virus DNA in premalignant cervical intraepithelial neoplasia.

An additional object of the present invention is to develop a probe or set of probes which will be able to detect in a single hybridiza¬ tion test, the nucleic acid sequences which are of clinical importance.

Another object of the present invention to develop a probe or probes for detecting the presence or absence of HPV nucleic acids in a biological sample containing other nucleic acids, the presence or absence of which is not sought to be detected, which probe or probes comprise a complementary nucleic acid sequence which are hybridizable with the nucleic acids sought to be detected.

A specific object of the present invention is to provide novel type specific nucleic acid probes which will not substantially cross-hybridize with other HPV genotypes under stringent conditions. The conditions of hybridization restrict the hybridization to the nucleic acid region of interest. Another object of the present invention is to develop subgenomic type specific probes which can be used in conjunction with a variety of detection techniques and which will have sufficient specifi¬ city and sensitivity to be applied in a rapid and reliable diagnostic test for HPV infection.

Another object is to develop probes in substantially pure form which can be used in a number of tests such as Southern hybridization, dot blot hybridization and jji situ hybridization, where the biological samples to be evaluated are either fresh tissue or fixed tissue.

A further object of the present invention is to develop composite probes comprised of HPV subgenomic type specific sequences in tandem. Still another object of the present invention is to prepare type specific HPV synthetic oligonucleotide probes.

Still yet another object of the present invention is to analyze simultaneously HPV DNA in clinical samples such that major genital HPV types 6, 11, 16, 18, 31, 33, and 35 can be distinguished in a single hybridization step. Accordingly, the present invention relates to a human papilloma virus typing method to detect specific human papilloma virus genotypes based on human papilloma virus DNA restriction fragment length comprising; (a) digesting human papilloma virus DNA with a site specific reagent or combina¬ tion of reagents which are able to cleave the human papilloma virus DNA to produce a digestion pattern of a specific genotype of human papilloma virus; (b) detecting in the digest of (a) , a specific human papilloma virus DNA to genomic blotting genotype using a labeled nucleic acid probe or probes from a region other than the L-l open reading frame that are complementary to a sequence of the specific genotype of the human papilloma virus DNA, said labeled nucleic acid probe or probes being not-able to substantially cross-hybridize with other genotypes of human papilloma virus DNA under stringent conditions; and (c) comparing the genomic blotting pattern obtained in (b) with a standard genomic blotting pattern for said human papilloma virus DNA sequence obtained using said site specific reagent and an equivalent labeled nucleic acid probe. The present invention also concerns a human papilloma virus typing method using jLn situ hybridization methods comprising: (a) placing and fixing a biological specimen containing human cells which may contain at least one genotype of human papilloma virus on a solid support; (b) subjecting the specimen to hybridization using a labeled type- specific human papilloma virus nucleic acid probe corresponding to a sequence of said human papilloma virus, the labeled nucleic acid probe being not able to substantially cross-hybridize with other genotypes of human papilloma virus DNA under stringent conditions; and (c) detecting the presence of said labeled probe in said biological specimen.

Brief Description of the Drawings

Fig. 1 depicts a nested probe.

Fig. 2 is a photograph of an agarose gel after a standard DNA and four restriction, enzyme- digested, type specific HPV plas id DNAs have undergone electrophoresis. The labels are specific for HPV types 6 (probe B) , 11 (probe A) , 16 and 18 (probe B) as indicated. M is marker DNA - Hindlll digested bacteriophage lambda DNA. Fig. 3 is a photograph after Southern blots were prepared and hybridized separately with type specific probes for HPV types 6 (probe B) , 11 (probe A) , 16 and 18 (probe B) to demonstrate the specifi¬ city and sensitivity of the probes of the present invention.

Fig. 4 is a photograph after Southern blots were prepared and hybridized separately with a mixture of HPV types 6, 11 and 16 or with type specific probes for HPV types 6 (probe B) , 11 (probe A) or 16 using PstI digestion as the diagnostic restriction cut.

Fig. 5 shows the results after slot blot hybridization of reconstruction and clinical samples with a type specific HPV 11 probe (probe A) . Fig. 6 is a photograph of labeled extended synthetic oligonucleotides which are type specific for HPV types 6, 11, 16 and 18. Fig. 7 presents the sequence of eight synthetic oligonucleotides comprised of thirty bases; A) and B) are specific for type 6, C) and D) are specific for type 11, E) and F) are specific for type 16 and G) and H) are specific for type 18.

Fig. 8 presents the sequence of eight synthetic oligonucleotides composed of fifty bases; A) and B) are specific for type 6, C) and D) are specific for type 11, E) and F) are specific for type 16 and G) and H) are specific for type 18.

Fig. 9 depicts the nucleotide sequence of the type specific HPV type 6 DNA probe A.

Fig. 10 depicts the nucleotide sequence of the type specific HPV type 6 DNA probe B. Fig. 11 depicts the nucleotide sequence of the type specific HPV type 11 DNA probe A.

Fig. 12 depicts the nucleotide sequence of the type specific HPV type 11 DNA probe B.

Fig. 13 depicts the nucleotide sequence of the type specific HPV type 16 DNA probe.

Fig. 14 depicts the nucleotide sequence of the type specific HPV type 18 DNA probe A.

Fig. 15 depicts the nucleotide sequence of the type specific HPV type 18 DNA probe B. Fig. 16 depicts the HPV 6 marker fragment and the specific probe.

Fig. 17 depicts the HPV 11 marker fragment and the specific prob o

Fig. 18 depicts the HPV 16 marker fragment and the specific probe. Fig. 19 depicts the HPV 18 marker fragment and the specific probe.

Fig. 20 depicts the HPV 31 marker fragment and the specific probe. Fig. 21 depicts the HPV 33 marker fragment and the specific probe.

Fig. 22 depicts the HPV 35 marker fragment and the specific probe.

Fig. 23 depicts the nucleotide sequence of the HPV 33 marker fragment.

Fig. 24 depicts the nucleotide sequence of the HPV 33 type specific probe.

Fig. 25 is a photograph of the results obtained from the simultaneous HPV typing test.

In the HPV typing method of the present invention the biological specimens containing human cells are initially deposited and fixed on a solid support. Suitable solid supports for use in the practice of the present invention include nitrocel¬ lulose, glass, DBM paper, plastics, i.e. nylon, or the like.

Alternatively, the solid support may be a bead. By mobilizing the HPV nucleic acid probe on a bead, the hybridization process would be easy to automate. It would be easier to wash and separate the labeled probe from the rest of the solution.

A sandwich hybridization assay may also be conducted. A sandwich hybridization assay involves the use of two probes. One probe is supported on a bead and the other probe contains a label for identification. Both probes would be specific for the same type of HPV.

Any technique known in the art may be used to prepare the biological specimen for the method of the present invention. For instance, the biological specimen may be centrifuged or prepared by automated methods known in the art. Suitable fixative techniques include the use of methanol-acetic acid, chloroform-hydrochloric acid, paraformaldehyde, glutaraldehyde, ethanol and the like.

A variety of methods are known to isolate DNA from nucleated cells under conditions that preclude DNA degradation. One such isolation involves digesting the cells with a protease that does not attack DNA at a temperature and under conditions that reduce the likelihood of DNAase activity followed by extraction of the digest with an organic solvent. DNA isolation from nucleated cells is described by Kan et al, "Identification of a Nondeletion Defect in α-Thalassemia", N. Eno. J. Med.. vol. 297, pp. 1081-1084 (1977), and Taylor et al, "Genetic Lesion in Ho ozygous-Thalassemia (Hydrops Fetalis)", Nature, vol. 251, pp. 392-393 (1974) . The extracted DNA may be purified by dialysis, chromatography, precipitation or other known methods for purifying polynucleotides. The DNA being evaluated would likely be a combination of human DNA and human papilloma virus DNA. The DNA thus obtained is hydrolyzed in vitro with a specific reagent or combination of reagents which cleave or cut nucleic acids at specific sites. Such site specific reagents include restriction endonucleases, modified synthetic oligonucleotides and other site specific reagents known in the art. Site specific reagents are taught by Dreyer et al, "Sequence-Specific Cleavage of Single-stranded DNA: Oligodeoxynucleotide-EDTA-

Fe(II)", Proc. Natl. Acad. Sci. USA, vol. 82, pp. 968-972 (1985) and Chu et al, "Nonenzymatic Sequence-Specific Cleavage of Single-stranded DNA", Proc. Natl. Acad. Sci. USA, vol. 82, pp. 963-967 (1985) . At the present time, restriction endonucleases are preferred. In any event, it is essential that the site specific reagent be one that produces a digestion pattern associated with the human papilloma virus locus or loci under investiga- tion. Suitable restriction endonucleases include

BamHI, PstI, Ndel, EcoRI, PvuII, Sau3a, Kpnl and the like. The preferred restriction endonucleases that produce restriction fragments for the loci at which the various specific HPV probes interact are BamHI, PstI, and the combination of BamHI and PstI.

For the clinical simultaneous analysis of HPV DNA, cellular DNA may be obtained from a crude patient sample or it may be extracted and purified according to those methods known in the art. The cellular DNA is then digested according to methods known in the art including the use of diagnostic restriction enzymes to produce fragments of various lengths. Therefore, any restriction enzyme or combination of restriction enzymes which produce different sized fragments for specific probes can be utilized. Applicants prepared their probes from the HPV DNA regions having the lowest degree of homology among the HPV types. Suitable regions include the L-2 open reading frame, the E-l open reading frame, the E-6 open reading frame, the E-7 open reading frame and the non-coding region which is oftentimes referred to as the upstream regulatory region. The present invention does not rely on the L-l open reading frame for the preparation of probes since that region exhibits too much homology and thus cross-hybridization among the various types of HPV. Furthermore, the L-l codes for very small specific nucleotide sequences. The probes of the present invention, on the other hand, allow for probes having longer bases. These probes are therefore more sensitive since a smaller amount of HPV may be detected in a sample and less probe is necessary for detection of the HPV.

The digestion or hydrolysis of the nucleic acid with the site specific reagent may be carried out in an aqueous medium under conditions favoring cleavage of the nucleic acid. The specific conditions, buffers or additives necessary for the digestion of the nucleic acid with the site specific reagent depends on the site specific reagent selected. For instance, in the case of restriction endonucleases, the manufacturer generally provides a suitable buffer along with the commercial endonuclease. Site specific reagents may also perform better under a variety of conditions or substances. Such substances may include ions, such as magnesium ions or other inorganic salts; cofactors, such as ATP or S-adenosyl methionine; or the like.

The amount of DNA in the digestion mixture will typically be in the range of 0.005% to 0.1% by weight. In most instances 5 to 20 micrograms of total cell DNA digested to completion provides an adequate sample for typing. Excess reagent for hydrolysis for restriction endonucleases, usually one to five units/microgra DNA, is recommended. However, irrespective of the site specific reagent selected, generally an excess amount of such site specific reagent is required for complete hydro¬ lysis. If desired, prior to being subjected to genomic blotting or solution hybridization, the restriction digest may be worked up by precipitation and resuspension.

The restriction digest may then be analyzed by any method known in the art. A variety of methods are known in the art to place the nucleic acids onto a membrane. Suitable methods include genomic blotting, Southern blotting, vacuum transfer, electrotransfer, solution hybridization and the like. In Southern blotting the digestion products are electrophoresed, transferred and affixed to a support which binds nucleic acids, and then hybridized with an appropriate labeled nucleic acid probe. Labeled hybrids are detected by autoradiography, visual observation or other known techniques. In the case of typing for a particular HPV genotype, the analysis is directed to detecting a DNA sequence that uniquely characterizes that virus genotype. The products of DNA hydrolysis may be separated by electrophoresis on a supporting medium by size, shape, charge, conformation or other parameters, under the influence of an applied electric field. Gel sheets or slabs, e.g., agarose or agarose-acrylamide, are typically used as the supporting medium for the electrophoresis. The electrophoresis conditions are designed to effect the desired degree of resolution of the fragments. A degree of resolution that separates fragments that differ in size from one another by as little as 100 base pairs will .usually be sufficient. Size markers are run on the same gel to permit estimation of the size of the restriction fragments. In carryinq out the electrophoresis, the digestion products are loaded onto one end of the gel slab (commonly called the "origin") and the fragments separate by electrically facilitated transport through the gel, with the shortest fragment electrophoresing the fastest from the origin towards the other (anode) end of the slab. The distance traveled by the various linear DNA fragments will depend on their molecular weight. Thus, the fragments containing the sequences complementary to the probes will be separated generally in accordance with their size. If desired, one can also separate rather large DNA molecules ranging up to several million DNA base pairs in length by the method of pulsed field gel electrophoresis or inversion field gel electro- phoresis or the like as taught by Schwartz et al,

Cell, vol. 37, pp. 67-75 (1984) and by Carle et al, Nuc. Acids Res.. vol. 12, pp. 5647-5664 (1984) . After separation of DNA molecules by any of the above methods of electrophoresis, the gel is readied for hybridization by placing it in a DNA denaturing solution, conveniently a mild base, generally about 0.2 to IM hydroxide, preferably 0.5M NaOH, to dissociate the DNA strands. Usually, the DNA is first partially depurinated or nicked to facilitate transfer of the DNA out of the gel. After denaturation, the gel may be placed in a neutralizing solution and neutralized to a mildly acid pH (ex. if a nitrocellulose membrane is used) . If desired, DNA is then transferred to the sub¬ strate, which is typically made from materials such as nitrocellulose paper, nylon or DBM paper, by contacting the gel with the paper in the presence of reagents, e.g., buffer, and under conditions, e.g., light weight, vacuum, and approximately 0°C to 25°C, that promote transfer and covalent or non-covalent binding of the DNA to the paper. Such reagents and conditions are described by Southern, E.M., J. Mol. Biol.. vol. 98, pp. 503-517 (1975), and U.S. Patent No. 4,302,204. In the simultaneous analysis of HPV DNA in clinical samples, it is desirable to use a solid support, such as a nylon hybridization membrane. After the transfer is complete the paper is separated from the gel and the gel is dried. Hybridization (annealing) of the resolved single strand DNA on the paper to a HPV probe is effected by incubating the paper with the probe under hybridizing conditions. The hybridization will typically be conducted in an aqueous buffer solution which may contain a polar solvent such as formamide. Other additives that enhance the hybridization such as sodium chloride, sodium citrate and dextran sulfate may be used. Serum albumin, sodium dodecyl sulfate, and sonicated denatured DNA such as denatured salmon sperm DNA may be included in the hybridization medium to reduce the background. Complementary nucleic acid probes that are specific to one HPV nucleotide sequence are used in the hybridization step of the typing method. However, more than one probe which is specific to a HPV nucleotide sequence of a different genotype may be used. Each probe may have a different label to make it possible to distinguish between the probes for the different HPV genotypes. In the detection of HPV types via simultaneous analysis, the membranes are hybridized with the type specific HPV probes, which are set forth in Figures 16-24.

Locus specific nucleic acid probes may be prepared by any method known in the art. One method of determining type specific human papilloma virus sequences is to use direct nucleotide sequence comparison using homology matrix analysis. See, Pustell and Kafatas, "A High Speed, High Capacity Homology Matrix: Zooming Through SV 40 and Polyo a", Nucl. Acids Res.. vol. 10, pp. 4765-4782 (1982). In that method, the specific nucleic acid sequence of a specific type of human papilloma virus is determined by common DNA sequence analysis, that is, chemical sequencing and/or dideoxy methods. The homology or similarity of the specific nucleic acid sequence to existing papilloma virus is then compared to known types of human papilloma virus. The regions of non- homology or dissimilarity are then isolated using restriction enzymes. Alternatively, the regions of non-homology are synthesized and subsequently purified. Suitable restriction enzymes to determine regions of non-homology are set forth below in Table I.

TABLE I HPV Type Enzymes Used to Create

Type-Specific Probes

Type 6 BamHI, PstI

Type 11 BamHI, Ndel, Kpnl, PstI

Type 16 EcoRI, PvuII Type 18 BamHI, Sau3A

The purified regions of non-homology may be labeled and used as probes in known DNA blotting procedures using known human papilloma virus sequences as targets. This is done to confirm that the type specific nucleic acid probes thus obtained do not cross-hybridize with other known types of human papilloma viruses.

The probes may be cloned into any suitable vector, for instance, commercially available SP6/T7 vectors or pBR322 vectors. SP6 and T7 like vectors allow cloned DNA to be transcribed into high specific activity RNA in. vitro. Use of these vectors will allow preparation of both DNA probes and RNA probes from the same construct. Tandem probes may also be useful in the practice of the present invention. Tandem probes may be constructed by covalently joining two or more type specific HPV probes within a single vector.

The nucleic acid probes which are suitable in the practice of the present invention include DNA probes, RNA probes, synthetic oligonucleotide probes, thioester based probes and the like. The RNA probes would have an identical sequence to the DNA probes except that thymine would be replaced with uridine, The probes are made detectable by labeling them with a detectable atom, ligand or the like using known labeling techniques. Suitable labeling methods include nick translation, random priming, kinasing, photoreactions, sulf©nation, iodination, chemical reactions, terminal deoxytransferase (TDT) , poly-A transferase, in vitro transcription and the like. Suitable labels include 3H, 35S, 32P, 14C,

I, I, sulfur compounds, modified nucleotides (i.e., biotin) and the like. The labels may be detected by a variety of detection techniques such as luminescence, autoradiography, fluorescence, enzymatic detection, strepavidin linked enzymes, avidin linked enzymes, immuno linked enzymes, gold or gold with silver enhancement, and the like. An alternate to the subgenomic probes described above are the synthetic oligonucleotide probes. There are several advantages associated with the use of synthetic oligonucleotide probes. They can be made in large quantities and subsequent- ly highly purified by HPLC. Secondly, there would be no vector sequences that could potentially result in false positive results from detection of vector¬ like sequences of E. coli contaminating the genital tract. Clinical samples may frequently be con- taminated with E. coli DNA and pBR322 related plasmid DNA and thus sequences which have homology to these vector-like sequences can be easily detected and lead to false results. Further advantages include the absolute definition of the sequence, the ability to detect sequences which are not easily defined by restriction enzyme recognition sites and also consistency in production. The probes may be constructed to allow the maximum degree of flexibility and options with regard to their potential use and performance. For each sequence a minimum of two oligonucleotides each having 30 bases in length may be synthesized. The sequences are chosen such that 10 bases at the 3 • end of one will be complimentary to 10 bases at the 5' end of the other as depicted in Fig. 1. Oligonucleotides synthesized in this manner when hybridized to each other and used as templates for DNA repair synthesis create nested probes. Thus, an oligonucleotide sequence of 50 base pairs may be prepared from oligonucleotides of 30 base pairs. Suitable 30 base pair oligonucleotides are set forth in Fig. 7. Suitable 50 base pair oligonucleo- tides are set forth in Fig. 8.

The conditions required for hybridization and washing of oligonucleotide probes may be different from those for subgenomic probes. Empirically determined formulae available in the literature allow for the estimation of the oligonucleotide dissociation temperature (Td) . These formulae may be used for the determination of hybridization conditions for screening of probe mixtures. Hybridization of oligonucleotides also depends on several factors which include (i) the length of the probe and (ii) the GC content. Even if the probes in the mixture are identical in length they will differ in GC content as well as Td. Synthetic oligonucleotide probes having the desired base sequences may be prepared using a wide variety of methods known in the art. Suitable methods include beta cyano methyl or ethyl phosphor- amidate techniques and the like..

The specificity of a synthetic oligonucleo¬ tide may be determined by using it as a hybridiza¬ tion probe in genomic blot analysis. Other known techniques may of course be used to determine probe sensitivity.

The labeled hybrids on the membrane (or gel in the solution hybridization embodiment) are then identified. Autoradiography is frequently used to detect radiolabel-containing hybrids. This technique involves laying the membrane on a piece of radiation sensitive film (X-ray film) . The disintegration of the label results in the deposi¬ tion of a silver grain in the film. The film is developed and the pattern of labeled fragments is identified. The specificity of the probe and the particular restriction endonuclease used will determine the number of fragments that appear in the pattern. Type-specific probes should give a pattern with one isolated band. This, of course, depends on the compound which the nucleic acid is hybridized with. If full length genomic probes were used, more than one band would appear thus making it much more difficult to interpret the results.

The performance of the probes of the present invention may be evaluated under conditions of stringent hybridization. It is preferable to evaluate the type specific probes under stringent hybridization conditions since there is always a slight amount of homology and therefore cross- hybridization potential among the various HPV genotypes. By using stringent hybridization conditions, there is a smaller likelihood of detecting such areas of homology while minimizing the potential for cross-hybridization. Stringent hybridization is defined to be Tm -20βC; under these conditions thermally stable hybrids form which have less than 14% base mismatch. Tm is the melting temperature whereby 50% of the molecules are hybridized or denatured. The Tm is determined by the relationship:

Pm = 81.5 + (16.6 x log[Na+]) - (0.41 x 0%[%G+C]) - (0.72 x % formamide)

In that relationship, G is guanine and C is cytosine. From this, one can determine that for any DNA with 45% G+C content that the Tm in 1 M Na+ or 6X SSC is 99.95°C (where IX SSC=0.15 M NaCl, 0.015 M Na citrate, pH 7.0). The inclusion of formamide in the hybridization reaction will reduce the Tm by

0.72°C/1% formamide. Therefore, in a hybridization reaction containing 50% formamide the Tm = 100°C - 36°C = 64"C. The maximum hybridization rate occurs at about 20βC below the Tm of the DNA duplex. Therefore, standard high stringency hybridizations would be carried out at the maximum rate at 45°C in 6X SSC and 50% formamide. To maintain identical high stringency during the post hybridization washes, using the above equation, the blots should be incubated at 52°C in 0.1X SSC. For the hybridization experiments the DNA may be transferred to a solid support essentially as described by Southern. In order to evaluate the type specificity of the newly constructed subgenomic probes, they may be hybridized to restriction enzyme digested genomic blots of HPV types 6, 11, 16 and 18 to ensure the correct hybridization patterns followed by dot blots.

The performance of both DNA and RNA probes may be scrutinized in this manner. The signal to noise ratio in hybridization reactions with RNA probes is potentially greater that with DNA probes for two reasons. RNA-DNA duplexes are more stable than DNA-DNA duplexes and consequently they can be formed and washed under more stringent conditions than the DNA hybrids. Also RNAase can be used to remove nonspecifically bound RNA while leaving RNA- DNA or RNA-RNA duplexes intact. Another advantage to using in. vitro synthesized RNA probes is that they contain only very low levels of contaminating vector sequences. This is primarily due to the specificity of the RNA polymerases (SP6 or T7 for their own promoters) which are used in these systems. The preferred specific nucleic acid HPV probes were selected based on their ease of cloning, i.e. location of usable restriction sites; the size of the non-homologous region and the consistency of the restriction fragment size to which the type- specific nucleic acid probe would hybridize. Regions of HPV types 6, 11, 16 and 18 have been identified which are essentially or substan¬ tially non-homologous under stringent hybridization conditions. The following examples further illustrate the various aspects of the present invention. These examples are not intended to limit the invention in any manner.

The purpose of the type specific probes is to distinguish the genotypes of HPV 6, 11, 16 and 18 without regard to possible subtypes. Therefore we do not distinguish HPV 6 subtype A from HPV 6 subtype B or HPV 11 subtype A from HPV 11 subtype B. What Applicants have done for HPV types 6, 11 and 18 is to determine two regions of each genotype which are capable of being type specific probes. These are designated, in each case, Probe A and Probe B. The use of each probe will depend on the actual embodiment of the test. EXAMPLE 1

Construction of Subgenomic HPV Probes

Specific regions of the HPV types 6, 11, 16 and 18 genomes were identified and subcloned using the enzymes described in Table I above into one of the GEMINI series of plasmid vectors (from Promega Biotec) within the multiple cloning site. The fragments for HPV types 6, 11, 16 and 18 are shown in Fig. 2. Fig. 9 through Fig. 15 sets forth the type specific HPV probes. This vector system allowed (1) DNA probes to be constructed by removing the HPV DNA insert from vector sequences by using flanking restriction enzyme sites in the multiple cloning site, and (2) production of RNA probes by transcription from the SP6 and T7 promoter which flanks the GEMINI multiple cloning site. RNA probes produced by this method usually contain some vector sequences, but this does not present a problem in the analysis.

DNA probes were prepared by excision of the insert from the vector using restriction enzymes, electrophoresis through agarose gels, electro- elution of the specific band, purification by affinity column chromatography (Elutip-d, S&S or NACS-37, BRL) and labeling with 32P or biotin by nick translation. Typically 32P labeled probes with specific activities of 3-6 x 108 dpm/microgram DNA were obtained.

RNA, complementary to the HPV type specific fragments, was synthesized in cell free systems utilizing promoters located on either side of the insert. In general, plasmid DNA was linearized by restriction enzyme digestion at a site distal to the insert and promoter, and RNA was synthesized by an RNA polymerase. The use of specific promoters, such as SP6 or T7 bacteriophage promoters, allowed the use of the corresponding (SP6 or T7) RNA poly- merases. The choice of which strand of DNA, that the RNA is complementary to, was determined by the choice of promoter relative to the insert HPV DNA.

RNA probes were generated by transcription of insert DNA from the SP6 promoter by SP6 RNA polymerase. The DNA was linearized by restriction digestion in the MCS at a site distal to the SP6 promoter and insert, transcribed by standard methods using 32P-CTP or 32P-UTP, and purified over spin-columns of Sephadex G-50. RNA produced by this transcription method had a specific activity of 2.5 x 108 dpm/microgra RNA.

EXAMPLE 2 Evaluation of the Specificity and Sensitivity of the

Sub-Genomic HPV DNA Probes

Type specific hybridization should be viewed in the particular conditions under which cross- hybridization to other DNAs does not occur. This is particularly important for distinguishing between HPV, since regions of high sequence homology can lead to cross-hybridization under relaxed hybridiza¬ tion conditions. A general discussion of stringency is presented in the paper by Law et al, "Conserved Polynucleotide Sequences Among the Genomes of

Papillomaviruses", Journal of Virology, vol. 32, pp. 199-207 (1979) .

To begin the definition of hybridization parameter, the Tm for each probe was calculated using the formula:

t.m = 81.5 + (16.6 x log[Na+]) + (0.41 x %[G + C]) - (0.72 x % formamide)

Initially, a very high stringency hybridiza- tion (Tm -10°C: hybridization at 55° in IM Na+, 50% formamide; wash at 62" in 17 mM Na+) was done where the purified type specific HPV insert DNAs were membrane bound on a Southern blot and 32P-labeled genomic HPV cloned DNA was used as a probe. The HPV inserts were hybridized using only the homologous virus type; no detectable hybridization was observed by the heterologous HPV types.

The experiment was repeated using standard high stringency hybridization conditions (Tm - 20°C: hybridization at 45°in IM Na+, 50% formamide; wash at 52° in 17 mM Na+) . The results were the same. Therefore, the putative type specific HPV probes appeared to have the desired characteristics as target DNAs on Southern blots. Using the subgenomic inserts as 3 P-labeled probes, a series of Southern blots were hybridized under the standard high stringency conditions to determine the specificity and sensitivity of the probes. Specificity of hybridization was determined on reconstitution blots where 200 copy amounts of restriction enzyme digested cloned genomic HPV DNA were mixed with 10 micrograms of digested placental DNA, electrophoresed through a 0.8% agarose gel, and transferred to nylon membranes by Southern blotting. As seen in Fig. 3a, the type specific HPV 6 probe B (TS 6) DNA probe hybridized only with insert DNA from HPV 6; likewise the type specific HPV 11 probe A (TS 11) , type specific HPV 16 (TS 16) and type specific HPV 18 probe B (TS 18) hybridized only to the homologous HPV type. The observed hybridization in the heterologous lanes is due to contaminating vector sequences in the probe and not cross- hybridization to HPV DNA sequences. In addition, no cross-hybridization was observed by the type specific HPV probes (TS 6, TS 11, TS 16 or TS 18) to HPV 1, HPV 2, HPV 4, placental DNA, yeast DNA or bacteriophage lambda DNA. The sensitivity of detection of the type specific HPV probes was determined on Southern blots containing 100, 10, 1, and 0.1 copy reconstruction as outlined above. The results may be observed in Fig. 3b.

Because the type-specific HPV probes appeared specific by the reconstitution blots, they were tested against DNA samples purified from genital lesions. Using PstI digestion as the diagnostic restriction cut, Southern blots were prepared and hybridized separately with TS 6, TS 11 and TS 16 as noted in Fig. 4. Southern blots were also hybri¬ dized separately with TS 18 (not shown) . Of the lesions that were identified and typed by using genomic probes, each gave the expected hybridization with the type specific HPV probe. In addition, four of the lesions that were initially diagnosed as negative gave positive hybridization of the 1.8 kilobase PstI fragment with the TS 16 probe. Re- analysis of these four DNA samples with the HPV 16 genomic probe confirmed the presence of low amounts of HPV 16 in 3 of the samples.

The hybridization characteristics of the type specific HPV DNA probes were analyzed in the slot blot format as noted with type specific HPV 11 probe A in Fig. 5. Cellular DNA was denatured and filtered onto nylon membrane using a Minifold II apparatus (S&S) . Membranes were then hybridized independently to the type specific HPV DNA probes. Analysis of reconstruction DNA, uninfected DNA and DNA from genital lesions indicated positive hybridization signals above about 10 copies HPV DNA per cell. The slot blot format under the conditions of this example was considered to be less sensitive than the Southern blot.

EXAMPLE 3

Evaluation of the Specificity and Sensitivity of Sub-Genomie HPV RNA Probes

32 P-labeled RNA, transcribed in vitro from the type specific HPV DNA clones, was analyzed as hybridization probes in experiments identical to those described for the DNA probes in Example 2. The results were almost identical. The type- specific RNA probes demonstrated specific hybridiza¬ tion in Southern blots to the homologous HPV types. Also, the RNA probes exhibited positive hybridiza¬ tion to the same DNAs from the genital lesion to which the type specific HPV DNA probes hybridized

(these include the four samples which were initially negative using genomic probes) .

The background noise in Southern blots appears cleaner with the RNA probes. However, this cleanliness did not translate into increased sensitivity in the slot blot where the limits of reliable detection remained at 10 copies per cell. It was also observed that a post-hybridization SNAase A treatment of the filters did not increase the sensitivity of detection.

EXAMPLE 4

Tandem Probes

The subgenomic type specific HPV probes for HPV 6, HPV 11, HPV 16 and HPV 18 are all cloned into a GEMINI vector using compatible sites in the multiple cloning site. This results in a 2.2 kilobase insert which is released from vector sequences by an EcoRI-Hindlll double digestion. The insert is purified as described above for the subgenomic DNA inserts and tested as a 32P-labeled probe in Southern blot hybridization.

In reconstruction experiments, the tandem probe hybridized to the same restriction fragments of all four HPV types as did the type specific DNA probes independently. Hybridization of the tandem probe to PstI digested DNA from genital lesions results in the expected bands for HPV 6 (1.5 kb) HPV 11 (1.6 kb) and HPV 16 (1.8 kb) . HPV 18 containing lesions and cell lines give variable sized bands. This is expected because the predicted 5.7 kb PstI band of HPV 18 contains the region of integration which usually occurs with HPV 18 DNA during malignant progression and the HPV 18 samples which are examined are derived from invasive carcinoma.

EXAMPLE 5 Synthetic Oligonucleotides

To determine the utility of synthetic oligonucleotides as type specific HPV probes, a set of oligonucleotides were identified and produced specific for sequences in the E6 region of HPV types 6, 11, 16, and 18. Using the homology matrix analysis of Pustell and Kafatas described earlier, regions of 50 base pairs were identified which contained minimal sequence homology between the HPV types. Type-specific HPV oligonucleotides were produced as pairs of overlapping, complementary 30 base molecules (Fig. 7). The 10 bases at the 3'-end of each molecule of each pair were complementary. Therefore, by annealing the oligonucleotides, a template for DNA repair synthesis by DNA polymerase I was created. The conditions for labeling the oligonucleo¬ tides were similar to those used for DNA sequencing by the Sanger method [Sanger et al, "DNA Sequencing With Chain Termination Inhibitors", Proc. Natl. Acad. Sci. USA, vol. 74, pp. 5463-5467 (1977)] except that dideoxy nucleotide triphosphates were omitted. By reacting the oligonucleotides with Klenow DNA polymerase I 50 M dNTPs, 50 mM NaCl, 7 mM MgCl2, 7 mM tris pH 7=5, 5 mM DTT at 22° approximately 95% conversion of the 30-mers (Fig. 7) to 50-mers (Fig. 8) was observed in Fig. 6. By using 32P-labeled dNTPs specific activities of 1.5 x

109 dpm/microgra s DNA were achieved (theoretically,

8 x 109 dpm/micrograms is possible) . Alternatively, oligonucleotides were labelled using polynucleotide kinase.

Hybridization to reconstruction Southern blots using the standard high stringent conditions of Example 1, showed specific hybridization to the homologous HPV types with no detectable cross hybridization to the heterologous viruses. Also, equivalent sensitivities of detection using either protocol with a single copy reconstruction were visible in an overnight exposure.

Good sensitivity was achieved using the 50 base pair type specific HPV probes. To verify the hybridization characteristics of the type specific HPV oligonucleotides, these probes were hybridized to the DNA samples from genital lesions using the Southern blot format. As with the subgenomic DNA and RNA probes, the HPV oligonucleotides detected the same specificity and sensitivity of hybridization as previously observed.

EXAMPLE 6

SIMULTANEOUS ANALYSIS OF HPV DNA IN CLINICAL SAMPLES To distinguish HPV types 6, 11, 16, 18, 31,

33, and 35 in a single hybridization step, the following seven steps were followed:

1. The sample was collected from the patient and transported to the laboratory. 2. Cellular DNA was then extracted and purified.

3. The pure DNA was digested with diagnos¬ tic restriction enzymes to produce fragments of various lengths. 4. The DNA fragments were then separated by electrophoresis and transferred to a solid support.

5. The membranes were hybridized with the type specific HPV probes.

6. The hybridized HPV processes were detected audioradiographically if 32P-labeled probes were used or enzymatically, if non-isotopic probes were used.

7. The results are interpreted via a distinct sized band for each HPV genotype. Each gel is run with molecular weight markers and hybridiza¬ tion controls. The hybridization controls produce a bar code that has each type specific HPV band migrating at a known position. By lining up the band in the patient sample with the bar code, the type of HPV is determined. Figure 25 is illustra¬ tive of this analysis for HPV types 6, 11, 16, and 18.

Following the above procedure for the simultaneous analysis of HPV in DNA using the

Southern hybridization test, the combination of Bam HI and Pst I restriction endonucleases produced type specific bands as follows:

HPV 6: 0.69 kb HPV 11: 1.44 kb

HPV 16: 1.78 kb

HPV 18: 1.05 kb

HPV 31: 2.81 kb

HPV 33: 2.01 kb HPV 35: 0.48 kb

For HPV 31 and HPV 33, the type specific probes consist of subsets of the marker fragments resulting in the data obtained for the above bands. In the case of HPV 35, the entire marker fragment can be used as a type specific probe. Additionally, any subset of the HPV 35 0.48 kb fragment that exhibits type specific hybridization could be used in this test. This type of simultaneous analysis of a sample is not restricted to the use of a Bam HI and Pst I combination, nor to the specific probes described herein for the analysis of HPV DNA. Any restriction enzyme or combination of restriction enzymes which produce different size fragments for specific probes can be used for the simultaneous analysis of a sample for whatever the specific probes detect. Furthermore, this type of simultaneous assay is not limited to the testing of HPV only. This simultaneous assay can also be used to diagnose a variety of infectious disease states including hepatitis, sexually transmitted diseases and the like. Typical sexually transmitted diseases that may be simultaneously assayed include herpes, gonorrhea, Chlamydia, syphilis, AIDS, and the like.

Modifications of the methods and compositions described above that are obvious to those of ordinary skill in genetic engineering, genetics, molecular biology, biochemistry, cell biology, and/or immunology are intended to be encompassed by the present invention.

Claims

WHAT IS CLAIMED IS:
1. A human papilloma virus typing method to detect specific human papilloma virus genotypes based on human papilloma virus DNA restriction fragment length comprising:
(a) digesting human papilloma virus DNA with a site specific reagent or combination of reagents which are able to cleave said human papilloma virus DNA to produce a digestion pattern of a specific genotype of human papilloma virus;
(b) detecting in the digest of (a) , a specific human papilloma virus DNA genotype to genomic blotting using a labeled nucleic acid probe from a region other than the L-l reading frame that is complementary to a sequence of the specific genotype of said human papilloma virus DNA, said labeled nucleic acid probe being not able to substantially cross-hybridize with other genotypes of human papilloma virus DNA under stringent conditions; and
(c) comparing the pattern obtained in (b) with a standard pattern for said human papilloma virus DNA sequence obtained using said site specific reagent and an equivalent labeled nucleic acid probe.
2. The human papilloma virus typing method according to claim 1, wherein the labeled nucleic acid is complementary to human papilloma virus type
3. The human papilloma virus typing method according to claim 1, wherein the labeled nucleic acid is complementary to human papilloma virus type 11.
4. The human papilloma virus typing method according to claim 1, wherein the labeled nucleic acid is complimentary to human papilloma virus type 16.
5. The human papilloma virus typing method according to claim 1, wherein the labeled nucleic acid is complementary to human papilloma virus type 18.
6. The human papilloma virus typing method according to claim 1, wherein more than one labeled nucleic acid is used each labelled nucleic acid being specific for a different human papilloma virus genotype.
7. The human papilloma virus typing method according to claim 1, wherein the labeled nucleic acid is comprised of at least two sections wherein each of said sections are complementary to a different genotype of human papilloma virus.
8. The human papilloma virus typing method according to claim 7, wherein said two sections of said labeled nucleic acids are in tandem.
9. The human papilloma virus typing method according to claim 1, wherein the restriction endonuclease is BamHI.
10. The human papilloma virus typing method according to claim 1, wherein the restriction endonuclease is PstI.
11. The human papilloma virus typing method according to claim 1, wherein the restriction endonuclease is BamHI and PstI.
12. The human papilloma virus typing method according to claim 1, wherein the nucleic acid probe is a DNA probe.
13. The human papilloma virus typing method according to claim 1, wherein the nucleic acid probe is a RNA probe.
14. The human papilloma virus typing method according to claim 1, wherein the nucleic acid probe is a synthetic oligonucleotide.
15. The human papilloma virus typing method according to claim 1, wherein the method of detecting the specific human papilloma virus DNA genotype is genomic blotting.
16. The human papilloma virus typing method according to claim 1, wherein the method of detecting the specific human papilloma virus DNA genotype uses a solution hybridization based system.
17. The human papilloma virus typing method according to claim 1, wherein the method of detecting the specific human papilloma virus DNA genotype involves hybridization to DNA immobilized within a dried gel.
18. A human papilloma virus typing method using in situ hybridization methods comprising:
(a) placing and fixing a biological specimen containing human cells which may contain at least one genotype of human papilloma virus on a solid support; (b) subjecting said specimen to hybridization using a labeled type-specific nucleic acid probe corresponding to a sequence of said human papilloma virus, said labeled nucleic acid probe being not able to substantially cross-hybridize with other genotypes of human papilloma virus DNA under stringent conditions; and
(c) detecting the presence of said labeled probe in said biological specimen.
19. The human papilloma virus typing method according to claim 18, wherein at least two types of specific human papilloma virus nucleic acid probes are used and each of said probes have a different label.
20. The human papilloma virus typing method according to claim 18, wherein the labeled probe is complementary to human papilloma virus type 6.
21. The human papilloma virus typing method according to claim 18, wherein the labeled probe is complementary to human papilloma virus type 11.
22. The human papilloma virus typing method according to claim 18, wherein the labeled probe is complementary to human papilloma virus type 16.
23. The human papilloma virus typing method according to claim 18, wherein the labeled probe is complementary to human papilloma virus type 18.
24. The human papilloma virus typing method according to claim 18, wherein more than one labeled probe is used, each probe being specific for a different human papilloma virus genotype.
25. The human papilloma virus typing method according to claim 18, wherein the nucleic acid probe is a DNA probe.
26. The human papilloma virus typing method according to claim 18, wherein the nucleic acid probe is a RNA probe.
27. The human papilloma virus typing method according to claim 18, wherein the nucleic acid probe is a synthetic oligonucleotide probe. 0
28. A nucleic acid probe in isolated form that is specific to a nucleic acid sequence of human papilloma virus type 6, said nucleic acid probe being obtained by cleaving said nucleic acid sequence of human papilloma virus type 6 using BamHI 5 and PstI.
29. A DNA probe in isolated form which is complementary to human papilloma virus type 6 having the following nucleotide sequence or its complement:
CTGCAGGAACAACCAGCACATTCATACTGCCTGTTATAATTGCATTTGTTGTATGTTTTG
TTAGCATCATACTTATTGTATGGATATCTGAGTTTATTGTGTACACATCTGTGCTAGTAC
TAAC-ACTGCTTTTATATTTACTATTGTGGCTGCTATTAACAACCCCCTTGCAATTTTTCC
TACTAACTCTACTTGTGTGTTACTGTCCCGCATTGTATATACACTACTATATTGTTACCA
CACAGCAATGATGCTAACATGTCAATTTAATGATGGAGATACCTGGCTGGGTTTGTGGTT
GTTATGTGCCTTTATTGTAGGGATGTTGGGGTTATTATTGATGCACTATAGAGCTGTACA
AGGGGATAAACACACCAAATGTAAGAAGTGTAACAAACACAACTGTAATGATGATTATGT
AACTATGCATTATACTACTGATGGTGATTATATATATATGAATTAGAGTAAACCGTTTTT
TATATTTGTAACAGTGTATGCTTTGTATACCATGGCACATAGTAGGGCCCGACGACGCAA
GCGTGCGTCAGCTACACAGCTATATCAAACATGTAAACTCACTGGAACATGCCCCCCAGA
TGTAATTCCTAAGGTGGAGCACAACACCATTGCAGATCAAATATTAAAATGGGGAAGTTT
GGGGGTGTTTTTTGGAGGGTTGGGTATAGGCACGGGTTCCGGCACTGGGGGTCGTACTGG
CTATGTTCCCTTACAAACTTCTGCAAAACCTTCTATTACTAGTGGGCCTATGGCTCGTCC
TCCTGTGGTGGTGGAGCCTGTGGCCCCTTCGGATCC
30. A RNA probe in isolated form which is complementary to human papilloma virus type 6 having a nucleotide sequence corresponding to the DNA sequence recited in claim 29 or its complement.
31. A DNA probe in isolated form which is complementary to human papilloma virus type 6 having the following nucleotide sequence or its complement:
GGATCCATCTATTGTGTCTTTAATTGAAGAATCGGCAATCATTAACGCAGGGGCGCCTGA AATTGTGCCCCCTGCACACGGTGGGTTTACAATTACATCCTCTGAAACAACTACCCCTGC AATATTGGATGTATCAGTTACTAGTCACACTACTACTAGTATATTTAGAAATCCTGTCTT TACAGAACCTTCTGTAACACAACCCCAACCACCCGTGGAGGCTAATGGACATATATTAAT TTCTGCACCCACTGTAACGTCACACCCTATAGAGGAAATTCCTTTAGATACTTTTGTGGT ATCATCTAGTGATAGCGGTCCTACATCCAGTACCCCTGTTCCTGGTACTGCACCTCGGCC TCGTGTGGGCCTATATAGTCGTGCATTGCACCAGGTGCAGGTTACAGACCCTGCATTTCT TTCCACTCCTCAACGCTTAATTACATATGATAACCCTGTATATGAAGGGGAGGATGTTAG TGTACAATTTAGTCATGATTCTATACACAATGCACCTGATGAGGCTTTTATGGACATAAT TCGTTTGCACAGACCTGCCATTGCGTCCCGACGTGGCCTTGTGCGGTACAGTCGCATTGG ACAACGGGGGTCTATGCACACTCGCAGCGGAAAGCACATAGGGGCCCGCATTCATTATTT TTATGATATTTCACCTATTGCACAGGCTGCAG
32. A RNA probe in isolated form which is complementary to human papilloma virus type 6 having a nucleotide sequence corresponding to the DNA sequence recited in claim 31 or its complement.
33. A nucleic acid probe in isolated form that is specific to a nucleic acid sequence of human papilloma virus type 11, said nucleic acid probe being obtained by cleaving said nucleic acid sequence of human papilloma virus type 11 using BamHI and Ndel.
34. A DNA probe in isolated form which is complementary to human papilloma virus type 11 having the following nucleotide sequence or its complement:
GGATCCCTATAAGGATATGAGTTTTTGGGAGGTTAACTTAAAAGAAAAGTTTTCAAGTGA ATTAGATCAGTTTCCCCTTGGACGTAAGTTTTTATTGCAAAGTGGATATCGAGGACGGAC GTCTGCTCGTACAGGTATAAAGCGCCCAGCTGTGTCTAAGCCCTCTACAGCCCCCAAACG AAAACGTACCAAAACCAAAAAGTAATATATGTGTGTCAGTGTGTTGTGTTATTTATATGT TGTTGTAGTGTGTATATGTTTCTTGTATTGTGTATATGTGTATATGTTTGTGTATATGTG TATGTTATGTATGTTATGTTGTTATGTATGTTTGTGTGTTTAGTGTGTGTATATATTTGT GGAATGTGTATGTATGTTTTTGTGCAATAAACAATTATTATGTGTGTCCTGTTACACCCA GTGACTAAGTTGTGTTTTGCACGCGCCGTTTGTGTTGCCTTCATATTATATTATATATAT TTGTAATATACCTATACTATGTTACCCCCCCCCACTTGCAACCGTTTTCGGTTGCCCTTA CATACACTTACCTCAAATTTGTTATAACGTGTTTTGTACTAATCCCATATG
35. A RNA probe in isolated form which is complementary to human papilloma virus type 11 having a nucleotide sequence corresponding to the DNA sequence recited in claim 34 or its complement.
36. A nucleic acid probe in isolated form that is specific to a nucleic acid sequence of a human papilloma virus type 11, said nucleic acid probe being obtained by cleaving said nucleic acid sequence of human papilloma virus type 11 using Kpnl and PstI.
37. A DNA probe in isolated form which is complementary to human papilloma virus 11 having the following nucleotide sequence or its complement:
GTACCCCCTACACAGGGTGGCTTTACTATAACATCATCTGAATCGACTACACCTGCTATT TTAGATGTGTCTGTTACCAATCACACTACCACTAGTGTGTTTCAAAATCCCCTGTTTACA GAACCGTCTGTAATACAGCCCCAACCACCTGTGGAGGCCAGTGGTCACATACTTATATCT GCCCCAACAATAACATCCCAACATGTAGAAGACATTCCACTAGACACTTTTGTTGTATCC TCTAGTGATAGTGGACCTACATCCAGTACTCCTCTTCCTCGTGCTTTTCCTCGGCCTCGG GTGGGTTTGTATAGTCGTGCCTTACAGCAGGTACAGGTTACGGACCCCGCGTTTTTGTCC ACGCCACAGCGATTGGTAACTTATGACAACCCTGTCTATGAAGGAGAAGATGTAAGTTTA CAATTTACCCATGAGTCTATCCACAATGCACCTGATGAAGCATTTATGGATATTATTAGA CTACATAGACCAGCTATAACGTCCAGACGGGGTCTTGTGCGTTTTAGTCGCATTGGGCAA CGGGGGTCCATGTACACACGCAGTGGACAACATATAGGTGCCCGCATACATTATTTTCAG GACATTTCACCAGTTACACAAGCTGCAG
38. A RNA probe in isolated form which is complementary to human papilloma virus type 11 having a nucleotide sequence corresponding to the DNA sequence recited in claim 37 or its complement.
39. A nucleic acid probe in isolated form that is specific to a nucleic acid sequence of human papilloma virus type 16, said nucleic acid probe being obtained by cleaving said nucleic acid sequence of human papilloma virus type 16 using BamHI and PvuII.
40. A DNA probe in isolated form which is complementary to human papilloma virus type 16 having the following nucleotide sequence or its complement:
GAATTCGGTTGCATGCTTTTTGGCACAAAATGTGTTTTTTTAAATAGTTCTATGTCAGCA ACTATGGTTTAAACTTGTACGTTTCCTGCTTGCCATGCGTGCCAAATCCCTGTTTTCCTG ACCTGCACTGCTTGCCAACCATTCCATTGTTTTTTACACTGCACTATGTGCAACTACTGA ATCACTATGTACATTGTGTCATATAAAATAAATCACTATGCGCCAACGCCTTACATACCG CTGTTAGGCACATATTTTTGGCTTGTTTTAACTAACCTAATTGCATATTTGGCATAAGGT TTAAACTTCTAAGGCCAACTAAATGTCACCCTAGTTCATACATGAACTGTGTAAAGGTTA GTCATACATTGTTCATTTGTAAAACTGCACATGGGTGTGTGCAAACCGATTTTGGGTTAC ACATTTACAAGCAACTTATATAATAATACTAAACTACAATAATTCATGTATAAAACTAAG GGCGTAACCGAAATCGGTTGAACCGAAACCGGTTAGTATAAAAGCAGACATTTTATGCAC CAAAAGAGAACTGCAATGTTTCAGGACCCACAGGAGCGACCCAGAAAGTTACCACAGTTA TGCACAGAGCTGCAAACAACTATACATGATATAATATTAGAATGTGTGTACTGCAAGCAA CAGTTACTGCGACGTGAGGTATATGACTTTGCTTTTCGGGATTTATGCATAGTATATAGA GATGGGAATCCATATGCTGTATGTGATAAATGTTTAAAGTTTTATTCTAAAATTAGTGAG TATAGACATTATTGTTATAGTTTGTATGGAACAACATTAGAACAGCAATACAACAAACCG TTGTGTGATTTGTTAATTAGGTGTATTAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAG CAAAGACATCTGGACAAAAAGCAAAGATTCCATAATATAAGGGGTCGGTGGACCGGTCGA TGTATGTCTTGTTGCAGATCATCAAGAACACGTAGAGAAACCCAG
41. A RNA probe in isolated form which is complementary to human papilloma virus type 16 having a nucleotide sequence corresponding to the DNA sequence recited in claim 40 or its complement.
42. A nucleic acid probe in isolated form that is specific to a nucleic acid sequence of human papilloma virus type 18, said nucleic acid probe being obtained by cleaving said nucleic acid sequence of human papilloma virus type 18 using BamHI.
43. A DNA probe in isolated form which is complementary to human papilloma virus type 18 having the following nucleotide sequence or its complement:
GGATCCCTATGATAAGTTAAAGTTTTGGAATGTGGATTTAAAGGAAAAGTTTTCTTTAGA CTTAGATCAATATCCCCTTGGACGTAAATTTTTGGTTCAGGCTGGATTGCGTCGCAAGCC CACCATAGGCCCTCGCAAACGTTCTGCTCCATCTGCCACTACGTCTTCTAAACCTGCCAA GCGTGTGCGTGTACGTGCCAGGAAGTAATATGTGTGTGTGTATATATATATACATCTATT GTTGTGTTTGTATGTCCTGTGTTTGTGTTTGTTGTATGATTGCATTGTATGGTATGTATG GTTGTTGTTGTATGTTGTATGTTACTATAATTGTTGGTATGTGGCATTAAATAAAATATG TTTTGTGGTTCTGTGTGTTATGTCCTTGCGCCCTAGTGAGTAACAACTGTATTTGTGTTT GTGGTATGGGTGTTGCTTGTTGGGCTATATATTGTCCTGTATTTCAAGTTATAAAACTGC ACACCTTACAGCATCCATTTTATCCTACAATCCTCCATTTTGCTGTGCAACCGATTTCGG TTGCCTTTGGCTTATGTCTGTGGTTTTCTGCACAATACAGTACGCTGGCACTATTGCAAA ATTTAATCTTTTGGGCACTGCTCCTACATATTTTGAACCATTGGCGCGCCTCTTTGGCGA TACAAGGCGCACCTGGTATTAGTCATTTTCCTGTCCAGGTGCGCTACAACAATTGCTTGC ATAACTATATCCACTCCCTATGTAATAAAACTGCTTTTAGGCACATATTTTAGTTTGTTT TTACTTACGCTAATTGCATACTTGGCTTGTACAACTACTTTCATGTCCAACATTCTGTCT ACCCTTAACATGAACTATAATATGACTAAGCTGTGCATACATAGTTTATGCAACCGAAAT AGGTTGGGCAGCACATACTATACTTTTCATTAATACTTTTAACAATTGTAGTATATAAAA AAGGGAGTGACCGAAAACGGTCGGGACCGAAAACGGTGTATATAAAAGATGTGAGAAACA CACCACAATACCATGGCGCGCTTTGAGGATCC
44. A RNA probe in isolated form which is complementary to human papilloma virus type 18 having a nucleotide sequence corresponding to the DNA sequence recited in claim 43 or its complement.
45. A nucleic acid probe in isolated form that is specific to a nucleic acid sequence of human papilloma virus type 18, said nucleic acid probe being obtained by cleaving said nucleic acid sequence of human papilloma virus type 18 using BamHI and Sau3A.
46. A DNA probe in isolated form which is complementary to human papilloma virus type 18 having the following nucleotide sequence or its complement:
GGATCCAACACGGCGACCCTACAAGCTACCTGATCTGTGCACGGAACTGAACAGTTCACT GCAAGACATAGAAATAACCTGTGTATATTGCAAGAAAGTATTGGAACTTACAGAGGTATT TGAAATTGCATTTAAAGATTTATTTGTGGTGTATAGAGACAGTATACCGCATGCTGCATG CCATAAATGTATAGATTTTTATTCTAGAATTAGAGAATTAAGACATTATTCAGACTCTGT GTATGGAGACACATTGGAAAAACTAACTAACACTGGGTTATACAATTTATTAATAAGGTG CCTGCGGTGCCAGAAACCGTTGAATCCAGCAGAAAAACTTAGACACCTTAATGAAAAACG ACGATTTCACAACATAGCTGGGCACTATAGAGGCCAGTGCCATTCGTGCTGCAACCGAGC ACGACAGGAACGACTCCAACGACGCAGAGAAACACAAGTATAATATTAAGTATGCATGGA CCTAAGGCAACATTGCAAGACATTGTATTGCATTTAGAGCCCCAAAATGAAAGTTCCGGT TGACCTTCTATGTCACGAGCAATTAAGCGACTCAGAGGAAGAAAACGATGAAATAGATGG AGTTAATGATGAAGATTTACCAGCCCGACGAGCCGAACCACAACGTCACACAATGTGTGT ATGTGTGTAAGTGTGAAGCCAGAATTGAGCTAGTAGTAGAAAGCTCAGCAGACGACCTTC GAGCATTCCAGCAGCTGTTTGTGAACACCCTGTCCTTTGTGTGCCGTGGTGTGCAGGGAG CAGTAAGCAACAATGGCTGATC
5 47. A RNA probe in isolated form which is complementary to human papilloma virus type 18 having a nucleotide sequence corresponding to the DNA sequence recited in claim 46 or its complement.
48. A synthetic oligonucleotide having the 10 following sequence:
CTAAAGGTCCTGTTTCGAGGCGGCTATCCA
49. A synthetic oligonucleotide having the following sequence:
CAGCACGCGCAGGCTGCATATGGATAGCCG
15
50. A synthetic oligonucleotide having the following sequence:
CTAAAGGTTGTGTGGCGAGACAACTTTCCC
51. A synthetic oligonucleotide having the following sequence:
CAACAGGCACACGCTGCAAAGGGAAAGTTG
52. A synthetic oligonucleotide having the following sequence:
TTATGCATAGTATATAGAGATGGGAATCCA
53. A synthetic oligonucleotide having the following sequence:
CATTTATCACATACAGCATATGGATTCCCA
54. A synthetic oligonucleotide having the following sequence:
TTATTTGTGGTGTATAGAGACAGTATACCG
55. A synthetic oligonucleotide having the following sequence: CATTTATGGCATGCAGCATGCGGTATACTG
56. A synthetic oligonucleotide having the following sequence:
CTAAAGGTCCTGTTTCGAGGCGGCTATCCATATGCAGCCTGCGCGTGCTG
57. A synthetic oligonucleotide having the following sequence:
CAGCACGCGCAGGCTGCATATGGATAGCCGCCTCGAAACAGGACCTTTAG
58. A synthetic oligonucleotide having the following sequence:
CTAAAGGTTGTGTGGCGAGACAACTTTCCCTTTGCAGCGTGTGCCTGTTG
59. A synthetic oligonucleotide having the following sequence:
CAACAGGCACACGCTGCAAAGGGAAAGTTGTCTCGCCACACAACCTTTAG
60. A synthetic oligonucleotide having the following sequence:
TTATGCATAGTATATAGAGATGGGAATCCATATGCTGTATGTGATAAATG
61. A synthetic oligonucleotide having the following sequence:
CATTTATCACATACAGCATATGGATTCCCATCTCTATATACTATGCATAA
62. A synthetic oligonucleotide having the following sequence:
TTATTTGTGGTGTATAGAGACAGTATACCGCATGCTGCATGCCATAAATG
63. A synthetic oligonucleotide having the following sequence: CATTTATGGCATGCAGCATGCGGTATACTGTCTCTATACACCACAAATAA
64. A method for the simultaneous analysis of two or more infectious diseases in a single hybridization step comprising:
(a) digesting disease-specific DNA with a site specific reagent or combination of reagents which' are able to cleave said disease- specific DNA to produce a digestion pattern of two or more specific genotypes of infectious diseases;
(b) detecting in the digest of (a) , a disease-specific DNA genotype to genomic blotting using a nucleic acid probe that is complementary to a sequence of the specific genotype of said disease- specific DNA, said labeled nucleic acid probe being not able to substantially cross-hybridize with other genotypes of said disease-specific DNA under stringent conditions; and
(c) comparing the pattern obtained in (b) with a standard pattern for said disease- specific DNA sequence obtained using said site specific reagent and an equivalent labeled nucleic acid probe.
65. A method according to claim 64, wherein said disease-specific DNA is viral DNA.
66. A method according to claim 64, wherein said disease-specific DNA may be selected from the group of sexually transmitted diseases consisting of syphilis, gonorrhea, Chlamydia, AIDS, and mixtures thereof.
67. A human papilloma virus typing method for simultaneously distinguishing specific human papilloma virus genotypes in a single hydridization step comprising:
(a) digesting human papilloma virus DNA with a site specific reagent or combination of reagents which are able to cleave said human papilloma virus DNA to produce a digestion pattern of one or more specific genotypes of human papilloma virus; (b) separating said one or more digestion patterns via electrophoresis;
(c) detecting in one or more of the separated digests of (b) , one or more specific human papilloma virus DNA genotypes using at least two nucleic acid probes that are complementary in sequence to a sequence of one or more specific genotypes of said human papilloma virus DNA, said labeled nucleic acid probe being not able to substantially cross-hybridize with other genotypes of human papilloma virus DNA under stringent conditions; and
(d) comparing the pattern obtained in 5 (c) with a standard pattern for said one or more human papilloma virus DNA sequences obtained using said site specific reagent and at least two labeled nucleic acid probes.
68. A human papilloma virus typing method 10 according to claim 67, wherein said human papilloma virus genotypes are selected from the group consisting of type 6, type 11, type 16, type 18, type 31, type 33, type 35, and combinations thereof.
69. A human papilloma virus typing method 15 according to claim 67, wherein said site specific reagent is selected from the group consisting of Bam HI, Pst I, and combinations thereof.
70. A DNA probe in isolated form which is complementary to human papilloma virus type 33
20 having the following nucleotide sequence or complement thereof:
GTAGACA
ACTGTGCGTT TTAGTAGAGT AGGTCAAAAA GCCACACTTA AAACTCGCAG TGGTAAACA ATTGGAGCTA GAATACATTA TTATCAGGAT TTAAGTCCTA TTGTGCCTTT AGACCACAC GTGCCAAATG AACAATAAGA ATTACAGCCT TTACATGATA CTTCTACATC GTCTTATAG ATTAATGATG GTTTGTATGA TGTTTATGCA GACGATGTGG ATAATGTACA CACCCCAAT CAACACTCAT ACAGTACGTT TGCAACAACA CGTACCAGCA ATGTGTCTAT ACCTTTAAA ACAGGATTTG ATACTCCTGT TATGTCTGGC CCTGATATAC CTTCCCCTTT ATTTCCCAC TCTAGCCCAT TTGTTCCTAT TTCGCCTTTT TTTCCTTTTG ACACCATTGT TGTAGAC
71. A method for the simultaneous analysis of two or more nucleic acid targets in a sample in a single hybridization step comprising:
(a) detecting two or more nucleic acid targets by hybridization using specific labeled nucleic acid probes, said nucleic acid probes being not able to substantially cross-hybridize with other DNA under stringent conditions; and
(b) comparing the pattern obtained in (a) with a standard pattern for said DNA target sequence to determine the presence of two or more nucleic acid targets in the sample.
PCT/US1989/001318 1988-04-04 1989-04-04 Human papilloma virus typing method and nucleic acid probes used therein WO1989009940A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US17740488 true 1988-04-04 1988-04-04
US177,404 1988-04-04
US33038189 true 1989-03-31 1989-03-31
US330,381 1989-03-31

Publications (1)

Publication Number Publication Date
WO1989009940A1 true true WO1989009940A1 (en) 1989-10-19

Family

ID=26873235

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1989/001318 WO1989009940A1 (en) 1988-04-04 1989-04-04 Human papilloma virus typing method and nucleic acid probes used therein

Country Status (3)

Country Link
EP (1) EP0408658A4 (en)
JP (1) JPH03503605A (en)
WO (1) WO1989009940A1 (en)

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0402132A2 (en) * 1989-06-08 1990-12-12 Takara Shuzo Co. Ltd. Method for the detection of human papilloma-virus
WO1991008312A1 (en) * 1989-12-01 1991-06-13 Gene-Trak Systems Detection of hpv transcripts
FR2661921A1 (en) * 1990-05-11 1991-11-15 Pasteur Institut Probe papillomavirus (HPV66), in particular for in vitro diagnosis of papillomavirus infections, neoplasia may be accompanied by genital, and genetically and immunologically related products this papillomavirus.
EP0477972A2 (en) * 1990-09-28 1992-04-01 Abbott Laboratories Nucleotide sequences useful as type-specific probes, PCR primers and LCR probes for the amplification and detection of human papilloma virus, and related kits and methods
EP0489442A1 (en) * 1990-12-06 1992-06-10 SCLAVO S.p.A. Synthetic oligonucleotides useful for the diagnosis of infections from different types of virus of the papilloma group and usage thereof
FR2679254A1 (en) * 1991-07-17 1993-01-22 Clonatec Sa oligonucleotide probes for typing and the detection of human papillomavirus.
US5182377A (en) * 1988-09-09 1993-01-26 Hoffmann-La Roche Inc. Probes for detection of human papillomavirus
US5342930A (en) * 1988-05-13 1994-08-30 Institut Pasteur Isolated DNA of human papillomavirus type 54(HPV54)
US5447839A (en) * 1988-09-09 1995-09-05 Hoffmann-La Roche Inc. Detection of human papillomavirus by the polymerase chain reaction
US5580970A (en) * 1989-12-01 1996-12-03 Amoco Corporation Detection of HPV transcripts
EP0774518A2 (en) 1995-11-15 1997-05-21 Gen-Probe Incorporated Nucleic acid probes complementary to Human Papillomavirus nucleic acid and related methods and kits
EP1806410A2 (en) * 2001-08-23 2007-07-11 Merck & Co., Inc. Fluorescent multiplex HPV PCR assays using multiple fluorophores
EP1935992A2 (en) 2003-12-23 2008-06-25 Autogenomics, Inc. Multiplexed nucleic acid analysis with high specificity for human papilloma virus

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2726396A1 (en) * 2008-04-17 2009-10-22 Qiagen Gaithersburg, Inc. Compositions, methods, and kits using synthetic probes for determining the presence of a target nucleic acid

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0192001A2 (en) * 1984-11-30 1986-08-27 Institut Pasteur Papilloma virus probes and in vitro methods for the diagnosis of papilloma virus infections
US4748109A (en) * 1983-07-01 1988-05-31 Baird Phillip J Assay method and reagent to determine antibodies to papillomavirus virions
US4777239A (en) * 1986-07-10 1988-10-11 The Board Of Trustees Of The Leland Stanford Junior University Diagnostic peptides of human papilloma virus

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4690890A (en) * 1984-04-04 1987-09-01 Cetus Corporation Process for simultaneously detecting multiple antigens using dual sandwich immunometric assay
WO1987005630A1 (en) * 1986-03-21 1987-09-24 Institut Pasteur Determined dna sequences derived from a papillomavirus genome, their uses for in vitro diagnostic purposes and the production of antigenic compositions
FR2629458B2 (en) * 1987-07-31 1991-08-09 Ire Celltarg Sa News of specific nucleic acid probes of different types of human papilloma virus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4748109A (en) * 1983-07-01 1988-05-31 Baird Phillip J Assay method and reagent to determine antibodies to papillomavirus virions
EP0192001A2 (en) * 1984-11-30 1986-08-27 Institut Pasteur Papilloma virus probes and in vitro methods for the diagnosis of papilloma virus infections
US4777239A (en) * 1986-07-10 1988-10-11 The Board Of Trustees Of The Leland Stanford Junior University Diagnostic peptides of human papilloma virus

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Biological Abstracts, Volume 83, No. 7, issued 1987, April 1 (Philadelphia, Pennsylvania, USA), B. PARENT et al, "Treatment of Dysplasias of the Cervix: A New Strategy Using Viral Typing", Abstract No. 66364, J. Gynecol. Obstet. Biol. Reprod. 15(7) 941-947 (1986), entire Abstract. *
Journal of Virological Methods, Volume 19, No. 1, issued 1988 January, S. PARKKINEN, "Nucleic Acid Sandwich Hybridization in Detection of HPV 16 DNA: Technique and its Clinical Application", pages 69-77 see pages 69 and 76. *
Journal of Virological Methods, Volume 20 No. 3, issued 1988 July, H.A. CUBIE etal, "Synthetic Oligonucleotide Probes for the Detection of Human Papilloma Viruses by in Situ Hybridisation", pages 239-249, see pages 239 and 246-247. *
Journal of Virology, Volume 58, No. 1, issued 1986 April, A.T. LORINCZ et al, "Cloning and Characterization of the DNA of a New Human Papillomavirus from a Woman with Dysplasia of the Uterine Cervix", pages 225-229, see page 228 *
Nature, Volume 317, issued 1985, October 17, J.W. KREIDER et al, "Morphological Transformation in Vivo of Human Uterine Cervic with Papillomavirus from Condylomta Acuminata", pages 639-641, see figures 2 and 3, pages 640-641. *
See also references of EP0408658A4 *

Cited By (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5534439A (en) * 1988-05-13 1996-07-09 Institut Pasteur Isolated DNA of human papillomavirus type 55 (HPV55)
US5968522A (en) * 1988-05-13 1999-10-19 Institut Pasteur Immunogenic compositions and antibodies directed against human papillomavirus type 49 (HPV 49), type 50 (HPV 50), type 54 (HPV 54), and type 55 (HPV 55).
US5824466A (en) * 1988-05-13 1998-10-20 Institut Pasteur Purified polypeptide of human papillomavirus type 49 (HPV49) type 50 (HVP50), and type 55 (HPV55)
US5591574A (en) * 1988-05-13 1997-01-07 Institut Pasteur Probes, diagnostic method and immunization method based on papillomavirus types HPV 49 and HPV 50
US5342930A (en) * 1988-05-13 1994-08-30 Institut Pasteur Isolated DNA of human papillomavirus type 54(HPV54)
US5447839A (en) * 1988-09-09 1995-09-05 Hoffmann-La Roche Inc. Detection of human papillomavirus by the polymerase chain reaction
US5705627A (en) * 1988-09-09 1998-01-06 Roche Molecular Systems, Inc. Detection of human papillomavirus by the polymerase chain reaction using specific L1, and E6 probes
US5182377A (en) * 1988-09-09 1993-01-26 Hoffmann-La Roche Inc. Probes for detection of human papillomavirus
US5283171A (en) * 1988-09-09 1994-02-01 Hoffmann-La Roche Inc. Compositions for and detection of human papillomavirus by specific oligonucleotide polymerase primers using the polymerase chain reaction
EP0402132A3 (en) * 1989-06-08 1991-05-08 Takara Shuzo Co. Ltd. Method for the detection of human papilloma-virus
EP0402132A2 (en) * 1989-06-08 1990-12-12 Takara Shuzo Co. Ltd. Method for the detection of human papilloma-virus
US5580970A (en) * 1989-12-01 1996-12-03 Amoco Corporation Detection of HPV transcripts
EP0662518A2 (en) * 1989-12-01 1995-07-12 Amoco Corporation Nucleic acid probe for detection of HPV transcripts
EP0662518A3 (en) * 1989-12-01 1995-08-30 Amoco Corp Nucleic acid probe for detection of HPV transcripts.
WO1991008312A1 (en) * 1989-12-01 1991-06-13 Gene-Trak Systems Detection of hpv transcripts
FR2661921A1 (en) * 1990-05-11 1991-11-15 Pasteur Institut Probe papillomavirus (HPV66), in particular for in vitro diagnosis of papillomavirus infections, neoplasia may be accompanied by genital, and genetically and immunologically related products this papillomavirus.
WO1991018118A1 (en) * 1990-05-11 1991-11-28 Institut Pasteur Papillomavirus probe (hpv66), particularly for the diagnosis in vitro of papillomavirus infections which may be accompanied by genital neoplasia, and products genetically and immunologically related to said papillomavirus
EP0458668A1 (en) * 1990-05-11 1991-11-27 Institut Pasteur Papilloma virus probe (HPV66), particularly for the diagnosis of papillomaviral infections in vitro which accompany genital neoplasia, as well as products genetically and immunologically related to this papilloma virus
EP0477972A2 (en) * 1990-09-28 1992-04-01 Abbott Laboratories Nucleotide sequences useful as type-specific probes, PCR primers and LCR probes for the amplification and detection of human papilloma virus, and related kits and methods
EP0477972A3 (en) * 1990-09-28 1992-05-20 Abbott Laboratories Nucleotide sequences useful as type-specific probes, pcr primers and lcr probes for the amplification and detection of human papilloma virus, and related kits and methods
EP0489442A1 (en) * 1990-12-06 1992-06-10 SCLAVO S.p.A. Synthetic oligonucleotides useful for the diagnosis of infections from different types of virus of the papilloma group and usage thereof
WO1993002217A3 (en) * 1991-07-17 1993-04-01 Clonatec Sa Oligonucleotide probes for type determination and detection of human papillomaviruses
FR2679254A1 (en) * 1991-07-17 1993-01-22 Clonatec Sa oligonucleotide probes for typing and the detection of human papillomavirus.
WO1993002217A2 (en) * 1991-07-17 1993-02-04 Clonatec S.A. Oligonucleotide probes for type determination and detection of human papillomaviruses
EP0774518A2 (en) 1995-11-15 1997-05-21 Gen-Probe Incorporated Nucleic acid probes complementary to Human Papillomavirus nucleic acid and related methods and kits
US6583278B1 (en) 1995-11-15 2003-06-24 Gen-Probe Incorporated Nucleic acid probes complementary to human papilloma virus nucleic acid
US8501410B2 (en) 1995-11-15 2013-08-06 Gen-Probe Incorporated Oligonucleotides for detecting human papilloma virus in a test sample
US9194008B2 (en) 1995-11-15 2015-11-24 Gen-Probe Incorporated Hybridization assay detection probes for detecting human papilloma virus in a sample
US7355034B2 (en) 1995-11-15 2008-04-08 Gen-Probe Incorporated Oligonucleotides for use in determining the presence of human papilloma virus in a test sample
US7470512B2 (en) 1995-11-15 2008-12-30 Gen-Probe Incorporated Oligonucleotides for use in determining the presence of human papilloma virus in a test sample
EP1806410A2 (en) * 2001-08-23 2007-07-11 Merck & Co., Inc. Fluorescent multiplex HPV PCR assays using multiple fluorophores
EP1806410A3 (en) * 2001-08-23 2007-10-24 Merck & Co., Inc. Fluorescent multiplex HPV PCR assays using multiple fluorophores
EP1935992A2 (en) 2003-12-23 2008-06-25 Autogenomics, Inc. Multiplexed nucleic acid analysis with high specificity for human papilloma virus
EP1935992A3 (en) * 2003-12-23 2008-12-03 Autogenomics, Inc. Multiplexed nucleic acid analysis with high specificity for human papilloma virus

Also Published As

Publication number Publication date Type
JPH03503605A (en) 1991-08-15 application
EP0408658A4 (en) 1991-10-02 application
EP0408658A1 (en) 1991-01-23 application

Similar Documents

Publication Publication Date Title
Sun et al. Viral load of high‐risk human papillomavirus in cervical squamous intraepithelial lesions
US6420106B1 (en) Method and kit for early cancer prediction
US6355424B1 (en) Assessment of human papillomavirus-related disease
Kalantari et al. Physical state of HPV16 and chromosomal mapping of the integrated form in cervical carcinomas
Molijn et al. Molecular diagnosis of human papillomavirus (HPV) infections
US5783412A (en) Method of detection of carcinogenic human papillomavirus
Melchers et al. Increased detection rate of human papillomavirus in cervical scrapes by the polymerase chain reaction as compared to modified FISH and southern‐blot analysi
US20060160188A1 (en) Systems, methods , and compositions for detection of human papilloma virus in biological samples
US4983728A (en) Nucleic acid probes of human papilloma virus
US5814448A (en) Polymerase chain reaction/restriction fragment polymorphism method for the detection and typing of human papillomaviruses
US5527898A (en) Detection of human papillomavirus by the polymerase chain reaction
Lungu et al. Typing of human papillomaviruses by polymerase chain reaction amplification with L1 consensus primers and RFLP analysis
Van den Brule et al. Rapid detection of human papillomavirus in cervical scrapes by combined general primer-mediated and type-specific polymerase chain reaction.
Tieben et al. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers
US5702888A (en) Process for the detection of nucleic acids
Chan et al. High prevalence of human papillomavirus type 58 in Chinese women with cervical cancer and precancerous lesions
Dallas et al. Polymerase chain reaction for fast, nonradioactive detection of high‐and low‐risk papillomavirus types in routine cervical specimens and in biopsies
US5580970A (en) Detection of HPV transcripts
Herrington et al. Interphase cytogenetics using biotin and digoxigenin labelled probes I: relative sensitivity of both reporter molecules for detection of HPV16 in CaSki cells.
Poddighe et al. Interphase cytogenetics of tumours
US5182377A (en) Probes for detection of human papillomavirus
Resnick et al. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers
Crum et al. Cervical papillomaviruses segregate within morphologically distinct precancerous lesions.
Gaffey et al. Human papillomavirus and Epstein-Barr virus in sinonasal Schneiderian papillomas: an in situ hybridization and polymerase chain reaction study
US6352825B1 (en) Human Papilloma Virus detection in a nucleic acid amplification process using general primers

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1989905255

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1989905255

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1989905255

Country of ref document: EP