USRE35749E - Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs - Google Patents

Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs Download PDF

Info

Publication number
USRE35749E
USRE35749E US08/710,744 US71074496A USRE35749E US RE35749 E USRE35749 E US RE35749E US 71074496 A US71074496 A US 71074496A US RE35749 E USRE35749 E US RE35749E
Authority
US
United States
Prior art keywords
fragment
bamhi
yeast
plasmid
region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US08/710,744
Inventor
Steven Rosenberg
Patricia Tekamp-Olson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27413075&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=USRE35749(E) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
US case filed in International Trade Commission litigation https://portal.unifiedpatents.com/litigation/International%20Trade%20Commission/case/337-TA-408 Source: International Trade Commission Jurisdiction: International Trade Commission "Unified Patents Litigation Data" by Unified Patents is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US07/380,783 external-priority patent/US5089398A/en
Application filed by Chiron Corp filed Critical Chiron Corp
Priority to US08/710,744 priority Critical patent/USRE35749E/en
Application granted granted Critical
Publication of USRE35749E publication Critical patent/USRE35749E/en
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ROSENBERG, STEVEN, TEKAMP-OLSEN, PATRICIA, VALENZUELA, PABLO D.T.
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • C07K14/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8121Serpins
    • C07K14/8125Alpha-1-antitrypsin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0089Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2730/00Reverse transcribing DNA viruses
    • C12N2730/00011Details
    • C12N2730/10011Hepadnaviridae
    • C12N2730/10111Orthohepadnavirus, e.g. hepatitis B virus
    • C12N2730/10122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • mammalian proteins could be synthesized in a unicellular microorganism by introduction of a gene encoding for the mammalian protein under the transcriptional and translational control of regulatory sequences recognized by the microorganism host.
  • the introduction of these foreign constructions into a microorganism host resulted in competition between the regulatory signals of the construct and the regulatory signal endogenous to the host for the host systems involved with expression.
  • the structural gene of interest is usually directed to a product which, is nonproductive and may be injurious to the host. Therefore, host cells which can turn off the foreign gene can effectively dominate modified host cells.
  • Novel hybrid promoter regions are provided for use in conjunction with constructs having a structural gene under the transcriptional control of the hybrid promoter region and a terminator region.
  • the hybrid promoter comprises a first segment providing transcriptional enhancement, either constitutive or regulated, and a second segment defining an RNA polymerase binding site and transcriptional initiation site.
  • the hybrid promoter regions lack the deleterious effects associated with a wild-type promoter region in recombinant constructs, which results in reduced transformation efficiencies and lower yeast viability.
  • FIG. 1 is a diagrammatic view of plasmids GAP1-6
  • FIG. 2 is a diagrammatic view of plasmids Pyk1-6.
  • FIG. 3 indicates the DNA linker sequence and a flow diagram showing its use in a construct for hSOD.
  • Novel DNA fragments are provided as well as constructions employing the fragments for enhanced expression of structural genes in a yeast host.
  • the constructs employing a hybrid promoter region provide for enhanced efficiencies of transformation and greatly improved viability of the yeast host as contrasted with those employing a wild-type yeast promoter. Concomitant with the improved viability is increased expression of a structural gene, in comparison with the truncated promoter region, and, therefore, greatly enhanced overall yields of expression products.
  • the "promoter region” is divided into two domains: (1) the structural gene proximal region, which includes the transcription initiation site, the "TATA" sequence capping sequence, as appropriate, and an RNA polymerase binding sequence, which sequence intends a sequence which includes nucleotides upstream from the initiation site for directing the initiation of synthesis of the messenger RNA; and (2) a distal region which provides for regulated or constitutive expression, with enhanced expression as compared to the first domain linked to non-functional yeast DNA.
  • the hybrid promoters of the subject invention employ the RNA polymerase binding region of a yeast glycolytic enzyme promoter and a region upstream from said polymerase binding region, which is different from the wild-type upstream region of the RNA polymerase binding region and provides for enhanced efficiencies of transcription.
  • This distal region will be derived from either a sequence, usually a yeast sequence, involved in regulation of transcription, or a prokaryotic sequence which provides for enhanced constitutive expression of the desired gene.
  • cassettes or constructs can be prepared which provide for one or more restriction sites intermediate the promoter region and a related terminator region where the structural gene may be inserted, so as to be under the transcriptional control of the hybrid promoter region.
  • the cassettes which can be prepared comprising the transcriptional initiation and termination region, having appropriate restriction sites for structural gene insertion can be cloned in prokaryotic vectors, so that after insertion of the structural gene, the resulting cassette, including the structural gene, may be cloned, isolated and purified, before introduction into a yeast vector.
  • P.R.(1) is the promoter region proximal to the structural gene and having the transcription initiation site, the RNA polymerase binding site, and including the TATA box, the CAAT sequence, as well as translational regulatory signals, e.g., capping sequence, as appropriate;
  • P.R.(-2) is the promoter region joined to the 5'-end of P.R.(1) associated with enhancing the efficiency of transcription of the RNA polymerase binding region;
  • R.S. is a sequence having one or more restriction recognition sites, preferably at least two restriction recognition sites, where the sites may result upon restriction into blunt ends or overhangs;
  • T.R. intends the termination region, which will include the terminator, which may be a stem and loop structure, and which may be associated with one or more stop codon, a polyadenylation signal sequence, if any, as well as any other transcriptional and translational termination sequences.
  • P.R.(1) will generally be at least about 150 bp, more usually at least about 200 bp, usually not more than about 600 bp, more usually not more than about 500 bp, generally not more than about 450 bp and preferably less than about 400 bp; the sequence will extend in the downstream direction of transcription to about bp +3, more usually bp -1 and may extend only to bp -20, more usually to bp -10 (the numbering intends that +1 is the first bp of the initiation codon with which the promoter region is associated in the wild-type host while -1 is the immediately upstream bp and the integers increase in the direction of transcription;
  • P.R.(1) will be deprived from a strong yeast promoter, normally a glycolytic enzyme promoter, such as glyceraldehyde-3-phosphate dehydrogenase, pyruvate kinase, alcohol dehydrogenase, phosphoglucoisomerase, triose phosphate isomerase, phosphofructokinase, etc.;
  • a glycolytic enzyme promoter such as glyceraldehyde-3-phosphate dehydrogenase, pyruvate kinase, alcohol dehydrogenase, phosphoglucoisomerase, triose phosphate isomerase, phosphofructokinase, etc.
  • P.R.(2) will provide for an enhancing function of transcription, which enhancing function may provide for constitutive or regulated transcription; regulators will be derived from regions associated with regulation of yeast genes, other than the natural or wild-type gene associated with the first domain in the wild-type or natural host, such as UDP-galactose epimerase (GAL10), galactokinase (GAL1), acid phosphatase (PHO5), etc.
  • GAL10 UDP-galactose epimerase
  • GAL1 galactokinase
  • PHO5 acid phosphatase
  • yeast regulatory sequences the domain will usually be at least about 100 bp, more usually at least about 200 bp, for convenience generally not exceeding about 3 kbp, usually not exceeding about 1 kbp, desirably not exceeding about 600 bp.
  • the regulatory region will generally begin at least about 200 bp from the initiation codon, usually at least about 300 bp and may begin at 400 bp or farther upstream
  • Regulation can be as a result of a change in the chemical or physical environment of the host, such as a change in carbon source, e.g., glucose to galactose or vice versa; a change in concentration of a nutrient, e.g., an inorganic nutrient such as a phosphate; or a change in temperature, e.g., 25° C. to 35° C.
  • a change in carbon source e.g., glucose to galactose or vice versa
  • a change in concentration of a nutrient e.g., an inorganic nutrient such as a phosphate
  • a change in temperature e.g. 25° C. to 35° C.
  • Constitutive transcription can be achieved employing prokaryotic sequences of at least about 500 bp, usually 1 kbp or more, for convenience, generally not exceeding about 5 kbp; conveniently, the prokaryotic sequence can be obtained from the vector in which the cassette is cloned, illustrative vectors including pBR322, lambda, Charon 4A, pACYC184, pUC5, etc.
  • R.S. will generally be at least 4 bp, more usually at least 6 bp, and may be 100 bp or more, more usually being not more than about 60 bp and my include one or more, usually not more than about 10 restriction sites, where such restriction sites may be illustrated by EcoRI, BamHI, SalI, HindIII, AluI, AvaI, TaqI, HpaI, etc., having at least one unique restriction site for the construct sequences.
  • T.R. is the termination region which will include the necessary transcriptional and translational signals for termination, such as the polyadenylation site, etc.;
  • T.R. will generally be at least about 100 bp, more usually at 150 bp, and generally less than about 1 kbp, usually less than about 600 kbp; the termination region may be derived from any convenient yeast sequence, so long as the terminator balances the promoter, conveniently being derived from a glycolytic enzyme terminator, where the terminator may be associated with the same or different enzyme with which the promoter is associated.
  • M is a marker which provides for selection of hosts containing the construction, where (B) intends a prokaryotic, e.g., bacterial, host and a intends an integer of from 0 to 3, usually 1 to 2, although additional markers may be present, where the marker allows for selection of the host containing the construct as well as providing for selective pressure on maintaining hosts having the construct; the markers include biocide resistance, such as antibiotic resistance, toxin resistance and heavy metal resistance; providing prototrophy to an auxotrophic host; providing immunity; and the
  • the markers may provide for complementation of an auxotrophic host, e.g., his - , ura - , trp - , leu - genotype, resulting in prototrophy; resistance to metals, such as cup + genotype; resistance to antibiotics, such as amp r , tc r , cam r , str r , tur r genotype, etc.;
  • auxotrophic host e.g., his - , ura - , trp - , leu - genotype, resulting in prototrophy
  • resistance to metals such as cup + genotype
  • resistance to antibiotics such as amp r , tc r , cam r , str r , tur r genotype, etc.
  • b is 0 or 1, intending that the construction is either linear or circular, usually circular.
  • the above construct can he used for insertion of a wide variety of structural genes, both prokaryotic and eukaryotic, both manually occurring and synthetic, where the genes may include signal leaders for secretion, and the like.
  • the genes may express enzymes, hormones, proteins from pathogens for vaccines, structural proteins, lymphokines, membrane surface proteins, immunogloblins, blood proteins, or the like.
  • the particular structural gene which is inserted is not critical to this invention and any polypeptide or protein of interest may be prepared employing the constructions of the subject invention.
  • the structural genes will usually be foreign to the yeast host, where foreign intends different from wild-type yeast structural genes and from a source that does not normally exchange genetic information with yeast.
  • the structural gene will be at least about 36 bp, and not more than about 20 kbp, usually not more than about 3000 bp, usually not more than about 1500 bp. Included in the structural gene may be non-coding flanking regions, the 5'-flanking region normally being quite short, usually less than about 30 bp, while the 3'-flanking region may be extended, usually not exceeding about 500 bp.
  • the structural gene fragment will usually include the translational stop codons for proper termination of amino acid chain extension.
  • the resulting construct will have the following formula: ##STR3## wherein all of the symbols have been defined previously except for: gene, which intends the structural gene, having its initiation codon and stop codons as appropriate; and
  • Convenient yeast replication systems include the 2 ⁇ m plasmid replication system, combination of CEN3 and ARS1 or ARS3, or the like.
  • the replication systems may be high or low copy number, depending on the effect of the construct on the viability of the host. While the indicated replication systems are those which have found common employment, any replication system useful in yeast may be employed which provides for efficient replication and maintenance.
  • the structural gene will be inserted into an appropriate shuttle vector capable of replication and selection in either a yeast or bacterial host, where the resulting construction will have the following formula: ##STR4## where all symbols have been defined previously.
  • cassette without an inserted structural gene but containing the restriction enzyme recognition sequence, R.S. my be propagated in yeast or contained within a shuttle vector, where the construction will have the following respective formulae: ##STR5## where all symbols have been defined previously.
  • the various fragments which form the cassette and final constructions may be joined together ha accordance with conventional ways.
  • genes have been isolated and restriction mapped, as well as sequenced.
  • To that external one can select the sequence of interest by restriction of the gene, employing further manipulation as necessary such as resection with Bal31, in vitro mutagenesis, primer repair, or the like, to provide a fragment of a desired size, including the desired sequence, and having the appropriate termini.
  • Linkers and adapters can be used for joining sequences, as well as replacing lost sequences, where the restriction site is internal to the region of interest.
  • the various fragments which are isolated maybe purified by electrophoresis, electroeluted, ligated to other sequence, cloned, reisolated and further manipulated.
  • regulatory sequences for controlling transcription of the structural gene of interest allows for growing the host cells to high density with no or low levels of expression of the structural gene, and then inducing expression by changing the environmental conditions, e.g., nutrient, temperature, etc.
  • the yeast cells could be grown in rich media with a glycerol-lactic acid combination to high density, e.g., mid or late log phase, followed by switching the carbon source to galactose.
  • high density e.g., mid or late log phase
  • carbon source e.g., galactose
  • PHO5 regulation one could grow the cells at high phosphate, about 1 to 10 mM, and then decrease the phosphate concentration to about 0.1 to 0.5 mM.
  • temperature sensitivity one could grow the cells at 25° to 37° C. and then change the temperature as appropriate by about 5° to 20° C.
  • the host cells would have the regulatory system associated with the regulatory region employed.
  • glyceraldehyde-3-phosphate dehydrogenase promoter region for the RNA polymerase binding site in conjunction with regulator sequences, such as those associated with GAL4, PHO5, or the like.
  • regulator sequences such as those associated with GAL4, PHO5, or the like.
  • the region intends the sequence associated with regulation of other galactose metabolism genes, e.g., GAL1 and GAL10, which are under the regulatory control of such sequence in conjunction with the expression product of the GAL4 gene.
  • the PHO5 sequence refers to a region associated with the PHO5 gene which provides for transcriptional regulation of the PHO5 gene.
  • Yeast were transformed and grown using a variety of media including selective medium (yeast nitrogen base without lencine); YEPD medium, containing 1% (w/v) yeast extract, 2% (w/v) peptone and 2% (w/v) glucose, and others as appropriate and/or detailed below.
  • Hepatitis B surface antigen was determined after lysis of yeast by glass bead agitation and clarification by centrifugation, using the AusriaII assay (Abbott Laboratories). Protein is determined by the Coomassie dye binding method.
  • Plasmid pLGSD5 is prepared as described in Gaurente et al., (1982) supra.
  • the plasmid was manipulated as follows: After restriction with XhoI, the overhangs were filled in with the Klenow fragment of DNA polymerase I ("Klenow fragment"), ligated with EcoRI linkers (GGAATTCC) and then completely digested with EcoRI and Sau3A to provide a 370 bp fragment which was isolated by gel electrophoresis and included the intergenic sequence between GAL1 and GAL10 genes of yeast, and provides for the GAL4 regulation sequence of the GAL1 and GAL10 genes.
  • This fragment was inserted into pBR322 which had been completely digested with EcoRI and BamHI, followed by treatment with alkaline phosphatase to prevent oligomerization.
  • the resulting plasmid pBRGAL4 was treated in two different ways.
  • pBRGAL4 was completely digested with Sau3A, the overhangs filled in with the Klenow fragment, and the resulting blunt-ended fragment ligated with SalI linkers (CGTCGACG), followed by digestion with SalI and XhoI.
  • the resulting 370 bp fragment was isolated by gel electrophoresis. This fragment has the original 370 bp yeast GAL4 regulator sequence with XhoI and SalI termini.
  • the second fragment was obtained by complete digestion of pBRGAL4 with XhoI and SalI to provide a XhoI-SalI fragment which included the 370 bp yeast GAL4 regulator sequence as well as about 280 bp of pBR322, the GAL4 sequence extending from Sau3A to SalI.
  • plot5 was prepared by inserting the 40 bp polylinker of the following sequence ##STR6## into pBR322 as an EcoRI-PvulI substitution followed by insertion of the trp-lac promoter (Russell and Bennett, Gene (1982) 20:231-245) into the PvuII site with transcription oriented toward the polylinker sequence.
  • plot5 was completely digested with SalI, followed treatment with alkaline phosphatase and the 370 bp and 650 bp fragments independently inserted into plot5 to provide plasmids plot5GAL4/370 and plot5GAL4/650, respectively.
  • Plasmid pC1/1 is a derivative of pJDB219 (Beggs, Nature (1978) 275:104) in which the region corresponding to bacterial plasmid pMB9 in pJDB219 has been replaced by pBR322 in pC1/1.
  • the resulting plasmids were designated pC1/1GAL4/370 and pC1/1GAL4/650, respectively.
  • the BamHI-SalI fragment is located in the pBR322 portion of the vector pC1/1.
  • the next construction develops a hybrid promoter for expression of the Hepatitis B surface antigen (HBsAg or sAg), employing the RNA polymerase binding region of GAPDH.
  • HBsAg or sAg Hepatitis B surface antigen
  • the Bam linkers have the sequence CGGATCCG.
  • pHBS56/16-3 was prepared as follows: A TaqI-HpaI fragment obtained from the HBsAg coding region which included 26 bp of the pre-sAg region, 681 bp of the sAg region and 128 bp of the 3'-untranslated region, was linked with EcoRI linkers and cloned at the EcoRI site in pBR322. The EcoRI linkers have the sequence GGAATTCC. The plasmid pHBS5 was thus obtained.
  • the digest was resected with Bal31 and religated with EcoRI linkers (GGAATTCC). After digestion with EcoRI the material of about 800 bp was isolated from a polyacrylamide gel. This isolate was then recloned into pBR322 which had been digested with EcoRI and treated with alkaline phosphatase. Where the resection was to the sequence CATGG, which included the methionine codon, the EcoRI linker created an NcoI site. The plasmids were screened for the presence of an NcoI site and one of the plasmids chosen for further manipulation.
  • This plasmid designated pHBS5-3, was restricted with EcoRI, the EcoRI fragment made blunt-ended with Klenow fragment and dNTPs, and the blunt-ended fragment was then restricted with XbaI to provide an about 100 bp fragment having an XbaI overhang and blunt end at the former EcoRI site.
  • pHBS5 was then digested with ClaI, made blunt-ended with the Klenow fragment and dNTPs, digested with XbaI, followed by alkaline phosphatase treatment.
  • the 100 bp fragment was then inserted into the vector to provide the plasmid pHBS6.
  • an adenosine had been lost, so as to lose the EcoRI site, where the sequence was now ATCGATTCCCATGG.
  • the ClaI and NcoI sites were retained. The loss of the A resulted in pKBS6 having a single EcoRI site.
  • pHBS5-3 was digested with EcoRI and the resulting EcoRI fragment having the sAg fragment isolated by gel electrophoresis and inserted into the vector pHBS16 (Valenzuela et al., Nature (1982) 298:347-350).
  • This plasmid has the ADH1 promoter and the sAg gene in an EcoRI fragment in a plasmid containing the 2 ⁇ m origin, a TrpI gene and pBR322.
  • the plasmid was digested with EcoRI, treated with alkaline phosphatase to prevent recircularization, and the EcoRI fragment from pHBS5-3 inserted to provide pHBS16-3, where the sAg gene isolated as a TaqI-HpaI fragment had been modified by Bal31 resection.
  • the plasmid pHBS16-3 was digested with SphI and XbaI to provide a fragment which had the ADH promoter at the Sph terminus and the 5'-end of the sAg gene.
  • pHBS56 was then digested with SphI.
  • pHBS56 was prepared from pC1/1 by digestion with SphI, which deletes a portion of the plasmid spanning the 2 ⁇ m-pBR322 joint.
  • the active portion of the ADH1 promoter region is contained within the SphI-HindIII fragment of approximately 300 bp (Bennetzen et al., J. Biol. Chem. (1982) 257:301).
  • the SphI site in the ADH promoter begins at position -413 and the yeast terminator sequence is contained within a HindIII-SphI fragment of about 330 bp. In each case the SphI site is distal to the coding region.
  • a 1500 bp ADH1 promoter fragment terminating at position -9 (Hitzeman et al., Nature (1981) 293:717) and an approximately 450 bp terminator unit from nucleotides 913 to 1368 in the ADH gene nucleotide sequence were joined at a HindIII-site between the fragments and cloned into the BamHI site of the vector YEp13 (Broach and Hicks, Gene (1979) 8:121) to provide pADH5.
  • the HBsAg-DNA segment of pHBS5 was excised by EcoRI digestion, blunt-ended with the Klenow fragment and joined at both ends with HindIII linkers, CAAGCTTG. After digestion with HindIII, the HBsAg fragment was inserted into the HindIII site of the plasmid pADH5 which had been digested at the HindIII site intermediate the ADH1 promoter and terminator sequence.
  • a plasmid with the HBsAg gene in the correct orientation as determined by restriction analysis was designated pRBS22.
  • the cassette was included between two SphI restriction sites. pHBS22 was digested with SphI to obtain a fragment of about 1500 bp and inserted into SphI digested pC1/1 to provide pHBS56 which was cloned in E. coli HB101.
  • pHBS56 was digested with SphI and XbaI to provide a 1.1 kb fragment having the ADH terminator region and the 3'-portion of the sAg gene with the SphI site proximal to the terminator region.
  • the 1.1 kb SphI-XbaI fragment was joined to the SphI-XhaI fragment from pHBS16-3, which resulted in providing the complete sAg gene in the correct orientation between the ADH promoter and terminator.
  • This SphI-SphI fragment was then ligated to SphI digested pHBS56, replacing the cassette of pHBS56 to provide the plasmid pHBS56/16-3 with the resected sAg coding region fragment.
  • the cassette was then excised from pHBS56/16-3 by digestion with SphI, followed by chewing back the overhangs with the Klenow fragment in the presence of dNTPs, then ligated with BamHI linkers, followed by digestion with BamHI to provide a 1.6 kb fragment which was isolated by gel electrophoresis.
  • the fragment included the ADH promoter region, the sAg gene and ADH terminator region, as described above.
  • This fragment was inserted into the BamHI site of pBR322 to provide pPGT16-3 which was digested with BamHI and XbaI and the resulting 1.1 kb fragment gel isolated, where the XbaI-BamHI fragment had the 3' portion of the sAg gene and the ADH terminator region.
  • pHBS6 was digested with XbaI and NcoI and the 94 bp fragment gel isolated to provide the 5'-portion of the sAg gene.
  • a synthetic adapter was prepared of the formula ##STR7## having TaqI and NcoI termini and providing the -25 to -1 nucleotides of the GAPDH (GAP49) promoter and the initiation codon of the sAg gene.
  • This synthetic fragment, the NcoI-XbaI fragment, and the XbaI-BamHI fragment were ligated simultaneously, followed by digestion with TaqI and BamHI.
  • the resulting fragment was then substituted into pBR322 linearized with ClaI and BamHI, followed by treatment with alkaline phosphatase.
  • pHBS6LGAPsAgtADH The resulting plasmid, which contains the -1 to -25 bp of the GAPDH promoter region, the sAg gene, and the ADH terminator, when the NcoI restriction site is lost was called pHBS6LGAPsAgtADH.
  • pGAP1 a plasmid prepared by insertion of a HindIII fragment containing the GAPDH gene GAP49 (Holland and Holland, J. Biol. Chem. (1979) 254:5466-5474) inserted in the HindIII site of pBR322, was digested with HinfI and a 500 bp promoter containing fragment isolated. The fragment was resected with Bal31 to remove about 50 or 90 bp, followed by ligation with HindIII linkers and digestion with HindIII.
  • pBR322 was digested with HindIII, followed by treatment with alkaline phosphatase and the about 450 or 410 bp fragment inserted to provide pGAP128 and pGAP396, respectively.
  • Plasmid plot5pGAP396 was prepared from pGAP396 in an identical manner and thus differs from plasmid plot5pGAP128 in having about 15-30 fewer bp at each terminus of the GAPDH promoter region (about -385 to -3).
  • Plasmids GAP1-GAP4 were then prepared in the following manner. Plasmid plot5pGAP128 was digested with TaqI and BamHI to provide an about 390 bp TaqI-BamHI fragment which included the -26 to about -400 bp of the GAPDH promoter region and a portion of the HindIII and plot5 polylinker.
  • pHBS6LGAPsAgtADH plasmid was also digested with TaqI and BamHI and a 1.1 -kb TaqI-BamHI fragment containing the 3'-terminus of the GAPDH promoter region, the sAg gene and the ADH terminator region was gel isolated and ligated to the other TaqI-BamHI fragment to provide a BamHI-BamHI fragment which included approximately 400 bp of the GAPDH promoter region, the sAg gene in proper orientation for transcriptional regulation by the GAPDH promoter, followed by the ADH terminator region.
  • This fragment was ligated into pBR322 which had been digested with BamHI and treated with alkaline phosphatase to provide plasmid pPGT80.
  • This BamHI cassette could now be isolated and inserted into plasmid pC1/1, at the BamHI site in the pBR322 portion of pC1/1, where in plasmid GAP1 the ADH terminator region is proximal to the amp r gene with the pBR322 portion divided into an approximately 4 kb sequence including the amp r gene and a 375 bp region separating the cassette from the 2 ⁇ m sequences.
  • the pomoter is adjacent to the long pBR322 sequence with transcription in the same direction as the amp r gene.
  • GAP3 and GAP4 were inserted into BamHI-digested pC 1/1 GAL4/650 to obtain plasmids GAP3 and GAP4, where GAP3 has the GAPDH promoter distal from the GAL4 regulator region and the long pBR322 sequence and GAP4 has the GAPDH promoter adjacent to the GAL4 regulator region, which is adjacent to the long pBR322 sequence.
  • Plasmids GAP5 and GAP6 were isolated as follows. Plasmid plot5pGAP396 was digested with SalI and TaqI and a fragment containing 9 bp of the plot5 polylinker sequence and the GAPDH promoter sequence extending from about -385 to -26 bp was isolated. An approximately 130 bp TaqI-XbaI fragment including -25 to -1 bp of the GAPDH promoter and +1 to +93 bp of the sAg gene was obtained from pHBS6LGAPsAgtADH.
  • a 1.1 kb XbaI-SalI fragment containing the 3'-portion of the sAg gene and the ADH terminator as well as 6 bp of plot5 polylinker sequence was obtained from plasmid plot5sAgtADH (described below--Pyravate Kinase Promoter). These three fragments were ligated, digested with SalI and then cloned into SalI-digested pC1/1GAL4/370.
  • GAP5 has the GAPDH promoter region adjacent to the GAL4 regulator region, which is proximal to the short pBR322 sequence
  • GAP6 has the GAPDH promoter region distal from the GAL4 regulator region-and proximal to the long pBR322 sequence (see FIG. 1).
  • Plasmid pHBS6Pyk containing the sAg gene under the transcriptional regulatory control of the Pyk promoter was obtained by cloning a 4.4 kb insert of yeast genomic DNA in pBR322 containing the Pyk gene and 911 nucleotides of 5'-untranslated region, and digestion of this plasmid pPyk9.1.1 with XbaI. After making the ends blunted-ended, the linear fragment was digested with BamHI providing a 912 bp BamHI-blunt fragment containing the Pyk promoter and 8 bases from the Pyk coding region. This fragment was inserted into the plasmid pHBS6, which had been digested with NcoI, blunt-ended and digested with BamHI.
  • the plasmid pHBS6Pyk was totally digested with EcoRI, to obtain a fragment including the sAg gene and a portion of the Pyk promoter region.
  • the fragment was made blunt-ended with the Klenow fragment and dNTPs, followed by ligation to BamHI linked digested with XbaI, which is internal to the sAg gene, the XbaI terminus made blunt-ended with the Klenow fragment and dNTPs, followed by digestion with BamHI, to provide a 580 bp BamHI-blunt-ended (XbaI) fragment.
  • the plasmid plot5 was digested with EcoRI, made blunt-ended, digested with BamHI and treated with alkaline phosphatase and the two fragments joined to provide plasmids plot5PyksAg51 and plot5PyksAg.57.
  • the two differ in that the BamHI site of the latter was not regenerated during cloning, possibly as a consequence of minimal nuclease contamination (digestion).
  • plot5 was treated as previously described (EcoRI digestion, blunt-ended, BamHI digestion and treatment with alkaline phosphatase) and joined to a 1.1 kb fragment obtained by digestion of pPGT16-3 with XbaI, followed by blunt ending, followed by digestion with BamHI and gel isolation. This fragment was introduced into plot5 to provide the plasmid plot5sAgtADH. Again the BamHI site in this plasmid was not regenerated, presumably due to digestion by contaminating nuclease.
  • Plasmids Pyk1 and Pyk2 were prepared as follows. Plasmid plot5PyksAg51 was digested with BamHI, then with XbaI, and an approximately 580 bp fragment containing about 480 bp of Pyk promoter and 93 bp of the 5'-end of the sAg gene was gel isolated. A 1.1 kb XbaI-SalI fragment containing the 3'-portion of the sAg gene, the ADH terminator and about 6 bp of the plot5 polylinker was isolated from plot5AgtADH.
  • Plasmid Pyk2 was prepared similarly but the 580 bp SalI-XbaI, Pyk promoter/HBsAg gene 5'-end fusion fragment was isolated from plot5PyksAg.57 and included about 6 bp of plot5 polylinker sequence upstream from the promoter region. Also the 1.1 kb XbaI-BamHI fragment containing the 3'-part of the HBsAg gene and the ADH terminator was derived from plasmid pPGT16-3.
  • Plasmids Pyk3-Pyk6 were prepared as follows. Plasmid plot5PyksAg51 was digested with BamHI, then with XbaI and the about 580 bp fragment containing the Pyk promoter and the 5'-part of the HBsAg gene isolated as above. The 1.1 kb BamHI-XbaI fragment, containing the 3'-portion of the HBsAg gene and ADH terminator, was recovered from pPGT16-3, also as above, and the two fragments ligated, digested with BamHI and inserted with different orientations into the BamHI site of pC1/1GAL4/650 (Pyk3, Pyk4).
  • Plasmids Pyk5 and Pyk6 were prepared similarly except that the SalI-XbaI fragment containing the Pyk promoter and 5'-end of the sAg gene was isolated from plot5PyksAg.57 and the XbaI-SalI sAg gene 3'-portion/ADH terminator fusion fragment was derived from plot5sAgtADH and thus both fragments included approximately 6 bp of plot5 polylinker sequence. The cassette so formed was then cloned into the SalI site of pC1/1GAL4/370 in opposite orientations.
  • the six plasmids designated Pyk1-6 are distinguished by Pyk1 having the promoter region proximal to the short pBR322 sequence; Pyk2 having the promoter region proximal to the long pBR322 sequence; Pyk3 having the promoter region proximal to the short pBR322 sequence and distal from the GAL4 sequence; while Pyk4 has the promoter region proximal to the GAL4 region, which in turn is proximal to the long pBR322 sequence; Pyk5 has the promoter region proximal to the GAL4 region which is proximal to the short pBR322 sequence; while Pyk6 has a promoter region distal from the GAL4 region and proximal to the long pBR322 sequence.
  • a yeast expression vector was prepared called pPGAP having a polyrestriction site linker between the GAPDH terminator and short promoter region.
  • Plasmid mid plot5pGAP128 was digested with BamHI and TaqI to yield an approximately 390 bp BamHI-TaqI fragment having the -400 to -26 bp of the GAPDH promixer.
  • the BamHI-TaqI fragment was ligated to a synthetic fragment having the following sequence: ##STR8## to provide a BamHI-SalI fragment, which was digested with BamHI and SalI and used to replace the BamHI-SalI fragment of BamHI-SalI digested pBR322 treated with alkaline phosphatase.
  • the plasmid pGAPNRS was obtained which was digested with BamHI and SalI to provide a 400 bp BamHI-SalI fragment which was gel isolated. This fragment was ligated to an about 900 bp SalI-BamHI fragment containing the GAPDH terminator region and a short segment of 3' coding region and the resulting 1.4 kb BamHI-BamHI fragment digested with BamHI.
  • the SalI-BamHI GAPDH terminator fragment was obtained by SalI and BamHI digestion of pGAP2, a plasmid prepared by insertion of an about 3.3 kb BamHI fragment containing the GAPDH gene GAP49 (Holland and Holland, supra) into the BamHI site of pBR322. Plasmids pGAP2 and pGAP1 were obtained as follows: A yeast gene library was prepared by inserting fragments obtained after partial digestion of total yeast DNA with restriction endonuclease Sau3A in lambda-phage Charon 28 (Blattner et al., Science (1977) 196:161-169).
  • the phage library was screened with DNA complementary to the yeast GAPDH mRNA and the yeast GAPDH gene from one of these clones was subcloned as either an about 3.3 kb BamHI fragment in the BamHI site of pBR322 (pGAP-2) or as an about 2.1 kb HindIII fragment in the HindIII site of pBR322 (pGAP-1).
  • pBR322 was digested with EcoRI and SalI, the termini blunt-ended and ligated to BamHI linkers, followed by BamHI digestion and the BamHI-BamHI 3.8 kb fragment gel isolated, recircularized by self-ligation, cloned and designated pBR ⁇ R1-Sal.
  • the 1.4 kb BamHI-BamHI fragment was inserted into the BamHI-digested, alkaline phosphatase treated pBR ⁇ R1-Sal vector to provide the plasmid pPGAP of about 5.3 kb with the orientation in the opposite direction of the amp r .
  • the plasmid phSOD was prepared as follows:
  • RNA was prepared from an adult human liver by the guanidinium thiocyanate/lithium chloride method (Cathala et al., DNA (1983) 2:329-435).
  • polyA RNA was used to synthesize double-stranded cDNA (Maniatis et al., Molecular Cloning, 213-242, Cold Spring Harbor, 1982) and this was passed over a Sepharose CL4B column to enrich for cDNAs of greater than 350 bp (Fiddes and Goodman, Nature (1979) 281:351-356).
  • the cDNA was inserted at the PstI site of plot4, a pBR322 derivative having the following sequence replacing the PstI-EcoRI site.
  • the cDNA insertion employed the oligo-dG:dC tailing method (Maniatis et al., supra).
  • E. coli strain D1210 was transformed with this mixture and transformants selected on L-agar containing 10 ⁇ g/ml tetracycline (Kushner, S. R. (1978) In: Genetic Engineering eds. Boyer, H. B. and Nicosia, S., (Elsevier/North Holland, Amsterdam) p. 17).
  • Plasmid DNA constituting at liver cDNA library was prepared (Maniatis et al., Molecular Cloning, pp. 86-94, Cold Spring Harbor 1982) directly from approximately 62,060 recombinant colonies plated at a density of approximately 3,000 colonies per 9 cm diameter Petri dish.
  • Strain D1210 was retransformed with the liver cDNA library and about 40,000 clones were grown on nine 14 cm diameter Petri dishes. After transfer of the colonies to nitrocellulose paper and chloramphenicol amplification of plasmid DNA, the cells were lysed and the filters prepared for hybridization (Ish-Horowicz and Burke, Nucleic Acids Research (1981) 9:2989-2998).
  • Oligonucleotide probes were employed for screening by hybridization, with the probes consisting of enzymatically-radiolabeled, chemically-synthesized DNA molecules complementary to the mRNA encoding amino acid residues 19 to 24 of the protein (Jabusch et al., supra.; Barra et al., supra.); the mixture had the following sequences: ##STR9## where all of the indicated possibilities for encoding the peptide sequence were prepared (32-fold degenerate).
  • the probes were labeled with 32 P to a specific activity of 1-3 ⁇ 10 8 cpm/ ⁇ g and Millipore (0.45 ⁇ m) filtered before use. Filters were prehybridized for 6 hrs at 30° C. in 4 ⁇ SSC, 2 ⁇ Denhardts's solution, 40 mM sodium phosphate, pH 7.5, 300 ⁇ g/ml sonicated salmon testes DNA. Hybridization was for 20 hrs at 30° C. in the same solution containing 2 ⁇ 10 6 cpm/ml hSOD DNA probe (residues 19-24). Filters were washed in 4 ⁇ SSC, once for 15 min at r.t. and twice for 15 min at 30° C., blotted dry and autoradiographed with an intensifying screen for 24 hrs at -70° C.
  • plasmid pool contained a cDNA inserts of 520 bp that hybridized with both probes and after colony purification, plasmid DNA was prepared from this clone and sequenced by the method of Maxam and Gilbert (Proc. Natl. Acad. Sci. USA (1977) 74:560-564).
  • the hSOD cDNA clone pSOD1 constitutes the coding region for amino acids 10-153 of hSOD, a single translational stop codon and a 3' untranslated region. Therefore, in the expression vector construct, the base sequence of the region encoding amino acids 1-9 is derived from the published amino acid sequence of hSOD (Jabusch et al., supra; Barra et.al., supra) and synthesized chemically as a part of the variable linker segment (see discussion relating to FIG. 3).
  • the single strand 4(24) was prepared by using all four bases, at each site where X is indicated. Furthermore, silica was withdrawn from the synthesis of the 24 mer, such that single-stranded 21 mers, 22 mers, and 23 mers are obtained in addition to the 24 mers. After removal from the silica support, the four mixtures are combined in appropriate proportions to provide for equimolar amounts of each of the possible single strands. This mixture was treated as a single product in the subsequent steps.
  • Molecules F(26), C(16), B(31) and D(11) were mixed together in equimolar amounts and 10 ⁇ g phosphorylated using T4 polynucleotide kinase. After phenol-ether extraction, the additional non-phosphorylated synthetic DNA molecules 4(24) and E(13) were added, such that all fragments were equimolar. The equimolar mixture contained 13 ⁇ g of DNA in 133 ⁇ l of 0.3 ⁇ kinase buffer.
  • the single strands were ligated together with T4 ligase in 200 ⁇ l ligation mix at 14° C. for 4 hrs, phenol-chloroform extracted, ethanol precipitated and the 5'-ends of 4(24) and E(13) phosphorylated using T4 polynucleotide kinase (Maniatis et al., supra).
  • Preparative polyacrytamide gel electrophoresis was used to isolate the completely ligated 53 bp material having 5'- and 3'-overhangs.
  • the above purified fragment mixture was then ligated to the 460 bp TaqI-PstI segment of the hSOD cDNA as shown in FIG. 3.
  • This segment was itself constructed by isolating the 454 bp TaqI-AluI hSOD fragment, making it flush-ended using Klenow and inserting it into plot5 between its EcoRI and SalI sites which had been similarly made flush-ended.
  • the 460 bp TaqI-PstI hSOD fragment was isolated by preparative polyacrylamide gel electrophoresis.
  • the 515 bp fragment resulting from the joining of the synthetic fragment to the 460 bp TaqI-PstI hSOD fragment was blunt-ended (525-528 bp) and then digested with SalI and the resulting 519-522 bp hSOD fragment isolated by polyarcylamide gel electrophoresis. This fragment was then inserted into plot5 which had been digested with PvuII and SalI and then treated with alkaline phosphatase.
  • the resulting plasmids were used to transform strain D1210. Recombinants obtained after transformation of strain D1210 were selected on L-agar containing 100 ⁇ g/ml ampicillin to give a set of clones, which were screened for an NcoI site. One was selected and designated phSOD.
  • the plasmid phSOD was ligated with NcoI and SalI and a 550 bp fragment obtained, which included 1 nucleotide untranstated at the 5'-terminus and the entire coding region for hSOD.
  • pPGAP was digested with NcoI and SalI followed by treatment with alkaline phosphatase and the SalI-NcoI fragment substituted for the NcoI-SalI fragment in pPGAP to provide pPGAPSOD.
  • BamHI digestion of pPGAPSOD resulted in a 2 kb fragment which was gel isolated and inserted into the BamHI site of pC1/1 and pC1/1 GAL4/370.
  • hSOD levels were measured using a standard radioimmunoassay with iodinated authentic hSOD as standard. Constitutive synthesis from the GAP promoter leads to very high levels of hSOD production, of the order of 10-30% of the total cell protein. The induction with galactose works almost as well, yielding about 7% of the cell protein as hSOD.
  • a cDNA library was made from 10 ⁇ g of polyA + RNA isolated from a part of a human liver. This library was prepared by oligo-dT priming of the first cDNA strand and self-priming of the second cDNA strand.
  • the ds cDNA was size fractionated on a Sepharose CL4B column and those molecules greater than 300 bp isolated. This fraction was treated with nuclease S1 and tailed with dCTP, using terminal transferase.
  • the tailed cDNA was annealed to pBR322 which had been digested with PstI and tailed with dGTP. Transformation of E. coli HB101 yielded 60,000 colonies, where greater than 90% of the clones were recombinant.
  • Two synthetic oligonucleotide probes were used to isolate the alpha-1-antitrypsin ( ⁇ 1 -AT) cDNA, the first probe corresponding to amino acid residues 344-350 near the C-terminus of the protein was used to probe 5,000 colonies and the second probe, corresponding to amino acid residues -23 to -17 (+1 being the first nucleotide of the first codon of the mature ⁇ 1 -AT) of the signal peptide, was used to probe 25,000 colonies.
  • the probe sequences were taken from the partial nucleotide sequence described by Kurachi et al., Proc. Natl. Acad. Sci. USA (1981) 78:6826; Wein et al., Nature (1982) 297:655).
  • a synthetic adapter was employed having the following sequence: ##STR12## Approximately two pmoles of fragments 1 and 2 were ligated together and after removal of the ligase, digested with BamHI and AvaI. Fragment 3 and the synthetic adapter were ligated and digested with AvaI and SalI and the two resulting fragment mixtures were ligated followed by digestion with BamHI and SalI.
  • pATi Fragments migrating upon electrophoresis in the region of about 1000-1400 bp were isolated and cloned by substitution into BamHI and SalI digested and alkaline phosphatase treated pBR322. The resulting plasmid is referred to as pATi.
  • Plasmid pPGAP was digested with NcoI, followed by blunt-ending, followed by SalI digestion and treatment with alkaline phosphatase.
  • the NcoI-SalI fragment was substituted with an approximately 1250 bp blunt-ended (BamHI)-SalI fragment obtained from plasmid pATi, by BamHI digestion, blunt ending, and SalI digestion.
  • plasmid pGAPATi This was inserted into the pPGAP vector to produce the plasmid pGAPATi, a 6.6 kb plasmid, which was digested with NcoI and BamHI and a 2.3 kb NcoI-BamHI fragment obtained having the ⁇ 1 -AT gene and the GAPDH terminator and approximately 400 bp BamHI-NcoI fragment obtained having the GAPDH promoter.
  • These fragments were treated together and inserted into the BamHI site of pC1/1.
  • the plasmids pC1/1GAPATi8 and pC1/1GAPATi9 were obtained with the orientation of expression clockwise in the former and counterclockwise in the latter, with amp r being in the counterclockwise direction.
  • plasmids were transformed in S. cerevisiae AB103 (A.T.C.C. No. 20658, deposited Jan. 5, 1983) by standard methods, selecting for leucine prototrophy and grown as described above.
  • Yeast extracts were prepared by lysis with glass beads and the ⁇ 1 -AT activity determined by inhibition of human leukocyte elastase.
  • Yeast strain 2150-2-3 was crossed with a yeast strain AB103 transformant containing pC1/1GAPATi9. The diploids were sporulated and the tetrads disected. Strains were maintained on leucine selective plates in order to ensure maintenance of the plasmid, since the parents are auxotrophs. A series of colonies were screened for their genotype with respect to a number of markers. The most vigorous strains were selected and cultures grown on leucine selective media. The best strain was designated AB110 (pC1/1GAPATi9), gave 6-7.5% of the total cell protein as ⁇ 1 -AT as shown in the above Table 3. The strain AB110 has the following genotype: Mat ⁇ , ura3-52, leu2-04 or both leu2-3 and leu2-112, pep4-3, his4-580 (cir°).
  • Plasmid pPGT80 was digested with BamHI, the ends blunt-ended, followed by digestion with XbaI and the 500 bp fragment containing the GAPDH promoter and 5'-end of the sAg gene isolated.
  • the PHO5 gene was isolated from a yeast genomic library employing an oligonucleotide probe 5'-GGCACTCACACGTGGGACTAG-3' derived from the published partial sequence (Meyhack et. al., The EMBO Journal (1932) 1:675-680).
  • a subfragment of this clone containing 550 bp of the 5'-untranslated region and approximately 80 bp of coding sequence was subcloned as a BamHI-SalI substitution in pBR322 to provide pPHO5.
  • This fragment has the sequence 5'-ATGTTTAAA-3', encoding the first three amino acids, the second and third codons specifying an AhaIII site.
  • the plasmid pHBS6 was digested with NcoI, blunt-ended, followed by digestion with BamHI and treatment with alkaline phosphatase.
  • the PHO5 promoter region was obtained by digesting the pPHO5 plasmid with AhaIII, resecting the resulting fragment with Bal31 for a short time, followed by digestion with BamHI and isolation of a 500-550 bp BamHI blunt-ended fragment. This fragment was employed for substitution of the NcoI-BamHI fragment from pHBS6 and was screened for regeneration of the NcoI restriction site to provide plasmid pHBS6PHO5/1.
  • Plasmid pHBS6PHO5/1 was digested with BstEII which cleaves at position -175 in the PHO5 promoter. This molecule was blunt-ended, digested with SalI and the 650 bp fragment having the 5'-portion of the promoter domain, containing 275 bp of pBR322 and 375 bp of the PHO5 promoter region isolated. This fragment was ligated with the blunt-ended (BamHI)-XbaI fragment obtained from digestion of pPGT80 with BamHI, blunt ending, followed by XbaI digestion.
  • the resulting plasmid pPHO5PGT80 had a cassette comprising the PHO5 regulatory region, the GAPDH promoter, the sAg gene and the ADH terminator.
  • This cassette was excised from the plasmid by BamHI digestion, whereby a 1.8 kb BamHI-BamHI fragment was gel isolated and ligated into the BamHI site of BamHI digested and alkaline phosphatase treated pC1/1 to provide plasmids PHO5GAP1 and PHO5GAP2 where the PHO5 was distal and proximal to the long pBR322sequence, respectively.
  • the two plasmids were transformed into yeast strain 2150-2-3 as described above and grown in rich media as described above for 8 to 10 generations in either high (7 mM) or low (0.2 mM) phosphate. Samples were harvested in late log phase and HBsAg determined as described previously. The results are shown below in Table 4.
  • yeast glycolytic enzyme gene promoters employing the 3' domain proximal to the coding region of the gene in conjunction with a 5'-portion or second domain of the promoter region of a yeast gene subject to inducible regulation by a nutrient, e.g., carbon source or phosphate. temperature, or other externally controllable source or condition.
  • the second domain may be replaced by prokaryotic sequences of at least about 1 kb or greater, which provide for constitutive enhancement in the absence of the second domain of the promoter region.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Yeast promoters of glycolytic enzymes are modified by isolating a fragment encompassing the RNA polymerase binding site and joining to the 5' end of this fragment a DNA sequence providing for enhanced inducible or constitutive transcription of a structural gene. Constructs are prepared for efficient expression of foreign genes in yeast.
Yeast strains 2150-2-3(pC1/1GAPSOD) and AB110(pC1/1GAPATi9), producing human α1 -antitrypsin and superoxide dismutase, were desposited at the A.T.C.C. on May 9, 1984 and given Accession Nos. 20708 and 20709, respectively; and 2150-2-3(GAP5), 2150-2-3(Pyk5) and 2150-2-3(PHO5GAP1), expressing Hepatitis B surface antigen, were deposited at the A.T.C.C. on May 9, 1984 and given Accession Nos. 20705, 20706 and 20707, respectively.

Description

This application is a continuation of U.S. Ser. No. 07/635,048 filed Dec. 28, 1990, now abandoned, which is a continuation of U.S. Ser. No. 07/380,783 filed Jul. 18, 1989, now U.S. Pat. No. 5,089,398, .Iadd.which is a continuation of Ser. No. 073,381, filed Jul. 13, 1987, (now abandoned).Iaddend., which is a continuation of U.S. Ser. No. 06/609,540 filed May 11, 1984, now abandoned, which is a continuation-in-part of U.S. Ser. No. 06/468,589 filed Feb. 22, 1983, now abandoned.
BACKGROUND OF THE INVENTION
1. Field of the Invention
With the advent of hybrid DNA technology, production of mammalian proteins in microorganisms became a reality. For the first time, mammalian proteins could be synthesized in a unicellular microorganism by introduction of a gene encoding for the mammalian protein under the transcriptional and translational control of regulatory sequences recognized by the microorganism host. The introduction of these foreign constructions into a microorganism host resulted in competition between the regulatory signals of the construct and the regulatory signal endogenous to the host for the host systems involved with expression. The structural gene of interest is usually directed to a product which, is nonproductive and may be injurious to the host. Therefore, host cells which can turn off the foreign gene can effectively dominate modified host cells.
Substantially progress has been made in isolating sequences concerned with transcriptional and translational regulation for protein expression. But frequently flanking sequences, as well as distant sequences, may also affect the efficiency and regulation of the expression of the protein. Therefore, as one manipulates these various sequences, removing them from their native environment, and joining them to unnatural sequences, that is sequences other than the wild-type sequence, one can never be certain as to the result.
In order to enhance the economies of producing proteins in microorganisms, there have been substantial efforts directed to improving the efficiency of transcription and translation, maximizing the proportion of total protein directed to production of the desired product, enhancing the viability of the modified host, as well as improving the efficiency with which the modified host may be obtained.
2. Description of the Prior Art
Guarente et al., Proc. Natl. Acad. Sci. USA (1982) 79:7410-7414, describes a hybrid promoter region employing the GAL4 regulatory region. Guarente and Ptashne, ibid. (1981) 78:2199-2203, report the presence of two domains in a yeast promoter, with a region upstream from the TATA sequence providing an activation site. Kramer et al., ibid. (1984) 81:367-370, describe the regulated expression of a human interferon gene in yeast employing the yeast acid phosphatase promoter, where expression is induced by phosphate or a temperature shift. Tekamp-Olson et al., Cold Spring Harbor Meeting, Molecular Biology of Yeast, 1983, describe the absence of deleterious effects on yeast viability when employing "short" promoters, as distinct from the presence of such effects, when employing an extended promoter region or "long" promoters.
SUMMARY OF THE INVENTION
Novel hybrid promoter regions are provided for use in conjunction with constructs having a structural gene under the transcriptional control of the hybrid promoter region and a terminator region. The hybrid promoter comprises a first segment providing transcriptional enhancement, either constitutive or regulated, and a second segment defining an RNA polymerase binding site and transcriptional initiation site. The hybrid promoter regions lack the deleterious effects associated with a wild-type promoter region in recombinant constructs, which results in reduced transformation efficiencies and lower yeast viability.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagrammatic view of plasmids GAP1-6;
FIG. 2 is a diagrammatic view of plasmids Pyk1-6; and
FIG. 3 indicates the DNA linker sequence and a flow diagram showing its use in a construct for hSOD.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
Novel DNA fragments are provided as well as constructions employing the fragments for enhanced expression of structural genes in a yeast host. The constructs employing a hybrid promoter region provide for enhanced efficiencies of transformation and greatly improved viability of the yeast host as contrasted with those employing a wild-type yeast promoter. Concomitant with the improved viability is increased expression of a structural gene, in comparison with the truncated promoter region, and, therefore, greatly enhanced overall yields of expression products.
For the purposes of the subject invention, the "promoter region" is divided into two domains: (1) the structural gene proximal region, which includes the transcription initiation site, the "TATA" sequence capping sequence, as appropriate, and an RNA polymerase binding sequence, which sequence intends a sequence which includes nucleotides upstream from the initiation site for directing the initiation of synthesis of the messenger RNA; and (2) a distal region which provides for regulated or constitutive expression, with enhanced expression as compared to the first domain linked to non-functional yeast DNA.
The hybrid promoters of the subject invention employ the RNA polymerase binding region of a yeast glycolytic enzyme promoter and a region upstream from said polymerase binding region, which is different from the wild-type upstream region of the RNA polymerase binding region and provides for enhanced efficiencies of transcription. This distal region will be derived from either a sequence, usually a yeast sequence, involved in regulation of transcription, or a prokaryotic sequence which provides for enhanced constitutive expression of the desired gene.
Conveniently, cassettes or constructs can be prepared which provide for one or more restriction sites intermediate the promoter region and a related terminator region where the structural gene may be inserted, so as to be under the transcriptional control of the hybrid promoter region. By leaving one or more restriction sites, one can provide for ease of insertion of the structural gene intermediate the transcription initiation and termination regions. The cassettes which can be prepared comprising the transcriptional initiation and termination region, having appropriate restriction sites for structural gene insertion can be cloned in prokaryotic vectors, so that after insertion of the structural gene, the resulting cassette, including the structural gene, may be cloned, isolated and purified, before introduction into a yeast vector.
The cassette, will for the most part, have the following formula: ##STR1## wherein:
P.R.(1) is the promoter region proximal to the structural gene and having the transcription initiation site, the RNA polymerase binding site, and including the TATA box, the CAAT sequence, as well as translational regulatory signals, e.g., capping sequence, as appropriate;
P.R.(-2) is the promoter region joined to the 5'-end of P.R.(1) associated with enhancing the efficiency of transcription of the RNA polymerase binding region;
R.S. is a sequence having one or more restriction recognition sites, preferably at least two restriction recognition sites, where the sites may result upon restriction into blunt ends or overhangs;
T.R. intends the termination region, which will include the terminator, which may be a stem and loop structure, and which may be associated with one or more stop codon, a polyadenylation signal sequence, if any, as well as any other transcriptional and translational termination sequences.
P.R.(1) will generally be at least about 150 bp, more usually at least about 200 bp, usually not more than about 600 bp, more usually not more than about 500 bp, generally not more than about 450 bp and preferably less than about 400 bp; the sequence will extend in the downstream direction of transcription to about bp +3, more usually bp -1 and may extend only to bp -20, more usually to bp -10 (the numbering intends that +1 is the first bp of the initiation codon with which the promoter region is associated in the wild-type host while -1 is the immediately upstream bp and the integers increase in the direction of transcription;
P.R.(1) will be deprived from a strong yeast promoter, normally a glycolytic enzyme promoter, such as glyceraldehyde-3-phosphate dehydrogenase, pyruvate kinase, alcohol dehydrogenase, phosphoglucoisomerase, triose phosphate isomerase, phosphofructokinase, etc.;
P.R.(2) will provide for an enhancing function of transcription, which enhancing function may provide for constitutive or regulated transcription; regulators will be derived from regions associated with regulation of yeast genes, other than the natural or wild-type gene associated with the first domain in the wild-type or natural host, such as UDP-galactose epimerase (GAL10), galactokinase (GAL1), acid phosphatase (PHO5), etc. For yeast regulatory sequences, the domain will usually be at least about 100 bp, more usually at least about 200 bp, for convenience generally not exceeding about 3 kbp, usually not exceeding about 1 kbp, desirably not exceeding about 600 bp. The regulatory region will generally begin at least about 200 bp from the initiation codon, usually at least about 300 bp and may begin at 400 bp or farther upstream from the initiation codon.
Regulation can be as a result of a change in the chemical or physical environment of the host, such as a change in carbon source, e.g., glucose to galactose or vice versa; a change in concentration of a nutrient, e.g., an inorganic nutrient such as a phosphate; or a change in temperature, e.g., 25° C. to 35° C. Constitutive transcription can be achieved employing prokaryotic sequences of at least about 500 bp, usually 1 kbp or more, for convenience, generally not exceeding about 5 kbp; conveniently, the prokaryotic sequence can be obtained from the vector in which the cassette is cloned, illustrative vectors including pBR322, lambda, Charon 4A, pACYC184, pUC5, etc.
R.S. will generally be at least 4 bp, more usually at least 6 bp, and may be 100 bp or more, more usually being not more than about 60 bp and my include one or more, usually not more than about 10 restriction sites, where such restriction sites may be illustrated by EcoRI, BamHI, SalI, HindIII, AluI, AvaI, TaqI, HpaI, etc., having at least one unique restriction site for the construct sequences.
T.R. is the termination region which will include the necessary transcriptional and translational signals for termination, such as the polyadenylation site, etc.;
T.R. will generally be at least about 100 bp, more usually at 150 bp, and generally less than about 1 kbp, usually less than about 600 kbp; the termination region may be derived from any convenient yeast sequence, so long as the terminator balances the promoter, conveniently being derived from a glycolytic enzyme terminator, where the terminator may be associated with the same or different enzyme with which the promoter is associated.
Where a cassette is cloned in a bacterial vector, the construction will have the following formula: ##STR2## wherein all the symbols have been defined previously, except for: Rep (B), which intends a replicon or replication system recognized by a prokaryotic host and may be derived from a plasmid or phage, such as ColE1, and R plasmid, e.g., pRK290, lambda, e.g., Charon 4A, λdv, etc.;
M is a marker which provides for selection of hosts containing the construction, where (B) intends a prokaryotic, e.g., bacterial, host and a intends an integer of from 0 to 3, usually 1 to 2, although additional markers may be present, where the marker allows for selection of the host containing the construct as well as providing for selective pressure on maintaining hosts having the construct; the markers include biocide resistance, such as antibiotic resistance, toxin resistance and heavy metal resistance; providing prototrophy to an auxotrophic host; providing immunity; and the
the markers may provide for complementation of an auxotrophic host, e.g., his-, ura-, trp-, leu- genotype, resulting in prototrophy; resistance to metals, such as cup+ genotype; resistance to antibiotics, such as ampr, tcr, camr, strr, turr genotype, etc.;
b is 0 or 1, intending that the construction is either linear or circular, usually circular.
The above construct can he used for insertion of a wide variety of structural genes, both prokaryotic and eukaryotic, both manually occurring and synthetic, where the genes may include signal leaders for secretion, and the like. The genes may express enzymes, hormones, proteins from pathogens for vaccines, structural proteins, lymphokines, membrane surface proteins, immunogloblins, blood proteins, or the like. The particular structural gene which is inserted is not critical to this invention and any polypeptide or protein of interest may be prepared employing the constructions of the subject invention. The structural genes will usually be foreign to the yeast host, where foreign intends different from wild-type yeast structural genes and from a source that does not normally exchange genetic information with yeast.
Usually, the structural gene will be at least about 36 bp, and not more than about 20 kbp, usually not more than about 3000 bp, usually not more than about 1500 bp. Included in the structural gene may be non-coding flanking regions, the 5'-flanking region normally being quite short, usually less than about 30 bp, while the 3'-flanking region may be extended, usually not exceeding about 500 bp. Thus, the structural gene fragment will usually include the translational stop codons for proper termination of amino acid chain extension.
When the structural gene has been inserted into the cassette which is joined to a yeast replication system, normally including one or more markers recognized by yeast, the resulting construct will have the following formula: ##STR3## wherein all of the symbols have been defined previously except for: gene, which intends the structural gene, having its initiation codon and stop codons as appropriate; and
Y, which intends that the symbol is related to yeast.
Convenient yeast replication systems include the 2 μm plasmid replication system, combination of CEN3 and ARS1 or ARS3, or the like. The replication systems may be high or low copy number, depending on the effect of the construct on the viability of the host. While the indicated replication systems are those which have found common employment, any replication system useful in yeast may be employed which provides for efficient replication and maintenance. Often the structural gene will be inserted into an appropriate shuttle vector capable of replication and selection in either a yeast or bacterial host, where the resulting construction will have the following formula: ##STR4## where all symbols have been defined previously. Also, it is, of course, understood that the cassette without an inserted structural gene but containing the restriction enzyme recognition sequence, R.S., my be propagated in yeast or contained within a shuttle vector, where the construction will have the following respective formulae: ##STR5## where all symbols have been defined previously.
The various fragments which form the cassette and final constructions may be joined together ha accordance with conventional ways. In many cases, genes have been isolated and restriction mapped, as well as sequenced. To that external one can select the sequence of interest by restriction of the gene, employing further manipulation as necessary such as resection with Bal31, in vitro mutagenesis, primer repair, or the like, to provide a fragment of a desired size, including the desired sequence, and having the appropriate termini. Linkers and adapters can be used for joining sequences, as well as replacing lost sequences, where the restriction site is internal to the region of interest. The various fragments which are isolated, maybe purified by electrophoresis, electroeluted, ligated to other sequence, cloned, reisolated and further manipulated.
The use of regulatory sequences for controlling transcription of the structural gene of interest allows for growing the host cells to high density with no or low levels of expression of the structural gene, and then inducing expression by changing the environmental conditions, e.g., nutrient, temperature, etc.
For example, with the GAL4 regulatory region, the yeast cells could be grown in rich media with a glycerol-lactic acid combination to high density, e.g., mid or late log phase, followed by switching the carbon source to galactose. For PHO5 regulation one could grow the cells at high phosphate, about 1 to 10 mM, and then decrease the phosphate concentration to about 0.1 to 0.5 mM. For temperature sensitivity, one could grow the cells at 25° to 37° C. and then change the temperature as appropriate by about 5° to 20° C. The host cells would have the regulatory system associated with the regulatory region employed.
Various techniques will be exemplified in the Experimental section of this application, which techniques can be used as paradigmatic for constructions employing fragments from sources other than those exemplified. Of particular interest, as evidenced by the Experimental section, will be the use of the glyceraldehyde-3-phosphate dehydrogenase promoter region for the RNA polymerase binding site in conjunction with regulator sequences, such as those associated with GAL4, PHO5, or the like. In referring to the GAL4 regulatory region or associated sequence, the region intends the sequence associated with regulation of other galactose metabolism genes, e.g., GAL1 and GAL10, which are under the regulatory control of such sequence in conjunction with the expression product of the GAL4 gene. The PHO5 sequence refers to a region associated with the PHO5 gene which provides for transcriptional regulation of the PHO5 gene.
The following examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
All DNA manipulations were done according to standard procedures. See Molecular Cloning, T. Maniatis et al., Cold Spring Harbor Lab., 1982. Enzymes used in cloning were utilized as per the manufacturer's specifications. Enzymes were obtained either from New England Biolabs or Bethesda Research Laboratories. Procedures with these enzymes employed the supplier's directions. Yeast were transformed and grown using a variety of media including selective medium (yeast nitrogen base without lencine); YEPD medium, containing 1% (w/v) yeast extract, 2% (w/v) peptone and 2% (w/v) glucose, and others as appropriate and/or detailed below. In the case of plating media contained 2% (w/v) agar and for transformation 3% top agar. Hepatitis B surface antigen was determined after lysis of yeast by glass bead agitation and clarification by centrifugation, using the AusriaII assay (Abbott Laboratories). Protein is determined by the Coomassie dye binding method.
Construction of GAL regulator containing plasmids
Plasmid pLGSD5 is prepared as described in Gaurente et al., (1982) supra. The plasmid was manipulated as follows: After restriction with XhoI, the overhangs were filled in with the Klenow fragment of DNA polymerase I ("Klenow fragment"), ligated with EcoRI linkers (GGAATTCC) and then completely digested with EcoRI and Sau3A to provide a 370 bp fragment which was isolated by gel electrophoresis and included the intergenic sequence between GAL1 and GAL10 genes of yeast, and provides for the GAL4 regulation sequence of the GAL1 and GAL10 genes.
This fragment was inserted into pBR322 which had been completely digested with EcoRI and BamHI, followed by treatment with alkaline phosphatase to prevent oligomerization. The resulting plasmid pBRGAL4 was treated in two different ways.
In the first procedure pBRGAL4 was completely digested with Sau3A, the overhangs filled in with the Klenow fragment, and the resulting blunt-ended fragment ligated with SalI linkers (CGTCGACG), followed by digestion with SalI and XhoI. The resulting 370 bp fragment was isolated by gel electrophoresis. This fragment has the original 370 bp yeast GAL4 regulator sequence with XhoI and SalI termini.
The second fragment was obtained by complete digestion of pBRGAL4 with XhoI and SalI to provide a XhoI-SalI fragment which included the 370 bp yeast GAL4 regulator sequence as well as about 280 bp of pBR322, the GAL4 sequence extending from Sau3A to SalI.
The two fragments were then cloned in the plasmid plot5. plot5 was prepared by inserting the 40 bp polylinker of the following sequence ##STR6## into pBR322 as an EcoRI-PvulI substitution followed by insertion of the trp-lac promoter (Russell and Bennett, Gene (1982) 20:231-245) into the PvuII site with transcription oriented toward the polylinker sequence. plot5 was completely digested with SalI, followed treatment with alkaline phosphatase and the 370 bp and 650 bp fragments independently inserted into plot5 to provide plasmids plot5GAL4/370 and plot5GAL4/650, respectively. Each of the plasmids was then completely digested with BamHI and SalI to reproduce the individual fragments extended by 6 bp of the polylinker fragment. These fragments were then ligated into pC1/1, which had been completely digested with BamHI and SalI followed by treatment with alkaline phosphatase to prevent recircularization. Plasmid pC1/1 is a derivative of pJDB219 (Beggs, Nature (1978) 275:104) in which the region corresponding to bacterial plasmid pMB9 in pJDB219 has been replaced by pBR322 in pC1/1. The resulting plasmids were designated pC1/1GAL4/370 and pC1/1GAL4/650, respectively. The BamHI-SalI fragment is located in the pBR322 portion of the vector pC1/1.
The next construction develops a hybrid promoter for expression of the Hepatitis B surface antigen (HBsAg or sAg), employing the RNA polymerase binding region of GAPDH. The previously prepared plasmid pHBS56/16-3, a yeast shuttle vector containing the alcohol dehydrogenase 1 (ADH1) promoter, the HBsAg gene and ADH terminator as a SphI fragment, was digested with SphI and the ends modified with Bam linkers. The Bam linkers have the sequence CGGATCCG.
pHBS56/16-3 was prepared as follows: A TaqI-HpaI fragment obtained from the HBsAg coding region which included 26 bp of the pre-sAg region, 681 bp of the sAg region and 128 bp of the 3'-untranslated region, was linked with EcoRI linkers and cloned at the EcoRI site in pBR322. The EcoRI linkers have the sequence GGAATTCC. The plasmid pHBS5 was thus obtained.
After digesting pHBS5 with EcoRI, the digest was resected with Bal31 and religated with EcoRI linkers (GGAATTCC). After digestion with EcoRI the material of about 800 bp was isolated from a polyacrylamide gel. This isolate was then recloned into pBR322 which had been digested with EcoRI and treated with alkaline phosphatase. Where the resection was to the sequence CATGG, which included the methionine codon, the EcoRI linker created an NcoI site. The plasmids were screened for the presence of an NcoI site and one of the plasmids chosen for further manipulation. This plasmid, designated pHBS5-3, was restricted with EcoRI, the EcoRI fragment made blunt-ended with Klenow fragment and dNTPs, and the blunt-ended fragment was then restricted with XbaI to provide an about 100 bp fragment having an XbaI overhang and blunt end at the former EcoRI site.
pHBS5 was then digested with ClaI, made blunt-ended with the Klenow fragment and dNTPs, digested with XbaI, followed by alkaline phosphatase treatment. The 100 bp fragment was then inserted into the vector to provide the plasmid pHBS6. Upon sequencing of the blunt-ended ligation site, it was found that an adenosine had been lost, so as to lose the EcoRI site, where the sequence was now ATCGATTCCCATGG. The ClaI and NcoI sites were retained. The loss of the A resulted in pKBS6 having a single EcoRI site.
pHBS5-3 was digested with EcoRI and the resulting EcoRI fragment having the sAg fragment isolated by gel electrophoresis and inserted into the vector pHBS16 (Valenzuela et al., Nature (1982) 298:347-350). This plasmid has the ADH1 promoter and the sAg gene in an EcoRI fragment in a plasmid containing the 2 μm origin, a TrpI gene and pBR322. The plasmid was digested with EcoRI, treated with alkaline phosphatase to prevent recircularization, and the EcoRI fragment from pHBS5-3 inserted to provide pHBS16-3, where the sAg gene isolated as a TaqI-HpaI fragment had been modified by Bal31 resection. The plasmid pHBS16-3 was digested with SphI and XbaI to provide a fragment which had the ADH promoter at the Sph terminus and the 5'-end of the sAg gene.
pHBS56 was then digested with SphI. pHBS56 was prepared from pC1/1 by digestion with SphI, which deletes a portion of the plasmid spanning the 2 μm-pBR322 joint. The active portion of the ADH1 promoter region is contained within the SphI-HindIII fragment of approximately 300 bp (Bennetzen et al., J. Biol. Chem. (1982) 257:301). The SphI site in the ADH promoter begins at position -413 and the yeast terminator sequence is contained within a HindIII-SphI fragment of about 330 bp. In each case the SphI site is distal to the coding region. A 1500 bp ADH1 promoter fragment terminating at position -9 (Hitzeman et al., Nature (1981) 293:717) and an approximately 450 bp terminator unit from nucleotides 913 to 1368 in the ADH gene nucleotide sequence were joined at a HindIII-site between the fragments and cloned into the BamHI site of the vector YEp13 (Broach and Hicks, Gene (1979) 8:121) to provide pADH5.
The HBsAg-DNA segment of pHBS5 was excised by EcoRI digestion, blunt-ended with the Klenow fragment and joined at both ends with HindIII linkers, CAAGCTTG. After digestion with HindIII, the HBsAg fragment was inserted into the HindIII site of the plasmid pADH5 which had been digested at the HindIII site intermediate the ADH1 promoter and terminator sequence. A plasmid with the HBsAg gene in the correct orientation as determined by restriction analysis was designated pRBS22. The cassette was included between two SphI restriction sites. pHBS22 was digested with SphI to obtain a fragment of about 1500 bp and inserted into SphI digested pC1/1 to provide pHBS56 which was cloned in E. coli HB101.
pHBS56 was digested with SphI and XbaI to provide a 1.1 kb fragment having the ADH terminator region and the 3'-portion of the sAg gene with the SphI site proximal to the terminator region. The 1.1 kb SphI-XbaI fragment was joined to the SphI-XhaI fragment from pHBS16-3, which resulted in providing the complete sAg gene in the correct orientation between the ADH promoter and terminator. This SphI-SphI fragment was then ligated to SphI digested pHBS56, replacing the cassette of pHBS56 to provide the plasmid pHBS56/16-3 with the resected sAg coding region fragment. The cassette was then excised from pHBS56/16-3 by digestion with SphI, followed by chewing back the overhangs with the Klenow fragment in the presence of dNTPs, then ligated with BamHI linkers, followed by digestion with BamHI to provide a 1.6 kb fragment which was isolated by gel electrophoresis. The fragment included the ADH promoter region, the sAg gene and ADH terminator region, as described above. This fragment was inserted into the BamHI site of pBR322 to provide pPGT16-3 which was digested with BamHI and XbaI and the resulting 1.1 kb fragment gel isolated, where the XbaI-BamHI fragment had the 3' portion of the sAg gene and the ADH terminator region.
pHBS6 was digested with XbaI and NcoI and the 94 bp fragment gel isolated to provide the 5'-portion of the sAg gene. A synthetic adapter was prepared of the formula ##STR7## having TaqI and NcoI termini and providing the -25 to -1 nucleotides of the GAPDH (GAP49) promoter and the initiation codon of the sAg gene. This synthetic fragment, the NcoI-XbaI fragment, and the XbaI-BamHI fragment were ligated simultaneously, followed by digestion with TaqI and BamHI. The resulting fragment was then substituted into pBR322 linearized with ClaI and BamHI, followed by treatment with alkaline phosphatase. The resulting plasmid, which contains the -1 to -25 bp of the GAPDH promoter region, the sAg gene, and the ADH terminator, when the NcoI restriction site is lost was called pHBS6LGAPsAgtADH.
pGAP1, a plasmid prepared by insertion of a HindIII fragment containing the GAPDH gene GAP49 (Holland and Holland, J. Biol. Chem. (1979) 254:5466-5474) inserted in the HindIII site of pBR322, was digested with HinfI and a 500 bp promoter containing fragment isolated. The fragment was resected with Bal31 to remove about 50 or 90 bp, followed by ligation with HindIII linkers and digestion with HindIII. pBR322 was digested with HindIII, followed by treatment with alkaline phosphatase and the about 450 or 410 bp fragment inserted to provide pGAP128 and pGAP396, respectively.
pGAP128 was digested with HindIII, the fragment made blunt-ended with the Klenow fragment and dNTPs and the resulting 450 bp fragment isolated by gel electrophoresis. This fragment was inserted into SmaI digested plot5, which had been treated with alkaline phosphatase, to provide plasmid plot5pGAP128, which contained about -400 to +27 bp of the GAPDH promoter and coding region, Plasmid plot5pGAP396 was prepared from pGAP396 in an identical manner and thus differs from plasmid plot5pGAP128 in having about 15-30 fewer bp at each terminus of the GAPDH promoter region (about -385 to -3).
Plasmids GAP1-GAP4 were then prepared in the following manner. Plasmid plot5pGAP128 was digested with TaqI and BamHI to provide an about 390 bp TaqI-BamHI fragment which included the -26 to about -400 bp of the GAPDH promoter region and a portion of the HindIII and plot5 polylinker. pHBS6LGAPsAgtADH plasmid was also digested with TaqI and BamHI and a 1.1 -kb TaqI-BamHI fragment containing the 3'-terminus of the GAPDH promoter region, the sAg gene and the ADH terminator region was gel isolated and ligated to the other TaqI-BamHI fragment to provide a BamHI-BamHI fragment which included approximately 400 bp of the GAPDH promoter region, the sAg gene in proper orientation for transcriptional regulation by the GAPDH promoter, followed by the ADH terminator region. This fragment was ligated into pBR322 which had been digested with BamHI and treated with alkaline phosphatase to provide plasmid pPGT80. This BamHI cassette could now be isolated and inserted into plasmid pC1/1, at the BamHI site in the pBR322 portion of pC1/1, where in plasmid GAP1 the ADH terminator region is proximal to the ampr gene with the pBR322 portion divided into an approximately 4 kb sequence including the ampr gene and a 375 bp region separating the cassette from the 2 μm sequences. In GAP2, the pomoter is adjacent to the long pBR322 sequence with transcription in the same direction as the ampr gene. The same cassette was inserted into BamHI-digested pC 1/1 GAL4/650 to obtain plasmids GAP3 and GAP4, where GAP3 has the GAPDH promoter distal from the GAL4 regulator region and the long pBR322 sequence and GAP4 has the GAPDH promoter adjacent to the GAL4 regulator region, which is adjacent to the long pBR322 sequence.
Plasmids GAP5 and GAP6 were isolated as follows. Plasmid plot5pGAP396 was digested with SalI and TaqI and a fragment containing 9 bp of the plot5 polylinker sequence and the GAPDH promoter sequence extending from about -385 to -26 bp was isolated. An approximately 130 bp TaqI-XbaI fragment including -25 to -1 bp of the GAPDH promoter and +1 to +93 bp of the sAg gene was obtained from pHBS6LGAPsAgtADH. A 1.1 kb XbaI-SalI fragment containing the 3'-portion of the sAg gene and the ADH terminator as well as 6 bp of plot5 polylinker sequence was obtained from plasmid plot5sAgtADH (described below--Pyravate Kinase Promoter). These three fragments were ligated, digested with SalI and then cloned into SalI-digested pC1/1GAL4/370. GAP5 has the GAPDH promoter region adjacent to the GAL4 regulator region, which is proximal to the short pBR322 sequence, and GAP6 has the GAPDH promoter region distal from the GAL4 regulator region-and proximal to the long pBR322 sequence (see FIG. 1).
Pyruvate kinase promoter
Plasmid pHBS6Pyk containing the sAg gene under the transcriptional regulatory control of the Pyk promoter was obtained by cloning a 4.4 kb insert of yeast genomic DNA in pBR322 containing the Pyk gene and 911 nucleotides of 5'-untranslated region, and digestion of this plasmid pPyk9.1.1 with XbaI. After making the ends blunted-ended, the linear fragment was digested with BamHI providing a 912 bp BamHI-blunt fragment containing the Pyk promoter and 8 bases from the Pyk coding region. This fragment was inserted into the plasmid pHBS6, which had been digested with NcoI, blunt-ended and digested with BamHI. The plasmid pHBS6Pyk was totally digested with EcoRI, to obtain a fragment including the sAg gene and a portion of the Pyk promoter region. The fragment was made blunt-ended with the Klenow fragment and dNTPs, followed by ligation to BamHI linked digested with XbaI, which is internal to the sAg gene, the XbaI terminus made blunt-ended with the Klenow fragment and dNTPs, followed by digestion with BamHI, to provide a 580 bp BamHI-blunt-ended (XbaI) fragment. The plasmid plot5 was digested with EcoRI, made blunt-ended, digested with BamHI and treated with alkaline phosphatase and the two fragments joined to provide plasmids plot5PyksAg51 and plot5PyksAg.57. The two differ in that the BamHI site of the latter was not regenerated during cloning, possibly as a consequence of minimal nuclease contamination (digestion).
plot5 was treated as previously described (EcoRI digestion, blunt-ended, BamHI digestion and treatment with alkaline phosphatase) and joined to a 1.1 kb fragment obtained by digestion of pPGT16-3 with XbaI, followed by blunt ending, followed by digestion with BamHI and gel isolation. This fragment was introduced into plot5 to provide the plasmid plot5sAgtADH. Again the BamHI site in this plasmid was not regenerated, presumably due to digestion by contaminating nuclease.
Plasmids Pyk1 and Pyk2 were prepared as follows. Plasmid plot5PyksAg51 was digested with BamHI, then with XbaI, and an approximately 580 bp fragment containing about 480 bp of Pyk promoter and 93 bp of the 5'-end of the sAg gene was gel isolated. A 1.1 kb XbaI-SalI fragment containing the 3'-portion of the sAg gene, the ADH terminator and about 6 bp of the plot5 polylinker was isolated from plot5AgtADH. These two fragments were ligated, digested with BamHI and SalI and then cloned into plasmid pC1/1, which had been cleaved with BamHI and SalI and treated with alkaline phosphatase to yield plasmid Pyk1. Plasmid Pyk2 was prepared similarly but the 580 bp SalI-XbaI, Pyk promoter/HBsAg gene 5'-end fusion fragment was isolated from plot5PyksAg.57 and included about 6 bp of plot5 polylinker sequence upstream from the promoter region. Also the 1.1 kb XbaI-BamHI fragment containing the 3'-part of the HBsAg gene and the ADH terminator was derived from plasmid pPGT16-3.
Plasmids Pyk3-Pyk6 were prepared as follows. Plasmid plot5PyksAg51 was digested with BamHI, then with XbaI and the about 580 bp fragment containing the Pyk promoter and the 5'-part of the HBsAg gene isolated as above. The 1.1 kb BamHI-XbaI fragment, containing the 3'-portion of the HBsAg gene and ADH terminator, was recovered from pPGT16-3, also as above, and the two fragments ligated, digested with BamHI and inserted with different orientations into the BamHI site of pC1/1GAL4/650 (Pyk3, Pyk4). Plasmids Pyk5 and Pyk6 were prepared similarly except that the SalI-XbaI fragment containing the Pyk promoter and 5'-end of the sAg gene was isolated from plot5PyksAg.57 and the XbaI-SalI sAg gene 3'-portion/ADH terminator fusion fragment was derived from plot5sAgtADH and thus both fragments included approximately 6 bp of plot5 polylinker sequence. The cassette so formed was then cloned into the SalI site of pC1/1GAL4/370 in opposite orientations.
The six plasmids designated Pyk1-6 (see FIG. 2) are distinguished by Pyk1 having the promoter region proximal to the short pBR322 sequence; Pyk2 having the promoter region proximal to the long pBR322 sequence; Pyk3 having the promoter region proximal to the short pBR322 sequence and distal from the GAL4 sequence; while Pyk4 has the promoter region proximal to the GAL4 region, which in turn is proximal to the long pBR322 sequence; Pyk5 has the promoter region proximal to the GAL4 region which is proximal to the short pBR322 sequence; while Pyk6 has a promoter region distal from the GAL4 region and proximal to the long pBR322 sequence.
These plasmids described above were transformed into S. carlsbergensis strain 2150-2-3 (available from Lee Hartwell, University of Washington) under conventional conditions (Hinnen et al., Proc. Natl. Acad. Sci. USA (1978) 75:1929-1933). Cultures of 50-150 ml were grown to mid or late log phase in rich media (YEP) under neutral conditions (3% glycerol, 2% lactic acid), and then inducing conditions (+2% galactose), or repressing conditions (+2% glucose) for the final 1-2 generations. After lysis with glass beads and clarification of the supernatants by centrifugation, HBsAg expression was determined as described above. The results for the 12 plasmids are set forth in the following Table 1.
              TABLE 1                                                     
______________________________________                                    
Expression of HBsAg from Gal Regulated Hybrid Promoters                   
       YEP +                                                              
       Glycerol/                                                          
       Lactic acid                                                        
               YEP +     YEP +   Induction                                
       μg sAg/                                                         
               Galactose Glucose (Gal/glycerol                            
Construction                                                              
         mg protein                                                       
                   μg sAg/mg protein                                   
                                 lactic acid)                             
______________________________________                                    
GAP1     0.04      0.09      0.02  2.0                                    
GAP2     1.65      0.8       1.5   0.5                                    
GAP3     0.25      0.30      --    1.2                                    
GAP4     0.10      0.75      --    7.5                                    
GAP5     0.25      2.1       --    8.4                                    
GAP6     1.55      1.4       1.0   0.9                                    
PYK1     0.10      0.30      0.14  3.0                                    
PYK2     1.65      1.4       1.1   0.85                                   
PYK3     0.10      0.15      --    1.5                                    
PYK4     0.10      1.0       0.05  10.0                                   
PYK5     0.03      1.4       0.02  47.0                                   
PYK6     1.7       1.8       0.9   0.9                                    
______________________________________                                    
Construction of pPGAP
A yeast expression vector was prepared called pPGAP having a polyrestriction site linker between the GAPDH terminator and short promoter region. Plasmid mid plot5pGAP128 was digested with BamHI and TaqI to yield an approximately 390 bp BamHI-TaqI fragment having the -400 to -26 bp of the GAPDH promixer. The BamHI-TaqI fragment was ligated to a synthetic fragment having the following sequence: ##STR8## to provide a BamHI-SalI fragment, which was digested with BamHI and SalI and used to replace the BamHI-SalI fragment of BamHI-SalI digested pBR322 treated with alkaline phosphatase. After ligation, the plasmid pGAPNRS was obtained which was digested with BamHI and SalI to provide a 400 bp BamHI-SalI fragment which was gel isolated. This fragment was ligated to an about 900 bp SalI-BamHI fragment containing the GAPDH terminator region and a short segment of 3' coding region and the resulting 1.4 kb BamHI-BamHI fragment digested with BamHI. The SalI-BamHI GAPDH terminator fragment was obtained by SalI and BamHI digestion of pGAP2, a plasmid prepared by insertion of an about 3.3 kb BamHI fragment containing the GAPDH gene GAP49 (Holland and Holland, supra) into the BamHI site of pBR322. Plasmids pGAP2 and pGAP1 were obtained as follows: A yeast gene library was prepared by inserting fragments obtained after partial digestion of total yeast DNA with restriction endonuclease Sau3A in lambda-phage Charon 28 (Blattner et al., Science (1977) 196:161-169). The phage library was screened with DNA complementary to the yeast GAPDH mRNA and the yeast GAPDH gene from one of these clones was subcloned as either an about 3.3 kb BamHI fragment in the BamHI site of pBR322 (pGAP-2) or as an about 2.1 kb HindIII fragment in the HindIII site of pBR322 (pGAP-1).
pBR322 was digested with EcoRI and SalI, the termini blunt-ended and ligated to BamHI linkers, followed by BamHI digestion and the BamHI-BamHI 3.8 kb fragment gel isolated, recircularized by self-ligation, cloned and designated pBRΔR1-Sal. The 1.4 kb BamHI-BamHI fragment was inserted into the BamHI-digested, alkaline phosphatase treated pBRΔR1-Sal vector to provide the plasmid pPGAP of about 5.3 kb with the orientation in the opposite direction of the ampr.
The plasmid phSOD was prepared as follows:
Molecular cloning of hSOD cDNA
Total RNA was prepared from an adult human liver by the guanidinium thiocyanate/lithium chloride method (Cathala et al., DNA (1983) 2:329-435). polyA RNA was used to synthesize double-stranded cDNA (Maniatis et al., Molecular Cloning, 213-242, Cold Spring Harbor, 1982) and this was passed over a Sepharose CL4B column to enrich for cDNAs of greater than 350 bp (Fiddes and Goodman, Nature (1979) 281:351-356). The cDNA was inserted at the PstI site of plot4, a pBR322 derivative having the following sequence replacing the PstI-EcoRI site. The cDNA insertion employed the oligo-dG:dC tailing method (Maniatis et al., supra). E. coli strain D1210 was transformed with this mixture and transformants selected on L-agar containing 10 μg/ml tetracycline (Kushner, S. R. (1978) In: Genetic Engineering eds. Boyer, H. B. and Nicosia, S., (Elsevier/North Holland, Amsterdam) p. 17). Plasmid DNA constituting at liver cDNA library was prepared (Maniatis et al., Molecular Cloning, pp. 86-94, Cold Spring Harbor 1982) directly from approximately 62,060 recombinant colonies plated at a density of approximately 3,000 colonies per 9 cm diameter Petri dish.
Isolation of r-hSOD clones
Strain D1210 was retransformed with the liver cDNA library and about 40,000 clones were grown on nine 14 cm diameter Petri dishes. After transfer of the colonies to nitrocellulose paper and chloramphenicol amplification of plasmid DNA, the cells were lysed and the filters prepared for hybridization (Ish-Horowicz and Burke, Nucleic Acids Research (1981) 9:2989-2998). Oligonucleotide probes were employed for screening by hybridization, with the probes consisting of enzymatically-radiolabeled, chemically-synthesized DNA molecules complementary to the mRNA encoding amino acid residues 19 to 24 of the protein (Jabusch et al., supra.; Barra et al., supra.); the mixture had the following sequences: ##STR9## where all of the indicated possibilities for encoding the peptide sequence were prepared (32-fold degenerate).
The probes were labeled with 32 P to a specific activity of 1-3×108 cpm/μg and Millipore (0.45 μm) filtered before use. Filters were prehybridized for 6 hrs at 30° C. in 4×SSC, 2×Denhardts's solution, 40 mM sodium phosphate, pH 7.5, 300 μg/ml sonicated salmon testes DNA. Hybridization was for 20 hrs at 30° C. in the same solution containing 2×106 cpm/ml hSOD DNA probe (residues 19-24). Filters were washed in 4×SSC, once for 15 min at r.t. and twice for 15 min at 30° C., blotted dry and autoradiographed with an intensifying screen for 24 hrs at -70° C.
Areas on the master plates that corresponded to duplicate positive signals were picked into L-broth and plasmid DNA prepared by the miniscreen procedure (Maniatis et al., Molecular Cloning, 178, 368-369, Cold Spring Harbor 1982). This DNA was cut with PstI and subjected to Southern blot analysis (Southern, J. Mol. Biol. (1975) 98:503-517) hybridizing initially with the previous labeled probes (amino acid residues 19-24) and then with additional radiolabeled probes derived from amino acid residues 109-114 and having the following sequences (all possible variations, 72-fold degenerate) present as a mixture: ##STR10## One plasmid pool (pSOD1) contained a cDNA inserts of 520 bp that hybridized with both probes and after colony purification, plasmid DNA was prepared from this clone and sequenced by the method of Maxam and Gilbert (Proc. Natl. Acad. Sci. USA (1977) 74:560-564). The hSOD cDNA clone pSOD1 constitutes the coding region for amino acids 10-153 of hSOD, a single translational stop codon and a 3' untranslated region. Therefore, in the expression vector construct, the base sequence of the region encoding amino acids 1-9 is derived from the published amino acid sequence of hSOD (Jabusch et al., supra; Barra et.al., supra) and synthesized chemically as a part of the variable linker segment (see discussion relating to FIG. 3).
Construction of plot5 derivatives containing r-hSOD
The synthetic DNA molecules F(26), C(16), B(31), D(11), E(13) and 4(24) shown in FIG. 3, were synthesized by the phosphoramidite method.
The single strand 4(24) was prepared by using all four bases, at each site where X is indicated. Furthermore, silica was withdrawn from the synthesis of the 24 mer, such that single-stranded 21 mers, 22 mers, and 23 mers are obtained in addition to the 24 mers. After removal from the silica support, the four mixtures are combined in appropriate proportions to provide for equimolar amounts of each of the possible single strands. This mixture was treated as a single product in the subsequent steps.
Molecules F(26), C(16), B(31) and D(11) were mixed together in equimolar amounts and 10 μg phosphorylated using T4 polynucleotide kinase. After phenol-ether extraction, the additional non-phosphorylated synthetic DNA molecules 4(24) and E(13) were added, such that all fragments were equimolar. The equimolar mixture contained 13 μg of DNA in 133 μl of 0.3×kinase buffer.
After annealing by cooling at a uniform rate from 70° C. to 20° C. over 60 min, the single strands were ligated together with T4 ligase in 200 μl ligation mix at 14° C. for 4 hrs, phenol-chloroform extracted, ethanol precipitated and the 5'-ends of 4(24) and E(13) phosphorylated using T4 polynucleotide kinase (Maniatis et al., supra). Preparative polyacrytamide gel electrophoresis was used to isolate the completely ligated 53 bp material having 5'- and 3'-overhangs.
The above purified fragment mixture was then ligated to the 460 bp TaqI-PstI segment of the hSOD cDNA as shown in FIG. 3. This segment was itself constructed by isolating the 454 bp TaqI-AluI hSOD fragment, making it flush-ended using Klenow and inserting it into plot5 between its EcoRI and SalI sites which had been similarly made flush-ended. After preparation of plasmid DNA from this recombinant, the 460 bp TaqI-PstI hSOD fragment was isolated by preparative polyacrylamide gel electrophoresis. After extraction and precipitation, the 515 bp fragment resulting from the joining of the synthetic fragment to the 460 bp TaqI-PstI hSOD fragment was blunt-ended (525-528 bp) and then digested with SalI and the resulting 519-522 bp hSOD fragment isolated by polyarcylamide gel electrophoresis. This fragment was then inserted into plot5 which had been digested with PvuII and SalI and then treated with alkaline phosphatase. The resulting plasmids were used to transform strain D1210. Recombinants obtained after transformation of strain D1210 were selected on L-agar containing 100 μg/ml ampicillin to give a set of clones, which were screened for an NcoI site. One was selected and designated phSOD.
Construction of a yeast vector for SOD expression
The plasmid phSOD was ligated with NcoI and SalI and a 550 bp fragment obtained, which included 1 nucleotide untranstated at the 5'-terminus and the entire coding region for hSOD. pPGAP was digested with NcoI and SalI followed by treatment with alkaline phosphatase and the SalI-NcoI fragment substituted for the NcoI-SalI fragment in pPGAP to provide pPGAPSOD. BamHI digestion of pPGAPSOD resulted in a 2 kb fragment which was gel isolated and inserted into the BamHI site of pC1/1 and pC1/1 GAL4/370. These plasmids were transformed into yeast strain 2150-2-3 as described previously, with the results of expression set forth in the following Table 2.
              TABLE 2                                                     
______________________________________                                    
Expression of Human SOD in Yeast Strain 2150                              
                           SOD.sup.2                                      
Plasmid         Carbon Source                                             
                           μg/mg protein                               
______________________________________                                    
pC1/1           g, L.sup.  0                                              
pC1/1GAPSOD     g, L       148                                            
pC1/1GALGAPSOD  g, L       0.4                                            
                gal        68                                             
______________________________________                                    
 .sup.1 All cultures grown in Minus Leucine media with 2% lactic acid, 3% 
 glycerol with or without 2% galactose to late log or early stationary    
 phase.                                                                   
 .sup.2 Determined by RIA.                                                
hSOD levels were measured using a standard radioimmunoassay with iodinated authentic hSOD as standard. Constitutive synthesis from the GAP promoter leads to very high levels of hSOD production, of the order of 10-30% of the total cell protein. The induction with galactose works almost as well, yielding about 7% of the cell protein as hSOD.
Cloning of alpha-1-antitrypsin
A cDNA library was made from 10 μg of polyA+ RNA isolated from a part of a human liver. This library was prepared by oligo-dT priming of the first cDNA strand and self-priming of the second cDNA strand. The ds cDNA was size fractionated on a Sepharose CL4B column and those molecules greater than 300 bp isolated. This fraction was treated with nuclease S1 and tailed with dCTP, using terminal transferase. The tailed cDNA was annealed to pBR322 which had been digested with PstI and tailed with dGTP. Transformation of E. coli HB101 yielded 60,000 colonies, where greater than 90% of the clones were recombinant.
Two synthetic oligonucleotide probes were used to isolate the alpha-1-antitrypsin (α1 -AT) cDNA, the first probe corresponding to amino acid residues 344-350 near the C-terminus of the protein was used to probe 5,000 colonies and the second probe, corresponding to amino acid residues -23 to -17 (+1 being the first nucleotide of the first codon of the mature α1 -AT) of the signal peptide, was used to probe 25,000 colonies. The probe sequences were taken from the partial nucleotide sequence described by Kurachi et al., Proc. Natl. Acad. Sci. USA (1981) 78:6826; Leicht et al., Nature (1982) 297:655). Approximately 3% of the colonies hybridized to the C-terminal probe and four hybridized to the N-terminal probe. The four N-terminal clones and 12 C-terminal clones were isolated and subjected to restriction analysis. From these, three overlapping clones which cover the entire cDNA were subjected to further study and were used to construct the full-length cDNA clone.
The entire sequence of a composite full length cDNA derived from the three plasmids is as follows:
__________________________________________________________________________
                                                   -24                    
                                                   Met                    
                                                      Pro                 
                                                         Ser              
                                                            Ser           
GGGGGGGGGGAGGGTAATCGACA                            ATG                    
                                                      CCG                 
                                                         TCT              
                                                            TCT           
   -20                           -10                        -1            
   Val                                                                    
      Ser                                                                 
         Trp                                                              
            Gly                                                           
               Ile                                                        
                  Leu                                                     
                     Leu                                                  
                        Leu                                               
                           Ala                                            
                              Gly                                         
                                 Leu                                      
                                    Cys                                   
                                       Cys                                
                                          Leu                             
                                             Val                          
                                                Pro                       
                                                   Vaql                   
                                                      Ser    Leu          
                                                      Ala                 
   GTC                                                                    
      TCG                                                                 
         TGG                                                              
            GGC                                                           
               ATC                                                        
                  CTC                                                     
                     CTG                                                  
                        CTG                                               
                           GCA                                            
                              GGC                                         
                                 CTG                                      
                                    TGC                                   
                                       TGC                                
                                          CTG                             
                                             GTC                          
                                                CCT                       
                                                   GTC                    
                                                      TCC    CTG          
                                                      GCT                 
   Glu                                                                    
      Asp                                                                 
         Pro                                                              
            Gln                                                           
               Gly                                                        
                  Asp                                                     
                     Ala                                                  
                        Ala                                               
                           Gln                                            
                              Lys                                         
                                 Thr                                      
                                    Asp                                   
                                       Thr                                
                                          Ser                             
                                             His                          
                                                His                       
                                                   Asp                    
                                                      Gln    Asp          
                                                      His                 
1  GAG                                                                    
      GAT                                                                 
         CCC                                                              
            CAG                                                           
               GGA                                                        
                  GAT                                                     
                     GCT                                                  
                        GCC                                               
                           CAG                                            
                              AAG                                         
                                 ACA                                      
                                    GAT                                   
                                       ACA                                
                                          TCC                             
                                             CAC                          
                                                CAT                       
                                                   GAT                    
                                                      CAG    GAT          
                                                      CAC                 
          BamHI                                                           
21 Pro                                                                    
      Thr                                                                 
         Phe                                                              
            Asn                                                           
               Lys                                                        
                  Ile                                                     
                     Thr                                                  
                        Pro                                               
                           Asn                                            
                              Leu                                         
                                 Ala                                      
                                    Glu                                   
                                       Phe                                
                                          Ala                             
                                             Phe                          
                                                Ser                       
                                                   Leu                    
                                                      Tyr                 
                                                         Arg              
                                                            Gln           
61 CCA                                                                    
      ACC                                                                 
         TTC                                                              
            AAC                                                           
               AAG                                                        
                  ATC                                                     
                     ACC                                                  
                        CCC                                               
                           AAC                                            
                              CTG                                         
                                 GCT                                      
                                    GAG                                   
                                       TTC                                
                                          GCC                             
                                             TTC                          
                                                AGC                       
                                                   CTA                    
                                                      TAC    CGC          
                                                      CAG                 
41 Leu                                                                    
      Ala                                                                 
         His                                                              
            Gln                                                           
               Ser                                                        
                  Asn                                                     
                     Ser                                                  
                        Thr                                               
                           Asn                                            
                              Ile                                         
                                 Phe                                      
                                    Phe                                   
                                       Ser                                
                                          Pro                             
                                             Val                          
                                                Ser                       
                                                   Ile                    
                                                      Ala    Thr          
                                                      Ala                 
121                                                                       
   CTG                                                                    
      GCA                                                                 
         CAC                                                              
            CAG                                                           
               TCC                                                        
                  AAC                                                     
                     AGC                                                  
                        ACC                                               
                           AAT                                            
                              ATC                                         
                                 TTC                                      
                                    TTC                                   
                                       TCC                                
                                          CCA                             
                                             GTG                          
                                                AGC                       
                                                   ATC                    
                                                      GCT    ACA          
                                                      GCC                 
61 Phe                                                                    
      Ala                                                                 
         Met                                                              
            Leu                                                           
               Ser                                                        
                  Leu                                                     
                     Gly                                                  
                        Thr                                               
                           Lys                                            
                              Ala                                         
                                 Asp                                      
                                    Thr                                   
                                       His                                
                                          Asp                             
                                             Glu                          
                                                Ile                       
                                                   Leu                    
                                                      Glu    Gly          
                                                      Leu                 
181                                                                       
   TTT                                                                    
      GCA                                                                 
         ATG                                                              
            CTC                                                           
               TCC                                                        
                  CTG                                                     
                     GGG                                                  
                        ACC                                               
                           AAG                                            
                              GCT                                         
                                 GAC                                      
                                    ACT                                   
                                       CAC                                
                                          GAT                             
                                             GAA                          
                                                ATC                       
                                                   CTG                    
                                                      GAG    GGC          
                                                      CTG                 
81 Asn                                                                    
      Phe                                                                 
         Asn                                                              
            Leu                                                           
               Thr                                                        
                  Glu                                                     
                     Ile                                                  
                        Pro                                               
                           Glu                                            
                              Ala                                         
                                 Gln                                      
                                    Ile                                   
                                       His                                
                                          Glu                             
                                             Gly                          
                                                Phe                       
                                                   Gln                    
                                                      Glu    Leu          
                                                      Leu                 
241                                                                       
   AAT                                                                    
      TTC                                                                 
         AAC                                                              
            CTC                                                           
               ACG                                                        
                  GAG                                                     
                     ATT                                                  
                        CCG                                               
                           GAG                                            
                              GCT                                         
                                 CAG                                      
                                    ATC                                   
                                       CAT                                
                                          GAA                             
                                             GGC                          
                                                TTC                       
                                                   CAG                    
                                                      GAA    CTC          
                                                      CTC                 
Arg(a,c)                                     Asp                          
                                                Gly(c)                    
101                                                                       
   His                                                                    
      Thr                                                                 
         Leu                                                              
            Asn                                                           
               Gln                                                        
                  Pro                                                     
                     Asp                                                  
                        Ser                                               
                           Gln                                            
                              Leu                                         
                                 Gln                                      
                                    Leu                                   
                                       Thr                                
                                          Thr                             
                                             Gly                          
                                                Asn                       
                                                   Gly                    
                                                      Leu                 
                                                         Phe              
                                                            Leu           
301                                                                       
   CAT                                                                    
      ACC                                                                 
         CTC                                                              
            AAC                                                           
               CAG                                                        
                  CCA                                                     
                     GAC                                                  
                        AGC                                               
                           CAG                                            
                              CTC                                         
                                 CAG                                      
                                    CTG                                   
                                       ACC                                
                                          ACC                             
                                             GGC                          
                                                AAT                       
                                                   GGC                    
                                                      CTG    TTC          
                                                      CTC                 
121                                                                       
   Ser                                                                    
      Glu                                                                 
         Gly                                                              
            Leu                                                           
               Lys                                                        
                  Leu                                                     
                     Val                                                  
                        Asp                                               
                           Lys                                            
                              Phe                                         
                                 Leu                                      
                                    Glu                                   
                                       Asp                                
                                          Val                             
                                             Lys                          
                                                Lys                       
                                                   Leu                    
                                                      Tyr    His          
                                                      Ser                 
361                                                                       
   AGC                                                                    
      GAG                                                                 
         GGC                                                              
            CTG                                                           
               AAG                                                        
                  CTA                                                     
                     GTG                                                  
                        GAT                                               
                           AAG                                            
                              TTT                                         
                                 TTG                                      
                                    GAG                                   
                                       GAT                                
                                          GTT                             
                                             AAA                          
                                                AAG                       
                                                   TTG                    
                                                      TAC    CAG          
                                                      TCA                 
141                                                                       
   Glu                                                                    
      Ala                                                                 
         Phe                                                              
            Thr                                                           
               Val                                                        
                  Asn                                                     
                     Phe                                                  
                        Gly                                               
                           Asp                                            
                              Thr                                         
                                 Glu                                      
                                    Glu                                   
                                       Ala                                
                                          Lys                             
                                             Lys                          
                                                Gln                       
                                                   Ile                    
                                                      Asn    Asp          
                                                      Tyr                 
421                                                                       
   GAA                                                                    
      GCC                                                                 
         TTC                                                              
            ACT                                                           
               GTC                                                        
                  AAC                                                     
                     TTC                                                  
                        GGG                                               
                           GAC                                            
                              ACC                                         
                                 GAA                                      
                                    GAG                                   
                                       GCC                                
                                          AAG                             
                                             AAA                          
                                                CAG                       
                                                   ATC                    
                                                      AAC    GAT          
                                                      TAC                 
161                                                                       
   Val                                                                    
      Glu                                                                 
         Lys                                                              
            Gly                                                           
               Thr                                                        
                  Gln                                                     
                     Gly                                                  
                        Lys                                               
                           Ile                                            
                              Val                                         
                                 Asp                                      
                                    Leu                                   
                                       Val                                
                                          Lys                             
                                             Glu                          
                                                Leu                       
                                                   Asp                    
                                                      Arg    Asp          
                                                      Thr                 
481                                                                       
   GTG                                                                    
      GAG                                                                 
         AAG                                                              
            GGT                                                           
               ACT                                                        
                  CAA                                                     
                     GGG                                                  
                        AAA                                               
                           ATT                                            
                              GTG                                         
                                 GAT                                      
                                    TTG                                   
                                       GTC                                
                                          AAG                             
                                             GAG                          
                                                CTT                       
                                                   GAC                    
                                                      AGA    GAC          
                                                      ACA                 
181                                                                       
   Val                                                                    
      Phe                                                                 
         Ala                                                              
            Leu                                                           
               Val                                                        
                  Asn                                                     
                     Tyr                                                  
                        Ile                                               
                           Phe                                            
                              Phe                                         
                                 Lys                                      
                                    Gly                                   
                                       Lys                                
                                          Trp                             
                                             Glu                          
                                                Arg                       
                                                   Pro                    
                                                      Phe    Glu          
                                                      Val                 
541                                                                       
   GTT                                                                    
      TTT                                                                 
         GCT                                                              
            CTG                                                           
               GTG                                                        
                  AAT                                                     
                     TAC                                                  
                        ATC                                               
                           TTC                                            
                              TTT                                         
                                 AAA                                      
                                    GGC                                   
                                       AAA                                
                                          TGG                             
                                             GAG                          
                                                AGA                       
                                                   CCC                    
                                                      TTT    GAA          
                                                      GTC                 
                                       Ala(b)                             
201                                                                       
   Lys                                                                    
      Asp                                                                 
         Thr                                                              
            Glu                                                           
               Glu                                                        
                  Glu                                                     
                     Asp                                                  
                        Phe                                               
                           His                                            
                              Val                                         
                                 Asp                                      
                                    Gln                                   
                                       Val                                
                                          Thr                             
                                             Thr                          
                                                Val                       
                                                   Lys                    
                                                      Val                 
                                                         Pro              
                                                            Met           
601                                                                       
   AAG                                                                    
      GAC                                                                 
         ACC                                                              
            GAG                                                           
               GAA                                                        
                  GAG                                                     
                     GAC                                                  
                        TTC                                               
                           CAC                                            
                              GTG                                         
                                 GAC                                      
                                    CAG                                   
                                       GTG                                
                                          ACC                             
                                             ACC                          
                                                GTG                       
                                                   AAG                    
                                                      GTG    CCT          
                                                      ATG                 
                                             BstEII                       
221                                                                       
   Met                                                                    
      Lys                                                                 
         Arg                                                              
            Leu                                                           
               Gly                                                        
                  Met                                                     
                     Phe                                                  
                        Asn                                               
                           Ile                                            
                              Gln                                         
                                 His                                      
                                    Cys                                   
                                       Lys                                
                                          Lys                             
                                             Leu                          
                                                Ser                       
                                                   Ser                    
                                                      Trp                 
                                                         Val              
                                                            Leu           
661                                                                       
   ATG                                                                    
      AAG                                                                 
         CGT                                                              
            TTA                                                           
               GGC                                                        
                  ATG                                                     
                     TTT                                                  
                        AAC                                               
                           ATC                                            
                              CAG                                         
                                 CAC                                      
                                    TGT                                   
                                       AAG                                
                                          AAG                             
                                             CTG                          
                                                TCC                       
                                                   AGC                    
                                                      TGG    GTG          
                                                      CTG                 
                           Asn(c)                                         
241                                                                       
   Leu                                                                    
      Met                                                                 
         Lys                                                              
            Tyr                                                           
               Leu                                                        
                  Gly                                                     
                     Asn                                                  
                        Ala                                               
                           Thr                                            
                              Ala                                         
                                 Ile                                      
                                    Phe                                   
                                       Phe                                
                                          Leu                             
                                             Pro                          
                                                Asp                       
                                                   Glu                    
                                                      Gly                 
                                                         Lys              
                                                            Leu           
721                                                                       
   CTG                                                                    
      ATG                                                                 
         AAA                                                              
            TAC                                                           
               CTG                                                        
                  GGC                                                     
                     AAT                                                  
                        GCC                                               
                           ACC                                            
                              GCC                                         
                                 ATC                                      
                                    TTC                                   
                                       TTC                                
                                          CTG                             
                                             CCT                          
                                                GAT                       
                                                   GAG                    
                                                      GGG    AAA          
                                                      CTA                 
261                                                                       
   Gln                                                                    
      His                                                                 
         Leu                                                              
            Glu                                                           
               Asn                                                        
                  Glu                                                     
                     Leu                                                  
                        Thr                                               
                           His                                            
                              Asp                                         
                                 Ile                                      
                                    Ile                                   
                                       Thr                                
                                          Lys                             
                                             Phe                          
                                                Leu                       
                                                   Glu                    
                                                      Asn    Glu          
                                                      Asp                 
781                                                                       
   CAG                                                                    
      CAC                                                                 
         CTG                                                              
            GAA                                                           
               AAT                                                        
                  GAA                                                     
                     CTC                                                  
                        ACC                                               
                           CAC                                            
                              GAT                                         
                                 ATC                                      
                                    ATC                                   
                                       ACC                                
                                          AAG                             
                                             TTC                          
                                                CTG                       
                                                   GAA                    
                                                      AAT    GAA          
                                                      GAC                 
                                    EcoRV                                 
281                                                                       
   Arg                                                                    
      Arg                                                                 
         Ser                                                              
            Ala                                                           
               Ser                                                        
                  Leu                                                     
                     His                                                  
                        Leu                                               
                           Pro                                            
                              Lys                                         
                                 Leu                                      
                                    Ser                                   
                                       Ile                                
                                          Thr                             
                                             Gly                          
                                                Thr                       
                                                   Tyr                    
                                                      Asp                 
                                                         Leu              
                                                            Lys           
841                                                                       
   AGA                                                                    
      AGG                                                                 
         TCT                                                              
            GCC                                                           
               AGC                                                        
                  TTA                                                     
                     CAT                                                  
                        TTA                                               
                           CCC                                            
                              AAA                                         
                                 CTG                                      
                                    TCC                                   
                                       ATT                                
                                          ACT                             
                                             GGA                          
                                                ACC                       
                                                   TAT                    
                                                      GAT    CTG          
                                                      AAG                 
Val(a,c)                                                                  
301                                                                       
   Ser                                                                    
      Ile                                                                 
         Leu                                                              
            Gly                                                           
               Gln                                                        
                  Leu                                                     
                     Gly                                                  
                        Ile                                               
                           Thr                                            
                              Lys                                         
                                 Val                                      
                                    Phe                                   
                                       Ser                                
                                          Asn                             
                                             Gly                          
                                                Ala                       
                                                   Asp                    
                                                      Leu                 
                                                         Ser              
                                                            Gly           
901                                                                       
   AGC                                                                    
      ATC                                                                 
         CTG                                                              
            GGT                                                           
               CAA                                                        
                  CTG                                                     
                     GGC                                                  
                        ATC                                               
                           ACT                                            
                              AAG                                         
                                 GTC                                      
                                    TTC                                   
                                       AGC                                
                                          AAT                             
                                             GGG                          
                                                GCT                       
                                                   GAC                    
                                                      CTC    TCC          
                                                      GGG                 
321                                                                       
   Val                                                                    
      Thr                                                                 
         Glu                                                              
            Glu                                                           
               Ala                                                        
                  Pro                                                     
                     Leu                                                  
                        Lys                                               
                           Leu                                            
                              Ser                                         
                                 Lys                                      
                                    Ala                                   
                                       Val                                
                                          His                             
                                             Lys                          
                                                Ala                       
                                                   Val                    
                                                      Leu    Thr          
                                                      Ile                 
961                                                                       
   GTC                                                                    
      ACA                                                                 
         GAG                                                              
            GAG                                                           
               GCA                                                        
                  CCC                                                     
                     CTG                                                  
                        AAG                                               
                           CTC                                            
                              TCC                                         
                                 AAG                                      
                                    GCC                                   
                                       GTG                                
                                          CAT                             
                                             AAG                          
                                                GCT                       
                                                   GTG                    
                                                      CTG    ACC          
                                                      ATC                 
 341 1021                                                                 
   Asp GAC                                                                
      Glu GAG                                                             
         Lys AAA                                                          
            Gly GGG                                                       
               Thr ACT                                                    
                  Glu GAA                                                 
                     Ala GCT                                              
                        Ala GCT                                           
                           Gly GGG                                        
                              Ala GCC                                     
                                 Met ATG                                  
                                    Phe TTT                               
                                       Leu TTA                            
                                          Glu GAG                         
                                             Ala GCC                      
                                                Ile ATA                   
                                                   Pro CCC                
                                                       ##STR11##          
                                                      Ile ATC             
361                                                                       
   Pro                                                                    
      Pro                                                                 
         Glu                                                              
            Val                                                           
               Lys                                                        
                  Phe                                                     
                     Asn                                                  
                        Lys                                               
                           Pro                                            
                              Phe                                         
                                 Val                                      
                                    Phe                                   
                                       Leu                                
                                          Met                             
                                             Ile                          
                                                Glu                       
                                                   Gln                    
                                                      Asn                 
                                                         Thr              
                                                            Lys           
1081                                                                      
   CCC                                                                    
      CCC                                                                 
         GAG                                                              
            GTC                                                           
               AAG                                                        
                  TTC                                                     
                     AAC                                                  
                        AAA                                               
                           CCC                                            
                              TTT                                         
                                 GTC                                      
                                    TTC                                   
                                       TTA                                
                                          ATG                             
                                             ATT                          
                                                GAA                       
                                                   CAA                    
                                                      AAT    ACC          
                                                      AAG                 
            AvaI                                                          
381                                                                       
   Ser                                                                    
      Pro                                                                 
         Leu                                                              
            Phe                                                           
               Met                                                        
                  Gly                                                     
                     Lys                                                  
                        Val                                               
                           Val                                            
                              Asn                                         
                                 Pro                                      
                                    Thr                                   
                                       Gln                                
                                          Lys                             
                                             OC                           
1141                                                                      
   TCT                                                                    
      CCC                                                                 
         CTC                                                              
            TTC                                                           
               ATG                                                        
                  GGA                                                     
                     AAA                                                  
                        GTG                                               
                           GTG                                            
                              AAT                                         
                                 CCC                                      
                                    ACC                                   
                                       CAA                                
                                          AAA                             
                                             TAA                          
                                                CTGCCTCTCGCTCCTCAAC       
                                  HinfI                                   
                              AAT                                         
                                 CCC                                      
                                    ACC                                   
                                       CAA                                
                                          AAA                             
                                             TAG                          
                                 GGG                                      
                                    TGG                                   
                                       GTT                                
                                          TTT                             
                                             ATC                          
                                                AGCT                      
                                                    SalI                  
__________________________________________________________________________
 LEGEND                                                                   
 Nucleotide and predicted amino acid sequences of α.sub.1 -AT cDNA. 
 The reactive center metser at positions 358-359 is boxed.                
 Subscripts to amino acids in parentheses identify differences between the
 subject protein sequence and those derived from (a) protein sequencing   
 (Carrell et al., 1982), (b) the cDNA of Woo et al.,  see Carrell et al., 
 1982!), and (c) the cDNA of Bollen et al., 1983. The synthetic DNA       
 molecules used in the construction of the BamHI to SalI fragment encoding
 the mature protein are shown as are the cDNA restriction sites used in   
 this construction.                                                       
The above sequence was determined using the dideoxy sequencing method of Sanger et al., Proc. Natl. Acad. Sci. USA (1977) 74:5463, in the M13 vectors of Messing et al., Nucleic Acids Res. (1981) 9:309. The differences at the nucleotide and amino acid level from the published cDNA sequences are shown.
Construction of the full length clone for expression of yeast began with three fragments isolated from cDNA clones: 1) a 630 bp BamHI-BstEII fragment; 2) a 450 bp BstEII-AvaI fragment; and 3) an 85 bp AvaI-HinfI fragment. A synthetic adapter was employed having the following sequence: ##STR12## Approximately two pmoles of fragments 1 and 2 were ligated together and after removal of the ligase, digested with BamHI and AvaI. Fragment 3 and the synthetic adapter were ligated and digested with AvaI and SalI and the two resulting fragment mixtures were ligated followed by digestion with BamHI and SalI. Fragments migrating upon electrophoresis in the region of about 1000-1400 bp were isolated and cloned by substitution into BamHI and SalI digested and alkaline phosphatase treated pBR322. The resulting plasmid is referred to as pATi.
Plasmid pPGAP was digested with NcoI, followed by blunt-ending, followed by SalI digestion and treatment with alkaline phosphatase. The NcoI-SalI fragment was substituted with an approximately 1250 bp blunt-ended (BamHI)-SalI fragment obtained from plasmid pATi, by BamHI digestion, blunt ending, and SalI digestion. This was inserted into the pPGAP vector to produce the plasmid pGAPATi, a 6.6 kb plasmid, which was digested with NcoI and BamHI and a 2.3 kb NcoI-BamHI fragment obtained having the α1 -AT gene and the GAPDH terminator and approximately 400 bp BamHI-NcoI fragment obtained having the GAPDH promoter. These fragments were treated together and inserted into the BamHI site of pC1/1. The plasmids pC1/1GAPATi8 and pC1/1GAPATi9 were obtained with the orientation of expression clockwise in the former and counterclockwise in the latter, with ampr being in the counterclockwise direction. These plasmids were transformed in S. cerevisiae AB103 (A.T.C.C. No. 20658, deposited Jan. 5, 1983) by standard methods, selecting for leucine prototrophy and grown as described above. Yeast extracts were prepared by lysis with glass beads and the α1 -AT activity determined by inhibition of human leukocyte elastase.
Assays contained in 1 ml: 1:0-0.2 human leukocyte elastase (HLE); 0.1 mM MeO-Suc-Ala-Ala-Pro-Val-p-nitroanilide (Batty et al., J. Biol. Chem. (1980) 255:3931); 50 mM Tris, pH 8, 0.5M NaCl, and the indicated amounts of yeast extract or human α1 -AT. Assays were initiated by the addition of elastase, incubated at 28° C. for 15 min, terminated by the addition of 100 μl of 8N acetic acid and the absorbance at 410 nm determined. Typical results are shown in the following Table 3.
              TABLE 3                                                     
______________________________________                                    
                Amt.    Amt. Amt.  %                                      
                Extract HLE  Protein                                      
                                   Elastase                               
                                         %                                
Plasmid Strain  (μl) (μg)                                           
                             (μg)                                      
                                   Activity                               
                                         α.sub.1 -AT*               
______________________________________                                    
pC1/    AB103   5.0     0.1  50.0  40    0.17                             
IGAPATi8        10.0    0.1  100.0 26    0.11                             
pC1/    AB103   0.25    0.1  2.3   89    0.7                              
IGAPATi9        1.0     0.1  9.1   26    1.2                              
pC1/    AB110   0.2     0.2  2.9   39    6.1                              
IGAPATi9        0.4     0.2  4.8   14    4.3                              
______________________________________                                    
 *Calculation based upon the Mol. wt. of HLE (29 kD), the amount of protei
 added and the degree of inhibition.                                      
The above data demonstrate that plasmids having the orientation of the expression cassette in the counterclockwise orientation, the promoter proximal to the long sequence of pBR322, make 10-20 times more α1 -AT than the same cassette in the other orientation.
Yeast strain AB110
Yeast strain 2150-2-3 was crossed with a yeast strain AB103 transformant containing pC1/1GAPATi9. The diploids were sporulated and the tetrads disected. Strains were maintained on leucine selective plates in order to ensure maintenance of the plasmid, since the parents are auxotrophs. A series of colonies were screened for their genotype with respect to a number of markers. The most vigorous strains were selected and cultures grown on leucine selective media. The best strain was designated AB110 (pC1/1GAPATi9), gave 6-7.5% of the total cell protein as α1 -AT as shown in the above Table 3. The strain AB110 has the following genotype: Matα, ura3-52, leu2-04 or both leu2-3 and leu2-112, pep4-3, his4-580 (cir°).
Phosphate induction
Plasmid pPGT80 was digested with BamHI, the ends blunt-ended, followed by digestion with XbaI and the 500 bp fragment containing the GAPDH promoter and 5'-end of the sAg gene isolated.
The PHO5 gene was isolated from a yeast genomic library employing an oligonucleotide probe 5'-GGCACTCACACGTGGGACTAG-3' derived from the published partial sequence (Meyhack et. al., The EMBO Journal (1932) 1:675-680). A subfragment of this clone containing 550 bp of the 5'-untranslated region and approximately 80 bp of coding sequence was subcloned as a BamHI-SalI substitution in pBR322 to provide pPHO5. This fragment has the sequence 5'-ATGTTTAAA-3', encoding the first three amino acids, the second and third codons specifying an AhaIII site. The plasmid pHBS6 was digested with NcoI, blunt-ended, followed by digestion with BamHI and treatment with alkaline phosphatase. The PHO5 promoter region was obtained by digesting the pPHO5 plasmid with AhaIII, resecting the resulting fragment with Bal31 for a short time, followed by digestion with BamHI and isolation of a 500-550 bp BamHI blunt-ended fragment. This fragment was employed for substitution of the NcoI-BamHI fragment from pHBS6 and was screened for regeneration of the NcoI restriction site to provide plasmid pHBS6PHO5/1.
Plasmid pHBS6PHO5/1 was digested with BstEII which cleaves at position -175 in the PHO5 promoter. This molecule was blunt-ended, digested with SalI and the 650 bp fragment having the 5'-portion of the promoter domain, containing 275 bp of pBR322 and 375 bp of the PHO5 promoter region isolated. This fragment was ligated with the blunt-ended (BamHI)-XbaI fragment obtained from digestion of pPGT80 with BamHI, blunt ending, followed by XbaI digestion. After digesting the ligated fragment with SalI and XbaI, the resulting fragment was then substituted into pPGT16-3 which had been digested with SalI and XbaI and treated with alkaline phosphatase. The resulting plasmid pPHO5PGT80 had a cassette comprising the PHO5 regulatory region, the GAPDH promoter, the sAg gene and the ADH terminator. This cassette was excised from the plasmid by BamHI digestion, whereby a 1.8 kb BamHI-BamHI fragment was gel isolated and ligated into the BamHI site of BamHI digested and alkaline phosphatase treated pC1/1 to provide plasmids PHO5GAP1 and PHO5GAP2 where the PHO5 was distal and proximal to the long pBR322sequence, respectively.
The two plasmids were transformed into yeast strain 2150-2-3 as described above and grown in rich media as described above for 8 to 10 generations in either high (7 mM) or low (0.2 mM) phosphate. Samples were harvested in late log phase and HBsAg determined as described previously. The results are shown below in Table 4.
              TABLE 4                                                     
______________________________________                                    
Regulation of HBsAg Production in Yeast using a                           
Hybrid PHO5/GAPDH Promoter                                                
        High Phosphate                                                    
                   Low Phosphate                                          
        (7 mM)     (0.2 mM)   Induction                                   
Construction                                                              
           (sAg μg/mg protein)                                         
                              low/high                                    
______________________________________                                    
PHO5GAP-1 0.08         0.95       12.0                                    
PHO5GAP-2 0.27         0.40       1.5                                     
______________________________________                                    
From the above results, it is evident that effective regulation with phosphate is obtained, with one orientation being superior to the other.
It is evident from the above results, that highly efficient expression can be obtained, either constitutive or regulated, by providing for truncated promoter regions of yeast glycolytic enzyme gene promoters employing the 3' domain proximal to the coding region of the gene in conjunction with a 5'-portion or second domain of the promoter region of a yeast gene subject to inducible regulation by a nutrient, e.g., carbon source or phosphate. temperature, or other externally controllable source or condition. Alternatively, the second domain may be replaced by prokaryotic sequences of at least about 1 kb or greater, which provide for constitutive enhancement in the absence of the second domain of the promoter region. Thus, a wide variety of genes exogenous to yeast may be expressed in high yield in high percentages of the total protein of the yeast host.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding it will be obvious that certain changes and modifications my be practiced within the scope of the appended claims.

Claims (5)

What is claimed is:
1. A DNA construct for expression of heterologous proteins, wherein said construct comprises:
a structural gene encoding said heterologous protein, wherein said structural gene is under the regulatory control of a first domain; and
. .a.!. .Iadd.said .Iaddend.first domain .Iadd.being .Iaddend.proximal to said structural gene, said first domain comprising .Iadd.at least .Iaddend.about 200. .-500.!. bp, and including the RNA polymerase binding site and transcription initiation site of the yeast Saccharomyces glyceraldehyde-3-phosphate dehydrogenase gene.
2. The DNA construct of claim 1, wherein said structural gene encodes Hepatitis B virus surface antigen.
3. The DNA construct of claim 2, wherein said construct is plasmid PHO5GAP1. .Iadd.
4. A method for expressing and producing a heterologous protein in yeast, which comprises:
expressing a structural gene encoding said heterologous protein in a yeast expression vector having an inserted DNA construct to produce said heterologous protein, said inserted DNA construct comprising:
said structural gene being under the regulatory control of a first domain; and
said first domain being proximal to said structural gene, said first domain comprising at least about 200 bp and including the RNA polymerase binding site and transcription initiation site of the yeast Saccharomyces glyceraldehyde-3-phosphate dehydrogenase gene. .Iaddend..Iadd.5. The method of claim 4 wherein said structural gene encodes Hepatitis B virus
surface antigen. .Iaddend..Iadd.6. The method of claim 5 wherein said expression vector comprises the plasmid PHO5GAP1. .Iaddend..Iadd.7. The method of claim 4 wherein said structural gene encodes a protein for vaccines. .Iaddend..Iadd.8. The method of claim 4 wherein said first domain comprises about 200-500 bp. .Iaddend..Iadd.9. The DNA construct of claim 1 wherein said first domain comprises about 200-500 bp. .Iaddend.
US08/710,744 1983-02-22 1996-09-20 Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs Expired - Lifetime USRE35749E (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US08/710,744 USRE35749E (en) 1983-02-22 1996-09-20 Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US46858983A 1983-02-22 1983-02-22
US60954084A 1984-05-11 1984-05-11
US7338187A 1987-07-13 1987-07-13
US07/380,783 US5089398A (en) 1983-02-22 1989-07-18 Enhanced yeast transcription employing hybrid GAPDH promoter region constructs
US63504890A 1990-12-28 1990-12-28
US08/042,134 US5349059A (en) 1983-02-22 1993-04-02 Hybrid promoter contructs of glyceraldehyde-3-phosphate dehydrogenase promoter
US08/710,744 USRE35749E (en) 1983-02-22 1996-09-20 Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US63504890A Continuation 1983-02-22 1990-12-28
US08/042,134 Reissue US5349059A (en) 1983-02-22 1993-04-02 Hybrid promoter contructs of glyceraldehyde-3-phosphate dehydrogenase promoter

Publications (1)

Publication Number Publication Date
USRE35749E true USRE35749E (en) 1998-03-17

Family

ID=27413075

Family Applications (3)

Application Number Title Priority Date Filing Date
US06/760,197 Expired - Lifetime US4876197A (en) 1983-02-22 1985-07-29 Eukaryotic regulatable transcription
US08/042,134 Ceased US5349059A (en) 1983-02-22 1993-04-02 Hybrid promoter contructs of glyceraldehyde-3-phosphate dehydrogenase promoter
US08/710,744 Expired - Lifetime USRE35749E (en) 1983-02-22 1996-09-20 Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs

Family Applications Before (2)

Application Number Title Priority Date Filing Date
US06/760,197 Expired - Lifetime US4876197A (en) 1983-02-22 1985-07-29 Eukaryotic regulatable transcription
US08/042,134 Ceased US5349059A (en) 1983-02-22 1993-04-02 Hybrid promoter contructs of glyceraldehyde-3-phosphate dehydrogenase promoter

Country Status (1)

Country Link
US (3) US4876197A (en)

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050170404A1 (en) * 2004-02-02 2005-08-04 Ambrx, Inc. Modified human growth hormone polypeptides and their uses
US20060019347A1 (en) * 2004-07-21 2006-01-26 Ambrx, Inc. Biosynthetic polypeptides utilizing non-naturally encoded amino acids
WO2006069246A2 (en) 2004-12-22 2006-06-29 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
US20060153860A1 (en) * 2004-06-18 2006-07-13 Ambrx, Inc. Novel antigen-binding polypeptides and their uses
US20060166236A1 (en) * 2004-12-15 2006-07-27 Chong-Sheng Yuan Allosteric enzyme coupled immunoassay (AECIA)
US20060183198A1 (en) * 2004-12-22 2006-08-17 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
WO2008030558A2 (en) 2006-09-08 2008-03-13 Ambrx, Inc. Modified human plasma polypeptide or fc scaffolds and their uses
US20080108792A1 (en) * 2005-06-03 2008-05-08 Ambrx, Inc. Human Interferon Molecules and Their Uses
US20080107680A1 (en) * 2004-12-22 2008-05-08 Ambrx, Inc. Modified Human Growth Hormone
US20080255045A1 (en) * 2007-03-30 2008-10-16 Ambrx, Inc. Modified FGF-21 Polypeptides and Their Uses
US20080317670A1 (en) * 2005-12-14 2008-12-25 Ambrx, Inc. Compositions Containing, Methods Involving, and Uses of Non-Natural Amino Acids and Polypeptides
US20090123971A1 (en) * 2004-12-22 2009-05-14 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
WO2009067636A2 (en) 2007-11-20 2009-05-28 Ambrx, Inc. Modified insulin polypeptides and their uses
US20090137736A1 (en) * 2005-11-08 2009-05-28 Ambrx, Inc. Accelerants for the Modification of Non-Natural Amino Acids and Non-Natural Amino Acid Polypeptides
US7632823B2 (en) 2005-08-18 2009-12-15 Ambrx, Inc. Compositions of tRNA and uses thereof
WO2010011735A2 (en) 2008-07-23 2010-01-28 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US7674618B2 (en) 2003-09-04 2010-03-09 Medarex, Inc. Expression vector
WO2010037062A1 (en) 2008-09-26 2010-04-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US20100093608A1 (en) * 2008-09-26 2010-04-15 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US20100159585A1 (en) * 2006-09-08 2010-06-24 Ambrx, Inc. Suppressor tRNA Transcription in Vertebrate Cells
US20100159586A1 (en) * 2006-09-08 2010-06-24 Ambrx, Inc. Hybrid Suppressor tRNA for Vertebrate Cells
EP2206785A1 (en) 1998-12-31 2010-07-14 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
US7816320B2 (en) 2004-12-22 2010-10-19 Ambrx, Inc. Formulations of human growth hormone comprising a non-naturally encoded amino acid at position 35
EP2266602A2 (en) 2004-11-01 2010-12-29 Novartis Vaccines and Diagnostics, Inc. Combination approaches for generating immune responses
EP2278021A2 (en) 1999-11-01 2011-01-26 Novartis Vaccines and Diagnostics, Inc. Expression vectors, transfection systems, and method of use thereof
EP2281832A2 (en) 2000-07-05 2011-02-09 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2292772A1 (en) 2001-07-05 2011-03-09 Novartis Vaccines and Diagnostics, Inc. HIV vaccination with a DNA encoding a HIV polypeptide and a HIV polypeptide
US20110144307A1 (en) * 2005-11-16 2011-06-16 Ambrx, Inc. Methods and Compositions Comprising Non-Natural Amino Acids
WO2011112871A1 (en) 2010-03-11 2011-09-15 Immune Design Corp. Vaccines for pandemic influenza
EP2412242A2 (en) 2001-07-05 2012-02-01 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
WO2012024452A2 (en) 2010-08-17 2012-02-23 Ambrx, Inc. Modified relaxin polypeptides and their uses
EP2805964A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified bovine somatotropin polypeptides and their uses
EP2805965A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified porcine somatotropin polypeptides and their uses
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
EP3103880A1 (en) 2008-02-08 2016-12-14 Ambrx, Inc. Modified leptin polypeptides and their uses
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
WO2017040387A2 (en) 2015-08-31 2017-03-09 Technovax, Inc. Human respiratory syncytial virus (hrsv) virus-like particles (vlps) based vaccine
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US11471523B2 (en) 2018-09-11 2022-10-18 Cn.Usa Biotech Holdings, Inc. Universal vaccines against immunogens of pathogenic organisms that provide organism-specific and cross-group protection

Families Citing this family (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB8521496D0 (en) * 1985-08-29 1985-10-02 Ciba Geigy Ag Repressible yeast promoters
GB8620926D0 (en) * 1986-08-29 1986-10-08 Delta Biotechnology Ltd Yeast promoter
US5032676A (en) * 1986-10-14 1991-07-16 Immunex Corporation Nonglycosylated analogs of human colony stimulating factors
US5541084A (en) * 1987-06-06 1996-07-30 Robert R. Yocum Hybrid yeast promoter comprising an ENO2 UAS and TATA region and an additional UAS located between said ENO2 UAS and TATA region
DE3789866T2 (en) * 1987-07-17 1994-09-22 Rhein Biotech Gesellschaft Fuer Neue Biotechnologische Prozesse Und Produkte Mbh, 40595 Duesseldorf DNA molecules that code for FMDH control sections and structural genes for a protein with FMDH activity, and their use.
JPH0669365B2 (en) * 1989-05-22 1994-09-07 株式会社ミドリ十字 Albumin gene-containing plasmid, transformant, method for producing transformant, method for producing albumin
US6172039B1 (en) 1990-04-16 2001-01-09 Apex Bioscience, Inc. Expression of recombinant hemoglobin and hemoglobin variants in yeast
DK0548165T3 (en) 1990-09-13 2001-07-16 Univ Duke Expression of G protein-coupled receptors in yeast
ATE158816T1 (en) 1990-11-26 1997-10-15 Genetics Inst EXPRESSION OF PACE IN HOST CELLS AND METHODS OF USE THEREOF
US5268273A (en) * 1990-12-14 1993-12-07 Phillips Petroleum Company Pichia pastoris acid phosphatase gene, gene regions, signal sequence and expression vectors comprising same
US5422254A (en) * 1992-02-14 1995-06-06 Oy Alko Ab Method to increase the trehalose content of organisms by transforming them with the structural genes for the short and long chains of yeast trehalose synthase
KR100249110B1 (en) * 1992-05-06 2000-04-01 다니엘 엘. 캐시앙 Nucleic acid sequence amplification method, composition and kit
WO1994007994A1 (en) * 1992-10-05 1994-04-14 Mckenzie Maureen A Insulin-dependent yeast or fungi
US5629167A (en) * 1994-04-19 1997-05-13 Biocine S.P.A. Detection of antibodies against Chlamydia trachomatis pgp3 antigen in patient sera by enzyme-linked immunosorbent assay
AUPM598394A0 (en) * 1994-05-31 1994-06-23 Unisearch Limited Transformed human hepatoma cell line which releases insulin
US5597697A (en) * 1994-09-30 1997-01-28 Diamond; Paul Screening assay for inhibitors and activators of RNA and DNA-dependent nucleic acid polymerases
CA2671261A1 (en) 1997-11-06 1999-05-20 Novartis Vaccines And Diagnostics S.R.L. Neisserial antigens
EP1047784B2 (en) 1998-01-14 2015-03-18 Novartis Vaccines and Diagnostics S.r.l. Neissera meningitidis antigens
AUPP263498A0 (en) * 1998-03-27 1998-04-23 Walter And Eliza Hall Institute Of Medical Research, The Novel therapeutic molecules and uses therefor
GB9808932D0 (en) 1998-04-27 1998-06-24 Chiron Spa Polyepitope carrier protein
EP2261338A3 (en) 1998-05-01 2012-01-04 Novartis Vaccines and Diagnostics, Inc. Neisseria meningitidis antigens and compositions
WO2000066741A2 (en) 1999-04-30 2000-11-09 Chiron S.P.A. Conserved neisserial antigens
GB9911683D0 (en) 1999-05-19 1999-07-21 Chiron Spa Antigenic peptides
GB9916529D0 (en) 1999-07-14 1999-09-15 Chiron Spa Antigenic peptides
JP2004508801A (en) 1999-10-29 2004-03-25 カイロン ソチエタ ア レスポンサビリタ リミタータ Neisseria antigenic peptide
US6709863B2 (en) 1999-12-08 2004-03-23 Iowa State University Research Foundation Nucleic acid molecules encoding multiple start codons and histidine tags
PT2289545T (en) 2000-01-17 2016-09-06 Glaxosmithkline Biologicals Sa Supplemented omv vaccine against meningococcus
US6358733B1 (en) * 2000-05-19 2002-03-19 Apolife, Inc. Expression of heterologous multi-domain proteins in yeast
US7053265B2 (en) 2000-10-02 2006-05-30 The Board Of Trustees Operating Michigan State University Application of bi-directional promoters for modification of gene expression
CA2881568C (en) 2000-10-27 2019-09-24 Novartis Vaccines And Diagnostics, Inc. Nucleic acids and proteins from streptococcus groups a & b
GB0107661D0 (en) 2001-03-27 2001-05-16 Chiron Spa Staphylococcus aureus
GB0107658D0 (en) 2001-03-27 2001-05-16 Chiron Spa Streptococcus pneumoniae
RU2331435C2 (en) 2001-12-12 2008-08-20 Чирон Срл. Immunisation against chlamydia trachomatis
WO2003100022A2 (en) * 2002-05-24 2003-12-04 Restoragen, Inc. Methods and dna constructs for high yield production of polypeptides
AU2003243316A1 (en) * 2002-05-24 2003-12-12 Nps Allelix Corp. Method for enzymatic production of glp-2(1-33) and glp-2-(1-34) peptides
CA2485695A1 (en) * 2002-05-24 2003-12-04 Fred W. Wagner Method for universal enzymatic production of bioactive peptides
CA2485701A1 (en) * 2002-05-24 2003-12-04 Fred W. Wagner Method for enzymatic production of glp-1 (7-36) amide peptides
DK1521767T3 (en) 2002-05-24 2010-04-12 Medtronic Inc Methods and Constructs for Expressing High Yield Clostripain
EP1562982B1 (en) 2002-11-15 2010-05-05 Novartis Vaccines and Diagnostics S.r.l. Unexpected surface proteins in neisseria meningitidis
GB0308198D0 (en) 2003-04-09 2003-05-14 Chiron Srl ADP-ribosylating bacterial toxin
HRP20120315T1 (en) * 2003-11-21 2012-05-31 Nps Pharmaceuticals Production of glucagon like peptide 2 and analogs
DE10356218A1 (en) * 2003-12-03 2005-06-30 Bayer Cropscience Ag A method for identifying fungicidally active compounds based on pyruvate kinases from fungi
AU2005244258B2 (en) 2004-04-09 2010-07-01 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
KR100869623B1 (en) * 2004-04-27 2008-11-21 미쓰이 가가쿠 가부시키가이샤 Process for producing hydroxycarboxylic acid
CA2605179A1 (en) 2005-04-18 2006-10-26 Novartis Vaccines And Diagnostics, Inc. Expressing hepatitis b virus surface antigen for vaccine preparation
JP5135220B2 (en) 2005-09-01 2013-02-06 ノバルティス ヴァクシンズ アンド ダイアグノスティクス ゲーエムベーハー アンド カンパニー カーゲー Multiple vaccinations including serogroup C meningococcus
ATE548459T1 (en) 2005-09-16 2012-03-15 Monsanto Technology Llc METHOD FOR THE GENETIC CONTROL OF INSECT INFESTATION IN PLANTS AND COMPOSITIONS
CA2622671C (en) 2005-09-16 2020-12-22 Devgen Nv Methods for controlling pests using rnai
CN105385679B (en) 2006-02-13 2020-05-26 孟山都技术有限公司 Selecting and stabilizing dsRNA constructs
PT2054431E (en) 2006-06-09 2011-11-03 Novartis Ag Conformers of bacterial adhesins
US20090275632A1 (en) * 2006-10-27 2009-11-05 Oncomethylome Sciences Sa Methods of diagnosis and treatment
US10612032B2 (en) 2016-03-24 2020-04-07 The Board Of Trustees Of The Leland Stanford Junior University Inducible production-phase promoters for coordinated heterologous expression in yeast
CN110268057B (en) 2016-11-16 2024-03-29 斯坦福大学托管董事会 Systems and methods for identifying and expressing gene clusters

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0060057A1 (en) * 1981-02-25 1982-09-15 Genentech, Inc. Expression of polypeptides in yeast
EP0072318A2 (en) * 1981-08-04 1983-02-16 The Regents Of The University Of California Synthesis of human virus antigens by yeast
EP0073657A1 (en) * 1981-08-31 1983-03-09 Genentech, Inc. Preparation of hepatitis B surface antigen in yeast
EP0096910A1 (en) * 1982-05-19 1983-12-28 Unilever N.V. Yeast of the genus Kluyveromyces modified for the expression of preprothaumatin or its various allelic and modified forms or their maturation forms

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4615974A (en) * 1981-08-25 1986-10-07 Celltech Limited Yeast expression vectors

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0060057A1 (en) * 1981-02-25 1982-09-15 Genentech, Inc. Expression of polypeptides in yeast
EP0072318A2 (en) * 1981-08-04 1983-02-16 The Regents Of The University Of California Synthesis of human virus antigens by yeast
EP0073657A1 (en) * 1981-08-31 1983-03-09 Genentech, Inc. Preparation of hepatitis B surface antigen in yeast
EP0096910A1 (en) * 1982-05-19 1983-12-28 Unilever N.V. Yeast of the genus Kluyveromyces modified for the expression of preprothaumatin or its various allelic and modified forms or their maturation forms

Non-Patent Citations (36)

* Cited by examiner, † Cited by third party
Title
Bennetzen, J.L. et al., "Codon Selection in Yeast", J. Of Biol. Chem., 1982, 257(6), 3026-3031.
Bennetzen, J.L. et al., Codon Selection in Yeast , J. Of Biol. Chem., 1982, 257(6), 3026 3031. *
Burnette, W.N. et al., Modern Approaches to Vaccines, "Production of Hepatitis-B Recombinant Vacines", Cold Spring Harbor Laboratory, 1984, 245-250.
Burnette, W.N. et al., Modern Approaches to Vaccines, Production of Hepatitis B Recombinant Vacines , Cold Spring Harbor Laboratory, 1984, 245 250. *
Burnette, W.N., et al., Developments in Biological Standardization, "Properties and Relative Immunogenicity of Various Preparations of Recombinant DNA-Derived Hepatitis B Surface Antigen", (Congress Joint IABS/Who Symposium on Standardization and Control of Biologicals Produced by Recombinant DNA Technology), 1983, 59, 113-120.
Burnette, W.N., et al., Developments in Biological Standardization, Properties and Relative Immunogenicity of Various Preparations of Recombinant DNA Derived Hepatitis B Surface Antigen , (Congress Joint IABS/Who Symposium on Standardization and Control of Biologicals Produced by Recombinant DNA Technology), 1983, 59, 113 120. *
Dobson, M.J. et al., "Conservation of high efficiency promoter sequences in Saccharomyces cerevisiae", Nucl. Acids Res., 1982, 10(8), 2625-2637.
Dobson, M.J. et al., Conservation of high efficiency promoter sequences in Saccharomyces cerevisiae , Nucl. Acids Res., 1982, 10(8), 2625 2637. *
Highfield, P.E., Developments in Biological Standardization, "Impact of Genetic Engineering on Hepatitis B Virus", (Congress Joint IABS/Who Symposium on Standardization and Control of Biologicals Produced by Recombinant DNA Technology), 1983, 59, 121-124.
Highfield, P.E., Developments in Biological Standardization, Impact of Genetic Engineering on Hepatitis B Virus , (Congress Joint IABS/Who Symposium on Standardization and Control of Biologicals Produced by Recombinant DNA Technology), 1983, 59, 121 124. *
Hitzeman, R.A. et al., "Expression of a human gene for interferon in yeast", Nature, 1981, 293, 717-722.
Hitzeman, R.A. et al., Expression of a human gene for interferon in yeast , Nature, 1981, 293, 717 722. *
Holland, J.J. et al., "Structure and Expression of Yeast Glycolytic Genes", 291-303.
Holland, J.J. et al., Structure and Expression of Yeast Glycolytic Genes , 291 303. *
Holland, J.P. et al., "Structural Comparison of Two Nontandemly Repeated Yeast Glyceraldehyde-3-Phosphate Dehydrogenase Genes", J. Biol Chem., 1980, 255(6), 2596-2605.
Holland, J.P. et al., "The Primary Structure of a Glyceraldehyde-3-phosphate Dehydrogenase Gene from Saccharomyces cerevisiae", J. Biol. Chem., 1979, 254(19), 9839-9845.
Holland, J.P. et al., Structural Comparison of Two Nontandemly Repeated Yeast Glyceraldehyde 3 Phosphate Dehydrogenase Genes , J. Biol Chem., 1980, 255(6), 2596 2605. *
Holland, J.P. et al., The Primary Structure of a Glyceraldehyde 3 phosphate Dehydrogenase Gene from Saccharomyces cerevisiae , J. Biol. Chem., 1979, 254(19), 9839 9845. *
Holland, M.J. et al., "Isolation and Characterization of a Gene Coding for Glyceraldehyde-3-phosphate Dehydrogenase from Saccharomyces cerevisiae", J. Biol. Chem., 1979, 254(12), 5466-5474.
Holland, M.J. et al., Isolation and Characterization of a Gene Coding for Glyceraldehyde 3 phosphate Dehydrogenase from Saccharomyces cerevisiae , J. Biol. Chem., 1979, 254(12), 5466 5474. *
Miyanohara, A. et al., "Expression of hepatitis B surface antigen gene in yeast", Proc. Natl. Acad. Sci. USA, 1983, 80, 1-5.
Miyanohara, A. et al., Expression of hepatitis B surface antigen gene in yeast , Proc. Natl. Acad. Sci. USA, 1983, 80, 1 5. *
Musti, A.M. et al., "Transcriptional mapping of two yeast genes coding for glyceraldehyde 3-phosphate dehydrogenase isolated by sequence homology with wit chicken gene", Gene, 1983, 133-143.
Musti, A.M. et al., Transcriptional mapping of two yeast genes coding for glyceraldehyde 3 phosphate dehydrogenase isolated by sequence homology with wit chicken gene , Gene, 1983, 133 143. *
Oshima, T. et al., "Yeast Saccharomyces High Expression Vector", 5th Annual Meeting of the Japan Molecular Biology Institute (Tokyo), 1982, Lecture Synopses No. A1-34, 37.
Oshima, T. et al., Yeast Saccharomyces High Expression Vector , 5th Annual Meeting of the Japan Molecular Biology Institute (Tokyo), 1982, Lecture Synopses No. A1 34, 37. *
Tekamp Olson, P. et al., Regulatory Regions of Yeast Pyruvate Kinase and Glyceraldehyde 3 Phosphate Dehydrogenase Promoters , (Abstract), Meeting on the Molecular Biology of Yeast, 1993, 197. *
Tekamp-Olson, P. et al., "Regulatory Regions of Yeast Pyruvate Kinase and Glyceraldehyde-3-Phosphate Dehydrogenase Promoters", (Abstract), Meeting on the Molecular Biology of Yeast, 1993, 197.
Tuite, M.F. et al., "Regulated high efficiency expression of human interferon-alpha in Saccharomyces cerevisiae", IRL Press Limited, Oxford, England, 1982, 603-608.
Tuite, M.F. et al., Regulated high efficiency expression of human interferon alpha in Saccharomyces cerevisiae , IRL Press Limited, Oxford, England, 1982, 603 608. *
Urdea, M.S. et al., "Chemical synthesis of a gene for human epidermal growth factor urogastrone and its expression in yeast", Proc. Natl. Acad. Sci. USA, 1983, 80, 7461-7465.
Urdea, M.S. et al., Chemical synthesis of a gene for human epidermal growth factor urogastrone and its expression in yeast , Proc. Natl. Acad. Sci. USA, 1983, 80, 7461 7465. *
Valenzuela, P. et al., "Characterization of Hepatitis B Surface Antigen Particles Produced in Yeast and in Mammalian Cells", (Abstract), Presented at the meeting on Modern Approaches to Vaccines, 1983, 70.
Valenzuela, P. et al., Characterization of Hepatitis B Surface Antigen Particles Produced in Yeast and in Mammalian Cells , (Abstract), Presented at the meeting on Modern Approaches to Vaccines, 1983, 70. *
Van Vuuren et al. (1987) Am. J. Enol. Vitic. 38: 49 53, abstract cited. *
Van Vuuren et al. (1987) Am. J. Enol. Vitic. 38: 49-53, abstract cited.

Cited By (143)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2206785A1 (en) 1998-12-31 2010-07-14 Novartis Vaccines and Diagnostics, Inc. Improved expression of HIV polypeptides and production of virus-like particles
EP2278022A2 (en) 1999-11-01 2011-01-26 Novartis Vaccines and Diagnostics, Inc. Expression vectors, transfection systems, and method of use thereof
EP2278021A2 (en) 1999-11-01 2011-01-26 Novartis Vaccines and Diagnostics, Inc. Expression vectors, transfection systems, and method of use thereof
EP2311958A2 (en) 2000-07-05 2011-04-20 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2281832A2 (en) 2000-07-05 2011-02-09 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2292772A1 (en) 2001-07-05 2011-03-09 Novartis Vaccines and Diagnostics, Inc. HIV vaccination with a DNA encoding a HIV polypeptide and a HIV polypeptide
EP2412242A2 (en) 2001-07-05 2012-02-01 Novartis Vaccines and Diagnostics, Inc. Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
US7674618B2 (en) 2003-09-04 2010-03-09 Medarex, Inc. Expression vector
US8119603B2 (en) 2004-02-02 2012-02-21 Ambrx, Inc. Modified human interferon polypeptides and their uses
US8232371B2 (en) 2004-02-02 2012-07-31 Ambrx, Inc. Modified human interferon polypeptides and their uses
EP2327724A2 (en) 2004-02-02 2011-06-01 Ambrx, Inc. Modified human growth hormone polypeptides and their uses
US20080097083A1 (en) * 2004-02-02 2008-04-24 Ambrx, Inc. Modified Human Four Helical Bundle Polypeptides and Their Uses
US8906676B2 (en) 2004-02-02 2014-12-09 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US8778880B2 (en) 2004-02-02 2014-07-15 Ambrx, Inc. Human growth hormone modified at position 35
US8097702B2 (en) 2004-02-02 2012-01-17 Ambrx, Inc. Modified human interferon polypeptides with at least one non-naturally encoded amino acid and their uses
US9260472B2 (en) 2004-02-02 2016-02-16 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US20050220762A1 (en) * 2004-02-02 2005-10-06 Ambrx, Inc. Modified human interferon polypeptides and their uses
US20050170404A1 (en) * 2004-02-02 2005-08-04 Ambrx, Inc. Modified human growth hormone polypeptides and their uses
US20080207877A1 (en) * 2004-02-02 2008-08-28 Ambrx, Inc. Modified Human Four Helical Bundle Polypeptides and Their Uses
US8907064B2 (en) 2004-02-02 2014-12-09 Ambrx, Inc. Modified human four helical bundle polypeptides and their uses
US20080050374A1 (en) * 2004-06-18 2008-02-28 Ambrx, Inc. Novel antigen-binding polypeptides and their uses
US9175083B2 (en) 2004-06-18 2015-11-03 Ambrx, Inc. Antigen-binding polypeptides and their uses
US20080085277A1 (en) * 2004-06-18 2008-04-10 Ambrx, Inc. Novel antigen-binding polypeptides and their uses
US7632924B2 (en) 2004-06-18 2009-12-15 Ambrx, Inc. Antigen-binding polypeptides and their uses
US20080081038A1 (en) * 2004-06-18 2008-04-03 Ambrx, Inc. Novel antigen-binding polypeptides and their uses
US20060153860A1 (en) * 2004-06-18 2006-07-13 Ambrx, Inc. Novel antigen-binding polypeptides and their uses
US7638299B2 (en) 2004-07-21 2009-12-29 Ambrx, Inc. Biosynthetic polypeptides utilizing non-naturally encoded amino acids
US20100048871A1 (en) * 2004-07-21 2010-02-25 Ambrx, Inc. Biosynthetic Polypeptides Utilizing Non-Naturally Encoded Amino Acids
US20060019347A1 (en) * 2004-07-21 2006-01-26 Ambrx, Inc. Biosynthetic polypeptides utilizing non-naturally encoded amino acids
EP2266602A2 (en) 2004-11-01 2010-12-29 Novartis Vaccines and Diagnostics, Inc. Combination approaches for generating immune responses
US20060166236A1 (en) * 2004-12-15 2006-07-27 Chong-Sheng Yuan Allosteric enzyme coupled immunoassay (AECIA)
US20080199909A1 (en) * 2004-12-22 2008-08-21 Ambrx, Inc. Methods for Expression and Purification of Recombinant Human Growth Hormone
US20090123971A1 (en) * 2004-12-22 2009-05-14 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US8080391B2 (en) 2004-12-22 2011-12-20 Ambrx, Inc. Process of producing non-naturally encoded amino acid containing high conjugated to a water soluble polymer
US7736872B2 (en) 2004-12-22 2010-06-15 Ambrx, Inc. Compositions of aminoacyl-TRNA synthetase and uses thereof
US8178108B2 (en) 2004-12-22 2012-05-15 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
US8163695B2 (en) 2004-12-22 2012-04-24 Ambrx Formulations of human growth hormone comprising a non-naturally encoded amino acid
US8143216B2 (en) 2004-12-22 2012-03-27 Ambrx, Inc. Modified human growth hormone
US20100167347A1 (en) * 2004-12-22 2010-07-01 Ambrx, Inc. Compositions of Aminoacyl-tRNA Synthetase and Uses Thereof
US20100173380A1 (en) * 2004-12-22 2010-07-08 Ambrx, Inc. Compositions of Aminoacyl-tRNA Synthetase and Uses Thereof
US20100174054A1 (en) * 2004-12-22 2010-07-08 Ambrx, Inc. Compositions of Aminoacyl-tRNA Synthetase and Uses Thereof
US20100173379A1 (en) * 2004-12-22 2010-07-08 Ambrx, Inc. Compositions of Aminoacyl-tRNA Synthetase and Uses Thereof
EP2399893A2 (en) 2004-12-22 2011-12-28 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
US20100184140A1 (en) * 2004-12-22 2010-07-22 Ambrx, Inc. Compositions of Aminoacyl-tRNA Synthetase and Uses Thereof
US7816320B2 (en) 2004-12-22 2010-10-19 Ambrx, Inc. Formulations of human growth hormone comprising a non-naturally encoded amino acid at position 35
US7829310B2 (en) 2004-12-22 2010-11-09 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7838265B2 (en) 2004-12-22 2010-11-23 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US20110195899A1 (en) * 2004-12-22 2011-08-11 Ambrx, Inc. Formulations of Human Growth Hormone Comprising a Non-Naturally Encoded Amino Acid
US7846689B2 (en) 2004-12-22 2010-12-07 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US7858344B2 (en) 2004-12-22 2010-12-28 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US8178494B2 (en) 2004-12-22 2012-05-15 Ambrx, Inc. Modified human growth hormone formulations with an increased serum half-life
WO2006069246A2 (en) 2004-12-22 2006-06-29 Ambrx, Inc. Compositions containing, methods involving, and uses of non-natural amino acids and polypeptides
US7959926B2 (en) 2004-12-22 2011-06-14 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone mutants
US7883866B2 (en) 2004-12-22 2011-02-08 Ambrx, Inc. Compositions of aminoacyl-tRNA synthetase and uses thereof
US20060183198A1 (en) * 2004-12-22 2006-08-17 Ambrx, Inc. Methods for expression and purification of recombinant human growth hormone
EP2284191A2 (en) 2004-12-22 2011-02-16 Ambrx, Inc. Process for the preparation of hGH
US20080107680A1 (en) * 2004-12-22 2008-05-08 Ambrx, Inc. Modified Human Growth Hormone
US7947473B2 (en) 2004-12-22 2011-05-24 Ambrx, Inc. Methods for expression and purification of pegylated recombinant human growth hormone containing a non-naturally encoded keto amino acid
US7939496B2 (en) 2004-12-22 2011-05-10 Ambrx, Inc. Modified human growth horomone polypeptides and their uses
US20080108792A1 (en) * 2005-06-03 2008-05-08 Ambrx, Inc. Human Interferon Molecules and Their Uses
US20080119640A1 (en) * 2005-06-03 2008-05-22 Ambrx, Inc. Human Interferon Molecules and Their Uses
US20080132681A1 (en) * 2005-06-03 2008-06-05 Ambrx, Inc. Human Interferon Molecules and Their Uses
US8093356B2 (en) 2005-06-03 2012-01-10 Ambrx, Inc. Pegylated human interferon polypeptides
US20100135959A1 (en) * 2005-06-03 2010-06-03 Ambrx, Inc. Human Interferon Molecules and Their Uses
US7632823B2 (en) 2005-08-18 2009-12-15 Ambrx, Inc. Compositions of tRNA and uses thereof
US20090137736A1 (en) * 2005-11-08 2009-05-28 Ambrx, Inc. Accelerants for the Modification of Non-Natural Amino Acids and Non-Natural Amino Acid Polypeptides
US9488660B2 (en) 2005-11-16 2016-11-08 Ambrx, Inc. Methods and compositions comprising non-natural amino acids
US20110144307A1 (en) * 2005-11-16 2011-06-16 Ambrx, Inc. Methods and Compositions Comprising Non-Natural Amino Acids
US20080317670A1 (en) * 2005-12-14 2008-12-25 Ambrx, Inc. Compositions Containing, Methods Involving, and Uses of Non-Natural Amino Acids and Polypeptides
US8053560B2 (en) 2006-09-08 2011-11-08 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US20100159585A1 (en) * 2006-09-08 2010-06-24 Ambrx, Inc. Suppressor tRNA Transcription in Vertebrate Cells
WO2008030558A2 (en) 2006-09-08 2008-03-13 Ambrx, Inc. Modified human plasma polypeptide or fc scaffolds and their uses
US8618257B2 (en) 2006-09-08 2013-12-31 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US20110207914A1 (en) * 2006-09-08 2011-08-25 Ambrx, Inc. Modified Human Plasma Polypeptide or Fc Scaffolds and Their Uses
US20080125574A1 (en) * 2006-09-08 2008-05-29 Ambrx, Inc. Modified Human Plasma Polypeptide or Fc Scaffolds and Their Uses
US8420792B2 (en) 2006-09-08 2013-04-16 Ambrx, Inc. Suppressor tRNA transcription in vertebrate cells
US7919591B2 (en) 2006-09-08 2011-04-05 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US9133495B2 (en) 2006-09-08 2015-09-15 Ambrx, Inc. Hybrid suppressor tRNA for vertebrate cells
US20100160212A1 (en) * 2006-09-08 2010-06-24 Ambrx, Inc. Modified Human Plasma Polypeptide or Fc Scaffolds and Their Uses
US8022186B2 (en) 2006-09-08 2011-09-20 Ambrx, Inc. Modified human plasma polypeptide or Fc scaffolds and their uses
US20100159586A1 (en) * 2006-09-08 2010-06-24 Ambrx, Inc. Hybrid Suppressor tRNA for Vertebrate Cells
US20110172401A1 (en) * 2007-03-30 2011-07-14 Ambrx, Inc. Modified FGF-21 Polypeptides and Their Uses
US20080255045A1 (en) * 2007-03-30 2008-10-16 Ambrx, Inc. Modified FGF-21 Polypeptides and Their Uses
US10377805B2 (en) 2007-03-30 2019-08-13 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally encoding amino acids and their uses
US9975936B2 (en) 2007-03-30 2018-05-22 Ambrx, Inc. Nucleic acids encoding modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US8383365B2 (en) 2007-03-30 2013-02-26 Ambrx, Inc. Methods of making FGF-21 mutants comprising non-naturally encoded phenylalanine derivatives
US9517273B2 (en) 2007-03-30 2016-12-13 Ambrx, Inc. Methods of treatment using modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US10961291B2 (en) 2007-03-30 2021-03-30 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US8012931B2 (en) 2007-03-30 2011-09-06 Ambrx, Inc. Modified FGF-21 polypeptides and their uses
US11993637B2 (en) 2007-03-30 2024-05-28 Ambrx, Inc. Modified FGF-21 polypeptides with non-naturally encoded amino acids
US9079971B2 (en) 2007-03-30 2015-07-14 Ambrx, Inc. Modified FGF-21 polypeptides comprising non-naturally occurring amino acids
US8114630B2 (en) 2007-05-02 2012-02-14 Ambrx, Inc. Modified interferon beta polypeptides and their uses
US20100298212A1 (en) * 2007-11-20 2010-11-25 Ambrx, Inc. Modified Insulin Polypeptides and Their Uses
WO2009067636A2 (en) 2007-11-20 2009-05-28 Ambrx, Inc. Modified insulin polypeptides and their uses
US8946148B2 (en) 2007-11-20 2015-02-03 Ambrx, Inc. Modified insulin polypeptides and their uses
EP2930182A1 (en) 2007-11-20 2015-10-14 Ambrx, Inc. Modified insulin polypeptides and their uses
EP3103880A1 (en) 2008-02-08 2016-12-14 Ambrx, Inc. Modified leptin polypeptides and their uses
US9938333B2 (en) 2008-02-08 2018-04-10 Ambrx, Inc. Modified leptin polypeptides and their uses
WO2010011735A2 (en) 2008-07-23 2010-01-28 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US20100035812A1 (en) * 2008-07-23 2010-02-11 Ambrx, Inc. Modified Bovine G-CSF Polypeptides And Their Uses
EP3225248A1 (en) 2008-07-23 2017-10-04 Ambrx, Inc. Modified bovine g-csf polypeptides and their uses
US10138283B2 (en) 2008-07-23 2018-11-27 Ambrx, Inc. Modified bovine G-CSF polypeptides and their uses
US10428333B2 (en) 2008-09-26 2019-10-01 Ambrx Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
WO2010037062A1 (en) 2008-09-26 2010-04-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US9121025B2 (en) 2008-09-26 2015-09-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US20110195483A1 (en) * 2008-09-26 2011-08-11 Ambrx, Inc. Non-Natural Amino Acid Replication-Dependent Microorganisms and Vaccines
US20100093608A1 (en) * 2008-09-26 2010-04-15 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US9121024B2 (en) 2008-09-26 2015-09-01 Ambrx, Inc. Non-natural amino acid replication-dependent microorganisms and vaccines
US8278418B2 (en) 2008-09-26 2012-10-02 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
EP3216800A1 (en) 2008-09-26 2017-09-13 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US9156899B2 (en) 2008-09-26 2015-10-13 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
US9644014B2 (en) 2008-09-26 2017-05-09 Ambrx, Inc. Modified animal erythropoietin polypeptides and their uses
US8569233B2 (en) 2008-09-26 2013-10-29 Eli Lilly And Company Modified animal erythropoietin polypeptides and their uses
EP2805964A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified bovine somatotropin polypeptides and their uses
EP2805965A1 (en) 2009-12-21 2014-11-26 Ambrx, Inc. Modified porcine somatotropin polypeptides and their uses
WO2011112871A1 (en) 2010-03-11 2011-09-15 Immune Design Corp. Vaccines for pandemic influenza
US8735539B2 (en) 2010-08-17 2014-05-27 Ambrx, Inc. Relaxin polypeptides comprising non-naturally encoded amino acids
US9567386B2 (en) 2010-08-17 2017-02-14 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US11311605B2 (en) 2010-08-17 2022-04-26 Ambrx, Inc. Methods of treating heart failure and fibrotic disorders using modified relaxin polypeptides
EP4302783A2 (en) 2010-08-17 2024-01-10 Ambrx, Inc. Modified relaxin polypeptides and their uses
US11786578B2 (en) 2010-08-17 2023-10-17 Ambrx, Inc. Modified relaxin polypeptides and their uses
US10253083B2 (en) 2010-08-17 2019-04-09 Ambrx, Inc. Therapeutic uses of modified relaxin polypeptides
US11439710B2 (en) 2010-08-17 2022-09-13 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
US9962450B2 (en) 2010-08-17 2018-05-08 Ambrx, Inc. Method of treating heart failure with modified relaxin polypeptides
US9452222B2 (en) 2010-08-17 2016-09-27 Ambrx, Inc. Nucleic acids encoding modified relaxin polypeptides
WO2012024452A2 (en) 2010-08-17 2012-02-23 Ambrx, Inc. Modified relaxin polypeptides and their uses
US10702588B2 (en) 2010-08-17 2020-07-07 Ambrx, Inc. Modified relaxin polypeptides comprising a non-naturally encoded amino acid in the A chain
US10751391B2 (en) 2010-08-17 2020-08-25 Ambrx, Inc. Methods of treatment using modified relaxin polypeptides comprising a non-naturally encoded amino acid
US12138296B2 (en) 2010-09-23 2024-11-12 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US11273202B2 (en) 2010-09-23 2022-03-15 Elanco Us Inc. Formulations for bovine granulocyte colony stimulating factor and variants thereof
US10377806B2 (en) 2014-10-24 2019-08-13 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides and uses thereof
US11248031B2 (en) 2014-10-24 2022-02-15 Bristol-Myers Squibb Company Methods of treating diseases associated with fibrosis using modified FGF-21 polypeptides
US10189883B2 (en) 2014-10-24 2019-01-29 Bristol-Myers Squibb Company Therapeutic uses of modified FGF-21 polypeptides
US9631004B2 (en) 2014-10-24 2017-04-25 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US9434778B2 (en) 2014-10-24 2016-09-06 Bristol-Myers Squibb Company Modified FGF-21 polypeptides comprising an internal deletion and uses thereof
US12247058B2 (en) 2014-10-24 2025-03-11 Bristol-Myers Squibb Company Nucleic acids encoding modified FGF-21 polypeptides, vectors and cells containing, and use thereof
WO2017040387A2 (en) 2015-08-31 2017-03-09 Technovax, Inc. Human respiratory syncytial virus (hrsv) virus-like particles (vlps) based vaccine
US11185570B2 (en) 2017-02-08 2021-11-30 Bristol-Myers Squibb Company Method of treating cardiovascular disease and heart failure with modified relaxin polypeptides
US11364281B2 (en) 2017-02-08 2022-06-21 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and pharmaceutical compositions thereof
US10266578B2 (en) 2017-02-08 2019-04-23 Bristol-Myers Squibb Company Modified relaxin polypeptides comprising a pharmacokinetic enhancer and uses thereof
US12097241B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Methods of treating kidney failure, and/or improving or stablizing renal function using modified relaxin polypeptides
US12097242B2 (en) 2017-02-08 2024-09-24 Bristol-Myers Squibb Company Treatment of fibrosis, cardiovascular disease and heart failure with modified relaxin polypeptides
US11471523B2 (en) 2018-09-11 2022-10-18 Cn.Usa Biotech Holdings, Inc. Universal vaccines against immunogens of pathogenic organisms that provide organism-specific and cross-group protection

Also Published As

Publication number Publication date
US4876197A (en) 1989-10-24
US5349059A (en) 1994-09-20

Similar Documents

Publication Publication Date Title
USRE35749E (en) Constructs of glyceraldehyde-3-phosphate dehydrogenase promoter and methods for expressing genes using said constructs
US5089398A (en) Enhanced yeast transcription employing hybrid GAPDH promoter region constructs
EP0164556B1 (en) Enhanced yeast transcription employing hybrid promoter region constructs
US4880734A (en) Eukaryotic regulatable transcription
EP0073657B1 (en) Preparation of hepatitis b surface antigen in yeast
CA1304020C (en) High level expression in yeast
FI94427B (en) Regulatory region for heterologous gene expression in yeast
CA1341381C (en) Yeast hybrid vectors and their use for the production of polypeptides
CA1296272C (en) Superoxide dismutase cloning and expression in microorganisms
FI107265B (en) Expression of hepatitis B, S and PreS2 proteins in methylotropic yeasts
IE863021L (en) Yeast production of hepatitis b surface antigen
US4752576A (en) Expression of α-1 antitrypsin in yeast
WO1992013951A1 (en) Production of human serum albumin in methylotrophic yeast cells
US4803164A (en) Preparation of hepatitis b surface antigen in yeast
CA1341165C (en) Active site modified protease alpha-1-antitrypsin inhibitors and their production
US5066591A (en) Polypeptides of human copper/zinc superoxide dimutase
US5710033A (en) Superoxide dismutase cloning and expression in microorganisms
AU605036B2 (en) Expression of hepatitis B2 pres protein in methylothrophic yeasts
US5252476A (en) Superoxide dismutase cloning and expression in microorganisms
US5629189A (en) DNA encoding human cytoplasmic Cu/Zn superoxide dismutase
US5407822A (en) Artificial promoter for the expression of proteins in yeast
AU707657B2 (en) Process for the production of proteins
US5691139A (en) Genetic modification of superoxide dismutase to increase expression in microorganisms

Legal Events

Date Code Title Description
FPAY Fee payment

Year of fee payment: 4

AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ROSENBERG, STEVEN;TEKAMP-OLSEN, PATRICIA;VALENZUELA, PABLO D.T.;REEL/FRAME:009245/0145

Effective date: 19980603

FPAY Fee payment

Year of fee payment: 8

FPAY Fee payment

Year of fee payment: 12