WO1988002779A1 - Composite yeast vectors - Google Patents

Composite yeast vectors Download PDF

Info

Publication number
WO1988002779A1
WO1988002779A1 PCT/US1987/002663 US8702663W WO8802779A1 WO 1988002779 A1 WO1988002779 A1 WO 1988002779A1 US 8702663 W US8702663 W US 8702663W WO 8802779 A1 WO8802779 A1 WO 8802779A1
Authority
WO
WIPO (PCT)
Prior art keywords
yeast
dna
dna sequence
functional segment
gene
Prior art date
Application number
PCT/US1987/002663
Other languages
French (fr)
Inventor
Robert L. Strausberg
Susan L. Strausberg
Original Assignee
Genex Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genex Corporation filed Critical Genex Corporation
Publication of WO1988002779A1 publication Critical patent/WO1988002779A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • C07K14/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121Serpins
    • C07K14/8128Antithrombin III
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • C12N15/625DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/036Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C07K2319/81Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding

Definitions

  • the present invention relates to a method of expressing genes in yeast. More particularly, the invention relates to a method of expressing foreign genes in yeast. The invention further relates to composite DNA expression vectors capable of effecting ultrahigh expression of a polypeptide in a yeast host, yeast cells transformed by the DNA expression vector, use of the DNA expression vector to effect ultrahigh expression of a target polypeptide, and to target polypeptide products produced by yeast cells transformed by the DNA expression vectors.
  • yeasts such as Saccharomyces as hosts for expressing mammalian and other foreign proteins offer advantages lacking in more commonly used prokaryotic hosts such as Escherichia coli.
  • yeasts are capable of glycosylation while prokaryotic hosts such as E. coli are not.
  • S. cerevisiae is generally regarded as safe by the United States Food and Drug Administration. The genetic system of S. cerevisiae has been well-defined.
  • Saccharomyces has thus recently been used to express such foreign polypeptides as hepatitis B, Valenzueia et al., Nature 298:347-350 (1982); Miyanohara et al., Proc. Natl. Acad. Sci. USA .80:1-5 (1983); Hitzeman et al., Nucleic Acids Res. 11: 2745-2763 (1983); McAleer et al.. Nature 307:178-180 (1984), interferons, Tuite et al., EMBO J. 1:603-608 (1932), calf chymosin, Mellor et al..
  • heterologous polypeptides In spite of the advantages of using a yeast such as Saccharomyces as an expression host, production of heterologous polypeptides generally has been disappointingly low as compared to that of the normal homologous gene products. Chen et al.. Nucleic Acids Res. 12 :8951-8970 (1984). Many investigators have sought to increase expression of proteins, especially of heterologous proteins, in yeast hosts by employing in an expression vector various components and combinations thereof that might be expected to increase heterologous protein expression because they are thought to strongly express homologous gene products in yeasts. Generally, these expression vectors have included a strong yeast promoter to direct transcription, a yeast sequence to terminate transcription, and a replication origin and selectable marker to maintain the plasmid in the host cell. The promoter and terminator sequences have generally been chosen from highly expressed yeast genes. Promoter sequences often have been selected based on their ability to tightly regulate expression of the foreign product which sometimes is toxic to the host cell.
  • European Patent Application No. 84303833.2 discloses a cloning vector containing a foreign gene and the yeast galactokinase (GAL1) regulatory region and promoter in position to regulate the expression of the foreign gene.
  • GAL1 yeast galactokinase
  • This system was used to produce a galactokin- ase-bovine prochymosin fusion protein in S. cerevisiae.
  • GAL4 yeast galactokinase
  • increased copy number for the GAL4 gene known to enhance messenger RNA levels of the galactose metabolic genes in yeast, (Laughon et al., Proc. Natl. Acad. Sci. USA 79:6827-6831 (1982)), by isolating the GAL4 gene from yeast DNA and inserting it into a plasmid which contains the GAL1 regulatory region and promoter as well as the foreign gene.
  • European Patent Application No. 84101937.5 discloses use of a GAL1 promoter of the yeast galactokinase gene in expressing a desired protein.
  • the GAL1 promoter used was a DNA segment containing the transcription start signal for galactokinase in S. cerevisiae.
  • European Patent Application No. 84302723.6 (Pub. No. 0 123 544 A2 ) discloses use of the promoter and signal peptide portions of the yeast alpha-factor gene joined to the sequence encoding the desired heterologous protein. This system was used to express human interferon gamma, human serum albumin, bovine interferon alpha-1 and alpha-2, tissue plasminogen activator, rennin and a human insulin-like growth factor.
  • PCT Application No. WO 86/00926 discloses use of controllable represspr operator sequences responsive to the a 1/alpha-2 and alpha-2 gene products of the type a and type alpha yeast mating locus alleles to repress expression of a heterologous structural gene located downstream of the expression controlled sequence in the presence of a gene product of a yeast mating type locus.
  • PCT Application No. 83/01370 discloses use of the SUC2 promoter, containing the transcription start signal for the structural gene for invertase to direct expression of an interferon gene within a yeast cell. The system allows passive regulation of interferon production, and was used to express human leukocyte interferon in S. cerevisiae.
  • European Patent Application No. 84104967.9 discloses use of the 5' -flanking region from the yeast repressible acid phosphatase (PH05) gene to tightly regulate the expression of heterologous genes in yeast.
  • the PH05 promoter/regulator was used to direct expression of interferon in S. cerevisiae.
  • European Patent Application No. 33110472.4 discloses use of the promoter of the PHO5 gene, including the PHO5 signal peptide, to control expression of a target peptide gene in S. cerevisiae.
  • the system was used to express norepinephrine alpha. Production of the target protein varied as a function of the phosphate concentration in the medium.
  • PCT Application No. 85/01470 discloses use of a PHO5 promoter lying within the approximately 0.55 Kb sequence preceding the ATG translational start triplet at the beginning of the PHO5 coding sequence, which is excised and isolated from the PHO5 gene, to control expression of a heterologous peptide in S. cerevisiae.
  • This PHO5 promoter system in one embodiment containing also the major PHO5 start site, is used to direct expression of human fertility hormones, such as hCG, LH and FSH.
  • human fertility hormones such as hCG, LH and FSH.
  • GPD glyceraldehyde-3'-phosphate alhy- drogenase
  • Hinnen et al., Chem. Ab. 102:Ab. No. 40931k (1985) discloses use of the promoter and 80% of the 5' end of the PHO5 signal sequence fused to a cDNA fragment encoding the mature protein sequence and a portion of the 3' end of the signal sequence of human alpha interferon.
  • This system thus includes a hybrid PHO5-hIF-alpha signal sequence used to transform S. cerevisiae.
  • European Patent Application No. 83310471.6 (Pub. No. 0 109 559 A1) discloses use of the giyceraldehyde-3-phosphate dehydrogenase promoter to control expression of a target peptide in Saccharomyces. Also disclosed is the use of the 3' -terminal non-transla- tional region of the GAPDH gene in the plasmid at a point downstream from the target peptide gene to increase production of the target peptide.
  • PCT Application No. 84/00153 discloses use of a yeast regulon and a transcription terminator derived from one of the GAPDH genes of S. cerevisiae. It is disclosed that a 850 nucleotide GAPDH regulon was almost 100 times more effective as smaller regulons (280 nuclectides). Also disclosed is the use of the GAPDH regulon in conjunction with a signal sequence derived from a gene for yeast invertase, yeast acid phosphatas ⁇ , unmatured forms of thaumatin-like proteins, unmatured forms of chymosin-like proteins or two consensus signal poly peptides, the amino acid sequences of which are disclosed. Also disclosed is the use of preferred yeast codons in either the target peptide sequence, the signal sequence or both.
  • Urdea et al., Proc. Natl. Acad. Sci. USA 80: 7461-7465 (1983) discloses a plasmid containing the yeast GAPDH promoter, the structural gene for human epidermal growth factor (urogastrone) and a terminator derived from yeast alcohol dehydrogenase (ADH).
  • This genetic unit was inserted into a yeast plasmid vector that contained the yeast 2 micron sequences, a DNA fragment containing the yeast LEU coding sequences, and a fragment of pBR322 containing the origin of replication and the ampicillin resistance gene, and used to direct synthesis of urogastrone.
  • the DNA sequence for the gene encoding urogastrone was designed with yeast-preferred codons inferred from codon usage in the highly expressed yeast genes for GAPDH, ADH and pyruvate kinase. This expression system produced about 30 micrograms of target protein per liter of yeast culture.
  • European Patent Application No. 85870170.9 discloses the use of strong yeast promoters such as the promoters of alcohol dehydrogenase (ADH1), enolase (ENO8; ENO46), glyceraldehyde-3-phosphate dehydrogenase (GAP63; GAP491), phosphoglycerate kinase (PGK), alkaline phosphatase (PHO3; PHO5 ) and promoter p415, to control expression of enzymes of the 1,4-beta-N-acetylmuramidase type.
  • ADH1 alcohol dehydrogenase
  • ENO8 enolase
  • GAP63 glyceraldehyde-3-phosphate dehydrogenase
  • PGK phosphoglycerate kinase
  • PHO3 alkaline phosphatase
  • promoter p415 to control expression of enzymes of the 1,4-beta-N-acetylmurami
  • Bock et al. U.S. Patent No. 4,517,294, disclose that a plasmid vector containing four components is required to express a heterologous gene such as the cDNA for human antithrombin III in yeast.
  • the first component allows for transformation of both E. coli and yeast, and contains a selectable gene from each organism.
  • the second component is a 5'-flanking sequence from a highly expressed yeast gene to promote transcription of a downstream-placed structural gene, such as the 5'-flanking sequence from yeast 3-phosphoglycerate kinase (PGK).
  • the third component is a structural gene containing both an ATG translation start and translation stop signals.
  • the fourth component is the 3'-flanking sequence of a yeast gene containing the signal for transcription termination and polyadenylation. Bock et al. further describe plasmids directing the production of antithrombin III in yeast.
  • PGK 3-phosphoglycer ate kinase
  • the present inventors have developed an expression vector capable of directing heterologous polypeptide expression at high expression levels for yeast hosts.
  • the present invention provides for expression of many heterologous polypeptides in yeast hosts at minimum levels of one gram per liter of yeast culture, or at least 10% of total yeast cell protein.
  • the present invention provides a means of expressing heterologous peptides in yeast at a level which is termed "ultrahigh" for the purposes of describing the invention herein.
  • a combination of yeast expression elements comprising a vector capable of effecting ultrahigh expression of a heterologous polypeptide in a yeast host.
  • the ultrahigh expression obtained according to the present invention is surprisingly greater than that which would be expected based upon the known effects of the individual elements themselves.
  • a DNA expression system comprising:
  • a hybrid first yeast promoter comprising the functional segment of the regulatory region of a galactose-inducible promoter gene operably linked to the functional segment of the transcription initiation site of a highly expressed yeast gene
  • the DNA expression system of the present invention is useful for expressing many different heterologous polypeptides.
  • the invention provides for a DNA expression system as described above, further comprising, inserted in phase between the signal sequence and the transcription terminator, the functional segment of a DNA sequence encoding a heterologous target polypeptide.
  • the invention provides for yeast hosts transformed with the DNA expression vector of the DNA expression system as described above.
  • the invention provides for a method of producing a heterologous target polypeptide in a yeast host, comprising culturing said yeast host transformed with a DNA expression vector of the DNA expression system as described above, causing expression of said target polypeptide, and recovering said target polypeptide.
  • the DNA expression vector of the DNA expression system described above may be in the form of a plasmid.
  • the DNA sequence comprising the DNA expression vector of the DNA expression system described above may be integrated into yeast chromosomal material.
  • Figure 1 is a flow chart describing the construction of At-III expression vector YpGX228.
  • Figure 2 is a flow chart showing the construction of expression vector YpGX229.
  • Figure 3 is a flow chart showing the construction of M13 vector MGX69.
  • Figure 4 is a flow chart showing the construction of expression vector YpGX235.
  • FIG. 5 shows the organization of the GAL1-10 genes in S. cerevisiae.
  • Figure 6 shows the addition of Hindlll and Xhol sites to the GAL1-10 regulatory region.
  • Figure 7 is a restriction map showing restriction sites in the GAL1-10 regulatory region created by oligonucleotide-directed mutagenesis.
  • Figure 8 is a flow chart showing the addition of a Xhol site to the alpha-factor regulatory region.
  • Figure 9 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the alpha-factor prepro-Lys-Arg-At-III gene.
  • Figure 10 is a flow chart showing the insertion of a GAL upstream activation site adjacent to the alpha-factor prepro-Lys-Arg-At-III gene.
  • Figure 11 is a flow chart showing the insertion of the GAL4 gene into the plasmid YpGx243.
  • Figure 12 shows galactose-regu ⁇ ated expression of At-ill.
  • Figure 13 is a flow chart showing the deletion of alpha-factor Pro-Lys-Arg and addition of a Xhol site to the alpha-factor regulatory region.
  • Figure 14 is a flow chart showing the assembly of an expression vector including the alpha-factor Pre-At-III gene.
  • Figure 15 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the alpha-factor Pre-At-III gene.
  • Figure 16 is a flow chart showing the assembly of a galactose-regulated alpha-factor Pre-At-III gene.
  • Figure 17 is a flow chart showing the addition of the GAL4 gene to the plasmid YpGX246.
  • Figure 18 is a flow chart showing the deletion of the alpha-factor Pre sequence and the addition of a Xhol site to the alpha-factor regulatory region.
  • Figure 19 is a flow chart showing the assembly of a gene encoding the PHO5 signal and the structural gene for At-III.
  • Figure 20 is a flow chart showing the assembly of a yeast-S. coli shuttle vector including the PHO5 signal/At-III gene.
  • Figure 21 is a flow chart showing the assembly of a galactose-regulated PHO5 signal/At-III gene.
  • Figure 22 is a flow chart showing the addition of the GAL4 gene to the plasmid YpGX262.
  • Figure 23 is a flow chart showing the assembly of a gene encoding SUC2 signal-At-III.
  • Figure 24 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the SUC2 signal-At-III gene.
  • Figure 25 is a flow chart showing the assembly of a galactose-regulated SUC2 signal-At-III gene.
  • Figure 26 is a flow chart showing the addition of the GAL4 gene to Y ⁇ GX254.
  • Figure 27 is a flow chart showing the assembly of a gene encoding pre-At-III.
  • Figure 28 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the pre-At-III gene.
  • Figure 29 is a flow chart showing the assembly of a galactose-regulated pre-At-III gene.
  • Figure 30 is a flow chart showing the addition of the GAL4 gene to YpGX264.
  • Figure 31 shows a restriction and functional map of a yeast-E. coli shuttle vector, plasmid YpGX265 GAL4.
  • Figure 32 shows the detection of PHO5 signal-At-III protein by Coomassie staining of an SDS-polyacrylamide gel.
  • DNA expression vector any autonomous element capable of replicating in a host independently of the host's chromosome, after additional sequences of DNA have been incorporated into the autonomous element's genome.
  • DNA expression vectors include bacterial plasmids and phages and yeast plasmids. Plasmids may be single or multi copy, with multi copy plasmids preferred.
  • ultrahigh expression is meant the production of heterologous polypeptide in a yeast host at levels not less than one gram per liter of yeast culture and not less than 10% of total yeast cell protein. It will be appreciated that it may be desirable to control the expression of certain heterologous polypeptides that are toxic to the host's cells at sub-ul- trahigh levels. This may be accomplished, for example, by including within the expression vector a DNA sequence capable of repressing expression in the presence of a factor such as a gene product or metabolite, while maintaining the ability to express at ultrahigh levels in the absence of that gene product or metabolite.
  • nucleotide sequence of interest is in the same reading frame as those nucleotide squences to which the sequence of interest may be operably linked.
  • promoter is meant a DNA sequence generally described as the 5' region of a gene, located proximal to the start codon. At the promoter region, tran scription or expression of an adjacent gene is initiated. This is called the transcription initiation site. Also at the promoter region may be a sequence of nucleotides that interacts with a positive intermediary, thereby exerting positive control over the expression of any operably linked structural gene or genes.
  • a preferred positive intermediary for the purposes of the present invention is the protein produced by the GAL4 structural gene.
  • hybrid yeast promoter the transcription initiation site and the nucleotide sequence which interacts with a positive intermediary are derived from different yeast genes.
  • galactose inducible is meant a structural gene the expression of which is inducible by the presence in the medium of galactose.
  • the regulation of yeast galactose genes is described by Oshima, "Regulatory Circuits for Gene Expression: The metabolism of Galactose and Phosphate," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold Spring Harbor Laboratory, Publisher, New York, pp. 159-180 (1982).
  • GAL1 the Leloir pathway enzymes galactokinase, transferase and epimerase, coded for by genes designated GAL1, GAL7 and GAL10, respectively, and the specific galactose regulatory protein, coded for by the, GAL80 gene.
  • GAL4 protein any DNA sequence capable of binding the GAL4 protein, whether natural or synthetic, and including consensus binding sequences, may be used for the purposes of the present invention and is included within the scope thereof.
  • Specific DNA binding of the GAL4 protein and a near-consensus synthetic oligonucleotide are described in Giniger et al., Cell 40 : 767-774 (1985).
  • GAL1 and GAL10 are herein referred to collectively as GAL1-10.
  • the DNA sequence of the promoter region that interacts with the positive intermediary as described above is also termed the "upstream activation site" (UAS).
  • UAS upstream activation site
  • the upstream activation site of the GAL1-10 gene comprising bases -613 to -158.
  • structural gene is meant a DNA sequence that may be transcribed into mRNA, which mRNA may then be translated into a sequence of amino acids characteristic of a specific peptide.
  • first nucleotide of the first translated codon is numbered +1, and the nucleotides are numbered consecutively with positive integers throughout the translated region of the structural gene and into the 3' untranslated region.
  • the numbering of nucleotides in the promoter and regulatory region 5' to the translated region proceeds consecutively with negative integers.
  • the 5' nucleotide of the promoter and regulatory region adjacent to the first translated nucleotide of the structural gene would be numbered -1.
  • transcription initiation site a DNA sequence of a promoter to which RNA-polymerase binds, thereby initiating transcription. of succeeding codons in a 5' - 3' direction.
  • TIS transcription initiation site
  • a transcription initiation site of a highly expressed yeast gene is used. Those of skill will appreciate that many such highly expressed yeast genes are known, the transcription initiation sites of which are suitable for the purposes of the present invention. Preferred for the present invention is the transcription initiation site of an alpha mating factor gene.
  • the alpha mating factor gene of yeast and yeast mating types are described in Herskowitz et al., "Control of Cell Type in Saccharomyces cerevisiae: Mating Type and Mating-Type Interconver- sion," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccaromyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Publisher, New York, pp. 181-209 (1981); Nasmyth, Ann. Rev. Genet. 16:439-500 (1982).
  • Preferred for the purposes of the present invention is the gene encoding the alpha-1 mating factor (MF-alpha-1).
  • the transcription initiation site of the MF-alpha-1 gene comprising bases -158 to -3.
  • signal sequence is meant that part of the DNA sequence encoding the prepro- or pre-protein, which has a high affinity to biomembranes or special receptor-proteins in biomembranes or which is involved in the transport or translocation of prepro- or pre-protein. These transport or transiocation processes are often accompanied by processing of the prepro- or pre-protein to create the mature form of the protein.
  • Preferred for the purposes of the present invention is a signal sequence derived from the DNA sequence encoding yeast acid phosphatase. Phosphatase genes are described in Oshima, "Regulatory Circuit for Gene Expression: The Metabolism of Galactose and Phosphate," in, J.
  • yeast codons codons containing nucleotide bases that have been observed more frequently than other possible codon triplets to encode particular amino acids in yeast. Preferred yeast codons and their use are described by Holland et al., J. Biol. Chem. 255:2596-2605 (1980).
  • transcription terminator is meant a sequence of DNA, presented at the end of the transcript, that causes RNA polymerase to terminate transcription.
  • Preferred for the purposes of the present invention is the transcription terminator of a yeast glyceralde- hyde-3-phosphate dehydrogenase gene (GAPDH).
  • GAPDH yeast glyceralde- hyde-3-phosphate dehydrogenase gene
  • the GAPDH gene is described in Holland et al., J. Biol. Chem. 254:9839-9845 (1979).
  • Also preferred as a tran scription terminator for the purposes of the present invention is the nucleotide sequence:
  • replicon is meant a unit of genome in which DNA is replicated, and which contains an origin for initiation of replication (replication origin).
  • Preferred replicons for the purposes of the present invention include fragments of the yeast 2 micron plasmid, termed YEp plasmid vectors, but other replicons such as Yip, YRp and YCp may also be used. These are described, for example, in Botstein et al., "Principles and Practice of Recombinant DNA Research with Yeast," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold Spring Harbor Laboratory, Publishers, New York, pp.
  • plasmid pJDB207 is also preferred for the purposes of the present invention.
  • This plasmid is available from commerical sources such as Amersham Corporation, Arlington Heights, 111., 60005.
  • selectable yeast marker is meant a gene conferring upon the cell in which it is contained the ability to grow in a medium which either contains or lacks a particular constituent.
  • a gene conferring ability to grow in the absence of a required nutrient, such as a particular amino acid would act as a selectable marker.
  • this gene may be introduced via, for example, a plasmid.
  • plasmid a gene conferring ability to grow in a medium that lacked the required nutrient.
  • Common selectable yeast markers include LEU2, URA3, TRP1, ARG4 and HIS3 genes. Preferred for the purposes of the present invention is the LEU2 gene. More preferred is the LEU2-d gene. Different markers are used for bacteria such as E. coli. Here, genes are chosen which confer upon the host bacterium resistance to an antibiotic. Commonly employed selectable markers for bacteria are genes conferring resistance to ampicillin and tetracycline. A plasmid that is constructed to contain selectable markers for both yeast and bacteria will be capable of selection in either host. Because such a plasmid is capable of expression in either yeast or bacteria, it is termed a "shuttle vector.” Also preferred for the purposes of the present invention is a selectable yeast maker derived from plasmid pJDB207. This plasmid is available from commerical sources such as Amersham Corporation, Arlington Heights, 111., 60005.
  • target peptide is meant the peptide it is desired to express in the yeast host according to the present invention.
  • the target peptide may be encoded by a structural gene, in which case a mature peptide product would be expressed.
  • the target peptide may comprise the prepro-, pro- or pre- forms of the peptide.
  • the target peptide will be "heterologous” if it is encoded by a DNA sequence that is foreign, i.e., originates from a donor different from the host or is a chemically synthesized gene, and can include a donor of a different species from the host.
  • the heterologous gene codes for a peptide ordinarily not produced by the organism.
  • a "homologous" target peptide is encoded by a DNA sequence originating from the host, which sequence encodes a peptide ordinarily produced by the organism.
  • integrated to yeast chromosomal material is meant that the DNA sequence of interest is caused or allowed to become part of the chromosomal material of the yeast host itself, and is replicated along with host chromosomal replication, as opposed to replicating independently as when the DNA sequence of interest is carried in a DNA expression vector such as a plasmid. Integration may be effected, for example, by employing an integrating vector such as YIp5. YIp5 is described, for example, by Botstein et al., "Principles and Practice of Recombinant DNA Research with Yeast," supra.
  • transformation is meant the aquisition in eukaryotic cells of new genetic markers by incorporation of added DNA. This is the process by which naked DNA is introduced into a cell, resulting in a heritable change.
  • the transformation of yeast is described in Hinnen et al., Proc. Natl. Acad. Sci. USA 75(4):1929-1933 (1978).
  • the present invention provides for a DNA expression vector which can be used to express many heterologous proteins at ultrahigh expression levels of no less than 1 gram per liter of yeast culture or at least 10% of total yeast cell protein.
  • the hybrid yeast promoter was composed of elements from two naturally occuring yeast promoters.
  • the transcription initiation site was derived from the MF-alpha-1 gene.
  • An upstream activation site derived from the regulatory region of the yeast GAL1-10 gene was utilized in place of the MF-alpha-1 upstream activation site.
  • Use of the GAL1-10 upstream activation site permits tightly regulated expression of the MF-alpha-1 transcription initiation site by metabolites such as glucose and galactose.
  • the hybrid yeast promoter was carried on a yeast-S.
  • coli shuttle vector derived from the plasmid pJDB207. Beggs, "Multiple-Copy Yeast Plasmid Vectors," in, D. von Wettstein et al., eds. Molecular Genetics in Yeast, Alfred Benzon Symposia, vol. 16, pp. 383-389 (1981). Because this shuttle vector carries the combination of a yeast 2 micron plasmid replication origin and the LEU2-d selectable yeast marker, plasmid copy number is very high in yeast (up to about 200 copies per haploid cell). Using this vector, however, it was found that target peptide expression directed by the hybrid GAL1-10/MF-alpha-1 promoter was limited.
  • the GAL4 protein encoded by the GAL4 gene, is a positive regulatory protein for the yeast galactose system. It has been shown that this protein binds to the GAL1 upstream activation site and is required for high level regulated expression of the GAL1 gene. The amount of GAL4 protein is normally very low in the yeast cell. Laughon et al., Proc. Natl. Acad. Sci. USA 79 : 6827-6831 (1982). Inclusion of the GAL4 structural gene in the DNA expression vector apparently increased the amount of GAL4 protein in the cell and enhanced expression directed by the plasmid-born hybrid promoter.
  • the plasmid of this embodiment carries a synthetic yeast transcription terminator designed from a yeast GAPDH gene.
  • the synthetic DNA sequence was designed by the present inventors employing convenient restriction endonuclease recognition sites to facilitate DNA manipulations. The use of restriction endonucleases and associated molecular biology techniques are described in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Publisher, New York (1982).
  • a signal sequence derived from the yeast PHO5 gene was inserted between the hybrid promoter and the start of the coding sequence of the target peptide.
  • the signal sequence employed was designed from the yeast PHO5 gene and comprised a synthetic DNA sequence, such that the codon selection was based on preferred yeast codons rather than the naturally occuring PHO5 signal sequence.
  • the invention comprises a DNA expression system comprising a DNA expression vector prepared as follows:
  • a novel hybrid promoter that includes the efficient transcription initiation site (including bases -158 to -1) of the MF-alpha-1 gene, Kurjan et al., Cell 30: 933-943 (1982), and a GAL4 binding site derived from the GAL1-10 regulatory region. Citron et al., J. Bacteriol. 158:269-278 (1984), including bases -610 to -157.
  • This hybrid regulatory region was constructed by placing a Xhol restriction endonuclease site at base number -158 preceding the ATG translational start of the MF-alpha-1 gene, and Hindlll and Xhol restriction sites at bases -610 and -157 of the GAL1-10 regulatory region, respectively.
  • a PHO5 (Arima et al., Nucleic Acids Res. 11:1657-1672 (1983)) signal encoding sequence derived from synthetic DNA, substantially comprising preferred Saccharomyces codons rather than the natural coding sequence.
  • the synthetic DNA sequence encoding this signal is:
  • Yeast and E. coli replicating origins and selectable markers derived from plasmid pJDB207 Beggs, J.D. "Multiple-copy yeast plasmid vectors," in, Alfred Benzon Symposium 16, Molecular Genetics in Yeast, Von Wettstein, D. et al., eds., Munksgaard, Copenhagen, pp. 383-389 (1981).
  • the yeast replication origin derived from the 2 micron plasmid and the LEU2-d gene permit especially high plasmid copy number in Saccharomyces (up to 200 copies per cell).
  • Restriction sites are situated between the PHO5 signal encoding sequence and GAPDH transcription terminator for insertion of foreign genes.
  • Vector YpGX227 is a yeast-E. coli shuttle vector.
  • E. coli the replication origin and ampicillin resistance encoding sequences for plasmid pBR322 are present.
  • the S. cerevisiae LEU2 gene permits selective maintenance of the plasmid in yeast hosts with defects in the chromosomal LEU2 gene, and also permits integration of the plasmid sequences into host chromosomal DNA.
  • Vector YpGX227 includes the S. cerevisiae alphafactor (MF-alpha-1) promoter and, sequences encoding the pre, pro, and first spacer. Kurjan et al., U.S. Patent No. 4,546,082. At the end of the first spacer encoding sequence is a naturally occuring Hindlll restriction site. The strategy for constructing the alpha-factor/At-III expression vector utilized that Hindlll site.
  • GPDH yeast glyceraldehyde-3-phosphate dehydrogenase
  • the first step in the vector construction was to place a Hindlll restriction site at the 5' end of the cloned At-III DNA sequence.
  • This Hindlll site was created by oligonucleotide-directed in vitro mutagenesis (Zoller et al., Meth. Enzymol. 100 : 468-500 (1983)) of the At-III sequence derived from the Escherichia coli plasmid pGXl755 ( Figure 1). Flanking the O L /P s -At-III region are unique EcoRI and Hindlll restriction sites.
  • the EcoRI-Hindlll restriction fragment containing the O L /P R promoter and the At-III gene was first isolated from the pGXl755 and then ligated to EcoRI/Hindlll-digested M13mp8. This ligation generated the M13 vector MGX64 ( Figure 1), and single-stranded MGX64 DNA was prepared following transfection of E. coli strain JM109.
  • a 39-base oligonucleotide was utilized to insert a nine-base pair sequence including a Hindlll site and a trp codon at the 5' end of the At-III sequence in MGX64. Addition of two G residues following. the Hindlll site was necessary to create an in-frame fusion with the alpha-factor secretory sequences. This insertion created vector MGX65 which has the following sequence at the 5' end of At-III:
  • At-III sequence was excised from MGX65 as a Hindlll fragment and ligated into the alpha-factor expression vector YpGX227 generating vector YpGX228 ( Figure 1).
  • Vector YpGX228 carries the yeast LEU2 gene, which can be used as a selectable marker for transformation, but it does not contain a Saccharomyces origin of replication. Transformation with this plasmid therefore results in integration of the alpha-factor/At-III sequence into a yeast chromosome.
  • the 3' end of the At-III sequence has a long transcribed, non-translated region. It has been observed that heterologous gene expression in yeast can sometimes be enhanced by positioning a yeast transcription terminator near the end of the protein coding region. Mellon et al., Gene 24:1-14 (1983).
  • the 3' end of the AT-III DNA sequence was therefore modified by creating a BamHI restriction site immediately 3' of the TAA translation termination codon.
  • the BamHI site was created by oligonucleotide- directed mutagenesis using MGX64 single-stranded DNA as a template and a 36-base oligonucleotide.
  • the resulting vector, MGX66 shown in Figure 2, has the 3' DNA sequence shown below.
  • This BamHI restriction site can be used to link the At-III DNA sequence to the yeast glyceraldehyde-3- phosphate dehydrogenase (GAPDH) transcription termination sequence present in the alpha-factor expression vector YpGX227 ( Figure 2).
  • GPDH yeast glyceraldehyde-3- phosphate dehydrogenase
  • At-III The 5' portion of At-III was purified from MGX65 as a Hindlll-PstI restriction fragment, while the 3' portion was purified from MGX66 as a Pstl-BamHI restriction fragment.
  • the alpha-factor expression vector YpGX227 was cleaved with Hindlll and BamHI, treated with calf alkaline phosphatase, and used in a three- way ligation with the At-III fragments from MGX65 and MGX66.
  • This ligation produced vector YpGX229 ( Figure 2) in which the alpha-factor-At-III coding sequence is flanked by the alpha-factor promoter at the 5' end and the GAPDH transcription terminator at the 3' end. Because YpGX229 is derived from YpGX227, it can be used to integrate the alpha-factor/At-III sequence into a yeast chromosome.
  • alpha-factor/At-III expression vectors designated YpGX228 and YpGX229 were constructed that encode an alpha-factor prepro-lys-arg-glu-ala-glu-ala- trp-At-III.
  • the alpha-factor/At-lll DNA sequence from YpGX229 was chosen for further modification because it lacks the At-III 3' untranslated region and contains the GAPDH transcription terminator.
  • the YpGX229 alpha-factor/At-III DNA sequence was excised as a Sall fragment, and ligated into Sall-digested, calf alkaline phosphatase-treated M13mp9 (commercially available), generating the M13 vector MGX68 ( Figure 3).
  • the MGX68 single-stranded template and a 35-base oligonucleotide were then used to delete the 15-base pair sequence containing the glu-ala-glu-ala-trp codons, which separate, the alpha-factor spacer, lys-arg, from mature At-III.
  • the deleted vector was designated MGX69 ( Figure 3) and the expected sequence was confirmed by DNA sequence analysis.
  • the alpha-factor/At-III DNA sequence from MGX69 was then used to construct expression vector, Y ⁇ GX235.
  • the alpha-factor/At-III sequence was excised from MGX69 as a Hindlll-Bglll fragment which was ligated to Hindlll-BamHl digested pJDB207 ( Figure 4) (Bglll and BamHI generate the same 5' single-stranded ends).
  • the alpha-factor/At-III expression vector YpGX235 was introduced by transformation into several yeast host strains. These included both MAT (Mating Type) a and MAT alpha strains. However, efficient transformation was observed only when MAT a hosts were transformed. (Although when MAT-alpha cells were transformed with YpGX235, small colonies were observed microscopically, they stopped growing before visible colonies were seen.) The most obvious explanation for the inability to isolate viable YpGX235 transformants of MAT alpha cells is that the AT-III expression levels from YpGX235 are high enough to be lethal to the cells. In MAT a hosts, it is expected that alpha-factor-directed expression would be considerably lower than that in MAT alpha hosts.
  • the GALl-10 regulatory region In order to tightly regulate expression of the gene encoding alpha-factor prepro-lys-arg-At-III, the upstream activation site (UAS) of the GAL1-10 regulatory region was positioned 5' of the alpha-factor transcription initiation site (TIS) present in vector MGX69.
  • the GAL1 and GAL10 genes are located within 560 base pairs of each other on chromosome II of Saccharomyces, but are transcribed from opposite strands ( Figure 5). Sequences within the 560-base pair intergene region include the GAL1 and GAL10 TIS and UAS sequences. The UAS specifically determines the regulated expression of the GAL1 and GAL10 genes in response to galactose.
  • Oshima "Regulatory Circuit for Gene Expression: The Metabolism of Galactose and Phosphate," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Publisher, New York, pp. 159-180 (1982), describes the regulation of galactose metabolic genes in yeast. The current hypothesis is that the UAS sequences preceding each gene bind a positive regulatory protein encoded by the GAL4 gene. A negative regulatory protein encoded by the GAL80 gene is also involved in the control of galactose gene expression.
  • the GAL4 and GAL80 proteins form a complex that prevents binding of the GAL4 protein to the UAS sequences, and therefore no active transcription of the GAL genes occurs.
  • the GAL4-GAL80 protein complex dissociates, releasing the GAL4 protein which can then bind to the GAL UAS sequences to stimulate active transcription of the GAL1 and the GAL10 genes.
  • the effects of perturbations of the system such as inactivation of the GAL80 protein by mutation or boosting the level of GAL4 protein by recombinant DNA techniques, have been examined. Johnston et al., Proc. Natl. Acad. Sci.
  • the GAL1-10 UAS region previously has been utilized successfully to regulate expression of another yeast gene, CYC1, with galactose. Guarante et al., Proc. Natl. Acad. Sci. USA 79: 7410-7414 1982). In addition, results have been published that more specifically define the GAL1-10 UAS sequences Ginigen et al., Cell 40: 767-774 1985).
  • An M13 vector carrying the GAL1-10 regulatory region, MGX14 ( Figure 6), was assembled by ligating a HincII-EcoRI GAL1-10 fragment to Hincll- and EcoRI- digested M13mp9.
  • the Hincll and EcoRI sites in MGX14 are located in the 201st and 45th codons of the GAL1 and GAL10 genes, respectively.
  • the A in the ATG translation initiation codon of GAL1 is defined as +1 and the preceding base as -1.
  • this vector, MGX400 served as the template for a third mutagenesis, in which five base pairs were inserted using a 36-base oligonucleotide primer to create a Hindlll restriction site at position -610.
  • the final vector, MGX402 thus contains two new Xhol sites and one new Hindlll site.
  • the GAL UAS region can be conveniently excised from MGX401 either as an Xhol-Xhol or Xhol-Hindlll restriction fragment. A summary of these new restrictions sites and their location in the GAL1-10 region is depicted in Figure 7.
  • the regulatory region of the alpha-factor gene (MF-alpha-1) is not as well defined as is the GAL1-10 regulatory region. Nevertheless, the present inventors were able to predict the approximate locations of the alpha-factor UAS and TIS.
  • the mating type-regulated alpha-factor prepro-lys-arg-At-III gene had previously been cloned into M13. That vector, MGX69, was used as a template for the insertion of a Xhol restriction site at position -158 relative to the ATG start codon ( Figure 8). This new Xhol site permitted the alpha-factor UAS to be conveniently separated from the alpha-factor TIS. Construction of the galactose- regulated alpha-factor prepro-lys-arg-At-III gene in a yeast-E. coli shuttle vector
  • the GAL1-10 UAS and alpha-factor prepro-lys-arg- AT-III gene were then joined in yeast-E. coli shuttle vector pJDB207.
  • This vector includes the yeast 2 micron replication origin and the LEU2-d gene which allows selection for high-copy number in Saccharomyces.
  • the first step in this construction involved introduction of the alpha-factor prepro-lys-arg-At-III gene from MGX96 into pJDB207 ( Figure 9).
  • the GAL1-10 UAS was excised from MGX402 on a 1,200-bp Hindlll fragment which was then gel-purified and cleaved with Xhol.
  • YpGX239 was digested with Hindlll and Xhol and the large vector fragment was gel-purified.
  • the Hindlll-Xhol fragments were then ligated to generate YpGX243.
  • yeast cells transformed with YpGX243 have a hundred-fold more GAL UAS sequences in comparison with the non-transformed host cell, the GAL4 levels might not be sufficient to efficiently promote expression of both the chromosomal GAL genes and the plasmid-encoded galactose-regulated At-III gene.
  • the GAL4 gene has been cloned on plasmid pSJ3 (Johnston et al., Proc. Natl. Acad. Sci. USA 79: 6971-6975 (1982) ayeast-E. coli shuttle vector.
  • the approach was to directly insert the GAL4 gene into plasmid YpGX243 ( Figure 11).
  • the GAL4 gene from pSJ3 was excised as a Hindlll fragment and ligated to the unique Hindlll site of plasmid YpGX243.
  • the resulting vector, YpGX243GAL4 was used to transform S. cerevisiae strain G20. These strains then had the same number of copies of the GAL4 gene and the galactose-regulated alpha-factor prepro-lys-arg-At-III gene.
  • yeast strain 422 which carries chromosomal mutations both in the LEU2 and URA3 genes, was transformed with both plasmids (YpGX243 and pSJ3). This approach also yielded enhanced GAL4 product and increased AT-III expression.
  • SHY1 ATCC Accession No. 44769.
  • An expression vector that includes the alphafactor pre-At-III gene was assembled by excising the alpha-factor pre-At-III gene from MGX92 as a Hindlll-BglII fragment and ligating it with pJDB207 which had been cleaved with BamHI and Hindlll and treated with calf alkaline phosphatase ( Figure 14).
  • the resulting vector, YpGX241, is identical to YpGX235 with the exception that the alpha-factor pro-lys-arg sequence is deleted.
  • a galactose-regulated version of this gene was generated in two steps ( Figures 15 and 16).
  • MGX403 was cleaved with Hindlll and Bglll and ligated with BamHI- and Hindlll-digested, calf alkaline phosphatase-treated pJDB207 to generate YpGX245 ( Figure 15).
  • the GAL1-10 UAS was then inserted into YpGX245 by digesting with Hindlll and Xhol, isolating the large vector fragment, and ligating this fragment with the Xhol-Hindlll GAL1-10 UAS fragment from MGX402 ( Figure 15).
  • the newly assembled vector was designated YpGX246.
  • the GAL4 gene was then added to YpGX246 by isolating it from pSJ3 as a 3.65-kb Hindlll fragment and ligating that fragment with Hindlll-digested, calf alkaline phosphatase-treated YpGX246 ( Figure 17).
  • the newly assembled vector was designated YpGX246GAL4.
  • the 57-base pair alpha-factor pre sequence was deleted from MGX92 using a 36-base oligonucleotide primer ( Figure 18).
  • the resulting vector carrying the desired met-AT-III gene was designated MGX404.
  • a Xhol site was inserted at position -158 relative to the start of the MF-alpha-1 gene of MGX404 by oligonu- cleotide-directed mutagenesis, generating MGX408.
  • At-III protein expression 10-30 mg per liter of culture
  • the inventors positioned other signal encoding sequences at the 5' end of the gene (directly 5' to the mature At-III coding sequence) to determine whether other sequences in the translation initiation region might improve translation efficiency of mRNA encoded by these vectors.
  • the signals utilized included those encoded by the yeast PHO5 and SUC2 genes, and the natural At-III signal.
  • the PHO5 signal is comprised of 17 amino acids (including the methionine initiation codon). Since insertion of the entire PHO5 signal-coding sequence requires 48 nucleotides, we performed two consecutive mutageneses to complete this construction. Starting with single-stranded template DNA from vector MGX408 ( Figure 19), a mutagenesis was performed using a 54 base oligonucleotide to insert the coding sequence for the 8 C-terminal amino acids of the PHO5 signal. The mutagenized vector was screened with the mutagenic oligonucleotide by hybridization and putative positive clones were analyzed by DNA sequencing. A vector carrying the desired sequence was designated MGX425 ( Figure 19).
  • Single-stranded template prepared from this vector was mutagenized using a 54 base oligonucleotide to insert the N-terminal portion of the PHO5 signal-coding sequence. Positive clones were again screened by hybridization and the correct sequence was confirmed by DNA sequencing.
  • the new vector (MGX428) contains the PHO5 signal ( Figure 19). The presence of the entire PHO5 signal was confirmed by DNA sequence analysis.
  • the DNA fragment encoding the PHO5 signal fused to mature At-III was excised from double-stranded MGX428 DNA using Hindlll and Bglll restriction endonucleases ( Figure 20). The fragment was then inserted into the yeast-E. coli shuttle vector YpGX243 which had been digested with Hindlll and BamHI and treated with calf alkaline phosphatase (CAP). Ligation of the isolated At-III fragment from MGX428 with the prepared plasmid YpGX243 generated vector YpGX261 ( Figure 20). This vector contains all of the elements necessary to produce At-III in yeast using the MF-alpha-1 promoter.
  • the MF-alpha-1 UAS was replaced with the UAS derived from the GAL1-10 regulatory region.
  • the MF-alpha-1 UAS was excised from YpGX261 as a Hindlll-Xhol restriction fragment ( Figure 21) and the plasmid was treated with calf alkaline phosphatase. The large vector fragment was then gel-purified.
  • the GAL1-10 UAS was isolated from plasmid YpGX243 by digesting that vector with restriction endonucleases Hindlll and Xhol and gel purifying the small fragment.
  • the GAL4 gene was excised from plasmid YpGX243GAL4 as a Hindlll restriction fragment ( Figure 22) and the gel-purified 3.65 kb fragment was ligated with Hindlll-linearized, calf alkaline phosphatase-treated YpGX262.
  • the new plasmid, YpGX262GAL4 was utilized to express the gala- tose-regulated PHO5 signal-At-III sequence in yeast.
  • the expression/secretion vectors encoding the other signal sequences were generated in a very similar manner to that described for the PHO5 signal. The main difference was the number of rounds of oligonucleotide-directed mutagenesis used to create the desired signal sequence.
  • a cDNA gene encoding antithrombin-III protein is prepared as described by Bock et al. (U.S. Patent No. 4,157,294) and is cloned into an E. coli plasmid such as pTA2.
  • the AT-III cDNA coding sequence is excised from pTA2 as an EcoRI-PstI fragment.
  • a limited PstI digest permits isolation of molecules which have not been digested within the At-III coding sequence.
  • Double-stranded phage M13mpl8 DNA is digested with restriction endonucleases EcoRI and PstI, and the large vector fragment is gel purified. This DNA molecule is ligated with the EcoRI-PstI At-III cDNA and, following transformation of E. coli M13, plaques con- taining the recombinant DNA molecules are identified by restriction digest analysis.
  • oligonucleotide directed mutagenesis Zoller et al., Ann. Rev. Genetics 19:423-462 (1985)
  • a restriction endonuclease recognition site for BamHI is inserted immediately after the TAA codon.
  • a suitable oligonucleotide to prime this mutagenesis is:
  • the mutagenized molecules containing the new BamHI site are identified by digesting double-stranded DNA with BamHI and determining which molecules are linearized. The presence and proper positioning of the BamHI site is confirmed by DNA sequence analysis. Sanger, Science 214:1205-1210 (1981)). This M13 vector is called M13At-2.
  • double-stranded M13At-2 DNA is digested with EcoRI and SacII, and the large vector fragment is gel purified.
  • the 5' coding region of At-III and a Smal site are then added by ligating the gel purified M13At-2 DNA with two oligonucleotides which have been annealed. Suitable oligonucleotides for this purpose are:
  • phage molecules carrying the inserted oligonucleotides are identified by hybridization and the sequence is confirmed by DNA sequence analysis.
  • the vector so prepared is M13-At-3.
  • the At-III cDNA molecule is excised from M13At-3 using the Smal and BamHI restriction sites and reintroduced by ligation into M13mp18 which has been digested with Smal and BamHI.
  • the new M13 vector is M13At-4. Double-stranded M13At-4 is digested with Smal. The DNA is then digested with Hindlll and the At-III-containing fragment is gel purified.
  • yeast upstream activation site (UAS) and transcription initiation site (TIS), and PHO5 signal encoding region are removed from vector YpGX265GAL4 (Deposited as ATCC # 67233) ( Figure 31) by digesting with Hindlll and EcoRV and the fragment is gel purified. This fragment is ligated with the previously prepared M13At-4 DNA and Hindlll linearized M13mpl8 DNA in a three-way ligation. Following transformation of E. coli vector molecules carrying the At-III sequence in phase with yeast signal sequence are identified by restriction digestion.
  • an oligonucleotide directed mutagenesis is performed to delete those bases.
  • a suitable oligonucleotide to prime this mutagenesis is:
  • YpGX255GAL4 is digested with Hindlll to excise the GAL4 gene, which is then gel purified and saved.
  • the plasmid fragment is then digested with BamHI and the large vector fragment is gel purified. This fragment is then ligated with the purified M13-At-5 BamHI- Hindlll fragment.
  • the desired plasmid is identified by restriction endonuclease analysis and is called YpGX262.
  • YpGX262 is linearized with enzyme Hindlll and treated with calf alkaline phosphatase.
  • the Hindlll GAL4 fragment is ligated with the Hindlll-linearized calf alkaline phosphatase-treated YpGX262.
  • YpGX262GAL4 Following transformation of E. coli, recombinant DNA molecules carrying the GAL4 gene are identified.
  • the vector is called YpGX262GAL4.
  • M13mp9 (commercially available) is digested with enzymes BamHI and Hindlll and gel purified.
  • YpGX262 is digested with Hindlll and BamHI and the fragment carrying the UAS, TIS, signal and At-III is gel purified. These two DNA fragments are ligated and E. coli is transformed.
  • the desired vector, MGX428' is iden tified by restriction analysis of double-stranded DNA. Single-stranded template MGX428' DNA is prepared and oligonucleotide directed mutagenesis is performed to delete the PHO5 signal encoding sequence.
  • a suitable oligonucleotide to prime this mutagenesis is:
  • Mutant clones are identified by probing with an oligonucleotide of this sequence, which recognizes the boundaries on either end of the PHO5 signal encoding sequence. Successful completion of the mutagenesis is confirmed by DNA sequence analysis.
  • the new vector is MGX408'. This vector carries the coding sequence for methionine-At-III.
  • Template DNA is prepared from MGX408' in preparation for oligonucleotide directed mutagenesis.
  • the SUC2 signal sequence is inserted at the 5' end of the At-III gene in two consecutive insertion mutageneses.
  • An appropriate oligonucleotide for the first step has the sequence
  • This oligonucleotide is used as the primer for oligonucleotide directed mutagenesis to insert the C terminus of the SUC2 signal encoding sequence.
  • the mutagenic oligonucleotide is then labeled with 32 P and used as a probe to screen M13 plaques for the presence of the insertion. The sequence is confirmed by DNA sequence analysis.
  • the desired mutant clone is called MGX419'.
  • Single-stranded MGX419' template DNA is prepared and used in a second round of mutagenesis in which the remaining coding sequence for the SUC2 is inserted.
  • the oligonucleotide used to prime this mutagenesis is
  • the mutagenic oligonucleotide can then be labeled with 32 P and used to detect mutant clones by hybridization screening. Molecules which are positive in this hybridization screen are then analyzed by DNA sequence analysis to confirm the successful mutagenesis.
  • the new vector, MGX420' carries the entire coding sequence for the SUC2 signal linked to the AT-III coding sequence.
  • the UAS, TIS, signal coding sequence, and At-III coding sequence are excised from double-stranded MGX420' DNA with restriction endonucleases Hindlll and BamHI and purified by gel electrophoresis.
  • YpGX262 is digested with enzymes BamHI and Hindlll and the large vector fragment is gel purified. A ligation is performed with these two DNA fragments and S. coli is then transformed. The E. coli transformants are then screened by restriction digest analysis for insertion of the DNA fragment from MGX420'.
  • the desired plasmid is called YpGX254.
  • YpGX254 is digested with Hindlll and then treated with calf alkaline phosphatase.
  • the Hindlll fragment from YpGX265GAL4 carrying the GAL4 gene is then inserted into this vector by ligation and E. coli cells are transformed.
  • the desired plasmid is identified by restriction digest analysis and is called YpGX254GAL4.
  • Template DNA is prepared from MGX408' for use in oligonucleotide directed mutagenesis.
  • the At-III signal sequence as determined by Bock et al. (U.S. Patent No. 4,517,294) is inserted at the 5' end of the At-III gene in three consecutive insertion mutageneses.
  • An appropriate oligonucleotide for the first step has the sequence.
  • This oligonucleotide is used as the primer for oligonucleotide directed mutagenesis to insert the C terminus of the At-III signal encoding sequence.
  • the mutagenie ologonucleotide is then labeled with 32 P and used as a probe to screen M13 plaques for the presence of the insertion. The sequence is confirmed by DNA sequence analysis.
  • the desired mutant clone is called
  • Single-stranded MGX429' template DNA is prepared and used in a second round of mutagenesis in which the coding sequence for the middle of the At-III signal is inserted.
  • the oligonucleotide used to prime this mutagenesis is
  • the mutagenic oligonucleotide can then be labeled with 32 P and used to detect mutant clones by hybridization screening. Molecules which are positive in this hybridization screen are then analyzed by DNA sequence analysis to confirm the successful mutagenesis.
  • the new vector, MGX430' carries approximately two-thirds of the At-III signal coding sequence linked to the mature At-III coding sequence.
  • Template DNA is prepared from MGX430' and used in a mutagenesis with an oligonucleotide which provides the remaining coding sequence for the At-III signal N-terminus.
  • the oligonucleotide has the sequence:
  • the promoter, signal coding sequence, and mature At-III coding sequence are excised from double-strand ed MGX431' DNA with restriction endonucleases Hindlll and Bam HI and purified by gel electrophoresis.
  • YpGX262 is digested with enzymes BamHI and Hindlll and the large vector fragment is gel purified. A ligation is performed with the DNA fragments and E. coli is then transformed. The E. coli transformants are then screened by restriction digest analysis for insertion of the DNA fragment from MGX431'. The desired plasmid is called YpGX264.
  • YpGX264 is digested with Hindlll and then treated with calf alkaline phosphatase.
  • the Hindlll fragment from YpGX265GAL4 carrying the GAL4 gene is then inserted into this vector by ligation and E. coli cells are transformed.
  • the desired plasmid is identified by restriction digest analysis and is called YpGX264GAL4.
  • Template DNA is prepared from MGX408' in preparation for oligonucleotide directed mutagenesis.
  • a proline codon is inserted between the methionine initiation codon and the mature At-III coding sequence.
  • An appropriate oligonucleotide for this step has the sequence
  • the desired mutant clone is called MGX423'.
  • the promoter, signal coding sequence, and At-III coding sequence are excised from double-stranded MGX423' DNA with restriction endonucleases Hindlll and BamHI and purified by gel electrophoresis.
  • YpGX262 is digested with enzymes BamHI and Hindlll and the large vector fragment is gel purified.
  • a ligation is performed with these two DNA fragments and E. coli is then transformed.
  • the E. coli transformants are then screened by restriction digest analysis for insertion of the DNA fragment from MGX423'.
  • the desired plasmid is called YpGX256.
  • YpGX256 is digested with Hindlll and then treated with calf alkaline phosphatase.
  • the Hindlll fragment from YpGX265GAL4 carrying the GAL 4 gene is then inserted into this vector by ligation and E. coli cells are transformed.
  • the desired plasmid is identified by restriction digest analysis and is called YpGX256GAL4.
  • yeast strains such as D8.
  • Appropriate strains for these studies are ones which have nuclear mutations in the S. cerevisiae LEU2 gene.
  • ATCC strain # 44769 for example, is appropriate for this purpose.
  • the transformed yeast strains are maintained on a medium composed of 0.7% yeast nitrogen base, 10% glucose (YNBD10) plus appropriate nutritional supplements, if required.
  • the transformed cells are transferred to a medium composed of yeast extract (1%), peptone (2%), glucose (1%), galactose (1%) and grown for 1-2 days at 30°C with shaking.
  • yeast extract 1%
  • peptone 2%
  • glucose 1%
  • galactose 16%
  • the cells can be grown to high density using only glucose as the carbon source, and as the glucose is exhausted expression of the foreign protein will commence.
  • a third method used to induce expression of the protein product is as follows.
  • the cells were inoculated into culture medium composed of yeast nitrogen base (0.7%) and 2% glucose. These cells were grown for approximately 16 hours at 30°C with shaking.
  • Soluble At-III protein was determined by radioimmunoassay. the protein level is expressed as milligrams per liter of yeast culture. Western blot analysis of insoluble and soluble At-III produced by these strains indicated that about 10% of the At-III was soluble.
  • the cells were then pelleted by centrifugation and resuspended to the original volume in medium composed of yeast extract 1%, peptone (2%) and glucose (2%). the cells were grown for approximately 24 hours at 30°C with shaking. These cells were then pelleted by centrifugation and resuspended to the original volume in medium composed of yeast extract (1%), peptone (2%) and galactose (2%) and grown for approximately 24 hours at 30°C with shaking. The cells were pelleted by centrifugation and then broken by vortexing with glass beads in a buffer composed of 25mM Tris, 125mM EDTA, pH 8.4.
  • this protein fraction from strain DB(YpGX262GAL4) was examined by SDS-poly- acrylamide gel electrophoresis according to the method of Lemmiae, Nature 227:680-635(1970). Samples from cells grown in YPD (no galactose induction) or YPGal (galactose induced) were compared. As can be seen in Figure 32, following staining of the gel with Coomassie brilliant blue, a prominent band of antithrombin III protein appeared only in the induced sample. This protein routinely composed 25-50% of the total yeast insoluble protein observed by this method.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A DNA sequence comprising, in phase: (a) a hybrid first yeast promoter comprising the functional segment of the regulatory region of a galactose-inducible promoter gene operably linked to at least a portion of the transcription initiation site of an alpha mating factor gene; (b) the functional segment of a signal sequence, said signal sequence comprising mainly preferred yeast condons; (c) the functional segment of a DNA sequence encoding a transcription terminator; (d) a replicon; (e) the functional segment of DNA sequence encoding a selectable yeast marker; and (f) the functional segment of the DNA sequence being operably linked to the functional segment of a DNA sequence encoding a second yeast promoter. DNA expression vectors containing this sequence, yeast hosts transformed with said expression vector, and method of producing a heterologous target peptide in yeast hosts employing said DNA expression vectors. By means of the invention ultrahigh (greater than 1 gram/liter, or at least 10 % of total yeast cell protein) expression of heterologous polypeptides may be affected.

Description

TITLE OF THE INVENTION:
COMPOSITE YEAST VECTORS
BACKGROUND OF THE INVENTION Field of the Invention
The present invention relates to a method of expressing genes in yeast. More particularly, the invention relates to a method of expressing foreign genes in yeast. The invention further relates to composite DNA expression vectors capable of effecting ultrahigh expression of a polypeptide in a yeast host, yeast cells transformed by the DNA expression vector, use of the DNA expression vector to effect ultrahigh expression of a target polypeptide, and to target polypeptide products produced by yeast cells transformed by the DNA expression vectors.
Background of the Invention
The culture of various yeast strains has long been of great practical and economic importance. A description of commonly used yeasts and their characteristics may be found in Remington's Pharmaceutical Sciences, 16th Edition, A. Osol, ed., Mack Publishing Co., Easton, Penn., pp. 1276-1277 (1980). Large scale culture of this eukaryotic organism on an industrial scale is well known. Burrow, "Baker's yeast," p. 349-420, in, The Yeast, vol. 3, Rose and Harrison, eds., Academic Press, London (1970), and it has been suggested that existing know-how and technologies of large scale yeast culture might be advantageously adapted to the production of polypeptides. Loison et al., Bio/Technology 4:433-437 (1986). In addition, the use of yeasts such as Saccharomyces as hosts for expressing mammalian and other foreign proteins offers advantages lacking in more commonly used prokaryotic hosts such as Escherichia coli. For example, yeasts are capable of glycosylation while prokaryotic hosts such as E. coli are not. S. cerevisiae is generally regarded as safe by the United States Food and Drug Administration. The genetic system of S. cerevisiae has been well-defined. See, e.g., Mortimer et al., "Genetic Mapping in Saccharomyces cerevisiae," in, The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Strathern et al., eds.. Cold Spring Harbor Laboratory, New York, pp. 11-26 (1981). The principles controlling gene expression in S. cerevisiae are also well characterized. See generally, Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold Spring Harbor Laboratory, New York (1982). Saccharomyces has thus recently been used to express such foreign polypeptides as hepatitis B, Valenzueia et al., Nature 298:347-350 (1982); Miyanohara et al., Proc. Natl. Acad. Sci. USA .80:1-5 (1983); Hitzeman et al., Nucleic Acids Res. 11: 2745-2763 (1983); McAleer et al.. Nature 307:178-180 (1984), interferons, Tuite et al., EMBO J. 1:603-608 (1932), calf chymosin, Mellor et al.. Gene 24:1-14 (1983), epidermal growth factor, ϋrdea et al., Proc. Natl. Acad. Sci. USA 80: 7461-7465 (1983), and calf prochymosin, Smith et al., Science 229:1219-1224 (1985).
In spite of the advantages of using a yeast such as Saccharomyces as an expression host, production of heterologous polypeptides generally has been disappointingly low as compared to that of the normal homologous gene products. Chen et al.. Nucleic Acids Res. 12 :8951-8970 (1984). Many investigators have sought to increase expression of proteins, especially of heterologous proteins, in yeast hosts by employing in an expression vector various components and combinations thereof that might be expected to increase heterologous protein expression because they are thought to strongly express homologous gene products in yeasts. Generally, these expression vectors have included a strong yeast promoter to direct transcription, a yeast sequence to terminate transcription, and a replication origin and selectable marker to maintain the plasmid in the host cell. The promoter and terminator sequences have generally been chosen from highly expressed yeast genes. Promoter sequences often have been selected based on their ability to tightly regulate expression of the foreign product which sometimes is toxic to the host cell.
For example, European Patent Application No. 84303833.2 (Pub. No. 0 128 743 A2) discloses a cloning vector containing a foreign gene and the yeast galactokinase (GAL1) regulatory region and promoter in position to regulate the expression of the foreign gene. This system was used to produce a galactokin- ase-bovine prochymosin fusion protein in S. cerevisiae. Also disclosed is the use of increased copy number for the GAL4 gene, known to enhance messenger RNA levels of the galactose metabolic genes in yeast, (Laughon et al., Proc. Natl. Acad. Sci. USA 79:6827-6831 (1982)), by isolating the GAL4 gene from yeast DNA and inserting it into a plasmid which contains the GAL1 regulatory region and promoter as well as the foreign gene.
European Patent Application No. 84101937.5 (Pub. No. 0 123 811 A2) discloses use of a GAL1 promoter of the yeast galactokinase gene in expressing a desired protein. The GAL1 promoter used was a DNA segment containing the transcription start signal for galactokinase in S. cerevisiae.
European Patent Application No. 84302723.6 (Pub. No. 0 123 544 A2 ) discloses use of the promoter and signal peptide portions of the yeast alpha-factor gene joined to the sequence encoding the desired heterologous protein. This system was used to express human interferon gamma, human serum albumin, bovine interferon alpha-1 and alpha-2, tissue plasminogen activator, rennin and a human insulin-like growth factor.
PCT Application No. WO 86/00926 discloses use of controllable represspr operator sequences responsive to the a 1/alpha-2 and alpha-2 gene products of the type a and type alpha yeast mating locus alleles to repress expression of a heterologous structural gene located downstream of the expression controlled sequence in the presence of a gene product of a yeast mating type locus. PCT Application No. 83/01370 (Pub. No. WO 84/01153) discloses use of the SUC2 promoter, containing the transcription start signal for the structural gene for invertase to direct expression of an interferon gene within a yeast cell. The system allows passive regulation of interferon production, and was used to express human leukocyte interferon in S. cerevisiae.
European Patent Application No. 84104967.9 (Pub. No, 0 124 874 A2) discloses use of the 5' -flanking region from the yeast repressible acid phosphatase (PH05) gene to tightly regulate the expression of heterologous genes in yeast. The PH05 promoter/regulator was used to direct expression of interferon in S. cerevisiae.
European Patent Application No. 33110472.4 (Pub. No. 0 109 560 A2) discloses use of the promoter of the PHO5 gene, including the PHO5 signal peptide, to control expression of a target peptide gene in S. cerevisiae. The system was used to express norepinephrine alpha. Production of the target protein varied as a function of the phosphate concentration in the medium.
PCT Application No. 85/01470 (Pub. No. WO 86/00923) discloses use of a PHO5 promoter lying within the approximately 0.55 Kb sequence preceding the ATG translational start triplet at the beginning of the PHO5 coding sequence, which is excised and isolated from the PHO5 gene, to control expression of a heterologous peptide in S. cerevisiae. This PHO5 promoter system, in one embodiment containing also the major PHO5 start site, is used to direct expression of human fertility hormones, such as hCG, LH and FSH. Also disclosed is use of the promoter sequence of the gene encoding yeast glyceraldehyde-3'-phosphate alhy- drogenase (GAPD) to control heterologous protein expression.
Hinnen et al., Chem. Ab. 102:Ab. No. 40931k (1985) discloses use of the promoter and 80% of the 5' end of the PHO5 signal sequence fused to a cDNA fragment encoding the mature protein sequence and a portion of the 3' end of the signal sequence of human alpha interferon. This system thus includes a hybrid PHO5-hIF-alpha signal sequence used to transform S. cerevisiae.
European Patent Application No. 83310471.6 (Pub. No. 0 109 559 A1) discloses use of the giyceraldehyde-3-phosphate dehydrogenase promoter to control expression of a target peptide in Saccharomyces. Also disclosed is the use of the 3' -terminal non-transla- tional region of the GAPDH gene in the plasmid at a point downstream from the target peptide gene to increase production of the target peptide.
PCT Application No. 84/00153 (Pub. No. WO 84/04538) discloses use of a yeast regulon and a transcription terminator derived from one of the GAPDH genes of S. cerevisiae. It is disclosed that a 850 nucleotide GAPDH regulon was almost 100 times more effective as smaller regulons (280 nuclectides). Also disclosed is the use of the GAPDH regulon in conjunction with a signal sequence derived from a gene for yeast invertase, yeast acid phosphatasε, unmatured forms of thaumatin-like proteins, unmatured forms of chymosin-like proteins or two consensus signal poly peptides, the amino acid sequences of which are disclosed. Also disclosed is the use of preferred yeast codons in either the target peptide sequence, the signal sequence or both.
Urdea et al., Proc. Natl. Acad. Sci. USA 80: 7461-7465 (1983) discloses a plasmid containing the yeast GAPDH promoter, the structural gene for human epidermal growth factor (urogastrone) and a terminator derived from yeast alcohol dehydrogenase (ADH). This genetic unit was inserted into a yeast plasmid vector that contained the yeast 2 micron sequences, a DNA fragment containing the yeast LEU coding sequences, and a fragment of pBR322 containing the origin of replication and the ampicillin resistance gene, and used to direct synthesis of urogastrone. The DNA sequence for the gene encoding urogastrone was designed with yeast-preferred codons inferred from codon usage in the highly expressed yeast genes for GAPDH, ADH and pyruvate kinase. This expression system produced about 30 micrograms of target protein per liter of yeast culture.
European Patent Application No. 85870170.9 (Pub. No. 0 184 575 A2) discloses the use of strong yeast promoters such as the promoters of alcohol dehydrogenase (ADH1), enolase (ENO8; ENO46), glyceraldehyde-3-phosphate dehydrogenase (GAP63; GAP491), phosphoglycerate kinase (PGK), alkaline phosphatase (PHO3; PHO5 ) and promoter p415, to control expression of enzymes of the 1,4-beta-N-acetylmuramidase type.
Bock et al., U.S. Patent No. 4,517,294, disclose that a plasmid vector containing four components is required to express a heterologous gene such as the cDNA for human antithrombin III in yeast. The first component allows for transformation of both E. coli and yeast, and contains a selectable gene from each organism. The second component is a 5'-flanking sequence from a highly expressed yeast gene to promote transcription of a downstream-placed structural gene, such as the 5'-flanking sequence from yeast 3-phosphoglycerate kinase (PGK). The third component is a structural gene containing both an ATG translation start and translation stop signals. The fourth component is the 3'-flanking sequence of a yeast gene containing the signal for transcription termination and polyadenylation. Bock et al. further describe plasmids directing the production of antithrombin III in yeast.
In spite of these advances in the development of yeast vectors, expression of heterologous gene products has been much reduced compared with expression of homologous proteins in the same expression vector. Thus, Chen et al., Nucleic Acids Res. 12(23):8951-8970 (1984) noted that accounts of expression experiments involving interferons, hepatitis surface antigen, chymosin and human growth hormone reported heterologous protein levels far below the levels of normal homologous yeast gene products. This phenomenon, which is not well understood, often reduces the expression of the foreign gene product to milligrams or even micrograms per liter of cell culture. Such low production limits the utility of yeast as a host for heterologous protein expression. Chen et al. used the promoter sequence and transcription termination and polyadenylation sequence from the 3-phosphoglycer ate kinase (PGK) gene to control expression of interferon in yeast, and reported expression 15-50 times lower than expression of the natural homologous PGK gene on the same plasmid. Chen et al. found that the difference was directly proportional to changes in steady-state levels of mRNAs, but could not explain the relationship.
Another suggested explanation for the relatively poor expression of heterologous genes in yeast has been that the codons used to direct protein synthesis in mammalian genes differ significantly from those used for highly expressed homologous yeast genes. It is well known that, because the genetic code is degenerate, several different codons can specify the inclusion of a given amino acid in a growing polypeptide chain. Nirenberg et al., "The RNA Code and Protein Synthesis," in, L. Frisch, ed., Symposia on Quantitative Biology XXXI, Cold Spring Harbor Laboratory, Publisher, New York pp. 11-24 (1966). The highly expressed yeast genes contain a high proportion of specific codons which correspond to prominent tRNA species present in the cell. Genes which are expressed less efficiently generally include a more random codon choice for a particular amino acid. Bennetzen et al., J. Biol. Chem. 257:3026-3031 (1982). Since mammalian and other genes generally do not utilize these so-called "preferred" yeast codons, this might explain the observed limited expression. Urdea et al., supra, discussed above, used such an approach and reported enhanced expression of urogastrone under the control of a GAPDH promoter and ADH terminator in yeast. However, heterologous protein expression was low (about 30 micrograms/liter of culture) in comparison with expected homologous gene production.
In further refining yeast expression vectors to optimize production of foreign gene products, expression elements from different yeast genes have been combined to create hybrid expression vectors, such as those described hereinabove. Observed improvement in heterologous expression, however, generally has not been dramatic. For example. Smith et al., Science 229:1219-1224 (1985) employed many different combinations of promoter and secretion-signal sequences to control expression of prochymosin in yeast. Examination of total antigen production (see. Table 1 of Smith et al.) shows very little difference in prochymosin production among the various combinations employed, including a GAL1-PHO5 combination.
Thus, in spite of recent advances in yeast vector technology, a need has continued to exist for a DNA expression vector capable of effecting expression of heterologous polypeptides in yeast hosts at high expression levels.
SUMMARY OF THE INVENTION
Recognizing the need for the development of a yeast DNA expression vector capable of highly efficient expression of heterologous polypeptides in yeast hosts, the present inventors have developed an expression vector capable of directing heterologous polypeptide expression at high expression levels for yeast hosts. In fact, the present invention provides for expression of many heterologous polypeptides in yeast hosts at minimum levels of one gram per liter of yeast culture, or at least 10% of total yeast cell protein. Accordingly, the present invention provides a means of expressing heterologous peptides in yeast at a level which is termed "ultrahigh" for the purposes of describing the invention herein. Thus, according to the present invention, there is provided a combination of yeast expression elements comprising a vector capable of effecting ultrahigh expression of a heterologous polypeptide in a yeast host. The ultrahigh expression obtained according to the present invention is surprisingly greater than that which would be expected based upon the known effects of the individual elements themselves.
In one embodiment of the present invention, there is provided a DNA expression system comprising:
(I) a DNA expression vector capable of effecting expression of a polypeptide in a yeast host comprising, in phase:
(a) a hybrid first yeast promoter comprising the functional segment of the regulatory region of a galactose-inducible promoter gene operably linked to the functional segment of the transcription initiation site of a highly expressed yeast gene;
(b) the functional segment of a signal sequence, said signal sequence substantially comprising preferred yeast codons;
(c) the functional segment of a DNA sequence encoding a transcription terminator;
(d) a yeast replicon; (e) the functional segment of a DNA sequence encoding a selectable yeast marker; and
(II) a source of the peptide encoded by the DNA sequence of the GAL4 structural gene.
The DNA expression system of the present invention is useful for expressing many different heterologous polypeptides. Thus, in another embodiment, the invention provides for a DNA expression system as described above, further comprising, inserted in phase between the signal sequence and the transcription terminator, the functional segment of a DNA sequence encoding a heterologous target polypeptide. In another embodiment, the invention provides for yeast hosts transformed with the DNA expression vector of the DNA expression system as described above. In another embodiment, the invention provides for a method of producing a heterologous target polypeptide in a yeast host, comprising culturing said yeast host transformed with a DNA expression vector of the DNA expression system as described above, causing expression of said target polypeptide, and recovering said target polypeptide.
In another embodiment of the invention, the DNA expression vector of the DNA expression system described above may be in the form of a plasmid. Alternatively, the DNA sequence comprising the DNA expression vector of the DNA expression system described above may be integrated into yeast chromosomal material.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a flow chart describing the construction of At-III expression vector YpGX228. Figure 2 is a flow chart showing the construction of expression vector YpGX229.
Figure 3 is a flow chart showing the construction of M13 vector MGX69.
Figure 4 is a flow chart showing the construction of expression vector YpGX235.
Figure 5 shows the organization of the GAL1-10 genes in S. cerevisiae.
Figure 6 shows the addition of Hindlll and Xhol sites to the GAL1-10 regulatory region.
Figure 7 is a restriction map showing restriction sites in the GAL1-10 regulatory region created by oligonucleotide-directed mutagenesis.
Figure 8 is a flow chart showing the addition of a Xhol site to the alpha-factor regulatory region.
Figure 9 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the alpha-factor prepro-Lys-Arg-At-III gene.
Figure 10 is a flow chart showing the insertion of a GAL upstream activation site adjacent to the alpha-factor prepro-Lys-Arg-At-III gene.
Figure 11 is a flow chart showing the insertion of the GAL4 gene into the plasmid YpGx243.
Figure 12 shows galactose-reguϊated expression of At-ill.
Figure 13 is a flow chart showing the deletion of alpha-factor Pro-Lys-Arg and addition of a Xhol site to the alpha-factor regulatory region.
Figure 14 is a flow chart showing the assembly of an expression vector including the alpha-factor Pre-At-III gene. Figure 15 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the alpha-factor Pre-At-III gene.
Figure 16 is a flow chart showing the assembly of a galactose-regulated alpha-factor Pre-At-III gene.
Figure 17 is a flow chart showing the addition of the GAL4 gene to the plasmid YpGX246.
Figure 18 is a flow chart showing the deletion of the alpha-factor Pre sequence and the addition of a Xhol site to the alpha-factor regulatory region.
Figure 19 is a flow chart showing the assembly of a gene encoding the PHO5 signal and the structural gene for At-III.
Figure 20 is a flow chart showing the assembly of a yeast-S. coli shuttle vector including the PHO5 signal/At-III gene.
Figure 21 is a flow chart showing the assembly of a galactose-regulated PHO5 signal/At-III gene.
Figure 22 is a flow chart showing the addition of the GAL4 gene to the plasmid YpGX262.
Figure 23 is a flow chart showing the assembly of a gene encoding SUC2 signal-At-III.
Figure 24 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the SUC2 signal-At-III gene.
Figure 25 is a flow chart showing the assembly of a galactose-regulated SUC2 signal-At-III gene.
Figure 26 is a flow chart showing the addition of the GAL4 gene to YρGX254.
Figure 27 is a flow chart showing the assembly of a gene encoding pre-At-III. Figure 28 is a flow chart showing the assembly of a yeast-E. coli shuttle vector including the pre-At-III gene.
Figure 29 is a flow chart showing the assembly of a galactose-regulated pre-At-III gene.
Figure 30 is a flow chart showing the addition of the GAL4 gene to YpGX264.
Figure 31 shows a restriction and functional map of a yeast-E. coli shuttle vector, plasmid YpGX265 GAL4.
Figure 32 shows the detection of PHO5 signal-At-III protein by Coomassie staining of an SDS-polyacrylamide gel.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
In the following description, reference will be made to various methodologies well known to those of skill in the art of recombinant genetics. Publications and other materials setting forth such well known methodologies will be referred to in the course of this description, and are incorporated herein by reference in their entireties as though set forth in full. Standard reference works setting forth the general principles of recombinant DNA technology include Lewin, B. M., Genes II, John Wiley & Sons, Publishers, New York (1985). The molecular biology of the yeast Saccharomyces is comprehensively reviewed in Strathern, J. N. et al., The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Publisher, New York (1981) and Strathern, J. N. et al., The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold Spring Harbor Laboratory, Publisher, New York (1932).
By "DNA expression vector" is meant any autonomous element capable of replicating in a host independently of the host's chromosome, after additional sequences of DNA have been incorporated into the autonomous element's genome. Such DNA expression vectors include bacterial plasmids and phages and yeast plasmids. Plasmids may be single or multi copy, with multi copy plasmids preferred.
By "ultrahigh expression" is meant the production of heterologous polypeptide in a yeast host at levels not less than one gram per liter of yeast culture and not less than 10% of total yeast cell protein. It will be appreciated that it may be desirable to control the expression of certain heterologous polypeptides that are toxic to the host's cells at sub-ul- trahigh levels. This may be accomplished, for example, by including within the expression vector a DNA sequence capable of repressing expression in the presence of a factor such as a gene product or metabolite, while maintaining the ability to express at ultrahigh levels in the absence of that gene product or metabolite.
By "in phase" is meant that the nucleotide sequence of interest is in the same reading frame as those nucleotide squences to which the sequence of interest may be operably linked.
By "promoter" is meant a DNA sequence generally described as the 5' region of a gene, located proximal to the start codon. At the promoter region, tran scription or expression of an adjacent gene is initiated. This is called the transcription initiation site. Also at the promoter region may be a sequence of nucleotides that interacts with a positive intermediary, thereby exerting positive control over the expression of any operably linked structural gene or genes. A preferred positive intermediary for the purposes of the present invention is the protein produced by the GAL4 structural gene. In a "hybrid yeast promoter," the transcription initiation site and the nucleotide sequence which interacts with a positive intermediary are derived from different yeast genes.
By "functional segment" is meant the DNA sequence or sequences responsible for effecting the function attributed to the fragment of interest.
By "galactose inducible" is meant a structural gene the expression of which is inducible by the presence in the medium of galactose. The regulation of yeast galactose genes is described by Oshima, "Regulatory Circuits for Gene Expression: The metabolism of Galactose and Phosphate," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold Spring Harbor Laboratory, Publisher, New York, pp. 159-180 (1982). Preferred for the purposes of the present invention, are the Leloir pathway enzymes galactokinase, transferase and epimerase, coded for by genes designated GAL1, GAL7 and GAL10, respectively, and the specific galactose regulatory protein, coded for by the, GAL80 gene. It will be appreciated that any DNA sequence capable of binding the GAL4 protein, whether natural or synthetic, and including consensus binding sequences, may be used for the purposes of the present invention and is included within the scope thereof. Specific DNA binding of the GAL4 protein and a near-consensus synthetic oligonucleotide are described in Giniger et al., Cell 40 : 767-774 (1985). Shimada et al., Gene 39:1-9 (1985) describe the inducible expression of the GAL80 gene by the GAL4 protein. GAL1 and GAL10 are herein referred to collectively as GAL1-10. The DNA sequence of the promoter region that interacts with the positive intermediary as described above is also termed the "upstream activation site" (UAS). Also preferred for the purposes of the present invention is the upstream activation site of the GAL1-10 gene comprising bases -613 to -158.
By "structural gene" is meant a DNA sequence that may be transcribed into mRNA, which mRNA may then be translated into a sequence of amino acids characteristic of a specific peptide. Typically the first nucleotide of the first translated codon is numbered +1, and the nucleotides are numbered consecutively with positive integers throughout the translated region of the structural gene and into the 3' untranslated region. The numbering of nucleotides in the promoter and regulatory region 5' to the translated region proceeds consecutively with negative integers. Thus the 5' nucleotide of the promoter and regulatory region adjacent to the first translated nucleotide of the structural gene would be numbered -1.
By "operably linked" is meant that the promoter controls the initiation of expression of the polypeptide encoded by the structural gene. By "transcription initiation site" (TIS) is meant a DNA sequence of a promoter to which RNA-polymerase binds, thereby initiating transcription. of succeeding codons in a 5' - 3' direction. For the purposes of the present invention, a transcription initiation site of a highly expressed yeast gene is used. Those of skill will appreciate that many such highly expressed yeast genes are known, the transcription initiation sites of which are suitable for the purposes of the present invention. Preferred for the present invention is the transcription initiation site of an alpha mating factor gene. The alpha mating factor gene of yeast and yeast mating types are described in Herskowitz et al., "Control of Cell Type in Saccharomyces cerevisiae: Mating Type and Mating-Type Interconver- sion," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccaromyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Publisher, New York, pp. 181-209 (1981); Nasmyth, Ann. Rev. Genet. 16:439-500 (1982). Preferred for the purposes of the present invention is the gene encoding the alpha-1 mating factor (MF-alpha-1). Also preferred for the purposes of the present invention is the transcription initiation site of the MF-alpha-1 gene comprising bases -158 to -3.
By "signal sequence" is meant that part of the DNA sequence encoding the prepro- or pre-protein, which has a high affinity to biomembranes or special receptor-proteins in biomembranes or which is involved in the transport or translocation of prepro- or pre-protein. These transport or transiocation processes are often accompanied by processing of the prepro- or pre-protein to create the mature form of the protein. Preferred for the purposes of the present invention, is a signal sequence derived from the DNA sequence encoding yeast acid phosphatase. Phosphatase genes are described in Oshima, "Regulatory Circuit for Gene Expression: The Metabolism of Galactose and Phosphate," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Publisher, New York, pp. 159-180 (1982). More preferred is the DNA sequence encoding repressible acid phosphatase (PHO5) gene. Even more preferred as a signal sequence for the purposes of the present invention is the nucleotide sequence:
ATGTTCAAATCTGTTGTTTACTCTATTTTGGCTGCTTCTTTGGCCA ACGCT.
By "preferred yeast codons" is meant codons containing nucleotide bases that have been observed more frequently than other possible codon triplets to encode particular amino acids in yeast. Preferred yeast codons and their use are described by Holland et al., J. Biol. Chem. 255:2596-2605 (1980).
By "transcription terminator" is meant a sequence of DNA, presented at the end of the transcript, that causes RNA polymerase to terminate transcription. Preferred for the purposes of the present invention is the transcription terminator of a yeast glyceralde- hyde-3-phosphate dehydrogenase gene (GAPDH). The GAPDH gene is described in Holland et al., J. Biol. Chem. 254:9839-9845 (1979). Also preferred as a tran scription terminator for the purposes of the present invention is the nucleotide sequence:
GGATTCCGGGTTTTTTATAGCTTTATGACTTAGTTTCAATTATATA CTATTTTAATGACATTTTCAG.
By "replicon" is meant a unit of genome in which DNA is replicated, and which contains an origin for initiation of replication (replication origin). Preferred replicons for the purposes of the present invention include fragments of the yeast 2 micron plasmid, termed YEp plasmid vectors, but other replicons such as Yip, YRp and YCp may also be used. These are described, for example, in Botstein et al., "Principles and Practice of Recombinant DNA Research with Yeast," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, Cold Spring Harbor Laboratory, Publishers, New York, pp. 607-636 (1982). Also preferred for the purposes of the present invention is a replicon derived from plasmid pJDB207. This plasmid is available from commerical sources such as Amersham Corporation, Arlington Heights, 111., 60005.
By "selectable yeast marker" is meant a gene conferring upon the cell in which it is contained the ability to grow in a medium which either contains or lacks a particular constituent. Thus, for example, a gene conferring ability to grow in the absence of a required nutrient, such as a particular amino acid, would act as a selectable marker. If this gene is not normally present in the yeast cell, it may be introduced via, for example, a plasmid. Thus, only clones containing the plasmid would be able to grow in a medium that lacked the required nutrient. Use of selectable markers is described in Broach et al., Gene8:121-133 (1979). Common selectable yeast markers include LEU2, URA3, TRP1, ARG4 and HIS3 genes. Preferred for the purposes of the present invention is the LEU2 gene. More preferred is the LEU2-d gene. Different markers are used for bacteria such as E. coli. Here, genes are chosen which confer upon the host bacterium resistance to an antibiotic. Commonly employed selectable markers for bacteria are genes conferring resistance to ampicillin and tetracycline. A plasmid that is constructed to contain selectable markers for both yeast and bacteria will be capable of selection in either host. Because such a plasmid is capable of expression in either yeast or bacteria, it is termed a "shuttle vector." Also preferred for the purposes of the present invention is a selectable yeast maker derived from plasmid pJDB207. This plasmid is available from commerical sources such as Amersham Corporation, Arlington Heights, 111., 60005.
By "target peptide" is meant the peptide it is desired to express in the yeast host according to the present invention. The target peptide may be encoded by a structural gene, in which case a mature peptide product would be expressed. Alternatively, the target peptide may comprise the prepro-, pro- or pre- forms of the peptide. The target peptide will be "heterologous" if it is encoded by a DNA sequence that is foreign, i.e., originates from a donor different from the host or is a chemically synthesized gene, and can include a donor of a different species from the host. The heterologous gene codes for a peptide ordinarily not produced by the organism. A "homologous" target peptide is encoded by a DNA sequence originating from the host, which sequence encodes a peptide ordinarily produced by the organism.
By "integrated to yeast chromosomal material" is meant that the DNA sequence of interest is caused or allowed to become part of the chromosomal material of the yeast host itself, and is replicated along with host chromosomal replication, as opposed to replicating independently as when the DNA sequence of interest is carried in a DNA expression vector such as a plasmid. Integration may be effected, for example, by employing an integrating vector such as YIp5. YIp5 is described, for example, by Botstein et al., "Principles and Practice of Recombinant DNA Research with Yeast," supra.
By "transformation" is meant the aquisition in eukaryotic cells of new genetic markers by incorporation of added DNA. This is the process by which naked DNA is introduced into a cell, resulting in a heritable change. The transformation of yeast is described in Hinnen et al., Proc. Natl. Acad. Sci. USA 75(4):1929-1933 (1978).
In a preferred embodiment, the present invention provides for a DNA expression vector which can be used to express many heterologous proteins at ultrahigh expression levels of no less than 1 gram per liter of yeast culture or at least 10% of total yeast cell protein. In this embodiment, the hybrid yeast promoter was composed of elements from two naturally occuring yeast promoters. The transcription initiation site was derived from the MF-alpha-1 gene. An upstream activation site derived from the regulatory region of the yeast GAL1-10 gene was utilized in place of the MF-alpha-1 upstream activation site. Use of the GAL1-10 upstream activation site permits tightly regulated expression of the MF-alpha-1 transcription initiation site by metabolites such as glucose and galactose. The hybrid yeast promoter was carried on a yeast-S. coli shuttle vector derived from the plasmid pJDB207. Beggs, "Multiple-Copy Yeast Plasmid Vectors," in, D. von Wettstein et al., eds. Molecular Genetics in Yeast, Alfred Benzon Symposia, vol. 16, pp. 383-389 (1981). Because this shuttle vector carries the combination of a yeast 2 micron plasmid replication origin and the LEU2-d selectable yeast marker, plasmid copy number is very high in yeast (up to about 200 copies per haploid cell). Using this vector, however, it was found that target peptide expression directed by the hybrid GAL1-10/MF-alpha-1 promoter was limited.
It was determined by the present inventors that the disappointingly low expression directed by the hybrid GAL1-10/MF-alpha-1 promoter was caused by insufficient GAL4 protein in the yeast host cell. The GAL4 protein, encoded by the GAL4 gene, is a positive regulatory protein for the yeast galactose system. It has been shown that this protein binds to the GAL1 upstream activation site and is required for high level regulated expression of the GAL1 gene. The amount of GAL4 protein is normally very low in the yeast cell. Laughon et al., Proc. Natl. Acad. Sci. USA 79 : 6827-6831 (1982). Inclusion of the GAL4 structural gene in the DNA expression vector apparently increased the amount of GAL4 protein in the cell and enhanced expression directed by the plasmid-born hybrid promoter.
To terminate transcription efficiently, the plasmid of this embodiment carries a synthetic yeast transcription terminator designed from a yeast GAPDH gene. The synthetic DNA sequence was designed by the present inventors employing convenient restriction endonuclease recognition sites to facilitate DNA manipulations. The use of restriction endonucleases and associated molecular biology techniques are described in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Publisher, New York (1982).
A signal sequence derived from the yeast PHO5 gene was inserted between the hybrid promoter and the start of the coding sequence of the target peptide. The signal sequence employed was designed from the yeast PHO5 gene and comprised a synthetic DNA sequence, such that the codon selection was based on preferred yeast codons rather than the naturally occuring PHO5 signal sequence.
As a result of these modifications, the present inventors found that this DNA expression vector was capable of ultrahigh levels of heterologous target peptide expression unprecedented in the art of yeast expression. This surprisingly ultrahigh expression could not have been predicted, and is greatly in excess of the improvements in expression that would be expected from the known additive effects of the individual alterations. In another preferred embodiment, the invention comprises a DNA expression system comprising a DNA expression vector prepared as follows:
1. A novel hybrid promoter that includes the efficient transcription initiation site (including bases -158 to -1) of the MF-alpha-1 gene, Kurjan et al., Cell 30: 933-943 (1982), and a GAL4 binding site derived from the GAL1-10 regulatory region. Citron et al., J. Bacteriol. 158:269-278 (1984), including bases -610 to -157. (The A of the GAL1 ATG translation start codon is +1.) This hybrid regulatory region was constructed by placing a Xhol restriction endonuclease site at base number -158 preceding the ATG translational start of the MF-alpha-1 gene, and Hindlll and Xhol restriction sites at bases -610 and -157 of the GAL1-10 regulatory region, respectively.
2. A PHO5 (Arima et al., Nucleic Acids Res. 11:1657-1672 (1983)) signal encoding sequence derived from synthetic DNA, substantially comprising preferred Saccharomyces codons rather than the natural coding sequence. The synthetic DNA sequence encoding this signal is:
ATGTTCAAATCTGTTGTTTACTCTATTTTGGCTGCTTCTTTGGCCA ACGCT.
3. A GAPDH (Holland et al., J. Biol. Chem. 254:9839-9845 (1979); Holland et al., J. Biol. Chem. 255:2596-2605 (1980)) transcription terminator derived from synthetic DNA. The sequence of this strong transcription terminator is:
GGATCCCGGGTTTTTTATAGCTTTATGACTTAGTTTCAATTATATA CTATTTTAATGACATTTTCAG. 4. The Saccharomyces GAL4 (Johnston et al., Proc. Natl. Acad. Sci. USA 79: 6971-6975 (1982)) gene to provide additional GAL4 protein to recognize the GAL4 binding sites on the plasmid.
5. Yeast and E. coli replicating origins and selectable markers derived from plasmid pJDB207. Beggs, J.D. "Multiple-copy yeast plasmid vectors," in, Alfred Benzon Symposium 16, Molecular Genetics in Yeast, Von Wettstein, D. et al., eds., Munksgaard, Copenhagen, pp. 383-389 (1981). The yeast replication origin derived from the 2 micron plasmid and the LEU2-d gene permit especially high plasmid copy number in Saccharomyces (up to 200 copies per cell).
6. Restriction sites are situated between the PHO5 signal encoding sequence and GAPDH transcription terminator for insertion of foreign genes.
The materials and methods used in carrying out the present invention may be more fully understood by reference to the following examples, which examples are not intended in any manner to limit the scope of the present invention.
EXAMPLE I
Construction of an Alpha-Factor/At-III Expression Vector
Human antithrombin III (At-III), a single-chain glycoprotein, is described by Bock et al., U.S. Patent Number 4,517,294.
Vector YpGX227 is a yeast-E. coli shuttle vector. For replication and plasmid selection in E. coli the replication origin and ampicillin resistance encoding sequences for plasmid pBR322 are present. The S. cerevisiae LEU2 gene permits selective maintenance of the plasmid in yeast hosts with defects in the chromosomal LEU2 gene, and also permits integration of the plasmid sequences into host chromosomal DNA.
Vector YpGX227 includes the S. cerevisiae alphafactor (MF-alpha-1) promoter and, sequences encoding the pre, pro, and first spacer. Kurjan et al., U.S. Patent No. 4,546,082. At the end of the first spacer encoding sequence is a naturally occuring Hindlll restriction site. The strategy for constructing the alpha-factor/At-III expression vector utilized that Hindlll site.
To terminate transcription, a synthetic sequence derived from a yeast glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was utilized. The sequence of this terminator is:
GGATCCCGGGTTTTTTATAGCTTTATGACTTAGTTTCAATTATATA CTATTTTAATGACATTTTCAG
The DNA sequence encoding the alpha-factor spacer and the N-terminus of mature alpha-factor is shown below:
Hindlll
Figure imgf000030_0001
AAA AGA GAG GCT GAA GCT TGG lys arg glu ala glu ala trp
The first step in the vector construction was to place a Hindlll restriction site at the 5' end of the cloned At-III DNA sequence. This Hindlll site was created by oligonucleotide-directed in vitro mutagenesis (Zoller et al., Meth. Enzymol. 100 : 468-500 (1983)) of the At-III sequence derived from the Escherichia coli plasmid pGXl755 (Figure 1). Flanking the OL/Ps-At-III region are unique EcoRI and Hindlll restriction sites. To perform the oligonucleotide-directed mutagenesis, the EcoRI-Hindlll restriction fragment containing the OL/PR promoter and the At-III gene was first isolated from the pGXl755 and then ligated to EcoRI/Hindlll-digested M13mp8. This ligation generated the M13 vector MGX64 (Figure 1), and single-stranded MGX64 DNA was prepared following transfection of E. coli strain JM109.
A 39-base oligonucleotide was utilized to insert a nine-base pair sequence including a Hindlll site and a trp codon at the 5' end of the At-III sequence in MGX64. Addition of two G residues following. the Hindlll site was necessary to create an in-frame fusion with the alpha-factor secretory sequences. This insertion created vector MGX65 which has the following sequence at the 5' end of At-III:
Hindlll
Figure imgf000031_0001
GAA GCT TGG CAC glu ala trp his
Figure imgf000031_0002
mature AT-III
The At-III sequence was excised from MGX65 as a Hindlll fragment and ligated into the alpha-factor expression vector YpGX227 generating vector YpGX228 (Figure 1). Vector YpGX228 carries the yeast LEU2 gene, which can be used as a selectable marker for transformation, but it does not contain a Saccharomyces origin of replication. Transformation with this plasmid therefore results in integration of the alpha-factor/At-III sequence into a yeast chromosome.
In YpGX228 the 3' end of the At-III sequence has a long transcribed, non-translated region. It has been observed that heterologous gene expression in yeast can sometimes be enhanced by positioning a yeast transcription terminator near the end of the protein coding region. Mellon et al., Gene 24:1-14 (1983). The 3' end of the AT-III DNA sequence was therefore modified by creating a BamHI restriction site immediately 3' of the TAA translation termination codon. The BamHI site was created by oligonucleotide- directed mutagenesis using MGX64 single-stranded DNA as a template and a 36-base oligonucleotide. The resulting vector, MGX66, shown in Figure 2, has the 3' DNA sequence shown below.
BamHI ..................... TAA GGA TCC
At-III Stop
This BamHI restriction site can be used to link the At-III DNA sequence to the yeast glyceraldehyde-3- phosphate dehydrogenase (GAPDH) transcription termination sequence present in the alpha-factor expression vector YpGX227 (Figure 2). Using MGX65, MGX65 and YpGX227 (Figure 2), an alpha-factor/At-III expression vector, YpGX229, was constructed that contains a 5' in-frame fusion of mature At-III to the first codon of the mature alpha-factor peptide and a GAPDH transcription terminator immediately 3' of the At-III coding sequence. This construction made use of the unique PstI restriction site present in the At-III DNA sequence. The 5' portion of At-III was purified from MGX65 as a Hindlll-PstI restriction fragment, while the 3' portion was purified from MGX66 as a Pstl-BamHI restriction fragment. The alpha-factor expression vector YpGX227 was cleaved with Hindlll and BamHI, treated with calf alkaline phosphatase, and used in a three- way ligation with the At-III fragments from MGX65 and MGX66. This ligation produced vector YpGX229 (Figure 2) in which the alpha-factor-At-III coding sequence is flanked by the alpha-factor promoter at the 5' end and the GAPDH transcription terminator at the 3' end. Because YpGX229 is derived from YpGX227, it can be used to integrate the alpha-factor/At-III sequence into a yeast chromosome.
In summary, alpha-factor/At-III expression vectors designated YpGX228 and YpGX229 were constructed that encode an alpha-factor prepro-lys-arg-glu-ala-glu-ala- trp-At-III. The alpha-factor/At-lll DNA sequence from YpGX229 was chosen for further modification because it lacks the At-III 3' untranslated region and contains the GAPDH transcription terminator.
In order to delete the five codons separating the lys-arg codons of the alpha-factor spacer from the initial histidine codon of mature At-III, the YpGX229 alpha-factor/At-III DNA sequence was excised as a Sall fragment, and ligated into Sall-digested, calf alkaline phosphatase-treated M13mp9 (commercially available), generating the M13 vector MGX68 (Figure 3). The MGX68 single-stranded template and a 35-base oligonucleotide were then used to delete the 15-base pair sequence containing the glu-ala-glu-ala-trp codons, which separate, the alpha-factor spacer, lys-arg, from mature At-III. The deleted vector was designated MGX69 (Figure 3) and the expected sequence was confirmed by DNA sequence analysis.
The alpha-factor/At-III DNA sequence from MGX69 was then used to construct expression vector, YρGX235. To generate YpGX235, the alpha-factor/At-III sequence was excised from MGX69 as a Hindlll-Bglll fragment which was ligated to Hindlll-BamHl digested pJDB207 (Figure 4) (Bglll and BamHI generate the same 5' single-stranded ends).
Transformation of S. cerevisiae with the Alpha-Factor/ At-III Expression Vector
The alpha-factor/At-III expression vector YpGX235 was introduced by transformation into several yeast host strains. These included both MAT (Mating Type) a and MAT alpha strains. However, efficient transformation was observed only when MAT a hosts were transformed. (Although when MAT-alpha cells were transformed with YpGX235, small colonies were observed microscopically, they stopped growing before visible colonies were seen.) The most obvious explanation for the inability to isolate viable YpGX235 transformants of MAT alpha cells is that the AT-III expression levels from YpGX235 are high enough to be lethal to the cells. In MAT a hosts, it is expected that alpha-factor-directed expression would be considerably lower than that in MAT alpha hosts. Previous studies have shown that alpha-factor-directed invertase expression, based on a 2 micron plasmid of medium copy number, is 60-70 fold higher in MAT alpha cells than in MAT a cells Emr et al., Proc. Natl. Acad. Sci. USA 80: 7080-7084(1983).
The inability to stably transform MAT alpha hosts with YpGX235 indicated that high-level constitutive expressesion of At-III in S. cerevisiae may not be compatible with cell growth and division. To alleviate this problem it was necessary to tightly regulate the expression of At-III in S. cerevisiae, so that high-level expression occured after the logarithmic growth phase.
EXPERIMENTAL RESULTS AND METHODS FOR THE EXPRESSION OF BIOLOGICALLY ACTIVE AT-III IN S. CEREVISIAE
Construction of a Galactose-Regulated Gene Encoding Alpha-Factor Prepro-Lys-Arg-At-III
The GALl-10 regulatory region. In order to tightly regulate expression of the gene encoding alpha-factor prepro-lys-arg-At-III, the upstream activation site (UAS) of the GAL1-10 regulatory region was positioned 5' of the alpha-factor transcription initiation site (TIS) present in vector MGX69. The GAL1 and GAL10 genes are located within 560 base pairs of each other on chromosome II of Saccharomyces, but are transcribed from opposite strands (Figure 5). Sequences within the 560-base pair intergene region include the GAL1 and GAL10 TIS and UAS sequences. The UAS specifically determines the regulated expression of the GAL1 and GAL10 genes in response to galactose.
Oshima, "Regulatory Circuit for Gene Expression: The Metabolism of Galactose and Phosphate," in, J. Strathern et al., eds., The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Publisher, New York, pp. 159-180 (1982), describes the regulation of galactose metabolic genes in yeast. The current hypothesis is that the UAS sequences preceding each gene bind a positive regulatory protein encoded by the GAL4 gene. A negative regulatory protein encoded by the GAL80 gene is also involved in the control of galactose gene expression. In the absence of galactose, the GAL4 and GAL80 proteins form a complex that prevents binding of the GAL4 protein to the UAS sequences, and therefore no active transcription of the GAL genes occurs. In the presence of galactose, the GAL4-GAL80 protein complex dissociates, releasing the GAL4 protein which can then bind to the GAL UAS sequences to stimulate active transcription of the GAL1 and the GAL10 genes. To test this hypothesis, the effects of perturbations of the system, such as inactivation of the GAL80 protein by mutation or boosting the level of GAL4 protein by recombinant DNA techniques, have been examined. Johnston et al., Proc. Natl. Acad. Sci. USA 79:6971-6975 (1982). As expected, excess active GAL4 protein leads to constitutive expression of the galac- tose genes. However, the genes are still subject to glucose repression, and growth of yeast cells in media containing high levels of glucose overrides "constitutive" expression of the galactose genes.
The GAL1-10 UAS region previously has been utilized successfully to regulate expression of another yeast gene, CYC1, with galactose. Guarante et al., Proc. Natl. Acad. Sci. USA 79: 7410-7414 1982). In addition, results have been published that more specifically define the GAL1-10 UAS sequences Ginigen et al., Cell 40: 767-774 1985).
Oligonucieotide-directed mutagenesis of the GAL1-10 regulatory region
An M13 vector carrying the GAL1-10 regulatory region, MGX14 (Figure 6), was assembled by ligating a HincII-EcoRI GAL1-10 fragment to Hincll- and EcoRI- digested M13mp9. The Hincll and EcoRI sites in MGX14 are located in the 201st and 45th codons of the GAL1 and GAL10 genes, respectively. In describing the location of restriction endonuclease recognition sites added to the GAL1-10 regulatory region, the A in the ATG translation initiation codon of GAL1 is defined as +1 and the preceding base as -1. Using MGX14 as the initial template, three restriction sites were added sequentially to the GAL1-10 regulatory region by oligonucieotide-directed mutagenesis (Figure 6). First, a 38-base oligonucleotide was utilized as a primer to insert four bases and create an Xhol site at position -616. The vector with this mutation, MGX97, was then mutagenized using a 41-base oligonucleotide as a primer to create a second Xhol site at position -157. Finally, this vector, MGX400, served as the template for a third mutagenesis, in which five base pairs were inserted using a 36-base oligonucleotide primer to create a Hindlll restriction site at position -610. The final vector, MGX402, thus contains two new Xhol sites and one new Hindlll site. The GAL UAS region can be conveniently excised from MGX401 either as an Xhol-Xhol or Xhol-Hindlll restriction fragment. A summary of these new restrictions sites and their location in the GAL1-10 region is depicted in Figure 7.
Oligonucleotide-directed mutagenesis of the alphafactor regulatory region
The regulatory region of the alpha-factor gene (MF-alpha-1) is not as well defined as is the GAL1-10 regulatory region. Nevertheless, the present inventors were able to predict the approximate locations of the alpha-factor UAS and TIS. The mating type-regulated alpha-factor prepro-lys-arg-At-III gene had previously been cloned into M13. That vector, MGX69, was used as a template for the insertion of a Xhol restriction site at position -158 relative to the ATG start codon (Figure 8). This new Xhol site permitted the alpha-factor UAS to be conveniently separated from the alpha-factor TIS. Construction of the galactose- regulated alpha-factor prepro-lys-arg-At-III gene in a yeast-E. coli shuttle vector
The GAL1-10 UAS and alpha-factor prepro-lys-arg- AT-III gene were then joined in yeast-E. coli shuttle vector pJDB207. This vector includes the yeast 2 micron replication origin and the LEU2-d gene which allows selection for high-copy number in Saccharomyces. The first step in this construction involved introduction of the alpha-factor prepro-lys-arg-At-III gene from MGX96 into pJDB207 (Figure 9). This was accomplished by excising the alpha-factor prepro-lys-arg-At-III gene as a Hindlll-Bglll restriction fragment from MGX96 and ligating with pJDB207, which had been cleaved with Hindlll and BamHI and treated with calf alkaline phosphatase. The resulting plasmid vector, YpGX239, is identical to the previously constructed vector YpGX235 with the exception of the added Xhol site in the alpha-factor regulatory region. To replace the alpha-factor UAS in YpGX239 with the GAL1-10 UAS, the steps outlined in Figure 10 were performed. The GAL1-10 UAS was excised from MGX402 on a 1,200-bp Hindlll fragment which was then gel-purified and cleaved with Xhol. YpGX239 was digested with Hindlll and Xhol and the large vector fragment was gel-purified. The Hindlll-Xhol fragments were then ligated to generate YpGX243. Production of alpha-Factor Prepro-Lys-Arg-At-III in Yeast Cells Transformed with YpGX243
To test for galactose-regulated expression of alpha-factor prepro-lys-arg-At-III, various S. cerevisiae strains were transformed with vector YpGX243. Whereas great difficulty was encountered in transforming MAT alpha hosts with YpGX235, YpGX243 transformed MAT alpha and MAT a hosts equally well. The transformed yeast cells were grown in a medium containing 1% yeast extract, 1% Bacto-Peptone, 2% glucose (YPD) and then induced for At-III production by shifting to a similar medium (YPGal) containing 2% galactose in place of the glucose. Production of AT-III was measured by radioimmunoassay (RIA). The results forstrain G20(YpGX243) showed that at 16 hours only 0.05% of the total soluble protein was At-III cross-reacting material (CRM). The results did however, indicate that expression of the alpha-factor prepro-lys-arg- At-III gene is galactose-regulated. However, RIA determination under-estimates total At-III in the cell because the majority of the At-III produced is insoluble, and thus is not detected by the RIA.
An interesting result which suggested that At-III production in G20(YpGX243) was limited by a genetic factor was that, unlike the non-transformed host, this strain grew poorly on YPGal medium. Because the At- III production was quite low and not likely to limit cell growth, it seemed probable that the chromosomal galactose metabolic genes were being inefficiently expressed. The present inventors reasoned that the problem could be a very low level of GAL4 protein in relation to the number of GAL1-10 UAS sequences. It is believed that the GAL4 protein (a positive regulator) binds specifically to GAL1-10 UAS, promoting transcription of the galactose metabolic genes by RNA polymerase. Because yeast cells transformed with YpGX243 have a hundred-fold more GAL UAS sequences in comparison with the non-transformed host cell, the GAL4 levels might not be sufficient to efficiently promote expression of both the chromosomal GAL genes and the plasmid-encoded galactose-regulated At-III gene.
Methods to Increase the GAL4 Gene Copy Number
To compensate for the possibility that the poor growth of G20(YpGX243) on YPGal medium was due to insufficient GAL4 product, the copy number of the GAL4 gene in yeast cells transformed with YpGX243 was increased. The GAL4 gene has been cloned on plasmid pSJ3 (Johnston et al., Proc. Natl. Acad. Sci. USA 79: 6971-6975 (1982) ayeast-E. coli shuttle vector.
The approach was to directly insert the GAL4 gene into plasmid YpGX243 (Figure 11). The GAL4 gene from pSJ3 was excised as a Hindlll fragment and ligated to the unique Hindlll site of plasmid YpGX243. The resulting vector, YpGX243GAL4, was used to transform S. cerevisiae strain G20. These strains then had the same number of copies of the GAL4 gene and the galactose-regulated alpha-factor prepro-lys-arg-At-III gene. In a second approach, yeast strain 422, which carries chromosomal mutations both in the LEU2 and URA3 genes, was transformed with both plasmids (YpGX243 and pSJ3). This approach also yielded enhanced GAL4 product and increased AT-III expression. Another suitable host strain for use in this approach is SHY1 (ATCC Accession No. 44769).
Cultures of the transformed cells were induced with galactose and At-III CRM levels were again monitored by RIA at 0, 3 and 16 hours after induction (Figure 12). The data for strains G20 (YpGX243GAL4) and G20(YpGX243) clearly demonstrate that At-III expression is more efficient when additional copies of GAL4 are present. It is clear that increasing the copy number of the GAL4 gene does increase the level of At-III CRM produced.
Generation of Galactose- or Alpha-Factor-Regulated Genes Encoding Alpha-Factor Pre-At-III
To delete the alpha-factor pro sequence from MGX69 by oligόnucleotide-directed mutagenesis, a 36-base oligonucleotide was used as the primer. The mutagenesis deleted 195 base pairs, including the alphafactor pro sequence and the lys-arg spacer residues, to yield vector MGX92 (Figure 13). In preparation for inserting the GAL1-10 UAS, an Xhol site was inserted into the alpha-factor regulatory region of MGX92 by oligonucleotide-directed mutagenesis, generating vector MGX403 (Figure 13).
An expression vector that includes the alphafactor pre-At-III gene was assembled by excising the alpha-factor pre-At-III gene from MGX92 as a Hindlll-BglII fragment and ligating it with pJDB207 which had been cleaved with BamHI and Hindlll and treated with calf alkaline phosphatase (Figure 14). The resulting vector, YpGX241, is identical to YpGX235 with the exception that the alpha-factor pro-lys-arg sequence is deleted.
A galactose-regulated version of this gene was generated in two steps (Figures 15 and 16). First, MGX403 was cleaved with Hindlll and Bglll and ligated with BamHI- and Hindlll-digested, calf alkaline phosphatase-treated pJDB207 to generate YpGX245 (Figure 15). The GAL1-10 UAS was then inserted into YpGX245 by digesting with Hindlll and Xhol, isolating the large vector fragment, and ligating this fragment with the Xhol-Hindlll GAL1-10 UAS fragment from MGX402 (Figure 15). The newly assembled vector was designated YpGX246.
The GAL4 gene was then added to YpGX246 by isolating it from pSJ3 as a 3.65-kb Hindlll fragment and ligating that fragment with Hindlll-digested, calf alkaline phosphatase-treated YpGX246 (Figure 17). The newly assembled vector was designated YpGX246GAL4.
Deletion of the MF-alpha-1 Pre Coding Sequence
The 57-base pair alpha-factor pre sequence was deleted from MGX92 using a 36-base oligonucleotide primer (Figure 18). The resulting vector carrying the desired met-AT-III gene was designated MGX404. Again, in preparation for insertion of the GAL1-10 UAS, a Xhol site was inserted at position -158 relative to the start of the MF-alpha-1 gene of MGX404 by oligonu- cleotide-directed mutagenesis, generating MGX408. Aithough galactose regulation of the alpha-factor/At-III gene led to improved levels of At-III protein expression (10-30 mg per liter of culture), the inventors positioned other signal encoding sequences at the 5' end of the gene (directly 5' to the mature At-III coding sequence) to determine whether other sequences in the translation initiation region might improve translation efficiency of mRNA encoded by these vectors. The signals utilized included those encoded by the yeast PHO5 and SUC2 genes, and the natural At-III signal.
Construction of expression/secretion vectors encoding the PHO5 signal linked to mature At-III
The PHO5 signal is comprised of 17 amino acids (including the methionine initiation codon). Since insertion of the entire PHO5 signal-coding sequence requires 48 nucleotides, we performed two consecutive mutageneses to complete this construction. Starting with single-stranded template DNA from vector MGX408 (Figure 19), a mutagenesis was performed using a 54 base oligonucleotide to insert the coding sequence for the 8 C-terminal amino acids of the PHO5 signal. The mutagenized vector was screened with the mutagenic oligonucleotide by hybridization and putative positive clones were analyzed by DNA sequencing. A vector carrying the desired sequence was designated MGX425 (Figure 19). Single-stranded template prepared from this vector was mutagenized using a 54 base oligonucleotide to insert the N-terminal portion of the PHO5 signal-coding sequence. Positive clones were again screened by hybridization and the correct sequence was confirmed by DNA sequencing. The new vector (MGX428) contains the PHO5 signal (Figure 19). The presence of the entire PHO5 signal was confirmed by DNA sequence analysis.
The DNA fragment encoding the PHO5 signal fused to mature At-III was excised from double-stranded MGX428 DNA using Hindlll and Bglll restriction endonucleases (Figure 20). The fragment was then inserted into the yeast-E. coli shuttle vector YpGX243 which had been digested with Hindlll and BamHI and treated with calf alkaline phosphatase (CAP). Ligation of the isolated At-III fragment from MGX428 with the prepared plasmid YpGX243 generated vector YpGX261 (Figure 20). This vector contains all of the elements necessary to produce At-III in yeast using the MF-alpha-1 promoter.
Because tightly regulated expression of At-III is necessary to achieve high expression levels in yeast, the MF-alpha-1 UAS was replaced with the UAS derived from the GAL1-10 regulatory region. First, the MF-alpha-1 UAS was excised from YpGX261 as a Hindlll-Xhol restriction fragment (Figure 21) and the plasmid was treated with calf alkaline phosphatase. The large vector fragment was then gel-purified. The GAL1-10 UAS was isolated from plasmid YpGX243 by digesting that vector with restriction endonucleases Hindlll and Xhol and gel purifying the small fragment. Ligation of the purified GAL1-10 UAS with the enzymatically prepared YpGX243 plasmid fragment generated YpGX262 (Figure 21). This plasmid is identical to YpGX263 except that the MF-alpha-1 UAS is replaced by the GAL1-10 UAS. To achieve efficient expression using the galactose regulatory system, it is necessary to provide extra copies of the gene encoding the GAL4 protein, a positive regulator of this system. The GAL4 gene was excised from plasmid YpGX243GAL4 as a Hindlll restriction fragment (Figure 22) and the gel-purified 3.65 kb fragment was ligated with Hindlll-linearized, calf alkaline phosphatase-treated YpGX262. The new plasmid, YpGX262GAL4, was utilized to express the gala- tose-regulated PHO5 signal-At-III sequence in yeast.
Construction of expression/secretion vectors encoding the two additional forms of At-III
The expression/secretion vectors encoding the other signal sequences were generated in a very similar manner to that described for the PHO5 signal. The main difference was the number of rounds of oligonucleotide-directed mutagenesis used to create the desired signal sequence.
Construction of the expression/secretion vectors containing the invertase (SUC2) signal fused to the coding sequence for mature At-III is described in Figures 23 through 26. Because the SUC2 signal is only 19 amino acids long, two rounds of mutagenesis were sufficient to insert this sequence. The final set of expression/secretion vectors, those containing the At-III signal sequence, was constructed as described in Figures 27 through 30. Three rounds of mutagenesis were required to insert this signal sequence. The level of soluble At-III protein produced by strain D8 transformed with the newly constructed expression vectors is shown in Table I. Soluble At-III levels for strains that produce PHO5 signal- At-III and natural pre-At-III are quite high, measuring 121 mg/l and 17.4 mg/l, respectively.
To measure the level of insoluble At-III protein produced by PHO5 signal-At-III-containing strains, the Western blots of insoluble and soluble At-III protein were compared. This indicated that insoluble At-III protein accumulates at about 1 g/l in shake-flask cultures of these strains. Such ultrahigh expression could not have been predicted from previous results.
EXAMPLE II
Assembly of an Expression Vector Encoding PHO5 Signal-At-III
A cDNA gene encoding antithrombin-III protein is prepared as described by Bock et al. (U.S. Patent No. 4,157,294) and is cloned into an E. coli plasmid such as pTA2.
The AT-III cDNA coding sequence is excised from pTA2 as an EcoRI-PstI fragment. A limited PstI digest permits isolation of molecules which have not been digested within the At-III coding sequence.
Double-stranded phage M13mpl8 DNA is digested with restriction endonucleases EcoRI and PstI, and the large vector fragment is gel purified. This DNA molecule is ligated with the EcoRI-PstI At-III cDNA and, following transformation of E. coli M13, plaques con- taining the recombinant DNA molecules are identified by restriction digest analysis. To place a restriction endonuclease restriction site immediately following the TAA translation stop codon, oligonucleotide directed mutagenesis, Zoller et al., Ann. Rev. Genetics 19:423-462 (1985)), is performed. In this case a restriction endonuclease recognition site for BamHI is inserted immediately after the TAA codon. A suitable oligonucleotide to prime this mutagenesis is:
5' GCAAAGAATAAGAACATTGGATCCTTACTTAACACAAGG
The mutagenized molecules containing the new BamHI site are identified by digesting double-stranded DNA with BamHI and determining which molecules are linearized. The presence and proper positioning of the BamHI site is confirmed by DNA sequence analysis. Sanger, Science 214:1205-1210 (1981)). This M13 vector is called M13At-2.
To place a Smal restriction endonuclease site at the start of the mature At-III coding region, double-stranded M13At-2 DNA is digested with EcoRI and SacII, and the large vector fragment is gel purified. The 5' coding region of At-III and a Smal site are then added by ligating the gel purified M13At-2 DNA with two oligonucleotides which have been annealed. Suitable oligonucleotides for this purpose are:
A 5' AATTCCCGGGCACGGTTCTCCGGTTGACATCTGCACCGCGAAACCGC B 3' GGGCCCGTGCCAAGAGGCCAACTGTAGACGTGGCGCTTTGG Following transformation of E. coli, phage molecules carrying the inserted oligonucleotides are identified by hybridization and the sequence is confirmed by DNA sequence analysis. The vector so prepared is M13-At-3.
The At-III cDNA molecule is excised from M13At-3 using the Smal and BamHI restriction sites and reintroduced by ligation into M13mp18 which has been digested with Smal and BamHI. The new M13 vector is M13At-4. Double-stranded M13At-4 is digested with Smal. The DNA is then digested with Hindlll and the At-III-containing fragment is gel purified.
The yeast upstream activation site (UAS) and transcription initiation site (TIS), and PHO5 signal encoding region are removed from vector YpGX265GAL4 (Deposited as ATCC # 67233) (Figure 31) by digesting with Hindlll and EcoRV and the fragment is gel purified. This fragment is ligated with the previously prepared M13At-4 DNA and Hindlll linearized M13mpl8 DNA in a three-way ligation. Following transformation of E. coli vector molecules carrying the At-III sequence in phase with yeast signal sequence are identified by restriction digestion.
To create a molecule in which the PHO5 signal encoding sequence is linked to the cDNA encoding mature At-III without extraneous nucleotides, an oligonucleotide directed mutagenesis is performed to delete those bases. A suitable oligonucleotide to prime this mutagenesis is:
5 ' GTCAACCGGAGAACCGTGAGCGTTGGCCAAAGAAGC Mutant clones can then be identified by hybridization with oligonucleotide used for mutagenesis (which is now labeled with 32P) and the sequence is confirmed by DNA sequence analysis. The vector is called M13At-5. The yeast UAS, TIS and signal encoding sequences and the At-III gene are then excised from double-stranded M13At-5 by digesting with Hindlll and BamHI.
YpGX255GAL4 is digested with Hindlll to excise the GAL4 gene, which is then gel purified and saved. The plasmid fragment is then digested with BamHI and the large vector fragment is gel purified. This fragment is then ligated with the purified M13-At-5 BamHI- Hindlll fragment. The desired plasmid is identified by restriction endonuclease analysis and is called YpGX262.
YpGX262 is linearized with enzyme Hindlll and treated with calf alkaline phosphatase. The Hindlll GAL4 fragment is ligated with the Hindlll-linearized calf alkaline phosphatase-treated YpGX262. Following transformation of E. coli, recombinant DNA molecules carrying the GAL4 gene are identified. The vector is called YpGX262GAL4.
Deletion of the PHO5 Signal Encoding Sequence
M13mp9 (commercially available) is digested with enzymes BamHI and Hindlll and gel purified. YpGX262 is digested with Hindlll and BamHI and the fragment carrying the UAS, TIS, signal and At-III is gel purified. These two DNA fragments are ligated and E. coli is transformed. The desired vector, MGX428', is iden tified by restriction analysis of double-stranded DNA. Single-stranded template MGX428' DNA is prepared and oligonucleotide directed mutagenesis is performed to delete the PHO5 signal encoding sequence. A suitable oligonucleotide to prime this mutagenesis is:
5' GTCAACCGGAGAACCGTGTCTTTTGGTCGTTTATATTGTG
Mutant clones are identified by probing with an oligonucleotide of this sequence, which recognizes the boundaries on either end of the PHO5 signal encoding sequence. Successful completion of the mutagenesis is confirmed by DNA sequence analysis. The new vector is MGX408'. This vector carries the coding sequence for methionine-At-III.
Assembly of an Expression Vector Encoding SUC2 Signal-At-III
Template DNA is prepared from MGX408' in preparation for oligonucleotide directed mutagenesis. The SUC2 signal sequence is inserted at the 5' end of the At-III gene in two consecutive insertion mutageneses. An appropriate oligonucleotide for the first step has the sequence
5' AACCGGAGAACCGTGCAAAAGGAAAAGGAAGGCTTGCAAAAGCA TTCTTTTGGTCGT
This oligonucleotide is used as the primer for oligonucleotide directed mutagenesis to insert the C terminus of the SUC2 signal encoding sequence. The mutagenic oligonucleotide is then labeled with 32P and used as a probe to screen M13 plaques for the presence of the insertion. The sequence is confirmed by DNA sequence analysis. The desired mutant clone is called MGX419'.
Single-stranded MGX419' template DNA is prepared and used in a second round of mutagenesis in which the remaining coding sequence for the SUC2 is inserted. The oligonucleotide used to prime this mutagenesis is
5' AACCGGAGAACCGTGTGCAGATATTTTGGCTGCAAAACCAGCCAAAA GGAAAAGGAA
As in previous examples the mutagenic oligonucleotide can then be labeled with 32P and used to detect mutant clones by hybridization screening. Molecules which are positive in this hybridization screen are then analyzed by DNA sequence analysis to confirm the successful mutagenesis. The new vector, MGX420', carries the entire coding sequence for the SUC2 signal linked to the AT-III coding sequence.
The UAS, TIS, signal coding sequence, and At-III coding sequence are excised from double-stranded MGX420' DNA with restriction endonucleases Hindlll and BamHI and purified by gel electrophoresis.
YpGX262 is digested with enzymes BamHI and Hindlll and the large vector fragment is gel purified. A ligation is performed with these two DNA fragments and S. coli is then transformed. The E. coli transformants are then screened by restriction digest analysis for insertion of the DNA fragment from MGX420'. The desired plasmid is called YpGX254. YpGX254 is digested with Hindlll and then treated with calf alkaline phosphatase. The Hindlll fragment from YpGX265GAL4 carrying the GAL4 gene is then inserted into this vector by ligation and E. coli cells are transformed. The desired plasmid is identified by restriction digest analysis and is called YpGX254GAL4.
Assembly of an Expression Vector Encoding Pre-At-III
Template DNA is prepared from MGX408' for use in oligonucleotide directed mutagenesis. The At-III signal sequence as determined by Bock et al. (U.S. Patent No. 4,517,294) is inserted at the 5' end of the At-III gene in three consecutive insertion mutageneses. An appropriate oligonucleotide for the first step has the sequence.
5' GTCAACCGGAGAACCGTGACAGGTCACGCAGTCCCAGAA GCCAATGAGCATTTTGGTCGTTTATATTGT
This oligonucleotide is used as the primer for oligonucleotide directed mutagenesis to insert the C terminus of the At-III signal encoding sequence. The mutagenie ologonucleotide is then labeled with 32P and used as a probe to screen M13 plaques for the presence of the insertion. The sequence is confirmed by DNA sequence analysis. The desired mutant clone is called
MGX429'.
Single-stranded MGX429' template DNA is prepared and used in a second round of mutagenesis in which the coding sequence for the middle of the At-III signal is inserted. The oligonucleotide used to prime this mutagenesis is
5' CCCAGAAGCCAATGAGCAGCAAGGACAAAAGATAAA CCTTCCTTTTTCCCATTTTGGTCGTTTATATTGTG
As in previous steps, the mutagenic oligonucleotide can then be labeled with 32P and used to detect mutant clones by hybridization screening. Molecules which are positive in this hybridization screen are then analyzed by DNA sequence analysis to confirm the successful mutagenesis. The new vector, MGX430', carries approximately two-thirds of the At-III signal coding sequence linked to the mature At-III coding sequence.
Template DNA is prepared from MGX430' and used in a mutagenesis with an oligonucleotide which provides the remaining coding sequence for the At-III signal N-terminus. The oligonucleotide has the sequence:
5' AAACCTTCCTTTTTCCAGAGGTTACAGTTCCTATCACATTGGAA TACATTTTGGTCGTTTATATTGTG
Following mutagenesis with this oligonucleotide, again a hybridization screen with 32P-labeled mutagenic oligonucleotide reveals single-stranded DNA molecules from the M13 plaques containing the desired sequence. The presence of the coding region for the entire AT-III signal is confirmed by DNA sequence analysis. The new vector is called MGX431'.
The promoter, signal coding sequence, and mature At-III coding sequence are excised from double-strand ed MGX431' DNA with restriction endonucleases Hindlll and Bam HI and purified by gel electrophoresis.
YpGX262 is digested with enzymes BamHI and Hindlll and the large vector fragment is gel purified. A ligation is performed with the DNA fragments and E. coli is then transformed. The E. coli transformants are then screened by restriction digest analysis for insertion of the DNA fragment from MGX431'. The desired plasmid is called YpGX264.
YpGX264 is digested with Hindlll and then treated with calf alkaline phosphatase. The Hindlll fragment from YpGX265GAL4 carrying the GAL4 gene is then inserted into this vector by ligation and E. coli cells are transformed. The desired plasmid is identified by restriction digest analysis and is called YpGX264GAL4.
Assembly of an Expression Vector Encoding Methionine-Proline-At-III
According to Daum et al. (U.S. Patent No. 4,543,329), it should be possible to produce methionine-proline-At-III in a microorganism and then process that molecule in vitro to generate mature At-III. To assemble a vector for production of that molecule the following procedure is followed.
Template DNA is prepared from MGX408' in preparation for oligonucleotide directed mutagenesis. A proline codon is inserted between the methionine initiation codon and the mature At-III coding sequence. An appropriate oligonucleotide for this step has the sequence
5' CGGAGAACCGTGTGGCATTCTTTTGGTCG The mutagenic oligonucleotide is then labeled with
32 P and used as a probe to screen M13 plaques for the presence of the insertion. The sequence is confirmed by DNA sequence analysis. The desired mutant clone is called MGX423'.
The promoter, signal coding sequence, and At-III coding sequence are excised from double-stranded MGX423' DNA with restriction endonucleases Hindlll and BamHI and purified by gel electrophoresis. YpGX262 is digested with enzymes BamHI and Hindlll and the large vector fragment is gel purified.
A ligation is performed with these two DNA fragments and E. coli is then transformed. The E. coli transformants are then screened by restriction digest analysis for insertion of the DNA fragment from MGX423'. The desired plasmid is called YpGX256.
YpGX256 is digested with Hindlll and then treated with calf alkaline phosphatase. The Hindlll fragment from YpGX265GAL4 carrying the GAL 4 gene is then inserted into this vector by ligation and E. coli cells are transformed. The desired plasmid is identified by restriction digest analysis and is called YpGX256GAL4.
Tranformation of Yeast and Induction of Foreign Gene Expression
The method of Hinnen et al., Proc. Natl. Acad. Sci. USA 75:1929-1933 (1978) is used to transform appropriate yeast strains such as D8. Appropriate strains for these studies are ones which have nuclear mutations in the S. cerevisiae LEU2 gene. ATCC strain # 44769, for example, is appropriate for this purpose. The transformed yeast strains are maintained on a medium composed of 0.7% yeast nitrogen base, 10% glucose (YNBD10) plus appropriate nutritional supplements, if required.
To grow the transformed cells for production of the foreign protein these cells are transferred to a medium composed of yeast extract (1%), peptone (2%), glucose (1%), galactose (1%) and grown for 1-2 days at 30°C with shaking. Alternatively the cells can be grown to high density using only glucose as the carbon source, and as the glucose is exhausted expression of the foreign protein will commence.
A third method used to induce expression of the protein product is as follows. The cells were inoculated into culture medium composed of yeast nitrogen base (0.7%) and 2% glucose. These cells were grown for approximately 16 hours at 30°C with shaking.
Figure imgf000058_0001
1 Soluble At-III protein was determined by radioimmunoassay. the protein level is expressed as milligrams per liter of yeast culture. Western blot analysis of insoluble and soluble At-III produced by these strains indicated that about 10% of the At-III was soluble.
The cells were then pelleted by centrifugation and resuspended to the original volume in medium composed of yeast extract 1%, peptone (2%) and glucose (2%). the cells were grown for approximately 24 hours at 30°C with shaking. These cells were then pelleted by centrifugation and resuspended to the original volume in medium composed of yeast extract (1%), peptone (2%) and galactose (2%) and grown for approximately 24 hours at 30°C with shaking. The cells were pelleted by centrifugation and then broken by vortexing with glass beads in a buffer composed of 25mM Tris, 125mM EDTA, pH 8.4. The soluble and insoluble cellular proteins were separated by centrifugation and the amount of antithrombin III protein in the soluble fraction was measured by radioimmunoassay. The results of these assays for strain D8 transformed with the At-III expression vectors listed are presented in Table I.
In addition, comparable amounts of yeast soluble and insoluble protein from the transformed strains were compared by Western blot analysis. These Western blots indicated that only about 10% of the antithrombin III produced by these strains is in the soluble fraction and therefore the total amount of antithrombin III accumulating in the cells after induction is about 10 fold more than the value indicated in the radioimmunoassay.
To confirm that very high levels of antithrombin III protein were remaining associated with the insoluble yeast cellular protein, this protein fraction from strain DB(YpGX262GAL4) was examined by SDS-poly- acrylamide gel electrophoresis according to the method of Lemmiae, Nature 227:680-635(1970). Samples from cells grown in YPD (no galactose induction) or YPGal (galactose induced) were compared. As can be seen in Figure 32, following staining of the gel with Coomassie brilliant blue, a prominent band of antithrombin III protein appeared only in the induced sample. This protein routinely composed 25-50% of the total yeast insoluble protein observed by this method.
I
Figure imgf000061_0001

Claims

WHAT IS CLAIMED IS:
1. A DNA expression system comprising:
(I) a DNA expression vector capable of effecting expression of a polypeptide in a yeast host comprising, in phase:
(a) a hybrid first yeast promoter comprising the functional segment of the regulatory region of a galactose-inducible promoter gene operably linked to the functional segment of the transcription initiation site of an alpha mating factor gene;
(b) the functional segment of a signal sequence, said signal sequence substantially comprising preferred yeast codons;
(c) the functional segment of a DNA sequence encoding a transcription terminator;
(d) a yeast replicon;
(e) the functional segment of a DNA sequence encoding a selectable yeast marker; and
(II) a source of the peptide encoded by the DNA sequence of the GAL4 structural gene.
2. The DNA expression system of claim 1, said DNA expression vector further comprising, inserted in phase between the signal sequence and the transcription terminator, the functional segment of a DNA sequence encoding a heterologous target peptide.
3. The DNA expression system of claim 1, wherein said DNA expression vector is a plasmid.
4. The DNA expression system of claim 1, wherein said DNA expression vector is a shuttle vector.
5. The DNA expression system of claim 1, wherein said hybrid first yeast promoter comprising the functional segment of the promoter region of a galactose-inducible structural gene comprises the functional segment of the DNA sequence encoding the GAL1-10 upstream activation site.
6. The DNA expression system of claim 1, wherein said hybrid first yeast promoter comprising the functional segment of the promoter region of a galactose-inducible structural gene comprises the functional segment of a DNA sequence encoding an upstream activation site selected from the group consisting of GAL1, GAL7, GAL10 and GAL80.
7. The DNA expression system of claim 1, wherein said hybrid first yeast promoter comprising the functional segment of the promoter region of a galactose-inducible structural gene comprises the functional segment of the upstream activation site of GAL1.
8. The DNA expression system of claim 1, wherein said signal sequence is derived from the DNA sequence encoding yeast acid phosphatase.
9. The DNA expression system of claim 8, wherein said DNA sequence encodes repressible acid phosphatase signal sequence.
10. The DNA expression system of claim 8, wherein said DNA sequence encodes the PHO5 signal sequence.
11. The DNA expression system of claim 1, wherein said transcription terminator is derived from the DNA sequence encoding yeast glyceraldehyde-3-phosphate dehydrogenase.
12. The DNA expression system of claim 11, wherein said yeast is Saccharomyces.
13. The DNA expression system of claim 11, wherein said yeast is S. cerevisiae.
14. The DNA expression system of claim 1, wherein said replicon is derived from the DNA sequence encoding the yeast 2 micron circle.
15. The DNA expression system of claim 14, wherein said yeast is Saccharomyces.
16. The DNA expression system of claim 14, wherein said yeast is S. cerevisiae.
17. The DNA expression system of claim 1, wherein said selectable yeast marker is derived from the DNA sequence encoding the LEU2 gene.
18. The DNA expression system of claim 1, wherein said selectable yeast marker is derived from the DNA sequence encoding the LEU2-d gene.
19. The DNA expression system of claim 1, wherein said transcription initiation site of an alpha mating factor gene is derived from the MF-alpha-1 gene.
20. The DNA expression system of claim 19, wherein said transcription initiation site comprises bases -158 to -1.
21. The DNA expression system of claim 5, wherein said DNA sequence encoding the GAL1-10 upstream activation site comprises bases -610 to -157.
22. The DNA expression system of claim 1, wherein said signal sequence is:.
ATGTTCAAATCTGTTGTTTACTCTATTTTGGCTGCTTCTTTGGCCA ACGCT.
23. The DNA expression system of claim 1, wherein said DNA sequence encoding a transcription terminator is:
GGATCCCGGGTTTTTTATAGCTTTATGACTTAGTTTCAATTATATA CTATTTAATGACATTTTCAG.
24. The DNA expression system of claim 1, wherein said replicon is derived from plasmid pJDB207.
25. The DNA expression system of claim 1, wherein said selectable yeast marker is derived from plasmid pJDB207.
26. A DNA sequence comprising, in phase:
(a) a hybrid first yeast promoter comprising the functional segment of the regulatory region of a galactose-inducible promoter gene operably linked to at least a portion of the transcription initiation site of an alpha mating factor gene;
(b) the functional segment of a signal sequence, said signal sequence substantially comprising preferred yeast codons;
(c) the functional segment of a DNA sequence encoding a transcription terminator;
(d) a yeast replicon; and
(e) the functional segment of DNA sequence encoding a selectable yeast marker.
27. The DNA sequence of claim 26, wherein said sequence is integrated into yeast chromosomal material.
28. The integrated sequence of claim 27, further comprising the functional segment of a DNA sequence encoding a heterologous peptide.
29. A yeast host transformed with the DNA expression vector of claim 1.
30. The yeast host of claim 29, wherein said host is Saccharomyces.
31. The host of claim 30, wherein said Saccharomyces is S. cerevisiae.
32. The yeast host of any of claims 29, 30 or 31, wherein production of the target peptide is inducible by the presence of galactose in the culture medium.
33. Yeast strain designated YpGX265GAL4, Accession No. 67233, deposited with the American Type Culture Collection.
34. A hybrid promoter comprising the functional segment of the DNA sequence encoding the upstream activation site of GAL1-10 operably linked to the functional segment of the transcription initiation site of MF-alpha-1.
35. A plasmid system comprising:
(I) a plasmid comprising:
(a) a hybrid first yeast promoter comprising the functional segment of the DNA sequence encoding the upstream activation site of GAL1-10 operably linked to the functional segment of the transcription initiation site of MF-alpha-1;
(b) the functional segment of the PHO5 signal sequence, said sequence substantially comprising preferred yeast codons;
(c) the functional segment of the DNA sequence comprising a Saccharomyces GAPDH transcription terminator; (d) the functional segment of the Saccharomyces 2 micron circle replication origin;
(e) the functional segment of the yeast LSU2-d selectable marker; and
(II) a source of the peptide encoded by the DNA sequence of the GAL4 structural gene.
36. The plasmid system of claim 35, said plasmid further comprising, in phase, the functional segment of the DNA sequence encoding a heterologous target peptide.
37. A method of producing a heterologous target peptide in a yeast host, comprising culturing said yeast host transformed with said DNA expression vector of the DNA expression system of claim 2; causing expression of said target peptide; and recovering said target peptide.
38. The DNA expression system of claim 1, said source of the peptide encoded by the DNA sequence of the GAL4 structural gene (II) comprising the functional segment of the DNA sequence encoding the GAL4 structural gene, said DNA sequence being operably linked to the functional segment of a DNA sequence encoding a second yeast promoter, being present, in phase, in said DNA expression vector (I).
39. The DNA expression system of claim 1, said source of the peptide encoded by the DNA sequence of the GAL4 structural gene (II) comprising the function- al segment of the DNA sequence encoding the GAL4 structural gene, said DNA sequence being operably linked to the functional segment of a DNA sequence encoding a second yeast promoter, being contained in a second expression vector.
40. The DNA expression system of claim 1, wherein said peptide encoded by the DNA sequence of the GAL4 structural gene is added to the medium containing said DNA expression vector.
41. The DNA sequence of claim 26, further comprising the functional segment of the DNA sequence encoding the GAL4 structural gene, said DNA sequence being operably linked to the functional segment of a DNA sequence encoding a second yeast promoter.
42. The DNA sequence of claim 41, wherein said sequence is integrated into yeast chromosomal material.
43. The integrated sequence of claim 42, further comprising the functional segment of a DNA sequence encoding a heterologous peptide.
44. The plasmid system of claim 35, said source of the peptide encoded by the DNA sequence of the GAL4 structural gene (II) comprising the functional segment of the DNA sequence encoding the GAL4 structural gene, said DNA sequence being operably linked to the functional segment of a DNA sequence encoding a second yeast promoter, being present, in phase, in said plasmid.
45. The plasmid system of claim 35, said source of the peptide encoded by the DNA sequence of the GAL4 structural gene (II) comprising the functional segment of the DNA sequence encoding the GAL4 structural gene, said DNA sequence being operably linked to the functional segment of a DNA sequence encoding a second yeast promoter, being contained in a second plasmid.
46. The plasmid system of claim 35, wherein said peptide encoded by the DNA sequence of the GAL4 structural gene (II) is added to the medium containing said plasmid (I).
47. The DNA expression system of claim 1, Wherein said hybrid first yeast promoter comprising the functional segment of the promoter region of a galactose-inducible structural gene comprises the functional segment of a synthetic DNA sequence capable of binding to the GAL4 protein.
48. The DNA expression system of claim 8, wherein said yeast is Saccharomyces.
49. The DNA expression system of claim 8, wherein said yeast is S. cerevisiae.
50. Human antithrombin III protein produced by the method of claim 37.
PCT/US1987/002663 1986-10-14 1987-10-13 Composite yeast vectors WO1988002779A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US918,147 1986-10-14
US06/918,147 US5013652A (en) 1986-10-14 1986-10-14 Composite yeast vectors

Publications (1)

Publication Number Publication Date
WO1988002779A1 true WO1988002779A1 (en) 1988-04-21

Family

ID=25439883

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1987/002663 WO1988002779A1 (en) 1986-10-14 1987-10-13 Composite yeast vectors

Country Status (3)

Country Link
US (1) US5013652A (en)
EP (1) EP0329684A4 (en)
WO (1) WO1988002779A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0836482A1 (en) * 1995-05-24 1998-04-22 Hawaii Biotechnology Group, Inc. Subunit vaccine against flavivirus infection

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5202236A (en) * 1984-09-13 1993-04-13 Enzon Labs Inc. Method of producing bioadhesive protein
US5242808A (en) * 1984-09-13 1993-09-07 Enzon, Inc. Production of bioadhesive precursor protein analogs by genetically engineered organisms
US5202256A (en) * 1984-09-13 1993-04-13 Enzon Labs, Inc. Bioadhesive precursor protein expression vectors
US5879907A (en) * 1987-09-14 1999-03-09 Skandigen Ab Artificial gene coding for authentic human serum albumin, use thereof and method
US5281520A (en) * 1990-09-12 1994-01-25 Zymogenetics, Inc. Method for producing acyloxyacyl hydrolase
US5863783A (en) * 1991-03-27 1999-01-26 Gist-Brocades, N.V. Cloning and expression of DNA molecules encoding arabinan-degrading enzymes of fungal origin
US5989887A (en) * 1992-11-25 1999-11-23 Dsm N.V. Cloning and expression of DNA molecules incoding arabinan-degrading enzymes of fungal origin
DK6893D0 (en) * 1993-01-21 1993-01-21 Novo Nordisk As PEPTIDE
US5866404A (en) * 1995-12-06 1999-02-02 Yale University Yeast-bacteria shuttle vector
WO1997024457A1 (en) 1995-12-29 1997-07-10 Guilford Pharmaceuticals Inc. Method and kit for detection of multiple protein interactions
WO1998018918A1 (en) * 1996-10-29 1998-05-07 Commonwealth Scientific And Industrial Research Organisation Stable expression of triple helical proteins
US20020137890A1 (en) * 1997-03-31 2002-09-26 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP1015612B1 (en) * 1997-05-27 2005-01-26 Hanil Synthetic Fiber Co., Ltd. Process for preparing recombinant proteins using highly efficient expression vector from saccharomyces cerevisiae
US7419801B2 (en) * 2003-08-08 2008-09-02 Arriva Pharmaceuticals, Inc. Methods of protein production in yeast
AU2004290587B2 (en) * 2003-11-14 2010-08-12 Arriva Pharmaceuticals, Inc. Alpha 1-antitrypsin compositions and treatment methods using such compositions
US20070105768A1 (en) * 2004-11-10 2007-05-10 Rajiv Nayar Dry recombinant human alpha 1-antitrypsin formulation
WO2007130403A2 (en) * 2006-05-02 2007-11-15 University Of Pittsburgh-Of The Commonwealth System Of Higher Education REGULATION OF ApoB BY Hspl 10 PROTEINS AND RELATED COMPOSITIONS AND METHODS
MX2010011068A (en) * 2008-04-08 2010-11-04 Amyris Biotechnologies Inc Expression of heterologous sequences.

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4517294A (en) * 1982-03-03 1985-05-14 Genentech, Inc. Human antithrombin III
EP0174585A2 (en) * 1984-09-14 1986-03-19 Miles Laboratories, Inc. Promoters and the use thereof in the expression of unfused procaryotic or eucaryotic proteins in yeast

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL60184A (en) * 1979-05-31 1984-05-31 Schering Ag Process for the specific cleavage of protein sequences from proteins
US4546082A (en) * 1982-06-17 1985-10-08 Regents Of The Univ. Of California E. coli/Saccharomyces cerevisiae plasmid cloning vector containing the alpha-factor gene for secretion and processing of hybrid proteins
GB2125047B (en) * 1982-08-09 1986-02-19 Ciba Geigy Ag Yeast hybrid vectors and their use for the production of polypeptides
WO1984001153A1 (en) * 1982-09-15 1984-03-29 Collaborative Res Inc Production of interferon in yeast by use of invertase promoter
JPS5974988A (en) * 1982-10-20 1984-04-27 Suntory Ltd Induction developable plasmid vector of yeast and method for utilizing the same
JPH0716432B2 (en) * 1982-10-20 1995-03-01 サントリー株式会社 Method for producing peptide using yeast high expression vector plasmid
NO840200L (en) * 1983-01-28 1984-07-30 Cefus Corp GLUCOAMYLASE CDNA.
US4661454A (en) * 1983-02-28 1987-04-28 Collaborative Research, Inc. GAL1 yeast promoter linked to non galactokinase gene
NZ207926A (en) * 1983-04-25 1988-04-29 Genentech Inc Use of yeast #a#-factor to assist in expression of proteins heterologus to yeast
ZA843275B (en) * 1983-05-05 1984-12-24 Hoffmann La Roche Novel vectors for interferon expression
EP0129268B1 (en) * 1983-05-19 1989-10-04 Unilever N.V. Improvements in the expression of newly introduced genes in yeast cells
EP0128743A3 (en) * 1983-06-07 1985-12-27 Genex Corporation Expression of foreign genes in yeast
EP0480480A3 (en) * 1984-05-11 1992-06-10 Chiron Corporation Enhanced yeast transcription employing hybrid promoter region constructs
JPS60248181A (en) * 1984-05-23 1985-12-07 Shiseido Co Ltd Yeast manifestation vector
DE3581722D1 (en) * 1984-07-20 1991-03-14 Celltech Ltd EUKARYOTIC EXPRESSION VECTORS.
JPS61503002A (en) * 1984-07-31 1986-12-25 アプライド・リサーチ・システムズ・エイアールエス・ホールディング・ナムローゼ・フェンノートシャップ yeast cloning vector
US5336609A (en) * 1984-12-06 1994-08-09 Labofina, S.A. Transformed yeasts for producing lysozyme, plasmids used for this transformation, method of producing lysozyme

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4517294A (en) * 1982-03-03 1985-05-14 Genentech, Inc. Human antithrombin III
EP0174585A2 (en) * 1984-09-14 1986-03-19 Miles Laboratories, Inc. Promoters and the use thereof in the expression of unfused procaryotic or eucaryotic proteins in yeast

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
A. HINNEN et al CHEM. ABSTRACTS Vol. 102 No. 40931k p. 150 published 1985 by CHEM. ABSTRACTS (Columbus, Ohio). *
A. TOH-E et al, "A Stable Plasmid Carrying the yeast Lev2 Gene and Containing only yeast Deoxyribonucleic Acid", J. Bact. Vol. 141 No. 1 pp 413-416 published January 1985 by Amer. Soc. for Microbiol. (Washington, D.C.). (See the entire document). *
D.T. ROGERS et al, "Acid Phosphatase Polypeptides in Saccharomyces Cerevisiae are Encoded by a Differentially Regulated Multigene Family" Proc. Natl. Acad. Sci. Vol. 79 pp 2157-2161, April 1982 by National Academy of Science (Washington, D.C.). See the discussion. *
G.A. BITTER et al, "Secretion of Foreign Proteins from Saccharomyces Cerevisiae Directed by a -Factor Gene Fusions" Proc. Natl. Acad. Sci. Vol. 81, pp 5330-5334 September 1984 by National Academy of Science (Washington, D.C.). See Results Section in particular. *
J.P. HOLLAND et al, "The Primary Structure of Glyceraldehyde-3-Phosphate Dehydrogenase Gene from Saccharomyces Cerevisiae", J. Biol. Chem. Vol. 254 No. 19, pp 9839-9845, published 1979 by Amer. Soc. Biol. Chem. (Washington, D.C.). See Fig. 4 in particular. *
L. GUARENTE et al, "A Gallo-CyCl Hybrid yeast promoter Identifies the Gal4 Regulatory Region as an Upstream Site" Proc. Natl. Acad. Sci. Vol. 79, pp. 7410-7414, December 1982 by National Academy of Science (Washington, D.C.). See the entire document. *
M. JOHNSTON et al, "Sequences that Regulate the Divergent Gall-Gal10 promoter in Saccharomyces Cerevisiae" Mol. Cell Biol. Vol. 4, No. 8 pp 1440-1448 August 1984 by Amer. Soc. Microbiol. (Washington, D.C.). See the entire document. Especially Dicussion. *
R. YOCUM et al, "Use of Lac Z Fusions to Delimit Regulatory Elements of the Inducible Divergent Gall-Gal10 promoter in Saccharomyces Cerevisiae" Mol. Cell. Biol., Vol. 4 No. 10 pp 1985-1978, October 1984 by American Soc. Microbiol (Washington, D.C.). See the entire document. *
See also references of EP0329684A4 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0836482A1 (en) * 1995-05-24 1998-04-22 Hawaii Biotechnology Group, Inc. Subunit vaccine against flavivirus infection
EP0836482A4 (en) * 1995-05-24 1999-09-01 Hawaii Biotech Group Subunit vaccine against flavivirus infection

Also Published As

Publication number Publication date
US5013652A (en) 1991-05-07
EP0329684A4 (en) 1989-10-25
EP0329684A1 (en) 1989-08-30

Similar Documents

Publication Publication Date Title
US5013652A (en) Composite yeast vectors
US5037743A (en) BAR1 secretion signal
Clare et al. Production of mouse epidermal growth factor in yeast: high-level secretion using Pichia pastoris strains containing multiple gene copies
CA1340547C (en) Novel secretory leader sequences for yeasts
US6642029B1 (en) Hybrid DNA synthesis of mature insulin-like growth factors
EP0329203B1 (en) Yeast expression systems with vectors having pyk promoters, and synthesis of foreign protein
US4546082A (en) E. coli/Saccharomyces cerevisiae plasmid cloning vector containing the alpha-factor gene for secretion and processing of hybrid proteins
US4588684A (en) a-Factor and its processing signals
US5024941A (en) Expression and secretion vector for yeast containing a glucoamylase signal sequence
JP2793215B2 (en) Improved expression and secretion of heterologous proteins in yeast using truncated .ALPHA.-factor leader sequences
JP2680054B2 (en) A DNA construct having a Kluyveromyces α-factor leader sequence that directs secretion of a heterologous polypeptide
JPS63501614A (en) How to use BAR1 to secrete foreign proteins
JPH03143385A (en) Yeast cell
EP0316444B1 (en) Yeast expression vector
US5010003A (en) Use of yeast homologous signals to secrete heterologous proteins
US5667986A (en) Yeast promoter for expressing heterologous polypeptides
US4935350A (en) Materials and methods for controlling plasmid copy number and stability
EP0127304A1 (en) Process for producing heterologous protein in yeast, expression vehicle therefor, and yeast transformed therewith
EP0121884B1 (en) Hybrid dna synthesis of insulin
AU627147B2 (en) Production of human parathyroid hormone from microorganisms
JPH04339259A (en) Detection method for mutation strain
US5015575A (en) Hybrid DNA synthesis of insulin
EP0424117A1 (en) Yeast promoter
KR20010020482A (en) Improved protein expression strains
JPH0213377A (en) Production of desulfatohirudin compound

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE FR GB IT LU NL SE

WWE Wipo information: entry into national phase

Ref document number: 1987907201

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1987907201

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1987907201

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1987907201

Country of ref document: EP