USRE39247E1 - Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases - Google Patents
Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases Download PDFInfo
- Publication number
- USRE39247E1 USRE39247E1 US10/622,201 US62220103A USRE39247E US RE39247 E1 USRE39247 E1 US RE39247E1 US 62220103 A US62220103 A US 62220103A US RE39247 E USRE39247 E US RE39247E
- Authority
- US
- United States
- Prior art keywords
- seq
- sequence
- epsps
- glyphosate
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
- C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
- C12N15/8275—Glyphosate
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/814—Enzyme separation or purification
- Y10S435/816—Enzyme separation or purification by solubility
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/8215—Microorganisms
- Y10S435/822—Microorganisms using bacteria or actinomycetales
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/8215—Microorganisms
- Y10S435/822—Microorganisms using bacteria or actinomycetales
- Y10S435/832—Bacillus
- Y10S435/839—Bacillus subtilis
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/8215—Microorganisms
- Y10S435/822—Microorganisms using bacteria or actinomycetales
- Y10S435/874—Pseudomonas
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/8215—Microorganisms
- Y10S435/822—Microorganisms using bacteria or actinomycetales
- Y10S435/882—Staphylococcus
- Y10S435/883—Staphylococcus aureus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
- Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
- Y10T436/143333—Saccharide [e.g., DNA, etc.]
Definitions
- This invention relates in general to plant molecular biology and, more particularly, to a new class of glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases.
- Herbicide-tolerant plants may reduce the need for tillage to control weeds thereby effectively reducing soil erosion.
- N-phosphonomethylglycine commonly referred to as glyphosate.
- Glyphosate inhibits the shikimic acid pathway which leads to the biosynthesis of aromatic compounds including amino acids, plant hormones and vitamins.
- glyphosate curbs the conversion of phosphoenolpyruvic acid (PEP) and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (hereinafter referred to as EPSP synthase or EPSPS).
- EPSP synthase phosphoenolpyruvic acid
- EPSPS 5-enolpyruvylshikimate-3-phosphate synthase
- the term “glyphosate” should be considered to include any herbicidally effective form of N-phosphonomethylglycine (including any salt thereof) and other forms which result in the production of the glyphosate anion in plants.
- glyphosate-tolerant plants can be produced by inserting into the genome of the plant the capacity to produce a higher level of EPSP synthase in the chloroplast of the cell (Shah et al., 1986) which enzyme is preferably glyphosate-tolerant (Kishore et al. 1988).
- Variants of the wild-type EPSPS enzyme have been isolated which are glyphosate-tolerant as a result of alterations in the EPSPS amino acid coding sequence (Kishore and Shah, 1988; Schulz et al., 1984; Sost et al., 1984; Kishore et al., 1986).
- variants typically have a higher K i for glyphosate than the wild-type EPSPS enzyme which confers the glyphosate-tolerant phenotype, but these variants are also characterized by a high K m for PEP which makes the enzyme kinetically less efficient (Kishore and Shah, 1988; Sost et al., 1984; Schulz et al., 1984; Kishore et al., 1986; Sost and Amrhein, 1990).
- K m for PEP and the apparent K i for glyphosate for the native EPSPS from E.
- coli are 10 ⁇ M and 0.5 ⁇ M while for a glyphosate-tolerant isolate having a single amino acid substitution of an alanine for the glycine at position 96 these values are 220 ⁇ M and 4.0 mM, respectively.
- a number of glyphosate-tolerant plant variant EPSPS genes have been constructed by mutagenesis. Again, the glyphosate-tolerant EPSPS was impaired due to an increase in the K m for PEP and a slight reduction of the V max of the native plant enzyme (Kishore and Shah, 1988) thereby lowering the catalytic efficiency (V max /K m ) of the enzyme.
- the term “mature EPSP synthase” relates to the EPSPS polypeptide without the N-terminal chloroplast transit peptide. It is now known that the precursor form of the EPSP synthase in plants (with the transit peptide) is expressed and upon delivery to the chloroplast, the transit peptide is cleaved yielding the mature EPSP synthase. All numbering of amino acid positions are given with respect to the mature EPSP synthase (without chloroplast transit peptide leader) to facilitate comparison of EPSPS sequences from sources which have chloroplast transit peptides (i.e., plants and fungi) to sources which do not utilize a chloroplast targeting signal (i.e., bacteria).
- amino acid nomenclature for the naturally occurring amino acids found in protein is as follows: alanine (Ala;A), asparagine (Asn;N), aspartic acid (Asp;D), arginine (Arg;R), cysteine (Cys;C), glutamic acid (Glu;E), glutamine (Gln;Q), glycine (Gly;G), histidine (His;H), isoleucine (Ile;I), leucine (Leu;L), lysine (Lys;k), methionine (Met;M), phenylalanine (Phe;F), proline (Pro;P), serine (Ser;S), threonine (Thr;T), tryptophan (Trp;W), tyrosine (Tyr;Y), and valine (Val;V).
- An “X” is used when the amino acid residue is unknown and parentheses designate that an unambiguous assignment is not possible and the amino acid designation within the parenthe
- nonpolar amino acids include alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, and methionine.
- uncharged polar amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine.
- charged polar amino acids includes the “acidic” and “basic” amino acids.
- acidic amino acids includes aspartic acid and glutamic acid.
- basic amino acid includes lysine, arginine and histidine.
- polar amino acids includes both “charged polar” and “uncharged polar” amino acids.
- Deoxyribonucleic acid is a polymer comprising four mononucleotide units, dAMP (2′-Deoxyadenosine-5-monophosphate), dGMP (2′-Deoxyguanosine-5-monophosphate), dCMP (2′-Deoxycytosine-5-monophosphate) and dTMP (2′-Deoxythymosine-5-monophosphate) linked in various sequences by 3′,5′-phosphodiester bridges.
- the structural DNA consists of multiple nucleotide triplets called “codons” which code for the amino acids.
- the codons correspond to the various amino acids as follows: Arg (CGA, CGC, CGG, CGT, AGA, AGG); Leu (CTA, CTC, CTG, CTT, TTA, TTG); Ser (TCA, TCC, TCG, TCT, AGC, AGT); Thr (ACA, ACC, ACG, ACT); Pro (CCA, CCC, CCG, CCT); Ala (GCA, GCC, GCG, GCT); Gly (GGA, GGC, GGG, GGT); Ile (ATA, ATC, ATT); Val (GTA, GTC, GTG, GTT); Lys (AAA, AAG); Asn (AAC, AAT); Gla (CAA, CAG); His (CAC, CAT); Glu (GAA, GAG); Asp (GAC, GAT); Tyr (TAC, TAT); Cys (TGC, TGT); Phe (TTC, TTT); Met (ATG); and Trp (UGG). Moreover, due to the
- DNA molecules comprising DNA encoding kinetically efficient, glyphosate-tolerant EPSP synthases are disclosed.
- the EPSP synthases of the present invention reduce the amount of overproduction of the EPSPS enzyme in a transgenic plant necessary for the enzyme to maintain catalytic activity while still conferring glyphosate tolerance.
- the EPSP synthases described herein represent a new class of EPSPS enzymes, referred to hereinafter as Class II EPSPS enzymes.
- Class II EPSPS enzymes of the present invention usually share only between about 47% and 55% amino acid similarity or between about 22% and 30% amino acid identity to other known bacterial or plant EPSPS enzymes and exhibit tolerance to glyphosate while maintaining suitable K m (PEP) ranges.
- Suitable ranges of K m (PEP) for EPSPS for enzymes of the present invention are between 1-150 ⁇ M, with a more preferred range of between 1-35 ⁇ M, and a most preferred range between 2-25 ⁇ M. These kinetic constants are determined under the assay conditions specified hereinafter.
- An EPSPS of the present invention preferably has a K i for glyphosate range of between 15-10000 ⁇ M.
- the K i /K m ratio should be between about 2-500, and more preferably between 25-500.
- the V max of the purified enzyme should preferably be in the range of 2-100 units/mg ( ⁇ moles/minute.mg at 25° C.) and the K m for shikimate-3-phosphate should preferably be in the range of 0.1 to 50 ⁇ M.
- Class II EPSPS enzymes often may be distinguished from Class I EPSPS's by their inability to react with polyclonal antibodies prepared from Class I EPSPS enzymes under conditions where other Class I EPSPS enzymes would readily react with the Class I antibodies as well as the presence of certain unique regions of amino acid homology which are conserved in Class II EPSP synthases as discussed hereinafter.
- Class II EPSPS enzymes can be readily isolated and identified by utilizing a nucleic acid probe from one of the Class II EPSPS genes disclosed herein using standard hybridization techniques. Such a probe from the CP4 strain has been prepared and utilized to isolate the Class II EPSPS genes from strains LBAA and PG2982. These genes may also optionally be adapted for enhanced expression in plants by known methodology. Such a probe has also been used to identify homologous genes is bacteria isolated de novo from soil.
- the Class II EPSPS enzymes are preferably fused to a chloroplast transit peptide (CTP) to target the protein to the chloroplasts of the plant into which it may be introduced.
- CTP chloroplast transit peptide
- Chimeric genes encoding this CTP-Class II EPSPS fusion protein may be prepared with an appropriate promoter and 3′ polyadenylation site for introduction into a desired plant by standard methods.
- glyphosate herbicide it is preferable to transform the desired plant with a plant-expressible Class II EPSPS gene in conjunction with another plant-expressible gene which expresses a protein capable of degrading glyphosate such as a plant-expressible gene encoding a glyphosate oxidoreductase enzyme as described in PCT Application No. WO 92/00377, the disclosure of which is hereby incorporated by reference.
- the present invention provides a new class of EPSP synthases that exhibit a low K m for phosphoenolpyruvate (PEP), a high V max /K m ratio, and a high K i for glyphosate such that when introduced into a plant, the plant is made glyphosate-tolerant such that the catalytic activity of the enzyme and plant metabolism are maintained in a substantially normal state.
- a highly efficient EPSPS refers to its efficiency in the presence of glyphosate.
- the present invention provides EPSPS enzymes having a K m for phosphoenolpyruvate (PEP) between 1-150 ⁇ M and a K i (glyphosate)/K m (PEP) ratio between 3-500, said enzymes having the sequence domains:
- Exemplary Class II EPSPS enzyme sequences are disclosed from seven sources: Agrobacterium sp. strain designated CP4, Achromobacter sp. strain LBAA, Pseudomonas sp. strain PG2982, Bacillus subtilis 1A2, Staphylococcus aureus (ATCC 35556), Synechocystis sp. PCC6803 and Dichelobacter nodosus.
- a double-stranded DNA molecule comprising DNA encoding a Class II EPSPS enzyme is disclosed.
- Exemplary Class II EPSPS enzyme DNA sequences are disclosed from seven sources: Agrobacterium sp. strain designated CP4, Achromobacter sp. strain LBAA, Pseudomonas sp. strain PG2982, Bacillus subtilis 1A2, Staphylococcus aureus (ATCC 35556), Synechocystis sp. PCC6803 and Dichelobacter nodosus.
- nucleic acid probes from EPSPS Class II genes are presented that are suitable for use in screening for Class II EPSPS genes in other sources by assaying for the ability of a DNA sequence from the other source to hybridize to the probe.
- a recombinant, double-stranded DNA molecule comprising in sequence:
- transgenic plants and transformed plant cells are disclosed that are made glyphosate-tolerant by the introduction of the above-described plant-expressible Class II EPSPS DNA molecule into the plant's genome.
- a method for selectively controlling weeds in a crop field is presented by planting crop seeds or crop plants transformed with a plant-expressible Class II EPSPS DNA molecule to confer glyphosate tolerance to the plants which allows for glyphosate containing herbicides to be applied to the crop to selectively kill the glyphosate sensitive weeds, but not the crops.
- FIGS. 1A , 1 B show the DNA sequence (SEQ ID NO:1) for the full-length promoter of figwort mosaic virus (FMV35S).
- FIG. 2 shows the cosmid cloning vector pMON17020.
- FIG. 3A , 3 B, 3 C, 3 D and 3 E show the structural DNA sequence (SEQ ID NO:2) for the Class II EPSPS gene from bacterial isolate Agrobacterium sp. strain CP4 and the deduced amino acid sequence (SEQ ID NO:3).
- FIG. 4A , 4 B, 4 C, 4 D and 4 E show the structural DNA sequence (SEQ ID NO:4) for the Class II EPSPS gene from the bacterial isolate Achromobacter sp. strain LBAA and the deduced amino acid sequence (SEQ ID NO:5).
- FIG. 5A , 5 B, 5 C, 5 D and 5 E show the structural DNA sequence (SEQ ID NO:6) for the Class II EPSPS gene from the bacterial isolate Pseudomonas sp. strain PG2982 and the deduced amino acid sequence (SEQ ID NO:7).
- FIG. 6A and 6B show the Bestfit comparison of the CP4 EPSPS amino acid sequence (SEQ ID NO:3) with that for the E. coli EPSPS (SEQ ID NO:8).
- FIG. 7A and 7B show the Bestfit comparison of the CP4 EPSPS amino acid sequence (SEQ ID NO:3) with that for the LBAA EPSPS (SEQ ID NO:5).
- FIG. 8A and 8B show the structural DNA sequence (SEQ ID NO:9) for the synthetic CP4 Class II EPSPS gene.
- FIG. 9 shows the DNA sequence (SEQ ID NO:10) of the chloroplast transit peptide (CTP) and encoded amino acid sequence (SEQ ID NO:11) derived from the Arabidopsis thaliana EPSPS CTP and containing a SphI restriction site at the chloroplast processing site, hereinafter referred to as CTP2.
- FIG. 10A and 10B show the DNA sequence (SEQ ID NO:12) of the chloroplast transit peptide and encoded amino acid sequence (SEQ ID NO:13) derived from the Arabidopsis thaliana EPSPS gene and containing an EcoRI restriction site within the mature region of the EPSPS, hereinafter referred to as CTP3.
- FIG. 11 shows the DNA sequence (SEQ ID NO:14) of the chloroplast transit peptide and encoded amino acid sequence (SEQ ID NO:15) derived from the Petunia hybrida EPSPS CTP and containing a SphI restriction site at the chloroplast processing site and in which the amino acids at the processing site are changed to -Cys-Met-, hereinafter referred to as CTP4.
- FIG. 12A and 12B show the DNA sequence (SEQ ID NO:16) of the chloroplast transit peptide and encoded amino acid sequence (SEQ ID NO:17) derived from the Petunia hybrida EPSPS gene with the naturally occurring EcoRI site in the mature region of the EPSPS gene, hereinafter referred to as CTP5.
- FIG. 13 shows a plasmid map of CP4 plant transformation/expression vector pMON17110.
- FIG. 14 shows a plasmid map of CP4 synthetic EPSPS gene plant transformation/expression vector pMON17131.
- FIG. 15 shows a plasmid map of CP4 EPSPS free DNA plant transformation expression vector pMON13640.
- FIG. 16 shows a plasmid map of CP4 plant transformation/direct selection vector pMON17227.
- FIG. 17 shows a plasmid map of CP4 plant transformation/expression vector pMON19653.
- FIG. 18A , 18 B, 18 C and 18 D show the structural DNA sequence (SEQ ID NO:41) for the Class II EPSPS gene from the bacterial isolate Bacillus subtilis and the deduced amino acid sequence (SEQ ID NO:42).
- FIG. 19A , 19 B, 19 C and 19 D show the structural DNA sequence (SEQ ID NO:43) for the Class II EPSPS gene from the bacterial isolate Staphylococcus aureus and the deduced amino acid sequence (SEQ ID NO:44).
- FIG. 20A , 20 B, 20 C, 20 D, 20 E, 20 F, 20 G, 20 H, 20 I, 20 J and 20 K show the Bestfit comparison of the representative Class II EPSPS amino acid sequences Pseudomonas sp. stain PG2982 (SEQ ID NO:7), Achromobacter sp. strain LBAA (SEQ ID NO:5), Agrobacterium sp.
- CP4 Bacillus subtilis
- SEQ ID NO:44 Staphylococcus aureus
- Class I EPSPS amino acid sequences Sacchromyces cerevisiae (SEQ ID NO:49), Aspergillus nidulans (SEQ ID NO:50), Brassica napus (SEQ ID NO:51), Arabidopsis thaliana (SEQ ID NO:52), Nicotina tobacum (SEQ ID NO:53), L.
- SEQ ID NO:54 Petunia hybrida
- SEQ ID NO:55 Zea mays
- SEQ ID NO:56 Solmenella gallinarum
- SEQ ID NO:57 Solmenella typhimurium
- SEQ ID NO:58 Solmenella typhi
- E. coli SEQ ID NO:8
- K. pneumoniae SEQ ID NO:59
- Y. enterocolitica SEQ ID NO:60
- H. influenzae SEQ ID NO:61
- FIG. 21A , 21 B, 21 C, 21 D and 21 E show the structural DNA sequence (SEQ ID NO:66) for the Class II EPSPS gene from the bacterial isolate Synechocystis sp. PCC6803 and the deduced amino acid sequence (SEQ ID NO:67).
- FIG. 22A , 22 B, 22 C, 22 D and 22 E show the structural DNA sequence (SEQ ID NO:68) for the Class II EPSPS gene from the bacterial isolate Dichelobacter nodosus and the deduced amino acid sequence (SEQ ID NO:69).
- FIG. 23A , 23 B, 23 C and 23 D show the Bestfit comparison of the representative Class II EPSPS amino acid sequences Pseudomonas sp. strain PG2982 (SEQ ID NO:7), Achromobacter sp. strain LBAA (SEQ ID NO:5), Agrobacterium sp. strain designated CP4 (SEQ ID NO:3), Synechocystis sp. PCC6803 (SEQ ID NO:67), Bacillus subtilis (SEQ ID NO:42), Dichelobacter nodosus (SEQ ID NO:69) and Staphylococcus aureus (SEQ ID NO:44).
- FIG. 24 a plasmid map of canola plant transformation/expression vector pMON17209.
- FIG. 25 a plasmid map of canola plant transformation/expression vector pMON17237.
- RNA polymerase enzyme messenger RNA
- RNA polymerase enzyme RNA polymerase enzyme
- 3′ non-translated region which adds polyadenylate nucleotides to the 3′ end of the RNA.
- promoter region contains a sequence of bases that signals RNA polymerase to associate with the DNA, and to initiate the transcription into mRNA using one of the DNA strands as a template to make a corresponding complementary strand of RNA.
- nopaline synthase (NOS) and octopine synthase (OCS) promoters which are carried on tumor-inducing plasmids of Agrobacterium tumefaciens
- the cauliflower mosaic virus (CaMV) 19S and 35S promoters the cauliflower mosaic virus (CaMV) 19S and 35S promoters
- ssRUBISCO the light-inducible promoter from the small subunit of ribulose bis-phosphate carboxylase
- FMV35S figwort mosaic virus
- All of these promoters have been used to create various types of DNA constructs which have been expressed in plants; see, e.g., PCT publication WO 84/02913 (Rogers et al., Mosanto).
- Promoters which are known or found to cause transcription of DNA in plant cells can be used in the present invention.
- Such promoters may be obtained from a variety of sources such as plants and plant DNA virsues and include, but are not limited to, the CaMV35A and FMV35S promoters and promoters isolated from plant genes such as ssRUBISCO genes and the maize ubiquitin and rice actin genes.
- the particular promoter selected should be capable of causing sufficient expression to result in the production of an effective amount of a Class II EPSPS to render the plant substantially tolerant to glyphosate herbicides.
- the amount of Class II EPSPS needed to induce the desired tolerance may vary with the plant species.
- the promoters utilized have relatively high expression in all meristematic tissues in addition to other tissues inasmuch as it is now known that glyphosate is translocated and accumulated in this type of plant tissue.
- a combination of chimeric genes can be used to cumulatively result in the necessary overall expression level of the selected Class II EPSPS enzyme to result in the glyphosate-tolerant phenotype.
- the mRNA produced by a DNA construct of the present invention also contains a 5′ non-translated leader sequence.
- This sequence can be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA.
- the 5′ non-translated regions can also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence.
- the present invention is not limited to constructs, as presented in the following examples, wherein the non-translated region is derived from both the 5′ non-translated sequence that accompanies the promoter sequence and part of the 5′ non-translated region of the virus coat protein gene. Rather, the non-translated leader sequence can be derived from an unrelated promoter or coding sequence as discussed above.
- Preferred promoters for use in the present invention the full-length transcript (SEQ ID NO:1) promoter from the figwort mosaic virus (FMV35S) and the full-length transcript (35S) promoter from cauliflower mosaic virus (CaMV), including the enhanced CaMV35S promoter (Kay et al. 1987).
- the FMV35S promoter functions as strong and uniform promoter with particularly good expression in meristematic tissue for chimeric genes inserted into plants, particularly dicotyledons.
- the resulting transgenic plant in general expresses the protein encoded by the inserted gene at a higher and more uniform level throughout the tissues and cells of the transformed plant than the same gene driven by an enhanced CaMV35S promoter. Referring to FIG.
- the DNA sequence (SEQ ID NO:1) of the FMV35S promoter is located between nucleotides 6368 and 6930 of the FMV genome.
- a 5′ non-translated leader sequence is preferably coupled with the promoter.
- the leader sequence can be from the FMV35S genome itself or can be from a source other than FMV35S.
- heterologous genes for expression of heterologous genes in moncotyledonous plants the use of an intron has been found to enhance expression of the heterologous gene. While one may use any of a number of introns which have been isolated from plant genes, the use of the first intron from the maize heat shock 70 gene is preferred.
- the 3′ non-translated region of the chimeric plant gene contains a polyadenylation signal which functions in plants to cause the addition of polyadenylate nucleotides to the 3′ end of the viral RNA.
- suitable 3′ regions are (1) the 3′ transcribed, non-translated regions containing the polyadenylated signal of Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene, and (2) plant genes like the soybean storage protein genes and the small subunit of the ribulose-1,5-biphosphate carboxylase (ssRUBISCO) gene.
- Ti Agrobacterium tumor-inducing
- NOS nopaline synthase
- ssRUBISCO plant genes like the soybean storage protein genes and the small subunit of the ribulose-1,5-biphosphate carboxylase
- An example of a preferred 3′ region is that from the ssRUBISCO gene from pea (E9), described in greater
- the DNA constructs of the present invention also contain a structural coding sequence in double-stranded DNA form which encodes a glyphosate-tolerant, highly efficient Class II EPSPS enzyme.
- EPSPS enzymes In an attempt to identify and isolate glyphosate-tolerant, highly efficient EPSPS enzymes, kinetic analysis of the EPSPS enzymes from a number of bacteria exhibiting tolerance to glyphosate or that had been isolated from suitable sources was undertaken. It was discovered that in some cases the EPSPS enzymes showed no tolerance to inhibition by glyphosate and it was concluded that the tolerance phenotype of the bacterium was due to an impermeability to glyphosate or other factors. In a number of cases, however, microorganisms were identified whose EPSPS enzyme showed a greater degree of tolerance to inhibition by glyphosate and that displayed a low K m for PEP when compared to that previously reported for other microbial and plant sources. The EPSPS enzymes from these microorganisms were then subjected to further study and analysis.
- Table I displays the data obtained for the EPSPS enzymes identified and isolated as a result of the above described analysis.
- Table I includes data for three identified Class II EPSPS enzymes that were observed to have a high tolerance to inhibition to glyphosate and a low K m for PEP as well as data for the native Petunia EPSPS and a glyphosate-tolerant variant of the Petunia EPSPS referred to as GA101.
- the GA101 variant is so named because it exhibits the substitution of an alanine residue for a glycine residue at position 101 (with respect to Petunia).
- the Agrobacterium sp. strain CP4 was initially identified by its ability to grow on glyphosate as a carbon source (10 mM) in the presence of 1 mM phosphate.
- the strain CP4 was identified from a collection obtained from a fixed-bed immobilized cell column that employed Mannville R-635 diatomaceous earth beads. The column had been run for three months on a waste-water feed from a glyphosate production plant. The column contained 50 mg/ml glyphosate and NH 3 as NH 4 Cl. Total organic carbon was 300 mg/ml and BOD's (Biological Oxygen Demand—a measure of “soft” carbon availability) were less than 30 mg/ml.
- Dworkin-Foster minimal salts medium containing glyphosate at 10 mM and with phosphate at 1 mM was used to select for microbes from a wash of this column that were capable of growing on glyphosate as sole carbon source.
- Dworkin-Foster minimal medium was made up by combining in I liter (with autoclaved H 2 O), 1 ml each of A, B and C and 10 ml of D (as per below) and thiamine HCl (5 mg).
- A. D-F Salts (1000X stock; per 100 ml; autoclaved): H 2 BO 3 1 mg MnSO 4 .7 H 2 O 1 mg ZnSO 4 .7 H 2 O 12.5 mg CuSO 4 .5 H 2 O 8 mg NaMoO 3 .3 H 2 O 1.7 mg
- B. FeSO 4 .7 H 2 O (1000X Stock; per 100 0.1 g ml; autoclaved)
- C. MgSO 4 .7 H 2 O (1000X Stock; per 100 20 g ml; autoclaved)
- Yeast Extract (YE; Difco) was added to a final concentration of 0.01 or 0.001%.
- the strain CP4 was also grown on media composed of D-F salts, amended as described above, containing glucose, gluconate and citrate (each at 0.1%) as carbon sources and with inorganic phosphate (0.2-1.0 mM) as the phosphorous source.
- EPSPS containing microorganisms were identified as Achromobacter sp. strain LBAA (Hallas et al., 1988), Pseudomonas sp. strain PG2982 (Moore et al., 1983; Fitzgibbon 1988), Bacillus subtilis 1A2 (Henner et al., 1984) and Staphylococcus aureus (O'Connell et al., 1993). It had been reported previously, from measurements in crude lysates, that the EPSPS enzyme from strain PG2982 was less sensitive to inhibition to glyphosate than that of E.
- EPSPS proteins studied to date have shown a remarkable degree of homology.
- bacterial and plant EPSPS's are about 54% identical and with similarity as high as 80%.
- bacterial EPSPS's and plant EPSPS's themselves the degree of identity and similarity is much greater (see Table II).
- Glyphosate-tolerant Enzymes is Microbial Isolates
- Chromosomal DNA was prepared from strain Agrobacterium sp. strain CP4 as follows: The cell pellet from a 200 ml L-Broth (Miller, 1972), late log phase culture of Agrobacterium sp. strain CP4 was resuspended in 10 ml of Solution I; 50 mM Glucose, 10 mM EDTA, 25 mM Tris-CL pH 8.0 (Birnboim and Doly, 1979). SDS was added to a final concentration of 1% and the suspension was subjected to three freeze-thaw cycles, each consisting of immersion in dry ice for 15 minutes and in water at 70° C. for 10 minutes.
- the ethanol-precipitable material was pelleted from the supernatant by brief centrifugation (8000 g; 5 minutes) following addition of two volumes of ethanol.
- the pellet was resuspended in 5 ml TE and dialyzed for 16 hours at 4° C. against 2 liters TE. This preparation yielded a 5 ml DNA solution of 552 ⁇ g/ml.
- Partially-restricted DNA was prepared as follows. Three 100 ⁇ g aliquot samples of CP4 DNA were treated for 1 hour at 37° C. with restriction endonuclease HindIII at rates of 4, 2 and 1 enzyme unit/ ⁇ g DNA, respectively. The DNA samples were pooled, made 0.25 mM with EDTA and extracted with an equal volume of phenol:chloroform. Following the addition of sodium acetate and ethanol, the DNA was precipitated with two volumes of ethanol and pelleted by centrifugation (12000 g; 10 minutes).
- the dried DNA pellet was resuspended in 500 ⁇ l TE and layered on a 10-40% Sucrose gradient (in 5% increments of 5.5 ml each) in 0.5M NaCl, 50 mM Tris pH8.0, 5 mM EDTA. Following centrifugation for 20 hours at 26,000 rpm in a SW28 rotor, the tubes were punctured and ⁇ 1.5 ml fractions collected. Samples (20 ⁇ l) of each second fraction were run on 0.7% agarose gel and the size of the DNA determined by comparison with linearized lambda DNA and HindIII-digested lambda DNA standards.
- ⁇ 2 is based on the pBR327 replicon and contains the spectinomycin/streptomycin (Sp r ;spc) resistance gene from Tn7 (Fling et al., 1985), the chloramphenicol resistance gene (Cm r ;cat) from Tn9 (Alton et al., 1979), the gene10 promoter region from phage T7 (Dunn et al., 1983), and the 1.6 kb BglII phage lambda cos fragment from pHC79 (Hohn and Collins, 1980). A number of cloning sites are located downstream of the cat gene. Since the predominant block to the expression of genes from other microbial sources in E.
- Sp r ;spc spectinomycin/streptomycin
- the use of the T7 promoter and supplying the T7 polymerase in trans from the pGP1-2 plasmid enables the expression of large DNA segments of foreign DNA, even those containing RNA polymerase transcription termination sequences.
- the expression of the spc gene is impaired by transcription from the T7 promoter such that only Cmr can be selected in strains containing pGP1-2.
- the use of antibiotic resistances such as Cm resistance which do not employ a membrane component is preferred due to the observation that high level expression of resistance genes that involve a membrane component, i.e. ⁇ -lactamase and Amp resistance, give rise to a glyphosate-tolerant phenotype. Presumably, this is due to the exclusion of glyphosate from the cell by the membrane localized resistance protein. It is also preferred that the selectable marker be oriented in the same direction as the T7 promoter.
- Vector and target sequences were ligated by combining the following:
- Vector DNA (HindIII/CAP) 3 ⁇ g Size fractionated CP4 HindIII fragments 1.5 ⁇ g 10X ligation buffer 2.2 ⁇ l T4 DNA ligase (New England Biolabs) (400 U/ ⁇ l) 1.0 ⁇ l and adding H 2 O to 22.0 ⁇ l. This mixture was incubated for 18 hours at 16° C. 10X ligation buffer is 250 mM Tris-HCl, pH 8.0; 100 mM MgCl 2 ; 100 mM Dithiothreitol; 2 mM Spermidine. The ligated DNA (5 ⁇ l) was packaged into lambda phage particles (Stratagene; Gigapack Gold) using the manufacturer's procedure.
- E. coli GB100 is an aroA derivative of MM294 [Talmadge and Gilbert, 1980]) and tested for complementation for growth in the absence of added aromatic amino acids and aminobenzoic acids.
- Other aroA strains such as SR481 (Bachman et al., 1980; Padgette et al., 1987), could be used and would be suitable for this experiment.
- GB100 is merely exemplary and should not be viewed in a limiting sense.
- This aroA strain usually requires that growth media be supplemented with L-phenylalanine, L-tyrosine and L-tryptophan each at 100 ⁇ g/ml and with para-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid and para-aminobenzoic acid each at 5 ⁇ g/ml for growth in minimal media.
- L-phenylalanine, L-tyrosine and L-tryptophan each at 100 ⁇ g/ml and with para-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid and para-aminobenzoic acid each at 5 ⁇ g/ml for growth in minimal media.
- para-hydroxybenzoic acid 2,3-dihydroxybenzoic acid and para-aminobenzoic acid
- the proteins encoded by the cosmids were determined in vivo using a T7 expression system (Tabor and Richardson, 1985). Cultures of E. coli containing pGP1-2 (Tabor and Richardson, 1985) and test and control cosmids were grown at 30° C. in L-broth (2 ml) with chloramphenicol and kanamycin (25 and 50 ⁇ g/ml, respectively) to a Klett reading of ⁇ 50.
- the cells were collected by centrifugation and suspended in 60-120 ⁇ l cracking buffer (60 mM Tris-HCl 6.8, 1% SDS, 1% 2-mercaptoethanol, 10% glycerol, 0.01% bromophenol blue). Aliquot samples were electrophoresed on 12.5% SDS-PAGE and following soaking for 60 minutes in 10 volumes of Acetic Acid-Methanol-water (10:30:60), the gel was soaked in ENLIGHTNINGTM (DUPONT) following manufacturer's directions, dried, and exposed at ⁇ 70° C. to X-Ray film. Proteins of about 45 kd in size, labeled with 35 S-methionine, were detected in number of the cosmids, including pMON17076.
- 60-120 ⁇ l cracking buffer 60 mM Tris-HCl 6.8, 1% SDS, 1% 2-mercaptoethanol, 10% glycerol, 0.01% bromophenol blue.
- EPSPS enzyme assays were performed using either the phosphate release or radioactive HPLC method, as previously described in Padgette et al., 1987, using 1 mM phosphoenol pyruvate (PEP, Boehringer) and 2 mM shikimate-3-phosphate (S3P) substrate concentrations.
- PEP phosphoenol pyruvate
- S3P shikimate-3-phosphate
- CP4 refers to the “smooth” isolate—CP4-S1.
- the cells from the three batches showing the highest specific activities were pooled.
- Cell paste of Agrobacterium sp. CP4 (300 g) was washed twice with 0.5 L of 0.9% saline and collected by centrifugation (30 minutes, 8000 rpm in a GS3 Sorvall rotor).
- the cell pellet was suspended in 0.9 L extraction buffer (100 mM TrisCl, 1 mM EDTA, 1 mM BAM (Benzamidine), 5 mM DTT, 10% glycerol, pH 7.5) and lysed by 2 passes through a Manton Gaulin cell.
- the resulting solution was centrifuged (30 minutes, 8000 rpm) and the supernatant was treated with 0.21 L of 1.5% protamine sulfate (in 100 mM TrisCl, pH 7.5, 0.2% w/v final protamine sulfate concentration).
- Fractions were collected (20 ml) and assayed for EPSPS activity by the phosphate release assay.
- the fractions with the highest EPSPS activity (fractions 36-50) were pooled and dialyzed against 3 ⁇ 2 L (18 hours) of 10 mM TrisCl, 25 mM KCl, 1 mM EDTA, 5 mM DTT, 10% glycerol, pH 7.8.
- the dialyzed EPSPS extract (350 ml) was loaded (5 ml/min) onto a column (2.4 cm ⁇ 30 cm, 136 ml) packed with Q-Sepharose Fast Flow (Pharmacia) resin equilibrated with 10 mM TrisCl, 25 mM KCl, 5 mM DTT, 10% glycerol, pH 7.8 (Q Sepharose buffer), and washed with 1 L of the same buffer.
- EPSPS was eluted with a linear gradient of Q Sepharose buffer going from 0.025M to 0.40M KCl (total volume of 1.4 L, 5 ml/min).
- Fractions were collected (15 ml) and assayed for EPSPS activity by the phosphate release assay.
- the fractions with the highest EPSPS activity (fractions 47-60) were pooled and the protein was precipitated by adding solid ammonium sulfate to 80% saturation and stirring for 1 hour.
- the precipitated protein was collected by centrifugation (20 minutes, 12000 rpm in a GSA Sorvall rotor), dissolved in Q Sepharose buffer (total volume of 14 ml), and dialyzed against the same buffer (2 ⁇ 1 L, 18 hours).
- the resulting dialyzed partially purified EPSPS extract (19 ml) was loaded (1.7 ml/min) onto a Mono Q 10/10 column (Pharmacia) equilibrated with Q Sepharose buffer, and washed with the same buffer (35 ml).
- EPSPS was eluted with a linear gradient of 0.025M to 0.35M KCl (total volume of 119 ml, 1.7 ml/min).
- Fractions were collected (1.7 ml) and assayed for EPSPS activity by the phosphate release assayed.
- the fractions with the highest EPSPS activity (fractions 30-37) were pooled (6 ml).
- the Mono Q pool was made 1M in ammonium sulfate by the addition of solid ammonium sulfate and 2 ml aliquots were chromatographed on a Phenyl Superose 5/5 column (Pharmacia) equilibrated with 100 mM TrisCl, 5 mM DTT, 1M ammonium sulfate, 10% glycerol, pH 7.5 (Phenyl Superose buffer).
- the resulting pure EPSPS sample (0.9 ml, 77 ⁇ g protein) was found to exhibit a single N-terminal amino acid sequence of: XH(G)ASSRPATARKSS(G)LX(G)(T)V(R)IPG(D)(K)(M) (SEQ ID NO:18).
- Phenyl Superose EPSPS pool was dialyzed against 50 mM TrisCl, 2 mM DTT, 10 mM KCl, 10% glycerol, pH 7.5 (2 ⁇ 1 L). An aliquot (0.55 ml, 0.61 mg protein) was loaded (1 ml/min) onto a Mono Q 5/5 column (Pharmacia) equilibrated with Q Sepharose buffer, washed with the same buffer (5 ml), and eluted with a linear gradient of Q Sepharose buffer going from 0-0.14M KCl in 10 minutes, then holding at 0.14M KCl (1 ml/min).
- Fractions were collected (1 ml) and assayed for EPSPS activity by the phosphate release assay and were subjected to SDS-PAGE (10-15%, Phast System, Pharmacia, with silver staining) to determine protein purity. Fractions exhibiting a single band of protein by SDS-PAGE (22-25, 222 ⁇ g) were pooled and dialyzed against 100 mM ammonium bicarbonate, pH 8.1 (2 ⁇ 1 L, 9 hours).
- the gradient used for elution of the trypsinized Agrobacterium sp. CP4 EPSPS was: 0-8 minutes, 0% RP-B; 8-28 minutes, 0-15% RP-B; 28-40 minutes, 15-21% RP-B; 40-68 minutes, 21-49% RP-B; 68-72 minutes, 49-75% RP-B; 72-74 minutes, 75-100% RP-B.
- Fractions were collected (1 ml) and, based on the elution profile at 210 nm, at least 70 distinct peptides were produced from the trypsinized EPSPS.
- Fractions 40-70 were evaporated to dryness and redissolved in 150 ⁇ l each of 10% acetonitrile, 0.1% trifluoroacetic acid.
- fraction 61 peptide was further purified on the C18 column by the gradient: 0-5 minutes, 0% RP-B; 5-10 minutes, 0-38% RP-B; 10-30 minutes, 38-45% B. Fractions were collected based on the UV signal at 210 nm.
- oligonucleotide probes were designed on the basis of the sequence of two of the tryptic sequences from the CP4 enzyme (Table III).
- the probe identified as MID was very low degeneracy and was used for initial screening.
- the probes identified as EDV-C and EDV-T were based on the same amino acid sequences and differ in one position (underlined in Table III below) and were used as confirmatory probes, with a positive to be expected only from one of these two probes.
- alternate acceptable nucleotides at a particular position are designated by a “/” such as A/C/T.
- the probes were labeled using gamma- 32 P-ATP and polynucleotide kinase.
- DNA from fourteen of the cosmids described above was restricted with EcoRI, transferred to membrane and probed with the oligonucleotide probes.
- the conditions used were as follows: prehybridization was carried out in 6 ⁇ SSC, 10 ⁇ Denhardt's for 2-18 hour periods at 60° C., and hybridization was for 48-72 hours in 6 ⁇ SSC, 10 ⁇ Denhardt's, 100 ⁇ g/ml tRNA at 10° C. below the T d for the probe.
- the T d of the probe was approximated by the formula 2° C ⁇ (A+T)+4° C ⁇ (G+C).
- the CP4 EPSPS gene was further localized as follows: a number of additional Southern analyses were carried out on different restriction digests of pMON17076 using the MID (SEQ ID NO:21) and EDV-T (SEQ ID NO:23) probes separately. Based on these analyses and on subsequent detailed restriction mapping of the pBlueScript (Stratagene) subclones of the ⁇ 9.9 kb fragment from pMON17076, a 3.8 kb EcoRI-SalI fragment was identified to which both probes hybridized. This analysis also showed that MID (SEQ ID NO:21) and EDV-T (SEQ ID NO:23) probes hybridized to different sides of BamHI, ClaI, and SacII sites.
- This 3.8 kb fragment was cloned in both orientations in pBlueScript to form pMON17081 and pMON17082.
- the phenotypes imparted to E. coli by these clones were then determined.
- Glyphosate tolerance was determined following transformation into E. coli MM294 containing pGP1-2 (pBlueScript also contains a T7 promoter) on M9 agar media containing glyphosate at 3 mM.
- Both pMON17081 and pMON17082 showed glyphosate-tolerant colonies at three days at 30° C. at about half the size of the controls on the same media lacking glyphosate. This result suggested that the 3.8 kb fragment contained an intact EPSPS gene.
- Nucleotide sequencing was begun from a number of restriction site ends, including the BamHI site discussed above. Sequences encoding protein sequences that closely matched the N-terminus protein sequence and that for the tryptic fragment 53-28 (SEQ ID NO:20) (the basis of the EDV-T probe) (SEQ ID NO:23) were localized to the SalI side of this BamHI site. These data provided conclusive evidence for the cloning of the CP4 EPSPS gene and for the direction of transcription of this gene. These data coupled with the restriction mapping data also indicated that the complete gene was located on an ⁇ 2.3 kb XhoI fragment and this fragment was subcloned into pBlueScript.
- the nucleotide sequence of almost 2 kb of this fragment was determined by a combination of sequencing from cloned restriction fragments and by the use of specific primers to extend the sequence.
- the nucleotide sequence of the CP4 EPSPS gene and flanking regions is shown in FIG. 3 (SEQ ID NO:2).
- the sequence corresponding to peptide 61-24-25 was also located. The sequence was determined using both the SEQUENASETM kit from IBI (International Biotechnologies Inc.) and the T7 sequencing/Deaza Kit from Pharmacia.
- PRIMER BgNc (addition of BgIII and NcoI sites to N-terminus) CGTGGATAGATCTAGGAAGACAACCATGGCTCACGGTC (SEQ ID NO:24)
- PRIMER Sph2 (addition of SphI site to N-terminus) GGATAGATTAAGGAAGACGCGCATGCTTCACGGTGCAAGCAGCC (SEQ ID NO:25)
- PRIMER S1 (addition of SacI site immediately after stop codons) GGCTGCCTGATGAGCTCCACAATCGCCATCGATGG
- PRIMER N1 (removal of internal NotI recognition site) CGTCGCTCGTCGTGCGTGGCCGCCCTGACGGC (SEQ ID NO:27)
- PRIMER NcoI (removal of first internal NcoI recognition site) CGGGCAAGGCCATGCAGGCTATGGGCGCC (SEQ ID NO:28)
- PRIMER Nco2 (removal of second internal NcoI recognition site)
- This CP4 EPSPS gene was then cloned as a NcoI-BamHI N-terminal fragment plus a BamHI-SacI C-terminal fragment into a PrecA-gene10L expression vector similar to those described (Wong et al., 1988; Olins et al., 1988) to form pMON17101.
- the K m for PEP and the K i for glyphosate were determined for the EPSPS activity in crude lysates of pMON17101/GB100 transformants following induction with nalidixic acid (Wong et al., 1988) and found to be the same as that determined for the purified and crude enzyme preparations from Agrobacterium sp. strain CP4.
- a cosmid bank of partially HindIII-restricted LBAA DNA was constructed in E. coli MM294 in the vector pHC79 (Hohn and Collins, 1980). This bank was probed with a full length CP4 EPSPS gene probe by colony hybridization and positive clones were identified at a rate of ⁇ 1 per 400 cosmids. The LBAA EPSPS gene was further localized in these cosmids by Southern analysis.
- the gene was located on an ⁇ 2.8 kb XhoI fragment and by a series of sequencing steps, both from restriction fragment ends and by using the oligonucleotide primers from the sequencing of the CP4 EPSPS gene, the nucleotide sequence of the LBAA EPSPS gene was completed and is presented in FIG. 4 (SEQ ID NO:4).
- the EPSPS gene from PG2982 was also cloned.
- the EPSPS protein was purified, essentially as described for the CP4 enzyme, with the following differences: Following the Sepharose CL-4B column, the fractions with the highest EPSPS activity were pooled and the protein precipitated by adding solid ammonium sulfate to 85% saturation and stirring for 1 hour. The precipitated protein was collected by centrifugation, resuspended in Q Sepharose buffer and following dialysis against the same buffer was loaded onto the column (as for the CP4 enzyme).
- oligonucleotide probes were designed based on this sequence and used to probe a library of PG2982 partial-HindIII DNA in the cosmid pHC79 (Hohn and Collins, 1980) by colony hybridization under nonstringent conditions. Final washing conditions were 15 minutes with 1 ⁇ SSC, 0.1% SDS at 55° C.
- the cosmid set identified in this way was made up of cosmids of diverse HindIII fragments. However, when this set was probed with the CP4 EPSPS gene probe, a cosmid containing the PG2982 EPSPS gene was identified (designated as cosmid 9C1 originally and later as pMON20107). By a series of restriction mappings and Southern analysis this gene was localized to a ⁇ 2.8 kb XhoI fragment and the nucleotide sequence of this gene was determined. This DNA sequence (SEQ ID NO:6) is shown in FIG. 5 . There are no nucleotide differences between the EPSPS gene sequences from LBAA (SEQ ID NO:4) and PG2982 (SEQ ID NO:6). The kinetic parameters of the two enzymes are within the range of experimental error.
- a gene from PG2982 that imparts glyphosate tolerance in E. coli has been sequenced (Fitzgibbon, 1988; Fitzgibbon and Brayruer, 1990).
- the sequence of the PG2982 EPSPS Class II gene shows no homology to the previously reported sequence suggesting that the glyphosate-tolerant phenotype of the previous work is not related to EPSPS.
- Bacillus subtilis 1A2 was obtained from the Bacillus Genetic Stock Center at Ohio State University.
- Standard EPSPS assay reactions contained crude bacterial extract with, 1 mM phosphoenolpyruvate (PEP), 2 mM shikimate-3-phosphate (S3P), 0.1 mM ammonium molybdate, 5 mM potassium fluoride, and 50 mM HEPES, pH 7.0 at 25° C.
- PEP phosphoenolpyruvate
- S3P shikimate-3-phosphate
- U 50 mM HEPES
- the EPSPS specific activity was found to be 0.003 U/mg. When the assays were performed in the presence of 1 mM glyphosphate, 100% of the EPSPS activity was retained.
- the appK m (PEP) of the B. subtilis EPSPS was determined by measuring the reaction velocity at varying concentrations of PEP. The results were analyzed graphically by the hyperbolic, Lineweaver-Burk and Eadie-Hofstee plots, which yielded appK m (PEP) values of 15.3 ⁇ M, 10.8 ⁇ M and 12.2 ⁇ M, respectively. These three data treatments are in good agreement, and yield an average value for appK m (PEP) of 13 ⁇ M.
- the appK i (glyphosate) was estimated by determining the reaction rates of B. subtilis 1A2 EPSPS in the presence of several concentrations of glyphosphate, at a PEP concentration of 2 ⁇ M. These results were compared to the calculated V max of the EPSPS, and making the assumption that glyphosate is a competitive inhibitor versus PEP for B. subtilis EPSPS, as it is for all other characterized EPSPSs, an appK i (glyphosate) was determined graphically. The appK i (glyphosate) was found to be 0.44 mM.
- coli GB100 (aroA-): 1) the gene was isolated by PCR and cloned into an overexpression vector, and 2) the gene was subcloned into an overexpression vector.
- aroA- the gene was isolated by PCR and cloned into an overexpression vector
- the gene was subcloned into an overexpression vector.
- two oligonucleotides were synthesized which incorporated two restriction enzyme recognition sites (NdeI and EcoRI) to the sequences of the following oligonucleotides:
- the kinetic properties of the S. aureus EPSPS expressed in E. coli were determined, including the specific activity, the appK m (PEP), and the appK i (glyphosate).
- the S. aureus EPSPS gene has been previously described (O'Connell et al., 1993)
- the strategy taken for the cloning of the S. aureus EPSPS was polymerase chain reaction (PCR), utilizing the known nucleotide sequence of the S. aureus aroA gene encoding EPSPS (O'Cormell et al., 1993).
- the S. aureus culture (ATCC 35556) was cordated in an M2 facility in three 250 mL shake flasks containing 55 mL of TYE (tryptone 5 g/L, yeast extract 3 g/L, pH 6.8). The three flasks were inoculated with 1.5 mL each of a suspension made from freeze dried ATCC 35556 S. aureus cells in 90 mL of PBS (phosphate-buffered saline) buffer.
- PBS phosphate-buffered saline
- Flasks were incubated at 30° C. for 5 days while shaking at 250 rpm.
- the resulting cells were lysed (boiled in TE [tris/EDTA] buffer for 8 minutes) and the DNA utilized for PCR reactions.
- the EPSPS gene was amplified using PCR and engineered into an E. coli expression vector as follows:
- E. coli GB100 negative control
- pMON 9563 wt petunia EPSPS, positive control
- the organisms were grown in minimal media plus and minus aromatic amino acids. Later analyses showed that the SA#2 and SA#3 clones were identical, and they were assigned the plasmid identifier pMON21139.
- E. coli GB100 was also grown in M9 minimal media and induced with nalidixic acid.
- the frozen pMON21139 E. coli GB100 cell pellet from above was extracted and assayed for EPSPS activity as previously described.
- EPSPS assays were performed using 1 mM phosphoenolpyruvate (PEP), 2 mM shikimate-3-phosphate (S3P), 0. 1 mM ammonium molybdate, 5 mM potassium fluoride, pH 7.0, 25° C.
- the total assay volume was 50 ⁇ L, which contained 10 ⁇ L of the undiluted desalted extract.
- the plasmid pMON21139 in E. coli GB100 was grown in M9 minimal media and was induced with nalidixic acid to induce EPSPS expression driven from the RecA promoter.
- a desalted extract of the intracellular protein was analyzed for EPSPS activity, yielding an EPSPS specific activity of 0.005 ⁇ mol/min mg. Under these assay conditions, the S. aureus EPSPS activity was completely resistant to inhibition by 1 mM glyphosate. Previous analysis had shown that E. coli GB100 is devoid of EPSPS activity.
- the appK m (PEP) of the S. aureus EPSPS was determined by measuring the reaction velocity of the enzyme (in crude bacterial extracts) at varying concentrations of PEP. The results were analyzed graphically using several standard kinetic plotting methods. Data analysis using the hyperbolic, Lineweaver-Burke, and Eadie-Hofstee methods yielded appK m (PEP) constants of 7.5, 4.8, and 4.0 ⁇ M, respectively. These three data treatments are in good agreement, and yield an average value for appK m (PEP) of 5 ⁇ M.
- the EPSPS from S. aureus was found to be glyphosate-tolerant, with an appK i (glyphosate) of approximately 0.2 mM.
- the appK m (PEP) for the enzyme is approximately 5 ⁇ M, yielding a appK i (glyphosate)/appK m (PEP) of 40.
- Class II EPSPS genes may be used to identify and clone additional genes in much the same way that Class I EPSPS gene probes have been used to clone other Class I genes.
- An example of the latter was in the cloning of the A. thaliana EPSPS gene using the P. hybrida gene as a probe (Klee et al., 1987).
- EPSPS activity has been reported previously for EPSP synthases from a number of sources. These enzymes have not been characterized to any extent in most cases.
- the use of Class I and Class II EPSPS gene probes or antibody probes provide a rapid means of initially screening for the nature of the EPSPS and provide tools for the rapid cloning and characterization of the genes for such enzymes.
- Additional bacteria containing class II EPSPS gene have also been identified.
- a bacterium called C 12 isolated from the same treatment column beads as CP4 (see above) but in a medium in which glyphosate was supplied as both the carbon and phosphorus source, was shown by Southern analysis to hybridize with a probe consisting of the CP4 EPSPS coding sequence. This result, in conjunction with that for strain LBAA, suggests that this enrichment method facilitates the identification of Class II EPSPS isolates.
- New bacterial isolates containing Class II EPSPS genes have also been identified from environments other than glyphosate waste treatment facilities. An inoculum was prepared by extracting soil (from a recently harvested soybean field in Jerseyville, Ill.) and a population of bacteria selected by growth at 28° C.
- Class II EPSPS enzymes are identifiable by an elevated Ki for glyphosate and thus the genes for these will impart a glyphosate tolerance phenotype in heterologous hosts.
- Expression of the gene from recombinant plasmids or phage may be achieved through the use of a variety of expression promoters and include the T7 promoter and polymerase.
- the T7 promoter and polymerase system has been shown to work in a wide range of bacterial (and mammalian) hosts and offers the advantage of expression of many proteins that may be present on large cloned fragments. Tolerance to growth on glyphosate may be shown on minimal growth media.
- genes or conditions that may give glyphosate tolerance have been observed, including over expression of beta-lactamase, the igrA gene (Fitzgibbon and Braymer, 1990), or the gene for glyphosate oxidoreductase (PCT Pub. No. WO92/00377). These are easily distinguished from Class II EPSPS by the absence of EPSPS enzyme activity.
- the EPSPS protein is expressed from the aroA gene (also called aroE in some genera, for example, in Bacillus) and mutants in this gene have been produced in a wide variety of bacteria. Determining the identity of the donor organism (bacterium) aids in the isolation of Class II EPSPS gene—such identification may be accomplished by standard micro-biological methods and could include Gram stain reaction, growth, color of culture, and gas or acid production on different substrates, gas chromatography analysis of methylesters of the fatty acids in the membranes of the microorganism, and determination of the GC % of the genome. The identity of the donor provides information that may be used to more easily isolate the EPSPS gene.
- An AroA- host more closely related to the donor organism could be employed to clone the EPSPS gene by complementation but this is not essential since complementation of the E. coli AroA mutant by the CP4 EPSPS gene was observed.
- the information on the GC content the genome may be used in choosing nucleotide probes—donor sources with high GC % would preferably use the CP4 EPSPS gene or sequences as probes and those donors with low GC would preferably employ those from Bacillus subtilis, for example. Relationships between different EPSPS genes
- PGDKSTSHRSFMGGL SEQ ID NO:32
- LDFGNAATGCRLT SEQ ID NO:33
- FIG. 7 displays the Bestfit computer program alignment of the CP4 (SEQ ID NO:3) and LBAA (SEQ ID NO:5) EPSPS deduced amino acid sequences with the CP4 sequence appearing as the top sequence in the Figure.
- the symbols used in FIGS. 6 and 7 are the standard symbols used in the Bestfit computer program to designate degrees of similarity and identity.
- CP4 51 25 K. pneumoniae vs. CP4 56 28 Y. enterocolitica vs. CP4 53 25 H. influenzae vs. CP4 53 27 P. multocida vs. CP4 55 30 A. salmonicida vs. CP4 53 23 B. pertussis vs. CP4 53 27 E. coli vs. CP4 52 26 E. coli vs. LBAA 52 26 E. coli vs. B. subtilis 55 29 E. coli vs. D. nodosus 55 32 E. coli vs. S. aureus 55 29 E. coli vs. Synechocystis sp.
- the domains of EPSP synthase sequence identified in this application were determined to be those important for maintenance of glyphosate resistance and productive binding of PEP.
- the information used in indentifying these domains included sequence alignments of numerous glyphosate-sensitive EPSPS molecules and the three-dimensional x-ray structures of E. coli EPSPS (Stallings, et al. 1991) and CP4 EPSPS.
- the structures are representative of a glyphosate-sensitive (i.e., Class I) enzyme, and a naturally-occuring glyphosate-tolerant (i.e., Class II) enzyme of the present invention.
- These exemplary molecules were superposed three-dimensionally and the results displayed on a computer graphics terminal.
- the EPSPS gene from Agrobacterium sp. strain CP4 contains sequences that could be inimical to high expression of the gene in plants. These sequences include potential polyadenylation sites that are often and A+T rich, a higher G+C % than that frequently found in plant genes (63% versus ⁇ 50%), concentrated stretches of G and C residues, and codons that are not used frequently in plant genes.
- the high G+C % in the CP4 EPSPS gene has a number of potential consequences including the following: a higher usage of G or C than that found in plant genes in the third position in codons, and the potential to form strong hair-pin structures that may affect expression or stability of the RNA.
- a synthetic CP4 gene was designed to change as completely as possible those inimical sequences discussed above.
- the gene sequence was redesigned to eliminate as much as possible the following sequences or sequence features (while avoiding the introduction of unnecessary restriction sites): stretches of G's and C's of 5 or greater; and A+T rich regions (predominantly) that could function as polyadenylation sites or potential RNA destabilization region.
- the sequence of this gene is shown in FIG. 8 (SEQ ID NO:9). This coding sequence was expressed in E. coli from the RecA promoter and assayed for EPSPS activity and compared with that from the native CP4 EPSPS gene.
- the apparent Km for PEP for the native and synthetic genes was 11.8 and 12.7, respectively, indicating that the enzyme expressed from the synthetic gene was unaltered.
- the N-terminus of the coding sequence was mutagenized to place an SphI site at the ATG to permit the construction of the CTP2-CP4 synthetic fusion for chloroplast import.
- the following primer was used to accomplish this mutagenesis:
- the glyphosate target in plants is located in the chloroplast.
- EPSPS 5-enolpyruvyl-shikimate-3-phosphate synthase
- CTP chloroplast transit peptide
- examples of other such chloroplast proteins include the small subunit (SSU) of Ribulose-1,5-bisphosphate carboxylase (RUBISCO), Ferredoxia, Ferredoxin oxidoreductase, the Light-harvesting-complex protein I and protein II, and Thioredoxin F. It has been demonstrated in vivo and in vitro that non-chloroplast proteins may be targeted to the chloroplast by use of protein fusions with a CTP and that a CTP sequence is sufficient to target a protein to the chloroplast.
- SSU small subunit
- RUBISCO Ribulose-1,5-bisphosphate carboxylase
- Ferredoxia Ferredoxia
- Ferredoxin oxidoreductase the Light-harvesting-complex protein I
- a CTP-CP4 EPSPS fusion was constructed between the Arabidopsis thaliana EPSPS CTP (Klee et al., 1987) and the CP4 EPSPS coding sequences.
- the Arabidopsis CTP was engineered by site-directed mutagenesis to place a SphI restriction site at the CTP processing site. This mutagenesis replaced the Glu-Lys at this location with Cys-Met.
- the sequence of this CTP designated as CTP2 (SEQ ID NO:10), is shown in FIG. 9 .
- the N-terminus of the CP4 EPSPS gene was modified to place a SphI site that spans the Met codon. The second codon was converted to one for leucine in this step also.
- the Arabidopsis EPSPS CTP was fused to the CP4 EPSPS through an EcoRI site.
- the sequence of this CTP3 (SEQ ID NO:12) is shown in FIG. 10 .
- An EcoRI site was introduced into the Arabidopsis EPSPS mature region around amino acid 27, replacing the sequence -Arg-Ala-Leu-Leu- with -Arg-Ile-Leu-Leu- in the process.
- the primer of the following sequence was used to modify the N-terminus of the CP4 EPSPS gene to add an EcoRI site to effect the fusion to the
- CTP4 SphI
- CTP5 EcoRI
- the SphI site was added by site-directed mutagenesis to place this restriction site (and change the amino acid sequence to -Cys-Met-) at the chloroplast processing site. All of the CTP-CP4 EPSPS fusions were shown to import into chloroplasts with approximately equal efficiency.
- the CTP4 (SEQ ID NO:14) and CTP5 (SEQ ID NO:16) sequences are shown in FIGS. 11 and 12 .
- a CTP2-LBAA EPSPS fusion was also constructed following the modification of the N-terminus of the LBAA EPSPS gene by the addition of a SphI site. This fusion was also found to be imported efficiently into chloroplasts.
- CTP2-CP4 EPSPS and the CTP4-CP4 EPSPS fusion have also been shown to import efficiently into chloroplasts prepared from the leaf sheaths of corn. These results indicate that these CTP-CP4 fusions could also provide useful genes to impart glyphosate tolerance in monocot species.
- CTP2 or CTP4 are preferred because these transit peptide constructions yield mature EPSPS enzymes upon import into the chloroplast which are closer in composition to the native EPSPSs not containing a transit peptide signal.
- CTP2 or CTP4 is preferred because these transit peptide constructions yield mature EPSPS enzymes upon import into the chloroplast which are closer in composition to the native EPSPSs not containing a transit peptide signal.
- Those skilled in the art will recognize that various chimeric constructs can be made which utilize the functionality of a particular CTP to import a Class II EPSPS enzyme into the plant cell chloroplast.
- the chloroplast import of the Class II EPSPS can be determined using the following assay.
- Intact chloroplasts are isolated from lettuce (Latuca sativa, var. longifolia) by centrifugation in Percoll/ficoll gradients as modified from Bartlett et al., (1982). The final pellet of intact chloroplasts is suspended in 0.5 ml of sterile 330 mM sorbitol in 50 mM Hepes-KOH, pH 7.7, assayed for chlorophyll (Arnon, 1949), and adjusted to the final chlorophyll concentration of 4 mg/ml (using sorbitol/Hepes). The yield of intact chloroplasts from a single head of lettuce is 3-6 mg chlorophyll.
- a typical 300 ⁇ l uptake experiment contained 5 mM ATP, 8.3 mM unlabeled methionine, 322 mM sorbitol, 58.3 mM Hepes-KOH (pH 8.0), 50 ⁇ l reticulocyte lysate translation products, and intact chloroplasts from L. sativa (200 ⁇ g chlorophyll).
- the uptake mixture is gently rocked at room temperature (in 10 ⁇ 75 mm glass tubes) directly in front of a fiber optic illuminator set at maximum light intensity (150 Watt bulb).
- the chloroplast pellet is then resuspended in 50-100 ⁇ l of lysis buffer (10 mM Hepes-KOH pH 7.5, 1 mM PMSF, 1 mM benzamidine, 5 mM e-amino-n-caproic acid, and 30 ⁇ g/ml aprotinin) and centrifuged at 15,000 ⁇ g for 20 minutes to pellet the thylakoid membranes.
- the clear supernatant (stromal proteins) from this spin, and an aliquot of the reticulocyte lysate incubation medium from each uptake experiment, are mixed with an equal volume of 2 ⁇ SDS-PAGE sample buffer for electrophoresis (Laemmli, 1970).
- SDS-PAGE is carried out according to Laemmli (1970) in 3-17% (w/v) acrylamide slab gels (60 mm ⁇ 1.5 mm) with 3% (w/v) acrylamide stacking gels (5 mm ⁇ 1.5 mm).
- the gel is fixed for 20-30 rain in a solution with 40% methanol and 10% acetic acid.
- the gel is soaked in EN 3 HANCETM (DuPont) for 20-30 minutes, followed by drying the gel on a gel dryer.
- the gel is imaged by autoradiography, using an intensifying screen and an overnight exposure to determine whether the CP4 EPSPS is imported into the isolated chloroplasts.
- Plants which can be made glyphosate-tolerant by practice of the present invention include, but are not limited to, soybean, cotton, corn, canola, oil seed rape, flax, sugarbeet, sunflower, potato, tobacco, tomato, wheat, rice, alfalfa and lettuce as well as various tree, nut and vine species.
- a double-stranded DNA molecule of the present invention (“chimeric gene”) can be inserted into the genome of a plant by any suitable method.
- Suitable plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed, e.g., by Herrera-Estrella (1983), Beyart (1984), Klee (1985) and EPO publication 120,516 (Schilperoort et al.).
- Ri root-inducing
- alternative methods can be used to insert the DNA constructs of this invention into plant cells. Such methods may involve, for example, the use of liposomes, electroporation, chemicals that increase free DNA uptake, free DNA delivery via microprojectile bombardment, and transformation using viruses or pollen.
- Class II EPSPS DNA sequences may be engineered into vectors capable of transforming plants by using known techniques. The following description is meant to be illustrative and not to be read in a limiting sense. One of ordinary skill in the art would know that other plasmids, vectors, markers, promoters, etc. would be used with suitable results.
- the CTP2-CP4 EPSPS fusion was cloned as a BglII-EcoRI fragment into the plant vector pMON979 (described below) to form pMON17110, a map of which is presented in FIG. 13 . In this vector the CP4 gene is expressed from the enhanced CaMV35S promoter (E35S; Kay et al. 1987).
- a FMV35S promoter construct (pMON17116) was completed in the following way: The SaII-NotI and the NotI-BglII fragments from pMON979 containing the Spc/AAC(3)-III/oriV and the pBR322/Right Border/NOS 3′/CP4 EPSPS gene segment from pMON17110 were ligated with the XhoI-BglII FMV35S promoter fragment from pMON981. These vectors were introduced into tobacco, cotton and canola.
- a series of vectors was also completed in the vector pMON977 in which the CP4 EPSPS gene, the CTP2-CP4 EPSPS fusion, and the CTP3-CP4 fusion were cloned as BglII-SacI fragments to form pMON17124, pMON17119, and pMON17120, respectively. These plasmids were introduced into tobacco. A pMON977 derivative containing the CTP2-LBAA EPSPS gene was also completed (pMON17206) and introduced into tobacco.
- the pMON979 plant transformation/expression vector was derived from pMON886 (described below) by replacing the neomycin phosphotransferase typeII (KAN) gene in pMON886 with the 0.89 kb fragment containing the bacterial gentamicin-3-N-acetyltransferase type III (AAC(3)-III) gene (Hayford et al., 1988).
- KAN neomycin phosphotransferase typeII
- AAC(3)-III 0.89 kb fragment containing the bacterial gentamicin-3-N-acetyltransferase type III
- the chimeric P-35S/AA(3)-III/NOS 3′ gene encodes gentamicin resistance which permits selection of transformed plant cells.
- pMON979 also contains a 0.95 kb expression cassette consisting of the enhanced CaMV 35S promoter (Kay et al., 1987), several unique restriction sites, and the NOS 3′ end (P-En-CaMV35SfNOS 3′). The rest of the pMON979 DNA segments are exactly the same as in pMON886.
- Plasmid pMON886 is made up of the following segments of DNA. The first is a 0.93 kb AvaI to engineered-EcoRV fragment isolated from transposon Tn7 that encodes bacterial spectinomycin/streptomycin resistance (Spc/Str), which is a determinant for selection in E. coli and Agrobacterium tumefaciens. This is joined to the 1.61 kb segment of DNA encoding a chimeric kanamycin resistance which permits selection of transformed plant cells.
- Spc/Str bacterial spectinomycin/streptomycin resistance
- the chimeric gene (P-35S/KANfNOS 3′) consists of the cauliflower mosaic virus (CaMV) 35S promoter, the neomycin phosphotransferase typeII (KAN) gene, and the 3′-nontranslated region of the nopaline synthase gene (NOS 3′) (Fraley et al., 1983).
- the next segment is the 0.75 kb oriV containing the origin of replication from the RK2 plasmid. It is joined to the 3.1 kb SalI to PvuI segment of pBR322 (ori322) which provides the origin of replication for maintenance in E.
- the next segment is the 0.36 kb PvuI to BclI from pTiT37 that carries the nopaline-type T-DNA right border (Fraley et al., 1985).
- the pMON977 vector is the same as pMON981 except for the presence of the P-En-CaMV35S promoter in place of the FMV35S promoter (see below).
- the pMON981 plasmid contains the following DNA segments: the 0.93 kb fragment isolated from transposon Tn7 encoding bacterial spectinomycin/streptomycin resistance [Spc/Str; a determinant for selection in E.
- coli and Agrobacterium tumefaciens (Fling et al., 1985)]; the chimeric kanamycin resistance gene engineered for plant expression to allow selection of the transformed tissue, consisting of the 0.35 kb cauliflower mosaic virus 35S promoter (P-35S) (Odell et al., 1985), the 0.83 kb neomycin phosphotransferase typeII gene (KAN), and the 0.26 kb 3′-nontranslated region of the nopaline synthase gene (NOS 3′) (Fraley et al., 1983); the 0.75 kb origin of replication from the RK2 plasmid (oriV) (Stalker et al., 1981); the 3.1 kb SalI to PvuI segment of pBR322 which provides the origin of replication for maintenance in E.
- P-35S the 0.83 kb neomycin phosphotransferase typeII gene
- NOS 3′
- the expression cassette consists of the 0.6 kb 35S promoter from the figwort mosaic virus (P-FMV35S) (Gowda et al., 1989) and the 0.7 kb 3′ non-translated region of the pea rbcS-E9 gene (E9 3′) (Coruzzi et al., 1984, and Morelli et al., 1985).
- the 0.6 kb SspI fragment containing the FMV35S promoter ( FIG. 1 ) was engineered to place suitable cloning sites downstream of the transcriptional start site.
- the CTP2-CP4syn gene fusion was introduced into plant expression vectors (including pMON981, to form pMON17131; FIG. 14 ) and transformed into tobacco, canola, potato, tomato, sugarbeet, cotton, lettuce, cucumber, oil seed rape, poplar, and Arabidopsis.
- the plant vector containing the Class II EPSPS gene may be mobilized into any suitable Agrobacterium strain for transformation of the desired plant species.
- the plant vector may be mobilized into an ABI Agrobacterium strain.
- a suitable ABI strain is the A208 Agrobacterium tumefaciens carrying the disarmed Ti plasmid pTiC58 (pMP90RK) (Koncz and Schell, 1986).
- the Ti plasmid does not carry the T-DNA phytohormone genes and the strain is therefore unable to cause the crown gall disease.
- Mating of the plant vector into ABI was done by the triparental conjugation system using the helper plasmid pRK2013 (Ditta et al., 1980).
- the vector When the plant tissue is incubated with the ABI::plant vector conjugate, the vector is transferred to the plant cells by the vir functions encoded by the disarmed pTiC58 plasmid.
- the vector opens at the T-DNA right border region, and the entire plant vector sequence may be inserted into the host plant chromosome.
- the pTiC58 Ti plasmid does not transfer to the plant cells but remains in the Agrobacterium.
- Class II EPSPS genes may also be introduced into plants through direct delivery methods.
- a number of direct delivery vectors were completed for the CP4 EPSPS gene.
- the vector pMON13640 a map of which is presented in FIG. 15 , is described here.
- the plasmid vector is based on a pUC plasmid (Vieira and Messing, 1987) containing, in this case, the nptII gene (kanamycin resistance; KAN) from Tn903 to provide a selectable marker in E. coli.
- the CTP4-EPSPS gene fusion is expressed from the P-FMV35S promoter and contains the NOS 3′ polyadenylation sequence fragment and from a second cassette consisting of the E35S promoter, the CTP4-CP4 gene fusion and the NOS 3′ sequences.
- the scoreable GUS marker gene (Jefferson et al., 1987) is expressed from the mannopine synthase promoter (P-MAS; Velten et al., 1984) and the soybean 7S storage protein gene 3′ sequences (Schuler et al., 1982).
- Similar plasmids could also be made in which CTP-CP4 EPSPS fusions are expressed from the enhanced CaMV35S promoter or other plant promoters.
- Other vectors could be made that are suitable for free DNA delivery into plants and such are within the skill of the art and contemplated to be within the scope of this disclosure.
- Transformants are selected, following double cross-over events into the plastid genome, on the basis of resistance to spectinomycin conferred through rRNA changes or through the introduction of an aminoglycoside 3′′-adenyltransferase gene (Svab et al., 1990; Svab and Maliga, 1993), or resistance to kanamycin through the neomycin phosphotransferase NptII (Carrer et al., 1993).
- DNA is introduced by biolistic means (Svab et al, 1990; Maliga et al., 1993) or by using polyethylene glycol (O'Neill et al., 1993).
- the cells (or protoplasts) are regenerated into whole plants.
- Choice of methodology for the generation step is not critical, with suitable protocols being available for hosts from Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, rapeseed, etc.), Cucurbitaceae (melons and cucumber), Gramineae (wheat, rice, corn, etc.), Solanaceae (potato, tobacco, tomato, peppers), various floral crops as well as various trees such as poplar or apple, nut crops or vine plants such as grapes. See, e.g., Ammirato, 1984; Shimamoto, 1989; Fromm, 1990; Vasil, 1990.
- EPSPS activity in plants is assayed by the following method. Tissue samples were collected and immediately frozen in liquid nitrogen. One gram of young leaf tissue was frozen in a mortar with liquid nitrogen and ground to a fine powder with a pestle. The powder was then transferred to a second mortar, extraction buffer was added (1 ml/gram), and the sample was ground for an additional 45 seconds.
- the extraction buffer for canola consists of 100 mM Tris, 1 mM EDTA, 10% glycerol, 5 mM DTT, 1 mM BAM, 5 mM ascorbate, 1.0 mg/ml BSA, pH 7.5 (4° C.).
- the extraction buffer for tobacco consists of 100 mM Tris, 10 mM EDTA, 35 mM KCl, 20% glycerol, 5 mM DTT, 1 mM BAM, 5 mM ascorbate, 1.0 mg/ml BSA, pH 7.5 (4° C.).
- the mixture was transferred to a microfuge tube and centrifuged for 5 minutes.
- the resulting supernatants were desalted on spin G-50 (Pharmacia) columns, previously equilibrated with extraction buffer (without BSA), in 0.25 ml aliquots.
- the desalted extracts were assayed for EPSP synthase activity by radioactive HPLC assay. Protein concentrations in samples were determined by the BioRad microprotein assay with BSA as the standard.
- Protein concentrations were determined using the BioRad Microprotein method, BSA was used to generate a standard curve ranging from 2-24 ⁇ g. Either 800 ⁇ l of standard or diluted sample was mixed with 200 ⁇ l of concentrated BioRad Bradford reagent. The samples were vortexed and read at A(595) after ⁇ 5 minutes and compared to the standard curve.
- EPSPS enzyme assays contained HEPES (50 mM), shikimate-3-phosphate (2 mM), NH 4 molybdate (0.1 mM) and KF (5 mM), with or without glyphosate (0.5 or 1.0 mM).
- the assay mix (30 ⁇ l) and plant extract (10 ⁇ l) were preincubated for 1 minute at 25° C. and the reactions were initiated by adding 14 C-PEP (1 mM). The reactions were quenched after 3 minutes with 50 ⁇ l of 90% EtOH/0.1M HOAc, pH 4.5. The samples were spun at 6000 rpm and the resulting supernatants were analyzed for 14 C-EPSP production by HPLC. Percent resistant EPSPS is calculated from the EPSPS activities with and without glyphosate.
- the percent conversion of 14 C labeled PEP to 14 C EPSP was determined by HPLC radioassay using a C18 guard column (Brownlee) and an AX 100 HPLC column (0.4 ⁇ 25 cm, Synchropak) with 0.28M isocratic potassium phosphate eluant, pH 6.5, at 1 ml/min.
- Initial velocities were calculated by multiplying fractional turnover per unit time by the initial concentration of the labeled substrate (1 mM).
- the assay was linear with time up to ⁇ 3 minutes and 30% turnover to EPSPS. Samples were diluted with 10 mM Tris, 10% glycerol, 10 mM DTT, pH 7.5 (4° C.) if necessary to obtain results within the linear range.
- DL-dithiotheitol DTT
- BAM benzamidine
- BSA bovine serum albumin
- Phosphoenolpyruvate was from Boehringer Mannheim and phosphoenol[1- 14 C]pyruvate (28 mCi/mmol) was from Amersham.
- Transformed tobacco plants have been generated with a number of the Class II EPSPS gene vectors containing the CP4 EPSPS DNA sequence as described above with suitable expression of the EPSPS. These transformed plants exhibit glyphosate tolerance imparted by the Class II CP4 EPSPS.
- Transformation of tobacco employs the tobacco leaf disc transformation protocol which utilizes healthy leaf tissue about 1 month old. After a 15-20 minutes surface sterilization with 10% Clorox plus a surfactant, the leaves are rinsed 3 times in sterile water. Using a sterile paper punch, leaf discs are punched and placed upside down on MS104 media (MS salts 4.3 g/l, sucrose 30 g/l, B5vitamins 500 ⁇ 2 ml/l, NAA 0.1 mg/l, and BA 1.0 mg/l) for a 1 day preculture.
- MS104 media MS salts 4.3 g/l, sucrose 30 g/l, B5vitamins 500 ⁇ 2 ml/l, NAA 0.1 mg/l, and BA 1.0 mg/l
- the discs are then inoculated with an overnight culture of a disarmed Agrobacterium ABI strain containing the subject vector that had been diluted 1/5 (i.e.: about 0.6 OD).
- the inoculation is done by placing the discs in centrifuge tubes with the culture. After 30 to 60 seconds, the liquid is drained off and the discs were blotted between sterile filter paper. The discs are then placed upside down on MS104 feeder plates with a filter disc to co-culture.
- the discs After 2-3 days of co-culture, the discs are transferred, still upside down, to selection plates with MS104 media. After 2-3 weeks, callus tissue formed, and individual clumps are separated from the leaf discs. Shoots are cleanly cut from the callus when they are large enough to be distinguished from stems. The shoots are placed on hormone-free rooting media (MSO: MS salts 4.3 g/l, sucrose 30 g/l, and B5 vitamins 500 ⁇ 2 ml/l) with selection for the appropriate antibiotic resistance. Root formation occurred in 1-2 weeks. Any leaf callus assays are preferably done on rooted shoots while still sterile. Rooted shoots are then placed in soil and kept in a high humidity environment (i.e.: plastic containers or bags). The shoots are hardened off by gradually exposing them to ambient humidity conditions.
- MSO hormone-free rooting media
- Tobacco cells were transformed with a number of plant vectors containing the native CP4 EPSPS gene, and using different promoters and/or CTP's. Preliminary evidence for expression of the gene was given by the ability of the leaf tissue from antibiotic selected transformed shoots to recallus on glyphosate. In some cases, glyphosate-tolerant callus was selected directly following transformation.
- the level of expression of the CP4 EPSPS was determined by the level of glyphosate-tolerant EPSPS activity (assayed in the presence of 0.5 mM glyphosate) or by Western blot analysis using a goat anti-CP4 EPSPS antibody.
- Canola plants were transformed with the pMON17110, pMON17116, and pMON17131 vectors and a number of plant lines of the transformed canola were obtained which exhibit glyphosate tolerance.
- Seedlings of Brassica napus cv Westar were established in 2 inch ( ⁇ 5 cm) pots containing Metro Mix 350. They were grown in a growth chabmer at 24° C., 16/8 hour photoperiod, light intensity of 400 ⁇ Em ⁇ 2 sec ⁇ 1 (HID lamps). They were fertilized with Peters 20-10-20 General Purpose Special. After 21 ⁇ 2 weeks they were transplanted to 6 inch ( ⁇ 15 cm) pots and grown in a growth chamber at 15°/10° C. day/night temperature, 16/8 hour photoperiod, light intensity of 800 uEm ⁇ 2 sec ⁇ 1 (HID lamps). They were fertilized with Peters 15-30-15 Hi-Phos Special.
- the Agrobacterium was grown overnight on a rotator at 24° C. in 2 mls of Luria Broth containing 50 mg/l kanamycin, 24 mg/l chloramphenicol and 100 mg/l spectinomycin. A 1:10 dilution was made in MS (Murashige and Skoog) media giving approximately 9 ⁇ 10 8 cells per ml. This was confirmed with optical density readings at 660 mu.
- the stem discs (explants) were inoculated with 1.0 ml of Agrobacterium and the excess was aspirated from the explants.
- the explants were placed basal side down in petri plates containing 1/10 ⁇ standard MS salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 1.0 mg/l 6-benzyladenine (BA).
- the plates were layered with 1.5 ml of media containing MS salts, B5 vitamins, 3% sucrose, pH 5.7, 4.0 mg/l p-chlorophenoxyacetic acid, 0.005 mg/l kinetin and covered with sterile filter paper.
- the explants were transferred to deep dish petri plates containing MS salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 1 mg/l BA, 500 mg/l carbenicillin, 50 mg/l cefotaxime, 200 mg/l kanamycin or 175 mg/l gentamicin for selection. Seven explants were placed on each plate. After 3 weeks they were transferred to fresh media, 5 explants per plate. The explants were cultured in a growth room at 25° C., continuous light (Cool White).
- Leaf recallusing assays were initiated to confirm modification of R o shoots. Three tiny pieces of leaf tissue were placed on recallusing media containing MS salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 5.0 mg/l BA, 0.5 mg/l naphthalene acetic acid (NAA), 500 mg/l carbenicillin, 50 mg/l cefotaxime and 200 mg/l kanamycin or gentamicin or 0.5 mM glyphosate. The leaf assays were incubated in a growth room under the same conditions as explant culture. After 3 weeks the leaf recallusing assays were scored for herbicide tolerance (callus or green leaf tissue) or sensitivity (bleaching).
- the shoot stems were dipped in Rootone® and placed in 2 inch ( ⁇ 5 cm) pots containing Metro-Mix 350 and placed in a closed humid environment. They were placed in a growth chamber at 24° C., 16/8 hour photoperiod, 400 uEm ⁇ 1 sec ⁇ 2 (HID lamps) for a hardening-off period of approximately 3 weeks.
- R 1 seed which gives rise to R 1 plants.
- R 1 seed which gives rise to R 1 plants.
- R 1 progeny are evaluated. Because an R o plant is assumed to be hemizygous at each insert location, selfing results in maximum genotypic segregation in the R 1 . Because each insert acts as a dominant allele, in the absence of linkage and assuming only one hemizygous insert is required for tolerance expression, one insert would segregate 3:1, two inserts, 15:1, three inserts 63:1, etc. Therefore, relatively few R 1 plants need be grown to find at least one resistant phenotype.
- Seed from an R o plant is harvested, threshed, and dried before planting in a glyphosate spray test.
- Various techniques have been used to grow the plants for R 1 spray evaluations. Tests are conducted in both greenhouses and growth chambers. Two planting systems are used; ⁇ 10 cm pots or plant trays containing 32 or 36 cells. Soil used for planting is either Metro 350 plus three types of slow release fertilizer or plant Metro 350. Irrigation is either overhead in greenhouses or sub-irrigation in growth chambers. Fertilizer is applied as required in irrigation water. Temperature regimes appropriate for canola were maintained. A sixteen hour photoperiod was maintained. At the onset of flowering, plants are transplanted to ⁇ 15 cm pots for seed production.
- a spray “batch” consists of several sets of R 1 progenies all sprayed on the same date. Some batches may also include evaluations of other than R 1 plants. Each batch also includes sprayed and unsprayed non-transgenic genotypes representing the genotypes in the particular batch which were putatively transformed. Also included in a batch is one or more non-segregating transformed genotypes previously identified as having some resistance.
- Two-six plants from each individual R o progeny are not sprayed and serve as controls to compare and measure the glyphosate tolerance, as well as to assess any variability not induced by the glyphosate.
- glyphosate is applied at rates varying from 0.28 to 1.12 kg/ha, depending on objectives of the study. Low rate technology using low volumes has been adopted.
- a laboratory track sprayer has been calibrated to deliver a rate equivalent to field conditions.
- a scale of 0 to 10 is used to rate the sprayed plants for vegetative resistance.
- the scale is relative to the unsprayed plants from the same R o plant.
- a 0 is death, while a 10 represents no visible difference from the unsprayed plant.
- a higher number between 0 and 10 represents progressively less damage as compared to the unsprayed plant.
- Plants are scored at 7, 14, and 28 days after treatment (DAT), or until bolting, and a line is given the average score of the sprayed plants within an R o plant family.
- Plants are scored using this scale at or shortly after initiation of flowering, depending on the rate of floral structure development.
- the data obtained for the Class II EPSPS transformants may be compared to glyphosate-tolerant Class I EPSP transformants in which the same promoter is used to express the EPSPS genes and in which the level of glyphosate-tolerant EPSPS activity was comparable for the two types of transformants.
- a comparison of the data of pMON17110 [in Table IXA] and pMON17131 [Table IXB] with that for pMON899 [in Table IXC; the Class I gene in pMON899 is that from A. thaliana ⁇ Klee et al., 1987 ⁇ in which the glycine at position 101 was changed to an alanine] illustrates that the Class II EPSPS is at least as good as that of the Class I EPSPS.
- An improvement in vegetative tolerance of Class II EPSPS is apparent when one takes into account that the Class II plants were sprayed at twice the rate and were tested as R 1 plants.
- the construction of two plant transformation vectors and the transformation procedures used to produce glyphosate-tolerant canola plants are described in this example
- the vectors, pMON17209 and pMON17237, were used to generate transgenic glyphosate-tolerant canola lines.
- the vectors each contain the gene encoding the 5-enol-pyruvyl-shikimate-3-phosphate synthase (EPSPS) from Agrobacterium sp. strain CP4.
- the vectors also contain either the gox gene encoding the glyphosate oxidoreductase enzyme (GOX) from Achromobacter sp.
- EPSPS 5-enol-pyruvyl-shikimate-3-phosphate synthase
- GOX glyphosate oxidoreductase enzyme
- strain LBAA Barry et al., 1992
- GOX v.247 the gene encoding a variant of GOX which displays improved catalytic properties.
- These enzymes convert glyphosate to aminomethylphosphonic acid and glyoxylate and protect the plant from damage by the metabolic inactivation of glyphosate.
- the combined result of providing an alternative, resistant EPSPS enzyme and the metabolism of glyphosate produces transgenic plants with enhanced tolerance to glyphosate
- Plant transformation vectors The following describes the general features of the plant transformation vectors that were modified to form vectors pMON17209 and pMON17237.
- the Agrobacterium mediated plant transformation vectors contain the following well-characterized DNA segments which are required for replication and function of the plasmids (Rogers and Klee, 1987; Klee and Rogers, 1989).
- the first segment is the 0.45 kb ClaI-DraI fragment from the pTi15955 octopine Ti plasmid which contains the T-DNA left border region (Barker et al., 1983). It is joined to the 0.75 kb origin of replication (oriV) derived from the broad-host range plasmid RK2 (Stalker et al., 1981).
- the next segment is the 3.1 kb SalI-PvuI segment of pBR 322 which provides the origin of replication for maintenance in E. coli and the born site for the conjugational transfer into the Agrobacterium turnefaciens cells (Bolivar et al., 1977). This is fused to the 0.93 kb fragment isolated from transposon Tn7 which encodes bacterial spectinomycin and streptomycin resistance (Fling et al., 1985), a determinant for the selection of the plasmids in E. coli and Agrobacterium.
- this vector also includes the 35S promoter/NPTII/NOS 3′ cassette to enable selection of transformed plant tissues on kanamycin (Klee and Rogers, 1989; Fraley et al., 1983; and Odell, et al., 1985) within the borders.
- An “empty” expression cassette is also present between the borders and consists of the enhanced E35S promoter (Kay et al., 1987), the 3′ region from the small subunit of RUBP carboxylase of pea (E9) (Coruzzi et al., 1984; Morelli et al., 1986), and a number of restriction enzyme sites that may be used for the cloning of DNA sequences for expression in plants.
- E9 the 3′ region from the small subunit of RUBP carboxylase of pea
- restriction enzyme sites that may be used for the cloning of DNA sequences for expression in plants.
- the plant transformation system based on Agrobacterium tumefaciens delivery has been reviewed (Klee and Rogers, 1989; Fraley et al., 1986).
- the Agrobacterium mediated transfer and integration of the vector T-DNA into the plant chromosome results in the expression of the chimeric genes conferring the desired phenotype in plants.
- the binary vectors are mobilized into Agrobacterium tumefaciens strain ABI by the triparental conjugation system using the helper plasmid pRK2013 (Ditta et al., 1980).
- the ABI strain contains the disarmed pTiC58 plasmid pMP90RK (Koncz and Schell, 1986) in the chloramphenicol resistant derivative of the Agrobacterium tumefaciens strain A208.
- Seedlings of Brassica napus cv. Westar were grown in Metro Mix 350 (Huminert Seed Co., St. Louis, Mo.) in a growth chamber with a day/night temperature of 15°/10° C., relative humidity of 50%, 16h/8h photoperiod, and at a light intensity of 500 ⁇ mol m ⁇ 2 sec ⁇ 1 .
- the plants were watered daily (via sub-irrigation) and fertilized every other day with Peter's 15:30:15 (Fogelsville, Pa.).
- the suspension of bacteria was removed by aspiration and the explants were placed basal side down—for an optimal shoot regeneration response—onto co-culture plates ( 1/10 MSO solid medium with a 1.5 ml TXD (tobacco xanthi diploid) liquid medium overlay and covered with a sterile 8.5 cm filter paper). Fifty-to-sixty stem explants were placed onto each co-culture plate.
- stem explants were moved onto MS medium containing 750 mg/l carbenicillin, 50 mg/l cefotaxime, and 1 mg/l BAP (benzylaminopurine) for 3 days.
- the stem explants were then placed for two periods of three weeks each, again basal side down and with 5 explants per plate, onto an MS/0.1 mM glyphosate, selection medium (also containing carbenicillin, cefotaxime, and BAP (The glyphosate stock [0.5M] is prepared as described in the following: 8.45 g glyphosate [analytical grade] is dissolved in 50 ml deionized water, adding KOH pellets to dissolve the glyphosate, and the volume is brought to 100 ml following adjusting the pH to 5.7.
- the solution is filter-sterilized and stored at 4° C.).
- green, normally developing shoots were excised from the stem explants and were placed onto fresh MS medium containing 750 mg/l carbenicillin, 50 mg/l cefotaxime, and 1 mg/l BAP, for further shoot development.
- MS medium containing 750 mg/l carbenicillin, 50 mg/l cefotaxime, and 1 mg/l BAP, for further shoot development.
- the shoots were 2-3 inches tall, a fresh cut at the end of the stem was made, the cut end was dipped in Root-tone, and the shoot was placed in Metro Mix 350 soil and allowed to harden-off for 2-3 weeks.
- the EPSPS gene was isolated originally from Agrobacterium sp. strain CP4 and expresses a highly tolerant enzyme. The original gene contains sequences that could be inimical to high expression of the gene in some plants. These sequences include potential polyadenylation sites that are often A+T rich, a higher G+C % than that frequently found in dicotyledonous plant genes (63% versus ⁇ 50%), concentrated stretches of G and C residues, and codons that may not used frequently in dicotyledonous plant genes. The high G+C % in the CP4 EPSPS gene could also result in the formation of strong hairpin structures that may affect expression or stability of the RNA.
- a plant preferred version of the gene was synthesized and used for these vectors.
- This coding sequence was expressed in E. coli from a PRecA-gene10L vector (Olins et al., 1988) and the EPSPS activity was compared with that from the native CP4 EPSPS gene.
- the appK m for PEP for the native and synthetic genes was 11.8 ⁇ M and 12.7 ⁇ M, respectively, indicating that the enzyme expressed from the synthetic gene was unaltered.
- the N-terminus of the coding sequence was then mutagenized to place an SphI site (GCATGC) at the ATG to permit the construction of the CTP2-CP4 synthetic fusion for chloroplast import.
- GCATGC SphI site
- a CTP-CP4 EPSPS fusion was constructed between the Arabidopsis thaliana EPSPS CTP (Klee et al., 1987) and the CP4 EPSPS coding sequences.
- the Arabidopsis CTP was engineered by site-directed mutagenesis to place a SphI restriction site at the CTP processing site. This mutagenesis replaced the Glu-Lys at this location with Cys-Met.
- the CTP2-CP4 EPSPS fusion was tested for import into chloroplasts isolated from Lactuca sativa using the methods described previously (della-Cioppa et al., 1986; 1987).
- the GOX gene that encodes the glyphosate metabolizing enzyme glyphosate oxidoreductase was cloned originally from Achromobacter sp. strain LBAA (Hallas et al., 1988; Barry et al., 1992).
- the gox gene from strain LBAA was also resynthesized in a plant-preferred sequence version and in which many of the restriction sites were removed (PCT Appln. No. WO 92/00377).
- the GOX protein is targeted to the plastids by a fusion between the C-terminus of a CTP and the N-terminus of GOX.
- CTP1 A CTP, derived from the SSU1A gene from Arabidopsis thaliana (Timko et al., 1988) was used. This CTP (CTP1) was constructed by a combination of site-directed mutageneses. The CTP1 is made up of the SSU1A CTP (amino acids 1-55), the first 23 amino acids of the mature SSU1A protein (56-78), a serine residue (amino acid 79), a new segment that repeats amino acids 50 to 56 from the CTP and the first two from the mature protein (amino acids 80-87), and an alanine and methionine residue (amino acid 88 and 89).
- NcoI restriction site if located at the 3′ end (spans the Met89 codon) to facilitate the construction of precise fusions to the 5′ of GOX.
- a BglII site was introduced upstream of the N-terminus of the SSU1A sequences to facilitate the introduction of the fusions into plant transformation vectors.
- a fusion was assembled between CTP1 and the synthetic GOX gene.
- the CP4 EPSPS and GOX genes were combined to form pMON17209 as described in the following.
- the CTP2-CP4 EPSPS fusion was assembled and inserted between the constitutive FMV35S promoter (Gowda et al., 1989; Richins et al., 1987) and the E9 3′ region (Coruzzi et al., 1984; Morelli et al., 1985) in a pUC vector (Yannisch-Perron et al., 1985; Vieira and Messing, 1987) to form pMON17190; this completed element may then be moved easily as a NotI-NotI fragment to other vectors.
- the CTP1-GOX fusion was also assembled in a pUC vector with the FMV35S promoter. This element was then moved as a HindIII-BamHI fragment into the plant transformation vector pMON10098 and joined to the E9 3′ region in the process.
- the resultant vector pMON17193 has a single NotI site into which the FMV 35S/CTP2-CP4 EPSPS/E9 3′ element from pMON17190 was cloned to form pMON17194.
- the kanamycin plant transformation selection cassette (Fraley et al., 1985) was then deleted from pMON17194, by cutting with XhoI and re-ligating, to form the pMON17209 vector (FIG. 24 ).
- the GOX enzyme has an apparent Km for glyphosate [appK m (glyphosate)] of ⁇ 25 mM.
- Km for glyphosate [appK m (glyphosate)] of ⁇ 25 mM.
- appK m glyphosate
- GOX v.247 the sequence differences between it and the original plant-preferred GOX are illustrated in PCT Appln. No. WO 92/00377.
- the GOX v.247 coding sequence was combined with CTP1 and assembled with the FMV35S promoter and the E9 3′ by cloning into the pMON17227 plant transformation vector to form pMON17241.
- the CP4 EPSPS was replaced by GOX v.247.
- the pMON17227 vector had been constructed by replacing the CTP1-GOX sequence in pMON17193 with those for the CTP2-CP4 EPSPS, to form pMON17199 and followed by deleting the kanamycin cassette (as described above for pMON17209).
- the pMON17237 vector ( FIG. 25 ) was then completed by cloning the FMV35S/CTP2-CP4 EPSPS/E9 3′ element as a NotI-NotI fragment into pMON17241.
- Soybean plants were transformed with the pMON13640 ( FIG. 15 ) vector and a number of plant lines of the transformed soybean were obtained which exhibit glyphosate tolerance.
- Soybean plants are transformed with pMON13640 by the method of microprojectile injection using particle gun technology as described in Christou et al. (1988).
- the seed harvested from R o plants is R 1 seed which gives rise to R 1 plants.
- To evaluate the glyphosate tolerance of an R o plant its progeny are evaluated. Because an R o plant is assumed to be hemizygous at each insert location, selfing results in maximum genotypic segregation in the R 1 . Because each insert acts as a dominant allele, in the absence of linkage and assuming only one hemizygous insert is required for tolerance expression, one insert would segregate 3:1, two inserts, 15:1, three inserts 63:1, etc. Therefore, relatively few R 1 plants need be grown to find at least one resistant phenotype.
- Seed from an R o soybean plant is harvested, and dried before planting in a glyphosate spray test. Seeds are planted into 4 inch ( ⁇ 5 cm) square pots containing Metro 350. Twenty seedlings from each R o plant is considered adequate for testing. Plants are maintained and grown in a greenhouse environment. A 12.5-14 hour photoperiod and temperatures of 30° C. day and 24° C. night is regulated. Water soluble Peters Pete Lite fertilizer is applied as needed.
- a spray “batch” consists of several sets of R 1 progenies all sprayed on the same date. Some batches may also include evaluations of other than R 1 plants. Each batch also includes sprayed and unsprayed non-transgenic genotypes representing the genotypes in the particular batch which were putatively transformed. Also included in a batch is one or more non-segregating transformed genotypes previously identified as having some resistance.
- One to two plants from each individual R o progeny are not sprayed and serve as controls to compare and measure the glyphosate tolerance, as well as to assess any variability not induced by the glyphosate.
- glyphosate is applied at a rate equivalent of 128 oz./acre (8.895 kg/ha) of Roundup®.
- a laboratory track sprayer has been calibrated to deliver a rate equivalent to those conditions.
- a vegetative score of 0 to 10 is used. The score is relative to the unsprayed progenies from the same R o plant. A 0 is death, while a 10 represents no visible difference from the unsprayed plant. A higher number between 0 and 10 represents progressively less damage as compared to the unsprayed plant. Plants are scored at 7, 14, and 28 days after treatment (DAT). The data from the analysis of one set of transformed and control soybean plants are described on Table X and show that the CP4 EPSPS gene imparts glyphosate tolerance in soybean also.
- the CP4 EPSPS gene may be used to select transformed plant material directly on media containing glyphosate.
- the ability to select and to identify transformed plant material depends, in most cases, on the use of a dominant selectable marker gene to enable the preferential and continued growth of the transformed tissues in the presence of a normally inhibitory substance.
- Antibiotic resistance and herbicide tolerance genes have been used almost exclusively as such dominant selectable marker genes in the presence of the corresponding antibiotic or herbicide.
- the nptII/kanamycin selection scheme is probably the most frequently used. It has been demonstrated that CP4 EPSPS is also a useful and perhaps superior selectable marker/selection scheme for producing and identifying transformed plants.
- a plant transformation vector that may be used in this scheme is pMON17227 (FIG. 16 ).
- This plasmid resembles many of the other plasmids described infra and is essentially composed of the previously described bacterial replicon system that enables this plasmid to replicate in E. coli and to be introduced into and to replicate in Agrobacterium, the bacterial selectable marker gene (Spc/Str), and located between the T-DNA right border and left border is the CTP2-CP4 synthetic gene in the FMV35S promoter-E9 3′ cassette.
- This plasmid also has single sites for a number of restriction enzymes, located within the borders and outside of the expression cassette. This makes it possible to easily add other genes and genetic elements to the vector for introduction into plants.
- Explants are prepared for pre-culture as in the standard procedure as described in Example 1: surface sterilization of leaves from 1 month old tobacco plants (15 minutes in 10% clorox+surfactant; 3 ⁇ dH 2 O washes); explants are cut in 0.5 ⁇ 0.5 cm squares, removing leaf edges, mid-rib, tip, and petiole end for uniform tissue type; explants are placed in single layer, upside down, on MS104 plates+2 ml 4COO5K media to moisten surface; pre-culture 1-2 days.
- Explants are inoculated using overnight culture of Agrobacterium containing the plant transformation plasmid that is adjusted to a titer of 1.2 ⁇ 10 9 bacteria/ml with 4COO5K media. Explants are placed into a centrifuge tube, the Agrobacterium suspension is added and the mixture of bacteria and explants is “Vortexed” on maximum setting for 25 seconds to ensure even penetration of bacteria. The bacteria are poured off and the explants are blotted between layers of dry sterile filter paper to remove excess bacteria. The blotted explants are placed upside down on MS104 plates+2 ml 4COO5K media+filter disc. Co-culture is 2-3 days.
- the explants are transferred to MS104+Carbenicillin 1000 mg/l+cefotaxime 100 mg/l for 3 days (delayed phase).
- the explants are then transferred to MS104+glyphosate 0.05 mM+Carbenicillin 1000 mg/l+cefotaxime 100 mg/l for selection phase.
- shoots are cut from callus and placed on MSO+Carbenicillin 500 mg/l rooting media. Roots form in 3-5 days, at which time leaf pieces can be taken from rooted plates to confirm glyphosate tolerance and that the material is transformed.
- the presence of the CP4 EPSPS protein in these transformed tissues has been confirmed by immunoblot analysis of leaf discs.
- the data from one experiment with pMON17227 is presented in the following: 139 shoots formed on glyphosate from 400 explants inoculated with Agrobacterium ABI/pMON17227; 97 of these were positive on recallusing on glyphosate. These data indicate a transformation rate of 24 per 100 explants, which makes this a highly efficient and time saving transformation procedure for plants.
- the pMON17227 plasmid contains single restriction enzyme recognition cleavage sites (NotI, XhoI, and BstXI) between the CP4 glyphosate selection region and the left border of the vector for the cloning of additional genes and to facilitate the introduction of these genes into plants.
- the CP4 EPSPS gene has also been introduced into Black Mexican Sweet (BMS) corn cells with expression of the protein and glyphosate resistance detected in callus.
- BMS Black Mexican Sweet
- the backbone for this plasmid was a derivative of the high copy plasmid pUC119 (Viera and Messing, 1987).
- the 1.3 Kb FspI-DraI pUC119 fragment containing the origin of replication was fused to the 1.3 Kb SmaI-HindIII filled fragment from pKC7 (Rao and Rogers, 1979) which contains the neomycin phosphotransferase type II gene to confer bacterial kanamycin resistance.
- This plasmid was used to construct a monocot expression cassette vector containing the 0.6 kb cauliflower mosaic virus (CaMV) 35S RNA promoter with a duplication of the ⁇ 90 to ⁇ 300 region (Kay et al., 1987), an 0.8 kb fragment containing an intron from a maize gene in the 5′ untranslated leader region, followed by a polylinker and the 3′ termination sequences from the nopaline synthase (NOS) gene (Fraley et al., 1983).
- CaMV cauliflower mosaic virus
- NOS nopaline synthase
- a 1.7 Kb fragment containing the 300 bp chIoroplast transit peptide from the Arabidopsis EPSP synthase fused in a frame to the 1.4 Kb coding sequence for the bacterial CP4 EPSP synthase was inserted into the monocot expression cassette in the polylinker between the intron and the NOS termination sequence to form the plasmid pMON19653 (FIG. 17 ).
- pMON19653 DNA was introduced into Black Mexican Sweet (BMS) cells by co-bombardment with EC9, a plasmid containing a sulfonylurea-resistant form of the maize acetolactate synthase gene. 2.5 mg of each plasmid was coated onto tungsten particles and introduced into log-phase BMS cells using a PDS-1000 particle gun essentially as described (Klein et al., 1989). Transformants are selected on MS medium containing 20 ppb chlorsulfuron. After initial selection on chlorsulfuron, the calli can be assayed directly by Western blot. Glyphosate tolerance can be assessed by transferring the calli to medium containing 5mM glyphosate. As shown in Table XI, CP4 EPSPS confers glyphosate tolerance to corn callus.
- BMS callus (3 g wet weight) was dried on filter paper (Whatman#1) under vacuum, reweighed, and extraction buffer (500 ⁇ l/g dry weight; 100 mM Tris, 1 mM EDTA, 10% glycerol) was added. The tissue was homogenized with a Wheaton overhead stirrer for 30 seconds at 2.8 power setting. After centrifugation (3 minutes, Eppendorf microfuge), the supernatant was removed and the protein was quantitated (BioRad Protein Assay).
- Improvements in the expression of Class II EPSPS could also be achieved by expressing the gene using stronger plant promoters, using better 3′ polyadenylation signal sequences, optimizing the sequences around the initiation codon for ribosome loading and translation initiation, or by combination of these or other expression or regulatory sequences or factors.
- the plant-expressible genes encoding the CP4 EPSPS and a glyphosate oxidoreductasease enzyme were introduced into embryogenic corn callus through particle bombardment. Plasmid DNA was prepared using standard procedures (Ausubel et al., 1987), cesium-chloride purified, and re-suspended at 1 mg/ml in TE buffer. DNA was precipitated onto M10 tungsten or 1.0 ⁇ g gold particles (BioRad) using a calcium chloride/spermidine precipitation protocol, essentially as described by Klein et al. (1987). The PDS1000® gunpowder gun (BioRad) was used.
- Callus tissue was obtained by isolating 1-2 mm long immature embryos from the “Hi-II” genotype (Armstrong et al., 1991), or Hi-II X B73 crosses, onto a modified N6 medium (Armstrong and Green, 1985; Songstad et al., 1991).
- Embryogenic callus (“type-II”; Armstrong and Green, 1985) initiated from these embryos was maintained by subculturing at two week intervals, and was bombarded when less than two months old. Each plate of callus tissue was bombarded from 1 to 3 times with either tungsten or gold particles coated with the plasmid DNA(s) of interest.
- both gene(s) were covalently linked together on the same plasmid DNA molecule.
- the genes were present on separate plasmids, but were introduced into the same plant through a process termed “co-transformation”.
- the 1 mg/ml plasmid preparations of interest were mixed together in an equal ratio, by volume, and then precipitated onto the tungsten or gold particles.
- the different plasmid molecules integrate into the genome of the same plant cell.
- the integration is into the same chromosomal location in the plant cell, presumably due to recombination of the plasmids prior to integration.
- the different plasmids integrate into separate chromosomal locations. In either case, there is integration of both DNA molecules into the same plant cell, and any plants produced from that cell.
- Transgenic corn plants were produced as described above which contained a plant-expressible CP4 gene and a plant-expressible gene encoding a glyphosate oxidoreductase enzyme.
- the plant-expressible CP4 gene comprised a structural DNA sequence encoding a CTP2/CP4 EPSPS fusion protein.
- the CTP2/CP4 EPSPS is a gene fusion composed of the N-terminal 0.23 Kb chloroplast transit peptide sequence from the Arabidopsis thaliana EPSPS gene (Klee et al. 1987, referred to herein as CTP2), and the C-terminal 1.36 Kb 5-enolpyruvylshikimate-3-phosphate synthase gene (CP4) from an Agrobacterium species. Plant expression of the gene fusion produces a pre-protein which is rapidly imported into chloroplasts where the CTP is cleaved and degraded (della-Cioppa et al., 1986) releasing the mature CP4 protein.
- the plant-expressible gene expressing a glyphosate oxidoreductase enzyme comprised a structural DNA sequence comprising CTP1/GOXsyn gene fusion composed of the N-terminal 0.26 Kb chloroplast transit peptide sequence derived from the Arabidopsis thaliana SSU 1a gene (Timko et al., 1988 referred to herein as CTP1), and the C-terminal 1.3 Kb synthetic gene sequence encoding a glyphosate oxidoreductase enzyme (GOXsyn, as described in PCT Pub. No. WO92/00377 previously incorporated by reference.
- the GOXsyn gene encodes the enzyme glyphosate oxidoreductase from an Achromobacter sp. strain LBAA which catalyzes the conversion of glyphosate to herbicidally inactive products, aminomethylphosphonate and glyoxylate. Plant expression of the gene fusion produces a pre-protein which is rapidly imported into chloroplasts where the CTP is cleaved and degraded (della-Cioppa et al., 1986) releasing the mature GOX protein.
- Both of the above described genes also include the following regulatory sequences for plant expression: (i) a promoter region comprising a 0.6 Kb 35S cauliflower mosaic virus (CaMV) promoter (Odell et al., 1985) with the duplicated enhancer region (Kay et al., 1987) which also contains a 0.8 Kb fragment containing the first intron from the maize heat shock protein 70 gene (Shah et al., 1985 and PCT Pub. No.
- CaMV cauliflower mosaic virus
- WO93/19189 the disclosure of which is hereby incorporated by reference; and (ii) a 3′ non-translated region comprising a 0.3 Kb fragment of the 3′ non-translated region of the nopaline synthase gene (Fraley et al., 1983 and Depicker, et al., 1982) which functions to direct polyadenylation of the mRNA.
- transgenic corn plants exhibit tolerance to glyphosate herbicide in greenhouse and field trials.
- the LBAA Class II EPSPS gene has been introduced into plants and also imparts glyphosate tolerance.
- Data on tobacco transformed with pMON17206 (infra) are presented in Table XIII.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Genes encoding Class II EPSPS enzymes are disclosed. The genes are useful in producing transformed bacteria and plants which are tolerant to glyphosate herbicide. Class II EPSPS genes share little homology with known, Class I EPSPS genes, and do not hybridize to probes from Class I EPSPS's. The Class II EPSPS enzymes are characterized by being more kinetically efficient than Class I EPSPS's in the presence of glyphosate. Plants transformed with Class II EPSPS genes are also disclosed as well as a method for selectively controlling weeds in a planted transgenic crop field.
Description
This is a continuation-in-part of a U.S. patent application Ser. No. 07/749,611, filed Aug. 28, 1991 now abandoned, which is a continuation-in-part of U.S. patent application Ser. No. 07/576,537, filed Aug. 31, 1990, now abandoned.
This invention relates in general to plant molecular biology and, more particularly, to a new class of glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases.
Recent advances in genetic engineering have provided the requisite tools to transform plants to contain foreign genes. It is now possible to produce plants which have unique characteristics of agronomic importance. Certainly, one such advantageous trait is more cost effective, environmentally compatible weed control via herbicide tolerance. Herbicide-tolerant plants may reduce the need for tillage to control weeds thereby effectively reducing soil erosion.
One herbicide which is the subject of much investigation in this regard is N-phosphonomethylglycine commonly referred to as glyphosate. Glyphosate inhibits the shikimic acid pathway which leads to the biosynthesis of aromatic compounds including amino acids, plant hormones and vitamins. Specifically, glyphosate curbs the conversion of phosphoenolpyruvic acid (PEP) and 3-phosphoshikimic acid to 5-enolpyruvyl-3-phosphoshikimic acid by inhibiting the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (hereinafter referred to as EPSP synthase or EPSPS). For purposes of the present invention, the term “glyphosate” should be considered to include any herbicidally effective form of N-phosphonomethylglycine (including any salt thereof) and other forms which result in the production of the glyphosate anion in plants.
It has been shown that glyphosate-tolerant plants can be produced by inserting into the genome of the plant the capacity to produce a higher level of EPSP synthase in the chloroplast of the cell (Shah et al., 1986) which enzyme is preferably glyphosate-tolerant (Kishore et al. 1988). Variants of the wild-type EPSPS enzyme have been isolated which are glyphosate-tolerant as a result of alterations in the EPSPS amino acid coding sequence (Kishore and Shah, 1988; Schulz et al., 1984; Sost et al., 1984; Kishore et al., 1986). These variants typically have a higher Ki for glyphosate than the wild-type EPSPS enzyme which confers the glyphosate-tolerant phenotype, but these variants are also characterized by a high Km for PEP which makes the enzyme kinetically less efficient (Kishore and Shah, 1988; Sost et al., 1984; Schulz et al., 1984; Kishore et al., 1986; Sost and Amrhein, 1990). For example, the apparent Km for PEP and the apparent Ki for glyphosate for the native EPSPS from E. coli are 10 μM and 0.5 μM while for a glyphosate-tolerant isolate having a single amino acid substitution of an alanine for the glycine at position 96 these values are 220 μM and 4.0 mM, respectively. A number of glyphosate-tolerant plant variant EPSPS genes have been constructed by mutagenesis. Again, the glyphosate-tolerant EPSPS was impaired due to an increase in the Km for PEP and a slight reduction of the Vmax of the native plant enzyme (Kishore and Shah, 1988) thereby lowering the catalytic efficiency (Vmax/Km) of the enzyme. Since the kinetic constants of the variant enzymes are impaired with respect to PEP, it has been proposed that high levels of overproduction of the variant enzyme, 40-80 fold, would be required to maintain normal catalytic activity in plants in the presence of glyphosate (Kishore et al., 1988).
While such variant EPSP synthases have proved useful in obtaining transgenic plants tolerant to glyphospate, it would be increasingly beneficial to obtain an EPSP synthase that is highly glyphosate-tolerant while still kinetically efficient such that the amount of the glyphosate-tolerant EPSPS needed to be produced to maintain normal catalytic activity in the plant is reduced or that improved tolerance be obtained with the same expression level.
Previous studies have shown that EPSPS enzymes from different sources vary widely with respect to their degree of sensitivity to inhibition by glyphosate. A study of plant and bacterial EPSPS enzyme activity as a function of glyphosate concentration showed that there was a very wide range in the degree of sensitivity to glyphosate. The degree of sensitivity showed no correlation with any genus or species tested (Schulz et al., 1985). Insensitivity to glyphosate inhibition of the activity of the EPSPS from the Pseudomonas sp. PG2982 has also been reported but with no details of the studies (Fitzgibbon, 1988). In general, while such natural tolerance has been reported, there is no report suggesting the kinetic superiority of the naturally occurring bacterial phosphosate-tolerant EPSPS enzymes over those of mutated EPSPS enzymes nor have any of the genes been characterized. Similarly, there are no reports on the expression of naturally glyphosate-tolerant EPSPS enzymes in plants to confer glyphosate tolerance.
For purposes of the present invention the term “mature EPSP synthase” relates to the EPSPS polypeptide without the N-terminal chloroplast transit peptide. It is now known that the precursor form of the EPSP synthase in plants (with the transit peptide) is expressed and upon delivery to the chloroplast, the transit peptide is cleaved yielding the mature EPSP synthase. All numbering of amino acid positions are given with respect to the mature EPSP synthase (without chloroplast transit peptide leader) to facilitate comparison of EPSPS sequences from sources which have chloroplast transit peptides (i.e., plants and fungi) to sources which do not utilize a chloroplast targeting signal (i.e., bacteria).
In the amino acid sequences which follow, the standard single letter or three letter nomenclature are used. All peptide structures represented in the following description are shown in conventional format in which the amino group at the N-terminus appears to the left and the carboxyl group at the C-terminus at the right. Likewise, amino acid nomenclature for the naturally occurring amino acids found in protein is as follows: alanine (Ala;A), asparagine (Asn;N), aspartic acid (Asp;D), arginine (Arg;R), cysteine (Cys;C), glutamic acid (Glu;E), glutamine (Gln;Q), glycine (Gly;G), histidine (His;H), isoleucine (Ile;I), leucine (Leu;L), lysine (Lys;k), methionine (Met;M), phenylalanine (Phe;F), proline (Pro;P), serine (Ser;S), threonine (Thr;T), tryptophan (Trp;W), tyrosine (Tyr;Y), and valine (Val;V). An “X” is used when the amino acid residue is unknown and parentheses designate that an unambiguous assignment is not possible and the amino acid designation within the parentheses is the most probable estimate based on known information.
The term “nonpolar” amino acids include alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, and methionine. The term “uncharged polar” amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. The term “charged polar” amino acids includes the “acidic” and “basic” amino acids. The term “acidic” amino acids includes aspartic acid and glutamic acid. The term “basic” amino acid includes lysine, arginine and histidine. The term “polar” amino acids includes both “charged polar” and “uncharged polar” amino acids.
Deoxyribonucleic acid (DNA) is a polymer comprising four mononucleotide units, dAMP (2′-Deoxyadenosine-5-monophosphate), dGMP (2′-Deoxyguanosine-5-monophosphate), dCMP (2′-Deoxycytosine-5-monophosphate) and dTMP (2′-Deoxythymosine-5-monophosphate) linked in various sequences by 3′,5′-phosphodiester bridges. The structural DNA consists of multiple nucleotide triplets called “codons” which code for the amino acids. The codons correspond to the various amino acids as follows: Arg (CGA, CGC, CGG, CGT, AGA, AGG); Leu (CTA, CTC, CTG, CTT, TTA, TTG); Ser (TCA, TCC, TCG, TCT, AGC, AGT); Thr (ACA, ACC, ACG, ACT); Pro (CCA, CCC, CCG, CCT); Ala (GCA, GCC, GCG, GCT); Gly (GGA, GGC, GGG, GGT); Ile (ATA, ATC, ATT); Val (GTA, GTC, GTG, GTT); Lys (AAA, AAG); Asn (AAC, AAT); Gla (CAA, CAG); His (CAC, CAT); Glu (GAA, GAG); Asp (GAC, GAT); Tyr (TAC, TAT); Cys (TGC, TGT); Phe (TTC, TTT); Met (ATG); and Trp (UGG). Moreover, due to the redundancy of the genetic code (i.e., more than one codon for all but two amino acids), there are many possible DNA sequences which may code for a particular amino acid sequence.
DNA molecules comprising DNA encoding kinetically efficient, glyphosate-tolerant EPSP synthases are disclosed. The EPSP synthases of the present invention reduce the amount of overproduction of the EPSPS enzyme in a transgenic plant necessary for the enzyme to maintain catalytic activity while still conferring glyphosate tolerance. The EPSP synthases described herein represent a new class of EPSPS enzymes, referred to hereinafter as Class II EPSPS enzymes. Class II EPSPS enzymes of the present invention usually share only between about 47% and 55% amino acid similarity or between about 22% and 30% amino acid identity to other known bacterial or plant EPSPS enzymes and exhibit tolerance to glyphosate while maintaining suitable Km (PEP) ranges. Suitable ranges of Km (PEP) for EPSPS for enzymes of the present invention are between 1-150 μM, with a more preferred range of between 1-35 μM, and a most preferred range between 2-25 μM. These kinetic constants are determined under the assay conditions specified hereinafter. An EPSPS of the present invention preferably has a Ki for glyphosate range of between 15-10000 μM. The Ki/Km ratio should be between about 2-500, and more preferably between 25-500. The Vmax of the purified enzyme should preferably be in the range of 2-100 units/mg (μmoles/minute.mg at 25° C.) and the Km for shikimate-3-phosphate should preferably be in the range of 0.1 to 50 μM.
Genes coding for Class II EPSPS enzymes have been isolated from five (5) different bacteria:Agrobacterium tumefaciens sp. strain CP4, Achromobacter sp. strain LBAA, Pseudomonas sp. strain PG2982, Bacillus subtilis, and Staphylococcus aureus. The LBAA and PG2982 Class II EPSPS genes have been determined to be identical and the proteins encoded by these two genes are very similar to the CP4 protein and share approximately 84% amino acid identity with it. Class II EPSPS enzymes often may be distinguished from Class I EPSPS's by their inability to react with polyclonal antibodies prepared from Class I EPSPS enzymes under conditions where other Class I EPSPS enzymes would readily react with the Class I antibodies as well as the presence of certain unique regions of amino acid homology which are conserved in Class II EPSP synthases as discussed hereinafter.
Other Class II EPSPS enzymes can be readily isolated and identified by utilizing a nucleic acid probe from one of the Class II EPSPS genes disclosed herein using standard hybridization techniques. Such a probe from the CP4 strain has been prepared and utilized to isolate the Class II EPSPS genes from strains LBAA and PG2982. These genes may also optionally be adapted for enhanced expression in plants by known methodology. Such a probe has also been used to identify homologous genes is bacteria isolated de novo from soil.
The Class II EPSPS enzymes are preferably fused to a chloroplast transit peptide (CTP) to target the protein to the chloroplasts of the plant into which it may be introduced. Chimeric genes encoding this CTP-Class II EPSPS fusion protein may be prepared with an appropriate promoter and 3′ polyadenylation site for introduction into a desired plant by standard methods.
To obtain the maximal tolerance to glyphosate herbicide it is preferable to transform the desired plant with a plant-expressible Class II EPSPS gene in conjunction with another plant-expressible gene which expresses a protein capable of degrading glyphosate such as a plant-expressible gene encoding a glyphosate oxidoreductase enzyme as described in PCT Application No. WO 92/00377, the disclosure of which is hereby incorporated by reference.
Therefore, in one aspect, the present invention provides a new class of EPSP synthases that exhibit a low Km for phosphoenolpyruvate (PEP), a high Vmax/Km ratio, and a high Ki for glyphosate such that when introduced into a plant, the plant is made glyphosate-tolerant such that the catalytic activity of the enzyme and plant metabolism are maintained in a substantially normal state. For purposes of this discussion, a highly efficient EPSPS refers to its efficiency in the presence of glyphosate.
More particularly, the present invention provides EPSPS enzymes having a Km for phosphoenolpyruvate (PEP) between 1-150 μM and a Ki(glyphosate)/Km (PEP) ratio between 3-500, said enzymes having the sequence domains:
-
- -R-X1-H-X2-E-(SEQ ID NO:37), in which
- X1 is an uncharged polar or acidic amino acid,
- X2 is serine or threonine; and
- -G-D-K-X3-(SEQ ID NO:38), in which
- X3 is serine or threonine; and
- -S-A-Q-X4-K-(SEQ ID NO:39), in which
- X4 is any amino acid; and
- -N-X5-T-R-(SEQ ID NO:40), in which
- X5 is any amino acid.
- -R-X1-H-X2-E-(SEQ ID NO:37), in which
Exemplary Class II EPSPS enzyme sequences are disclosed from seven sources: Agrobacterium sp. strain designated CP4, Achromobacter sp. strain LBAA, Pseudomonas sp. strain PG2982, Bacillus subtilis 1A2, Staphylococcus aureus (ATCC 35556), Synechocystis sp. PCC6803 and Dichelobacter nodosus.
In another aspect of the present invention, a double-stranded DNA molecule comprising DNA encoding a Class II EPSPS enzyme is disclosed. Exemplary Class II EPSPS enzyme DNA sequences are disclosed from seven sources: Agrobacterium sp. strain designated CP4, Achromobacter sp. strain LBAA, Pseudomonas sp. strain PG2982, Bacillus subtilis 1A2, Staphylococcus aureus (ATCC 35556), Synechocystis sp. PCC6803 and Dichelobacter nodosus.
In a further aspect of the present invention, nucleic acid probes from EPSPS Class II genes are presented that are suitable for use in screening for Class II EPSPS genes in other sources by assaying for the ability of a DNA sequence from the other source to hybridize to the probe.
In yet another aspect of the present invention, a recombinant, double-stranded DNA molecule comprising in sequence:
-
- a) a promoter which functions in plant cells to cause the production of an RNA sequence;
- b) a structural DNA sequence that causes the production of an RNA sequence which encodes a Class II EPSPS enzyme having the sequence domains;
- -R-X1-H-X2-E-(SEQ ID NO:37), in which
- X1 is an uncharged polar or acidic amino acid,
- X2 is serine or threonine; and
- -G-D-K-X3-(SEQ ID NO:38), in which
- X3 is serine or threonine; and
- -S-A-Q-X4-K-(SEQ ID NO:39), in which
- X4 is any amino acid; and
- -N-X5-T-R-(SEQ ID NO:40), in which
- X5 is any amino acid; and
- -R-X1-H-X2-E-(SEQ ID NO:37), in which
- c) a 3′ nontranslated region which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the EPSP synthase polypeptide to enhance the glyphosate tolerance of a plant cell transformed with said DNA molecule.
In still yet another aspect of the present invention, transgenic plants and transformed plant cells are disclosed that are made glyphosate-tolerant by the introduction of the above-described plant-expressible Class II EPSPS DNA molecule into the plant's genome.
In still another aspect of the present invention, a method for selectively controlling weeds in a crop field is presented by planting crop seeds or crop plants transformed with a plant-expressible Class II EPSPS DNA molecule to confer glyphosate tolerance to the plants which allows for glyphosate containing herbicides to be applied to the crop to selectively kill the glyphosate sensitive weeds, but not the crops.
Other and further objects, advantages and aspects of the invention will become apparent from the accompanying drawing figures and the description of the invention.
The expression of a plant gene which exists in double-stranded DNA form involves synthesis of messenger RNA (mRNA) from one strand of the DNA by RNA polymerase enzyme, and the subsequent processing of the mRNA primary transcript inside the nucleus. This processing involves a 3′ non-translated region which adds polyadenylate nucleotides to the 3′ end of the RNA.
Transcription of DNA into mRNA is regulated by a region of DNA usually referred to as the “promoter.” The promoter region contains a sequence of bases that signals RNA polymerase to associate with the DNA, and to initiate the transcription into mRNA using one of the DNA strands as a template to make a corresponding complementary strand of RNA. A number of promoters which are active in plant cells have been described in the literature. These include the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of Agrobacterium tumefaciens), the cauliflower mosaic virus (CaMV) 19S and 35S promoters, the light-inducible promoter from the small subunit of ribulose bis-phosphate carboxylase (ssRUBISCO, a very abundant plant polypeptide) and the full-length transcript promoter from the figwort mosaic virus (FMV35S), promoters from the maize ubiquitin and rice actin genes. All of these promoters have been used to create various types of DNA constructs which have been expressed in plants; see, e.g., PCT publication WO 84/02913 (Rogers et al., Mosanto).
Promoters which are known or found to cause transcription of DNA in plant cells can be used in the present invention. Such promoters may be obtained from a variety of sources such as plants and plant DNA virsues and include, but are not limited to, the CaMV35A and FMV35S promoters and promoters isolated from plant genes such as ssRUBISCO genes and the maize ubiquitin and rice actin genes. As described below, it is preferred that the particular promoter selected should be capable of causing sufficient expression to result in the production of an effective amount of a Class II EPSPS to render the plant substantially tolerant to glyphosate herbicides. The amount of Class II EPSPS needed to induce the desired tolerance may vary with the plant species. It is preferred that the promoters utilized have relatively high expression in all meristematic tissues in addition to other tissues inasmuch as it is now known that glyphosate is translocated and accumulated in this type of plant tissue. Alternatively, a combination of chimeric genes can be used to cumulatively result in the necessary overall expression level of the selected Class II EPSPS enzyme to result in the glyphosate-tolerant phenotype.
The mRNA produced by a DNA construct of the present invention also contains a 5′ non-translated leader sequence. This sequence can be derived from the promoter selected to express the gene, and can be specifically modified so as to increase translation of the mRNA. The 5′ non-translated regions can also be obtained from viral RNAs, from suitable eukaryotic genes, or from a synthetic gene sequence. The present invention is not limited to constructs, as presented in the following examples, wherein the non-translated region is derived from both the 5′ non-translated sequence that accompanies the promoter sequence and part of the 5′ non-translated region of the virus coat protein gene. Rather, the non-translated leader sequence can be derived from an unrelated promoter or coding sequence as discussed above.
Preferred promoters for use in the present invention the full-length transcript (SEQ ID NO:1) promoter from the figwort mosaic virus (FMV35S) and the full-length transcript (35S) promoter from cauliflower mosaic virus (CaMV), including the enhanced CaMV35S promoter (Kay et al. 1987). The FMV35S promoter functions as strong and uniform promoter with particularly good expression in meristematic tissue for chimeric genes inserted into plants, particularly dicotyledons. The resulting transgenic plant in general expresses the protein encoded by the inserted gene at a higher and more uniform level throughout the tissues and cells of the transformed plant than the same gene driven by an enhanced CaMV35S promoter. Referring to FIG. 1 , the DNA sequence (SEQ ID NO:1) of the FMV35S promoter is located between nucleotides 6368 and 6930 of the FMV genome. A 5′ non-translated leader sequence is preferably coupled with the promoter. The leader sequence can be from the FMV35S genome itself or can be from a source other than FMV35S.
For expression of heterologous genes in moncotyledonous plants the use of an intron has been found to enhance expression of the heterologous gene. While one may use any of a number of introns which have been isolated from plant genes, the use of the first intron from the maize heat shock 70 gene is preferred.
The 3′ non-translated region of the chimeric plant gene contains a polyadenylation signal which functions in plants to cause the addition of polyadenylate nucleotides to the 3′ end of the viral RNA. Examples of suitable 3′ regions are (1) the 3′ transcribed, non-translated regions containing the polyadenylated signal of Agrobacterium tumor-inducing (Ti) plasmid genes, such as the nopaline synthase (NOS) gene, and (2) plant genes like the soybean storage protein genes and the small subunit of the ribulose-1,5-biphosphate carboxylase (ssRUBISCO) gene. An example of a preferred 3′ region is that from the ssRUBISCO gene from pea (E9), described in greater detail below.
The DNA constructs of the present invention also contain a structural coding sequence in double-stranded DNA form which encodes a glyphosate-tolerant, highly efficient Class II EPSPS enzyme.
Identification of glyphosate-tolerant, highly efficient EPSPS enzymes
In an attempt to identify and isolate glyphosate-tolerant, highly efficient EPSPS enzymes, kinetic analysis of the EPSPS enzymes from a number of bacteria exhibiting tolerance to glyphosate or that had been isolated from suitable sources was undertaken. It was discovered that in some cases the EPSPS enzymes showed no tolerance to inhibition by glyphosate and it was concluded that the tolerance phenotype of the bacterium was due to an impermeability to glyphosate or other factors. In a number of cases, however, microorganisms were identified whose EPSPS enzyme showed a greater degree of tolerance to inhibition by glyphosate and that displayed a low Km for PEP when compared to that previously reported for other microbial and plant sources. The EPSPS enzymes from these microorganisms were then subjected to further study and analysis.
Table I displays the data obtained for the EPSPS enzymes identified and isolated as a result of the above described analysis. Table I includes data for three identified Class II EPSPS enzymes that were observed to have a high tolerance to inhibition to glyphosate and a low Km for PEP as well as data for the native Petunia EPSPS and a glyphosate-tolerant variant of the Petunia EPSPS referred to as GA101. The GA101 variant is so named because it exhibits the substitution of an alanine residue for a glycine residue at position 101 (with respect to Petunia). When the change introduced into the Petunia EPSPS (GA101) was introduced into a number of other EPSPS enzymes, similar changes in a kinetics were observed, an elevation of the Ki for glyphosate and of the Km for PEP.
| TABLE I |
| Kinetic characterization of EPSPS enzymes |
| ENZYME | Km PEP | Kl Glyphosate | |||
| SOURCE | (μM) | (μM) | Kl/Km | ||
| Petunia | 5 | 0.4 | 0.08 | ||
| |
200 | 2000 | 10 | ||
| PG2982 | 2.1-3.11 | 25-82 | ˜8-40 | ||
| LBAA | ˜7.3-82 | 60 (est)7 | ˜7.9 | ||
| CP4 | 123 | 2720 | 227 | ||
| B. subtilis 1A2 | 134 | 440 | 33.8 | ||
|
|
55 | 200 | 40 | ||
| 1Range of PEP tested = 1-40 μM | |||||
| 2Range of PEP tested = 5-80 μM | |||||
| 3Range of PEP tested = 1.5-40 μM | |||||
| 4Range of PEP tested = 1-60 μM | |||||
| 5Range of PEP tested = 1-50 μM | |||||
| 7(est) = estimated | |||||
The Agrobacterium sp. strain CP4 was initially identified by its ability to grow on glyphosate as a carbon source (10 mM) in the presence of 1 mM phosphate. The strain CP4 was identified from a collection obtained from a fixed-bed immobilized cell column that employed Mannville R-635 diatomaceous earth beads. The column had been run for three months on a waste-water feed from a glyphosate production plant. The column contained 50 mg/ml glyphosate and NH3 as NH4Cl. Total organic carbon was 300 mg/ml and BOD's (Biological Oxygen Demand—a measure of “soft” carbon availability) were less than 30 mg/ml. This treatment column has been described (Heitkamp et al., 1990). Dworkin-Foster minimal salts medium containing glyphosate at 10 mM and with phosphate at 1 mM was used to select for microbes from a wash of this column that were capable of growing on glyphosate as sole carbon source. Dworkin-Foster minimal medium was made up by combining in I liter (with autoclaved H2O), 1 ml each of A, B and C and 10 ml of D (as per below) and thiamine HCl (5 mg).
| A. | D-F Salts (1000X stock; per 100 ml; autoclaved): | ||
| H2BO3 | 1 | mg | ||
| MnSO4.7 H2O | 1 | mg | ||
| ZnSO4.7 H2O | 12.5 | mg | ||
| CuSO4.5 H2O | 8 | mg | ||
| NaMoO3.3 H2O | 1.7 | mg |
| B. | FeSO4.7 H2O (1000X Stock; per 100 | 0.1 | g | ||
| ml; autoclaved) | |||||
| C. | MgSO4.7 H2O (1000X Stock; per 100 | 20 | g | ||
| ml; autoclaved) | |||||
| D. | (NH4)2SO4 (100X stock; per 100 ml; | 20 | g | ||
| autoclaved) | |||||
Yeast Extract (YE; Difco) was added to a final concentration of 0.01 or 0.001%. The strain CP4 was also grown on media composed of D-F salts, amended as described above, containing glucose, gluconate and citrate (each at 0.1%) as carbon sources and with inorganic phosphate (0.2-1.0 mM) as the phosphorous source.
Other Class II EPSPS containing microorganisms were identified as Achromobacter sp. strain LBAA (Hallas et al., 1988), Pseudomonas sp. strain PG2982 (Moore et al., 1983; Fitzgibbon 1988), Bacillus subtilis 1A2 (Henner et al., 1984) and Staphylococcus aureus (O'Connell et al., 1993). It had been reported previously, from measurements in crude lysates, that the EPSPS enzyme from strain PG2982 was less sensitive to inhibition to glyphosate than that of E. coli, but there has been no report of the details of this lack of sensitivity and there has been no report on the Km for PEP for this enzyme or of the DNA sequence for the gene for this enzyme (Fitzgibbon, 1988; Fitzgibbon and Braymer, 1990). Relationship of the Class II EPSPS to those previously studied.
All EPSPS proteins studied to date have shown a remarkable degree of homology. For example, bacterial and plant EPSPS's are about 54% identical and with similarity as high as 80%. Within bacterial EPSPS's and plant EPSPS's themselves the degree of identity and similarity is much greater (see Table II).
| TABLE II |
| Comparison between exemplary Class I EPSPS protein sequences1 |
| similarity | identity | ||
| E. coli vs. S. typhaurium | 93 | 88 | ||
| P. hybrids vs. E. coli | 72 | 55 | ||
| P. hybrids vs. L. excalentum | 93 | 88 | ||
| 1The EPSPS sequences compared here were obtained from the following reference: E. coli, Rogers et al., 1983; S. typhourium, Smetzer et al, 1985; Petanoic hybrids; Shah et al, 1986; and tomato (L. escalautum), Gasper et al, 1988. | ||||
When crude extracts of CP4 and LBAA bacteria (50 μg protein) were probed using rabbit anti-EPSPS antibody (Padgette et al., 1987) to the Petunia EPSPS protein in a Western analysis, no positive signal could be detected, even with extended exposure times (Protein A—125I development system) and under conditions where the control EPSPS (Petunia EPSPS, 20 ng; a Class I EPSPS) was readily detected. The presence of EPSPS activity in these extracts was confirmed by enzyme assay. This surprising result, indicating a lack of similarity between the EPSPS's from these bacterial isolates and those previously studied, coupled with the combination of a low Km for PEP and a high Ki for glyphosate, illustrates that these new EPSPS enzymes are different from known EPSPS enzymes (now referred to as Class I EPSPS).
Glyphosate-tolerant Enzymes is Microbial Isolates
For clarity and brevity of disclosure, the following description of the isolation of genes encoding Class II EPSPS enzymes is directed to the isolation of such a gene from a bacterial isolate. Those skilled in the art will recognize that the same or similar strategy can be utilized to isolate such genes from other microbial isolates, plant or fungal sources.
Cloning of the Agrobacterium sp. strain CP4 EPSPS Gene(s) in E. coli
Having established the existence of a suitable EPSPS in Agrobacterium sp. strain CP4, two parallel approaches were undertaken to clone the gene: cloning based on the expected phenotype for a glyphosate-tolerant EPSPS; and purification of the enzyme to provide material to raise antibodies and to obtain amino acid sequences from the protein to facilitate the verification of clones. Cloning and genetic techniques, unless otherwise indicated, are generally those described in Maniatis et al., 1982 or Sambrook et al., 1987. The cloning strategy was as follows: introduction of a cosmid bank of strain Agrobacterium sp. strain CP4 into E. coli and selection for the EPSPS gene by selection for growth on inhibitory concentrations of glyphosate.
Chromosomal DNA was prepared from strain Agrobacterium sp. strain CP4 as follows: The cell pellet from a 200 ml L-Broth (Miller, 1972), late log phase culture of Agrobacterium sp. strain CP4 was resuspended in 10 ml of Solution I; 50 mM Glucose, 10 mM EDTA, 25 mM Tris-CL pH 8.0 (Birnboim and Doly, 1979). SDS was added to a final concentration of 1% and the suspension was subjected to three freeze-thaw cycles, each consisting of immersion in dry ice for 15 minutes and in water at 70° C. for 10 minutes. The lysate was then extracted four times with equal volumes of phenol:chloroform (1:1; phenol saturated with TE; TE=10 mM Tris pH8.0; 1.0 mM EDTA) and the phases separated by centrifugation (15000 g; 10 minutes). The ethanol-precipitable material was pelleted from the supernatant by brief centrifugation (8000 g; 5 minutes) following addition of two volumes of ethanol. The pellet was resuspended in 5 ml TE and dialyzed for 16 hours at 4° C. against 2 liters TE. This preparation yielded a 5 ml DNA solution of 552 μg/ml.
Partially-restricted DNA was prepared as follows. Three 100 μg aliquot samples of CP4 DNA were treated for 1 hour at 37° C. with restriction endonuclease HindIII at rates of 4, 2 and 1 enzyme unit/μg DNA, respectively. The DNA samples were pooled, made 0.25 mM with EDTA and extracted with an equal volume of phenol:chloroform. Following the addition of sodium acetate and ethanol, the DNA was precipitated with two volumes of ethanol and pelleted by centrifugation (12000 g; 10 minutes). The dried DNA pellet was resuspended in 500 μl TE and layered on a 10-40% Sucrose gradient (in 5% increments of 5.5 ml each) in 0.5M NaCl, 50 mM Tris pH8.0, 5 mM EDTA. Following centrifugation for 20 hours at 26,000 rpm in a SW28 rotor, the tubes were punctured and ˜1.5 ml fractions collected. Samples (20 μl) of each second fraction were run on 0.7% agarose gel and the size of the DNA determined by comparison with linearized lambda DNA and HindIII-digested lambda DNA standards. Fractions containing DNA of 25-35 kb fragments were pooled, desalted on AMICON10 columns (7000 rpm; 20° C.; 45 minutes) and concentrated by precipitation. This procedure yielded 15 μg of CP4 DNA of the required size. A cosmid bank was constructed using the vector pMON17020. This vector, a map of which is presented in FIG. 2 , is based on the pBR327 replicon and contains the spectinomycin/streptomycin (Spr;spc) resistance gene from Tn7 (Fling et al., 1985), the chloramphenicol resistance gene (Cmr;cat) from Tn9 (Alton et al., 1979), the gene10 promoter region from phage T7 (Dunn et al., 1983), and the 1.6 kb BglII phage lambda cos fragment from pHC79 (Hohn and Collins, 1980). A number of cloning sites are located downstream of the cat gene. Since the predominant block to the expression of genes from other microbial sources in E. coli appears to be at the level of transcription, the use of the T7 promoter and supplying the T7 polymerase in trans from the pGP1-2 plasmid (Tabor and Richardson, 1985), enables the expression of large DNA segments of foreign DNA, even those containing RNA polymerase transcription termination sequences. The expression of the spc gene is impaired by transcription from the T7 promoter such that only Cmr can be selected in strains containing pGP1-2. The use of antibiotic resistances such as Cm resistance which do not employ a membrane component is preferred due to the observation that high level expression of resistance genes that involve a membrane component, i.e. β-lactamase and Amp resistance, give rise to a glyphosate-tolerant phenotype. Presumably, this is due to the exclusion of glyphosate from the cell by the membrane localized resistance protein. It is also preferred that the selectable marker be oriented in the same direction as the T7 promoter.
The vector was then cut with HindIII and treated with calf alkaline phosphatase (CAP) in preparation for cloning. Vector and target sequences were ligated by combining the following:
| Vector DNA (HindIII/CAP) | 3 | μg | ||
| Size fractionated CP4 HindIII fragments | 1.5 | μg | ||
| 10X ligation buffer | 2.2 | μl | ||
| T4 DNA ligase (New England Biolabs) (400 U/μl) | 1.0 | μl | ||
and adding H2O to 22.0 μl. This mixture was incubated for 18 hours at 16° C. 10X ligation buffer is 250 mM Tris-HCl, pH 8.0; 100 mM MgCl2; 100 mM Dithiothreitol; 2 mM Spermidine. The ligated DNA (5 μl) was packaged into lambda phage particles (Stratagene; Gigapack Gold) using the manufacturer's procedure.
A sample (200 μl) of E. coli HB101 (Boyer and Rolland-Dussoix, 1973) containing the T7 polymerase expression plasmid pGP1-2 (Tabor and Richardson, 1985) and grown overnight in L-Broth (with maltose at 0.2% and kanamycin at 50/μg/ml) was infected with 50 μl of the packaged DNA. Transformants were selected at 30° C. on M9 (Miller, 1972) agar containing kanamycin (50 μg/ml), chloramphenicol (25 μg/ml), L-proline (50 μg/ml), L-leucine (50 μg/ml) and B1 (5 μg/ml), and with glyphosate at 3.0 mM. Aliquot samples were also plated on the same media lacking glyphosate to titer the packaged cosmids. Cosmid transformants were isolated on this latter medium at a rate of ˜5×105 per μg CP4 HindIII DNA after 3 days at 30° C. Colonies arose on the glyphosate agar from day 3 until day 15 with a final rate of ˜1 per 200 cosmids. DNA was prepared from 14 glyphosate-tolerant clones and, following verification of this phenotype, was transformed into E. coli GB100/pGP1-2 (E. coli GB100 is an aroA derivative of MM294 [Talmadge and Gilbert, 1980]) and tested for complementation for growth in the absence of added aromatic amino acids and aminobenzoic acids. Other aroA strains such as SR481 (Bachman et al., 1980; Padgette et al., 1987), could be used and would be suitable for this experiment. The use of GB100 is merely exemplary and should not be viewed in a limiting sense. This aroA strain usually requires that growth media be supplemented with L-phenylalanine, L-tyrosine and L-tryptophan each at 100 μg/ml and with para-hydroxybenzoic acid, 2,3-dihydroxybenzoic acid and para-aminobenzoic acid each at 5 μg/ml for growth in minimal media. Of the fourteen cosmids tested only one showed complementation of the aroA- phenotype. Transformants of this cosmid, pMON17076, showed weak but uniform growth on the unsupplemented minimal media after 10 days.
The proteins encoded by the cosmids were determined in vivo using a T7 expression system (Tabor and Richardson, 1985). Cultures of E. coli containing pGP1-2 (Tabor and Richardson, 1985) and test and control cosmids were grown at 30° C. in L-broth (2 ml) with chloramphenicol and kanamycin (25 and 50 μg/ml, respectively) to a Klett reading of ˜50. An aliquot was removed and the cells collected by centrifugation, washed with M9 salts (Miller, 1972) and resuspended in 1 ml M9 medium containing glucose at 0.2%, thiamine at 20 μg/ml and containing the 18 amino acids at 0.01% (minus cysteine and methionine). Following incubation at 30° C. for 90 minutes, the cultures were transferred to a 42° C. water bath and held there for 15 minutes. Rifampicin (Sigma) was added to 200 μg/ml and the cultures held at 42° C. for 10 additional minutes and then transferred to 30° C. for 20 minutes. Samples were pulsed with 10 μCi of 35S-methionine for 5 minutes at 30° C. The cells were collected by centrifugation and suspended in 60-120 μl cracking buffer (60 mM Tris-HCl 6.8, 1% SDS, 1% 2-mercaptoethanol, 10% glycerol, 0.01% bromophenol blue). Aliquot samples were electrophoresed on 12.5% SDS-PAGE and following soaking for 60 minutes in 10 volumes of Acetic Acid-Methanol-water (10:30:60), the gel was soaked in ENLIGHTNING™ (DUPONT) following manufacturer's directions, dried, and exposed at −70° C. to X-Ray film. Proteins of about 45 kd in size, labeled with 35S-methionine, were detected in number of the cosmids, including pMON17076.
Purification of EPSPS from Agrobacterium sp. strain CP4
All protein purification procedures were carried out at 3°-5° C. EPSPS enzyme assays were performed using either the phosphate release or radioactive HPLC method, as previously described in Padgette et al., 1987, using 1 mM phosphoenol pyruvate (PEP, Boehringer) and 2 mM shikimate-3-phosphate (S3P) substrate concentrations. For radioactive HPLC assays, 14-CPEP (Amersham) was utilized. S3P was synthesized as previously described in Wibbenmeyer et al. 1988. N-terminal amino acid sequencing was performed by loading samples onto a Polybrene precycled filter in aliquots while drying. Automated Edman degradation chemistry was used to determine the N-terminal protein sequence, using an Applied Biosystems Model 470A gas phase sequencer (Hunkapiller et al., 1983) with an Applied Biosystems 120A PTH analyzer.
Five 10-liter fermentations were carried out on a spontaneous “smooth” isolate of strain CP4 that displayed less clumping when grown in liquid culture. This reduced clumping and smooth colony morphology may be due to reduced polysaccharide production by this isolate. In the following section dealing with the purification of the EPSPS enzyme, CP4 refers to the “smooth” isolate—CP4-S1. The cells from the three batches showing the highest specific activities were pooled. Cell paste of Agrobacterium sp. CP4 (300 g) was washed twice with 0.5 L of 0.9% saline and collected by centrifugation (30 minutes, 8000 rpm in a GS3 Sorvall rotor). The cell pellet was suspended in 0.9 L extraction buffer (100 mM TrisCl, 1 mM EDTA, 1 mM BAM (Benzamidine), 5 mM DTT, 10% glycerol, pH 7.5) and lysed by 2 passes through a Manton Gaulin cell. The resulting solution was centrifuged (30 minutes, 8000 rpm) and the supernatant was treated with 0.21 L of 1.5% protamine sulfate (in 100 mM TrisCl, pH 7.5, 0.2% w/v final protamine sulfate concentration). After stirring for 1 hour, the mixture was centrifuged (50 minutes, 8000 rpm) and the resulting supernatant treated with solid ammonium sulfate to 40% saturation and stirred for 1 hour. After centrifugation (50 minutes, 8000 rpm), the resulting supernatant was treated with solid ammonium sulfate to 70% saturation, stirred for 50 minutes, and the insoluble protein was collected by centrifugation (1 hour, 8000 rpm). This 40-70% ammonium sulfate fraction was then dissolved in extraction buffer to give a final volume of 0.2 L, and dialyzed twice (Spectrum 10,000 MW cutoff dialysis tubing) against 2 L of extraction buffer for a total of 12 hours.
To the resulting dialyzed 40-70% ammonium sulfate fraction (0.29 L) was added solid ammonium sulfate to give a final concentration of 1M. This material was loaded (2 ml/min) onto a column (5 cm×15 cm, 295 ml) packed with phenyl Sepharose CL-4B (Pharmacia) resin equilibrated with extraction buffer containing 1M ammonium sulfate, and washed with the same buffer (1.5 L, 2 ml/min). EPSPS was eluted with a linear gradient of extraction buffer going from 1M to 0.00M ammonium sulfate (total volume of 1.5 L, 2 ml/min). Fractions were collected (20 ml) and assayed for EPSPS activity by the phosphate release assay. The fractions with the highest EPSPS activity (fractions 36-50) were pooled and dialyzed against 3×2 L (18 hours) of 10 mM TrisCl, 25 mM KCl, 1 mM EDTA, 5 mM DTT, 10% glycerol, pH 7.8.
The dialyzed EPSPS extract (350 ml) was loaded (5 ml/min) onto a column (2.4 cm×30 cm, 136 ml) packed with Q-Sepharose Fast Flow (Pharmacia) resin equilibrated with 10 mM TrisCl, 25 mM KCl, 5 mM DTT, 10% glycerol, pH 7.8 (Q Sepharose buffer), and washed with 1 L of the same buffer. EPSPS was eluted with a linear gradient of Q Sepharose buffer going from 0.025M to 0.40M KCl (total volume of 1.4 L, 5 ml/min). Fractions were collected (15 ml) and assayed for EPSPS activity by the phosphate release assay. The fractions with the highest EPSPS activity (fractions 47-60) were pooled and the protein was precipitated by adding solid ammonium sulfate to 80% saturation and stirring for 1 hour. The precipitated protein was collected by centrifugation (20 minutes, 12000 rpm in a GSA Sorvall rotor), dissolved in Q Sepharose buffer (total volume of 14 ml), and dialyzed against the same buffer (2×1 L, 18 hours).
The resulting dialyzed partially purified EPSPS extract (19 ml) was loaded (1.7 ml/min) onto a Mono Q 10/10 column (Pharmacia) equilibrated with Q Sepharose buffer, and washed with the same buffer (35 ml). EPSPS was eluted with a linear gradient of 0.025M to 0.35M KCl (total volume of 119 ml, 1.7 ml/min). Fractions were collected (1.7 ml) and assayed for EPSPS activity by the phosphate release assayed. The fractions with the highest EPSPS activity (fractions 30-37) were pooled (6 ml).
The Mono Q pool was made 1M in ammonium sulfate by the addition of solid ammonium sulfate and 2 ml aliquots were chromatographed on a Phenyl Superose 5/5 column (Pharmacia) equilibrated with 100 mM TrisCl, 5 mM DTT, 1M ammonium sulfate, 10% glycerol, pH 7.5 (Phenyl Superose buffer). Samples were loaded (1 ml/min), washed with Phenyl Superose buffer (10 ml), and eluted with a linear gradient of Phenyl Superose buffer going from 1M to 0.00M ammonium sulfate (total volume of 60 ml, 1 ml/min). Fractions were collected (1 ml) and assayed for EPSPS activity by the phosphate release assay. The fractions from each run with the highest EPSPS activity (fractions ˜36-40) were pooled together (10 ml, 2.5 mg protein). For N-terminal amino acid sequence determination, a portion of one fraction (#39 from run 1) was dialyzed against 50 mM NaHCO3 (2×1 L). The resulting pure EPSPS sample (0.9 ml, 77 μg protein) was found to exhibit a single N-terminal amino acid sequence of:
XH(G)ASSRPATARKSS(G)LX(G)(T)V(R)IPG(D)(K)(M) (SEQ ID NO:18).
XH(G)ASSRPATARKSS(G)LX(G)(T)V(R)IPG(D)(K)(M) (SEQ ID NO:18).
The remaining Phenyl Superose EPSPS pool was dialyzed against 50 mM TrisCl, 2 mM DTT, 10 mM KCl, 10% glycerol, pH 7.5 (2×1 L). An aliquot (0.55 ml, 0.61 mg protein) was loaded (1 ml/min) onto a Mono Q 5/5 column (Pharmacia) equilibrated with Q Sepharose buffer, washed with the same buffer (5 ml), and eluted with a linear gradient of Q Sepharose buffer going from 0-0.14M KCl in 10 minutes, then holding at 0.14M KCl (1 ml/min). Fractions were collected (1 ml) and assayed for EPSPS activity by the phosphate release assay and were subjected to SDS-PAGE (10-15%, Phast System, Pharmacia, with silver staining) to determine protein purity. Fractions exhibiting a single band of protein by SDS-PAGE (22-25, 222 μg) were pooled and dialyzed against 100 mM ammonium bicarbonate, pH 8.1 (2×1 L, 9 hours).
Trypsinolysis and peptide sequencing of Agrobacterium sp strain CP4 EPSPS
To the resulting pure Agrobacterium sp. strain CP4 EPSPS (111 μg) was added 3 μg of trypsin (Calbiochem), and the trypsinolysis reaction was allowed to proceed for 16 hours at 37° C. The tryptic digest was then chromatographed (1 ml/min) on a C18 reverse phase HPLC column (Vydac) as previously described in Padgette et al., 1988 for E. coli EPSPS. For all peptide purifications, 0.1% trifluoroacetic acid (TFA, Pierce) was designated buffer “RP-A” and 0.1% TFA in acetonitrile was buffer “RP-B”. The gradient used for elution of the trypsinized Agrobacterium sp. CP4 EPSPS was: 0-8 minutes, 0% RP-B; 8-28 minutes, 0-15% RP-B; 28-40 minutes, 15-21% RP-B; 40-68 minutes, 21-49% RP-B; 68-72 minutes, 49-75% RP-B; 72-74 minutes, 75-100% RP-B. Fractions were collected (1 ml) and, based on the elution profile at 210 nm, at least 70 distinct peptides were produced from the trypsinized EPSPS. Fractions 40-70 were evaporated to dryness and redissolved in 150 μl each of 10% acetonitrile, 0.1% trifluoroacetic acid.
The fraction 61 peptide was further purified on the C18 column by the gradient: 0-5 minutes, 0% RP-B; 5-10 minutes, 0-38% RP-B; 10-30 minutes, 38-45% B. Fractions were collected based on the UV signal at 210 nm. A large peptide peak in fraction 24 eluted at 42% RP-B and was dried down, resuspended as described above, and rechromatographed on the C18 column with the gradient: 0-5 minutes, 0% RP-B; 5-12 min, 0-38% RP-B; 12-15 min, 38-39% RP-B; 15-18 minutes, 39% RP-B; 18-20 minutes, 39-41% RP-B; 20-24 minutes, 41% RP-B; 24-28 minutes, 42% RP-B. The peptide in fraction 25, eluting at 41% RP-B and designated peptide 61-24-25, was subjected to N-terminal amino acid sequencing, and the following sequence was determined:
APSM(I)(D)EYPILAV (SEQ ID NO:19)
The CP4 EPSPS fraction 53 tryptic peptide was further purified by C18 HPLC by the gradient 0% B (5 minutes), 0-30% B (5-17 minutes), 30-40% B (17-37 minutes). The peptide in fraction 28, eluting at 34% B and designated peptide 53-28, was subjected to N-terminal amino acid sequencing, and the following sequence was determined:
ITGLLEGEDVINTGK (SEQ ID NO:20).
APSM(I)(D)EYPILAV (SEQ ID NO:19)
The CP4 EPSPS fraction 53 tryptic peptide was further purified by C18 HPLC by the gradient 0% B (5 minutes), 0-30% B (5-17 minutes), 30-40% B (17-37 minutes). The peptide in fraction 28, eluting at 34% B and designated peptide 53-28, was subjected to N-terminal amino acid sequencing, and the following sequence was determined:
ITGLLEGEDVINTGK (SEQ ID NO:20).
In order to verify the CP4 EPSPS cosmid clone, a number of oligonucleotide probes were designed on the basis of the sequence of two of the tryptic sequences from the CP4 enzyme (Table III). The probe identified as MID was very low degeneracy and was used for initial screening. The probes identified as EDV-C and EDV-T were based on the same amino acid sequences and differ in one position (underlined in Table III below) and were used as confirmatory probes, with a positive to be expected only from one of these two probes. In the oligonucleotides below, alternate acceptable nucleotides at a particular position are designated by a “/” such as A/C/T.
| TABLE III |
| Selected CP4 EPSPS peptide sequences and DNA probes |
| PEPTIDE 61-24-25 APSM(I)(D)EYPILAV | (SEQ ID NO:19) |
| Probe MID; 17-mer; mixed probe; 24-fold degenerate | (SEQ ID NO:21) |
| ATGATA/C/TGAC/TGAG/ATAC/TCC | |
| PEPTIDE 53-28 ITGLLEGEDVINTGK | (SEQ ID NO:20) |
| Probe EDV-C; 17-mer; mixed probe; 48-fold | (SEQ ID NO:22) |
| degenerate | |
| GAA/GGAC/TGTA/C/G/TATA/C/TAACAC | |
| Probe EDV-T; 17-mer; mixed probe; 48-fold | (SEQ ID NO:23) |
| degenerate | |
| GAA/GGAC/TGTA/C/G/TATA/C/TAATAC | |
The probes were labeled using gamma-32P-ATP and polynucleotide kinase. DNA from fourteen of the cosmids described above was restricted with EcoRI, transferred to membrane and probed with the oligonucleotide probes. The conditions used were as follows: prehybridization was carried out in 6× SSC, 10× Denhardt's for 2-18 hour periods at 60° C., and hybridization was for 48-72 hours in 6× SSC, 10× Denhardt's, 100 μg/ml tRNA at 10° C. below the Td for the probe. The Td of the probe was approximated by the formula 2° C×(A+T)+4° C×(G+C). The filters were then washed three times with 6× SSC for ten minutes each at room temperature, dried and autoradiographed. Using the MID probe, an ˜9.9 kb fragment in the pMON17076 cosmid gave the only positive signal. This cosmid DNA was then probed with the EDV-C (SEQ ID NO:22) and EDV-T (SEQ ID NO:23) probes separately and again this ˜9.9 kb band gave a signal and only with the EDV-T probe.
The combined data on the glyphosate-tolerant phenotype, the complementation of the E. coli aroA- phenotype, the expression of a ˜45 Kd protein, and the hybridization to two probes derived from the CP4 EPSPS amino acid sequence strongly suggested that the pMON17076 cosmid contained the EPSPS gene.
Localization and subcloning of the CP4 EPSPS gene
The CP4 EPSPS gene was further localized as follows: a number of additional Southern analyses were carried out on different restriction digests of pMON17076 using the MID (SEQ ID NO:21) and EDV-T (SEQ ID NO:23) probes separately. Based on these analyses and on subsequent detailed restriction mapping of the pBlueScript (Stratagene) subclones of the ˜9.9 kb fragment from pMON17076, a 3.8 kb EcoRI-SalI fragment was identified to which both probes hybridized. This analysis also showed that MID (SEQ ID NO:21) and EDV-T (SEQ ID NO:23) probes hybridized to different sides of BamHI, ClaI, and SacII sites. This 3.8 kb fragment was cloned in both orientations in pBlueScript to form pMON17081 and pMON17082. The phenotypes imparted to E. coli by these clones were then determined. Glyphosate tolerance was determined following transformation into E. coli MM294 containing pGP1-2 (pBlueScript also contains a T7 promoter) on M9 agar media containing glyphosate at 3 mM. Both pMON17081 and pMON17082 showed glyphosate-tolerant colonies at three days at 30° C. at about half the size of the controls on the same media lacking glyphosate. This result suggested that the 3.8 kb fragment contained an intact EPSPS gene. The apparent lack of orientation-dependence of this phenotype could be explained by the presence of the T7 promoter at one side of the cloning sites and the lac promoter at the other. The aroA phenotype was determined in transformants of E. coli GB100 on M9 agar media lacking aromatic supplements. In this experiment, carried out with and without the Plac inducer IPTG, pMON17082 showed much greater growth than pMON17081, suggesting that the EPSPS gene was expressed from the SalI site towards the EcoRI site.
Nucleotide sequencing was begun from a number of restriction site ends, including the BamHI site discussed above. Sequences encoding protein sequences that closely matched the N-terminus protein sequence and that for the tryptic fragment 53-28 (SEQ ID NO:20) (the basis of the EDV-T probe) (SEQ ID NO:23) were localized to the SalI side of this BamHI site. These data provided conclusive evidence for the cloning of the CP4 EPSPS gene and for the direction of transcription of this gene. These data coupled with the restriction mapping data also indicated that the complete gene was located on an ˜2.3 kb XhoI fragment and this fragment was subcloned into pBlueScript. The nucleotide sequence of almost 2 kb of this fragment was determined by a combination of sequencing from cloned restriction fragments and by the use of specific primers to extend the sequence. The nucleotide sequence of the CP4 EPSPS gene and flanking regions is shown in FIG. 3 (SEQ ID NO:2). The sequence corresponding to peptide 61-24-25 (SEQ ID NO:19) was also located. The sequence was determined using both the SEQUENASE™ kit from IBI (International Biotechnologies Inc.) and the T7 sequencing/Deaza Kit from Pharmacia.
That the cloned gene encoded the EPSPS activity purified from the Agrobacterium sp. strain CP4 was verified in the following manner: By a series of site directed mutageneses, BglII and NcoI sites were placed at the N-terminus with the fMet contained within the NcoI recognition sequence, the first internal NcoI site was removed (the second internal NcoI site was removed later), and a SacI site was placed after the stop codons. At a later stage the internal NotI site was also removed by site-directed mutagenesis. The following list includes the primers for the site-directed mutagenesis (addition or removal of restriction sites) of the CP4 EPSPS gene. Mutagenesis was carried out by the procedures of Kunkel et al. (1987), essentially as described in Sambrook et al. (1989).
| PRIMER BgNc |
| (addition of BgIII and NcoI sites to N-terminus) |
| CGTGGATAGATCTAGGAAGACAACCATGGCTCACGGTC |
| (SEQ ID NO:24) |
| PRIMER Sph2 |
| (addition of SphI site to N-terminus) |
| GGATAGATTAAGGAAGACGCGCATGCTTCACGGTGCAAGCAGCC |
| (SEQ ID NO:25) |
| PRIMER S1 (addition of SacI site immediately |
| after stop codons) |
| GGCTGCCTGATGAGCTCCACAATCGCCATCGATGG |
| (SEQ ID NO:26) |
| PRIMER N1 |
| (removal of internal NotI recognition site) |
| CGTCGCTCGTCGTGCGTGGCCGCCCTGACGGC |
| (SEQ ID NO:27) |
| PRIMER NcoI |
| (removal of first internal NcoI recognition site) |
| CGGGCAAGGCCATGCAGGCTATGGGCGCC |
| (SEQ ID NO:28) |
| PRIMER Nco2 |
| (removal of second internal NcoI recognition site) |
| CGGGCTGCCGCCTGACTATGGGCCTCGTCGG |
| (SEQ ID NO:29) |
This CP4 EPSPS gene was then cloned as a NcoI-BamHI N-terminal fragment plus a BamHI-SacI C-terminal fragment into a PrecA-gene10L expression vector similar to those described (Wong et al., 1988; Olins et al., 1988) to form pMON17101. The Km for PEP and the Ki for glyphosate were determined for the EPSPS activity in crude lysates of pMON17101/GB100 transformants following induction with nalidixic acid (Wong et al., 1988) and found to be the same as that determined for the purified and crude enzyme preparations from Agrobacterium sp. strain CP4.
Characterization of the EPSPS gene from Achromobacter sp. strain LBAA and from Pseudomonas sp. strain PG2982
A cosmid bank of partially HindIII-restricted LBAA DNA was constructed in E. coli MM294 in the vector pHC79 (Hohn and Collins, 1980). This bank was probed with a full length CP4 EPSPS gene probe by colony hybridization and positive clones were identified at a rate of ˜1 per 400 cosmids. The LBAA EPSPS gene was further localized in these cosmids by Southern analysis. The gene was located on an ˜2.8 kb XhoI fragment and by a series of sequencing steps, both from restriction fragment ends and by using the oligonucleotide primers from the sequencing of the CP4 EPSPS gene, the nucleotide sequence of the LBAA EPSPS gene was completed and is presented in FIG. 4 (SEQ ID NO:4).
The EPSPS gene from PG2982 was also cloned. The EPSPS protein was purified, essentially as described for the CP4 enzyme, with the following differences: Following the Sepharose CL-4B column, the fractions with the highest EPSPS activity were pooled and the protein precipitated by adding solid ammonium sulfate to 85% saturation and stirring for 1 hour. The precipitated protein was collected by centrifugation, resuspended in Q Sepharose buffer and following dialysis against the same buffer was loaded onto the column (as for the CP4 enzyme). After purification on the Q Sepharose column, ˜40 mg of protein in 100 mM Tris pH 7.8, 10% glycerol, 1 mM EDTA, 1 mM DTT, and 1M ammonium sulfate, was loaded onto a Phenyl Superose (Pharmacia) column. The column was eluted at 1.0 ml/minutes with a 40 ml gradient from 1.0M to 0.00M ammonium sulfate in the above buffer.
Approximately 1.0 mg of protein from the active fractions of the Phenyl Superose 10/10 column was loaded onto a Pharmacia Mono P 5/10 Chromatofocusing column with a flow rate of 0.75 ml/minutes. The starting buffer was 25 mM bis-Tris at pH 6.3, and the column was eluted with 39 ml of Polybuffer 74, pH 4.0. Approximately 50 μg of the peak fraction from the Chromatofocusing column was dialyzed into 25 mM ammonium bicarbonate. This sample was then used to determine the N-terminal amino acid sequence.
The N-terminal sequence obtained was:
XHSASPKPATARRSE (where X=an unidentified residue) (SEQ ID NO:30)
XHSASPKPATARRSE (where X=an unidentified residue) (SEQ ID NO:30)
A number of degenerate oligonucleotide probes were designed based on this sequence and used to probe a library of PG2982 partial-HindIII DNA in the cosmid pHC79 (Hohn and Collins, 1980) by colony hybridization under nonstringent conditions. Final washing conditions were 15 minutes with 1× SSC, 0.1% SDS at 55° C. One probe with the sequence GCGGTBGCSGGYTTSGG (where B=C, G, or T; S=C or G, and Y=C or T) (SEQ ID NO:31) identified a set of cosmid clones.
The cosmid set identified in this way was made up of cosmids of diverse HindIII fragments. However, when this set was probed with the CP4 EPSPS gene probe, a cosmid containing the PG2982 EPSPS gene was identified (designated as cosmid 9C1 originally and later as pMON20107). By a series of restriction mappings and Southern analysis this gene was localized to a ˜2.8 kb XhoI fragment and the nucleotide sequence of this gene was determined. This DNA sequence (SEQ ID NO:6) is shown in FIG. 5. There are no nucleotide differences between the EPSPS gene sequences from LBAA (SEQ ID NO:4) and PG2982 (SEQ ID NO:6). The kinetic parameters of the two enzymes are within the range of experimental error.
A gene from PG2982 that imparts glyphosate tolerance in E. coli has been sequenced (Fitzgibbon, 1988; Fitzgibbon and Brayruer, 1990). The sequence of the PG2982 EPSPS Class II gene shows no homology to the previously reported sequence suggesting that the glyphosate-tolerant phenotype of the previous work is not related to EPSPS.
Characterization of the EPSPS from Bacillus subtilis
Bacillus subtilis 1A2 (prototroph) was obtained from the Bacillus Genetic Stock Center at Ohio State University. Standard EPSPS assay reactions contained crude bacterial extract with, 1 mM phosphoenolpyruvate (PEP), 2 mM shikimate-3-phosphate (S3P), 0.1 mM ammonium molybdate, 5 mM potassium fluoride, and 50 mM HEPES, pH 7.0 at 25° C. One unit (U) of EPSPS activity is defined as one μmol EPSP formed per minute under these conditions. For kinetic determinations, reactions contained crude bacterial, 2 mM S3P, varying concentrations of PEP, and 50 mM HEPES, pH 7.0 at 25° C. The EPSPS specific activity was found to be 0.003 U/mg. When the assays were performed in the presence of 1 mM glyphosphate, 100% of the EPSPS activity was retained. The appKm(PEP) of the B. subtilis EPSPS was determined by measuring the reaction velocity at varying concentrations of PEP. The results were analyzed graphically by the hyperbolic, Lineweaver-Burk and Eadie-Hofstee plots, which yielded appKm(PEP) values of 15.3 μM, 10.8 μM and 12.2 μM, respectively. These three data treatments are in good agreement, and yield an average value for appKm(PEP) of 13 μM. The appKi(glyphosate) was estimated by determining the reaction rates of B. subtilis 1A2 EPSPS in the presence of several concentrations of glyphosphate, at a PEP concentration of 2 μM. These results were compared to the calculated Vmax of the EPSPS, and making the assumption that glyphosate is a competitive inhibitor versus PEP for B. subtilis EPSPS, as it is for all other characterized EPSPSs, an appKi(glyphosate) was determined graphically. The appKi(glyphosate) was found to be 0.44 mM.
The EPSPS expressed from the B. subtilis aroE gene described by Henner et al. (1986) was also studied. The source of the B. subtilis aroE (EPSPS) gene was the E. coli plasmid-bearing strain ECE13 (original code=MM294[p trp100]; Henner, et al., 1984; obtained from the Bacillus Genetic Stock Center at Ohio State University; the culture genotype is [pBR322 trp100] Ap [in MM294] [pBR322::6 kb insert with trpFBA-hisH]). Two strategies were taken to express the enzyme in E. coli GB100 (aroA-): 1) the gene was isolated by PCR and cloned into an overexpression vector, and 2) the gene was subcloned into an overexpression vector. For the PCR cloning of the B. subtilis aroE from ECE13, two oligonucleotides were synthesized which incorporated two restriction enzyme recognition sites (NdeI and EcoRI) to the sequences of the following oligonucleotides:
| (SEQ ID NO:45) |
| GGAACATATGAAACGAGATAAGGTGCAG |
| (SEQ ID NO:46) |
| GGAATTCAAACTTCAGGATCTTGAGATAGAAAATG |
The other approach to the isolation of the B. subtilis aroE gene, subcloning from ECE13 into pUC118, was performed as follows:
-
- (i) Cut ECE13 and pUC with XmaI and SphI.
- (ii) Isolate 1700bp aroE fragment and 2600bp pUC118 vector fragment.
- (iii) Ligate fragments and transform into GB100.
The subclone was designated pMON21133 and the PCR-derived clone was named pMON21132. Clones from both approaches were first confirmed for complementation of the aroA mutation in E. coli GB100. The cultures exhibited EPSPS specific activities of 0.044 U/mg and 0.71 U/mg for the subclone (pMON21133) and PCR-derived clone (pMON21132) enzymes, respectively. These specific activities reflect the expected types of expression levels of the two vectors. The B. subtilis EPSPS was found to be 88% and 100% resistant to inhibition by 1 mM glyphosate under these conditions for the subcloned (pMON21133) and PCR-derived (pMON21132) enzymes, respectively. The appKm (PEP) and the appKi(glyphosate) of the subcloned B. subtilis EPSPS (pMON21133) were determined as described above. The data were analyzed graphically by the same methods used for the 1A2 isolate, and the results obtained were comparable to those reported above for B. subtilis 1A2 culture.
Characterization of the EPSPS gene from Staphylococcus aureus
The kinetic properties of the S. aureus EPSPS expressed in E. coli were determined, including the specific activity, the appKm(PEP), and the appKi(glyphosate). The S. aureus EPSPS gene has been previously described (O'Connell et al., 1993)
The strategy taken for the cloning of the S. aureus EPSPS was polymerase chain reaction (PCR), utilizing the known nucleotide sequence of the S. aureus aroA gene encoding EPSPS (O'Cormell et al., 1993). The S. aureus culture (ATCC 35556) was fermeated in an M2 facility in three 250 mL shake flasks containing 55 mL of TYE (tryptone 5 g/L, yeast extract 3 g/L, pH 6.8). The three flasks were inoculated with 1.5 mL each of a suspension made from freeze dried ATCC 35556 S. aureus cells in 90 mL of PBS (phosphate-buffered saline) buffer. Flasks were incubated at 30° C. for 5 days while shaking at 250 rpm. The resulting cells were lysed (boiled in TE [tris/EDTA] buffer for 8 minutes) and the DNA utilized for PCR reactions. The EPSPS gene was amplified using PCR and engineered into an E. coli expression vector as follows:
-
- (i) two oligonucleotides were synthesized which incorporated two restriction enzyme recognition sites (NcoI and SacI) to the sequences of the oligonucleotides:
| (SEQ ID NO:47) |
| GGGGCCATGGTAAATGAACAAATCATTG |
| (SEQ ID NO:48) |
| GGGGGAGCTCATTATCCCTCATTTTGTAAAAGC |
-
- (ii) The purified, PCR-amplified aroA gene from S. aureus was digested using NcoI and SacI enzymes.
- (iii) DNA of pMON 5723, which contains a pRecA bacterial promoter and Gene10 leader sequence (Olins et al., 1988) was digested NcoI and SacI and the 3.5 kb digestion product was purified.
- (iv) The S. aureus PCR product and the NcoI/SacI pMON 5723 fragment were ligated and transformed into E. coli JM101 competent cells.
- (v) Two spectinomycin-resistant E. coli JM101 clones from above (SA#2 and SA#3) were purified and transformed formed into a competent aroA- E. coli strain, GB100
For complementation experiments SAGB#2 and SAGB# 3 were utilized, which correspond to SA#2 and SA# 3, respectively, transformed into E. coli GB100. In addition, E. coli GB100 (negative control) and pMON 9563 (wt petunia EPSPS, positive control) were tested for AroA complementation. The organisms were grown in minimal media plus and minus aromatic amino acids. Later analyses showed that the SA#2 and SA# 3 clones were identical, and they were assigned the plasmid identifier pMON21139.
SAGB#2 in E. coli GB100 (pMON21139) was also grown in M9 minimal media and induced with nalidixic acid. A negative control, E. coli GB100, was grown under identical conditions except the media was supplemented with aromatic amino acids. The cells were harvested, washed with 0.9% NaCl, and frozen at −80° C., for extraction and EPSPS analysis.
The frozen pMON21139 E. coli GB100 cell pellet from above was extracted and assayed for EPSPS activity as previously described. EPSPS assays were performed using 1 mM phosphoenolpyruvate (PEP), 2 mM shikimate-3-phosphate (S3P), 0. 1 mM ammonium molybdate, 5 mM potassium fluoride, pH 7.0, 25° C. The total assay volume was 50μL, which contained 10 μL of the undiluted desalted extract.
The results indicate that the two clones contain a functional aroA/EPSPS gene since they were able to grow in minimal media which contained no aromatic amino acids. As expected, the GB100 culture did not grow on minimal medium without aromatic amino acids (since no functional EPSPS is present), and the pMON9563 did confer growth in minimal media. These results demonstrated the successful cloning of a functional EPSPS gene from S. aureus. Both clones tested were identical, and the E. coli expression vector was designated pMON21139.
The plasmid pMON21139 in E. coli GB100 was grown in M9 minimal media and was induced with nalidixic acid to induce EPSPS expression driven from the RecA promoter. A desalted extract of the intracellular protein was analyzed for EPSPS activity, yielding an EPSPS specific activity of 0.005 μmol/min mg. Under these assay conditions, the S. aureus EPSPS activity was completely resistant to inhibition by 1 mM glyphosate. Previous analysis had shown that E. coli GB100 is devoid of EPSPS activity.
The appKm(PEP) of the S. aureus EPSPS was determined by measuring the reaction velocity of the enzyme (in crude bacterial extracts) at varying concentrations of PEP. The results were analyzed graphically using several standard kinetic plotting methods. Data analysis using the hyperbolic, Lineweaver-Burke, and Eadie-Hofstee methods yielded appKm(PEP) constants of 7.5, 4.8, and 4.0 μM, respectively. These three data treatments are in good agreement, and yield an average value for appKm(PEP) of 5 μM.
Further information of the glyphosate tolerance of S. aureus EPSPS was obtained by determining the reaction rates of the enzyme in the presence of several concentrations of glyphosate, at a PEP concentration of 2 μM. These results were compared to the calculated maximal velocity of the EPSPS, and making the assumption that glyphosate is a competitive inhibitor versus PEP for S. aureus EPSPS, as it is for all other characterized EPSPSs, an appKi(glyphosate) was determined graphically. The appKi(glyphosate) for S. aureus EPSPS estimated using this method was found to be 0.20 mM.
The EPSPS from S. aureus was found to be glyphosate-tolerant, with an appKi(glyphosate) of approximately 0.2 mM. In addition, the appKm(PEP) for the enzyme is approximately 5 μM, yielding a appKi(glyphosate)/appKm(PEP) of 40.
Alternative Isolation Protocols for Other Class II EPSPS Structural Genes
A number of Class II genes have been isolated and described here. While the cloning of the gene from CP4 was difficult due to the low degree of similarity between the Class I and Class II enzymes and genes, the identification of the other genes were greatly facilitated by the use of this first gene as a probe. In the cloning of the LBAA EPSPS gene, the CP4 gene probe allowed the rapid identification of cosmid clones and the localization of the intact gene to a small restriction fragment and some of the CP4 sequencing primers were also used to sequence the LBAA (and PG2982) EPSPS gene(s). The CP4 gene probe was also used to confirm the PG2982 gene clone. The high degree of similarity of the Class II EPSPS genes may be used to identify and clone additional genes in much the same way that Class I EPSPS gene probes have been used to clone other Class I genes. An example of the latter was in the cloning of the A. thaliana EPSPS gene using the P. hybrida gene as a probe (Klee et al., 1987).
Glyphosate-tolerant EPSPS activity has been reported previously for EPSP synthases from a number of sources. These enzymes have not been characterized to any extent in most cases. The use of Class I and Class II EPSPS gene probes or antibody probes provide a rapid means of initially screening for the nature of the EPSPS and provide tools for the rapid cloning and characterization of the genes for such enzymes.
Two of the three genes described were isolated from bacteria that were isolated from a glyphosate treatment facility (Strains CP4 and LBAA). The third (PG2982) was from a bacterium that had been isolated from a culture collection strain. This latter isolation confirms that exposure to glyphosate is not a prerequisite for the isolation of high glyphosate-tolerant EPSPS enzymes and that the screening of collections of bacteria could yield additional isolates. It is possible to enrich for glyphosate degrading or glyphosate resistant microbial populations (Quinn et al., 1988; Talbot et al., 1984) in cases where it was felt that enrichment for such microorganisms would enhance the isolation frequency of Class II EPSPS microorganisms. Additional bacteria containing class II EPSPS gene have also been identified. A bacterium called C 12, isolated from the same treatment column beads as CP4 (see above) but in a medium in which glyphosate was supplied as both the carbon and phosphorus source, was shown by Southern analysis to hybridize with a probe consisting of the CP4 EPSPS coding sequence. This result, in conjunction with that for strain LBAA, suggests that this enrichment method facilitates the identification of Class II EPSPS isolates. New bacterial isolates containing Class II EPSPS genes have also been identified from environments other than glyphosate waste treatment facilities. An inoculum was prepared by extracting soil (from a recently harvested soybean field in Jerseyville, Ill.) and a population of bacteria selected by growth at 28° C. in Dworkin-Foster medium containing glyphosate at 10 mM as a source of carbon (and with cycloheximide at 100 μg/ml to prevent the growth of fungi). Upon plating on L-agar media, five colony types were identified. Chromosomal DNA was prepared from 2ml L-broth cultures of these isolates and the presence of a Class II EPSPS gene was probed using a the CP4 EPSPS coding sequence probe by Southern analysis under stringent hybridization and washing conditions. One of the soil isolates, S2, was positive by this screen.
Class II EPSPS enzymes are identifiable by an elevated Ki for glyphosate and thus the genes for these will impart a glyphosate tolerance phenotype in heterologous hosts. Expression of the gene from recombinant plasmids or phage may be achieved through the use of a variety of expression promoters and include the T7 promoter and polymerase. The T7 promoter and polymerase system has been shown to work in a wide range of bacterial (and mammalian) hosts and offers the advantage of expression of many proteins that may be present on large cloned fragments. Tolerance to growth on glyphosate may be shown on minimal growth media. In some cases, other genes or conditions that may give glyphosate tolerance have been observed, including over expression of beta-lactamase, the igrA gene (Fitzgibbon and Braymer, 1990), or the gene for glyphosate oxidoreductase (PCT Pub. No. WO92/00377). These are easily distinguished from Class II EPSPS by the absence of EPSPS enzyme activity.
The EPSPS protein is expressed from the aroA gene (also called aroE in some genera, for example, in Bacillus) and mutants in this gene have been produced in a wide variety of bacteria. Determining the identity of the donor organism (bacterium) aids in the isolation of Class II EPSPS gene—such identification may be accomplished by standard micro-biological methods and could include Gram stain reaction, growth, color of culture, and gas or acid production on different substrates, gas chromatography analysis of methylesters of the fatty acids in the membranes of the microorganism, and determination of the GC % of the genome. The identity of the donor provides information that may be used to more easily isolate the EPSPS gene. An AroA- host more closely related to the donor organism could be employed to clone the EPSPS gene by complementation but this is not essential since complementation of the E. coli AroA mutant by the CP4 EPSPS gene was observed. In addition, the information on the GC content the genome may be used in choosing nucleotide probes—donor sources with high GC % would preferably use the CP4 EPSPS gene or sequences as probes and those donors with low GC would preferably employ those from Bacillus subtilis, for example. Relationships between different EPSPS genes
The deduced amino acid sequences of a number of Class I and the Class II EPSPS enzymes were compared using the Bestfit computer program provided in the UWGCG package (Devereux et al. 1984). The degree of similarity and identity as determined using this program is reported. The degree of similarity/identity determined within Class I and Class II protein sequences is remarkably high, for instance, comparing E. coli with S. typhimurium (similarity/identity=93%/88%) and even comparing E. coli with a plant EPSPS (Petunia hybrida; 72%/55%). These data are shown in Table IV. The comparison of sequences between Class I and Class II, however, shows a much lower degree of relatedness between the Classes (similarity/identity=50-53%/23-30%). The display of the Bestfit analysis for the E. coli (SEQ ID NO:8) and CP4 (SEQ ID NO:3) sequences shows the positions of the conserved residues and is presented in FIG. 6. Previous analyses of EPSPS sequences had noted the high degree of conservation of sequences of the enzymes and the almost invariance of sequences in two regions—the “20-35” and “95-107” regions (Gasser et al., 1988; numbered according to the Petunia EPSPS sequence)—and these regions are less conserved in the case of CP4 and LBAA when compared to Class I bacterial and plant EPSPS sequences (see FIG. 6 for a comparison of the E. coli and CP4 EPSPS sequences with the E. coli sequence appearing as the top sequence in the Figure). The corresponding sequences in the CP4 Class II EPSPS are:
| PGDKSTSHRSFMGGL | (SEQ ID NO:32) | |
| and | ||
| LDFGNAATGCRLT. | (SEQ ID NO:33) |
These comparisons show that the overall relatedness of Class I and Class II is EPSPS proteins is low and that sequences in putative conserved regions have also diverged considerably.
In the CP4 EPSPS an alanine residue is present at the “glycine101” position. The replacement of the conserved glycine (from the “95-107” region) by an alanine results in an elevated Ki for glyphosate and in an elevation in the Km for PEP in Class I EPSPS. In the case of the CP4 EPSPS, which contains an alanine at this position, the Km for PEP is in the low range, indicating that the Class II enzymes differ in many aspects from the EPSPS enzymes heretofore characterized.
Within the Class II isolates, the degree of similarity/identity is as high as that noted for that within Class I (Table IVA). FIG. 7 displays the Bestfit computer program alignment of the CP4 (SEQ ID NO:3) and LBAA (SEQ ID NO:5) EPSPS deduced amino acid sequences with the CP4 sequence appearing as the top sequence in the Figure. The symbols used in FIGS. 6 and 7 are the standard symbols used in the Bestfit computer program to designate degrees of similarity and identity.
| TABLE IVA1.2 |
| Comparison of relatedness of EPSPS protein sequences |
| Comparison between Class I and Class II EPSPS |
| protein sequences |
| similarity | identity | |||
| S. cerevisiae vs. |
54 | 30 | ||
| A. nidulans vs. |
50 | 25 | ||
| B. napus vs. CP4 | 47 | 22 | ||
| A. thaliana vs. |
48 | 22 | ||
| N. tabacum vs. |
50 | 24 | ||
| L. esculentum vs. |
50 | 24 | ||
| P. hybrida vs. |
50 | 23 | ||
| Z. mays vs. |
48 | 24 | ||
| S. gallinarum vs. |
51 | 25 | ||
| S. typhimurium vs. |
51 | 25 | ||
| S. typhi vs. |
51 | 25 | ||
| K. pneumoniae vs. CP4 | 56 | 28 | ||
| Y. enterocolitica vs. CP4 | 53 | 25 | ||
| H. influenzae vs. CP4 | 53 | 27 | ||
| P. multocida vs. |
55 | 30 | ||
| A. salmonicida vs. CP4 | 53 | 23 | ||
| B. pertussis vs. CP4 | 53 | 27 | ||
| E. coli vs. CP4 | 52 | 26 | ||
| E. coli vs. LBAA | 52 | 26 | ||
| E. coli vs. B. subtilis | 55 | 29 | ||
| E. coli vs. D. nodosus | 55 | 32 | ||
| E. coli vs. |
55 | 29 | ||
| E. coli vs. Synechocystis sp. PCC6803 | 53 | 30 | ||
| Comparison between Class I EPSPS protein sequences |
| similarity | identity | |||
| E. coli vs. S. typhimurium | 93 | 88 | ||
| P. hybrids vs. E. coli | 72 | 55 | ||
| Comparison between Class II EPSPS protein sequences |
| similarity | identity | |||
| D. nodosus vs. CP4 | 62 | 43 | ||
| LBAA vs. |
90 | 83 | ||
| PG2892 vs. |
90 | 83 | ||
| S. aureus vs. CP4 | 58 | 34 | ||
| B. subtills vs. CP4 | 59 | 41 | ||
| Synechocystis sp. PCC6803 vs. CP4 | 62 | 45 | ||
| 1The EPSPS sequences compared here were obtained from the following references: E. coli, Rogers et al., 1983; S. typhimurium, Stalker et al., 1985; Petunia hybrids, Shah et al., 1986; B. pertussis, Maskell et al., 1988; S. cerevisiae, Duncan et al., 1987, Synechocystis sp. PCC6803, Dalla Chiesa et al., 1994 and D. nodosus, Alm et al., 1994. | ||||
| 2“GAP” Program, Genetics Computer Group, (1991), Program Manual for the GCG Package, Version 7, April 1991, 575 Science Drive, Madison, Wisconsin, USA 53711 | ||||
The relative locations of the major conserved sequences among Class II EPSP sythase which distinguishes this group from the Class I EPSP synthases is listed below in Table IVB.
| TABLE IVB |
| Location of Conserved Sequences in |
| Class II EPSP Synthases |
| Source | Seq. 11 | Seq. 22 | Seq. 33 | Seq. 44 | ||
| CP4 | ||||||
| start | 200 | 26 | 173 | 271 | ||
| end | 204 | 29 | 177 | 274 | ||
| LBAA | ||||||
| start | 200 | 26 | 173 | 271 | ||
| end | 204 | 29 | 177 | 274 | ||
| PG2982 | ||||||
| start | 200 | 26 | 173 | 273 | ||
| end | 204 | 29 | 177 | 276 | ||
| B. subtilis | ||||||
| start | 190 | 17 | 164 | 257 | ||
| end | 194 | 20 | 168 | 260 | ||
| S. aureus | ||||||
| start | 193 | 21 | 166 | 261 | ||
| end | 197 | 24 | 170 | 264 | ||
| Synechocystis sp. | ||||||
| PCC6803 | ||||||
| start | 210 | 34 | 183 | 278 | ||
| end | 214 | 38 | 187 | 281 | ||
| D. nodosus | ||||||
| start | 195 | 22 | 168 | 261 | ||
| end | 199 | 25 | 172 | 264 | ||
| min. start | 190 | 17 | 164 | 257 | ||
| max. end | 214 | 38 | 187 | 281 | ||
| 1-R-X1-H-X2-E-(SEQ ID NO:37) | ||||||
| 2-G-D-K-X3-(SEQ ID NO:38) | ||||||
| 3-S-A-Q-X4-K-(SEQ ID NO:39) | ||||||
| 4-N-X5-T-E-(SEQ ID NO:40) | ||||||
The domains of EPSP synthase sequence identified in this application were determined to be those important for maintenance of glyphosate resistance and productive binding of PEP. The information used in indentifying these domains included sequence alignments of numerous glyphosate-sensitive EPSPS molecules and the three-dimensional x-ray structures of E. coli EPSPS (Stallings, et al. 1991) and CP4 EPSPS. The structures are representative of a glyphosate-sensitive (i.e., Class I) enzyme, and a naturally-occuring glyphosate-tolerant (i.e., Class II) enzyme of the present invention. These exemplary molecules were superposed three-dimensionally and the results displayed on a computer graphics terminal. Inspection of the display allowed for structure-based fine-tuning of the sequence alignments of glyphosate-sensitive and glyphosate-resistant EPSPS molecules. The new sequence alignments were examined to determine differences between Class I and Class II EPSPS enzymes. Seven regions were identified and these regions were located in the x-ray structure of CP4 EPSPS which also contained a bound analog of the intermediate which forms catalytically between PEP and S3P.
The structure of the CP4 EPSPS with the bound intermediate analog was displayed on a computer graphics terminal and the seven sequence segments were examined. Important residues for glyphosate binding were identified as well as those residues which stabilized the conformations of those important residues; adjoining residues were considered necessary for maintenance of correct three-dimensional structural motifs in the context of glyphosate- sensitive EPSPS molecules. Three of the seven domains were determined not to be important for glyphosate tolerance and maintenance of productive PEP binding. The following four primary domains were determined to be characteristic of Class II EPSPS enzymes of the present invention:
-
- -R-XrH-X2-E(SEQ ID NO:37), in which
- X1 is an uncharged polar or acidic amino acid,
- X2 is serine or threonine,
- The Arginine (R) reside at
position 1 is important because the positive charge of its guanidium group destabilizes the binding of glyphosate. The Histidine (H) residue atposition 3 stabilizes the Arginine (R) residue at position 4 of SEQ ID NO:40. The Glutamic Acid (E) residue atposition 5 stabilizes the Lysine (K) residue atposition 5 of SEQ ID NO:39.
- -G-D-K-X3(SEQ ID NO:38), in which
- X3 is serine or threonine,
- The Aspartic acid (D) residue at position 2 stabilizes the Arginine (R) residue at position 4 of SEQ ID NO:40. The Lysine (K) residue at
position 3 is important because for productive PEP binding. - -S-A-Q-X4-K(SEQ ID NO:39), in which
- X4 is any amino acid,
- The Alanine (A) residue at position 2 stabilizes the Arginine (R) residue at
position 1 of SEQ ID NO:37. The Serine (S) residue atposition 1 and the Glutamine (Q) residue atposition 3 are important for productive S3P binding. - -N-X5-T-R(SEQ ID NO:40), in which
- X5 is any amino acid,
- The Asparagine (N) residue at
position 1 and the Threonine (T) residue atposition 3 stabilize residue X1 at position 2 of SEQ ID NO:37. The Arginine (R) residue at position 4 is important because the positive charge of its guanidium group destabilizes the binding of glyphosate.
- -R-XrH-X2-E(SEQ ID NO:37), in which
Since the above sequences are only representative of the Class II EPSPSs which would be included within the generic structure of this group of EPSP synthases, the above sequences may be found within a subject EPSP synthase molecule within slightly more expanded regions. It is believed that the above-described conserved sequences would likely be found in the following regions of the mature EPSP synthases molecule:
-
- -R-X1-H-X2-E-(SEQ ID NO:37) located between
175 and 230 of the mature EPSP synthase sequence;amino acids - -G-D-K-X3-(SEQ ID NO:38) located between
5 and 55 of the mature EPSP synthase sequence;amino acids - -S-A-Q-X4-K-(SEQ ID NO:39) located between
150 and 200 of the mature EPSP synthase sequence; andamino acids - -N-X5-T-R-(SEQ ID NO:40) located between
245 and 295 of the mature EPSPS synthase sequence.amino acids
- -R-X1-H-X2-E-(SEQ ID NO:37) located between
One difference that may be noted between the deduced amino acid sequences of the CP4 and LBAA EPSPS proteins is at position 100 where an Alanine is found in the case of the CP4 enzyme and a Glycine is found in the case of the LBAA enzyme. In the Class I EPSPS enzymes a Glycine is usually found in the equivalent position, i.e Glycine96 in E. coli and K. pneumoniae and Glycine101 in Petunia. In the case of these three enzymes it has been reported that converting that Glycine to an Alanine results in an elevation of the appKi for glyphosate and a concomitant elevation in the appKm for PEP (Kishore et al., 1986; Kishore and Shah, 1988; Sost and Amrhein, 1990), which, as discussed above, makes the enzyme less efficient especially under conditions of lower PEP concentrations. The Glycine100 of the LBAA EPSPS was converted to an Alanine and both the appKm for PEP and the appKi for glyphosate were determined for the variant. The Glycine100Alanine change was introduced by mutagenesis using the following primer:
| CGGCAATGCCGCCACCGGCGCGCGCC | (SEQ ID NO:34) |
and both the wild type and variant genes were expressed in E. coli in a RecA promoter expression vector (pMON17201 and pMON17264, respectively) and the appKm's and appKi's determined in crude lysates. The data indicate that the appKi(glyphosate) for the G100A variant is elevated about 16-fold (Table V). This result is in agreement with the observation of the importance of this G-A change in raising the appKi(glyphosate) in the Class I EPSPS enzymes. However, in contrast to the results in the Class I G-A variants, the appKm(PEP) in the Class II (LBAA) G-A variant is unaltered. This provides yet another distinction between the Class II and Class I EPSPS enzymes.
| TABLE V | ||||
| sppKi | ||||
| sppKm(PEP) | (glyphosate) | |||
| Lysato prepared from: | |||||
| E. coli/pMON17201 (wild | 5.3 μM | 28 | μM* | ||
| type) | |||||
| E. coli/pMON17264 | 5.5 μM | 459 | μM# | ||
| (G100A variant) | |||||
| @range of PEP; 2-40 μM | |||||
| *range of glyphosate; 0-310 μM; | |||||
| #range of glyphosate; 0-5000 μM. | |||||
The LBAA G100A variant, by virtue of its superior kinetic properties, should be capable of imparting improved in planta glyphosate tolerance.
Modification and Resynthesis of the Agrobacterium sp. strain CP4 EPSPS Gene Sequence
The EPSPS gene from Agrobacterium sp. strain CP4 contains sequences that could be inimical to high expression of the gene in plants. These sequences include potential polyadenylation sites that are often and A+T rich, a higher G+C % than that frequently found in plant genes (63% versus ˜50%), concentrated stretches of G and C residues, and codons that are not used frequently in plant genes. The high G+C % in the CP4 EPSPS gene has a number of potential consequences including the following: a higher usage of G or C than that found in plant genes in the third position in codons, and the potential to form strong hair-pin structures that may affect expression or stability of the RNA. The reduction in the G+C content of the CP4 EPSPS gene, the disruption of stretches of G's and C's, the elimination of potential polyadenylation sequences, and improvements in the codon usage to that used more frequently in plant genes, could result in higher expression of the CP4 EPSPS gene in plants.
A synthetic CP4 gene was designed to change as completely as possible those inimical sequences discussed above. In summary, the gene sequence was redesigned to eliminate as much as possible the following sequences or sequence features (while avoiding the introduction of unnecessary restriction sites): stretches of G's and C's of 5 or greater; and A+T rich regions (predominantly) that could function as polyadenylation sites or potential RNA destabilization region. The sequence of this gene is shown in FIG. 8 (SEQ ID NO:9). This coding sequence was expressed in E. coli from the RecA promoter and assayed for EPSPS activity and compared with that from the native CP4 EPSPS gene. The apparent Km for PEP for the native and synthetic genes was 11.8 and 12.7, respectively, indicating that the enzyme expressed from the synthetic gene was unaltered. The N-terminus of the coding sequence was mutagenized to place an SphI site at the ATG to permit the construction of the CTP2-CP4 synthetic fusion for chloroplast import. The following primer was used to accomplish this mutagenesis:
| (SEQ ID NO:35) |
| GGACCGCTGCTTGCACCGTGAAGCATGCTTAAGCTTGGCGTAATCATGG. |
Expression of Chloroplast Directed CP4 EPSPS
The glyphosate target in plants, the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) enzyme, is located in the chloroplast. Many chloroplast-localized proteins, including EPSPS, are expressed from nuclear genes as precursors and are targeted to the chloroplast by a chloroplast transit peptide (CTP) that is removed during the import steps. Examples of other such chloroplast proteins include the small subunit (SSU) of Ribulose-1,5-bisphosphate carboxylase (RUBISCO), Ferredoxia, Ferredoxin oxidoreductase, the Light-harvesting-complex protein I and protein II, and Thioredoxin F. It has been demonstrated in vivo and in vitro that non-chloroplast proteins may be targeted to the chloroplast by use of protein fusions with a CTP and that a CTP sequence is sufficient to target a protein to the chloroplast.
A CTP-CP4 EPSPS fusion was constructed between the Arabidopsis thaliana EPSPS CTP (Klee et al., 1987) and the CP4 EPSPS coding sequences. The Arabidopsis CTP was engineered by site-directed mutagenesis to place a SphI restriction site at the CTP processing site. This mutagenesis replaced the Glu-Lys at this location with Cys-Met. The sequence of this CTP, designated as CTP2 (SEQ ID NO:10), is shown in FIG. 9. The N-terminus of the CP4 EPSPS gene was modified to place a SphI site that spans the Met codon. The second codon was converted to one for leucine in this step also. This change had no apparent effect on the in vivo activity of CP4 EPSPS in E. coli as judged by rate of complementation of the aroA allele. This modified N-terminus was then combined with the SacI C-terminus and cloned downstream of the CTP2 sequences. The CTP2-CP4 EPSPS fusion was cloned into pBlueScript KS(+). This vector may be transcribed in vitro using the T7 polymerase and the RNA translated with 35S-Methionine to provide material that may be evaluated for import into chloroplasts isolated from Lactuca sativa using the methods described hereinafter (della-Cioppa et al., 1986, 1987). This template was transcribed in vitro using T7 polymerase and the 35S-methionine-labeled CTP2-CP4 EPSPS material was shown to import into chloroplasts with an efficiency comparable to that for the control Petunia EPSPS (control=35S labeled PreEPSPS [pMON6140; della-Cioppa et al., 1986]).
In another example the Arabidopsis EPSPS CTP, designated as CTP3, was fused to the CP4 EPSPS through an EcoRI site. The sequence of this CTP3 (SEQ ID NO:12) is shown in FIG. 10. An EcoRI site was introduced into the Arabidopsis EPSPS mature region around amino acid 27, replacing the sequence -Arg-Ala-Leu-Leu- with -Arg-Ile-Leu-Leu- in the process. The primer of the following sequence was used to modify the N-terminus of the CP4 EPSPS gene to add an EcoRI site to effect the fusion to the
| CTG3: GGAAGACGCCCAGATTCACGGTGCAAGCAGCCGG | |
| (the EcoRI site is underlined) (SEQ ID NO:36) |
This CTP3-CP4 EPSPS fusion was also cloned into the pBlueScript vector and the T7 expressed fusion was found to also import into chloroplasts with an efficiency comparable to that for the control Petunia EPSPS (pMON6140).
A related series of CTPs, designated as CTP4 (SphI) and CTP5 (EcoRI), based on the Petunia EPSPS CTP and gene were also fused to the SphI- and EcoRI-modified CP4 EPSPS gene sequences. The SphI site was added by site-directed mutagenesis to place this restriction site (and change the amino acid sequence to -Cys-Met-) at the chloroplast processing site. All of the CTP-CP4 EPSPS fusions were shown to import into chloroplasts with approximately equal efficiency. The CTP4 (SEQ ID NO:14) and CTP5 (SEQ ID NO:16) sequences are shown in FIGS. 11 and 12 .
A CTP2-LBAA EPSPS fusion was also constructed following the modification of the N-terminus of the LBAA EPSPS gene by the addition of a SphI site. This fusion was also found to be imported efficiently into chloroplasts.
By similar approaches, the CTP2-CP4 EPSPS and the CTP4-CP4 EPSPS fusion have also been shown to import efficiently into chloroplasts prepared from the leaf sheaths of corn. These results indicate that these CTP-CP4 fusions could also provide useful genes to impart glyphosate tolerance in monocot species.
The use of CTP2 or CTP4 is preferred because these transit peptide constructions yield mature EPSPS enzymes upon import into the chloroplast which are closer in composition to the native EPSPSs not containing a transit peptide signal. Those skilled in the art will recognize that various chimeric constructs can be made which utilize the functionality of a particular CTP to import a Class II EPSPS enzyme into the plant cell chloroplast. The chloroplast import of the Class II EPSPS can be determined using the following assay.
Chloroplast Uptake Assay
Intact chloroplasts are isolated from lettuce (Latuca sativa, var. longifolia) by centrifugation in Percoll/ficoll gradients as modified from Bartlett et al., (1982). The final pellet of intact chloroplasts is suspended in 0.5 ml of sterile 330 mM sorbitol in 50 mM Hepes-KOH, pH 7.7, assayed for chlorophyll (Arnon, 1949), and adjusted to the final chlorophyll concentration of 4 mg/ml (using sorbitol/Hepes). The yield of intact chloroplasts from a single head of lettuce is 3-6 mg chlorophyll.
A typical 300 μl uptake experiment contained 5 mM ATP, 8.3 mM unlabeled methionine, 322 mM sorbitol, 58.3 mM Hepes-KOH (pH 8.0), 50 μl reticulocyte lysate translation products, and intact chloroplasts from L. sativa (200 μg chlorophyll). The uptake mixture is gently rocked at room temperature (in 10×75 mm glass tubes) directly in front of a fiber optic illuminator set at maximum light intensity (150 Watt bulb). Aliquot samples of the uptake mix (about 50 μl) are removed at various times and fractionated over 100 μl silicone-oil gradients (in 150 μl polyethylene tubes) by centrifugation at 11,000× g for 30 seconds. Under these conditions, the intact chloroplasts form a pellet under the silicone-oil layer and the incubation medium (containing the reticulocyte lysate) floats on the surface. After centrifugation, the silicone-oil gradients are immediately frozen in dry ice. The chloroplast pellet is then resuspended in 50-100 μl of lysis buffer (10 mM Hepes-KOH pH 7.5, 1 mM PMSF, 1 mM benzamidine, 5 mM e-amino-n-caproic acid, and 30 μg/ml aprotinin) and centrifuged at 15,000× g for 20 minutes to pellet the thylakoid membranes. The clear supernatant (stromal proteins) from this spin, and an aliquot of the reticulocyte lysate incubation medium from each uptake experiment, are mixed with an equal volume of 2×SDS-PAGE sample buffer for electrophoresis (Laemmli, 1970).
SDS-PAGE is carried out according to Laemmli (1970) in 3-17% (w/v) acrylamide slab gels (60 mm×1.5 mm) with 3% (w/v) acrylamide stacking gels (5 mm×1.5 mm). The gel is fixed for 20-30 rain in a solution with 40% methanol and 10% acetic acid. Then, the gel is soaked in EN3HANCE™ (DuPont) for 20-30 minutes, followed by drying the gel on a gel dryer. The gel is imaged by autoradiography, using an intensifying screen and an overnight exposure to determine whether the CP4 EPSPS is imported into the isolated chloroplasts.
Plant Transformation
Plants which can be made glyphosate-tolerant by practice of the present invention include, but are not limited to, soybean, cotton, corn, canola, oil seed rape, flax, sugarbeet, sunflower, potato, tobacco, tomato, wheat, rice, alfalfa and lettuce as well as various tree, nut and vine species.
A double-stranded DNA molecule of the present invention (“chimeric gene”) can be inserted into the genome of a plant by any suitable method. Suitable plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed, e.g., by Herrera-Estrella (1983), Beyart (1984), Klee (1985) and EPO publication 120,516 (Schilperoort et al.). In addition to plant transformation vectors derived from the Ti or root-inducing (Ri) plasmids of Agrobacterium, alternative methods can be used to insert the DNA constructs of this invention into plant cells. Such methods may involve, for example, the use of liposomes, electroporation, chemicals that increase free DNA uptake, free DNA delivery via microprojectile bombardment, and transformation using viruses or pollen.
Class II EPSPS Plant transformation vectors
Class II EPSPS DNA sequences may be engineered into vectors capable of transforming plants by using known techniques. The following description is meant to be illustrative and not to be read in a limiting sense. One of ordinary skill in the art would know that other plasmids, vectors, markers, promoters, etc. would be used with suitable results. The CTP2-CP4 EPSPS fusion was cloned as a BglII-EcoRI fragment into the plant vector pMON979 (described below) to form pMON17110, a map of which is presented in FIG. 13. In this vector the CP4 gene is expressed from the enhanced CaMV35S promoter (E35S; Kay et al. 1987). A FMV35S promoter construct (pMON17116) was completed in the following way: The SaII-NotI and the NotI-BglII fragments from pMON979 containing the Spc/AAC(3)-III/oriV and the pBR322/Right Border/NOS 3′/CP4 EPSPS gene segment from pMON17110 were ligated with the XhoI-BglII FMV35S promoter fragment from pMON981. These vectors were introduced into tobacco, cotton and canola.
A series of vectors was also completed in the vector pMON977 in which the CP4 EPSPS gene, the CTP2-CP4 EPSPS fusion, and the CTP3-CP4 fusion were cloned as BglII-SacI fragments to form pMON17124, pMON17119, and pMON17120, respectively. These plasmids were introduced into tobacco. A pMON977 derivative containing the CTP2-LBAA EPSPS gene was also completed (pMON17206) and introduced into tobacco.
The pMON979 plant transformation/expression vector was derived from pMON886 (described below) by replacing the neomycin phosphotransferase typeII (KAN) gene in pMON886 with the 0.89 kb fragment containing the bacterial gentamicin-3-N-acetyltransferase type III (AAC(3)-III) gene (Hayford et al., 1988). The chimeric P-35S/AA(3)-III/NOS 3′ gene encodes gentamicin resistance which permits selection of transformed plant cells. pMON979 also contains a 0.95 kb expression cassette consisting of the enhanced CaMV 35S promoter (Kay et al., 1987), several unique restriction sites, and the NOS 3′ end (P-En-CaMV35SfNOS 3′). The rest of the pMON979 DNA segments are exactly the same as in pMON886.
Plasmid pMON886 is made up of the following segments of DNA. The first is a 0.93 kb AvaI to engineered-EcoRV fragment isolated from transposon Tn7 that encodes bacterial spectinomycin/streptomycin resistance (Spc/Str), which is a determinant for selection in E. coli and Agrobacterium tumefaciens. This is joined to the 1.61 kb segment of DNA encoding a chimeric kanamycin resistance which permits selection of transformed plant cells. The chimeric gene (P-35S/KANfNOS 3′) consists of the cauliflower mosaic virus (CaMV) 35S promoter, the neomycin phosphotransferase typeII (KAN) gene, and the 3′-nontranslated region of the nopaline synthase gene (NOS 3′) (Fraley et al., 1983). The next segment is the 0.75 kb oriV containing the origin of replication from the RK2 plasmid. It is joined to the 3.1 kb SalI to PvuI segment of pBR322 (ori322) which provides the origin of replication for maintenance in E. coli and the bom site for the conjugational transfer into the Agrobacterium tumefaciens cells. The next segment is the 0.36 kb PvuI to BclI from pTiT37 that carries the nopaline-type T-DNA right border (Fraley et al., 1985).
The pMON977 vector is the same as pMON981 except for the presence of the P-En-CaMV35S promoter in place of the FMV35S promoter (see below).
The pMON981 plasmid contains the following DNA segments: the 0.93 kb fragment isolated from transposon Tn7 encoding bacterial spectinomycin/streptomycin resistance [Spc/Str; a determinant for selection in E. coli and Agrobacterium tumefaciens (Fling et al., 1985)]; the chimeric kanamycin resistance gene engineered for plant expression to allow selection of the transformed tissue, consisting of the 0.35 kb cauliflower mosaic virus 35S promoter (P-35S) (Odell et al., 1985), the 0.83 kb neomycin phosphotransferase typeII gene (KAN), and the 0.26 kb 3′-nontranslated region of the nopaline synthase gene (NOS 3′) (Fraley et al., 1983); the 0.75 kb origin of replication from the RK2 plasmid (oriV) (Stalker et al., 1981); the 3.1 kb SalI to PvuI segment of pBR322 which provides the origin of replication for maintenance in E. coli (ori-322) and the bom site for the conjugational transfer into the Agrobacterium tumefaciens cells, and the 0.36 kb PvuI to BclI fragment from the pTiT37 plasmid containing the nopaline-type T-DNA right border region (Fraley et al., 1985). The expression cassette consists of the 0.6 kb 35S promoter from the figwort mosaic virus (P-FMV35S) (Gowda et al., 1989) and the 0.7 kb 3′ non-translated region of the pea rbcS-E9 gene (E9 3′) (Coruzzi et al., 1984, and Morelli et al., 1985). The 0.6 kb SspI fragment containing the FMV35S promoter (FIG. 1 ) was engineered to place suitable cloning sites downstream of the transcriptional start site. The CTP2-CP4syn gene fusion was introduced into plant expression vectors (including pMON981, to form pMON17131; FIG. 14 ) and transformed into tobacco, canola, potato, tomato, sugarbeet, cotton, lettuce, cucumber, oil seed rape, poplar, and Arabidopsis.
The plant vector containing the Class II EPSPS gene may be mobilized into any suitable Agrobacterium strain for transformation of the desired plant species. The plant vector may be mobilized into an ABI Agrobacterium strain. A suitable ABI strain is the A208 Agrobacterium tumefaciens carrying the disarmed Ti plasmid pTiC58 (pMP90RK) (Koncz and Schell, 1986). The Ti plasmid does not carry the T-DNA phytohormone genes and the strain is therefore unable to cause the crown gall disease. Mating of the plant vector into ABI was done by the triparental conjugation system using the helper plasmid pRK2013 (Ditta et al., 1980). When the plant tissue is incubated with the ABI::plant vector conjugate, the vector is transferred to the plant cells by the vir functions encoded by the disarmed pTiC58 plasmid. The vector opens at the T-DNA right border region, and the entire plant vector sequence may be inserted into the host plant chromosome. The pTiC58 Ti plasmid does not transfer to the plant cells but remains in the Agrobacterium. Class II EPSPS free DNA vectors
Class II EPSPS genes may also be introduced into plants through direct delivery methods. A number of direct delivery vectors were completed for the CP4 EPSPS gene. The vector pMON13640, a map of which is presented in FIG. 15 , is described here. The plasmid vector is based on a pUC plasmid (Vieira and Messing, 1987) containing, in this case, the nptII gene (kanamycin resistance; KAN) from Tn903 to provide a selectable marker in E. coli. The CTP4-EPSPS gene fusion is expressed from the P-FMV35S promoter and contains the NOS 3′ polyadenylation sequence fragment and from a second cassette consisting of the E35S promoter, the CTP4-CP4 gene fusion and the NOS 3′ sequences. The scoreable GUS marker gene (Jefferson et al., 1987) is expressed from the mannopine synthase promoter (P-MAS; Velten et al., 1984) and the soybean 7S storage protein gene 3′ sequences (Schuler et al., 1982). Similar plasmids could also be made in which CTP-CP4 EPSPS fusions are expressed from the enhanced CaMV35S promoter or other plant promoters. Other vectors could be made that are suitable for free DNA delivery into plants and such are within the skill of the art and contemplated to be within the scope of this disclosure.
Plastid transformation:
While transformation of the nuclear genome of plants is much more developed at this time, a rapidly advancing alternative is the transformation of plant organelles. The transformation of plastids of land plants and the regeneration of stable transformants has been demonstrated (Svab et al., 1990; Maliga et al., 1993). Transformants are selected, following double cross-over events into the plastid genome, on the basis of resistance to spectinomycin conferred through rRNA changes or through the introduction of an aminoglycoside 3″-adenyltransferase gene (Svab et al., 1990; Svab and Maliga, 1993), or resistance to kanamycin through the neomycin phosphotransferase NptII (Carrer et al., 1993). DNA is introduced by biolistic means (Svab et al, 1990; Maliga et al., 1993) or by using polyethylene glycol (O'Neill et al., 1993). This transformation route results in the production of 500-10,000 copies of the introduced sequence per cell and high levels of expression of the introduced gene have been reported (Carrer et al., 1993; Maliga et al., 1993). The use of plastid transformation offers the advantages of not requiring the chloroplast transit peptide signal sequence to result in the localization of the heterologous Class II EPSPS in the chloroplast and the potential to have many copies of the heterologous plant-expressible Class II EPSPS gene in each plant cell since at least one copy of the gene would be in each plastid of the cell.
Plant Regeneration
When expression of the Class II EPSPS gene is achieved in transformed cells (or protoplasts), the cells (or protoplasts) are regenerated into whole plants. Choice of methodology for the generation step is not critical, with suitable protocols being available for hosts from Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, rapeseed, etc.), Cucurbitaceae (melons and cucumber), Gramineae (wheat, rice, corn, etc.), Solanaceae (potato, tobacco, tomato, peppers), various floral crops as well as various trees such as poplar or apple, nut crops or vine plants such as grapes. See, e.g., Ammirato, 1984; Shimamoto, 1989; Fromm, 1990; Vasil, 1990.
The following examples are provided to better elucidate the practice of the present invention and should not be intrepreted in any way to limit the scope of the present invention. Those skilled in the art will recognize that various modifications, truncations, etc. can be made to the methods and genes described herein while not departing from the spirit and scope of the present invention.
In the examples that follow, EPSPS activity in plants is assayed by the following method. Tissue samples were collected and immediately frozen in liquid nitrogen. One gram of young leaf tissue was frozen in a mortar with liquid nitrogen and ground to a fine powder with a pestle. The powder was then transferred to a second mortar, extraction buffer was added (1 ml/gram), and the sample was ground for an additional 45 seconds. The extraction buffer for canola consists of 100 mM Tris, 1 mM EDTA, 10% glycerol, 5 mM DTT, 1 mM BAM, 5 mM ascorbate, 1.0 mg/ml BSA, pH 7.5 (4° C.). The extraction buffer for tobacco consists of 100 mM Tris, 10 mM EDTA, 35 mM KCl, 20% glycerol, 5 mM DTT, 1 mM BAM, 5 mM ascorbate, 1.0 mg/ml BSA, pH 7.5 (4° C.). The mixture was transferred to a microfuge tube and centrifuged for 5 minutes. The resulting supernatants were desalted on spin G-50 (Pharmacia) columns, previously equilibrated with extraction buffer (without BSA), in 0.25 ml aliquots. The desalted extracts were assayed for EPSP synthase activity by radioactive HPLC assay. Protein concentrations in samples were determined by the BioRad microprotein assay with BSA as the standard.
Protein concentrations were determined using the BioRad Microprotein method, BSA was used to generate a standard curve ranging from 2-24 μg. Either 800 μl of standard or diluted sample was mixed with 200 μl of concentrated BioRad Bradford reagent. The samples were vortexed and read at A(595) after ˜5 minutes and compared to the standard curve.
EPSPS enzyme assays contained HEPES (50 mM), shikimate-3-phosphate (2 mM), NH4 molybdate (0.1 mM) and KF (5 mM), with or without glyphosate (0.5 or 1.0 mM). The assay mix (30 μl) and plant extract (10 μl) were preincubated for 1 minute at 25° C. and the reactions were initiated by adding 14C-PEP (1 mM). The reactions were quenched after 3 minutes with 50 μl of 90% EtOH/0.1M HOAc, pH 4.5. The samples were spun at 6000 rpm and the resulting supernatants were analyzed for 14C-EPSP production by HPLC. Percent resistant EPSPS is calculated from the EPSPS activities with and without glyphosate.
The percent conversion of 14C labeled PEP to 14C EPSP was determined by HPLC radioassay using a C18 guard column (Brownlee) and an AX100 HPLC column (0.4×25 cm, Synchropak) with 0.28M isocratic potassium phosphate eluant, pH 6.5, at 1 ml/min. Initial velocities were calculated by multiplying fractional turnover per unit time by the initial concentration of the labeled substrate (1 mM). The assay was linear with time up to ˜3 minutes and 30% turnover to EPSPS. Samples were diluted with 10 mM Tris, 10% glycerol, 10 mM DTT, pH 7.5 (4° C.) if necessary to obtain results within the linear range.
In these assays DL-dithiotheitol (DTT), benzamidine (BAM), and bovine serum albumin (BSA, essentially globulin free) were obtained from Sigma. Phosphoenolpyruvate (PEP) was from Boehringer Mannheim and phosphoenol[1-14C]pyruvate (28 mCi/mmol) was from Amersham.
Transformed tobacco plants have been generated with a number of the Class II EPSPS gene vectors containing the CP4 EPSPS DNA sequence as described above with suitable expression of the EPSPS. These transformed plants exhibit glyphosate tolerance imparted by the Class II CP4 EPSPS.
Transformation of tobacco employs the tobacco leaf disc transformation protocol which utilizes healthy leaf tissue about 1 month old. After a 15-20 minutes surface sterilization with 10% Clorox plus a surfactant, the leaves are rinsed 3 times in sterile water. Using a sterile paper punch, leaf discs are punched and placed upside down on MS104 media (MS salts 4.3 g/l, sucrose 30 g/l, B5vitamins 500×2 ml/l, NAA 0.1 mg/l, and BA 1.0 mg/l) for a 1 day preculture.
The discs are then inoculated with an overnight culture of a disarmed Agrobacterium ABI strain containing the subject vector that had been diluted 1/5 (i.e.: about 0.6 OD). The inoculation is done by placing the discs in centrifuge tubes with the culture. After 30 to 60 seconds, the liquid is drained off and the discs were blotted between sterile filter paper. The discs are then placed upside down on MS104 feeder plates with a filter disc to co-culture.
After 2-3 days of co-culture, the discs are transferred, still upside down, to selection plates with MS104 media. After 2-3 weeks, callus tissue formed, and individual clumps are separated from the leaf discs. Shoots are cleanly cut from the callus when they are large enough to be distinguished from stems. The shoots are placed on hormone-free rooting media (MSO: MS salts 4.3 g/l, sucrose 30 g/l, and B5 vitamins 500×2 ml/l) with selection for the appropriate antibiotic resistance. Root formation occurred in 1-2 weeks. Any leaf callus assays are preferably done on rooted shoots while still sterile. Rooted shoots are then placed in soil and kept in a high humidity environment (i.e.: plastic containers or bags). The shoots are hardened off by gradually exposing them to ambient humidity conditions.
Expression of CP4 EPSPS protein in transformed plants
Tobacco cells were transformed with a number of plant vectors containing the native CP4 EPSPS gene, and using different promoters and/or CTP's. Preliminary evidence for expression of the gene was given by the ability of the leaf tissue from antibiotic selected transformed shoots to recallus on glyphosate. In some cases, glyphosate-tolerant callus was selected directly following transformation. The level of expression of the CP4 EPSPS was determined by the level of glyphosate-tolerant EPSPS activity (assayed in the presence of 0.5 mM glyphosate) or by Western blot analysis using a goat anti-CP4 EPSPS antibody. The Western blots were quantitated by densitometer tracing and comparison to a standard curve established using purified CP4 EPSPS. These data are presented as % soluble leaf protein. The data from a number of transformed plant lines and transformation vectors are presented in Table VI below.
| TABLE VI |
| Expression of CP4 EPSPS in transformed tobacco tissue |
| CP4 EPSPS** | ||||
| Vector | Plant # | (% leaf protein) | ||
| pMON17110 | 25313 | 0.02 | ||
| pMON17110 | 25329 | 0.04 | ||
| pMON17116 | 25095 | 0.02 | ||
| pMON17119 | 25106 | 0.09 | ||
| pMON17119 | 25762 | 0.09 | ||
| pMON17119 | 25767 | 0.03 | ||
| **Glyphosate-tolerant EPSPS activity was also demonstrated in leaf extracts for these plants. | ||||
Glyphosate tolerance has also been demonstrated at the whole plant level in transformed tobacco plants. In tobacco, Ro transformants of CTP2-CP4 EPSPS were sprayed at 0.4 lb/acre (0.448 kg/hectare), a rate sufficient to kill control non-transformed tobacco plants corresponding to a rating of 3, 1 and 0 at days 7, 14 and 28, respectively, and were analyzed vegetatively and reproductively (Table VII).
| TABLE VII |
| Glyphosate tolerance in Ro tobacco CP4 transformants* |
| Score** |
| Vegetative |
| Vector/Plant # | day 7 | day 14 | day 28 | Fertile | ||
| pMON17110/25313 | 6 | 4 | 2 | no | ||
| pMON17110/25329 | 9 | 10 | 10 | yes | ||
| pMON17119/25106 | 9 | 9 | 10 | yes | ||
| *Spray rate = 0.4 lb/acre (0.448 kg/hectare) | ||||||
| **Plants are evaluated on a numerical scoring system of 0-10 where a vegetative score of 10 represents no damage relative to nonsprayed controls and 0 represents a dead plant. Reproductive scores (Fertile) are determined at 28 days after spraying and are evaluated as to whether or not the plant is fertile. | ||||||
Canola plants were transformed with the pMON17110, pMON17116, and pMON17131 vectors and a number of plant lines of the transformed canola were obtained which exhibit glyphosate tolerance.
Plant Material
Seedlings of Brassica napus cv Westar were established in 2 inch (˜5 cm) pots containing Metro Mix 350. They were grown in a growth chabmer at 24° C., 16/8 hour photoperiod, light intensity of 400 μEm−2sec−1 (HID lamps). They were fertilized with Peters 20-10-20 General Purpose Special. After 2½ weeks they were transplanted to 6 inch (˜15 cm) pots and grown in a growth chamber at 15°/10° C. day/night temperature, 16/8 hour photoperiod, light intensity of 800 uEm−2sec−1 (HID lamps). They were fertilized with Peters 15-30-15 Hi-Phos Special.
Transformation/Selection/Regeneration
Four terminal internodes from plants just prior to bolting or in the process of bolting but before flowering were removed and surfaced sterilized in 70% v/v ethanol for 1 minute, 2% w/v sodium hypochlorite for 20 minutes and rinsed 3 times with sterile deionized water. Stems with leaves attached could be refrigerated in moist plastic bags for up to 72 hours prior to sterilization. Six to seven stem segments were cut into 5 mm discs with a Redco Vegetable Slicer 200 maintaining orientation of basal end.
The Agrobacterium was grown overnight on a rotator at 24° C. in 2 mls of Luria Broth containing 50 mg/l kanamycin, 24 mg/l chloramphenicol and 100 mg/l spectinomycin. A 1:10 dilution was made in MS (Murashige and Skoog) media giving approximately 9×108 cells per ml. This was confirmed with optical density readings at 660 mu. The stem discs (explants) were inoculated with 1.0 ml of Agrobacterium and the excess was aspirated from the explants.
The explants were placed basal side down in petri plates containing 1/10× standard MS salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 1.0 mg/l 6-benzyladenine (BA). The plates were layered with 1.5 ml of media containing MS salts, B5 vitamins, 3% sucrose, pH 5.7, 4.0 mg/l p-chlorophenoxyacetic acid, 0.005 mg/l kinetin and covered with sterile filter paper.
Following a 2 to 3 day co-culture, the explants were transferred to deep dish petri plates containing MS salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 1 mg/l BA, 500 mg/l carbenicillin, 50 mg/l cefotaxime, 200 mg/l kanamycin or 175 mg/l gentamicin for selection. Seven explants were placed on each plate. After 3 weeks they were transferred to fresh media, 5 explants per plate. The explants were cultured in a growth room at 25° C., continuous light (Cool White).
Expression Assay
After 3 weeks shoots were excised from the explants. Leaf recallusing assays were initiated to confirm modification of Ro shoots. Three tiny pieces of leaf tissue were placed on recallusing media containing MS salts, B5 vitamins, 3% sucrose, 0.8% agar, pH 5.7, 5.0 mg/l BA, 0.5 mg/l naphthalene acetic acid (NAA), 500 mg/l carbenicillin, 50 mg/l cefotaxime and 200 mg/l kanamycin or gentamicin or 0.5 mM glyphosate. The leaf assays were incubated in a growth room under the same conditions as explant culture. After 3 weeks the leaf recallusing assays were scored for herbicide tolerance (callus or green leaf tissue) or sensitivity (bleaching).
Transplantation
At the time of excision, the shoot stems were dipped in Rootone® and placed in 2 inch (˜5 cm) pots containing Metro-Mix 350 and placed in a closed humid environment. They were placed in a growth chamber at 24° C., 16/8 hour photoperiod, 400 uEm−1sec−2(HID lamps) for a hardening-off period of approximately 3 weeks.
The seed harvested from Ro plants is R1 seed which gives rise to R1 plants. To evaluate the glyphosate tolerance of an Ro plant, its progeny are evaluated. Because an Ro plant is assumed to be hemizygous at each insert location, selfing results in maximum genotypic segregation in the R1. Because each insert acts as a dominant allele, in the absence of linkage and assuming only one hemizygous insert is required for tolerance expression, one insert would segregate 3:1, two inserts, 15:1, three inserts 63:1, etc. Therefore, relatively few R1 plants need be grown to find at least one resistant phenotype.
Seed from an Ro plant is harvested, threshed, and dried before planting in a glyphosate spray test. Various techniques have been used to grow the plants for R1 spray evaluations. Tests are conducted in both greenhouses and growth chambers. Two planting systems are used; ˜10 cm pots or plant trays containing 32 or 36 cells. Soil used for planting is either Metro 350 plus three types of slow release fertilizer or plant Metro 350. Irrigation is either overhead in greenhouses or sub-irrigation in growth chambers. Fertilizer is applied as required in irrigation water. Temperature regimes appropriate for canola were maintained. A sixteen hour photoperiod was maintained. At the onset of flowering, plants are transplanted to ˜15 cm pots for seed production.
A spray “batch” consists of several sets of R1 progenies all sprayed on the same date. Some batches may also include evaluations of other than R1 plants. Each batch also includes sprayed and unsprayed non-transgenic genotypes representing the genotypes in the particular batch which were putatively transformed. Also included in a batch is one or more non-segregating transformed genotypes previously identified as having some resistance.
Two-six plants from each individual Ro progeny are not sprayed and serve as controls to compare and measure the glyphosate tolerance, as well as to assess any variability not induced by the glyphosate. When the other plants reach the 2-4 leaf stage, usually 10 to 20 days after planting, glyphosate is applied at rates varying from 0.28 to 1.12 kg/ha, depending on objectives of the study. Low rate technology using low volumes has been adopted. A laboratory track sprayer has been calibrated to deliver a rate equivalent to field conditions.
A scale of 0 to 10 is used to rate the sprayed plants for vegetative resistance. The scale is relative to the unsprayed plants from the same Ro plant. A 0 is death, while a 10 represents no visible difference from the unsprayed plant. A higher number between 0 and 10 represents progressively less damage as compared to the unsprayed plant. Plants are scored at 7, 14, and 28 days after treatment (DAT), or until bolting, and a line is given the average score of the sprayed plants within an Ro plant family.
Six integers are used to qualitatively describe the degree of reproductive damage from glyphosate:
0: No floral bud development
2: Floral buds present, but aborted prior to opening
4: Flowers open, but no anthers, or anthers fail to extrude past petals
6: Sterile anthers
8: Partially sterile anthers
10: Fully fertile flowers
Plants are scored using this scale at or shortly after initiation of flowering, depending on the rate of floral structure development.
Expression of EPSPS in Canola
After the 3 week period, the transformed canola plants were assayed for the presence of glyphosate-tolerant EPSPS activity (assayed in the presence of glyphosate at 0.5 mM). The results are shown in Table VIII.
| TABLE VIII |
| Expression of CP4 EPSPS in transformed Canola plants |
| % resistant EPSPS activity | |||
| of Leaf extract | |||
| Plant # | (at 0.5 mM glyphosate) | ||
| Vector Control | 0 | |||
| |
41 | 47 | ||
| pMON17110 | 52 | 28 | ||
| pMON17110 | 71 | 82 | ||
| pMON17110 | 104 | 75 | ||
| pMON17110 | 172 | 84 | ||
| pMON17110 | 177 | 85 | ||
| pMON17110 | 252 | 29* | ||
| |
350 | 49 | ||
| |
40 | 25 | ||
| pMON17116 | 99 | 87 | ||
| |
175 | 94 | ||
| pMON17116 | 178 | 43 | ||
| pMON17116 | 182 | 18 | ||
| pMON17116 | 252 | 69 | ||
| |
298 | 44* | ||
| pMON17116 | 332 | 89 | ||
| pMON17116 | 383 | 97 | ||
| |
395 | 52 | ||
| *assayed in the presence of 1.0 mM glyphosate | ||||
R1 transformants of canola were then grown in a growth chamber and sprayed with glyphosate at 0.56 kg/ha (kilogram/hectare) and rated vegetatively. These results are shown in Table IXA-IXC. It is to be noted that expression of glyphosate resistant EPSPS in all tissues is preferred to observe optimal glyphosate tolerance phenotype in these transgenic plants. In the Tables below, only expression results obtained with leaf tissue are described.
| TABLE IXA |
| Glyphosate tolerance in Class II EPSPS |
| canola R1 transformants |
| (pMON17110 = P-E35S; pMON17116 = P-FMV35S; R1 plants; |
| Spray rate = 0.56 kg/ha) |
| Vegetative | |||
| % resistant | Score** |
| Vector/Plant No. | EPSPS* | day 7 | day 14 | ||
| Control Westar | 0 | 5 | 3 | ||
| pMON17110/41 | 47 | 6 | 7 | ||
| pMON17110/71 | 82 | 6 | 7 | ||
| pMON17110/177 | 85 | 9 | 10 | ||
| pMON17116/40 | 25 | 9 | 9 | ||
| pMON17116/99 | 87 | 9 | 10 | ||
| pMON17116/175 | 94 | 9 | 10 | ||
| pMON17116/178 | 43 | 6 | 3 | ||
| pMON17116/182 | 18 | 9 | 10 | ||
| pMON17116/383 | 97 | 9 | 10 | ||
| TABLE IXB |
| Glyphosate tolerance in Class II EPSPS |
| canola R1 transformants |
| (pMON17131 = P-FWV35S; R1 plants; Spray rate = 0.84 kg/ha) |
| Vegetative score** | Reproductive score | |||
| Vector/Plant No. | day 14 | day 28 | ||
| 17131/78 | 10 | 10 | ||
| 17131/102 | 9 | 10 | ||
| 17131/115 | 9 | 10 | ||
| 17131/116 | 9 | 10 | ||
| 17131/157 | 9 | 10 | ||
| 17131/169 | 10 | 10 | ||
| 17131/255 | 10 | 10 | ||
| |
1 | 0 | ||
| TABLE IXC |
| Glyphosate tolerance in Class I EPSPS |
| canola transformants |
| (P-E35S; R2 Plants; Spray rate = 0.28 kg/ha) |
| Vegetative | |||
| % resistant | Score** |
| Vector/Plant No. | EPSPS* | day 7 | day 14 | ||
| Control Westar | 0 | 4 | 2 | ||
| pMON899/715 | 96 | 5 | 6 | ||
| pMON899/744 | 95 | 8 | 8 | ||
| pMON899/794 | 86 | 6 | 4 | ||
| pMON899/818 | 81 | 7 | 8 | ||
| pMON899/885 | 57 | 7 | 6 | ||
| *% resistant EPSPS activity in the presence of 0.5 mM glyphosate | |||||
| **A vegetative score of 10 indicates no damage, a score of 0 is given to a dead plant. | |||||
The data obtained for the Class II EPSPS transformants may be compared to glyphosate-tolerant Class I EPSP transformants in which the same promoter is used to express the EPSPS genes and in which the level of glyphosate-tolerant EPSPS activity was comparable for the two types of transformants. A comparison of the data of pMON17110 [in Table IXA] and pMON17131 [Table IXB] with that for pMON899 [in Table IXC; the Class I gene in pMON899 is that from A. thaliana {Klee et al., 1987} in which the glycine at position 101 was changed to an alanine] illustrates that the Class II EPSPS is at least as good as that of the Class I EPSPS. An improvement in vegetative tolerance of Class II EPSPS is apparent when one takes into account that the Class II plants were sprayed at twice the rate and were tested as R1 plants.
The construction of two plant transformation vectors and the transformation procedures used to produce glyphosate-tolerant canola plants are described in this example The vectors, pMON17209 and pMON17237, were used to generate transgenic glyphosate-tolerant canola lines. The vectors each contain the gene encoding the 5-enol-pyruvyl-shikimate-3-phosphate synthase (EPSPS) from Agrobacterium sp. strain CP4. The vectors also contain either the gox gene encoding the glyphosate oxidoreductase enzyme (GOX) from Achromobacter sp. strain LBAA (Barry et al., 1992) or the gene encoding a variant of GOX (GOX v.247) which displays improved catalytic properties. These enzymes convert glyphosate to aminomethylphosphonic acid and glyoxylate and protect the plant from damage by the metabolic inactivation of glyphosate. The combined result of providing an alternative, resistant EPSPS enzyme and the metabolism of glyphosate produces transgenic plants with enhanced tolerance to glyphosate
Molecular biology techniques. In general, standard molecular biology and microbial genetics approaches were employed (Maniatis et al., 1982). Site-directed mutageneses were carried out as described by Kunkel et al. (1987). Plant-preferred genes were synthesized and the sequence confirmed.
Plant transformation vectors. The following describes the general features of the plant transformation vectors that were modified to form vectors pMON17209 and pMON17237. The Agrobacterium mediated plant transformation vectors contain the following well-characterized DNA segments which are required for replication and function of the plasmids (Rogers and Klee, 1987; Klee and Rogers, 1989). The first segment is the 0.45 kb ClaI-DraI fragment from the pTi15955 octopine Ti plasmid which contains the T-DNA left border region (Barker et al., 1983). It is joined to the 0.75 kb origin of replication (oriV) derived from the broad-host range plasmid RK2 (Stalker et al., 1981). The next segment is the 3.1 kb SalI-PvuI segment of pBR322 which provides the origin of replication for maintenance in E. coli and the born site for the conjugational transfer into the Agrobacterium turnefaciens cells (Bolivar et al., 1977). This is fused to the 0.93 kb fragment isolated from transposon Tn7 which encodes bacterial spectinomycin and streptomycin resistance (Fling et al., 1985), a determinant for the selection of the plasmids in E. coli and Agrobacterium. It is fused to the 0.36 kb PvuI-BclI fragment from the pTiT37 plasmid which contains the nopaline-type T-DNA right border region (Fraley et al., 1985). Several chimeric genes engineered for plant expression can be introduced between the Ti right and left border regions of the vector. In addition to the elements described above, this vector also includes the 35S promoter/NPTII/NOS 3′ cassette to enable selection of transformed plant tissues on kanamycin (Klee and Rogers, 1989; Fraley et al., 1983; and Odell, et al., 1985) within the borders. An “empty” expression cassette is also present between the borders and consists of the enhanced E35S promoter (Kay et al., 1987), the 3′ region from the small subunit of RUBP carboxylase of pea (E9) (Coruzzi et al., 1984; Morelli et al., 1986), and a number of restriction enzyme sites that may be used for the cloning of DNA sequences for expression in plants. The plant transformation system based on Agrobacterium tumefaciens delivery has been reviewed (Klee and Rogers, 1989; Fraley et al., 1986). The Agrobacterium mediated transfer and integration of the vector T-DNA into the plant chromosome results in the expression of the chimeric genes conferring the desired phenotype in plants.
Bacterial Inoculum. The binary vectors are mobilized into Agrobacterium tumefaciens strain ABI by the triparental conjugation system using the helper plasmid pRK2013 (Ditta et al., 1980). The ABI strain contains the disarmed pTiC58 plasmid pMP90RK (Koncz and Schell, 1986) in the chloramphenicol resistant derivative of the Agrobacterium tumefaciens strain A208.
Transformation procedure. Agrobacterium inocula were grown overnight at 28° C. in 2 ml of LBSCK (LBSCK is made as follows: LB liquid medium [1 liter volume]=10 g NaCl; 5 g Yeast Extract; 10 g tryptone; pH 7.0, and autoclave for 22 minutes. After autoclaving, add spectinomycin (50 mg/ml stock)—2 ml, kanamycin (50 mg/ml stock)—1 ml, and chloramphenicol (25 mg/ml stock)—1 ml.). One day prior to inoculation, the Agrobacterium was subcultured by inoculating 200 μl into 2 ml of fresh LBSCK and grown overnight. For inoculation of plant material, the culture was diluted with MSO liquid medium to an A660 range of 0.2-0.4.
Seedlings of Brassica napus cv. Westar were grown in Metro Mix 350 (Huminert Seed Co., St. Louis, Mo.) in a growth chamber with a day/night temperature of 15°/10° C., relative humidity of 50%, 16h/8h photoperiod, and at a light intensity of 500 μmol m−2 sec−1. The plants were watered daily (via sub-irrigation) and fertilized every other day with Peter's 15:30:15 (Fogelsville, Pa.).
In general, all media recipes and the transformation protocol follow those in Fry et al. (1987). Five to six week-old Westar plants were harvested when the plants had bolted (but prior to flowering), the leaves and buds were removed, and the 4-5 inches of stem below the flower buds were used as the explant tissue source. Following sterilization with 70% ethanol for 1 min and 38% Clorox for 20 min, the stems were rinsed three times with sterile water and cut into 5 mm-long segments (the orientation of the basal end of the stem segments was noted). The plant material was incubated for 5 minutes with the diluted Agrobacterium culture at a rate of 5 ml of culture per 5 stems. The suspension of bacteria was removed by aspiration and the explants were placed basal side down—for an optimal shoot regeneration response—onto co-culture plates ( 1/10 MSO solid medium with a 1.5 ml TXD (tobacco xanthi diploid) liquid medium overlay and covered with a sterile 8.5 cm filter paper). Fifty-to-sixty stem explants were placed onto each co-culture plate.
After a 2 day co-culture period, stem explants were moved onto MS medium containing 750 mg/l carbenicillin, 50 mg/l cefotaxime, and 1 mg/l BAP (benzylaminopurine) for 3 days. The stem explants were then placed for two periods of three weeks each, again basal side down and with 5 explants per plate, onto an MS/0.1 mM glyphosate, selection medium (also containing carbenicillin, cefotaxime, and BAP (The glyphosate stock [0.5M] is prepared as described in the following: 8.45 g glyphosate [analytical grade] is dissolved in 50 ml deionized water, adding KOH pellets to dissolve the glyphosate, and the volume is brought to 100 ml following adjusting the pH to 5.7. The solution is filter-sterilized and stored at 4° C.). After 6 weeks on this glyphosate selection medium, green, normally developing shoots were excised from the stem explants and were placed onto fresh MS medium containing 750 mg/l carbenicillin, 50 mg/l cefotaxime, and 1 mg/l BAP, for further shoot development. When the shoots were 2-3 inches tall, a fresh cut at the end of the stem was made, the cut end was dipped in Root-tone, and the shoot was placed in Metro Mix 350 soil and allowed to harden-off for 2-3 weeks.
Construction of Canola transformation vector pMON17209. The EPSPS gene was isolated originally from Agrobacterium sp. strain CP4 and expresses a highly tolerant enzyme. The original gene contains sequences that could be inimical to high expression of the gene in some plants. These sequences include potential polyadenylation sites that are often A+T rich, a higher G+C % than that frequently found in dicotyledonous plant genes (63% versus ˜50%), concentrated stretches of G and C residues, and codons that may not used frequently in dicotyledonous plant genes. The high G+C % in the CP4 EPSPS gene could also result in the formation of strong hairpin structures that may affect expression or stability of the RNA. A plant preferred version of the gene was synthesized and used for these vectors. This coding sequence was expressed in E. coli from a PRecA-gene10L vector (Olins et al., 1988) and the EPSPS activity was compared with that from the native CP4 EPSPS gene. The appKm for PEP for the native and synthetic genes was 11.8 μM and 12.7 μM, respectively, indicating that the enzyme expressed from the synthetic gene was unaltered. The N-terminus of the coding sequence was then mutagenized to place an SphI site (GCATGC) at the ATG to permit the construction of the CTP2-CP4 synthetic fusion for chloroplast import. This change had no apparent effect on the in vivo activity of CP4 EPSPS in E. coli as judged by complementation of the aroA mutant. A CTP-CP4 EPSPS fusion was constructed between the Arabidopsis thaliana EPSPS CTP (Klee et al., 1987) and the CP4 EPSPS coding sequences. The Arabidopsis CTP was engineered by site-directed mutagenesis to place a SphI restriction site at the CTP processing site. This mutagenesis replaced the Glu-Lys at this location with Cys-Met. The CTP2-CP4 EPSPS fusion was tested for import into chloroplasts isolated from Lactuca sativa using the methods described previously (della-Cioppa et al., 1986; 1987).
The GOX gene that encodes the glyphosate metabolizing enzyme glyphosate oxidoreductase (GOX) was cloned originally from Achromobacter sp. strain LBAA (Hallas et al., 1988; Barry et al., 1992). The gox gene from strain LBAA was also resynthesized in a plant-preferred sequence version and in which many of the restriction sites were removed (PCT Appln. No. WO 92/00377). The GOX protein is targeted to the plastids by a fusion between the C-terminus of a CTP and the N-terminus of GOX. A CTP, derived from the SSU1A gene from Arabidopsis thaliana (Timko et al., 1988) was used. This CTP (CTP1) was constructed by a combination of site-directed mutageneses. The CTP1 is made up of the SSU1A CTP (amino acids 1-55), the first 23 amino acids of the mature SSU1A protein (56-78), a serine residue (amino acid 79), a new segment that repeats amino acids 50 to 56 from the CTP and the first two from the mature protein (amino acids 80-87), and an alanine and methionine residue (amino acid 88 and 89). An NcoI restriction site if located at the 3′ end (spans the Met89 codon) to facilitate the construction of precise fusions to the 5′ of GOX. At a later stage, a BglII site was introduced upstream of the N-terminus of the SSU1A sequences to facilitate the introduction of the fusions into plant transformation vectors. A fusion was assembled between CTP1 and the synthetic GOX gene.
The CP4 EPSPS and GOX genes were combined to form pMON17209 as described in the following. The CTP2-CP4 EPSPS fusion was assembled and inserted between the constitutive FMV35S promoter (Gowda et al., 1989; Richins et al., 1987) and the E9 3′ region (Coruzzi et al., 1984; Morelli et al., 1985) in a pUC vector (Yannisch-Perron et al., 1985; Vieira and Messing, 1987) to form pMON17190; this completed element may then be moved easily as a NotI-NotI fragment to other vectors. The CTP1-GOX fusion was also assembled in a pUC vector with the FMV35S promoter. This element was then moved as a HindIII-BamHI fragment into the plant transformation vector pMON10098 and joined to the E9 3′ region in the process. The resultant vector pMON17193 has a single NotI site into which the FMV 35S/CTP2-CP4 EPSPS/E9 3′ element from pMON17190 was cloned to form pMON17194. The kanamycin plant transformation selection cassette (Fraley et al., 1985) was then deleted from pMON17194, by cutting with XhoI and re-ligating, to form the pMON17209 vector (FIG. 24).
Construction of Canola transformation vector pMON17237. The GOX enzyme has an apparent Km for glyphosate [appKm(glyphosate)] of ˜25 mM. In an effort to improve the effectiveness of the glyphosate metabolic rate in plants, a variant of GOX has been identified in which the appKm(glyphosate) has been reduced approximately 10-fold; this variant is referred to as GOX v.247 and the sequence differences between it and the original plant-preferred GOX are illustrated in PCT Appln. No. WO 92/00377. The GOX v.247 coding sequence was combined with CTP1 and assembled with the FMV35S promoter and the E9 3′ by cloning into the pMON17227 plant transformation vector to form pMON17241. In this vector, effectively, the CP4 EPSPS was replaced by GOX v.247. The pMON17227 vector had been constructed by replacing the CTP1-GOX sequence in pMON17193 with those for the CTP2-CP4 EPSPS, to form pMON17199 and followed by deleting the kanamycin cassette (as described above for pMON17209). The pMON17237 vector (FIG. 25 ) was then completed by cloning the FMV35S/CTP2-CP4 EPSPS/E9 3′ element as a NotI-NotI fragment into pMON17241.
Soybean plants were transformed with the pMON13640 (FIG. 15 ) vector and a number of plant lines of the transformed soybean were obtained which exhibit glyphosate tolerance.
Soybean plants are transformed with pMON13640 by the method of microprojectile injection using particle gun technology as described in Christou et al. (1988). The seed harvested from Ro plants is R1 seed which gives rise to R1 plants. To evaluate the glyphosate tolerance of an Ro plant, its progeny are evaluated. Because an Ro plant is assumed to be hemizygous at each insert location, selfing results in maximum genotypic segregation in the R1. Because each insert acts as a dominant allele, in the absence of linkage and assuming only one hemizygous insert is required for tolerance expression, one insert would segregate 3:1, two inserts, 15:1, three inserts 63:1, etc. Therefore, relatively few R1 plants need be grown to find at least one resistant phenotype.
Seed from an Ro soybean plant is harvested, and dried before planting in a glyphosate spray test. Seeds are planted into 4 inch (˜5 cm) square pots containing Metro 350. Twenty seedlings from each Ro plant is considered adequate for testing. Plants are maintained and grown in a greenhouse environment. A 12.5-14 hour photoperiod and temperatures of 30° C. day and 24° C. night is regulated. Water soluble Peters Pete Lite fertilizer is applied as needed.
A spray “batch” consists of several sets of R1 progenies all sprayed on the same date. Some batches may also include evaluations of other than R1 plants. Each batch also includes sprayed and unsprayed non-transgenic genotypes representing the genotypes in the particular batch which were putatively transformed. Also included in a batch is one or more non-segregating transformed genotypes previously identified as having some resistance.
One to two plants from each individual Ro progeny are not sprayed and serve as controls to compare and measure the glyphosate tolerance, as well as to assess any variability not induced by the glyphosate. When the other plants reach the first trifoliate leaf stage, usually 2-3 weeks after planting, glyphosate is applied at a rate equivalent of 128 oz./acre (8.895 kg/ha) of Roundup®. A laboratory track sprayer has been calibrated to deliver a rate equivalent to those conditions.
A vegetative score of 0 to 10 is used. The score is relative to the unsprayed progenies from the same Ro plant. A 0 is death, while a 10 represents no visible difference from the unsprayed plant. A higher number between 0 and 10 represents progressively less damage as compared to the unsprayed plant. Plants are scored at 7, 14, and 28 days after treatment (DAT). The data from the analysis of one set of transformed and control soybean plants are described on Table X and show that the CP4 EPSPS gene imparts glyphosate tolerance in soybean also.
| TABLE X |
| Glyphosate tolerance in Class II EPSPS soybean |
| transformants |
| (P-H35S, P-FMV35S; R0 plants; Spray rate = 128 oz./acre) |
| Vegetative score |
| Vector/Plant No. | day 7 | day 14 | day 28 | ||
| 13640/40-11 | 5 | 6 | 7 | ||
| 13640/40-3 | 9 | 10 | 10 | ||
| 13640/40-7 | 4 | 7 | 7 | ||
| control A5403 2 | 1 | 0 | |||
| |
1 | 0 | |||
The CP4 EPSPS gene may be used to select transformed plant material directly on media containing glyphosate. The ability to select and to identify transformed plant material depends, in most cases, on the use of a dominant selectable marker gene to enable the preferential and continued growth of the transformed tissues in the presence of a normally inhibitory substance. Antibiotic resistance and herbicide tolerance genes have been used almost exclusively as such dominant selectable marker genes in the presence of the corresponding antibiotic or herbicide. The nptII/kanamycin selection scheme is probably the most frequently used. It has been demonstrated that CP4 EPSPS is also a useful and perhaps superior selectable marker/selection scheme for producing and identifying transformed plants.
A plant transformation vector that may be used in this scheme is pMON17227 (FIG. 16). This plasmid resembles many of the other plasmids described infra and is essentially composed of the previously described bacterial replicon system that enables this plasmid to replicate in E. coli and to be introduced into and to replicate in Agrobacterium, the bacterial selectable marker gene (Spc/Str), and located between the T-DNA right border and left border is the CTP2-CP4 synthetic gene in the FMV35S promoter-E9 3′ cassette. This plasmid also has single sites for a number of restriction enzymes, located within the borders and outside of the expression cassette. This makes it possible to easily add other genes and genetic elements to the vector for introduction into plants.
The protocol for direct selection of transformed plants on glyphosate is outlined for tobacco. Explants are prepared for pre-culture as in the standard procedure as described in Example 1: surface sterilization of leaves from 1 month old tobacco plants (15 minutes in 10% clorox+surfactant; 3×dH2O washes); explants are cut in 0.5×0.5 cm squares, removing leaf edges, mid-rib, tip, and petiole end for uniform tissue type; explants are placed in single layer, upside down, on MS104 plates+2 ml 4COO5K media to moisten surface; pre-culture 1-2 days. Explants are inoculated using overnight culture of Agrobacterium containing the plant transformation plasmid that is adjusted to a titer of 1.2×109 bacteria/ml with 4COO5K media. Explants are placed into a centrifuge tube, the Agrobacterium suspension is added and the mixture of bacteria and explants is “Vortexed” on maximum setting for 25 seconds to ensure even penetration of bacteria. The bacteria are poured off and the explants are blotted between layers of dry sterile filter paper to remove excess bacteria. The blotted explants are placed upside down on MS104 plates+2 ml 4COO5K media+filter disc. Co-culture is 2-3 days. The explants are transferred to MS104+Carbenicillin 1000 mg/l+cefotaxime 100 mg/l for 3 days (delayed phase). The explants are then transferred to MS104+glyphosate 0.05 mM+Carbenicillin 1000 mg/l+cefotaxime 100 mg/l for selection phase. At 4-6 weeks shoots are cut from callus and placed on MSO+Carbenicillin 500 mg/l rooting media. Roots form in 3-5 days, at which time leaf pieces can be taken from rooted plates to confirm glyphosate tolerance and that the material is transformed.
The presence of the CP4 EPSPS protein in these transformed tissues has been confirmed by immunoblot analysis of leaf discs. The data from one experiment with pMON17227 is presented in the following: 139 shoots formed on glyphosate from 400 explants inoculated with Agrobacterium ABI/pMON17227; 97 of these were positive on recallusing on glyphosate. These data indicate a transformation rate of 24 per 100 explants, which makes this a highly efficient and time saving transformation procedure for plants. Similar transformation frequencies have been obtained with pMON17131 and direct selection of transformants on glyphosate with the CP4 EPSPS genes has also been shown in other plant species, including, Arabidopsis, soybean, corn, wheat, potato, tomato, cotton, lettuce, and sugarbeet.
The pMON17227 plasmid contains single restriction enzyme recognition cleavage sites (NotI, XhoI, and BstXI) between the CP4 glyphosate selection region and the left border of the vector for the cloning of additional genes and to facilitate the introduction of these genes into plants.
The CP4 EPSPS gene has also been introduced into Black Mexican Sweet (BMS) corn cells with expression of the protein and glyphosate resistance detected in callus.
The backbone for this plasmid was a derivative of the high copy plasmid pUC119 (Viera and Messing, 1987). The 1.3 Kb FspI-DraI pUC119 fragment containing the origin of replication was fused to the 1.3 Kb SmaI-HindIII filled fragment from pKC7 (Rao and Rogers, 1979) which contains the neomycin phosphotransferase type II gene to confer bacterial kanamycin resistance. This plasmid was used to construct a monocot expression cassette vector containing the 0.6 kb cauliflower mosaic virus (CaMV) 35S RNA promoter with a duplication of the −90 to −300 region (Kay et al., 1987), an 0.8 kb fragment containing an intron from a maize gene in the 5′ untranslated leader region, followed by a polylinker and the 3′ termination sequences from the nopaline synthase (NOS) gene (Fraley et al., 1983). A 1.7 Kb fragment containing the 300 bp chIoroplast transit peptide from the Arabidopsis EPSP synthase fused in a frame to the 1.4 Kb coding sequence for the bacterial CP4 EPSP synthase was inserted into the monocot expression cassette in the polylinker between the intron and the NOS termination sequence to form the plasmid pMON19653 (FIG. 17).
pMON19653 DNA was introduced into Black Mexican Sweet (BMS) cells by co-bombardment with EC9, a plasmid containing a sulfonylurea-resistant form of the maize acetolactate synthase gene. 2.5 mg of each plasmid was coated onto tungsten particles and introduced into log-phase BMS cells using a PDS-1000 particle gun essentially as described (Klein et al., 1989). Transformants are selected on MS medium containing 20 ppb chlorsulfuron. After initial selection on chlorsulfuron, the calli can be assayed directly by Western blot. Glyphosate tolerance can be assessed by transferring the calli to medium containing 5mM glyphosate. As shown in Table XI, CP4 EPSPS confers glyphosate tolerance to corn callus.
| TABLE XI |
| Expression of CP4 in BMS Corn Callus-pMON 19653 |
| CP4 expression | |||
| Line | (% extract protein) | ||
| 284 | 0.006% | ||
| 287 | 0.036 | ||
| 290 | 0.061 | ||
| 295 | 0.073 | ||
| 299 | 0.113 | ||
| 309 | 0.042 | ||
| 313 | 0.003 | ||
To measure CP4 EPSPS expression in corn callus, the following procedure was used: BMS callus (3 g wet weight) was dried on filter paper (Whatman#1) under vacuum, reweighed, and extraction buffer (500 μl/g dry weight; 100 mM Tris, 1 mM EDTA, 10% glycerol) was added. The tissue was homogenized with a Wheaton overhead stirrer for 30 seconds at 2.8 power setting. After centrifugation (3 minutes, Eppendorf microfuge), the supernatant was removed and the protein was quantitated (BioRad Protein Assay). Samples (50 μg/well) were loaded on an SDS PAGE gel (Jule, 3-17%) along with CP4 EPSPS standard (10 ng), electrophoresed, and transferred to nitrocellulose similarly to a previously described method (Padgette, 1987). The nitrocellulose blot was probed with goat anti-CP4 EPSPS IgG, and developed with I-125 Protein G. The radioactive blot was visualized by autoradiography. Results were quantitated by densitometry on an LKB UltraScan XL laser densitomer and are tabulated below in Table X.
| TABLE XII |
| Glyphosate resistance in BMS Corn Callus |
| using pMON 19653 |
| # chlorosulfuron- | # cross-resistant | ||
| Vector | Experiment | resistant lines | to Glyphosate |
| 19653 | 253 | 120 | 81/120 = 67.5% |
| 19653 | 254 | 80 | 37/80 = 46% |
| EC9 control | 253/254 | 8 | 0/8 = 0% |
Improvements in the expression of Class II EPSPS could also be achieved by expressing the gene using stronger plant promoters, using better 3′ polyadenylation signal sequences, optimizing the sequences around the initiation codon for ribosome loading and translation initiation, or by combination of these or other expression or regulatory sequences or factors.
The plant-expressible genes encoding the CP4 EPSPS and a glyphosate oxidoreductasease enzyme (PCT Pub. No. WO92/00377) were introduced into embryogenic corn callus through particle bombardment. Plasmid DNA was prepared using standard procedures (Ausubel et al., 1987), cesium-chloride purified, and re-suspended at 1 mg/ml in TE buffer. DNA was precipitated onto M10 tungsten or 1.0 μg gold particles (BioRad) using a calcium chloride/spermidine precipitation protocol, essentially as described by Klein et al. (1987). The PDS1000® gunpowder gun (BioRad) was used. Callus tissue was obtained by isolating 1-2 mm long immature embryos from the “Hi-II” genotype (Armstrong et al., 1991), or Hi-II X B73 crosses, onto a modified N6 medium (Armstrong and Green, 1985; Songstad et al., 1991). Embryogenic callus (“type-II”; Armstrong and Green, 1985) initiated from these embryos was maintained by subculturing at two week intervals, and was bombarded when less than two months old. Each plate of callus tissue was bombarded from 1 to 3 times with either tungsten or gold particles coated with the plasmid DNA(s) of interest. Callus was transferred to a modified N6 medium containing an appropriate selective agent (either glyphosate, or one or more of the antibiotics kanamycin, G418, or paromomycin) 1-8 days following bombardment, and then re-transferred to fresh selection media at 2-3 week intervals. Glyphosate-resistant calli first appeared approximately 6-12 weeks post-bombardment. These resistant calli were propagated on selection medium, and samples were taken for assays gene expression. Plant regeneration from resistant calli was accomplished essentially as described by Petersen et al. (1992).
In some cases, both gene(s) were covalently linked together on the same plasmid DNA molecule. In other instances, the genes were present on separate plasmids, but were introduced into the same plant through a process termed “co-transformation”. The 1 mg/ml plasmid preparations of interest were mixed together in an equal ratio, by volume, and then precipitated onto the tungsten or gold particles. At a high frequency, as described in the literature (e.g., Schocher et al., 1986), the different plasmid molecules integrate into the genome of the same plant cell. Generally the integration is into the same chromosomal location in the plant cell, presumably due to recombination of the plasmids prior to integration. Less frequently, the different plasmids integrate into separate chromosomal locations. In either case, there is integration of both DNA molecules into the same plant cell, and any plants produced from that cell.
Transgenic corn plants were produced as described above which contained a plant-expressible CP4 gene and a plant-expressible gene encoding a glyphosate oxidoreductase enzyme.
The plant-expressible CP4 gene comprised a structural DNA sequence encoding a CTP2/CP4 EPSPS fusion protein. The CTP2/CP4 EPSPS is a gene fusion composed of the N-terminal 0.23 Kb chloroplast transit peptide sequence from the Arabidopsis thaliana EPSPS gene (Klee et al. 1987, referred to herein as CTP2), and the C-terminal 1.36 Kb 5-enolpyruvylshikimate-3-phosphate synthase gene (CP4) from an Agrobacterium species. Plant expression of the gene fusion produces a pre-protein which is rapidly imported into chloroplasts where the CTP is cleaved and degraded (della-Cioppa et al., 1986) releasing the mature CP4 protein.
The plant-expressible gene expressing a glyphosate oxidoreductase enzyme comprised a structural DNA sequence comprising CTP1/GOXsyn gene fusion composed of the N-terminal 0.26 Kb chloroplast transit peptide sequence derived from the Arabidopsis thaliana SSU 1a gene (Timko et al., 1988 referred to herein as CTP1), and the C-terminal 1.3 Kb synthetic gene sequence encoding a glyphosate oxidoreductase enzyme (GOXsyn, as described in PCT Pub. No. WO92/00377 previously incorporated by reference. The GOXsyn gene encodes the enzyme glyphosate oxidoreductase from an Achromobacter sp. strain LBAA which catalyzes the conversion of glyphosate to herbicidally inactive products, aminomethylphosphonate and glyoxylate. Plant expression of the gene fusion produces a pre-protein which is rapidly imported into chloroplasts where the CTP is cleaved and degraded (della-Cioppa et al., 1986) releasing the mature GOX protein.
Both of the above described genes also include the following regulatory sequences for plant expression: (i) a promoter region comprising a 0.6 Kb 35S cauliflower mosaic virus (CaMV) promoter (Odell et al., 1985) with the duplicated enhancer region (Kay et al., 1987) which also contains a 0.8 Kb fragment containing the first intron from the maize heat shock protein 70 gene (Shah et al., 1985 and PCT Pub. No. WO93/19189, the disclosure of which is hereby incorporated by reference); and (ii) a 3′ non-translated region comprising a 0.3 Kb fragment of the 3′ non-translated region of the nopaline synthase gene (Fraley et al., 1983 and Depicker, et al., 1982) which functions to direct polyadenylation of the mRNA.
The above described transgenic corn plants exhibit tolerance to glyphosate herbicide in greenhouse and field trials.
The LBAA Class II EPSPS gene has been introduced into plants and also imparts glyphosate tolerance. Data on tobacco transformed with pMON17206 (infra) are presented in Table XIII.
| TABLE XIII |
| Tobacco Glyphosate Spray Test |
| (pMON17206; E35S-CTP2-LBAA EPSPS; 0/4 lbs/ac) |
| Line | 7 Day Rating | ||
| 33358 | 9 | ||
| 34586 | 9 | ||
| 33328 | 9 | ||
| 34606 | 9 | ||
| 33377 | 9 | ||
| 34611 | 10 | ||
| 34607 | 10 | ||
| 34601 | 9 | ||
| 34589 | 9 | ||
| Samsun (Control) | 4 | ||
From the foregoing, it will be recognized that this invention is one well adapted to attain all the ends and objects hereinabove set forth together with advantages which are obvious and which are inherent to the invention. It will be further understood that certain features and subcombinations are to utility and may be employed without reference to other features and subcombinations. This is contemplated by and is within the scope of the claims. Since many possible embodiments may be made of the invention without departing from the scope thereof, it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.
- Alm, R. A., Dalrympie, B. P. and Mattick, J. S. 1994. Sequencing and expression of the aroA gene from Dichelobacter nodosus, Gene, 145: 97-101.
- Altos, N. K. and Vapnek, D. (1979) Nature 282:864-869.
- Ammirato, P. V., et al. Handbook of Plant Cell Culture—Crop Species. Macmillan Publ. Co. (1984).
- Armstrong, C. L., and Green, C. E. 1985. Establishment and maintenance of friable, embryogenic maize callus and the involvement of L-proline. Planta 164:207-214.
- Armstrong, C. L., Green, C. E., and Phillips, R. L. 1991. Development and availability of germplasm with high Type II culture formation response. Maize Genetics Cooperation NewsLetter 65:92-93.
- Arnon, D. I. Plant Physiol. 24:1-15 (1949).
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. 1987. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley and Sons, Inc. New York.
- Bachmann, B. J. et al., Microb. Rev., 44:1-56 (1980).
- Barker, R., Idler, K., Thompson, D., and Kemp, J. (1983) Nucleotide sequence of the T-DNA region from the Agrobacterium tumefaciens Ti plasmid pTi15955. Plant Mol Biol 2:335-350
- Barry, G., Kishore, G., Padgette, S., Taylor, M., Kolacz, K., Weldon, M., Re D., Eichholtz, Fincher, K., and Hallas, L. (1992) Inhibitors of amino acid biosynthesis: Strategies for imparting glyphosate tolerance to crop plants. In: Biosynthesis and Molecular Regulation of Amino Acids in Plants. pp. 139-145. [Edited by Singh, B. K., Flores, H. E., and Shannon, J. C.] American Society of Plant Physiologists, Rockville, Md.
- Bartlett, S. G., Grossman, A. R., and Chua, N. H. (1982) in Methods in Chloroplast Molecular Biology, pp. 1081-1091. M. Edelman, R. B., Hallick, and Chua, N. H., eds.
- Bevan, M. (1984) Nucleic Acids Res. 12 (22): 8711-8721.
- Birnboim, H. C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl. Acids. Res. 7:1513-1525.
- Bolivar, R., Rodriguez, R. L., Greene, P. J., Betlach, M. B., Heynecker, H. L., Boyer, H. W., Crosa, J. H., and Falkow, S. (1977) Construction and characterization of new cloning vehicles, II. A multi-purpose cloning system. Gene 2: 95-113.
- Boyer, H. W. and Rolland-Dussolx, D. (1969) A complementation analysis of the restriction and modification of DNA in Escherichia coli, J. Mol. Biol. 41:459.
- Carrer, H., Hockenberry, T. N., Svab, Z., and Maliga, P. (1993) Kanamycin resistance as a selectable marker for plastid transformation in tobacco. Mol. Gen. Genet. 241: 49-56.
- Criston, P., D. E. McCabe, and W. F. Swain (1988) Stable transformation of Soybean Callus by DNA-Coated Gold Particles. Plant Physiol. 87:671-674.
- Coruzzi, G., Broglie, R., Edwards, C., and Chua, N. H. (1984). Tissue-specific and light-regulated expression of a pea nuclear gene encoding the small subunit of ribulose-1,5-bisphosphate carboxylase. EMBO J 3: 1671.
- Dalla Chiesa, M., Mayes, S. R., Maskell, D. J., Nixon, P. J. and Barber, J. 1994 An AroA homologue from Synechocystis sp. PCC6803, Gene, 144: 145-146.
- della-Cioppa, G., Bauer, S. C., Klein, B. K., Shah, D. M., Fraley, R. T. and Kishore G. K. (1986) Translocation of the precursor of 5-enolpyruvylshikimate-3-phosphate synthase into chloroplasts of higher plants in vitro. Proc. Natl. Acad Sci. USA 83: 6873-6877.
- della-Cioppa, G., Bauer, S. C., Taylor, M. T., Rochester, D. E., Klein, B. K., Shah, D. M., Fraley, R. T. and Kishore G. M. (1987) Targeting a herbicide-resistant enzyme from Escherichia coli to chloroplasts of higher plants. Bio/Technology 5: 579-584.
- Depicker, A., Stachel, S., Dhaese, P., Zambryski, P., and Goodman, H. M. 1982. Nopaline Synthase: Transcript Mapping and DNA Sequence. J. MOLEC. APPL. GENETICS 1:561-573.
- Devereux, J., Haeberli, P. and Smithies, O. (1984) A comprehensive set of sequence analysis programs for the VAX. Nucl. Acids. Res. 12:387-395.
- Ditta, G., Stanfield, S., Corbin, D., and Helinski, D. R. (1980) Broad host range DNA cloning system for Gram-Negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci USA 77, 7347-7351.
- Duncan, K., Edwards, R. M., Coggins, J. R. (1987) The pentafunctional aroM enzyme of Saccharomyces cerevisiae is a mosaic of monofunctional domains. Biochem. J. 246:375-386.
- Dunn, J. J. and Studier, F. W., (1983) J. Mol. Biol. 166:477-535.
- Fitzgibbon, J. E. (1988) Pseudomonas sp. strain PG2982: uptake of glyphosate and cloning of a gene which confers increased resistance to glyphosate. Ph.D. Dissertation, Louisiana State University.
- Fitzgibbon, E. F. and Braymer, H. D. (1990) Cloning of a gene from Pseudomonas sp. PG2982 conferring increased glyphosate resistance Appl. Environ. Microbiol. 56: 3382-3388.
- Fling, M. E., Kopf, J., and Richards, C. (1985). Nucleotide sequence of the transposon Tn7 gene encoding an aminoglycoside-modifying enzyme, 3″(9)-O-nucleotidyltransferase. Nucleic Acids Res. 13 no. 19, 7095-7106.
- Fraley, R. T., Rogers, S. G., Horsch, R. B., Sanders, P. R. Flick, J. S., Adams, S. P., Bittner, M. L., Brand, L. A., Fink, C. L., Fry, J. S., Galluppi, G. R., Goldberg, S. B., Hoffman, N. L., and Woo, S. C. 1983. Expression of bacterial genes in plant cells. Proc. Natl. Acad. Sci. USA 80:4803-4807.
- Fraley, R. T., Rogers, S. G., Horsch, R. B., Eichholtz D. A., Flick, J. S., Fink, C. L., Hoffmann, N. L. and Sanders, P. R. (1985) The SEV system: a new disarmed Ti plasmid vector system for plant transformation. Bio/Technology 3: 629-635.
- Fromm, M., (1990) UCLA Symposium on Molecular Strategies for Crop Improvement, Apr. 16-22, 1990. Keystone, Colo.
- Fry J., Barnason A., and Horsch R. (1987) Plant Cell Reports 6: 321-325.
- Gasser, C. S., Winter, J. A., Hironaka, C. M. and Shah, D. M. (1988) Structure, expression, and evolution of the 5-enolpyruvylshikimate 3-phosphate synthase genes of petunia and tomato. J. Biol. Chem. 263: 4280-4289.
- Gowda, S., Wu, F. C., and Shepard, R. J. (1989). Identification of promoter sequences for the major RNA transcripts of figwort mosaic and peanut chlorotic streak viruses (caulimovirus group). Journal of Cellular Bio-chemistry supplement 13D, 301 (Abstract).
- Hallas, L. E., Hahn, E. M. and Korndorfer, C. (1988) Characterization of microbial traits associated with glyphosate biodegradation in industrial activated sludge. J. Industrial Microbiol. 3: 377-385.
- Hayford, M. B., Medford, J. I., Hoffmann, N. L., Rogers, S. G. and Klee, H. J. (1988) Development of a plant transformation selection system based on expression of genes encoding gentamicin acetyltransferases. Plant Physiol. 86: 1216-1222.
- Herrera-Estrella, L., et al. (1983) Nature 303:209
- Heitkamp, M. A., Hallas, L. and Adams, W. J. (1990) Biotreatment of industrial wastewater with immobilized microorganisms—Presented in
Session 11, Paper S40, Society for Industrial Microbiology Annual Meeting, Orlando, Fla. Jul. 29-Aug. 3, 1990. - Henher, J. H., Band, L. and Shimotsu, H. (1984) Nucleotide sequence of the Bacillus subtilis tryptophan operon. Gene., 34: 169-177.
- Henner, J. H., Band, L., Flaggs, G. and Chen, E. (1986) The organization and nucleotide sequence of the Bacillus subtilis hisH, tyrA and aroE genes Gene 49: 147-152.
- Hohn, B. and Collins J. (1980) A small cosmid for efficient cloning of large DNA fragments. Gene 11: 291-298.
- Horsch, R. B. and H. Klee. (1986) Proc. Natl. Acad. Sci. U.S.A. 83:4428-32.
- Hunkapiller, M. W., Hewick, R. M., Dreyer, R. J., and Hood, L. (1983) Methods Enzymol. 91, 399-413.
- Jefferson, R. A., Kavanaugh, T. A. and Bevan, M. W., 1987, EMBO J., 6:3901-3907.
- Kay, R., Chan, A., Daly, M. and McPherson, J. 1987. Duplication of the
CaMV 35S promoter sequence creates a strong enhancer for plants. Science 236, 1299-1302. - Kishore, G., Shah, D., Padgette, S., della-Cioppa, G., Gasser, C., Re, D., Hironaka, C., Taylor, M., Wibbenmeyer, J., Eichholtz, D., Hayford, M., Hoffman, N., Delannay, X., Horsch, R., Klee, H., Rogers, S., Rochester, D., Brundage, L., Sanders, P. and Fraley, R. T. (1988) 5-Enolpyruvylshikimate 3-phosphate synthase: From Biochemistry to genetic engineering of glyphosate tolerance, in Biotechnology for Crop Protection ACS Symposium series No. 379. Eds. Hedlin P. A., Menn, J. J. and Hollingsworth, R. M. pp. 37-48.
- Kishore, G. and Shah, D. (1988) Ann. Rev. Biochem. 57:627-663.
- Kishore, G. M., Brundage, L., Kolk, K., Padgette, S. R., Rochester, D., Huynh, Q. K. and della-Cioppa, G. (1986) Fed. Proc. 45: 1506.
- Klee, H. J., et al. (1985) Bio/Technology 3:637-42.
- Klee, H. J., Muskopf, Y. M. and Gasser, C. S. (1987) Cloning of an Arabidopsis thaliana gene encoding 5-enolpyruvyl-shikimate-3-phosphate synthase: sequence analysis and manipulation to obtain glyphosate-tolerant plants. Mol. Gen. Genet. 210: 437-442.
- Klee, H. J. and Rogers, S. G. (1989) Plant gene vectors and genetic transformation: plant transformation systems based on the use of Agrobacterium tumefaciens in: Cell Culture and Somatic Cell: Genetics of Plants eds. J. Schell and L. K. Vasil. 6: 1-23.
- Klein, T. M., Kornstein, L., Sanford, J. C., and Fromm, M. E. 1989. Genetic transformation of maize cells by particle bombardment. Plant Phys. 91:440-444.
- Koncz, C. and Schell, J. (1986) The promoter of TL-
DNA gene 5 controls the tissue-specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204:383-396. - Kunkel, T. A., Roberts, J. D. and Zakour, R. A. (1987) Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367.
- Laemmli, U.K. (1970), “Cleavage of structural proteins during the assembly of the head of the bacteriophage T4” Nature, 227:680.
- Maliga, P., Carrer, H., Kanevski, I., Staub, J., and Svab, Z. (1993) Plastid engineering in land plants: a conservative genome is open to change. Philos. Trans. R. Soc. London B Biol. Sci. 342: 203-208.
- Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982) Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
- Maskell, D. J., Morrissey, P. and Dougan, G. (1988) Cloning and nucleotide sequence of the aroA gene of Bordetella pertussis. J. Bacteriol. 170:2467-2471.
- Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
- Moore, J. K., Braymer, H. D. and Larson, A. D. (1983) Isolation of a Pseudomonas sp. which utilizes the phosphonate herbicide glyphosate. Appl. Environ. Microbiol. 46: 316-320.
- Morelli, G., Nagy, F., Fraley, R. T., Rogers, S. G., and Chua, N. H. (1985). A short conserved sequence is involved in the light-inducibility of a
gene encoding ribulose 1,5-bisphosphate carboxylase small subunit of pea.Nature 315, 200-204. - O'Connell, C., Pattee, P. A. and Foster, T. J. (1993) Sequence and mapping of the aroA gene of Staphylococcus aureus 8325-4. J. Gen. Micr. 139: 1449-1460.
- Odell, J. T., Nagy, F., and Chua, N. H. (1985). Identification of DNA sequences required for activity of the
cauliflower mosaic virus 35S promoter. Nature 313, 810-812. - Olins, P. O., Devine, C. S., Rangwala, S. H. and Kavka, K. S. (1988) Gene 73: 227-235.
- O'Neill, C., Horvath, G. V., Horvath, E., Dix, P. J. and Medgyesy, P. (1993) Chloroplast transformation in plants: polyethylene glycol (PEG) treatment of protoplasts is an alternative to biolistic delivery systems. Plant J. 3: 729-738.
- Padgette, S. R., Huynh, Q. K., Borgmeyer, J., Shah, D. M., Brand, L. A., Re, D. B., Bishop, B. F., Rogers, S. G., Fraley, R. T., and Kishore, G. (1987) Bacterial expression and isolation of Petunia hybrida 5-enol-pyruvylshikimate-3-phosphate synthase. Arch. Biochem. Biophys. 258, 564-573.
- Padgette, S. R., Huynh, Q. K., Aykent, S., Sammons, R. D., Sikorski, J. A., and Kishore, G. M. (1988) J. Biol. Chem. 263, 1798-1802.
- Petersen, W. L., Sulc, S., and Armstrong, C. L. 1992. Effect of nurse cultures on the production of macro-calli and fertile plants from maize embryogenic suspension protoplasts. Plant Cell Reports 10:591-594.
- Quinn, J. P., Peden, J. M. M. and Dick, E. (1988) Glyphosate tolerance and utilization by the microflora of soils treated with the herbicide. Appl. Microbiol. Biotechnol.29: 511-516.
- Rao, R. N. and Rogers, S. G. (1979). Plasmid pKC7: A vector containing ten restriction endonuclease sites suitable for cloning DNA segments. Gene 7:79.
- Richins, R. D., Scholthof, H. B., and Shepard, R. J. (1987) Sequence of the figwort mosaic virus DNA (caulimovirus group). Nucl. Acids Res. 15: 8451-8466.
- Rogers, S. G., Brand, L. A. Holder, S. B. Sharps, E. S. and Brackin, M. J. (1983) Amplification of the aroA gene from E. coli results in tolerance to the herbicide glyphosate. Appl. Environ. Microbiol. 46:37-43.
- Rogers, S. G. and Klee, H. J. (1987). “Pathways to genetic manipulation employing Agrobacterium.” in Plant Gene Research, Plant DNA Infectious Agents, Vol IV, Hohn, T. and Schell, J., eds. Springer-Verlag, Vienna, pp.179-203.
- Sambrook, J., Fritsch, E. F. and Maniatis, T., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
- Schocher, R. J., Shillito, R. D., Saul, M. W., Paszkowski, J., and Potrykus, I. (1986). Co-transformation of unlinked foreign genes into plants by direct gene transfer. Bio/Technology 4:1093-1097.
- Songstad, D. D., Armstrong, C. L., and Petersen, W. L. (1991). AgNO3 increases type II callus production from immature embryos of maize inbred B73 and its derivatives. Plant Cell Reports 9: 699-702.
- Schuler, M. A., Schmitt, E. S. and Beachy, R. N. (1982) Nucleic Acids Res. 10:8225-8244.
- Schulz, A., Kruper, A. and Amrhein, N. (1985) Differential sensitivity of bacterial 5-enolpyruvylshikimate-3-phosphate synthases to the herbicide glyphosate. FEMS Microbiol. Lett. 28: 297-301.
- Schulz, A., Sost, D. and Amrhein, D. (1984) Arch. Microbiol. 137: 121-123.
- Shah, D., Horsch, R., Klee, H., Kishore, G., Winter, J., Turner, N., Hironaka, C., Sanders, P., Gasser, C., Aykent, S., Siegal, N., Rogers, S., and Fraley, R. (1986). Engineering herbicide tolerance in transgenic plants.
Science 233, 478-481. - Shah, D. M., Rochester, D. E., Krivi, G., Hironaka, C., Mozer, T. J., Fraley, R. T., and D. C. Tiemeier. 1985. Structure and expression of the maize hsp70 gene. Cell. and Mol. Biol. of Plant Stress, Alan R. Liss, Inc. pp. 181-200.
- Shimamoto, K. et al. (1989) Nature 338:274-276.
- Sost, D., Schulz, A. and Amrhein, N. (1984) FEBS Lett. 173: 238-241.
- Sost, D. and Amrhein, N. (1990) Substitution of Gly-96 to Ala in the 5-enolpyruvylshikimate 3-phosphate synthase of Klebsiella pneumoniae results in greatly reduced affinity for the herbicide glyphosate. Arch. Biochem. Biophys. 282: 433-436.
- Stalker, D. M., Thomas, C. M., and Helinski, D. R. (1981). Nucleotide sequence of the region of the origin of replication of the broad host range plasmid RK2. Mol Gen Genet 181: 8-12.
- Stalker, D. M., Hiatt, W. R. and Comai, L. (1985) A single amino acid substitution in the enzyme 5-enolpyruvylshikimate 3-phosphate synthase confers resistance to glyphosate. J. Biol. Chem. 260: 4724-4728.
- Stallings, W. C., Abdel-Meguid, S.S., Lim, L. W., Shieh, Huey-Sheng, Dayringer, H. E., Leimgruber, N. K., Stegeman, R. A., Anderson, K. S., Sikorski, J. A., Padgette S. R., Kishore, G. M. (1991). Structure and Topological Symmetry of the Glyphosate Target 5-enolpyruvylshikimate-3-phosphate synthase, Proc. Natl. Acad. Sci. USA 88, 5046-5050.
- Svab, Z., Hajdukiewicz, P., and Maliga, P. (1990) Stable transformation of plastids in higher plants. Proc. Natl. Acad. Sci. USA 87: 8526-8530.
- Svab, Z. and Maliga, P. (1993) High frequency plastid transformation in tobacco by selection for a chimeric aadA gene. Proc. Natl. Acad Sci. USA 90:913-917.
- Tabor, S. and Richardson, C. C. (1985) A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes. Proc. Natl. Acad. Sci. USA 82: 1074-1078.
- Talbot, H. W., Johnson, L. M. and Munnecke, D. M. (1984) Glyphosate utilization by Pseudomonas sp. and Alcali-genes sp. isolated from environmental sources. Current Microbiol. 10: 255-260.
- Talmadge, K., and Gilbert, W., (1980) “Construction of plasmid vectors with unique PstI cloning sites in the signal sequence coding region” Gene, 12: 235-241.
- Timko, M. P., Herdies, L., de Almeida, E., Cashmore, A. R., Leemans, J., and Krebbers, E. 1988. Genetic Engineering of Nuclear-Encoded Components of the Photosynthetic Apparatus in Arabidopsis in “The Impact of Chemistry on Biotechnology,” ACS Books, 279-295.
- Vasil, V., F. Redway and I. Vasil. (1990), Bio/Technology 8:429-434.
- Vieira, J. and Messing J. (1987) Production of single-stranded plasmid DNA. Methods Enzymol. 153: 3-11.
- Yanisch-Perron, C., Vieira, J. and Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119
Claims (149)
1. An isolated DNA molecule which encodes an EPSPS enzyme having the sequence of SEQ ID NO:3.
2. A The DNA molecule of claim 1 having the sequence of SEQ ID NO:2.
3. A The DNA molecule of claim 1 having the sequence of SEQ ID NO:9.
4. A recombinant, double-stranded DNA molecule comprising in sequence:
a) a promoter which functions in plant cells to cause the production of an RNA sequence;
b) a structural DNA sequence that causes the production of an RNA sequence which encodes a EPSPS enzyme having the sequence domains:
-R-X1-H-X2-E-(SEQ ID NO:37), in which
X1 is G, S, T, C, Y, N, Q, D or E;
X2 is S or T; and
-G-D-K-X3-(SEQ ID NO:38), in which
X3 is S or T; and
-S-A-Q-X4-K-(SEQ ID NO:39), in which
X4 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y or V; and
-N-X5-T-R-(SEQ ID NO:40), in which
X5 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y or V,
provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, S, T, W, Y, or V; and
c) a 3′ non-translated region which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence;
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the encoded EPSPS enzyme to enhance the glyphosate tolerance of a plant cell transformed with the DNA molecule.
5. A The DNA molecule of claim 4 in which the structural DNA sequence encodes a fusion polypeptide comprising an amino-terminal chloroplast transit peptide and the EPSPS enzyme.
6. A The DNA molecule of claim 4 in which X1 is D or N; X2 is S or T; X3 is S or T; X4 is V, I or L; and X5 is P or Q, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is Q.
7. A DNA molecule of claim 6 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43.
8. A The DNA molecule of claim 5 in which X1 is D or N; X2 is S or T; X3 is S or T; X4 is V, I or L; and X5 is P or Q, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is Q.
9. A DNA molecule of claim 8 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43.
10. A The DNA molecule of claim 8 137 in which the EPSPS sequence is enzyme has the sequence set forth in SEQ ID NO:3.
11. A The DNA molecule of claim 10 4 in which the promoter is a plant DNA virus promoter.
12. A The DNA molecule of claim 11 in which the promoter is selected from the group consisting of CaMV35S and FMV35S promoters.
13. A The DNA molecule of claim 10 5 in which the structural DNA sequence encodes a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11 and SEQ ID NO:15.
14. A The DNA molecule of claim 13 in which the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
15. A method of producing genetically transformed plants which are tolerant toward glyphosate herbicide, comprising the steps of:
a) inserting into the genome of a plant cell a recombinant, double-stranded DNA molecule comprising:
i) a promoter which functions in plant cells to cause the production of an RNA sequence,
ii) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence domains:
-R-X1-H-X2-E-(SEQ ID NO:37), in which
X1 is G, S, T, C, Y, N, Q, D or E;
X2 is S or T; and
-G-D-K-X3-(SEQ ID NO:38), in which
X3 is S or T; and
-S-A-Q-X4-K-(SEQ ID NO:39), in which
X4 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y or V; and
-N-X5-T-R-(SEQ ID NO:40), in which
X5 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y or V, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, S, T, W, Y or V; and
iii) a 3′ non-translated DNA sequence which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence;
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the polypeptide to enhance the glyphosate tolerance of a plant cell transformed with the DNA molecule;
b) obtaining a transformed plant cell; and
c) regenerating from the transformed plant cell a genetically transformed plant which has increased tolerance to glyphosate herbicide.
16. A The method of claim 15 in which X1 is D or N; X2 is S or T; X3 is S or T; X4 is V, I or L; and X5 is P or Q, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is Q.
17. A method of claim 16 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43.
18. A The method of claim 15 in which the structural DNA sequence encodes a fusion polypeptide comprising an amino-terminal chloroplast transit peptide and the EPSPS enzyme.
19. A The method of claim 18 in which X1 is D or N; X2 is S or T; X3 is S or T; X4 is V, I or L; and X5 is P or Q, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is Q.
20. A method of claim 19 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:42 and SEQ ID NO:44.
21. A The method of claim 19 143 in which the EPSPS enzyme is that set forth in SEQ ID NO:3.
22. A The method of claim 21 15 in which the promoter is from a plant DNA virus.
23. A The method of claim 22 in which the promoter is selected from the group consisting of CaMV35S and FMV35S promoters.
24. A glyphosate-tolerant plant cell comprising a the DNA molecule of claims claim 4 , 5 or 8or 10 .
25. A The glyphosate-tolerant plant cell of claim 24 in which the promoter is a plant DNA virus promoter.
26. A The glyphosate-tolerant plant cell of claim 25 in which the promoter is selected from the group consisting of CaMV35S and FMV35S promoters.
27. A The glyphosate-tolerant plant cell of claim 24 selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eukalyptus eucalyptus, apple, lettuce, peas, lentils, grape and turf grasses.
28. A glyphosate-tolerant plant comprising the plant cells cell of claim 27 .
29. A The glyphosate-tolerant plant of claim 28 in which the promoter is from a DNA plant virus promoter.
30. A The glyphosate-tolerant plant of claim 29 in which the promoter is selected from the group consisting of CaMV35S and FMV35S promoters.
31. A The glyphosate-tolerant plant of claim 30 selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eukalyptus eucalyptus, apple, lettuce, peas, lentils, grape and turf grasses.
32. A method for selectively controlling weeds in a field containing a crop having plant crop seeds or plants comprising the steps of:
a) planting the crop seeds or plants which are glyphosate-tolerant as a result of a recombinant double-stranded DNA molecule being inserted into the crop seed or plant, the DNA molecule having:
i) a promoter which functions in plant cells to cause the production of an RNA sequence,
ii) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence domains:
-R-X1-H-X2-E-(SEQ ID NO:37), in which
X1 is G, S, T, C, Y, N, Q, D or E;
X2 is S or T; and
-G-D-K-X3-(SEQ ID NO:38), in which
X3 is S or T; and
-S-A-Q-X4-K-(SEQ ID NO:39), in which
X4 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y or V; and
-N-X5-T-R-(SEQ ID NO:40), in which
X5 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y or V, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is A, R, N, D, C, Q, E, G, H, I, L, K, M, F, S, T, W, Y or V; and
iii) a 3′ non-translated DNA sequence which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the EPSPS enzyme to enhance the glyphosate tolerance of the crop plant transformed with the DNA molecule; and
b) applying to the crop and weeds in the field a sufficient amount of glyphosate herbicide to control the weeds without significantly affecting the crop.
33. A The method of claim 32 in which X1 is D or N; X2 is S or T; X3 is S or T; X4 is V, I or L; and X5 is P or Q, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is Q.
34. A method of claim 33 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:42 and SEQ ID NO:44.
35. A The method of claim 32 in which the structural DNA sequence encodes a fusion polypeptide comprising an amino-terminal chloroplast transit peptide and the EPSPS enzyme.
36. A The method of claim 35 in which X1 is D or N; X2 is S or T; X3 is S or T; X4 is V, I or L; and X5 is P or Q, provided that when X1 is D, X 2 is T, X 3 is S, and X 4 is V, then X 5 is Q.
37. A method of claim 36 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43.
38. A The method of claim 36 155 in which the DNA molecule encodes an EPSPS enzyme as set forth in SEQ ID NO:3.
39. A The method of claim 38 32 in which the DNA molecule further comprises a promoter selected from the group consisting of the CAMV35S and FMV35S promoters.
40. A The method of claim 39 in which the crop plant is selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eukalyptus eucalyptus, apple, lettuce, peas, lentils, grape and turf grasses.
41. A The DNA molecule of claim 5 in which the structural DNA sequence encodes a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17.
42. A The DNA molecule of claim 41 in which the chloroplast transit peptide is encoded by a DNA sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16.
43. A The DNA molecule of claim 5 in which the structural DNA sequence encodes a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11 and SEQ ID NO:15.
44. A The DNA molecule of claim 43 in which the chloroplast transit peptide is encoded by a DNA sequence selected from the group consisting of SEQ ID NO:10 and SEQ ID NO:14.
45. A The DNA molecule of claim 41 in which the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters.
46. A The DNA molecule of claim 42 in which the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters.
47. A The DNA molecule of claim 43 in which the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters.
48. A The DNA molecule of claim 44 in which the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters.
49. A The DNA molecule of claim 45 in which the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
50. A The DNA molecule of claim 46 in which the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
51. A The DNA molecule of claim 47 in which the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
52. A The DNA molecule of claim 48 in which the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
53. A DNA molecule of claim 49 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:42 and SEQ ID NO:44.
54. A DNA molecule of claim 50 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:42 and SEQ ID NO:44.
55. A DNA molecule of claim 51 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:42 and SEQ ID NO:44.
56. A DNA molecule of claim 52 in which the structural DNA sequence encodes an EPSPS enzyme selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:42 and SEQ ID NO:44.
57. A The DNA molecule of claim 53 137 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43 .
58. A The DNA molecule of claim 54 137 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43 as set forth in SEQ ID NO:9.
59. A DNA molecule of claim 55 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43.
60. A DNA molecule of claim 56 in which the structural DNA sequence contains an EPSPS coding sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43.
61. A DNA molecule of claim 49 in which the structural DNA sequence encodes an EPSPS enzyme having the sequence of SEQ ID NO:3.
62. A DNA molecule of claim 50 in which the structural DNA sequence encodes an EPSPS enzyme having the sequence of SEQ ID NO:3.
63. A DNA molecule of claim 51 in which the structural DNA sequence encodes an EPSPS enzyme having the sequence of SEQ ID NO:3.
64. A DNA molecule of claim 52 in which the structural DNA sequence encodes an EPSPS enzyme having the sequence of SEQ ID NO:3.
65. A DNA molecule of claim 61 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:9.
66. A DNA molecule of claim 62 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:9.
67. A DNA molecule of claim 63 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:9.
68. A DNA molecule of claim 64 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:9.
69. A The glyphosate-tolerant plant cell of claim 25 149 in which:
(a) the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters;
(b) the structural DNA sequence encodes:
(i) a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17; and
(ii) an EPSPS enzyme selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, SEQ ID NO:42 and SEQ ID NO:44 ; and
(c) the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
70. A The glyphosate-tolerant plant cell of claim 69 in which the structural DNA sequence comprises:
(a) a chloroplast transit peptide encoding DNA sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16; and
(b) an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43 .
71. A The glyphosate-tolerant plant cell of claim 69 in which the structural DNA sequence comprises:
(a) a chloroplast transist peptide encoding DNA sequence selected from the group consisting of SEQ ID NO:10 and SEQ ID NO:14; and
(b) a DNA sequence encoding an EPSPS enzyme having the sequence of SEQ ID NO:3.
72. A The glyphosate-tolerant plant cell of claim 71 in which the structural DNA sequence comprises an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2 and as set forth in SEQ ID NO:9.
73. A The glyphosate-tolerant plant cell of claim 71 selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eukalyptus eucalyptus, apple, lettuce, peas, lentils, grape and turf grasses.
74. A glyphosate-tolerant plant comprising a the DNA molecule of claims 5, 8 or 10 claim 131 in which:
(a) the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters;
(b) the structural DNA sequence encodes: ;
(i) a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17; and
(ii) an EPSPS enzyme selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7, SEQ ID NO:42 and SEQ ID NO:44 ; and
(c) the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
75. A The glyphosate-tolerant plant of claim 74 in which the structural DNA sequence comprises:
(a) a chloroplast transit peptide encoding DNA sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16; and
(b) an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:6, SEQ ID NO:41 and SEQ ID NO:43 .
76. A The glyphosate-tolerant plant of claim 75 in which the structural DNA sequence comprises:
(a) a chloroplast transit peptide encoding DNA sequence selected from the group consisting of SEQ ID NO:10 and SEQ ID NO:14; and
(b) a DNA sequence encoding an EPSPS enzyme having the sequence of SEQ ID NO:3.
77. A The glyphosate-tolerant plant of claim 76 74 in which the structural DNA sequence comprises an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:2 and as set forth in SEQ ID NO:9.
78. A The glyphosate-tolerant plant of claim 77 74 selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eukalyptus eucalyptus, apple, lettuce, peas, lentils, grape and turf grasses.
79. A seed of a the glyphosate-tolerant plant of claim 28 , wherein the seed comprises the recombinant DNA molecule.
80. A seed of a the glyphosate-tolerant plant of claim 31 , wherein the seed comprises the recombinant DNA molecule.
81. A seed of a the glyphosate-tolerant plant of claim 75 , wherein the seed comprises the recombinant DNA molecule.
82. A seed of a the glyphosate-tolerant plant of claim 76 , wherein the seed comprises the recombinant DNA molecule.
83. A seed of a the glyphosate-tolerant plant of claim 77 , wherein the seed comprises the recombinant DNA molecule.
84. A seed of a the glyphosate-tolerant plant of claim 78 129, wherein the seed comprises the recombinant DNA molecule.
85. A seed of a the glyphosate-tolerant plant of claim 79 144, wherein the seed comprises the recombinant DNA molecule.
86. A transgenic soybean plant which contains a heterologous gene which encodes an EPSPS enzyme having a Km for phosphoenolpyruvate (PEP) between 1 and 150 μM and a Ki(glyphosate)/Km(PEP) ratio between about 2 and 500, said plant exhibiting tolerance to N-phosphonomethylglycine herbicide at a rate of 1 lb/acre without significant yield reduction due to herbicide application.
87. Seed of a soybean plant of claim 86 .
88. The DNA molecule of claim 6 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:43.
89. The DNA molecule of claim 8 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:43.
90. The method of claim 16 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO: 43.
91. The method of claim 19 in which the structural DNA sequence encodes an EPSPS enzyme having a sequence selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:44.
92. The method of claim 33 in which the structural DNA sequence encodes an EPSPS enzyme having a sequence selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:44.
93. The method of claim 36 in which the structural DNA sequence contains an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:43.
94. The DNA molecule of claim 49 in which the structural DNA sequence encodes an EPSPS enzyme having a sequence selected from the group consisting of SEQ ID NO: 42 and SEQ ID NO: 44.
95. The DNA molecule of claim 50 in which the structural DNA sequence encodes an EPSPS enzyme having a sequence selected from the group consisting of SEQ ID NO: 42 and SEQ ID NO: 44.
96. The DNA molecule of claim 51 in which the structural DNA sequence encodes an EPSPS enzyme having a sequence selected from the group consisting of SEQ ID NO: 42 and SEQ ID NO: 44.
97. The DNA molecule of claim 52 in which the structural DNA sequence encodes an EPSPS enzyme having a sequence selected from the group consisting of SEQ ID NO: 42 and SEQ ID NO: 44.
98. The glyphosate-tolerant plant cell of claim 25 in which:
a) the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters;
b) the structural DNA sequence encodes:
i) a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17; and
ii) an EPSPS enzyme selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:44; and
c) the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
99. The glyphosate-tolerant plant cell of claim 26 in which the structural DNA sequence comprises:
a) a chloroplast transit peptide encoding DNA sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16; and
b) an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:43.
100. The glyphosate-tolerant plant comprising the DNA molecule of claim 4 , 5 or 8 in which:
a) the promoter is selected from the group consisting of CaMV 35S and FMV 35S promoters;
b) the structural DNA sequence encodes:
i) a chloroplast transit peptide selected from the group consisting of SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15 and SEQ ID NO:17; and
ii) an EPSPS enzyme selected from the group consisting of SEQ ID NO:42 and SEQ ID NO:44; and
c) the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
101. The glyphosate-tolerant plant of claim 28 in which the structural DNA sequence comprises:
a) a chloroplast transit peptide encoding DNA sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 and SEQ ID NO:16; and
b) an EPSPS encoding sequence selected from the group consisting of SEQ ID NO:41 and SEQ ID NO:43.
102. An isolated DNA molecule that encodes a 5-enolpyruvylshikimate- 3 -phosphate synthase (EPSPS) enzyme having the sequence of SEQ ID NO:70.
103. A recombinant, double-stranded DNA molecule comprising in sequence:
a) a promoter which functions in plant cells to cause the production of an RNA sequence;
b) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence of SEQ ID NO:70; and
c) a 3′ non-translated region that functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence;
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the encoded EPSPS enzyme to enhance the glyphosate tolerance of a plant cell transformed with the DNA molecule.
104. The DNA molecule of claim 103 , wherein the structural DNA sequence further causes the production of an RNA sequence that encodes an amino-terminal chloroplast transit peptide that is fused to the EPSPS enzyme.
105. The DNA molecule of claim 104 , wherein the chloroplast transit peptide has the sequence of SEQ ID NO:11 or SEQ ID NO:15.
106. The DNA molecule of claim 103 , wherein the promoter is a plant DNA virus promoter.
107. The DNA molecule of claim 106 , wherein the promoter is a CaMV35S promoter or an FMV35S promoter.
108. The DNA molecule of claim 103 , wherein the 3′ non-translated region is a NOS 3′ or an E9 3′ non-translated region.
109. A method of producing a genetically transformed plant which is tolerant toward glyphosate herbicide, comprising the steps of:
a) inserting into the genome of a plant cell a recombinant double-stranded DNA molecule comprising:
i) a promoter that functions in plant cells to cause the production of an RNS sequence;
ii) a structural DNA sequence that causes the production of an RNS sequence which encodes an EPSPS enzyme having the sequence of SEQ ID NO: 70; and
iii) a 3′ non-translated DNA sequence that functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNS sequence;
wherein the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the polypeptide to enhance the glyphosate tolerance of a plant cell transformed with the DNA molecule;
b) obtaining a transformed plant cell; and
c) regenerating from the transformed plant cell a genetically transformed plant which has increased tolerance to glyphosate herbicide.
110. The method of claim 109 , wherein the structural DNA further causes the production of an RNA sequence that encodes an amino-terminal chloroplast transit peptide that is fused to the EPSPS enzyme.
111. The method of claim 110 , wherein the chloroplast transit peptide has the sequence of SEQ ID NO:11 or SEQ ID NO:15.
112. The method of claim 109 , in which the promoter is a plant DNA virus promoter.
113. The method of claim 112 , in which the promoter is a CaMV35S promoter or an FMV35S promoter.
114. The method of claim 109 , wherein the 3′ non-translated DNA sequence is a NOS 3′ or an E9 3′ non-translated sequence.
115. A glyphosate-tolerant plant cell comprising a DNA sequence encoding an EPSPS enzyme having the sequence of SEQ ID NO: 70.
116. A glyphosate-tolerant plant comprising a DNA sequence encoding an EPSPS enzyme having the sequence of SEQ ID NO: 70.
117. The plant of claim 116 , wherein the plant is corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eucalyptus, apple, lettuce, peas, lentils, grape or turf grasses.
118. The plant of claim 117 , wherein the plant is corn.
119. The plant of claim 117 , wherein the plant is soybean.
120. The plant of claim 117 , wherein the plant is canola.
121. The plant of claim 117 , wherein the plant is cotton.
122. A seed of the plant of claim 116 , wherein the seed comprises the DNA sequence encoding an EPSPS enzyme having the sequence of SEQ ID NO: 70.
123. The seed of claim 122 , wherein the seed is corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eucalyptus, apple, lettuce, peas, lentils, grape or turf grass seed.
124. The seed of claim 123 , wherein the seed is corn seed.
125. The seed of claim 123 , wherein the seed is soybean seed.
126. The seed of claim 123 , wherein the seed is canola seed.
127. The seed of claim 123 , wherein the seed is cotton seed.
128. A glyphosate tolerant plant cell comprising the recombinant DNA molecule of claim 103 .
129. A plant comprising the glyphosate tolerant plant cell of claim 128 .
130. A method for selectively controlling weeds in a field containing a crop having planted crop seeds or plants comprising the steps of:
a) planting the crop seeds or plants which are glyphosate-tolerant as a result of a recombinant double-stranded DNA molecule being inserted into the crop seed or plant, the DNA molecule having:
i) a promoter which functions in plant cells to cause the production of an RNA sequence,
ii) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence of SEQ ID NO:70; and
iii) a 3′ non-translated DNA sequence which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence,
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the EPSPS enzyme to enhance the glyphosate tolerance of the crop plant transformed with the DNA molecule; and
b) applying to the crop and weeds in the field a sufficient amount of glyphosate herbicide to control the weeds without significantly affecting the crop.
131. A recombinant, double-stranded DNA molecule comprising in sequence:
a) a promoter which functions in plant cells to cause the production of an RNA sequence;
b) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence of SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO: 7;
c) a 3′ non-translated region which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence;
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the encoded EPSPS enzyme to enhance the glyphosate tolerance of a plant cell transformed with the DNA molecule.
132. The DNA molecule of claim 131 in which the structural DNA sequence encodes a fusion polypeptide comprising an amino-terminal chloroplast transit peptide and the EPSPS enzyme.
133. The DNA molecule of claim 131 in which the promoter is a plant DNA virus promoter.
134. The DNA molecule of claim 133 in which the promoter is selected from the group consisting of CaMV35S and FMV35S promoters.
135. The DNA molecule of claim 132 in which the structural DNA sequence encodes a chloroplast transit peptide selected from the group consisting of SEQ ID NO: 11 and SEQ ID NO: 15.
136. The DNA molecule of claim 131 in which the 3′ non-translated region is selected from the group consisting of the NOS 3′ and the E9 3′ non-translated regions.
137. A method of producing genetically transformed plants which are tolerant toward glyphosate herbicide, comprising the steps of:
a) inserting into the genome of a plant cell a recombinant, double-stranded DNA molecule comprising:
i) a promoter which functions in plant cells to cause the production of an RNA sequence,
ii) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence of SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7; and
iii) a 3′ non-translated DNA sequence which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence;
where the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the polypeptide to enhance the glyphosate tolerance of a plant cell transformed with the DNA molecule;
b) obtaining a transformed plant cell; and
c) regenerating from the transformed plant cell a genetically transformed plant which has increased tolerance to glyphosate herbicide.
138. The method of claim 137 in which the structural DNA sequence encodes a fusion polypeptide comprising an amino-terminal chloroplast transit peptide and the EPSPS enzyme.
139. The method of claim 130 , wherein the chloroplast transit peptide has the sequence of SEQ ID NO: 11 or SEQ ID NO: 15.
140. The method of claim 137 in which the promoter is a plant DNA virus.
141. The method of claim 140 in which the promoter is a CaMV35S promoter or a FMV35S promoter.
142. The method of claim 137 , wherein the 3′ non-translated DNA sequence is a NOS 3′ or an e9 3′ non-translated sequence.
143. A glyphosate-tolerant plant cell comprising the DNA molecule of claim 131 .
144. A plant comprising the glyphosate-tolerant plant cell of claim 143 .
145. A glyphosate-tolerant plant cell comprising an EPSPS enzyme having the sequence of SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:7.
146. A glyphosate-tolerant plant comprising an EPSPS enzyme having the sequence of SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7.
147. The glyphosate-tolerant plant cell of claim 143 or 145 selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eucalyptus, apple, lettuce, peas, lentils, grape, and turf grasses.
148. The glyphosate-tolerant plant of claim 144 or 146 selected from the group consisting of corn, wheat, rice, barley, soybean, cotton, sugarbeet, oilseed rape, canola, flax, sunflower, potato, tobacco, tomato, alfalfa, poplar, pine, eucalyptus, apple, lettuce, peas, lentils, grapes, and turf grasses.
149. A method for selectively controlling weeds in a field containing a crop having planted crop seeds or plants comprising the steps of:
a) planting the crop seeds or plants which are glyphosate-tolerant as a result of a recombinant double-stranded DNA molecule being inserted into the crop seed or plant, the DNA molecule having:
i) a promoter which functions in plant cells to cause the production of an RNA sequence,
ii) a structural DNA sequence that causes the production of an RNA sequence which encodes an EPSPS enzyme having the sequence of SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7; and
iii) a 3′ non-translated DNA sequence which functions in plant cells to cause the addition of a stretch of polyadenyl nucleotides to the 3′ end of the RNA sequence,
wherein the promoter is heterologous with respect to the structural DNA sequence and adapted to cause sufficient expression of the EPSPS enzyme to enhance the glyphosate tolerance of the crop plant transformed with the DNA molecule; and
b) applying to the crop and weeds in the field a sufficient amount of glyphosate herbicide to control the weeds without significantly affecting the crop.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/622,201 USRE39247E1 (en) | 1990-08-31 | 2003-07-18 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US57653790A | 1990-08-31 | 1990-08-31 | |
| US74961191A | 1991-08-28 | 1991-08-28 | |
| US08/306,063 US5633435A (en) | 1990-08-31 | 1994-09-13 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US10/622,201 USRE39247E1 (en) | 1990-08-31 | 2003-07-18 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/306,063 Reissue US5633435A (en) | 1990-08-31 | 1994-09-13 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| USRE39247E1 true USRE39247E1 (en) | 2006-08-22 |
Family
ID=27405130
Family Applications (8)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/306,063 Expired - Lifetime US5633435A (en) | 1990-08-31 | 1994-09-13 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US08/476,008 Expired - Lifetime US5627061A (en) | 1990-08-31 | 1995-06-07 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US08/833,485 Expired - Lifetime US5804425A (en) | 1989-02-06 | 1997-04-07 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US09/137,440 Expired - Fee Related US6248876B1 (en) | 1989-02-06 | 1998-08-20 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US09/464,099 Expired - Fee Related US7183110B2 (en) | 1990-08-31 | 1999-12-16 | Antibody immunoreactive with a 5-enolpyruvylshikimate-3-phosphate synthase |
| US10/622,201 Expired - Lifetime USRE39247E1 (en) | 1990-08-31 | 2003-07-18 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US11/526,170 Abandoned US20080227966A1 (en) | 1990-08-31 | 2006-09-22 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US12/459,672 Abandoned US20100022762A1 (en) | 1990-08-31 | 2009-07-06 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
Family Applications Before (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US08/306,063 Expired - Lifetime US5633435A (en) | 1990-08-31 | 1994-09-13 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US08/476,008 Expired - Lifetime US5627061A (en) | 1990-08-31 | 1995-06-07 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US08/833,485 Expired - Lifetime US5804425A (en) | 1989-02-06 | 1997-04-07 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US09/137,440 Expired - Fee Related US6248876B1 (en) | 1989-02-06 | 1998-08-20 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US09/464,099 Expired - Fee Related US7183110B2 (en) | 1990-08-31 | 1999-12-16 | Antibody immunoreactive with a 5-enolpyruvylshikimate-3-phosphate synthase |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/526,170 Abandoned US20080227966A1 (en) | 1990-08-31 | 2006-09-22 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US12/459,672 Abandoned US20100022762A1 (en) | 1990-08-31 | 2009-07-06 | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
Country Status (1)
| Country | Link |
|---|---|
| US (8) | US5633435A (en) |
Cited By (57)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008048964A2 (en) | 2006-10-16 | 2008-04-24 | Monsanto Technology Llc | Methods and compositions for improving plant health |
| US20080119361A1 (en) * | 2006-06-06 | 2008-05-22 | Feng Paul C C | Methods for weed control |
| US20080305952A1 (en) * | 2006-10-25 | 2008-12-11 | Arnevik Cindy L | Cropping systems for managing weeds |
| US20090029861A1 (en) * | 2007-02-26 | 2009-01-29 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of dmo and uses thereof |
| EP2425709A1 (en) | 2007-03-09 | 2012-03-07 | Monsanto Technology, LLC | Preparation and use of plant embryo explants for transformation |
| WO2012134921A2 (en) | 2011-03-25 | 2012-10-04 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| WO2013116700A1 (en) | 2012-02-01 | 2013-08-08 | Dow Agrosciences Llc | Glyphosate resistant plants and associated methods |
| WO2013138358A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013158766A1 (en) | 2012-04-17 | 2013-10-24 | Dow Agrosciences Llc | Synthetic brassica-derived chloroplast transit peptides |
| WO2013158442A1 (en) | 2012-04-20 | 2013-10-24 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| USRE44971E1 (en) | 2006-06-06 | 2014-06-24 | Monsanto Technology Llc | Method for selection of transformed cells |
| WO2014143996A2 (en) | 2013-03-15 | 2014-09-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods of use of acc oxidase polynucleotides and polypeptides |
| WO2014151255A1 (en) | 2013-03-15 | 2014-09-25 | Monsanto Technology Llc | Methods and compositions for weed control |
| US8907159B1 (en) | 2013-02-13 | 2014-12-09 | Pioneer Hi Bred International Inc | Maize inbred PH24DM |
| US8916744B1 (en) | 2013-02-13 | 2014-12-23 | Pioneer Hi Bred International Inc | Maize inbred PH24DV |
| US8921672B1 (en) | 2013-02-13 | 2014-12-30 | Pioneer Hi Bred International Inc | Maize inbred PH24DS |
| US8952229B1 (en) | 2012-02-21 | 2015-02-10 | Pioneer Hi Bred International Inc | Maize inbred PH1K0H1 |
| US8975469B1 (en) | 2012-02-21 | 2015-03-10 | Pioneer Hi Bred International Inc | Maize hybrid X13C704HR |
| WO2015108982A2 (en) | 2014-01-15 | 2015-07-23 | Monsanto Technology Llc | Methods and compositions for weed control using epsps polynucleotides |
| US9121022B2 (en) | 2010-03-08 | 2015-09-01 | Monsanto Technology Llc | Method for controlling herbicide-resistant plants |
| US9416363B2 (en) | 2011-09-13 | 2016-08-16 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9422557B2 (en) | 2011-09-13 | 2016-08-23 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9422558B2 (en) | 2011-09-13 | 2016-08-23 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9540642B2 (en) | 2013-11-04 | 2017-01-10 | The United States Of America, As Represented By The Secretary Of Agriculture | Compositions and methods for controlling arthropod parasite and pest infestations |
| EP3127425A2 (en) | 2009-09-17 | 2017-02-08 | Monsanto Technology LLC | Soybean transgenic event mon 87708 and methods of use thereof |
| US9777288B2 (en) | 2013-07-19 | 2017-10-03 | Monsanto Technology Llc | Compositions and methods for controlling leptinotarsa |
| US9840715B1 (en) | 2011-09-13 | 2017-12-12 | Monsanto Technology Llc | Methods and compositions for delaying senescence and improving disease tolerance and yield in plants |
| US9850496B2 (en) | 2013-07-19 | 2017-12-26 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US9920326B1 (en) | 2011-09-14 | 2018-03-20 | Monsanto Technology Llc | Methods and compositions for increasing invertase activity in plants |
| US10000767B2 (en) | 2013-01-28 | 2018-06-19 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| US10041068B2 (en) | 2013-01-01 | 2018-08-07 | A. B. Seeds Ltd. | Isolated dsRNA molecules and methods of using same for silencing target molecules of interest |
| US10059999B2 (en) | 2013-06-10 | 2018-08-28 | Monsanto Technology Llc | Molecular markers associated with soybean tolerance to low iron growth conditions |
| US10077451B2 (en) | 2012-10-18 | 2018-09-18 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| US10138526B2 (en) | 2011-08-31 | 2018-11-27 | Monsanto Technology Llc | Molecular markers associated with stem canker resistance in soybean |
| US10240162B2 (en) | 2012-05-24 | 2019-03-26 | A.B. Seeds Ltd. | Compositions and methods for silencing gene expression |
| US10378012B2 (en) | 2014-07-29 | 2019-08-13 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
| US10435701B2 (en) | 2013-03-14 | 2019-10-08 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| EP3575308A1 (en) | 2013-03-14 | 2019-12-04 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| US10557138B2 (en) | 2013-12-10 | 2020-02-11 | Beeologics, Inc. | Compositions and methods for virus control in Varroa mite and bees |
| US10612019B2 (en) | 2013-03-13 | 2020-04-07 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10609930B2 (en) | 2013-03-13 | 2020-04-07 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10655136B2 (en) | 2015-06-03 | 2020-05-19 | Monsanto Technology Llc | Methods and compositions for introducing nucleic acids into plants |
| US10683505B2 (en) | 2013-01-01 | 2020-06-16 | Monsanto Technology Llc | Methods of introducing dsRNA to plant seeds for modulating gene expression |
| US10760086B2 (en) | 2011-09-13 | 2020-09-01 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10801028B2 (en) | 2009-10-14 | 2020-10-13 | Beeologics Inc. | Compositions for controlling Varroa mites in bees |
| US10808249B2 (en) | 2011-09-13 | 2020-10-20 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10806146B2 (en) | 2011-09-13 | 2020-10-20 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10829828B2 (en) | 2011-09-13 | 2020-11-10 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10883103B2 (en) | 2015-06-02 | 2021-01-05 | Monsanto Technology Llc | Compositions and methods for delivery of a polynucleotide into a plant |
| US10888579B2 (en) | 2007-11-07 | 2021-01-12 | Beeologics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
| WO2021016043A1 (en) | 2019-07-19 | 2021-01-28 | Inari Agriculture, Inc. | Improved homology dependent repair genome editing |
| US10968449B2 (en) | 2015-01-22 | 2021-04-06 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US10988764B2 (en) | 2014-06-23 | 2021-04-27 | Monsanto Technology Llc | Compositions and methods for regulating gene expression via RNA interference |
| US11041172B2 (en) | 2019-06-25 | 2021-06-22 | Inari Agriculture, Inc. | Homology dependent repair genome editing |
| US11046969B2 (en) | 2017-05-24 | 2021-06-29 | Epiplanta Biotech Ltd. | Transgenic plant and the method for producing the same |
| US11091770B2 (en) | 2014-04-01 | 2021-08-17 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
| US11807857B2 (en) | 2014-06-25 | 2023-11-07 | Monsanto Technology Llc | Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression |
Families Citing this family (743)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5633435A (en) * | 1990-08-31 | 1997-05-27 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| FR2736926B1 (en) | 1995-07-19 | 1997-08-22 | Rhone Poulenc Agrochimie | 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE MUTEE, CODING GENE FOR THIS PROTEIN AND PROCESSED PLANTS CONTAINING THIS GENE |
| US6376754B1 (en) * | 1997-03-07 | 2002-04-23 | Asgrow Seed Company | Plants having resistance to multiple herbicides and its use |
| AU6882298A (en) * | 1997-04-03 | 1998-10-22 | Dekalb Genetics Corporation | Glyphosate resistant maize lines |
| US5883239A (en) * | 1997-07-18 | 1999-03-16 | Smithkline Beecham Corporation | aroA |
| US7161064B2 (en) * | 1997-08-12 | 2007-01-09 | North Carolina State University | Method for producing stably transformed duckweed using microprojectile bombardment |
| FI104907B (en) | 1997-09-18 | 2000-04-28 | Univ Helsinki Licensing | Agrobacterium-mediated transformation of ryps |
| DE69729489T2 (en) * | 1997-10-07 | 2005-06-30 | EMBRAPA-Empresa Brasileira De Pesquisa Agropecuária | PREPARATION OF TRANSGENIC LEGUMINOSES CONTAINING EXOGENOUS SNA |
| JP2001503280A (en) * | 1997-10-31 | 2001-03-13 | ノバルティス アクチエンゲゼルシャフト | Glyphosate resistant transgenic plants |
| US5914451A (en) * | 1998-04-06 | 1999-06-22 | Monsanto Company | Efficiency soybean transformation protocol |
| US6750377B1 (en) * | 1998-06-19 | 2004-06-15 | Advanta Technology Ltd. | Method of breeding glyphosate resistant plants |
| US6492578B1 (en) | 1998-07-10 | 2002-12-10 | Calgene Llc | Expression of herbicide tolerance genes in plant plastids |
| US6987215B1 (en) * | 1998-08-03 | 2006-01-17 | Rutgers, The State University Of New Jersey | Translation control elements for high-level protein expression in the plastids of higher plants and methods of use thereof |
| US6541682B1 (en) | 1998-11-12 | 2003-04-01 | Calgene Llc | Plastid transformation of solanaceous plants |
| DE69941009D1 (en) * | 1998-11-17 | 2009-07-30 | Monsanto Technology Llc | PHOSPHONATE METABOLIZING PLANTS |
| US6515206B1 (en) | 1998-12-23 | 2003-02-04 | Calgene Llc | Plastid transformation of Brassica |
| CA2359868A1 (en) * | 1999-01-14 | 2000-07-20 | Monsanto Company | Soybean transformation method |
| IT1307159B1 (en) * | 1999-01-14 | 2001-10-29 | Nottington Holding Bv | EQUIPMENT FOR MEASURING THE BREATHABILITY CAPACITY OF A FOOTWEAR. |
| US6190716B1 (en) * | 1999-02-17 | 2001-02-20 | Scott O. Galbreath, Jr. | Method for preparing a grape derived product |
| US7067722B2 (en) * | 1999-08-26 | 2006-06-27 | Monsanto Technology Llc | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| EP1206558B1 (en) * | 1999-08-26 | 2008-01-09 | Calgene LLC | Plants with modified polyunsaturated fatty acids |
| US7531718B2 (en) * | 1999-08-26 | 2009-05-12 | Monsanto Technology, L.L.C. | Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids |
| US7157619B1 (en) * | 1999-08-30 | 2007-01-02 | Monsanto Technology, L.L.C. | Plant sterol acyltransferases |
| AR025996A1 (en) * | 1999-10-07 | 2002-12-26 | Valigen Us Inc | NON-TRANSGENIC PLANTS RESISTANT TO HERBICIDES. |
| WO2001044457A2 (en) * | 1999-12-16 | 2001-06-21 | Monsanto Technology Llc | Dna constructs for expression of heterologous polypeptides in plants |
| FR2803592A1 (en) * | 2000-01-06 | 2001-07-13 | Aventis Cropscience Sa | NOVEL DERIVATIVES OF 3-HYDROXYPICOLINIC ACID, PROCESS FOR THEIR PREPARATION AND FUNGICIDAL COMPOSITIONS CONTAINING SAME |
| US6580019B1 (en) | 2000-03-09 | 2003-06-17 | Dekalb Genetics Corporation | Non-reciprocal recombination-mediated transgene deletion in transgenic plants |
| CA2401093A1 (en) * | 2000-03-09 | 2001-09-13 | Monsanto Technology Llc | Methods for making plants tolerant to glyphosate and compositions thereof |
| US6750379B2 (en) * | 2000-03-09 | 2004-06-15 | Dekalb Genetics Corporation | Homologous recombination-mediated transgene alterations in plants |
| BR122013026754B1 (en) | 2000-06-22 | 2018-02-27 | Monsanto Company | DNA Molecule And Processes To Produce A Corn Plant Tolerant For Glyphosate Herbicide Application |
| PL214848B1 (en) * | 2000-09-29 | 2013-09-30 | Monsanto Technology Llc | Glyphosate tolerant wheat plant 33391 and compositions and methods for detection thereof |
| US9816104B2 (en) * | 2000-10-06 | 2017-11-14 | Monsanto Technology Llc | Compositions and methods for deploying a transgenic refuge as a seed blend |
| FR2815969B1 (en) | 2000-10-30 | 2004-12-10 | Aventis Cropscience Sa | TOLERANT PLANTS WITH HERBICIDES BY METABOLIC BYPASS |
| CA2425349C (en) * | 2000-10-30 | 2011-08-02 | Monsanto Technology Llc | Canola event pv-bngt04(rt73) and compositions and methods for detection thereof |
| US7462481B2 (en) * | 2000-10-30 | 2008-12-09 | Verdia, Inc. | Glyphosate N-acetyltransferase (GAT) genes |
| IL155599A0 (en) * | 2000-10-30 | 2003-11-23 | Maxygen Inc | Polynucleotides encoding proteins which catalyze acetylation of glyphosate |
| US20090011938A1 (en) * | 2000-10-30 | 2009-01-08 | Pioneer Hi--Bred International, Inc. | Novel glyphosate-n-acetyltransferase (gat) genes |
| US6639124B2 (en) * | 2001-02-14 | 2003-10-28 | Natural Genes, Inc. | Production of genetically-controlled herbicide resistance in cotton plants in the absence if genetic engineering |
| AU2002249270B2 (en) * | 2001-02-22 | 2006-07-06 | Biogemma S.A.S. | Constitutive promoter from arabidopsis |
| EP1950305A1 (en) | 2001-05-09 | 2008-07-30 | Monsanto Technology, LLC | Tyr a genes and uses thereof |
| WO2003101194A2 (en) * | 2001-05-11 | 2003-12-11 | Naturize, Inc. | Biologic-chemical herbicide compositions and methods of use |
| WO2002092856A1 (en) * | 2001-05-15 | 2002-11-21 | Monsanto Technology Llc | A method of selecting dna constructs for herbicide tolerance in plants |
| US7977046B2 (en) * | 2002-05-10 | 2011-07-12 | Monsanto Technology Llc | Method of selecting DNA constructs for herbicide tolerance in plants |
| ATE530654T1 (en) * | 2001-07-06 | 2011-11-15 | Monsanto Technology Llc | METHOD FOR PROMOTING THE SEPARATION OF TRANSGENES IN PLANTS AND COMPOSITIONS THEREFOR |
| US8022272B2 (en) | 2001-07-13 | 2011-09-20 | Sungene Gmbh & Co. Kgaa | Expression cassettes for transgenic expression of nucleic acids |
| US20030084473A1 (en) * | 2001-08-09 | 2003-05-01 | Valigen | Non-transgenic herbicide resistant plants |
| WO2003029425A2 (en) * | 2001-10-01 | 2003-04-10 | Diversa Corporation | Whole cell engineering using real-time metabolic flux analysis |
| CA2462641A1 (en) * | 2001-10-01 | 2003-04-10 | Diversa Corporation | Whole cell engineering using real-time metabolic flux analysis |
| US20050075304A1 (en) * | 2001-11-30 | 2005-04-07 | Mcswiggen James | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
| US9267144B2 (en) * | 2002-01-23 | 2016-02-23 | Monsanto Technology Llc | Plastid transformation of maize |
| US7166771B2 (en) * | 2002-06-21 | 2007-01-23 | Monsanto Technology Llc | Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs |
| US7566813B2 (en) * | 2002-03-21 | 2009-07-28 | Monsanto Technology, L.L.C. | Nucleic acid constructs and methods for producing altered seed oil compositions |
| EP1484959A4 (en) * | 2002-03-21 | 2005-08-31 | Monsanto Technology Llc | NUCLEIC ACID CONSTRUCTS AND METHODS FOR PRODUCING MODIFIED SEED OIL COMPOSITIONS |
| CN1330762C (en) * | 2002-05-10 | 2007-08-08 | 北京大学 | Glyphosate tolerance-5-enolpyruvoyl shikimic acid-3-phosphoric acid synthesizing enzyme and its coding genes |
| US20040029283A1 (en) * | 2002-06-21 | 2004-02-12 | Fillatti Joanne J. | Intron double stranded RNA constructs and uses thereof |
| CA2851035C (en) | 2002-07-18 | 2018-05-29 | Stanislaw Flasinski | Methods for using artificial polynucleotides and compositions thereof to reduce transgene silencing |
| ATE546539T1 (en) | 2002-07-26 | 2012-03-15 | Basf Plant Science Gmbh | REVERSING THE NEGATIVE-SELECTIVE EFFECT OF NEGATIVE MARKER PROTEINS AS A SELECTION METHOD |
| US20070044175A1 (en) * | 2002-12-18 | 2007-02-22 | Athenix Corporation | Genes conferring herbicide resistance |
| US7078234B2 (en) | 2002-12-18 | 2006-07-18 | Monsanto Technology Llc | Maize embryo-specific promoter compositions and methods for use thereof |
| CN1745173B (en) * | 2002-12-18 | 2012-11-28 | 阿则耐克斯公司 | Genes conferring herbicide resistance |
| DK1587931T3 (en) | 2003-01-31 | 2012-07-23 | Monsanto Technology Llc | Glyphosate tolerant alfalfa events and methods for detecting them |
| ATE553203T1 (en) | 2003-02-12 | 2012-04-15 | Monsanto Technology Llc | COTTON EVENT MON 88913 AND COMPOUNDS AND METHODS FOR DETECTING THERETO |
| US7723575B2 (en) * | 2003-02-18 | 2010-05-25 | Monsanto Technology Llc | Glyphosate resistant class I 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) |
| US7888557B2 (en) * | 2003-02-22 | 2011-02-15 | Monsanto Technology Llc | Transgenic plants |
| BRPI0408896A (en) | 2003-03-28 | 2006-04-25 | Monsanto Technology Llc | plant promoters for use in early seed development |
| CA2521284C (en) | 2003-04-29 | 2014-07-08 | Pioneer Hi-Bred International, Inc. | Novel glyphosate-n-acetyltransferase (gat) genes |
| EP1921152A1 (en) | 2003-05-05 | 2008-05-14 | Monsanto Technology, LLC | Transgenic plants with glycine-betaine specific promoter |
| WO2005014820A1 (en) * | 2003-08-08 | 2005-02-17 | Si Chuan Heben Biotic Engineering Co. Ltd. | 5-enolpyruvyl-3-phosphoshikimate synthase of high glyphosate-bioresistance and coding sequence |
| PT2343364T (en) | 2003-08-25 | 2017-01-02 | Monsanto Technology Llc | Tubulin regulatory elements for use in plants |
| EP1664311A2 (en) * | 2003-09-25 | 2006-06-07 | Monsanto Technology LLC | Actin regulatory elements for use in plants |
| EP1699928B9 (en) | 2003-10-02 | 2010-11-03 | Monsanto Technology, LLC | Stacking crop improvement traits in transgenic plants |
| US7087809B2 (en) * | 2003-11-18 | 2006-08-08 | Natural Genes, Inc. | Natural herbicide resistance in wheat |
| US7807874B2 (en) | 2003-12-10 | 2010-10-05 | Monsanto Technology Llc | Stress tolerant plants and methods thereof |
| US8212113B2 (en) | 2003-12-15 | 2012-07-03 | Monsanto Technology Llc | Corn plant Mon88017 and compositions and methods for detection thereof |
| US7230162B2 (en) * | 2003-12-19 | 2007-06-12 | Monsanto Technology Llc | CEP1 gene promoter sequences from Zea mays and methods of use |
| ATE516295T1 (en) | 2004-01-20 | 2011-07-15 | Monsanto Technology Llc | CHIMERIC PROMOTORS FOR USE IN PLANTS |
| EP1723488A4 (en) * | 2004-01-21 | 2008-04-23 | Omega Genetics Llc | Glyphosate tolerant plants and methods of making and using the same |
| US7683237B2 (en) | 2004-02-10 | 2010-03-23 | Monsanto Technology Llc | Maize seed with synergistically enhanced lysine content |
| AR047598A1 (en) | 2004-02-10 | 2006-01-25 | Monsanto Technology Llc | TRANSGENIZED CORN SEED WITH GREATER AMINO ACID CONTENT |
| US20060041961A1 (en) | 2004-03-25 | 2006-02-23 | Abad Mark S | Genes and uses for pant improvement |
| BRPI0509541A (en) | 2004-03-30 | 2007-09-18 | Monsanto Technology Llc | methods for controlling plant pathogens using n-phosphonomethylglycine |
| US20070197474A1 (en) * | 2004-03-30 | 2007-08-23 | Clinton William P | Methods for controlling plants pathogens using N-phosphonomethylglycine |
| BRPI0509743A (en) | 2004-04-09 | 2007-09-25 | Monsanto Technology Llc | compositions and methods for controlling insect infestations in plants |
| US7405074B2 (en) * | 2004-04-29 | 2008-07-29 | Pioneer Hi-Bred International, Inc. | Glyphosate-N-acetyltransferase (GAT) genes |
| US7705201B2 (en) * | 2004-06-23 | 2010-04-27 | Monsanto Technology Llc | Transgenic plants expressing cytokinin biosynthetic genes and methods of use therefor |
| CN1973035A (en) * | 2004-06-24 | 2007-05-30 | 孟山都技术有限公司 | Microbial glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase |
| US20060075522A1 (en) | 2004-07-31 | 2006-04-06 | Jaclyn Cleveland | Genes and uses for plant improvement |
| EP1788861B1 (en) | 2004-08-24 | 2017-04-12 | Monsanto Technology, LLC | Adenylate translocator protein gene non-coding regulatory elements for use in plants |
| AU2005285015B2 (en) | 2004-09-13 | 2010-11-18 | Monsanto Technology Llc | Promoter molecules for use in plants |
| AU2005285014A1 (en) * | 2004-09-14 | 2006-03-23 | Monsanto Technology Llc | Promoter molecules for use in plants |
| BRPI0516039A (en) * | 2004-09-24 | 2008-08-19 | Monsanto Technology Llc | promoter molecules for use in plants |
| CN104894160B (en) | 2004-12-21 | 2020-06-05 | 孟山都技术有限公司 | Transgenic plants with improved agronomic traits |
| US20060200878A1 (en) | 2004-12-21 | 2006-09-07 | Linda Lutfiyya | Recombinant DNA constructs and methods for controlling gene expression |
| EP2765189A1 (en) | 2004-12-21 | 2014-08-13 | Monsanto Technology LLC | Recombinant DNA constructs and methods for controlling gene expression |
| US20070199095A1 (en) | 2005-10-13 | 2007-08-23 | Edwards Allen | Methods for producing hybrid seed |
| AU2005337132B2 (en) | 2004-12-21 | 2011-01-20 | Monsanto Technology, Llc | Transgenic plants with enhanced agronomic traits |
| US8314290B2 (en) | 2004-12-21 | 2012-11-20 | Monsanto Technology Llc | Temporal regulation of gene expression by MicroRNAs |
| US7534937B2 (en) * | 2004-12-29 | 2009-05-19 | Athenix Corporation | Genes conferring herbicide resistance |
| WO2006076423A2 (en) | 2005-01-12 | 2006-07-20 | Monsanto Technology, Llc | Genes and uses for plant improvement |
| WO2006096617A2 (en) | 2005-03-04 | 2006-09-14 | Monsanto Technology Llc | Mitigating necrosis in transgenic glyphosate-tolerant cotton plants treated with herbicidal glyphosate formulations |
| US20060235063A1 (en) * | 2005-03-24 | 2006-10-19 | Cheminova A/S | Method of protecting a soybean plant with flutriafol |
| AR056286A1 (en) * | 2005-03-24 | 2007-10-03 | Cheminova As | METHOD FOR PROTECTING A SOYBEAN PLANT WITH FLUTRIAFOL |
| AU2006235263B2 (en) * | 2005-04-08 | 2012-05-24 | BASF Agricultural Solutions Seed US LLC | Identification of a new class of EPSP synthases |
| BRPI0608829A2 (en) | 2005-04-19 | 2011-03-15 | Basf Plant Science Gmbh | method for transgenic expression with enhanced specificity in a plant, use of a chimeric nucleic acid construct, chimeric ribonucleotide sequence, expression construct, expression vector, nonhuman organism or transformed cell, transformed seed, and pharmaceutical preparation |
| EP1877564A2 (en) | 2005-05-05 | 2008-01-16 | Monsanto Technology, LLC | Interaction of glyphosate with photosystem ii inhibitor herbicides as a selection tool for roundup ready events |
| EP2478760A1 (en) | 2005-05-10 | 2012-07-25 | Monsanto Technology LLC | Genes and uses for plant improvement |
| AR053269A1 (en) | 2005-05-16 | 2007-04-25 | Monsanto Technology Llc | CORN PLANTS AND SEEDS WITH IMPROVEMENT OF ASPARAGIN AND PROTEIN |
| AP2693A (en) | 2005-05-27 | 2013-07-16 | Monsanto Technology Llc | Soybean event MON89788 and methods for detection thereof |
| AR054143A1 (en) * | 2005-06-21 | 2007-06-06 | Cheminova Agro As | SYNERGIC COMBINATION OF A GLIFOSATE HERBICIDE AND A TRIAZOL FUNGICIDE |
| CA2616535A1 (en) | 2005-07-29 | 2007-02-08 | Monsanto Technology Llc | Development of novel germplasm using segregates from transgenic crosses |
| EP1917360A2 (en) * | 2005-08-24 | 2008-05-07 | Pioneer Hi-Bred International Inc. | Compositions providing tolerance to multiple herbicides and methods of use thereof |
| US8993846B2 (en) | 2005-09-06 | 2015-03-31 | Monsanto Technology Llc | Vectors and methods for improved plant transformation efficiency |
| US9121028B2 (en) * | 2005-09-09 | 2015-09-01 | Monsanto Technology Llc | Selective gene expression in plants |
| MX348513B (en) | 2005-09-16 | 2017-06-16 | Devgen Nv | Methods for controlling pests using rnai. |
| ES2614943T3 (en) | 2005-09-16 | 2017-06-02 | Monsanto Technology Llc | Procedures for the genetic control of insect infestations in plants and their compositions |
| PT2275562E (en) | 2005-09-16 | 2016-01-26 | Devgen Nv | Transgenic plant-based methods for plant insect pests using rnai |
| US9708619B2 (en) | 2005-09-20 | 2017-07-18 | Basf Plant Science Gmbh | Methods for controlling gene expression using ta-siRNA |
| EP1931790B1 (en) | 2005-10-03 | 2012-01-25 | Monsanto Technology, LLC | Transgenic plant seed with increased lysine |
| US20070118928A1 (en) * | 2005-11-23 | 2007-05-24 | Yun Lin | Transgenic plant and method for altering oil and protein plant content |
| US7674958B2 (en) * | 2005-12-01 | 2010-03-09 | Athenix Corporation | GRG23 and GRG51 genes conferring herbicide resistance |
| EP1962577A4 (en) | 2005-12-21 | 2009-12-16 | Monsanto Technology Llc | TRANSGENIC PLANTS WITH IMPROVED AGRONOMIC CHARACTERISTICS |
| UA99594C2 (en) * | 2006-01-12 | 2012-09-10 | Сайбас Юроп Б.В. | Epsps mutants |
| US20080313769A9 (en) * | 2006-01-12 | 2008-12-18 | Athenix Corporation | EPSP synthase domains conferring glyphosate resistance |
| WO2007087279A2 (en) * | 2006-01-23 | 2007-08-02 | Board Of Trustees Of Michigan State University | Methods for breeding glyphosate resistant plants and compositions thereof |
| US7868228B2 (en) | 2006-01-31 | 2011-01-11 | Monsanto Technology Llc | Phosphopantetheinyl transferases from bacteria |
| AR059433A1 (en) | 2006-02-10 | 2008-04-09 | Monsanto Technology Llc | IDENTIFICATION AND USE OF WHITE GENES FOR THE CONTROL OF PARASITE PLANT NEMATODES |
| CN101421406B (en) | 2006-02-13 | 2016-08-31 | 孟山都技术有限公司 | For producing nucleic acid construct and the method that the seed oil of change forms |
| CN105385679B (en) | 2006-02-13 | 2020-05-26 | 孟山都技术有限公司 | Selecting and stabilizing dsRNA constructs |
| AR059724A1 (en) * | 2006-03-02 | 2008-04-23 | Athenix Corp | METHODS AND COMPOSITIONS TO IMPROVE ENZYMATIC ACTIVITY IN TRANSGENIC PLANTS |
| CN105475116A (en) | 2006-03-10 | 2016-04-13 | 孟山都技术有限公司 | Soybean seed and oil compositions and methods of making same |
| US7820883B2 (en) * | 2006-03-15 | 2010-10-26 | Dow Agrosciences Llc | Resistance to auxinic herbicides |
| US20100199363A1 (en) * | 2006-05-12 | 2010-08-05 | Hartley Carol J | Enzymes for degrading herbicides |
| WO2007134234A2 (en) | 2006-05-12 | 2007-11-22 | Monsanto Technology Llc | Methods and compositions for obtaining marker-free transgenic plants |
| EP2803728B1 (en) | 2006-05-16 | 2018-11-21 | Monsanto Technology LLC | Use of non-agrobacterium bacterial species for plant transformation |
| WO2007137114A2 (en) | 2006-05-17 | 2007-11-29 | Pioneer Hi-Bred International, Inc. | Artificial plant minichromosomes |
| US9045765B2 (en) * | 2006-06-09 | 2015-06-02 | Athenix Corporation | EPSP synthase genes conferring herbicide resistance |
| RU2008152187A (en) * | 2006-06-13 | 2010-07-20 | Атеникс Корпорейшн (Us) | IMPROVED EPSP SYNTHESIS: COMPOSITIONS AND METHODS OF APPLICATION |
| US7951995B2 (en) | 2006-06-28 | 2011-05-31 | Pioneer Hi-Bred International, Inc. | Soybean event 3560.4.3.5 and compositions and methods for the identification and detection thereof |
| US7968770B2 (en) * | 2006-06-28 | 2011-06-28 | Pioneer Hi-Bred International, Inc. | Methods for improving yield using soybean event 3560.4.3.5 |
| US8138393B2 (en) * | 2006-08-11 | 2012-03-20 | Monsanto Technology Llc | Production of high tryptophan maize by chloroplast targeted expression of anthranilate synthase |
| EP2048939A4 (en) | 2006-08-17 | 2010-04-28 | Monsanto Technology Llc | TRANSGENIC PLANTS WITH REINFORCED AGRONOMIC CHARACTERS |
| CL2007002532A1 (en) * | 2006-08-31 | 2008-01-11 | Monsanto Technology Llc Soc Organizada Bajo Las Leyes Del Estado De Delaware | Procedure to identify genes that confer improved traits of a plant population. |
| ES2655700T3 (en) | 2006-08-31 | 2018-02-21 | Monsanto Technology, Llc | Small RNAs in phase |
| AU2007352460C1 (en) | 2006-10-12 | 2013-05-23 | Monsanto Technology, Llc | Plant microRNAs and methods of use thereof |
| AU2007310975B2 (en) | 2006-10-18 | 2012-09-27 | Seminis Vegetable Seeds, Inc. | Carrots having increased lycopene content |
| US7851673B2 (en) | 2006-12-15 | 2010-12-14 | Agrinomics Llc | Generation of plants with altered oil, protein, or fiber content |
| US7714201B2 (en) * | 2006-12-22 | 2010-05-11 | Monsanto Technology Llc | Cotton variety 781000G |
| CN101646769A (en) | 2007-02-20 | 2010-02-10 | 孟山都技术公司 | invertebrate microRNA |
| AU2015203032B2 (en) * | 2007-02-26 | 2017-03-02 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of dmo and uses thereof |
| AU2007347785A1 (en) * | 2007-02-28 | 2008-09-04 | Athenix Corporation | Methods and compositions for improved enzyme activity in transgenic plants |
| US10036036B1 (en) | 2007-03-15 | 2018-07-31 | Monsanto Technology Llc | Compositions and methods for deploying a transgenic refuge as a seed blend |
| US7723580B2 (en) * | 2007-04-12 | 2010-05-25 | Dow Agrosciences Llc | Canola cultivar DN040844 |
| US7723577B2 (en) * | 2007-04-12 | 2010-05-25 | Dow Agrosciences Llc | Canola cultivar DN040847 |
| AU2008240142B2 (en) * | 2007-04-12 | 2014-11-06 | Corteva Agriscience Llc | Novel canola cultivars having high yield and stabilized fatty acid profiles |
| US7728195B2 (en) * | 2007-04-12 | 2010-06-01 | Dow Agrosciences Llc | Canola cultivar DN040856 |
| US7723581B2 (en) * | 2007-04-12 | 2010-05-25 | Dow Agrosciences Llc | Canola cultivar DN040845 |
| US7723579B2 (en) * | 2007-04-12 | 2010-05-25 | Dow Agrosciences Llc | Canola cultivar DN040244 |
| US7718852B2 (en) * | 2007-04-12 | 2010-05-18 | Dow Agrosciences Llc | Canola cultivar DN040241 |
| US7723578B2 (en) * | 2007-04-12 | 2010-05-25 | Dow Agrosciences Llc | Canola cultivar DN040839 |
| US7723582B2 (en) * | 2007-04-12 | 2010-05-25 | Dow Agrosciences Llc | Canola cultivar DN041100 |
| PL2193714T3 (en) | 2007-04-25 | 2012-01-31 | Syngenta Participations Ag | Fungicidal compositions |
| DK2840142T3 (en) | 2007-06-06 | 2019-03-18 | Monsanto Technology Llc | Genes and uses for plant improvement |
| US20110265221A1 (en) | 2007-07-10 | 2011-10-27 | Monsanto Technology Llc | Transgenic plants with enhanced agronomic traits |
| US8399218B2 (en) * | 2007-09-27 | 2013-03-19 | Dow Agrosciences, Llc | Engineered zinc finger proteins targeting 5-enolpyruvyl shikimate-3-phosphate synthase genes |
| BRPI0817911B8 (en) | 2007-10-05 | 2022-06-28 | Dow Agrosciences Llc | PROCESSES FOR TRANSFER OF MOLECULAR SUBSTANCES INTO PLANT CELLS AND PROCESS FOR EXPRESSION OF A GENE |
| US7709705B2 (en) * | 2007-11-16 | 2010-05-04 | Monsanto Technology Llc | Cotton variety 04T056 |
| US7709706B2 (en) * | 2007-11-16 | 2010-05-04 | Monsanto Technology Llc | Cotton variety 04P024 |
| US7718854B2 (en) * | 2007-11-16 | 2010-05-18 | Monsanto Technology Llc | Cotton variety 04T042 |
| US7825300B2 (en) * | 2007-11-16 | 2010-11-02 | Monsanto Technology Llc | Cotton variety 04T067 |
| US7728206B2 (en) * | 2007-11-16 | 2010-06-01 | Monsanto Technology Llc | Cotton variety 05T103 |
| US7750212B2 (en) * | 2007-11-16 | 2010-07-06 | Monsanto Technology Llc | Cotton variety 04P011 |
| US7714202B2 (en) * | 2007-11-19 | 2010-05-11 | Monsanto Technology Llc | Cotton variety 04Z007 |
| US7750213B2 (en) * | 2007-11-19 | 2010-07-06 | Monsanto Technology Llc | Cotton variety 04Z353 |
| US7825301B2 (en) * | 2007-11-19 | 2010-11-02 | Monsanto Technology Llc | Cotton variety 02Z89 |
| WO2009085982A1 (en) * | 2007-12-19 | 2009-07-09 | Monsanto Technology Llc | Method to enhance yield and purity of hybrid crops |
| US7799972B2 (en) * | 2007-12-21 | 2010-09-21 | Monsanto Technology Llc | Cotton variety 05H284 |
| US7732679B2 (en) * | 2007-12-21 | 2010-06-08 | Monsanto Technology Llc | Cotton variety 05H210 |
| US7745704B2 (en) * | 2007-12-21 | 2010-06-29 | Monsanto Technology Llc | Cotton variety 04V073 |
| US7737333B2 (en) * | 2007-12-21 | 2010-06-15 | Monsanto Technology Llc | Cotton variety 00H29 |
| US7741543B2 (en) * | 2007-12-21 | 2010-06-22 | Monsanto Technology Llc | Cotton variety 03H070 |
| US7737335B2 (en) * | 2007-12-21 | 2010-06-15 | Monsanto Technology Llc | Cotton variety 05H270 |
| US7737332B2 (en) * | 2007-12-21 | 2010-06-15 | Monsanto Technology Llc | Cotton variety 05Z855 |
| US7737334B2 (en) * | 2007-12-21 | 2010-06-15 | Monsanto Technology Llc | Cotton variety 05H229 |
| CN101932701A (en) * | 2008-02-01 | 2010-12-29 | 阿森尼克斯公司 | Directed evolution of GRG31 and GRG36 EPSP synthases |
| EP2240027A2 (en) | 2008-02-05 | 2010-10-20 | Basf Se | Plant health composition |
| US7923606B2 (en) * | 2008-02-18 | 2011-04-12 | Monsanto Technology Llc | Cotton variety DP 161 B2RF |
| US7803997B2 (en) * | 2008-02-18 | 2010-09-28 | Monsanto Technology Llc | Cotton variety 05V341 |
| US7829766B2 (en) * | 2008-02-18 | 2010-11-09 | Monsanto Technology Llc | Cotton variety PM 2141 B2RF |
| CL2009000440A1 (en) | 2008-02-29 | 2010-11-12 | Monsanto Technology Llc | Polynucleotides comprising a truncated rice actin promoter operatively linked to the cspb gene, a corn chromosome comprising said polycleotide, a procedure for the generation of drought-resistant plant species, and food based on seeds of said plant species. |
| WO2009110924A1 (en) * | 2008-03-03 | 2009-09-11 | Ms Technologies Llc | Antibodies immunoreactive with mutant 5-enolpyruvlshikimate-3-phosphate synthase |
| US7919689B2 (en) | 2008-03-05 | 2011-04-05 | Monsanto Technology Llc | Cotton variety 09Q914DF |
| US7829767B2 (en) * | 2008-03-13 | 2010-11-09 | Monsanto Technology Llc | Cotton variety 04Q035 |
| US7820887B2 (en) * | 2008-03-13 | 2010-10-26 | Monsanto Technology Llc | Cotton variety 05Q153 |
| US7825302B2 (en) | 2008-03-13 | 2010-11-02 | Monsanto Technology Llc | Cotton variety 03Q066 |
| US7923607B2 (en) * | 2008-03-14 | 2011-04-12 | Monsanto Technology Llc | Cotton variety 05Y070 |
| US7825303B2 (en) * | 2008-03-14 | 2010-11-02 | Monsanto Technology Llc | Cotton variety 04Y288 |
| US7919690B2 (en) * | 2008-03-14 | 2011-04-05 | Monsanto Technology Llc | Cotton variety 05Y067 |
| US8039699B2 (en) | 2008-03-20 | 2011-10-18 | Monsanto Technology Llc | Cotton variety 303308G |
| US8039698B2 (en) * | 2008-03-20 | 2011-10-18 | Monsanto Technology Llc | Cotton variety 779020G |
| US8039701B2 (en) * | 2008-03-20 | 2011-10-18 | Monsanto Technology Llc | Cotton variety 565452G |
| US8039700B2 (en) * | 2008-03-20 | 2011-10-18 | Monsanto Technology Llc | Cotton variety 468300G |
| PT2262896E (en) | 2008-04-07 | 2014-04-28 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| US8536406B2 (en) * | 2008-04-28 | 2013-09-17 | Michigan Technological University | COMT1 gene fiber-specific promoter elements from poplar |
| US20130333068A1 (en) | 2008-04-29 | 2013-12-12 | Marie Coffin | Genes and uses for plant enhancement |
| US7935870B2 (en) * | 2008-05-14 | 2011-05-03 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV354718 |
| US7964774B2 (en) * | 2008-05-14 | 2011-06-21 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV384196 |
| US8829282B2 (en) * | 2008-05-14 | 2014-09-09 | Monsanto Technology, Llc | Plants and seeds of spring canola variety SCV425044 |
| US7947877B2 (en) * | 2008-05-14 | 2011-05-24 | Monosanto Technology LLC | Plants and seeds of spring canola variety SCV328921 |
| ES2563485T3 (en) | 2008-07-01 | 2016-03-15 | Monsanto Technology Llc | Recombinant DNA constructs and procedures to modulate the expression of a target gene |
| EP3023499A1 (en) | 2008-07-16 | 2016-05-25 | Monsanto Technology LLC | Methods and vectors for producing transgenic plants |
| CN103834675A (en) | 2008-09-26 | 2014-06-04 | 巴斯夫农化产品有限公司 | Herbicide-resistant ahas-mutants and methods of use |
| WO2010037016A1 (en) | 2008-09-29 | 2010-04-01 | Monsanto Technology Llc | Soybean transgenic event mon87705 and methods for detection thereof |
| WO2010045324A1 (en) | 2008-10-14 | 2010-04-22 | Monsanto Technology Llc | Utilization of fatty acid desaturases from hemiselmis spp. |
| AR075466A1 (en) | 2008-10-22 | 2011-04-06 | Basf Se | USE OF AUXINE TYPE HERBICIDES IN CULTIVATED PLANTS |
| WO2010046423A2 (en) | 2008-10-22 | 2010-04-29 | Basf Se | Use of sulfonylurea herbicides on cultivated plants |
| US7820888B2 (en) * | 2008-10-27 | 2010-10-26 | Monsanto Technology Llc | Cotton variety MCS0701B2RF |
| US7935871B2 (en) | 2008-10-27 | 2011-05-03 | Monsanto Technology Llc | Cotton variety MCS0711B2RF |
| US7825304B2 (en) | 2008-10-27 | 2010-11-02 | Monsanto Technology Llc | Cotton variety MCS0702B2RF |
| US7947880B2 (en) | 2008-10-27 | 2011-05-24 | Monsanto Technology Llc | Cotton variety MX0623B2RF |
| US7939727B2 (en) * | 2008-10-27 | 2011-05-10 | Monsanto Technology Llc | Cotton variety MCS0747B2RF |
| US7935872B2 (en) | 2008-10-27 | 2011-05-03 | Monsanto Technology Llc | Cotton variety MX0622B2RF |
| US7943829B2 (en) * | 2008-10-30 | 2011-05-17 | Monsanto Technology Llc | Cotton variety 07W590DF |
| US7947881B2 (en) * | 2008-10-30 | 2011-05-24 | Monsanto Technology Llc | Cotton variety 07W514DF |
| US7943830B2 (en) * | 2008-10-30 | 2011-05-17 | Monsanto Technology Llc | Cotton variety 07W901DF |
| US8022277B2 (en) * | 2008-10-30 | 2011-09-20 | Monsanto Technology Llc | Cotton variety 07W505DF |
| US7943828B2 (en) * | 2008-10-30 | 2011-05-17 | Monsanto Technology Llc | Cotton variety 07X440DF |
| US8183440B2 (en) * | 2008-10-30 | 2012-05-22 | Monsanto Technology Llc | Cotton variety 07W902DF |
| US8044272B2 (en) | 2008-10-30 | 2011-10-25 | Monsanto Technology Llc | Cotton variety 06T201F |
| US7960620B2 (en) * | 2008-10-30 | 2011-06-14 | Monsanto Technology Llc | Cotton variety 07W903DF |
| CA2741211A1 (en) * | 2008-11-04 | 2010-05-14 | Dow Agrosciences Llc | Omega-9 quality brassica juncea |
| US20110258735A1 (en) | 2008-12-22 | 2011-10-20 | Marie Coffin | Genes and uses for plant enhancement |
| US20120277117A1 (en) | 2009-02-27 | 2012-11-01 | Adel Zayed | Hydroponic apparatus and methods of use |
| US7838737B1 (en) * | 2009-04-16 | 2010-11-23 | Pioneer Hi-Bred International, Inc. | Soybean variety XB39N09 |
| JP2012523850A (en) | 2009-04-20 | 2012-10-11 | モンサント テクノロジー エルエルシー | Multiple virus resistance in plants |
| WO2010132214A1 (en) * | 2009-05-15 | 2010-11-18 | University Of Tennessee Research Foundation | Environmental stress-inducible promoter and its application in crops |
| CN101886088B (en) * | 2009-05-15 | 2013-04-17 | 北京大学 | Transgenic structure and transgenic plant |
| US10555527B2 (en) | 2009-05-18 | 2020-02-11 | Monsanto Technology Llc | Use of glyphosate for disease suppression and yield enhancement in soybean |
| CA2765034A1 (en) | 2009-06-09 | 2010-12-23 | Pioneer Hi-Bred International, Inc. | Early endosperm promoter and methods of use |
| US8071848B2 (en) * | 2009-06-17 | 2011-12-06 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV218328 |
| US20120149572A1 (en) | 2009-06-25 | 2012-06-14 | Basf Se | Use of agrochemical mixtures for increasing the health of a plant |
| EP2275564A1 (en) | 2009-07-17 | 2011-01-19 | Freie Universität Berlin | Means and method for the production of transgenic plants that are resistant to clubroot |
| NZ750559A (en) | 2009-08-27 | 2023-01-27 | Pastoral Greenhouse Gas Res Ltd | Complete genome sequence of the methanogen methanobrevibacter ruminantium |
| BR112012004949A2 (en) * | 2009-09-03 | 2019-09-24 | Advanced Biological Marketing | herbicide resistant inoculant strains |
| WO2011050271A1 (en) | 2009-10-23 | 2011-04-28 | Monsanto Technology Llc | Methods and compositions for expression of transgenes in plants |
| CN102597244B (en) | 2009-10-26 | 2014-07-23 | 先锋国际良种公司 | Somatic ovule specific promoter and methods of use |
| CN102595879B (en) | 2009-11-06 | 2014-08-06 | 巴斯夫欧洲公司 | Crystalline complexes of 4-hydroxybenzoic acid and selected pesticides |
| TW201142029A (en) | 2009-11-24 | 2011-12-01 | Univ Leuven Kath | Banana promoters |
| GB0920891D0 (en) | 2009-11-27 | 2010-01-13 | Syngenta Participations Ag | Herbicidal compositions |
| US20120245031A1 (en) | 2009-12-08 | 2012-09-27 | Basf Se | Pesticidal Mixtures |
| NZ600883A (en) | 2009-12-08 | 2013-06-28 | Basf Se | An agrochemical pesticidal mixture for increasing the yield and health of a plant |
| UY33142A (en) | 2009-12-23 | 2011-07-29 | Bayer Cropscience Ag | TOLERANT PLANTS TO INHIBITING HERBICIDES OF HPPD |
| UY33140A (en) | 2009-12-23 | 2011-07-29 | Bayer Cropscience Ag | TOLERANT PLANTS TO INHIBITING HERBICIDES OF HPPD |
| AU2010334815B2 (en) | 2009-12-23 | 2015-07-09 | Bayer Intellectual Property Gmbh | Plants tolerant to HPPD inhibitor herbicides |
| MX2012007360A (en) | 2009-12-23 | 2012-11-06 | Bayer Ip Gmbh | Plants tolerant to hppd inhibitor herbicides. |
| BR112012015690A2 (en) | 2009-12-23 | 2015-08-25 | Bayer Intelectual Property Gmbh | Herbicide tolerant plants of hppd inhibitors. |
| US8704041B2 (en) | 2009-12-30 | 2014-04-22 | Pioneer Hi Bred International Inc | Methods and compositions for targeted polynucleotide modification |
| WO2011082318A2 (en) | 2009-12-30 | 2011-07-07 | Pioneer Hi-Bred International, Inc. | Methods and compositions for the introduction and regulated expression of genes in plants |
| BR112012019582B1 (en) | 2010-01-14 | 2021-09-21 | Monsanto Technology Llc | DNA MOLECULE COMPRISING PLANT REGULATORY ELEMENTS |
| CA2787698C (en) | 2010-01-25 | 2018-07-31 | Bayer Cropscience Nv | Methods for manufacturing plant cell walls comprising chitin |
| US9970021B2 (en) | 2010-01-26 | 2018-05-15 | Pioneer Hi-Bred International, Inc. | HPPD-inhibitor herbicide tolerance |
| US20120311743A1 (en) | 2010-02-02 | 2012-12-06 | Bayer Cropscience Ag | Soybean transformation using hppd inhibitors as selection agents |
| US8378177B2 (en) * | 2010-02-03 | 2013-02-19 | Dow Agrosciences, Llc | Canola cultivar DN051493 |
| US8203050B2 (en) * | 2010-02-24 | 2012-06-19 | Monsanto Technology Llc | Cotton variety 09R555B2R2 |
| US8207416B2 (en) * | 2010-02-24 | 2012-06-26 | Monsanto Technology Llc | Cotton variety 09R549B2R2 |
| US8207417B2 (en) * | 2010-02-24 | 2012-06-26 | Monsanto Technology Llc | Cotton variety 09R550B2R2 |
| US8207418B2 (en) * | 2010-02-24 | 2012-06-26 | Monsanto Technology Llc | Cotton variety 09R619B2R2 |
| US8203049B2 (en) * | 2010-02-24 | 2012-06-19 | Monsanto Technology Llc | Cotton variety 09R796B2R2 |
| US8138394B2 (en) * | 2010-02-26 | 2012-03-20 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV431158 |
| US8148611B2 (en) * | 2010-02-26 | 2012-04-03 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV453784 |
| US8143488B2 (en) * | 2010-02-26 | 2012-03-27 | Monsanto Technoloy LLC | Plants and seeds of spring canola variety SCV470336 |
| US8581048B2 (en) * | 2010-03-09 | 2013-11-12 | Monsanto Technology, Llc | Plants and seeds of spring canola variety SCV119103 |
| US8207419B2 (en) * | 2010-03-10 | 2012-06-26 | Monsanto Technology Llc | Cotton variety 09R798B2R2 |
| US8207420B2 (en) * | 2010-03-11 | 2012-06-26 | Monsanto Technology Llc | Cotton variety 09R615B2R2 |
| US8153865B2 (en) * | 2010-03-11 | 2012-04-10 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV152154 |
| US8203051B2 (en) * | 2010-03-11 | 2012-06-19 | Monsanto Technology Llc | Cotton variety 09R605B2R2 |
| EP2552191B1 (en) | 2010-03-31 | 2020-11-04 | Dow AgroSciences, LLC | Plant peptide gamma-zein for delivery of biomolecules into plant cells |
| US8252987B2 (en) | 2010-04-14 | 2012-08-28 | Monsanto Technology Llc | Cotton variety 09R643B2R2 |
| US8269075B2 (en) | 2010-04-14 | 2012-09-18 | Monsanto Technology Llc | Cotton variety 09R999B2R2 |
| US8283533B2 (en) | 2010-04-14 | 2012-10-09 | Monsanto Technology Llc | Cotton variety 09R573B2R2 |
| AU2011242727B2 (en) | 2010-04-20 | 2015-09-10 | Seminis Vegetable Seeds, Inc. | White-stem trait containing plants |
| US8273968B2 (en) | 2010-05-07 | 2012-09-25 | Monsanto Technology Llc | Cotton variety 09R303B2R2 |
| US20130085066A1 (en) | 2010-05-31 | 2013-04-04 | Basf Se | Method for Increasing the Health of a Plant |
| WO2011161131A1 (en) | 2010-06-25 | 2011-12-29 | Basf Se | Herbicidal mixtures |
| WO2011161132A1 (en) | 2010-06-25 | 2011-12-29 | Basf Se | Pesticidal mixtures |
| CA2804168C (en) | 2010-07-07 | 2020-02-18 | Dow Agrosciences Llc | Linear dna molecule delivery using pegylated quantum dots for stable transformation in plants |
| CN101914159B (en) * | 2010-07-13 | 2012-05-30 | 南京农业大学 | Polyclonal antibody with specific antigen-antibody reaction with CP4-EPSPS protein and its application |
| CA2805937A1 (en) | 2010-08-13 | 2012-02-16 | Pioneer Hi-Bred International, Inc. | Chimeric promoters and methods of use |
| WO2012022729A2 (en) | 2010-08-20 | 2012-02-23 | Basf Se | Method for improving the health of a plant |
| US20130157856A1 (en) | 2010-08-24 | 2013-06-20 | Basf Se | Agrochemical Mixtures for Increasing the Health of a Plant |
| US9222100B2 (en) | 2010-08-24 | 2015-12-29 | Monsanto Technology Llc | Methods and DNA constructs for autoregulating transgene silencing |
| KR20140016865A (en) | 2010-08-30 | 2014-02-10 | 다우 아그로사이언시즈 엘엘씨 | Sugarcane bacilliform viral(scbv) enhancer and its use in plant functional genomics |
| CA2813112A1 (en) | 2010-10-07 | 2012-04-12 | Basf Se | Use of strobilurins for increasing the gluten strength in winter cereals |
| EP2669370B1 (en) | 2010-11-10 | 2016-06-01 | Bayer CropScience AG | HPPD variants and methods of use |
| WO2012071039A1 (en) | 2010-11-24 | 2012-05-31 | Pioner Hi-Bred International, Inc. | Brassica gat event dp-061061-7 and compositions and methods for the identification and/or detection thereof |
| UA122558C2 (en) | 2010-11-24 | 2020-12-10 | Піонер Хай-Бред Інтернешнл, Інк. | Brassica gat event dp-073496-4 and compositions and methods for the identification and/or detection thereof |
| WO2012074868A2 (en) | 2010-12-03 | 2012-06-07 | Ms Technologies, Llc | Optimized expression of glyphosate resistance encoding nucleic acid molecules in plant cells |
| CN103562392B (en) * | 2010-12-03 | 2016-07-20 | Ms技术有限责任公司 | The optimization expression of plant cell glyphosate resistance coding nucleic acid molecule |
| UA115766C2 (en) | 2010-12-03 | 2017-12-26 | ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі | Stacked herbicide tolerance event 8264.44.06.1, related transgenic soybean lines, and detection thereof |
| TWI667347B (en) | 2010-12-15 | 2019-08-01 | 瑞士商先正達合夥公司 | Soybean event syht0h2 and compositions and methods for detection thereof |
| CA2821154A1 (en) | 2010-12-22 | 2012-06-28 | Pioneer Hi-Bred International, Inc. | Viral promoter, truncations thereof, and methods of use |
| US20130274104A1 (en) | 2010-12-22 | 2013-10-17 | Basf Se | Agrochemical mixtures for increasing the health of a plant |
| BR112013014698A2 (en) | 2010-12-22 | 2017-03-07 | E I Du Point De Nemours & Company | dna construct, vector, plant cell, plant, transgenic plant-derived seed, method for expression of a nucleotide sequence in a plant, method for expression of a nucleotide sequence in a plant cell, method for selectively expressing a nucleotide sequence in corn root, stem, grain and tassel tissues |
| UY33854A (en) | 2010-12-30 | 2012-07-31 | Dow Agrosciences Llc | NUCLEIC ACID MOLECULES THAT GO TO SUBUNITY C OF THE VACUOLAR ATPASA AND CONFERENCE RESISTANCE TO PATHOPHERAL PESTS |
| US8558064B2 (en) | 2010-12-30 | 2013-10-15 | Agrigenetics, Inc. | Canola cultivar CL31613 |
| US9603322B2 (en) | 2010-12-30 | 2017-03-28 | Agrigenetics, Inc. | Canola cultivars having high yield and stabilized fatty acid profiles |
| US8563810B2 (en) | 2010-12-30 | 2013-10-22 | Agrigenetics, Inc. | Canola cultivar DN040244A |
| BRPI1107329A2 (en) | 2010-12-30 | 2019-11-19 | Dow Agrosciences Llc | nucleic acid molecules that target the vacuolar atpase h-subunit that confer resistance to Coleoptera pests, plant transformation vector, transformed cell, as well as methods for controlling a Coleoptera pest population, controlling an infestation by said pest, improving the yield of a crop and to produce a transgenic cell |
| US8558065B2 (en) | 2010-12-30 | 2013-10-15 | Agrigenetics, Inc. | Canola cultivar G31064 |
| US8530726B2 (en) | 2010-12-30 | 2013-09-10 | Agrigenetics, Inc. | Canola cultivar G030994 |
| US8563811B2 (en) | 2010-12-30 | 2013-10-22 | Agrigenetics, Inc. | Canola cultivar DN040845A |
| AP2013007016A0 (en) | 2010-12-30 | 2013-07-31 | Dow Agrosciences Llc | Nucleic acid molecules that confer resistance to colepteran pests |
| US8921669B2 (en) | 2011-01-09 | 2014-12-30 | Monsanto Technology Llc | Cotton variety 10R052B2R2 |
| US8779251B2 (en) | 2011-01-09 | 2014-07-15 | Monsanto Technology Llc | Cotton variety 09R532B2R2 |
| US8921668B2 (en) | 2011-01-09 | 2014-12-30 | Monsanto Technology Llc | Cotton variety 09R536B2R2 |
| US8772605B2 (en) | 2011-01-26 | 2014-07-08 | Monsanto Technology Llc | Cotton variety 09R348B2R2 |
| US8772604B2 (en) | 2011-01-31 | 2014-07-08 | Monsanto Technology Llc | Cotton variety 10R011B2R2 |
| GB201101743D0 (en) | 2011-02-01 | 2011-03-16 | Syngenta Ltd | Herbicidal compositions |
| US8916377B2 (en) | 2011-02-15 | 2014-12-23 | Pioneer Hi Bred International Inc | Root-preferred promoter and methods of use |
| RU2642297C2 (en) | 2011-02-22 | 2018-01-24 | Агридженетикс, Инк. | Germ plasm of canola possessing compositional properties of seeds, which provide increased nutrition, nutritive value of canola |
| CA2830531C (en) | 2011-03-23 | 2019-10-15 | Dow Agrosciences Llc | Quantum dot carrier peptide conjugates suitable for imaging and delivery applications in plants |
| CA2830802A1 (en) | 2011-03-25 | 2012-10-04 | Bayer Intellectual Property Gmbh | Use of n-(1,2,5-oxadiazol-3-yl)benzamides for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides |
| JP5847921B2 (en) | 2011-03-25 | 2016-01-27 | バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH | N- (tetrazol-4-yl)-or N- (triazol-3-yl) arylcarboxamides for controlling unwanted plants in areas of transgenic crops resistant to HPPD inhibitor type herbicides or Use of those salts |
| US8513487B2 (en) | 2011-04-07 | 2013-08-20 | Zenon LISIECZKO | Plants and seeds of spring canola variety ND-662c |
| US8513494B2 (en) | 2011-04-08 | 2013-08-20 | Chunren Wu | Plants and seeds of spring canola variety SCV695971 |
| US20140206850A1 (en) | 2011-04-29 | 2014-07-24 | Keygene N.V. | Glyphosate resistance enhancement |
| US8507761B2 (en) | 2011-05-05 | 2013-08-13 | Teresa Huskowska | Plants and seeds of spring canola variety SCV372145 |
| US8513495B2 (en) | 2011-05-10 | 2013-08-20 | Dale Burns | Plants and seeds of spring canola variety SCV291489 |
| CA2997731C (en) | 2011-05-13 | 2020-05-26 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| US8735662B2 (en) | 2011-05-16 | 2014-05-27 | Nunhems B.V. | Lettuce variety salmon |
| US9150625B2 (en) | 2011-05-23 | 2015-10-06 | E I Du Pont De Nemours And Company | Chloroplast transit peptides and methods of their use |
| US8969667B2 (en) | 2011-05-26 | 2015-03-03 | Monsanto Technology Llc | Cotton variety 10R008B2R2 |
| US9179689B2 (en) | 2011-05-26 | 2015-11-10 | Monsanto Technology Llc | Cotton variety 10R047B2R2 |
| US9179620B2 (en) | 2011-05-26 | 2015-11-10 | Monsanto Technology Llc | Cotton variety 10R040B2R2 |
| US8975487B2 (en) | 2011-05-26 | 2015-03-10 | Monsanto Technology Llc | Cotton variety 11R159B2R2 |
| US9066485B2 (en) | 2011-05-26 | 2015-06-30 | Monsanto Technology Llc | Cotton variety 10R051B2R2 |
| US9179688B2 (en) | 2011-05-26 | 2015-11-10 | Monsanto Technology Llc | Cotton variety 10R015B2R2 |
| US9066484B2 (en) | 2011-05-26 | 2015-06-30 | Monsanto Technology Llc | Cotton variety 10R013B2R2 |
| GB201109239D0 (en) | 2011-06-01 | 2011-07-13 | Syngenta Participations Ag | Herbicidal compositions |
| PE20141518A1 (en) | 2011-07-01 | 2014-11-17 | Monsanto Technology Llc | METHODS AND COMPOSITIONS FOR THE SELECTIVE REGULATION OF PROTEIN EXPRESSION |
| US9951346B2 (en) | 2011-08-03 | 2018-04-24 | Pioneer Hi-Bred International, Inc. | Methods and compositions for targeted integration in a plant |
| US8785729B2 (en) | 2011-08-09 | 2014-07-22 | Nunhems, B.V. | Lettuce variety redglace |
| US8759618B2 (en) | 2011-08-17 | 2014-06-24 | Stine Seed Farm, Inc. | Maize event HCEM485, compositions and methods for detecting and use thereof |
| US8754293B2 (en) | 2011-09-09 | 2014-06-17 | Nunhems B.V. | Lettuce variety intred |
| EP3434779A1 (en) | 2011-09-13 | 2019-01-30 | Monsanto Technology LLC | Methods and compositions for weed control |
| AU2012308737B2 (en) | 2011-09-13 | 2018-06-14 | Monsanto Technology Llc | Methods and compositions for weed control |
| CA2848669A1 (en) | 2011-09-13 | 2013-03-21 | Monsanto Technology Llc | Methods and compositions for weed control targeting epsps |
| US9210857B1 (en) | 2011-11-21 | 2015-12-15 | Agrigenetics, Inc. | Canola inbred CL102407R |
| US9204601B1 (en) | 2011-11-21 | 2015-12-08 | Agrigenetics, Inc. | Canola inbred CL60855R |
| US9204602B1 (en) | 2011-11-21 | 2015-12-08 | Agrigenetics, Inc. | Canola inbred CL77606R |
| WO2013096810A1 (en) | 2011-12-21 | 2013-06-27 | The Curators Of The University Of Missouri | Soybean variety s05-11482 |
| WO2013096818A1 (en) | 2011-12-21 | 2013-06-27 | The Curators Of The University Of Missouri | Soybean variety s05-11268 |
| WO2013097940A1 (en) | 2011-12-30 | 2013-07-04 | Genoplante-Valor | Plants having a modulated content in seed proteins and method for production thereof |
| US9380756B2 (en) | 2012-01-04 | 2016-07-05 | Nunhems B.V. | Lettuce variety multigreen 50 |
| US20130180008A1 (en) | 2012-01-06 | 2013-07-11 | Pioneer Hi Bred International Inc | Ovule Specific Promoter and Methods of Use |
| US9006515B2 (en) | 2012-01-06 | 2015-04-14 | Pioneer Hi Bred International Inc | Pollen preferred promoters and methods of use |
| AR089793A1 (en) | 2012-01-27 | 2014-09-17 | Du Pont | METHODS AND COMPOSITIONS TO GENERATE COMPOSITE TRANSGENIC RISK LOCUS |
| JP6208692B2 (en) | 2012-02-02 | 2017-10-04 | ダウ アグロサイエンシィズ エルエルシー | Plant transactivation interaction motifs and uses thereof |
| EP2809787B8 (en) | 2012-02-02 | 2019-01-09 | Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET) | HaHB11 PROVIDES IMPROVED PLANT YIELD AND TOLERANCE TO ABIOTIC STRESS |
| IN2014DN06986A (en) | 2012-02-29 | 2015-04-10 | Dow Agrosciences Llc | |
| WO2013136274A1 (en) | 2012-03-13 | 2013-09-19 | University Of Guelph | Myb55 promoter and use thereof |
| WO2013148330A1 (en) | 2012-03-26 | 2013-10-03 | Pronutria, Inc. | Nutritive fragments, proteins and methods |
| AU2013242103A1 (en) | 2012-03-29 | 2014-10-16 | Basf Se | Co-crystals of dicamba and a co-crystal former B |
| US8835720B2 (en) | 2012-04-26 | 2014-09-16 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV967592 |
| US8859857B2 (en) | 2012-04-26 | 2014-10-14 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV259778 |
| US8802935B2 (en) | 2012-04-26 | 2014-08-12 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV942568 |
| US8878009B2 (en) | 2012-04-26 | 2014-11-04 | Monsanto Technology, LLP | Plants and seeds of spring canola variety SCV318181 |
| WO2013184764A2 (en) | 2012-06-07 | 2013-12-12 | Dow Agrosciences Llc | Construct and method for expressing transgenes using a brassica bidirectional constitutive promoter |
| CA2876426A1 (en) | 2012-06-15 | 2013-12-19 | E. I. Du Pont De Nemours And Company | Methods and compositions involving als variants with native substrate preference |
| CN103290036B (en) * | 2012-06-28 | 2014-11-05 | 北京未名凯拓作物设计中心有限公司 | 5-enolpyruvyl-shikimate-3-phosphate (EPSP) synthase gene from ochrobactrum anthropi and application thereof |
| US9433165B2 (en) | 2012-07-01 | 2016-09-06 | Monsanto Technology Llc | Cotton variety 11R110B2R2 |
| US9374957B2 (en) | 2012-07-01 | 2016-06-28 | Monsanto Technology Llc | Cotton variety 11R115B2R2 |
| US9237698B2 (en) | 2012-07-01 | 2016-01-19 | Monsanto Technology Llc | Cotton variety 11R136B2R2 |
| US9370150B2 (en) | 2012-07-01 | 2016-06-21 | Monsanto Technology Llc | Cotton variety 11R124B2R2 |
| US9237699B2 (en) | 2012-07-01 | 2016-01-19 | Monsanto Technology Llc | Cotton variety 11R154B2R2 |
| US9433164B2 (en) | 2012-07-01 | 2016-09-06 | Monsanto Technology Llc | Cotton variety 11R112B2R2 |
| EP2877581B1 (en) | 2012-07-26 | 2017-11-29 | Dow AgroSciences LLC | High-throughput dna fragment assembly |
| AU2012208997B1 (en) | 2012-07-30 | 2013-09-19 | Dlf Usa Inc. | An alfalfa variety named magnum salt |
| CN104662156A (en) | 2012-08-17 | 2015-05-27 | 美国陶氏益农公司 | Use of a maize untranslated region for transgene expression in plants |
| HK1217732A1 (en) | 2012-09-07 | 2017-01-20 | 美国陶氏益农公司 | Fad3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks |
| UA118090C2 (en) | 2012-09-07 | 2018-11-26 | ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі | METHOD OF THE METHER OF THE METHOD OF THE INTEGRED EMBLED SUBSTITUTION OF NUCLEIC NUCLE OF NUCLEIC ACID AND NON-NUCLIC ACID AND NON-SPECIAL SPECIES |
| AU2013224677B2 (en) | 2012-09-13 | 2017-05-11 | Plant Bioscience Limited | Brassica oleracea plants with improved nutritional value |
| AU2013224684B2 (en) | 2012-09-13 | 2017-07-06 | Plant Bioscience Limited | GENETIC MARKERS FOR Myb28 |
| MY196630A (en) | 2012-09-14 | 2023-04-23 | BASF Agricultural Solutions Seed US LLC | Hppd Variants and Methods of use |
| EP2903437A1 (en) | 2012-10-01 | 2015-08-12 | Basf Se | Use of n-thio-anthranilamide compounds on cultivated plants |
| WO2014059155A1 (en) | 2012-10-11 | 2014-04-17 | Pioneer Hi-Bred International, Inc. | Guard cell promoters and uses thereof |
| WO2014079820A1 (en) | 2012-11-22 | 2014-05-30 | Basf Se | Use of anthranilamide compounds for reducing insect-vectored viral infections |
| WO2014084884A1 (en) | 2012-11-28 | 2014-06-05 | Monsanto Technology Llc | Transgenic plants with enhanced traits |
| US9414556B1 (en) | 2012-11-29 | 2016-08-16 | Agrigenetics, Inc. | Canola inbred restorer line G98014R |
| US9447430B1 (en) | 2012-11-29 | 2016-09-20 | Agrigenetics, Inc. | Canola inbred line G2X0023AB |
| US9445564B1 (en) | 2012-11-29 | 2016-09-20 | Agrigenetics, Inc. | Canola inbred line DN051465A |
| WO2014097085A1 (en) * | 2012-12-18 | 2014-06-26 | Basf Se | Herbicide-metabolizing cytochrome p450 monooxygenases |
| AU2013362921B2 (en) | 2012-12-19 | 2018-03-01 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| AU2013361220A1 (en) | 2012-12-21 | 2015-04-02 | Pioneer Hi-Bred International, Inc. | Compositions and methods for auxin-analog conjugation |
| US20140203176A1 (en) | 2013-01-23 | 2014-07-24 | Dow Agrosciences Llc | Systems and methods for real-time sampling and analysis of biomolecules beneath the surface of biological tissue |
| US9426953B1 (en) | 2013-02-21 | 2016-08-30 | Agrigenetics, Inc. | Canola hybrid cultivar CE216910H |
| US9414557B1 (en) | 2013-02-21 | 2016-08-16 | Agrigenetics, Inc. | Canola inbred restorer line CE185952R |
| US9538716B1 (en) | 2013-02-21 | 2017-01-10 | Agrigenetics, Inc. | Canola inbred restorer line CE185942R |
| BR112015021651B1 (en) | 2013-03-07 | 2021-12-28 | Bayer Cropscience Lp | RECOMBINANT NUCLEIC ACID MOLECULE, EXPRESSION CASSETTE, BACTERIAL HOST CELL, RECOMBINANT POLYPEPTIDE, COMPOSITION AND METHODS FOR THEIR APPLICATION |
| WO2014135392A1 (en) | 2013-03-07 | 2014-09-12 | Basf Se | Co-crystals of pyrimethanil and selected dithiine tetracarboximide |
| US9273322B2 (en) | 2013-03-12 | 2016-03-01 | Pioneer Hi Bred International Inc | Root-preferred promoter and methods of use |
| US9243258B2 (en) | 2013-03-12 | 2016-01-26 | Pioneer Hi Bred International Inc | Root-preferred promoter and methods of use |
| EA028528B1 (en) | 2013-03-13 | 2017-11-30 | Пайонир Хай-Бред Интернэшнл, Инк. | Glyphosate application for weed control in brassica |
| BR112015023272A2 (en) | 2013-03-14 | 2017-07-18 | Pioneer Hi Bred Int | plant cell, plant, plant explant, transgenic seed, method for producing a plant cell having a heterologous polynucleotide encoding a polypeptide having dicamba decarboxylase activity, method for controlling weeds in a field containing a crop and method for controlling weeds in a field containing a culture |
| EP2970935A1 (en) | 2013-03-14 | 2016-01-20 | Pioneer Hi-Bred International, Inc. | Compositions having dicamba decarboxylase activity and methods of use |
| BR112015023285B1 (en) | 2013-03-14 | 2022-03-03 | Pioneer Hi-Bred International, Inc. | Expression cassette, bacterial host cell and method for controlling a coleopteran-like plant pest |
| CR20200120A (en) | 2013-03-14 | 2020-06-05 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| CA2901316A1 (en) | 2013-03-15 | 2014-09-25 | Pioneer Hi-Bred International, Inc. | Phi-4 polypeptides and methods for their use |
| WO2014182473A1 (en) | 2013-05-08 | 2014-11-13 | Monsanto Technology Llc | Compositions and methods for deploying a transgenic refuge seed blend |
| EP2810952A1 (en) | 2013-06-03 | 2014-12-10 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Novel pest control methods |
| CA2911185C (en) | 2013-06-11 | 2023-09-05 | Syngenta Participations Ag | Methods for generating transgenic plants |
| WO2015013509A1 (en) | 2013-07-25 | 2015-01-29 | Pioneer Hi-Bred International, Inc. | Method for producing hybrid brassica seed |
| US9307734B2 (en) | 2013-07-31 | 2016-04-12 | Monsanto Technology Llc | Cotton variety 13R347B2R2 |
| US9301484B2 (en) | 2013-07-31 | 2016-04-05 | Monsanto Technology Llc | Cotton variety 13R315B2R2 |
| US9307733B2 (en) | 2013-07-31 | 2016-04-12 | Monsanto Technology Llc | Cotton variety 12R244R2 |
| US9320232B2 (en) | 2013-07-31 | 2016-04-26 | Monsanto Technology Llc | Cotton variety 12R224B2R2 |
| US9433174B2 (en) | 2013-07-31 | 2016-09-06 | Monsanto Technology Llc | Cotton variety 12R251B2R2 |
| US9307735B2 (en) | 2013-07-31 | 2016-04-12 | Monsanto Technology Llc | Cotton variety 13R352B2R2 |
| US9433173B2 (en) | 2013-07-31 | 2016-09-06 | Monsanto Technology Llc | Cotton variety 12R249B2R2 |
| MX359026B (en) | 2013-08-16 | 2018-09-12 | Pioneer Hi Bred Int | Insecticidal proteins and methods for their use. |
| CA3221516A1 (en) | 2013-08-22 | 2015-02-26 | E. I. Du Pont De Nemours And Company | Plant genome modification using guide rna/cas endonuclease systems and methods of use |
| EA201690560A1 (en) | 2013-09-11 | 2016-10-31 | Пайонир Хай-Бред Интернэшнл, Инк. | REGULATORY ELEMENTS OF PLANTS AND METHODS OF THEIR APPLICATION |
| US10667524B2 (en) | 2013-09-13 | 2020-06-02 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| US20160237447A1 (en) | 2013-10-07 | 2016-08-18 | Monsanto Technology Llc | Transgenic Plants With Enhanced Traits |
| US10829773B2 (en) | 2013-10-09 | 2020-11-10 | Monsanto Technology Llc | Interfering with HD-Zip transcription factor repression of gene expression to produce plants with enhanced traits |
| US10392626B1 (en) | 2013-10-09 | 2019-08-27 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| EP3502127B1 (en) | 2013-10-09 | 2023-07-26 | Monsanto Technology LLC | Transgenic corn event mon87403 and methods for detection thereof |
| AU2014334590A1 (en) | 2013-10-18 | 2016-04-28 | Pioneer Hi-Bred International, Inc. | Glyphosate-N-acetyltransferase (GLYAT) sequences and methods of use |
| CA2923296A1 (en) | 2013-10-25 | 2015-04-30 | Pioneer Hi-Bred International, Inc. | Stem canker tolerant soybeans and methods of use |
| CA2932138A1 (en) | 2013-12-20 | 2015-06-25 | Dow Agrosciences Llc | Synergistic herbicidal weed control and improved crop tolerance from combinations of 2,4-d-choline, glyphosate, and glufosinate in 2,4-d-, glyphosate- and glufosinate-tolerant soybeans, corn, cotton and other crop areas |
| BR102014031844A2 (en) | 2013-12-20 | 2015-10-06 | Dow Agrosciences Llc | RAS and related nucleic acid molecules that confer resistance to Coleoptera and Hemiptera pests |
| WO2015095750A1 (en) | 2013-12-20 | 2015-06-25 | Dow Agrosciences Llc | Rnapii-140 nucleic acid molecules that confer resistance to coleopteran pests |
| US10683513B2 (en) | 2013-12-31 | 2020-06-16 | Dow Agrosciences Llc | Tissue-specific expression and hybrid plant production |
| UA120608C2 (en) | 2014-02-07 | 2020-01-10 | Піонір Хай-Бред Інтернешнл, Інк. | PURIFIED PTIP-83 POLYPEPTIDE AND METHOD OF APPLICATION |
| WO2015120270A1 (en) | 2014-02-07 | 2015-08-13 | Pioneer Hi Bred International, Inc. | Insecticidal proteins and methods for their use |
| US9596816B1 (en) | 2014-02-28 | 2017-03-21 | Agrigenetics, Inc. | Canola inbred restorer line CL215695R |
| US9854763B1 (en) | 2014-02-28 | 2018-01-02 | Agrigenetics, Inc. | Canola inbred line CL1992625B |
| US9554534B1 (en) | 2014-02-28 | 2017-01-31 | Agrigenetics, Inc. | Canola inbred line CL1992625A |
| US9844195B1 (en) | 2014-02-28 | 2017-12-19 | Agrigenetics, Inc. | Canola hybrid cultivar CL2537387H |
| WO2015138394A2 (en) | 2014-03-11 | 2015-09-17 | Bayer Cropscience Lp | Hppd variants and methods of use |
| RU2016139492A (en) | 2014-03-12 | 2018-04-12 | Дзе Юниверсити Оф Сидней | RNA PRODUCTION IN HIGHER PLANTS |
| CN103834674B (en) * | 2014-03-21 | 2016-03-23 | 华中农业大学 | An isolated 5-enolpyruvylshikimate-3-phosphate synthase gene |
| AR100159A1 (en) | 2014-04-22 | 2016-09-14 | Du Pont | GENES OF PLASID CARBON ANHYDRAINE FOR OIL INCREASE IN SEEDS WITH INCREASED DGAT EXPRESSION |
| UY36113A (en) | 2014-05-07 | 2015-10-30 | Dow Agrosciences Llc | DRE4 NUCLEIC ACID MOLECULES THAT CONFERENCE RESISTANCE TO PELLOPTER PESTS |
| AR100785A1 (en) | 2014-06-09 | 2016-11-02 | Dow Agrosciences Llc | HERBICIDE CONTROL OF MALEZA FROM COMBINATIONS OF FLUROXIPIR AND INHIBITORS OF ALS |
| US9686931B2 (en) | 2014-07-07 | 2017-06-27 | Alforex Seeds LLC | Hybrid alfalfa variety named HybriForce-3400 |
| CN106687594A (en) | 2014-07-11 | 2017-05-17 | 纳幕尔杜邦公司 | Compositions and methods for producing plants resistant to glyphosate herbicide |
| EP2979549A1 (en) | 2014-07-31 | 2016-02-03 | Basf Se | Method for improving the health of a plant |
| US20170218384A1 (en) | 2014-08-08 | 2017-08-03 | Pioneer Hi-Bred International, Inc. | Ubiquitin promoters and introns and methods of use |
| BR112017003757A2 (en) | 2014-09-12 | 2017-12-26 | Du Pont | ? corn plants, parts of corn plants or corn seeds? |
| CA2961733A1 (en) | 2014-09-17 | 2016-03-24 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| WO2016054071A1 (en) | 2014-09-29 | 2016-04-07 | Alforex Seeds LLC | Low lignin non-transgenic alfalfa varieties and methods for producing the same |
| US10487123B2 (en) | 2014-10-16 | 2019-11-26 | Monsanto Technology Llc | Chimeric insecticidal proteins toxic or inhibitory to lepidopteran pests |
| CN107108705B (en) | 2014-10-16 | 2021-05-25 | 先锋国际良种公司 | Insecticidal protein and method of use |
| MX388283B (en) | 2014-10-16 | 2025-03-19 | Monsanto Technology Llc | NOVEL TOXIC OR INHIBITING INSECTICIDE CHIMERIC PROTEINS FOR LEPIDOPTERA PESTS. |
| WO2016061392A1 (en) | 2014-10-16 | 2016-04-21 | Monsanto Technology Llc | Proteins toxic or inhibitory to lepidopteran insects |
| US9622443B2 (en) | 2014-10-28 | 2017-04-18 | Monsanto Technology Llc | Cotton variety 14R435B2R2 |
| US9585348B2 (en) | 2014-10-28 | 2017-03-07 | Monsanto Technology Llc | Cotton variety 14R1456B2R2 |
| EP3224371B1 (en) | 2014-11-04 | 2024-10-09 | Ball Horticultural Company | Altered pigment deposition in tagetes patula |
| EP3218497A1 (en) | 2014-11-12 | 2017-09-20 | NMC Inc. | Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same |
| US9986702B1 (en) | 2014-12-05 | 2018-06-05 | Agrigenetics, Inc. | Canola inbred restorer line G1934899R |
| EP3028573A1 (en) | 2014-12-05 | 2016-06-08 | Basf Se | Use of a triazole fungicide on transgenic plants |
| US10165751B2 (en) | 2014-12-05 | 2019-01-01 | Agrigenetics, Inc. | Canola inbred line G30853A |
| WO2016091675A1 (en) | 2014-12-12 | 2016-06-16 | Basf Se | Method for improving the health of a plant |
| WO2016091674A1 (en) | 2014-12-12 | 2016-06-16 | Basf Se | Use of cyclaniliprole on cultivated plants |
| US20170359965A1 (en) | 2014-12-19 | 2017-12-21 | E I Du Pont De Nemours And Company | Polylactic acid compositions with accelerated degradation rate and increased heat stability |
| US9820450B2 (en) | 2014-12-22 | 2017-11-21 | Monsanto Technology Llc | Cotton variety 14R942B2XF |
| US9788507B2 (en) | 2014-12-22 | 2017-10-17 | Monsanto Technology Llc | Cotton variety 14R955B2XF |
| US9717208B2 (en) | 2014-12-22 | 2017-08-01 | Monsanto Technology Llc | Cotton variety 14R953B2XF |
| US9743603B2 (en) | 2014-12-22 | 2017-08-29 | Monsanto Technology Llc | Cotton variety 14R925B2XF |
| ES2811279T3 (en) | 2014-12-22 | 2021-03-11 | Fraunhofer Ges Forschung | Nucampholin nucleic acid molecules for controlling beetle insect pests |
| US9924654B2 (en) | 2014-12-22 | 2018-03-27 | Monsanto Technology Llc | Cotton variety 14R922B2XF |
| US9668447B2 (en) | 2014-12-22 | 2017-06-06 | Monsanto Technology Llc | Cotton variety 14R941B2XF |
| US9820452B2 (en) | 2014-12-22 | 2017-11-21 | Monsanto Technology Llc | Cotton variety 14R915B2XF |
| US9723801B2 (en) | 2014-12-22 | 2017-08-08 | Monsanto Technology Llc | Cotton variety 14R952B2XF |
| US9743605B2 (en) | 2014-12-22 | 2017-08-29 | Monsanto Technology Llc | Cotton variety 14R950B2XF |
| US9743604B2 (en) | 2014-12-22 | 2017-08-29 | Monsanto Technology Llc | Cotton variety 14R949B2XF |
| US9743602B2 (en) | 2014-12-22 | 2017-08-29 | Monsanto Technology Llc | Cotton variety 14R911B2XF |
| US9820451B2 (en) | 2014-12-22 | 2017-11-21 | Monsanto Technology Llc | Cotton variety 14R948B2XF |
| US9826691B2 (en) | 2014-12-22 | 2017-11-28 | Monsanto Technology Llc | Cotton variety 14R914B2XF |
| US9615530B2 (en) | 2014-12-22 | 2017-04-11 | Monsanto Technology Llc | Cotton variety 14R938B2XF |
| EP3244727B1 (en) | 2015-01-15 | 2025-10-22 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| WO2016126990A1 (en) | 2015-02-04 | 2016-08-11 | Monsanto Technology Llc | Methods for plastid transformation |
| EP3262176A1 (en) | 2015-02-25 | 2018-01-03 | Pioneer Hi-Bred International, Inc. | Composition and methods for regulated expression of a guide rna/cas endonuclease complex |
| US9854765B2 (en) | 2015-02-26 | 2018-01-02 | Monsanto Technology Llc | Cotton variety 14R934B2XF |
| EP3067424A1 (en) | 2015-03-13 | 2016-09-14 | Dow AgroSciences LLC | Rna polymerase i1 nucleic acid molecules to control insect pests |
| WO2016149352A1 (en) | 2015-03-19 | 2016-09-22 | Pioneer Hi-Bred International Inc | Methods and compositions for accelerated trait introgression |
| US9968047B2 (en) | 2015-03-24 | 2018-05-15 | Agrigenetics, Inc. | Canola hybrid cultivar CL2562968H |
| US11519011B2 (en) | 2015-03-26 | 2022-12-06 | The Texas A&M University System | Conversion of lignin into bioplastics and lipid fuels |
| US10314270B2 (en) | 2015-04-01 | 2019-06-11 | Agrigenetics, Inc. | Canola hybrid cultivar G3697124H |
| BR112017021450B1 (en) | 2015-04-07 | 2021-12-28 | Basf Agrochemical Products B.V. | PEST CONTROL METHODS, PLANT HEALTH IMPROVEMENT METHOD AND COATED SEED |
| WO2016165729A1 (en) | 2015-04-13 | 2016-10-20 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Novel aflatoxin and fungal infection control methods |
| US10306852B2 (en) | 2015-04-15 | 2019-06-04 | Agrigenetics, Inc. | Canola inbred line G1992650A |
| US9968050B2 (en) | 2015-04-15 | 2018-05-15 | Agrigenetics, Inc. | Canola inbred restorer line G175274R |
| US9968051B2 (en) | 2015-04-15 | 2018-05-15 | Agrigenetics, Inc. | Canola hybrid cultivar G2537376H |
| US9974262B2 (en) | 2015-04-15 | 2018-05-22 | Agrigenetics, Inc. | Canola inbred restorer line CL134904R |
| EP3294878A1 (en) | 2015-05-15 | 2018-03-21 | Pioneer Hi-Bred International, Inc. | Guide rna/cas endonuclease systems |
| RU2017144238A (en) | 2015-05-19 | 2019-06-19 | Пайонир Хай-Бред Интернэшнл, Инк. | INSECTICIDAL PROTEINS AND METHODS OF THEIR APPLICATION |
| BR102016012010A2 (en) | 2015-05-29 | 2020-03-24 | Dow Agrosciences Llc | NUCLEIC ACID, RIBONUCLEIC ACID (RNA) AND DOUBLE-FILAMENT RIBONUCLEIC ACID (DSRNA) MOLECULE, CELL, PLANT AND SEED USES, PRIMARY PRODUCT, AS WELL AS METHODS TO CONTROL A POPULATION OF HOLIDAYS, OR HOSPITALS, OR HOSPITALS, OR HOSPITALS, OR HOSPITALS THE INCOME OF A CULTURE, AND TO PRODUCE A TRANSGENIC VEGETABLE CELL AND A TRANSGENIC PLANT |
| WO2016205445A1 (en) | 2015-06-16 | 2016-12-22 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| EP3436575A1 (en) | 2015-06-18 | 2019-02-06 | The Broad Institute Inc. | Novel crispr enzymes and systems |
| CN109475096B (en) | 2015-08-06 | 2022-08-23 | 先锋国际良种公司 | Plant-derived insecticidal proteins and methods of use thereof |
| WO2017025147A1 (en) * | 2015-08-13 | 2017-02-16 | Huawei Technologies Co., Ltd. | Transmitter and receiver for a wireless communication system |
| PL3349582T3 (en) | 2015-08-27 | 2022-02-07 | Monsanto Technology Llc | Novel insect inhibitory proteins |
| DK3341483T3 (en) | 2015-08-28 | 2020-03-16 | Pioneer Hi Bred Int | OCHROBACTRUM-MEDIATED TRANSFORMATION OF PLANTS |
| JP6873979B2 (en) | 2015-09-11 | 2021-05-19 | バイエル・クロップサイエンス・アクチェンゲゼルシャフト | HPPD mutants and usage |
| ES2842501T5 (en) | 2015-09-21 | 2023-04-13 | Modern Meadow Inc | Fiber Reinforced Fabric Composite Materials |
| EP3356537B1 (en) | 2015-10-02 | 2022-08-17 | Monsanto Technology LLC | Recombinant maize b chromosome sequence and uses thereof |
| CN105219767B (en) | 2015-10-09 | 2018-02-13 | 上海交通大学 | Transformation of soybean event SHZD32 01 and its application process |
| CN108138155A (en) | 2015-10-20 | 2018-06-08 | 先锋国际良种公司 | Restoring the function of a non-functional gene product via a guided CAS system and methods of use |
| US20180258438A1 (en) | 2015-11-06 | 2018-09-13 | Pioneer Hi-Bred International, Inc. | Generation of complex trait loci in soybean and methods of use |
| US10633703B2 (en) | 2015-11-10 | 2020-04-28 | Dow Agrosciences Llc | Methods and systems for predicting the risk of transgene silencing |
| CA3007016A1 (en) | 2015-12-16 | 2017-06-22 | Syngenta Participations Ag | Genetic regions & genes associated with increased yield in plants |
| US9854761B2 (en) | 2015-12-18 | 2018-01-02 | Monsanto Technology Llc | Cotton variety 15R510B2XF |
| US9854762B2 (en) | 2015-12-18 | 2018-01-02 | Monsanto Technology Llc | Cotton variety 15R509B2XF |
| US9980448B2 (en) | 2015-12-18 | 2018-05-29 | Monsanto Technology Llc | Cotton variety 15R515B2XF |
| US9961845B2 (en) | 2015-12-18 | 2018-05-08 | Monsanto Technology Llc | Cotton variety 15R551B2XF |
| BR112018012887B1 (en) | 2015-12-22 | 2024-02-06 | Pioneer Hi-Bred International, Inc | EXPRESSION CASSETTE, VECTOR, METHODS FOR OBTAINING PLANT CELL AND TRANSGENIC PLANT, METHODS FOR EXPRESSING A POLYNUCLEOTIDE |
| EP3408390A4 (en) | 2016-01-26 | 2019-10-09 | Monsanto Technology LLC | COMPOSITIONS AND METHODS FOR CONTROL OF PEST INSECTS |
| CA3004914A1 (en) | 2016-02-05 | 2017-08-10 | Pioneer Hi-Bred International, Inc. | Genetic loci associated with brown stem rot resistance in soybean and methods of use |
| US11525042B2 (en) | 2016-02-15 | 2022-12-13 | Modern Meadow, Inc. | Composite biofabricated material |
| EP3426780A1 (en) | 2016-03-11 | 2019-01-16 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| CA3010628A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| BR112018001122B1 (en) | 2016-03-11 | 2021-06-01 | Monsanto Technology Llc | RECOMBINANT DNA MOLECULE COMPRISING PLANT REGULATORY ELEMENTS AND METHOD OF EXPRESSION OF A TRANSCRIPABLE DNA MOLECULE |
| WO2017155715A1 (en) | 2016-03-11 | 2017-09-14 | Pioneer Hi-Bred International, Inc. | Novel cas9 systems and methods of use |
| CN105802933B (en) * | 2016-03-22 | 2020-05-05 | 北京大北农科技集团股份有限公司 | Herbicide tolerance protein, coding gene and application thereof |
| US10219463B2 (en) | 2016-03-25 | 2019-03-05 | Monsanto Technology Llc | Cotton variety 15R513B2XF |
| EA201892293A1 (en) | 2016-05-04 | 2019-04-30 | Пайонир Хай-Бред Интернэшнл, Инк. | INSECTICIDAL PROTEINS AND METHODS OF THEIR APPLICATION |
| EP3054014A3 (en) | 2016-05-10 | 2016-11-23 | BASF Plant Science Company GmbH | Use of a fungicide on transgenic plants |
| EP3462844B1 (en) | 2016-05-24 | 2024-11-27 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| MX2018014993A (en) | 2016-06-14 | 2019-09-06 | Pioneer Hi Bred Int | Use of cpf1 endonuclease for plant genome modifications. |
| BR112018076047A2 (en) | 2016-06-16 | 2019-03-26 | Pioneer Hi Bred Int | silencing element, dna construct, expression cassette, host cell, composition, plant cell, plant or plant part, transgenic seed, method for controlling a plant insect pest and kit |
| WO2017222773A1 (en) | 2016-06-20 | 2017-12-28 | Pioneer Hi-Bred International, Inc. | Novel cas systems and methods of use |
| RU2019101793A (en) | 2016-06-24 | 2020-07-24 | Пайонир Хай-Бред Интернэшнл, Инк. | PLANT REGULATORY ELEMENTS AND METHODS OF THEIR APPLICATION |
| WO2018005589A1 (en) | 2016-06-28 | 2018-01-04 | Cellectis | Altering expression of gene products in plants through targeted insertion of nucleic acid sequences |
| US11732268B2 (en) | 2016-06-28 | 2023-08-22 | Monsanto Technology Llc | Methods and compositions for use in genome modification in plants |
| US10136599B2 (en) | 2016-06-29 | 2018-11-27 | Monsanto Technology Llc | Cotton variety 15R535B2XF |
| CA3026113A1 (en) | 2016-07-01 | 2018-01-04 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins from plants and methods for their use |
| WO2018013333A1 (en) | 2016-07-12 | 2018-01-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods to control insect pests |
| US10463004B2 (en) | 2016-09-07 | 2019-11-05 | Agrigenetics, Inc. | Canola inbred line G1466454A/B |
| US10426110B2 (en) | 2016-09-07 | 2019-10-01 | Agrigenetics, Inc. | Canola inbred restorer line CL2503899R |
| US10244716B2 (en) | 2016-09-07 | 2019-04-02 | Agrigenetics, Inc. | Canola hybrid cultivar CL3701975H |
| US10420296B2 (en) | 2016-09-07 | 2019-09-24 | Agrigenetics, Inc. | Canola inbred restorer line G263532R |
| US10588281B2 (en) | 2016-09-07 | 2020-03-17 | Agrigenetics, Inc. | Canola hybrid cultivar G5428584H |
| WO2018064208A1 (en) | 2016-09-28 | 2018-04-05 | The Broad Institute, Inc. | Systematic screening and mapping of regulatory elements in non-coding genomic regions, methods, compositions, and applications thereof |
| EP3535285B1 (en) | 2016-11-01 | 2022-04-06 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| BR112019010476A2 (en) | 2016-11-23 | 2019-09-10 | BASF Agricultural Solutions Seed US LLC | recombinant nucleic acid molecule, vector, host cell, transgenic plant, transgenic seed, recombinant polypeptide, composition, method for controlling a pest population, for killing pests, for producing a polypeptide, plant or plant cell, method for protecting a plant against a pest, to increase yield on a plant, use and primary product |
| EP3550958A4 (en) | 2016-12-08 | 2020-10-07 | Syngenta Participations AG | METHODS FOR IMPROVING THE TRANSFORMATION FREQUENCY |
| EP3338552A1 (en) | 2016-12-21 | 2018-06-27 | Basf Se | Use of a tetrazolinone fungicide on transgenic plants |
| EA201991547A1 (en) | 2016-12-22 | 2020-01-17 | БАСФ АГРИКУЛЬЧУРАЛ СОЛЮШНС СИД УС ЛЛСи | APPLICATION CRY14 FOR PEST CONTROL NEMATODES |
| CN106636025B (en) * | 2016-12-28 | 2017-11-14 | 四川天豫兴禾生物科技有限公司 | A kind of rice EPSP S mutant and its encoding gene and application |
| EP3342780A1 (en) | 2016-12-30 | 2018-07-04 | Dow AgroSciences LLC | Pre-mrna processing factor 8 (prp8) nucleic acid molecules to control insect pests |
| US9963714B1 (en) | 2016-12-30 | 2018-05-08 | Monsanto Technology Llc | Cotton variety 16R247NRB2XF |
| US11286498B2 (en) | 2017-01-18 | 2022-03-29 | BASF Agricultural Solutions Seed US LLC | Use of BP005 for the control of plant pathogens |
| WO2018136604A1 (en) | 2017-01-18 | 2018-07-26 | Bayer Cropscience Lp | Bp005 toxin gene and methods for its use |
| CR20240086A (en) | 2017-01-19 | 2024-09-30 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| US10499605B2 (en) | 2017-03-03 | 2019-12-10 | Monsanto Technology Llc | Cotton variety 16R251NRB2XF |
| CA3055317A1 (en) | 2017-03-07 | 2018-09-13 | BASF Agricultural Solutions Seed US LLC | Hppd variants and methods of use |
| WO2018169787A1 (en) | 2017-03-13 | 2018-09-20 | Ball Horticultural Company | Downy mildew resistant impatiens |
| US20180265887A1 (en) | 2017-03-16 | 2018-09-20 | Jacobs Farm Del Cabo | Basil Plants With High Tolerance to Downy Mildew |
| WO2018202800A1 (en) | 2017-05-03 | 2018-11-08 | Kws Saat Se | Use of crispr-cas endonucleases for plant genome engineering |
| WO2018204777A2 (en) | 2017-05-05 | 2018-11-08 | The Broad Institute, Inc. | Methods for identification and modification of lncrna associated with target genotypes and phenotypes |
| US12297436B2 (en) | 2017-05-18 | 2025-05-13 | The Broad Institute, Inc. | Systems, methods, and compositions for targeted nucleic acid editing |
| CA3008850A1 (en) | 2017-06-29 | 2018-12-29 | Modern Meadow, Inc. | Yeast strains and methods for producing collagen |
| US10204689B1 (en) | 2017-07-25 | 2019-02-12 | Sandisk Technologies Llc | Non-volatile memory with methods to reduce creep-up field between dummy control gate and select gate |
| EP3661354A1 (en) | 2017-07-31 | 2020-06-10 | R. J. Reynolds Tobacco Company | Methods and compositions for viral-based gene editing in plants |
| CN111263810A (en) | 2017-08-22 | 2020-06-09 | 纳匹基因公司 | Organelle genome modification using polynucleotide directed endonucleases |
| US11252928B2 (en) | 2017-09-21 | 2022-02-22 | The Condard-Pyle Company | Miniature rose plant named ‘Meibenbino’ |
| AU2018338318B2 (en) | 2017-09-21 | 2022-12-22 | Massachusetts Institute Of Technology | Systems, methods, and compositions for targeted nucleic acid editing |
| US11917978B2 (en) | 2017-09-21 | 2024-03-05 | The Conard Pyle Company | Miniature rose plant named ‘meibenbino’ |
| US20200270622A1 (en) | 2017-09-25 | 2020-08-27 | Pioneer Hi-Bred International, Inc. | Tissue-preferred promoters and methods of use |
| US20210032651A1 (en) | 2017-10-24 | 2021-02-04 | Basf Se | Improvement of herbicide tolerance to hppd inhibitors by down-regulation of putative 4-hydroxyphenylpyruvate reductases in soybean |
| WO2019083810A1 (en) | 2017-10-24 | 2019-05-02 | Basf Se | Improvement of herbicide tolerance to 4-hydroxyphenylpyruvate dioxygenase (hppd) inhibitors by down-regulation of hppd expression in soybean |
| AU2018253595A1 (en) | 2017-11-13 | 2019-05-30 | Modern Meadow, Inc. | Biofabricated leather articles having zonal properties |
| US11618903B2 (en) | 2017-12-21 | 2023-04-04 | Instituto Nacional De Investigacion Agropecuaria | Methods for improving plant abiotic stress tolerance and yield |
| WO2019126709A1 (en) | 2017-12-22 | 2019-06-27 | The Broad Institute, Inc. | Cas12b systems, methods, and compositions for targeted dna base editing |
| US10856513B2 (en) | 2017-12-28 | 2020-12-08 | Monsanto Technology Llc | Cotton variety 16R338B3XF |
| US10863715B2 (en) | 2017-12-28 | 2020-12-15 | Monsanto Technology Llc | Cotton variety 16R343B3XF |
| US10925248B2 (en) | 2017-12-28 | 2021-02-23 | Monsanto Technology Llc | Cotton variety 16R225NRB2XF |
| US10842121B2 (en) | 2017-12-28 | 2020-11-24 | Monsanto Technology Llc | Cotton variety 16R141XF |
| US10863713B2 (en) | 2017-12-28 | 2020-12-15 | Monsanto Technology Llc | Cotton variety 16R341B3XF |
| US10842120B2 (en) | 2017-12-28 | 2020-11-24 | Monsanto Technology Llc | Cotton variety 16R125XF |
| US10939656B2 (en) | 2017-12-28 | 2021-03-09 | Monsanto Technology Llc | Cotton variety 16R228NRB2XF |
| US10849302B2 (en) | 2017-12-28 | 2020-12-01 | Monsanto Technology Llc | Cotton variety 16R335B3XF |
| US10869455B2 (en) | 2017-12-28 | 2020-12-22 | Monsanto Technology Llc | Cotton variety 16R345B3XF |
| US10842122B2 (en) | 2017-12-28 | 2020-11-24 | Monsanto Technology Llc | Cotton variety 16R123XF |
| US10874079B2 (en) | 2017-12-28 | 2020-12-29 | Monsanto Technology Llc | Cotton variety 16R351B3XF |
| US10856512B2 (en) | 2017-12-28 | 2020-12-08 | Monsanto Technology Llc | Cotton variety 16R336B3XF |
| US10842123B2 (en) | 2017-12-28 | 2020-11-24 | Monsanto Technology Llc | Cotton variety 16R324B3XF |
| US10863714B2 (en) | 2017-12-28 | 2020-12-15 | Monsanto Technology Llc | Cotton variety 16R330B3XF |
| US20200332311A1 (en) | 2018-01-12 | 2020-10-22 | The Texas A&M University System | Increasing plant bioproduct yield |
| EP3755792A4 (en) | 2018-02-23 | 2021-12-08 | Pioneer Hi-Bred International, Inc. | NEW CASE ORTHOLOGISTS9 |
| ES3036459T3 (en) | 2018-03-12 | 2025-09-19 | Pioneer Hi Bred Int | Methods for plant transformation |
| EP3764796B1 (en) | 2018-03-14 | 2025-12-03 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins from plants and methods for their use |
| EP3764798B1 (en) | 2018-03-14 | 2025-12-17 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins from plants and methods for their use |
| US10968257B2 (en) | 2018-04-03 | 2021-04-06 | The Broad Institute, Inc. | Target recognition motifs and uses thereof |
| CA3096516A1 (en) | 2018-05-22 | 2019-11-28 | Pioneer Hi-Bred International, Inc. | Plant regulatory elements and methods of use thereof |
| BR112020026640A2 (en) | 2018-06-28 | 2021-04-06 | Pioneer Hi-Bred International, Inc. | METHODS FOR SELECTING TRANSFORMED PLANTS |
| AU2019369415A1 (en) | 2018-10-31 | 2021-03-25 | Pioneer Hi-Bred International, Inc. | Compositions and methods for Ochrobactrum-mediated plant transformation |
| CN113166744B (en) | 2018-12-14 | 2025-02-07 | 先锋国际良种公司 | Novel CRISPR-Cas system for genome editing |
| AU2019406778A1 (en) | 2018-12-17 | 2021-07-22 | Massachusetts Institute Of Technology | Crispr-associated transposase systems and methods of use thereof |
| US10918071B2 (en) | 2018-12-19 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 16R346B3XF |
| US10918070B2 (en) | 2018-12-19 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R806B3XF |
| US10874081B2 (en) | 2018-12-19 | 2020-12-29 | Monsanto Technology Llc | Cotton variety 17R709XF |
| US10905086B2 (en) | 2018-12-19 | 2021-02-02 | Monsanto Technology Llc | Cotton variety 17R820B3XF |
| US10905085B2 (en) | 2018-12-19 | 2021-02-02 | Monsanto Technology Llc | Cotton variety 17R808B3XF |
| US10918074B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R844B3XF |
| US10905087B2 (en) | 2019-01-09 | 2021-02-02 | Monsanto Technology Llc | Cotton variety 16R246NRB2XF |
| US10939658B2 (en) | 2019-01-09 | 2021-03-09 | Monsanto Technology Llc | Cotton variety 16R232B2XF |
| US10918073B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R819B3XF |
| US10925249B2 (en) | 2019-01-09 | 2021-02-23 | Monsanto Technology Llc | Cotton variety 17R933NRB3XF |
| US10918072B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R814B3XF |
| US10939661B2 (en) | 2019-01-09 | 2021-03-09 | Monsanto Technology Llc | Cotton variety 17R815B3XF |
| US10939660B2 (en) | 2019-01-09 | 2021-03-09 | Monsanto Technology Llc | Cotton variety 17R740XF |
| US10918077B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R827B3XF |
| US10925250B2 (en) | 2019-01-09 | 2021-02-23 | Monsanto Technology Llc | Cotton variety 17R816B3XF |
| US10918076B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R817B3XF |
| US10939659B2 (en) | 2019-01-09 | 2021-03-09 | Monsanto Technology Llc | Cotton variety 16R353B3XF |
| US10918034B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R737XF |
| US10918075B2 (en) | 2019-01-09 | 2021-02-16 | Monsanto Technology Llc | Cotton variety 17R845B3XF |
| MX2021002743A (en) | 2019-01-10 | 2021-05-12 | Monsanto Technology Llc | PLANT REGULATORY ELEMENTS AND THEIR USES. |
| EP3704202A4 (en) | 2019-01-17 | 2020-12-16 | Modern Meadow, Inc. | LAYERED COLLAGEN MATERIALS AND METHOD FOR MAKING THEM |
| BR112021017998A2 (en) | 2019-03-11 | 2021-11-16 | Pioneer Hi Bred Int | Methods for producing clonal plants |
| CN109971879A (en) * | 2019-03-18 | 2019-07-05 | 中国检验检疫科学研究院 | Combination and application of PCR primers for detection of transgenic soybean line MON87705 |
| EP3947425A1 (en) | 2019-03-27 | 2022-02-09 | Pioneer Hi-Bred International, Inc. | Plant explant transformation |
| WO2020198496A1 (en) | 2019-03-28 | 2020-10-01 | Pioneer Hi-Bred International, Inc. | Modified agrobacterium strains and use thereof for plant transformation |
| US10993407B2 (en) | 2019-08-15 | 2021-05-04 | Monsanto Technology Llc | Cotton variety 17R818B3XF |
| CN114555628A (en) | 2019-10-14 | 2022-05-27 | 巴斯夫农业种子解决方案美国有限责任公司 | Novel insect-resistant genes and methods of use |
| AU2020367523A1 (en) | 2019-10-14 | 2022-04-28 | BASF Agricultural Solutions Seed US LLC | Novel insect resistant genes and methods of use |
| EP3825408A1 (en) | 2019-11-19 | 2021-05-26 | FRAUNHOFER-GESELLSCHAFT zur Förderung der angewandten Forschung e.V. | Methods of multi-species insect pest control |
| US11326176B2 (en) | 2019-11-22 | 2022-05-10 | Mozza Foods, Inc. | Recombinant micelle and method of in vivo assembly |
| US12359212B2 (en) | 2019-11-22 | 2025-07-15 | Mozza Foods, Inc. | Recombinant micelle and method of in vivo assembly |
| US11064672B2 (en) | 2019-12-16 | 2021-07-20 | Monsanto Technology Llc | Cotton variety 18R438B3XF |
| US11039594B1 (en) | 2019-12-16 | 2021-06-22 | Monsanto Technology Llc | Cotton variety 18R423B3XF |
| US11154029B2 (en) | 2019-12-16 | 2021-10-26 | Monsanto Technology Llc | Cotton variety 18R445B3XF |
| US11026392B1 (en) | 2019-12-16 | 2021-06-08 | Monsanto Technology Llc | Cotton variety 18R421B3XF |
| KR20220116485A (en) | 2019-12-16 | 2022-08-23 | 바스프 아그리컬쳐럴 솔루션즈 시드 유에스 엘엘씨 | Improved genome editing using paired nickases |
| US20230220405A1 (en) | 2019-12-16 | 2023-07-13 | BASF Agricultural Solutions Seed US LLC | Precise introduction of dna or mutations into the genome of wheat |
| US11051483B1 (en) | 2019-12-16 | 2021-07-06 | Monsanto Technology Llc | Cotton variety 18R448B3XF |
| US11134646B2 (en) | 2020-01-24 | 2021-10-05 | Monsanto Technology Llc | Cotton variety 18R459B3XF |
| US11310991B2 (en) | 2020-01-24 | 2022-04-26 | Monsanto Technology Llc | Cotton variety 18R540B3XF |
| US11129352B2 (en) | 2020-01-24 | 2021-09-28 | Monsanto Technology Llc | Cotton variety 18R418B3XF |
| US11129354B2 (en) | 2020-01-24 | 2021-09-28 | Monsanto Technology Llc | Cotton variety 18R435B3XF |
| US11206800B2 (en) | 2020-01-24 | 2021-12-28 | Monsanto Technology Llc | Cotton variety 18R067 |
| US11185046B2 (en) | 2020-01-24 | 2021-11-30 | Monsanto Technology Llc | Cotton variety 18R409B3XF |
| US11197454B2 (en) | 2020-01-24 | 2021-12-14 | Monsanto Technology Llc | Cotton variety 18R062 |
| US11129353B2 (en) | 2020-01-24 | 2021-09-28 | Monsanto Technology Llc | Cotton variety 18R419B3XF |
| US11134645B2 (en) | 2020-01-24 | 2021-10-05 | Monsanto Technology Llc | Cotton variety 18R441B3XF |
| US11197455B2 (en) | 2020-02-12 | 2021-12-14 | Monsanto Technology Llc | Cotton variety 18R410B3XF |
| US11154030B2 (en) | 2020-02-12 | 2021-10-26 | Monsanto Technology Llc | Cotton variety 16R020 |
| US11330787B2 (en) | 2020-02-12 | 2022-05-17 | Monsanto Technology Llc | Cotton variety 18R420B3XF |
| WO2021173480A2 (en) | 2020-02-24 | 2021-09-02 | Pioneer Hi-Bred International, Inc. | Intra-genomic homologous recombination |
| UY39125A (en) | 2020-03-11 | 2021-09-30 | BASF Agricultural Solutions Seed US LLC | TRANSCRIPTION REGULATORY NUCLEOTIDE SEQUENCES AND METHODS OF USE |
| CN115413222B (en) | 2020-04-23 | 2024-06-04 | 先正达农作物保护股份公司 | Soybean promoter and application thereof |
| EP4143258A4 (en) | 2020-05-01 | 2024-05-22 | Modern Meadow, Inc. | PROTEIN-POLYURETHANE ALLOYS AND LAYERED MATERIALS INCLUDING THE SAME |
| CA3186978A1 (en) | 2020-07-14 | 2022-01-20 | Pioneer Hi-Bred International, Inc. | Insecticidal proteins and methods for their use |
| US11944063B2 (en) | 2020-09-30 | 2024-04-02 | Spring Meadow Nursery, Inc. | Hydrangea ‘SMNHPH’ |
| WO2022072335A2 (en) | 2020-09-30 | 2022-04-07 | Pioneer Hi-Bred International, Inc. | Rapid transformation of monocot leaf explants |
| EP4321015A3 (en) | 2020-10-16 | 2024-04-17 | Klemm & Sohn GmbH & Co. KG | Double-flowering dwarf calibrachoa |
| US11155884B1 (en) | 2020-10-16 | 2021-10-26 | Klemm & Sohn Gmbh & Co. Kg | Double-flowering dwarf Calibrachoa |
| CA3206159A1 (en) | 2020-12-21 | 2022-06-30 | Monsanto Technology Llc | Novel insect inhibitory proteins |
| US11432520B2 (en) | 2020-12-22 | 2022-09-06 | Monsanto Technology Llc | Cotton variety 19R228B3XF |
| US11344000B1 (en) | 2020-12-22 | 2022-05-31 | Monsanto Technology Llc | Cotton variety 19R113B3XF |
| US11432519B2 (en) | 2020-12-22 | 2022-09-06 | Monsanto Technology Llc | Cotton variety 19R227B3XF |
| US11317592B1 (en) | 2020-12-22 | 2022-05-03 | Monsanto Technology Llc | Cotton variety 19R238NRB3XF |
| US11432521B2 (en) | 2020-12-22 | 2022-09-06 | Monsanto Technology Llc | Cotton variety 19R242NRB3XF |
| UY39585A (en) | 2020-12-23 | 2022-07-29 | Monsanto Technology Llc | PROTEINS THAT EXHIBIT INSECT INHIBITOR ACTIVITY AGAINST PESTS OF AGRICULTURAL IMPORTANCE OF CROP PLANTS AND SEEDS |
| MX2023007858A (en) | 2020-12-31 | 2023-07-07 | Monsanto Technology Llc | Novel insect inhibitory proteins. |
| US11432522B1 (en) | 2021-02-24 | 2022-09-06 | Monsanto Technology Llc | Cotton variety 19R244B3XF |
| US11606927B2 (en) | 2021-02-24 | 2023-03-21 | Monsanto Technology Llc | Cotton variety 19R130B3XF |
| US11606928B2 (en) | 2021-02-24 | 2023-03-21 | Monsanto Technology Llc | Cotton variety 19R231B3XF |
| US11589545B2 (en) | 2021-02-24 | 2023-02-28 | Monsanto Technology Llc | Cotton variety 19R240B3XF |
| US11737420B2 (en) | 2021-02-24 | 2023-08-29 | Monsanto Technology Llc | Cotton variety 19R241NRB3XF |
| US11589544B2 (en) | 2021-02-24 | 2023-02-28 | Monsanto Technology Llc | Cotton variety 19R229B3XF |
| US11602114B2 (en) | 2021-02-24 | 2023-03-14 | Monsanto Technology Llc | Cotton variety 19R107B3XF |
| US11602116B2 (en) | 2021-02-24 | 2023-03-14 | Monsanto Technology Llc | Cotton variety 19R236B3XF |
| US11602115B2 (en) | 2021-02-24 | 2023-03-14 | Monsanto Technology | Cotton variety 19R233B3XF |
| US11432523B1 (en) | 2021-02-26 | 2022-09-06 | Monsanto Technology Llc | Cotton variety 19R125B3XF |
| US11602117B2 (en) | 2021-02-26 | 2023-03-14 | Monsanto Technology Llc | Cotton variety 19R245B3XF |
| US11617336B2 (en) | 2021-02-26 | 2023-04-04 | Monsanto Technology Llc | Cotton variety 19R254B3XF |
| US11617335B2 (en) | 2021-02-26 | 2023-04-04 | Monsanto Technology Llc | Cotton variety 19R249B3XF |
| US11497188B2 (en) | 2021-02-26 | 2022-11-15 | Monsanto Technology Llc | Cotton variety 19R132B3XF |
| EP4314281A1 (en) | 2021-03-26 | 2024-02-07 | Flagship Pioneering Innovations VII, LLC | Production of circular polyribonucleotides in a eukaryotic system |
| US20240263206A1 (en) | 2021-03-26 | 2024-08-08 | Flagship Pioneering Innovations Vii, Llc | Compositions and methods for producing circular polyribonucleotides |
| TW202305130A (en) | 2021-03-26 | 2023-02-01 | 美商旗艦先鋒創新有限責任(Vii)公司 | Production of circular polyribonucleotides in a prokaryotic system |
| CN114280306B (en) * | 2021-05-27 | 2023-05-05 | 中国农业科学院植物保护研究所 | ELISA detection kit and detection method for eleusine indica EPSPS protein |
| CR20240001A (en) | 2021-07-08 | 2024-05-22 | Monsanto Technology Llc | Novel insect inhibitory proteins |
| WO2023044364A1 (en) | 2021-09-15 | 2023-03-23 | Enko Chem, Inc. | Protoporphyrinogen oxidase inhibitors |
| JP2024536851A (en) | 2021-09-27 | 2024-10-08 | モンサント テクノロジー エルエルシー | Compositions and methods for transforming embryonic explants excised from monocotyledonous seeds |
| UY39997A (en) | 2021-11-01 | 2023-05-15 | Flagship Pioneering Innovations Vii Llc | POLYNUCLEOTIDES FOR MODIFYING ORGANISMS |
| AU2022386267A1 (en) | 2021-11-12 | 2024-05-02 | Monsanto Technology Llc | Compositions and methods for altering plant determinacy |
| US12356950B2 (en) | 2021-12-23 | 2025-07-15 | Monsanto Technology Llc | Cotton variety 20R816B3TXF |
| US12075745B2 (en) | 2021-12-23 | 2024-09-03 | Monsanto Technology Llc | Cotton variety 19R325B3TXF |
| JP2025503677A (en) | 2022-01-14 | 2025-02-04 | エンコ ケム,インコーポレイテッド | Protoporphyrinogen oxidase inhibitors |
| AU2023209447A1 (en) | 2022-01-20 | 2024-07-18 | Flagship Pioneering Innovations Vii, Llc | Polynucleotides for modifying organisms |
| US12070008B2 (en) | 2022-01-26 | 2024-08-27 | Monsanto Technology Llc | Cotton variety 19R239B3XF |
| US12102052B2 (en) | 2022-01-26 | 2024-10-01 | Monsanto Technology Llc | Cotton variety 20R827B3TXF |
| US12108731B2 (en) | 2022-01-26 | 2024-10-08 | Monsanto Technology Llc | Cotton variety 20R824B3TXF |
| US12369556B2 (en) | 2022-01-26 | 2025-07-29 | Monsanto Technology Llc | Cotton variety 19R311B3TXF |
| US12108732B2 (en) | 2022-01-26 | 2024-10-08 | Monsanto Technology Llc | Cotton variety 20R914XF |
| US12108730B2 (en) | 2022-01-26 | 2024-10-08 | Monsanto Technology Llc | Cotton variety 19R316B3TXF |
| US12193404B2 (en) | 2022-01-26 | 2025-01-14 | Monsanto Technology Llc | Cotton variety 20R828B3TXF |
| US12004476B2 (en) | 2022-01-26 | 2024-06-11 | Monsanto Technology Llc. | Cotton variety 20R750B3XF |
| US12245568B2 (en) | 2022-01-26 | 2025-03-11 | Monsanto Technology Llc | Cotton variety 19R331B3TXF |
| US12382917B2 (en) | 2022-01-26 | 2025-08-12 | Monsanto Technology Llc | Cotton variety 20R821B3TXF |
| US11985950B2 (en) | 2022-01-26 | 2024-05-21 | Monsanto Technology Llc | Cotton variety 19R114B3XF |
| EP4479541A1 (en) | 2022-02-15 | 2024-12-25 | Futuragene Israel Ltd. | A bacillus thuringiensis pesticidal protein (bt pp) combination useful for plant protection |
| US20250386787A1 (en) | 2022-02-21 | 2025-12-25 | Beijing Dabeinong Biotechnology Co., Ltd. | Nucleic Acid Sequence for Detecting Glycine Max Plant DBN8205 and Detection Method Therefor |
| WO2024036190A2 (en) | 2022-08-09 | 2024-02-15 | Pioneer Hi-Bred International, Inc. | Guide polynucleotide multiplexing |
| AU2023337091A1 (en) | 2022-09-09 | 2025-03-06 | Eidgenössische Technische Hochschule Zürich | Plant regulatory elements and uses thereof |
| WO2024099765A2 (en) | 2022-11-10 | 2024-05-16 | BASF Agricultural Solutions Seed US LLC | Transcription regulating nucleotide sequences and methods of use |
| WO2024123786A1 (en) | 2022-12-06 | 2024-06-13 | Pioneer Hi-Bred International, Inc. | Methods and compositions for co-delivery of t-dnas expressing multiple guide polynucleotides into plants |
| EP4638759A2 (en) | 2022-12-19 | 2025-10-29 | BASF Agricultural Solutions US LLC | Insect toxin genes and methods for their use |
| US12389867B2 (en) | 2022-12-30 | 2025-08-19 | Monsanto Technology Llc | Cotton variety 21R4127B3TXF |
| US12389868B2 (en) | 2022-12-30 | 2025-08-19 | Monsanto Technology Llc | Cotton variety 20R733B3XF |
| US12575535B2 (en) | 2022-12-30 | 2026-03-17 | Monsanto Technology Llc | Cotton variety 21R649NRB3XF |
| US12284976B2 (en) | 2022-12-30 | 2025-04-29 | Monsanto Technology Llc | Cotton variety 21R4132B3TXF |
| US12426566B2 (en) | 2023-01-25 | 2025-09-30 | Monsanto Technology Llc | Cotton variety 20R751B3XF |
| US12414532B2 (en) | 2023-01-25 | 2025-09-16 | Monsanto Technology Llc | Cotton variety 20R731B3XF |
| US12414533B2 (en) | 2023-01-25 | 2025-09-16 | Monsanto Technology Llc | Cotton variety 20R752B3XF |
| US12356951B2 (en) | 2023-01-25 | 2025-07-15 | Monsanto Technology Llc | Cotton variety 21R523XF |
| US12439883B2 (en) | 2023-01-26 | 2025-10-14 | Monsanto Technology Llc | Cotton variety 21R4534B3TXF |
| US12419262B2 (en) | 2023-01-26 | 2025-09-23 | Monsanto Technology Llc | Cotton variety 21R4221B3TXF |
| US12433235B2 (en) | 2023-01-26 | 2025-10-07 | Monsanto Technology Llc | Cotton variety 21R4432B3TXF |
| US12419261B2 (en) | 2023-01-26 | 2025-09-23 | Monsanto Technology Llc | Cotton variety 21R626B3XF |
| US12419263B2 (en) | 2023-01-26 | 2025-09-23 | Monsanto Technology Llc | Cotton variety 21R4126B3TXF |
| JP2026510998A (en) | 2023-03-20 | 2026-04-10 | パイオニア ハイ-ブレッド インターナショナル, インコーポレイテッド | Cas polypeptide with modified PAM recognition |
| WO2024229385A1 (en) | 2023-05-03 | 2024-11-07 | Flagship Pioneering Innovations Vii, Llc | Artificial ghabrivirales satellite rnas |
| CN121816422A (en) | 2023-05-03 | 2026-04-07 | 旗舰创业创新第七有限责任公司 | Artificially synthesized viral satellite RNA |
| WO2024229347A1 (en) | 2023-05-03 | 2024-11-07 | Flagship Pioneering Innovations Vii, Llc | Artificial tombusviridae satellite rnas |
| CN121712897A (en) | 2023-05-03 | 2026-03-20 | 旗舰创业创新第七有限责任公司 | Split Virus Satellite RNA Amplification System for Plants |
| EP4705474A2 (en) | 2023-05-03 | 2026-03-11 | Flagship Pioneering Innovations VII, LLC | Artificial tymovirales satellite rnas |
| AR132591A1 (en) | 2023-05-03 | 2025-07-16 | Flagship Pioneering Innovations Vii Llc | SATELLITE RNA OF ARTIFICIAL SECOVIRIDAE |
| CN121712898A (en) | 2023-05-03 | 2026-03-20 | 旗舰创业创新第七有限责任公司 | Endogenous ribovirus satellite RNA amplification system for plants |
| WO2024229356A2 (en) | 2023-05-03 | 2024-11-07 | Flagship Pioneering Innovations Vii, Llc | Artificial solemoviridae satellite rnas |
| EP4705478A1 (en) | 2023-05-03 | 2026-03-11 | Flagship Pioneering Innovations VII, LLC | Artificial martellivirales satellite rnas |
| CN121548646A (en) | 2023-07-07 | 2026-02-17 | 巴斯夫农业解决方案美国有限责任公司 | Uses of the CRY gene for controlling nematode pests |
| US20250059551A1 (en) | 2023-08-14 | 2025-02-20 | The Texas A&M University System | Corn endotype-derived polypeptides capable of metabolizing fumonisin |
| US20250075226A1 (en) | 2023-08-29 | 2025-03-06 | University Of Freiburg | Proteins for regulation of symbiotic infection and associated regulatory elements |
| AU2024366942A1 (en) | 2023-10-27 | 2026-05-07 | Basf Agricultural Solutions Us Llc | Use of novel genes for the control of nematode pests |
| WO2025259976A1 (en) | 2024-06-14 | 2025-12-18 | Pioneer Hi-Bred International, Inc. | Deamination polyproteins and methods of use thereof |
| WO2026006779A1 (en) | 2024-06-27 | 2026-01-02 | The Regents Of The University Of California | Transgenic plants expressing fern rapid non-photochemical quenching (npq) proteins |
| WO2026010930A1 (en) | 2024-07-05 | 2026-01-08 | BASF Agricultural Solutions Seed US LLC | Use of axmi277 for the control of rotylenchulus reniformis nematode pests |
| EP4725303A1 (en) | 2024-10-11 | 2026-04-15 | Agrokray Limited Liability Company | Spelt, method of producing spelt plants, grain produced from spelt plant and food product produced therefrom |
Citations (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0193259A1 (en) * | 1985-01-18 | 1986-09-03 | Plant Genetic Systems N.V. | Modifying plants by genetic engineering to combat or control insects |
| EP0218571A2 (en) | 1985-08-07 | 1987-04-15 | Monsanto Company | Glyphosate-resistant plants |
| US4769061A (en) * | 1983-01-05 | 1988-09-06 | Calgene Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use |
| EP0293358A2 (en) | 1987-05-26 | 1988-11-30 | Monsanto Company | Glyphosate tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
| US5004863A (en) | 1986-12-03 | 1991-04-02 | Agracetus | Genetic engineering of cotton plants and lines |
| WO1991004323A1 (en) | 1989-07-17 | 1991-04-04 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
| EP0426641A2 (en) | 1989-10-31 | 1991-05-08 | Monsanto Company | Promoter for transgenic plants |
| US5094945A (en) * | 1983-01-05 | 1992-03-10 | Calgene, Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use |
| WO1992004449A1 (en) | 1990-08-31 | 1992-03-19 | Monsanto Company | Glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US5164316A (en) | 1987-01-13 | 1992-11-17 | The University Of British Columbia | DNA construct for enhancing the efficiency of transcription |
| US5196525A (en) | 1987-01-13 | 1993-03-23 | University Of British Columbia | DNA construct for enhancing the efficiency of transcription |
| US5312910A (en) | 1987-05-26 | 1994-05-17 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
| US5322938A (en) | 1987-01-13 | 1994-06-21 | Monsanto Company | DNA sequence for enhancing the efficiency of transcription |
| US5352605A (en) | 1983-01-17 | 1994-10-04 | Monsanto Company | Chimeric genes for transforming plant cells using viral promoters |
| US5416011A (en) | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
| US5463174A (en) | 1986-05-29 | 1995-10-31 | Calgene Inc. | Transformation and foreign gene expression in Brassica species |
| US5512466A (en) | 1990-12-26 | 1996-04-30 | Monsanto Company | Control of fruit ripening and senescence in plants |
| US5518908A (en) | 1991-09-23 | 1996-05-21 | Monsanto Company | Method of controlling insects |
| US5627061A (en) | 1990-08-31 | 1997-05-06 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US6204436B1 (en) | 1997-10-31 | 2001-03-20 | Novartis Ag | Transgenic plants |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5551553A (en) * | 1992-08-11 | 1996-09-03 | Stamet, Inc. | Angled disk drive apparatus for transporting and metering particulate material |
-
1994
- 1994-09-13 US US08/306,063 patent/US5633435A/en not_active Expired - Lifetime
-
1995
- 1995-06-07 US US08/476,008 patent/US5627061A/en not_active Expired - Lifetime
-
1997
- 1997-04-07 US US08/833,485 patent/US5804425A/en not_active Expired - Lifetime
-
1998
- 1998-08-20 US US09/137,440 patent/US6248876B1/en not_active Expired - Fee Related
-
1999
- 1999-12-16 US US09/464,099 patent/US7183110B2/en not_active Expired - Fee Related
-
2003
- 2003-07-18 US US10/622,201 patent/USRE39247E1/en not_active Expired - Lifetime
-
2006
- 2006-09-22 US US11/526,170 patent/US20080227966A1/en not_active Abandoned
-
2009
- 2009-07-06 US US12/459,672 patent/US20100022762A1/en not_active Abandoned
Patent Citations (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5094945A (en) * | 1983-01-05 | 1992-03-10 | Calgene, Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use |
| US4769061A (en) * | 1983-01-05 | 1988-09-06 | Calgene Inc. | Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use |
| US5352605A (en) | 1983-01-17 | 1994-10-04 | Monsanto Company | Chimeric genes for transforming plant cells using viral promoters |
| EP0193259A1 (en) * | 1985-01-18 | 1986-09-03 | Plant Genetic Systems N.V. | Modifying plants by genetic engineering to combat or control insects |
| EP0218571A2 (en) | 1985-08-07 | 1987-04-15 | Monsanto Company | Glyphosate-resistant plants |
| US5463174A (en) | 1986-05-29 | 1995-10-31 | Calgene Inc. | Transformation and foreign gene expression in Brassica species |
| US5159135A (en) | 1986-12-03 | 1992-10-27 | Agracetus | Genetic engineering of cotton plants and lines |
| US5004863A (en) | 1986-12-03 | 1991-04-02 | Agracetus | Genetic engineering of cotton plants and lines |
| US5004863B2 (en) | 1986-12-03 | 2000-10-17 | Agracetus | Genetic engineering of cotton plants and lines |
| US5159135B1 (en) | 1986-12-03 | 2000-10-24 | Agracetus | Genetic engineering of cotton plants and lines |
| US5004863B1 (en) | 1986-12-03 | 1992-12-08 | Agracetus | |
| US5322938A (en) | 1987-01-13 | 1994-06-21 | Monsanto Company | DNA sequence for enhancing the efficiency of transcription |
| US5164316A (en) | 1987-01-13 | 1992-11-17 | The University Of British Columbia | DNA construct for enhancing the efficiency of transcription |
| US5196525A (en) | 1987-01-13 | 1993-03-23 | University Of British Columbia | DNA construct for enhancing the efficiency of transcription |
| US5312910A (en) | 1987-05-26 | 1994-05-17 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
| US4971908A (en) * | 1987-05-26 | 1990-11-20 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
| EP0293358A2 (en) | 1987-05-26 | 1988-11-30 | Monsanto Company | Glyphosate tolerant 5-enolpyruvyl-3-phosphoshikimate synthase |
| US5569834A (en) | 1988-07-22 | 1996-10-29 | Monsanto Company | Method for soybean transformation and regeneration |
| US5416011A (en) | 1988-07-22 | 1995-05-16 | Monsanto Company | Method for soybean transformation and regeneration |
| US5310667A (en) * | 1989-07-17 | 1994-05-10 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
| WO1991004323A1 (en) | 1989-07-17 | 1991-04-04 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases |
| EP0426641A2 (en) | 1989-10-31 | 1991-05-08 | Monsanto Company | Promoter for transgenic plants |
| EP0546090A1 (en) | 1990-08-31 | 1993-06-16 | Monsanto Co | GLYPHOSAT TOLERANT 5-ENOLPYRUVYL-3-PHOSPHOSHIKIMAT SYNTHASES. |
| US5627061A (en) | 1990-08-31 | 1997-05-06 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US5633435A (en) | 1990-08-31 | 1997-05-27 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US5804425A (en) | 1990-08-31 | 1998-09-08 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| WO1992004449A1 (en) | 1990-08-31 | 1992-03-19 | Monsanto Company | Glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US6248876B1 (en) | 1990-08-31 | 2001-06-19 | Monsanto Company | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases |
| US5512466A (en) | 1990-12-26 | 1996-04-30 | Monsanto Company | Control of fruit ripening and senescence in plants |
| US5518908A (en) | 1991-09-23 | 1996-05-21 | Monsanto Company | Method of controlling insects |
| US6204436B1 (en) | 1997-10-31 | 2001-03-20 | Novartis Ag | Transgenic plants |
Non-Patent Citations (107)
| Title |
|---|
| "A Single Amino Acid Substitution In The Enzyme 5-Enolpyruvylshikimate-3-Phosphate Synthase Confers Resistance To The Herbicide Glyphosate," D. Stalker, W. Hiatt, and L., Comai, J. Biol. Chem. 260:4724-4728 (1985). |
| "Agrobacterium-Mediated Gene Transfer To Plants; Engineering Tolerance To Glyphosate," R. Horsch, R. Fraley, S. Rogers, H. Klee, J. Fry, M. Hinchee, and D. Shah, Iowa State Journal of Research 62:487-502 (1988). |
| "An Altered aroA Gene Product Confers Resistance to the Herbicide Glyphosate," L. Comai, L. Sen, and D. Stalker, Science 221:370-371 (1983). |
| "Biocontrol Of Plant Diseases vol. II" K. Mukerji and K. Garg, Editors, CRC Press Inc. (1988). |
| "Chloroplast Delivery Of A Bacterial EPSPS Synthase In Transgenic Plants And Tolerance To Glyphosate," N. Larson-Kelly, L. Comai, J. Kiser, C. Mau, A. Pokalsky, K. McBride, A. Jones, C. Shewmaker, and D. Stalker, Biochem. Biotech. 1:37-40 (1998). |
| "Chloroplast Transport Of A Ribulose Biphosphate Carboxylase Small Subunit-5-Enolpyruvyl 3-Phosphoshikimate Synthase Chimeric Protein Requires Part Of The Mature Small Subunit In Addition To The Transit Peptide," L. Comai, N. Larson-Kelly, J. Kiser, C. Mau, A. Pokalsky, C. Shewmaker, K. McBride, A. Jones, and D. Stalker, J. Biol. Chem. 263:15104-15109 (1988). |
| "Cloning Of An Arabidopsis Thaliana Gene Encoding 5-Enolpyruvylshikimate-3-Phosphate Synthase: Sequence Analysis And Manipulation To Obtain Glyphosae-Tolerant Plants," H. Klee, Y. Muskopf, and C. Gasser, Mol. Gen. Gene. 210:437-442 (1987). |
| "Efficient Transfer Of A Glyphosate Tolerance Gene Into Tomato Using A Binary Agrobacterium Tumefaciens Vector," L. Fillati, J. Kiser, R. Rose, and L. Comai, Bio/Technology 5:726-730 (1987). |
| "Engineering Herbicide Resistance In Plants," J. Botterman and J. Leemans, Trends In Genetics 4:219-222 (1988). |
| "Engineering Herbicide Tolerance In Transgenic Plants," D. Shah, R. Horsch, H. Klee, G. Kishore, J. Winter, N. Tumer, C. Hironaka, P. Sanders, C. Gasser, S. Aykent, N. Siegel, S. Rogers, and R. Fraley, Science 233:478-481 (1986). |
| "EPSP Synthase-From Biochemistry To Genetic Engineering Of Herbicide Tolerance," G. Kishore, S. Padgette, G. Della-Cioppa, D. Biest Re, L. Brundage, D. Shah, C. Gasser, P. Sanders, H. Klee, R. Horsch, N. Hoffmann, and R. Fraley, American Society of Biological Chemists, 78<SUP>th </SUP>Annual Meeting, Abstract # 754 (1987). |
| "Expression In Plants of a Mutant aroA Gene from Salmonella Typhimurium Confers Tolerance to Glyphosate," L. Comai, D. Facciotti, W.R. Hiatt, G. Thompson, R.E. Rose & D. M. Stalker, Nature 317:741-744 (1985). |
| "Gene Transfer To Cereal: An Assessment," I. Potrykus, Bio/Technology 1:535-542 (1990). |
| "Genetic Aspects Of Aromatic Amino Acid Biosynthesis In Lactococcus Lactis," H. Griffin, and M. Gasson, Mol. Gen. Genet. 246:119-127 (1995). |
| "Genetic Engineering Of Plants For Herbicide Resistance Expression Of An RuBP Carboxylase Small Subunit-EPSP Synthase Chimeric Gene, Chlorophast Transport Of The Hybrid Protein, And Tolerance Phenotype In Transgenic Plants," L. Comai, N. Larson-Kelly, J. Kiser, A. Jones, D. Stalker, P. Moran, K. Kiehne, and A. Koning, Vortr. Pflanzenzüchtg 16:441-454 (1989). |
| "Genetic Engineering Of Tobacco For Resistance To The Herbicide Glyphosate," L. Comai, D. Stalker, W. Hiatt, G. Thompson, and D. Facciotti, (abstract, 1985). |
| "Genetically-Engineered Herbicide Tolerance-Technical And Commercial Considerations," R. Fraley, G. Kishore, C. Gasser, S. Padgette, R. Horsch, S. Rogers, G. Della-Cioppa, and D. Shah, British Crop Protection Conference-Weeds 2:463-471 (1987). |
| "Glyphosate Tolerant Flax Plants From Agrobacterium Mediated Gene Transfer," M. Jordan and A. McHughen, Plant Cell Reports 7:281-284 (1988). |
| "Glyphosate Tolerant Variants Of Petunia EPSP Synthase," D. Eichholtz, C. Gasser, D. Re, S. Padgette, G. Kishore, D. Shah, and R. Fraley, American Society of Plant Physiologists, Sup. To Plant Physiology (1989). |
| "Monsanto Holds Right to Patent Herbicide-Resistant Seeds, European Patent Office Says," Associated Press, Apr. 9, 2005. |
| "Performance Assessment Under Field Conditions Of A Rapid Immunological Test For Transgenic Soybeans," J. Fagan, B. Schoel, A. Haegert, J. Moore, and J. Beeby, International Journal of Food Science and Technology 36:357-367 (2001). |
| "Producing Herbicide-Resistant Plants By Gene Transfer Technology". D. Stalker, in "Target Sites of Herbicide Action", P. Boger and G. Sandmann Editors, 1989. |
| "Production Of Transgenic Soybean Plants Using Agrobacterium-Mediated DNA Transfer," M. Hinchee, D. Connor-Ward, C. Newell, R. McDonnell, S. Sato, C. Gasser, D. Fischhoff, D. Re, R. Fraley, and R. Horsch, Bio/Technology 6:915-926 (1988). |
| "Pseudomonas sp. Strain PG2082: Uptake Of Glyphosate And Cloning Of A Gene Which Confers Increased Resistance To Glyphosate," J. Fitzgibbon, Ph.D. (Dec. 1998). |
| "Targeting A Herbicide-Resistant Enzyme From Escherichia Coli To Chloroplasts Of Higher Plants," G. della-Cioppa, S. Bauer, M. Taylor, D. Rochester, B. Klein, D. Shah, R. Fraley, and G. Kishore, Bio/Technology 5:579-584 (1987). |
| "The Development Of Herbicide Resistant Crops," B. Mazur and S. Falco, Annu. Rev. Plant Physiol. Plant Mol. Biol. 40:441-470 (1989). |
| "The Organization And Nucleotide Sequence Of the Bacillus Subtilis hisH, tyrA and AroE Genes," D. Henner, L. Band, G. Glaggs, and E. Chen, Gene 49:147-152 (1986). |
| "The Use Of Bacterial Genes Encoding Herbicide Tolerance In Constructing Transgenic Plants," E. Piruzian, V. Mett, N. Kobets, and F. Urmeeva, Microbiological Sciences 5:242-248 (1988). |
| Alberg, et al. (1989) Journal of The American Chemical Society, 111: 2337-2338. |
| Armstrong, et al. (1995) Crop Sci., 35:550-557. |
| Barlow, et al. (1989) Biochemistry, 28: 7985-7991. |
| Battraw, et al. (1990) Plant Mol. Biol., 15: 527-538. |
| Bower, et al. (1992) Plant Journal, 2: 409-416. |
| Bytebier, et al. (1987) Proc. Natl. Acad. Sci. USA, 84: 5345-5349. |
| Cheng, et al. (1996) Plant Cell Reports, 15: 653-657. |
| Chiesa, et al., Gene, (1994) 144: 145-146. |
| Christou, et al. (1988) Plant Physiol., 87: 671-674. |
| Christou, et al. (1991) Bio/Technology, 9: 957-962. |
| Comai et. al. (1988) Journal of Biological Chemistry 263:15104-15109. * |
| Comai, et al (1988) Journal of Biological Chemistry 263:15104-15109. * |
| Davey, et al. (1986) "Transformation of the Genomic Expression of Plant Cells," in Plasticity in Plants, Symposia of the Society for Experimental Biology, pp. 85-120. |
| Davey, et al. (1989) Plant Mol. Biol., 13: 273-285. |
| De Kathen, et al. (1990) Plant Cell Reports, 9: 276-279. |
| De la Pena, et al. (1987) Nature, 325: 274-276. |
| Defendants' Motion for Summary Judgmnt on Plaintiff's Patent Infringement Claim, Count One, Third Amended Complaint, dated Aug. 8, 2003, as filed in Monsanto Company v. Scruggs, 3:00CV161-B-A, U.S. District Court, Northern District of Mississippi, Western Division. |
| Defendants' Response to Plaintiff's Notice of Dismissal of Count One (and Rebuttal to Monsanto's Response to Defendant's Motion for Summary Judgment on Count One (with exhibits), dated Jan. 12, 2004, as filed in Monsanto Company v. Scruggs, 3:00CV161-B-A, U.S. District Court, Northern District of Mississippi, Western Division. |
| Defendant's Second Supplemental Answers to Plaintiff's Third Set of Interrogatories to Mitchell Scruggs, as filed May 30, 2004, in Monsanto Company v. Scruggs, 3:00CV161-P-D, U.S. District Court, Northern District of Mississippi, Western Division. |
| Eichholtz, et al. (1989) Plant Physiology, 89: 47. |
| English language translation of excerpt, Chemistry and Biology, Bioscience and Biotechnology, (1991) 29:734. |
| English language translation of excerpt, Nagata (1993), Plant Protoplast and Cell Engineering, p. 104, Kodansha Co., Ltd. |
| English language translation of excerpt, Okada (ed.) "Gene Expression and Regulation in Higher Plants," in Developments of Molecular Biology, No. 13, Maruzen Co., Japan., 1990. |
| English language translation of excerpt, Uozumi (1993) Plant Engineering, p. 111, Maruzen Co., Ltd. |
| Fillatti et al. (Jul. 1987) Bio/Technology 5:726-730. * |
| Fischer, et al. (1987) Archives of Biochemistry and Biophysics, 256: 325-334. |
| Fitzgibbon (Dec. 1988) Ph.D. Thesis University Microfilms International, (1989). * |
| Fitzgibbon (Dec. 1988) Ph.D. Thesis University Microfilms International, 1989, pp. viii-ix, 18, 22-29, 32, 93, 96-108. * |
| Fitzgibbon and Braymer (1990) Appl. Envir. Microbiol. 56:3382-3388. |
| Fitzgibbon, et al (1990) Chemical Abstracts, vol. 112, abstract No. 92785. |
| Flavell, et al. (1987) Nature, 307: 108-109. |
| Fromm, et al. (1990) Bio/Technology, 8: 833-839. |
| Gasser, et al., (1989), Science, 244: 1293-1299. |
| Goodman, et al. (1987) Science, 236: 48-54. |
| Gordon-Kamm, et al. (1990) Plant Cell, 2: 603-618. |
| Grant, et al. (1995) Plant Cell Reports, 15: 254-258. |
| Griffin and Gasson (1995) Mol. Gen. Genet. 246:119-127. * |
| Henner et al. (1986) Gene 49:147-152. * |
| Henner, et al. (1984) Gene, 34:169-177. |
| Horn, et al. (1988) Plant Cell Reports, 7: 469-472. |
| Jahne, et al. (1995), Euphytica, 85: 35-44. |
| Kane, et al. (1971) Journal of Biological Chemistry, 246: 4308-4316. |
| Kishore, et al., 1988 From Biochemistry to Genetic Engineering of Glyphosate Tolerance, American Chemical Society, Chapter 3, pp. 37-48. |
| Klein, et al. (1988) Proc. Natl. Acad. Sci. USA, 85: 8502-8505. |
| Koziel, et al. (1993) Bio/Technology, 11: 194-200. |
| Lanzetta, et al. (1979) Analytical Biochemistry, 100: 95-97. |
| Larson-Kelly et al. (1988) SAAS Bulletin, 1: 37-40. |
| Lorz, et al. (1985) Mol. Gen. Gene, 199:178-182. |
| Majumder, et al. (1995) Eur. J. Biochem., 229: 99-106. |
| McCabe, et al. (1988) Bio/Technology, 6: 923-926. |
| McKently, et al. (1995) Plant Cell Reports, 14: 699-703. |
| Memorandum in Support of Defendants' Motion for Summary Judgment on Plaintiff's Patent Infringement Claim, Count One, Third Amended Complaint (with exhibits), dated Aug. 8, 2003, as filed in Monsanto Company v. Scruggs, 3:00CV161-B-A, U.S. District Court, Northern District of Mississippi, Western Division. |
| Minutes of the Public Oral Proceedings before the EPO Technical Board of Appeal, on Apr. 6, 2005, for European Patent No. 0 546,090. |
| Padgette, et al. (1987) Archives of Biochemistry and Biophysics, 258: 564-573. |
| Padgette, et al. (1996) Herbicide-Resistant Crops, Chapter 4, pp. 53-84. |
| Park, et al. (1996) Plant Mol. Biol., 32: 1135-1148. |
| Paszkowski, et al. (1984) EMBO Journal, 3: 2717-2722. |
| Potrykus (Jun. 1990) Bio/Technology 8:535-542. * |
| Potrykus, et al. (1985) Mol. Gen. Genet., 199: 183-188. |
| Rhodes, et al. (1988) Science, 240: 204-207. |
| Schroeder, et al. (1993) Plant Physiol., 101: 751-757. |
| Schultz, et al. (1984) Arch. Microbiol., 137:121-123. |
| Schulz, et al. (1985) Chemical Abstracts, vol. 103, abstract No. 119839. |
| Schulz, et al. (1985) FEMS Microbiol Lett., 28:297-301. |
| Schulz, et al. (1985) FEMS Microbiology Letters, 28: 297-301. |
| Selvapandiyan, et al. (1995) FEBS Letters, 374: 253-256. |
| Shimamoto, et al. (1989) Nature, 338: 274-276. |
| Shuttleworth et al. (1992) Protein Engineering, 5: 461-466, 1992. |
| Somers, et al. (1992) Bio/Technology, 10: 1589-1594. |
| Steinrücken, et al. (1984) Eur. J. Biochem., 143: 341-349. |
| Steinrücken, et al. (1986) Archives of Biochemistry and Biophysics, 244: 169-178. |
| Toryama, et al. (1990) Bio/Technology, 6: 1072-1074. |
| Vasil, et al. (1992) Bio/Technology, 10: 667-674. |
| Wan, et al. (1994) Plant Physiol., 104: 37-48. |
| Wang, et al. (1992) Bio/Technology, 10: 691-696. |
| Weeks, et al. (1988) Plant Physiol., 102: 1077-1084. |
| Yang, et al. (1996) Plant Cell Reports, 15: 459-464. |
| Zhang, et al. (1988) Plant Cell Reports, 7: 379-384. |
| Zhang, et al. (1988) Theor. Appl. Genet., 76: 835-840. |
Cited By (99)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080119361A1 (en) * | 2006-06-06 | 2008-05-22 | Feng Paul C C | Methods for weed control |
| USRE44971E1 (en) | 2006-06-06 | 2014-06-24 | Monsanto Technology Llc | Method for selection of transformed cells |
| US8629328B2 (en) | 2006-06-06 | 2014-01-14 | Monsanto Technology Llc | Methods for weed control using plants transformed with dicamba monooxygenase |
| US7855326B2 (en) | 2006-06-06 | 2010-12-21 | Monsanto Technology Llc | Methods for weed control using plants having dicamba-degrading enzymatic activity |
| USRE45048E1 (en) | 2006-06-06 | 2014-07-22 | Monsanto Technology Llc | Methods for weed control using plants having dicamba-degrading enzymatic activity |
| US20110152096A1 (en) * | 2006-06-06 | 2011-06-23 | Feng Paul C C | Methods for weed control |
| WO2008048964A2 (en) | 2006-10-16 | 2008-04-24 | Monsanto Technology Llc | Methods and compositions for improving plant health |
| US20080305952A1 (en) * | 2006-10-25 | 2008-12-11 | Arnevik Cindy L | Cropping systems for managing weeds |
| US7939721B2 (en) | 2006-10-25 | 2011-05-10 | Monsanto Technology Llc | Cropping systems for managing weeds |
| EP2454940A2 (en) | 2006-10-25 | 2012-05-23 | Monsanto Technology LLC | Cropping systems for managing weeds |
| US7838729B2 (en) | 2007-02-26 | 2010-11-23 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of DMO and uses thereof |
| US8084666B2 (en) | 2007-02-26 | 2011-12-27 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of DMO and uses thereof |
| US8791325B2 (en) | 2007-02-26 | 2014-07-29 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of DMO and uses thereof |
| US8420888B2 (en) | 2007-02-26 | 2013-04-16 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of DMO and uses thereof |
| US20110126307A1 (en) * | 2007-02-26 | 2011-05-26 | Feng Paul C C | Chloroplast transit peptides for efficient targeting of dmo and uses thereof |
| US20090029861A1 (en) * | 2007-02-26 | 2009-01-29 | Monsanto Technology Llc | Chloroplast transit peptides for efficient targeting of dmo and uses thereof |
| EP3290520A1 (en) | 2007-03-09 | 2018-03-07 | Monsanto Technology LLC | Preparation and use of plant embryo explants for transformation |
| EP3916097A1 (en) | 2007-03-09 | 2021-12-01 | Monsanto Technology LLC | Preparation and use of plant embryo explants for transformation |
| EP2425709A1 (en) | 2007-03-09 | 2012-03-07 | Monsanto Technology, LLC | Preparation and use of plant embryo explants for transformation |
| US10888579B2 (en) | 2007-11-07 | 2021-01-12 | Beeologics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
| EP3875592A2 (en) | 2009-09-17 | 2021-09-08 | Monsanto Technology LLC | Soybean transgenic event mon 87708 and methods of use thereof |
| EP3127425A2 (en) | 2009-09-17 | 2017-02-08 | Monsanto Technology LLC | Soybean transgenic event mon 87708 and methods of use thereof |
| US10801028B2 (en) | 2009-10-14 | 2020-10-13 | Beeologics Inc. | Compositions for controlling Varroa mites in bees |
| EP3231872A1 (en) | 2010-03-08 | 2017-10-18 | Monsanto Technology LLC | Polynucleotide molecules for gene regulation in plants |
| US9121022B2 (en) | 2010-03-08 | 2015-09-01 | Monsanto Technology Llc | Method for controlling herbicide-resistant plants |
| US11812738B2 (en) | 2010-03-08 | 2023-11-14 | Monsanto Technology Llc | Polynucleotide molecules for gene regulation in plants |
| US9988634B2 (en) | 2010-03-08 | 2018-06-05 | Monsanto Technology Llc | Polynucleotide molecules for gene regulation in plants |
| EP2733151A1 (en) | 2011-03-25 | 2014-05-21 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| EP2733152A1 (en) | 2011-03-25 | 2014-05-21 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| WO2012134921A2 (en) | 2011-03-25 | 2012-10-04 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| US10138526B2 (en) | 2011-08-31 | 2018-11-27 | Monsanto Technology Llc | Molecular markers associated with stem canker resistance in soybean |
| US10760086B2 (en) | 2011-09-13 | 2020-09-01 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10435702B2 (en) | 2011-09-13 | 2019-10-08 | Monsanto Technology Llc | Methods and compositions for delaying senescence and improving disease tolerance and yield in plants |
| US10808249B2 (en) | 2011-09-13 | 2020-10-20 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10806146B2 (en) | 2011-09-13 | 2020-10-20 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9416363B2 (en) | 2011-09-13 | 2016-08-16 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9422557B2 (en) | 2011-09-13 | 2016-08-23 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9422558B2 (en) | 2011-09-13 | 2016-08-23 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10829828B2 (en) | 2011-09-13 | 2020-11-10 | Monsanto Technology Llc | Methods and compositions for weed control |
| US9840715B1 (en) | 2011-09-13 | 2017-12-12 | Monsanto Technology Llc | Methods and compositions for delaying senescence and improving disease tolerance and yield in plants |
| US9920326B1 (en) | 2011-09-14 | 2018-03-20 | Monsanto Technology Llc | Methods and compositions for increasing invertase activity in plants |
| US10428338B2 (en) | 2011-09-14 | 2019-10-01 | Monsanto Technology Llc | Methods and compositions for increasing invertase activity in plants |
| EP3235373A1 (en) | 2012-02-01 | 2017-10-25 | Dow AgroSciences LLC | Synthetic chloroplast transit peptides |
| EP3219200A1 (en) | 2012-02-01 | 2017-09-20 | Dow Agrosciences Llc | Glyphosate resistant plants and associated methods |
| WO2013116700A1 (en) | 2012-02-01 | 2013-08-08 | Dow Agrosciences Llc | Glyphosate resistant plants and associated methods |
| WO2013116758A1 (en) | 2012-02-01 | 2013-08-08 | Dow Agrosciences Llc | Synthetic brassica-derived chloroplast transit peptides |
| EP3470522A2 (en) | 2012-02-01 | 2019-04-17 | Dow AgroSciences LLC | Novel class of glyphosate resistance genes |
| US8952229B1 (en) | 2012-02-21 | 2015-02-10 | Pioneer Hi Bred International Inc | Maize inbred PH1K0H1 |
| US8975469B1 (en) | 2012-02-21 | 2015-03-10 | Pioneer Hi Bred International Inc | Maize hybrid X13C704HR |
| WO2013138358A1 (en) | 2012-03-13 | 2013-09-19 | Pioneer Hi-Bred International, Inc. | Genetic reduction of male fertility in plants |
| WO2013158766A1 (en) | 2012-04-17 | 2013-10-24 | Dow Agrosciences Llc | Synthetic brassica-derived chloroplast transit peptides |
| WO2013158442A1 (en) | 2012-04-20 | 2013-10-24 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| US10240162B2 (en) | 2012-05-24 | 2019-03-26 | A.B. Seeds Ltd. | Compositions and methods for silencing gene expression |
| US10240161B2 (en) | 2012-05-24 | 2019-03-26 | A.B. Seeds Ltd. | Compositions and methods for silencing gene expression |
| US10934555B2 (en) | 2012-05-24 | 2021-03-02 | Monsanto Technology Llc | Compositions and methods for silencing gene expression |
| US10077451B2 (en) | 2012-10-18 | 2018-09-18 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| US10844398B2 (en) | 2012-10-18 | 2020-11-24 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| US10041068B2 (en) | 2013-01-01 | 2018-08-07 | A. B. Seeds Ltd. | Isolated dsRNA molecules and methods of using same for silencing target molecules of interest |
| US10683505B2 (en) | 2013-01-01 | 2020-06-16 | Monsanto Technology Llc | Methods of introducing dsRNA to plant seeds for modulating gene expression |
| US10000767B2 (en) | 2013-01-28 | 2018-06-19 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| US8916744B1 (en) | 2013-02-13 | 2014-12-23 | Pioneer Hi Bred International Inc | Maize inbred PH24DV |
| US8907159B1 (en) | 2013-02-13 | 2014-12-09 | Pioneer Hi Bred International Inc | Maize inbred PH24DM |
| US8921672B1 (en) | 2013-02-13 | 2014-12-30 | Pioneer Hi Bred International Inc | Maize inbred PH24DS |
| US10612019B2 (en) | 2013-03-13 | 2020-04-07 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10609930B2 (en) | 2013-03-13 | 2020-04-07 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10435701B2 (en) | 2013-03-14 | 2019-10-08 | Monsanto Technology Llc | Methods and compositions for plant pest control |
| EP3587436A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| EP3587437A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| EP3587435A1 (en) | 2013-03-14 | 2020-01-01 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| EP3575308A1 (en) | 2013-03-14 | 2019-12-04 | Monsanto Technology LLC | Plant regulatory elements and uses thereof |
| US10568328B2 (en) | 2013-03-15 | 2020-02-25 | Monsanto Technology Llc | Methods and compositions for weed control |
| WO2014151255A1 (en) | 2013-03-15 | 2014-09-25 | Monsanto Technology Llc | Methods and compositions for weed control |
| WO2014143996A2 (en) | 2013-03-15 | 2014-09-18 | Pioneer Hi-Bred International, Inc. | Compositions and methods of use of acc oxidase polynucleotides and polypeptides |
| US10059999B2 (en) | 2013-06-10 | 2018-08-28 | Monsanto Technology Llc | Molecular markers associated with soybean tolerance to low iron growth conditions |
| US10662486B2 (en) | 2013-06-10 | 2020-05-26 | Monsanto Technology Llc | Molecular markers associated with soybean tolerance to low iron growth conditions |
| US9777288B2 (en) | 2013-07-19 | 2017-10-03 | Monsanto Technology Llc | Compositions and methods for controlling leptinotarsa |
| US11377667B2 (en) | 2013-07-19 | 2022-07-05 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US9856495B2 (en) | 2013-07-19 | 2018-01-02 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US9850496B2 (en) | 2013-07-19 | 2017-12-26 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US10597676B2 (en) | 2013-07-19 | 2020-03-24 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US10927374B2 (en) | 2013-11-04 | 2021-02-23 | Monsanto Technology Llc | Compositions and methods for controlling arthropod parasite and pest infestations |
| US10100306B2 (en) | 2013-11-04 | 2018-10-16 | Monsanto Technology Llc | Compositions and methods for controlling arthropod parasite and pest infestations |
| US9540642B2 (en) | 2013-11-04 | 2017-01-10 | The United States Of America, As Represented By The Secretary Of Agriculture | Compositions and methods for controlling arthropod parasite and pest infestations |
| US10557138B2 (en) | 2013-12-10 | 2020-02-11 | Beeologics, Inc. | Compositions and methods for virus control in Varroa mite and bees |
| WO2015108982A2 (en) | 2014-01-15 | 2015-07-23 | Monsanto Technology Llc | Methods and compositions for weed control using epsps polynucleotides |
| US10334848B2 (en) | 2014-01-15 | 2019-07-02 | Monsanto Technology Llc | Methods and compositions for weed control using EPSPS polynucleotides |
| US11091770B2 (en) | 2014-04-01 | 2021-08-17 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
| US10988764B2 (en) | 2014-06-23 | 2021-04-27 | Monsanto Technology Llc | Compositions and methods for regulating gene expression via RNA interference |
| US11807857B2 (en) | 2014-06-25 | 2023-11-07 | Monsanto Technology Llc | Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression |
| US11124792B2 (en) | 2014-07-29 | 2021-09-21 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
| US10378012B2 (en) | 2014-07-29 | 2019-08-13 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
| US10968449B2 (en) | 2015-01-22 | 2021-04-06 | Monsanto Technology Llc | Compositions and methods for controlling Leptinotarsa |
| US10883103B2 (en) | 2015-06-02 | 2021-01-05 | Monsanto Technology Llc | Compositions and methods for delivery of a polynucleotide into a plant |
| US10655136B2 (en) | 2015-06-03 | 2020-05-19 | Monsanto Technology Llc | Methods and compositions for introducing nucleic acids into plants |
| US11046969B2 (en) | 2017-05-24 | 2021-06-29 | Epiplanta Biotech Ltd. | Transgenic plant and the method for producing the same |
| US11512322B2 (en) | 2017-05-24 | 2022-11-29 | Epiplanta Biotech Ltd. | Transgenic plant and the method for producing the same |
| US11891610B2 (en) | 2017-05-24 | 2024-02-06 | Epiplanta Biotech Ltd. | Transgenic plant and the method for producing the same |
| US11041172B2 (en) | 2019-06-25 | 2021-06-22 | Inari Agriculture, Inc. | Homology dependent repair genome editing |
| WO2021016043A1 (en) | 2019-07-19 | 2021-01-28 | Inari Agriculture, Inc. | Improved homology dependent repair genome editing |
Also Published As
| Publication number | Publication date |
|---|---|
| US20020168680A1 (en) | 2002-11-14 |
| US6248876B1 (en) | 2001-06-19 |
| US20100022762A1 (en) | 2010-01-28 |
| US5633435A (en) | 1997-05-27 |
| US5804425A (en) | 1998-09-08 |
| US20080227966A1 (en) | 2008-09-18 |
| US5627061A (en) | 1997-05-06 |
| US7183110B2 (en) | 2007-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5633435A (en) | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases | |
| AU655945B2 (en) | Glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthases | |
| US5463175A (en) | Glyphosate tolerant plants | |
| US6225114B1 (en) | Modified gene encoding glyphosate-tolerant 5-enolpruvyl-3-phosphoshikimate synthase | |
| US7554012B2 (en) | Plants and plant cells exhibiting resistance to AMPA, and methods for making the same | |
| US5177010A (en) | Process for transforming corn and the products thereof | |
| US5188642A (en) | Glyphosate-resistant plants | |
| US4940835A (en) | Glyphosate-resistant plants | |
| US7960615B2 (en) | GRG36: novel EPSP synthase gene conferring herbicide resistance | |
| US20020007053A1 (en) | Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases | |
| USRE38825E1 (en) | Glyphosate tolerant plants | |
| Class et al. | Patent application title: Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases Inventors: Gerard Francis Barry (St. Louis, MO, US) Ganesh Murthy Kishore (Creve Coeur, MO, US) Stephen Rogers Padgette (Wildwood, MO, US) William Carlton Stallings (Wildwood, MO, US) Assignees: Monsanto Technology LLC | |
| RU2168544C2 (en) | Molecule of isolated double-stranded dna, molecule of recombinant double-stranded dna and method of genetically transformed plants preparing | |
| SSp | US Patent Oct. 31, 1995 Sheet 1 of 15 5,463,175 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| CC | Certificate of correction | ||
| FPAY | Fee payment |
Year of fee payment: 12 |
|
| REMI | Maintenance fee reminder mailed |