WO1984004749A1 - Novel preparation of nucleoside phosphoramidite intermediates - Google Patents

Novel preparation of nucleoside phosphoramidite intermediates Download PDF

Info

Publication number
WO1984004749A1
WO1984004749A1 PCT/US1984/000743 US8400743W WO8404749A1 WO 1984004749 A1 WO1984004749 A1 WO 1984004749A1 US 8400743 W US8400743 W US 8400743W WO 8404749 A1 WO8404749 A1 WO 8404749A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
chemical reaction
molar concentration
weak acid
iii
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1984/000743
Other languages
English (en)
French (fr)
Inventor
Serge Laurent Beaucage
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beckman Coulter Inc
Original Assignee
Beckman Instruments Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beckman Instruments Inc filed Critical Beckman Instruments Inc
Priority to DE8484902180T priority Critical patent/DE3479662D1/de
Publication of WO1984004749A1 publication Critical patent/WO1984004749A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07FACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00Compounds containing elements of Groups 5 or 15 of the Periodic Table
    • C07F9/02Phosphorus compounds
    • C07F9/547Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/553Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having one nitrogen atom as the only ring hetero atom
    • C07F9/572Five-membered rings
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/55Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Definitions

  • This invention relates to a method for preparing nucleoside phosphoramidite intermediates.
  • oligonucleotide synthesis was the introduction of the phosphite coupling approach by Letsinger and coworkers (1-3). This approach has been adapted to the synthesis of deoxyoligonucleotides (4-8), oligoribonucleotides (9-12), and nucleic acid analogs (13-15).
  • the approach involves the reaction of a suitably protected nucleoside, a bifunctional phosphitylating agent such as methoxydichlorophosphine, and a second protected nucleoside. Mild oxidation using iodine in tetrahydrofuran, lutidine and water generates the natural internucleotide bond.
  • phosphorus analogs such as selenophosphates (14), imidophosphates (14) and thiophosphates (14, 15) can be generated.
  • a serious limitation of this methodology has been the instability .of the reactive intermediates (nucleoside phosphomonochloridites or monotetrazolides) towards hydrolysis and air oxidation. This problem has been circumvented by either preparing the reactive species immediately prior to use or storing the active phosphite as a precipitate in hexanes at -20°C.
  • X is a phosphate protecting group
  • Y is a certain type of secondary amino group
  • Z is a hydroxy protecting group
  • A is selected from a group consisting of -H, -OH, and -OZ
  • B is selected from a group consisting of purine and pyrimidine bases.
  • Y is a saturated secondary amino group, i.e., one in which no double bond is present in the secondary amino radical. More particularly, Y is NR 1 R 2 , wherein R 1 and R 2 taken separately each represents alkyl, aralkyl, cycloalkyl and cycloalkylalkyl containing up to 10 carbon atoms; R 1 and R 2 when taken together form an alkylene chain containing up to 5 carbon atoms in the principal chain and a total of up to 10 carbon atoms with both terminal valence bonds of said chain being attached to the nitrogen atom to which R 1 and R 2 are attached; and R 1 and R 2 when taken together with the nitrogen atom to which they are attached form a saturated nitrogen heterocycle including at least one additional heteroatom from the group consisting of nitrogen, oxygen and sulfur.
  • Amines from which the group NR 1 R 2 can be derived include a wide variety of saturated secondary amines such as dimethylamine, diethylamine, diisopropylamine, dibutylamine, methylpropylamine, methylhexylamine, methylcyclopropylamine, ethylcyclohexylamine, methylbenzylamine, methycyclohexylmethylamine, butylcyclohexylamirte, morpholine, thiomorpholine, pyrrolidine, piperidine, 2,6-dimethylpiperidine, piperazine and similar saturated monocyclic nitrogen heterocycles.
  • saturated secondary amines such as dimethylamine, diethylamine, diisopropylamine, dibutylamine, methylpropylamine, methylhexylamine, methylcyclopropylamine, ethylcyclohexylamine, methylbenzylamine, methycyclohexylmethylamine
  • the ribonucleoside and deoxynucleoside bases represented by B in the above formulae are well known and include purine derivatives, e.g., adenine, hypoxanthine and guanine, and pyrimidine derivatives, e.g. cytosine, uracil and thymine.
  • the blocking groups represented by Z in the above formulae include trityl, methoxytrityl, dimethoxytrityl, dialkylphosphite, pivalyl, isobutyloxycarbonyl, t-butyl dimethylsilyl, and similar such blocking groups.
  • the phosphate protecting groups represented by X include, but are not limited to, a wide variety of hydrocarbyl radicals including alkyl, alkenyl, aryl, aralkyl and cycloalkyl containing up to about 10 carbon atoms.
  • Representative radicals are methyl, butyl, hexyl, phenethyl, benzyl, cyclohexyl, phenyl, naphthyl, allyl and cyclobutyl. Of these the preferred are lower alkyl, especially methyl and ethyl.
  • the present invention encompasses a convenient method for preparing deoxynucleoside and ribonucleoside phosphoramidite intermediates in situ from corresponding natural and unnatural nucleosides.
  • nucleoside phosphoramidite intermediates prepared in this manner can then be activated with a suitable agent and the activated nucleoside phosphoramidite intermediates can be used in excess during a coupling reaction with a suitably protected nucleoside, thus ensuring a favorable competition against trace amounts of moisture from both the solvent and the surrounding environment.
  • the nucleoside phosphoramidite intermediate is prepared by a chemical reaction represented by a formula:
  • nucleoside phosphoramidite intermediate is prepared by a chemical reaction represented by the following formulas
  • X is a phosphate protecting group
  • each Y is a secondary amino group
  • Z is a hydroxy protecting group
  • the weak acid is capable of selectively protonating only one amine of the secondary amino groups
  • each A is selected from a group consisting of -H, -OH, and -OZ
  • B is selected from a group consisting of natural and unnatural purine and pyrimidine bases
  • G is a heterocyclic base protecting group
  • each D is selected from a group consisting of -H and -OZ
  • E is selected from a group consisting of -OH and -OZ, provided that (a) when both As are the same and are -H or -OZ, then E is -OH and (b) both As and E cannot all simultaneously be equal
  • n is a number from 0-2
  • the solvent is capable of (a) solubilizing I
  • X can be virtually any phosphate protecting group. Many phosphate protecting groups are known to those skilled in the art (31-39).
  • X is selected from a group consisting of alkyl, haloalkyl, cyanoalkyl, alkyldiarylsilylalkyl, trialkylsilylalkyl, arylsulphonylalkyl, alkylthioalkyl, arylthioalkyl, alkenyl, haloalkenyl, aryl, haloaryl, aralkyl, haloaralkyl, cycloalkyl, halocycloalkyl, branched alkyl, and branched haloalkyl containing up to 10 carbon atoms.
  • X is methyl.
  • Each Y is preferably R 1 -N-R 2 , wherein each R 1 and R 2 , when taken separately, represents alkyl, haloalkyl, alkenyl, aralkyl, haloaralkyl, cycloalkyl, halocycloalkyl, cycloalkylalkyl, halocycloalkylalkyl, cycloalkenylyl, halocycloalkenylyl containing up to 10 carbon atoms, wherein each halogen substitution is at least three carbon atoms removed from the nitrogen atom and each unsaturation is at least C 2 -C 3 bonds removed from the nitrogen atom (i.e., the halogen substitution and/or unsaturation should not significantly decrease the basicity of the amino functionality); R 1 and R 2 , when taken together, form a chain selected from a group consisting of alkylene, haloalkylene, alkenylene, and haloalkenylene
  • each Y is selected from a group consisting of dimethylamine, diethylamine, diisopropylamine, dibutylamine, methylpropylamine, methylhexylamine, methylcyclopropylamine, ethylcyclohexylamine, methylbenzylamine, methycyclohexylmethylamine, butylcyclohexylamine, morpholine, thiomorpholine, pyrrolidine, piperidine, and 2,6-dimethylpi ⁇ eridine.
  • Y is pyrrolidine.
  • Z can be virtually any hydroxy protecting group. Many hydroxy protecting groups are known to those skilled in the art (31-33, 38-46).
  • Z is selected from a group consisting of pixyl groups, (e.g., 9-arylxanthen-9-yl), triarylmethyl groups (e.g., trityl, methoxytrityl, trimethoxytrityl, di-p-anisylphenylmethyl, p-fluorophenyl-1-naphthylphenylmethyl, p-anisyl-1maphthylphenylmethyl, di-o-anisyl-1-naphthylmethyl, di-oanisylphenylmethyl, and p-tolyldiphenylmethyl), dialkyl phosphite groups, alkylcarbonyl groups (e.g., acetyl, pivaloyl), arylcarbonyl groups (e.g., benzoyl), trial
  • nucleosides capable of being employed in the instant invention include those set forth in Table I.
  • nucleoside has the formula represented by nucleosides 3, 5, 12, and 14 of Table I.
  • the nucleoside contains two -OZ substituents
  • This can be accomplished by any technique known to those skilled in the art. For example, if one Z is trityl and the second Z is selected from a group consisting of benzoyl, trialkylsilyl, tetrahydropyranyl, or other ketal or acetal functions, the trityl can be removed by a mild acid or Lewis acid (e.g., zinc bromide) without removing the other protecting group.
  • a mild acid or Lewis acid e.g., zinc bromide
  • the benzoyl group can be removed under basic conditions without removing the trityl group.
  • the trialkylsilyl group can be removed by treatment with fluoride ions without removing the trityl group.
  • B can be virtually any natural or unnatural ribonucleoside or deoxynucleoside base.
  • bases include, but are not limited to, purine derivatives, e.g., adenine, hypoxanthine and guanine, pyrimidine derivatives, e.g., cytosine, uracil, and thymine, as well as homologues and analogues thereof.
  • G can be virtually any heterocyclic base protecting group. Many heterocyclic base protecting groups are known to those skilled in the art (23-33).
  • G is selected from a group consisting of amino, imide, and amide protecting groups of the corresponding heterocyclic base.
  • amino, imide, and amide protecting groups include, but are not limited to triarymethyl, trialkylsilylalkyl, arylthioalkyl, arylalkyl, cyanoalkyl, phthaloyl, aryl, aryloxycarbonyl, alkoxycarbonyl, arylcarbonyl, alkylcarbonyl, and Ndialkylaminomethylene.
  • n is selected such that one or more of the reactive functionalities on the heterocyclic ring are protected.
  • An illustration of this point is set forth in Table II.
  • r is 1.
  • the weak acid has a pK at about 25° C. in H 2 O of about 7.5 to about 11, more preferably from about 8 to about 10.5, even more preferably from about 8 to about 9, and optimally about 8.2 to about 8.5.
  • the weak acid is preferably selected from a group consisting of 1,2,4-triazole; 1, 2,3-triazole; 4,5dichloroimidazole; 4-nitroimidazole; 3-chlorotriazole; benzotriazole; and mixtures thereof. More preferably, the weak acid is selected from said group consisting of 4,5-dichloroimidazole, benzotriazole, and mixtures thereof.
  • the weak acid is 4, 5-dichloroimidazole.
  • the solvent is selected from a group consisting of tetramethyl urea, N,N-dimethylacetamide, 1-methyl-2-pyrrolidinone, N,N-dimethylformamide (DMF), dioxane, tetrahydrofuran (THF), ethyl acetate, chloroform, 1,3-dimethyl-2-imidazolidinone, N,N'dimethyl-N,N'-propyleneurea, homologues and analogues thereof, and mixtures thereof. More preferably, the solvent is selected from a group consisting of tetramethyl urea, 1, 3-dimethyl-2-imidazolidinone, 1-methyl-2pyrrolidinone, and mixtures thereof. In addition, it is also preferred that the solvent be anhydrous (i.e., contain less than 0.06% water).
  • the chemical reaction can proceed at any convenient temperature. This temperature can range from the freezing point to the boiling point of the reaction mixture. Preferably, the chemical reaction takes place at about room temperature.
  • reaction time can be from a few seconds to over a day. However, it is preferred to conclude the reaction as soon as possible (in a time span typically from about 5 to about 15 minutes, and more preferably about 10 minutes).
  • III is present in a molar concentration greater than reactable I. More preferably, the molar ratio of III rreactable I is 1.2:1.
  • the relative molar concentration of I and II is not critical. However, it is preferred that the molar concentration of II be at least twice the molar concentration of I. More preferably the molar concentration of II is from about 2 to about 5 times the molar concentration of I. Optimally, the molar concentration of II is approximately quadruple that of I.
  • the reactants can be added in any convenient sequence. However, with respect to the one-step rotation embodiment of the present invention it is preferred to add I to a solution containing III. This preferred sequence appears to generate less side products during the course of the reaction.
  • the nucleoside can be phosphorylated at either the 2', 3' or 5' position and is preferably phosphorylated at the 3' or 5' position. More preferably, the nucleoside is phosphorylated at the 3' position.
  • nucleoside phosphoramidite intermediates can be activated with a suitable agent, for example, lH-tetrazole and an excess of the activated nucleoside phosphoramidite intermediate can be used during a coupling reaction with a suitably protected nucleoside in either any liquid or solid phase methodology known to those skilled in the art (16, 22). This procedure thus ensures a favorable competition against trace amounts of moisture from the solvent as well as from the surrounding environment.
  • a suitable agent for example, lH-tetrazole
  • an excess of the activated nucleoside phosphoramidite intermediate can be used during a coupling reaction with a suitably protected nucleoside in either any liquid or solid phase methodology known to those skilled in the art (16, 22).
  • the coupling reaction be performed in a solid phase procedure.
  • Example 1 Preparation of bis-(N,N-dimethylamino) methoxyphosphine To 0.1 mole of methoxydichlorophosphine cooled at -15° C. in a 100 ml round bottom flask, was added under a nitrogen atmosphere dropwise over a period of about 30 minutes N,N-dimethylaminotrimethylsilane (0.21 mole). The reaction mixture was then removed from the cold bath and allowed to stir at ambient temperature for about 1 hour. The chlorotrimethylsilane generated during the course of the reaction was removed under reduced pressure (water aspirator). The material left distilled at 38-40° C. at 13 mm Hg. The cloudy liquid was filtered through a medium porosity glass sintered funnel. The yield was 68%. Physical characteristics were identified as follows:
  • the density of the clear liquid at 25° C. was found to be 0.936 g/ml.
  • the density of the clear liquid at 25° C. was found to be 1.037 g/ml.
  • Example 3 Preparation of bis-(N,N-diisopropyl) methoxyphosphine To methoxydichlorophosphine (15g, 0.11 mole) in 100 ml of anhydrous ethyl ether was added, dropwise at -15° C. under a nitrogen atmosphere over a period of about 30 minutes, N,N-diisopropylamine (44.5g, 0.44 mole) in 100 ml of anhydrous ethyl ether. The suspension was then removed from the cold bath and allowed to stir at ambient temperature for about 1 hour. The amine hydrochloride was then filtered and washed with 100 ml of anhydrous ether. Excess ether from the filtrate was distilled off at atmospheric pressure.
  • the bis-(pyrrolidino)methoxyphosphine (la; 0.25 mmol) prepared in Example 2 was syringed into a solution of the 5'-protected deoxynucleoside (III; 0.28 mmol) and 4,5-dichloroimidazole (II; 1.00 mmol) in 0.5 ml of dry 1methyl-2-pyrrolidinone, P NMR displayed a nearly quantitative yield of the nucleoside phosphorimidite IVa (-143.7, -143.4 ppm; 91.2% yield) along with a small amount of the symmetrical dinucleoside monophosphite V (-139.7 ppm; 8.8% byproduct).
  • Example 6 According to the procedure set forth in Example 5 the following oligonucleotide has been successfully prepared: d(GCATCGCCAGTCACTATGGCGT)
  • the overall yield was about 30%, implying that an average yield of 94.4% was obtained at each step (as measured spectrometrically from the dimethoxytrityl cation using an extinction of 7 x 10 4 at 498 nm).
  • pyrrophoric and/or reactive phosphitylating agents such as chloro-(N,N-dimethylamino)methoxyphosphine (16), chloro(N,N-diisopropylamino)methoxyphosphine (18), methoxydichlorophosphine (20, 21), bis-(tetrazoly)methoxyphosphine (21), which are difficult to handle and extremely sensitive to atmospheric moisture.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Saccharide Compounds (AREA)
PCT/US1984/000743 1983-06-01 1984-05-14 Novel preparation of nucleoside phosphoramidite intermediates Ceased WO1984004749A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE8484902180T DE3479662D1 (en) 1983-06-01 1984-05-14 Novel preparation of nucleoside phosphoramidite intermediates

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US50010383A 1983-06-01 1983-06-01

Publications (1)

Publication Number Publication Date
WO1984004749A1 true WO1984004749A1 (en) 1984-12-06

Family

ID=23988045

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1984/000743 Ceased WO1984004749A1 (en) 1983-06-01 1984-05-14 Novel preparation of nucleoside phosphoramidite intermediates

Country Status (4)

Country Link
EP (1) EP0144386B1 (https=)
JP (1) JPS60500817A (https=)
DE (1) DE3479662D1 (https=)
WO (1) WO1984004749A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0266168A3 (en) * 1986-10-31 1990-10-03 Amoco Corporation Compositions and methods for the synthesis of oligonucleotides having 5'-phosphorylated termini
WO1997042208A1 (en) * 1996-05-03 1997-11-13 Hybridon, Inc. In situ preparation of nucleoside phosphoramidites and their use in synthesis of oligonucleotides
US8431693B2 (en) 2004-04-05 2013-04-30 Alnylam Pharmaceuticals, Inc. Process for desilylation of oligonucleotides
US8586728B2 (en) 2006-12-12 2013-11-19 Cytos Biotechnology Ag Oligonucleotides containing high concentrations of guanine monomers

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0863910A1 (en) 1995-10-19 1998-09-16 NeXstar Pharmaceuticals, Inc. Method for solution phase synthesis of oligonucleotides

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0061746A1 (en) * 1981-03-27 1982-10-06 University Patents, Inc. Phosphoramidite compounds and their use in producing oligonucleotides
EP0090789A1 (en) * 1982-03-26 1983-10-05 Monsanto Company Chemical DNA synthesis

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0061746A1 (en) * 1981-03-27 1982-10-06 University Patents, Inc. Phosphoramidite compounds and their use in producing oligonucleotides
EP0090789A1 (en) * 1982-03-26 1983-10-05 Monsanto Company Chemical DNA synthesis

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Journal of the American Chemical Society, Volume 105, No. 3, 9 February 1983 (US) S.P. ADAMS et al.: "Hindered Dialkylamino Nucleoside Phosphite Reagents in the Synthesis of Two DNA 51-Mers", pages 661-663, see pages 661, 662 *
Tetrahedron Letters, Volume 22, No. 20, 1981, Pergamon Press Ltd. (GB) S.L. BEAUCAGE et al.: "Deoxynucleoside Phosphoramidites-A New Class of Key Intermediates for Deoxypolnucleotide Synthesis", pages 1859-1862, see pages 1859, 1860 *
Tetrahedron Letters, Volume 24, No. 10, 1983, Pergamon Press Ltd. (GB) TIN M. CAO et al.: "A Novel Route for Solid Phase Synthesis of Polynucleotides using Phosphite Chemistry" see pages 1019-1020 *
Tetrahedron Letters, Volume 24, No. 19, 1983, Pergamon Press Ltd. (GB) J.L. FOURREY et al.: "A New and General Procedure for the Preparation of Deoxynucleoside Phosphoramidites" pages 1963-1966, see pages 1963, 1964 *
Tetrahedron Letters, Volume 24, No. 3, 1983, Pergamon Press Ltd. (GB) L.J. McBRIDE et al.: "An Investigation of Several Deoxynucleoside Phosphoramidites useful for Synthesizing Deoxyoligonucleotides, pages 245-248, see pages 245, 246 (citedin the application) *
Tetrahedron Letters, Volume 25, No. 4, 1984, Pergamon Press (GB) S.L. BEAUCAGE: "A Simple and Efficient Preparation of Deoxynucleoside Phosphoramidites in Situ", see pages 375-378 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0266168A3 (en) * 1986-10-31 1990-10-03 Amoco Corporation Compositions and methods for the synthesis of oligonucleotides having 5'-phosphorylated termini
WO1997042208A1 (en) * 1996-05-03 1997-11-13 Hybridon, Inc. In situ preparation of nucleoside phosphoramidites and their use in synthesis of oligonucleotides
US8431693B2 (en) 2004-04-05 2013-04-30 Alnylam Pharmaceuticals, Inc. Process for desilylation of oligonucleotides
US8586728B2 (en) 2006-12-12 2013-11-19 Cytos Biotechnology Ag Oligonucleotides containing high concentrations of guanine monomers
US9914746B2 (en) 2006-12-12 2018-03-13 Kuros Biosciences Ag Oligonucleotides containing high concentrations of guanine monomers

Also Published As

Publication number Publication date
EP0144386A1 (en) 1985-06-19
JPS6330317B2 (https=) 1988-06-17
JPS60500817A (ja) 1985-05-30
DE3479662D1 (en) 1989-10-12
EP0144386B1 (en) 1989-09-06

Similar Documents

Publication Publication Date Title
US6596857B1 (en) Preparation of phosphorothioate oligomers
US4725677A (en) Process for the preparation of oligonucleotides
US6274725B1 (en) Activators for oligonucleotide synthesis
US6160109A (en) Preparation of phosphorothioate and boranophosphate oligomers
US4415732A (en) Phosphoramidite compounds and processes
WO1991016331A1 (en) Method of synthesizing sulfurized oligonucleotide analogs
US5936077A (en) Solid phase synthesis of oligonucleotides
IE58874B1 (en) Process and agents for phosphorylation
US6476216B1 (en) Preparation of phosphorothioate oligomers
CA1235079A (en) Process for the preparation of nucleoside alkyl-, aralkyl- and aryl-phosphonites and -phosphonates
EP0144386B1 (en) Novel preparation of nucleoside phosphoramidite intermediates
EP0611075B1 (en) Modified oligodeoxyribonucleotides, their preparation and their therapeutic use
Moore et al. Conceptual basis of the selective activation of bis (dialkylamino) methoxyphosphines by weak acids and its application toward the preparation of deoxynucleoside phosphoramidites in situ
KR20030081303A (ko) 올리고뉴클레오티드 합성용 신톤
US20070004911A1 (en) Silylated oligonucleotide compounds
US6340749B1 (en) Preparation of nucleoside phosphoramidites and oligonucleotide synthesis
US5639867A (en) TTTr as protective group in nucleotide synthesis
CA1268173A (en) Preparation of nucleoside phosphoramidite intermediates
Schulz et al. Synthesis of O4-p-nitrophenylethyl thymidine and uridine derivatives
Mag et al. Synthesis and binding properties of oligodeoxynucleotides containing phenylphosphon (othio) ate linkages
KR100228606B1 (ko) 올리고뉴클레오티드의 화학적 합성 방법
EP0901500B1 (en) In situ preparation of nucleoside phosphoramidites and their use in synthesis of oligonucleotides
US6884881B1 (en) 2′-Substituted RNA preparation
Dabkowski et al. Synthesis of phosphorofluoridates and phosphorofluoridothioates via the phosphoramidite approach
Hörndler et al. Nucleotides Part LI. Synthesis and biological activities of (2′‐5′) adenylate trimer conjugates with 2′‐terminal 3′‐O (ω‐hydroxyalkyl) and 3′‐O‐(ω‐carboxyalkyl) spacers

Legal Events

Date Code Title Description
AK Designated states

Designated state(s): JP

AL Designated countries for regional patents

Designated state(s): CH DE GB SE

WWE Wipo information: entry into national phase

Ref document number: 1984902180

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1984902180

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 1984902180

Country of ref document: EP