USRE33653E - Human recombinant interleukin-2 muteins - Google Patents

Human recombinant interleukin-2 muteins Download PDF

Info

Publication number
USRE33653E
USRE33653E US07/386,207 US38620789A USRE33653E US RE33653 E USRE33653 E US RE33653E US 38620789 A US38620789 A US 38620789A US RE33653 E USRE33653 E US RE33653E
Authority
US
United States
Prior art keywords
mutein
interleukin
ifn
dna
native
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime, expires
Application number
US07/386,207
Inventor
David F. Mark
Leo S. Lin
Shi-da Y. Lu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Cetus Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cetus Corp filed Critical Cetus Corp
Priority to US07/386,207 priority Critical patent/USRE33653E/en
Application granted granted Critical
Publication of USRE33653E publication Critical patent/USRE33653E/en
Priority to BG096074A priority patent/BG60506B2/en
Assigned to CETUS ONCOLOGY CORPORATION reassignment CETUS ONCOLOGY CORPORATION CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). EFFECTIVE ON 03/06/1992 Assignors: CETUS CORPORATION, A CORP. OF DE
Assigned to CETUS ONCOLOGY CORPORATION reassignment CETUS ONCOLOGY CORPORATION CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). EFFECTIVE ON 03/06/1992 Assignors: CETUS CORPORATION
Assigned to CHIRON CORPORATION reassignment CHIRON CORPORATION MERGER (SEE DOCUMENT FOR DETAILS). Assignors: CETUS ONCOLOGYCORPORATION (FORMERLY CETUS CORPORATION)
Adjusted expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/55—IL-2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • C07K14/565—IFN-beta
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S530/00—Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
    • Y10S530/808—Materials and products related to genetic engineering or hybrid or fused cell technology, e.g. hybridoma, monoclonal products
    • Y10S530/809—Fused cells, e.g. hybridoma
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S930/00—Peptide or protein sequence
    • Y10S930/01—Peptide or protein sequence
    • Y10S930/14—Lymphokine; related peptides
    • Y10S930/141—Interleukin
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S930/00—Peptide or protein sequence
    • Y10S930/01—Peptide or protein sequence
    • Y10S930/14—Lymphokine; related peptides
    • Y10S930/142—Interferon

Definitions

  • This invention is in the general area of recombinant DNA technology. More specifically it relates to mutationally altered biologically active proteins that differ from their parent analogs by one or more substituents/deletions of cysteine residues.
  • Biologically active proteins that are microbially produced via recombinant DNA (rDNA) technology may contain cysteine residues that are nonessential to their activity but are free to form undesirable intermolecular or intramolecular links.
  • rDNA recombinant DNA
  • One such protein is microbially produced human beta interferon (IFN- ⁇ ).
  • IFN- ⁇ human beta interferon
  • IFN- ⁇ This multimer formation renders purification and separation of IFN- ⁇ very laborious and time consuming and necessitates several additional steps in purification and isolation procedures such as reducing the protein during purification and reoxidizing it to restore it to its original conformation, thereby increasing the possibility of incorrect disulfide bond formation.
  • microbially produced IFN- ⁇ has also been found to exhibit consistently low specific activity due perhaps to the formation of multimers or of random intramolecular disulfide bridges.
  • the present invention is directed to producing by directed mutagenesis techniques mutationally altered biologically active proteins (such proteins are called "muteins", Glossary of Genetics and Cytogenetics, 4th Ed, p 381, Springer-Verlag (1976)) that retain the activity of their parent analogs but lack the ability to form intermolecular links or undesirable intramolecular disulfide bonds.
  • mutationally altered biologically active proteins such proteins are called "muteins”, Glossary of Genetics and Cytogenetics, 4th Ed, p 381, Springer-Verlag (1976)
  • One aspect of the invention is a synthetic mutein of a biologically active protein which protein has at least one cysteine residue that is free to form a disulfide link and is nonessential to said biological activity, said mutein having at least one of said cysteine residues deleted or replaced by another amino acid.
  • Another aspect of the invention relates to synthetic structural genes having DNA sequences that have been specifically designed ("designer genes") to encode the above described synthetic muteins.
  • designer genes DNA sequences that have been specifically designed
  • Subaspects of this aspect are expression vectors that include such structural designer genes, host cells or organisms transformed with such vectors, and processes for making the synthetic mutein by culturing such transformants or their progeny and recovering the mutein from the culture.
  • therapeutic compositions that contain therapeutically effective amounts of the muteins and therapeutic methods are other aspects of the invention.
  • Another aspect of the invention is a method of preventing a protein having one or more cysteine residues that is free to form an undesirable disulfide link from forming such a link comprising mutationally altering the protein by deleting the cysteine residue(s) or replacing them with other amino acids.
  • Still another aspect of the invention is a method for making the above described synthetic structural gene by oligonucleotide-directed mutagenesis comprising the following steps:
  • mutant oligonucleotide primers used in this process are another aspect of the invention.
  • FIG. 1 is a diagram of the amino acid sequence of IFN- ⁇ .
  • FIG. 2 is a schematic illustration showing the preparation of a mutant IFN- ⁇ gene by oligonucleotide-directed mutagenesis.
  • FIG. 3 shows a diagram of plasmid p ⁇ 1trp including the IFN- ⁇ gene.
  • FIG. 4 is a diagram of the cloning vector M13mp8 phage.
  • FIG. 5 shows the restriction map of clone M13- ⁇ 1.
  • FIG. 6 shows the sequencing gel pattern of the mutant IFN- ⁇ ser17 gene showing a single base change in the coding region.
  • FIG. 7 is a diagram of the expression plasmid pTrp3.
  • FIG. 8a shows the HinfI restriction pattern of clone pSY2501 and FIG. 8b shows the resulting two 169bp and 28bp fragments thereof.
  • FIG. 9 is a restriction map of clone pSY2501.
  • FIG. 10 shows the coding DNA sequence for the mutein IFN- ⁇ ser17 with the corresponding amino acid sequence therefor.
  • FIG. 11 shows the single 18,000 dalton protein band corresponding to IFN- ⁇ ser17 in the extracts of clones pSY2501 and p ⁇ 1trp.
  • FIG. 12 is a diagram of the plasmid pLW1 which contains the human interleukin-2 (IL-2) gene under the control of the E.coli trp promoter.
  • IL-2 human interleukin-2
  • FIG. 13 is a restriction map of phage clone M13-IL2.
  • FIG. 14 is a restriction map of the plasmid pLW46.
  • FIGS. 15a and 15b show, respectively, the nucleotide sequence of the coding strand of the clone pLW46 and the corresponding amino acid sequence of the IL-2 mutein designated IL-2 ser 125.
  • FIG. 16 is a diagram of the plasmid pLW32.
  • FIG. 17 is a diagram of the plasmid pLW55.
  • the present invention provides: muteins of biologically active proteins in which cysteine residues that are not essential to biological activity have been deliberately deleted or replaced with other amino acids to eliminate sites for intermolecular crosslinking or incorrect intramolecular disulfide bond formation; mutant genes coding for such muteins; and means for making such muteins.
  • Proteins that may be mutationally altered according to this invention may be identified from available information regarding the cysteine content of biologically active proteins and the roles played by the cysteine residues with respect to activity and tertiary structure. For proteins for which such information is not available in the literature this information may be determined by systematically altering each of the cysteine residues of the protein by the procedures described herein and testing the biological activity of the resulting muteins and their proclivity to form undesirable intermolecular or intramolecular disulfide bonds.
  • proteins other than IFN- ⁇ and IL-2 that are candidates for mutational alteration according to the invention are lymphotoxin (tumor necrosis factor), colony stimulating factor-1, and IFN- ⁇ 1.
  • lymphotoxin tumor necrosis factor
  • colony stimulating factor-1 colony stimulating factor-1
  • IFN- ⁇ 1 IFN- ⁇ 1.
  • Candidate proteins will usually have an odd number of cysteine residues.
  • IFN- ⁇ In the case of IFN- ⁇ it has been reported in the literature and that both the glycosylated and unglycosylated IFNs show qualitatively similar specific activities and that, therefore, the glycosyl moieties are not involved in and do not contribute to the biological activity of IFN- ⁇ . However, bacterially produced IFN- ⁇ which is unglycosylated consistently exhibits quantitatively lower specific activity than native IFN- ⁇ which is glycosylated. IFN- ⁇ is known to have three cysteine residues at positions 17, 31 and 141. Cysteine 141 has been demonstrated by Shepard, et al, supra, to be essential for biological activity.
  • IFN- ⁇ which contains four cysteine residues
  • cys 141 of IFN- ⁇ could be involved in an intramolecular --S--S-- bond with cys 31, leaving cys 17 free to form intramolecular crosslinks.
  • cys 17 By either deleting cys 17 or substituting it by a different amino acid, one can determine whether cys 17 is essential to biological activity, and its role in --SS-- bond formation.
  • cys 17 is not essential for the biological activity of the protein, the resulting cys 17-deleted or cys 17-substituted protein might exhibit specific activity close to that of native IFN- ⁇ and would possibly also facilitate isolation and purification of the protein.
  • oligonucleotide-directed mutagenesis procedure By the use of the oligonucleotide-directed mutagenesis procedure with a synthetic oligonucleotide primer that is complementary to the region of the IFN- ⁇ gene at the codon for cys 17 but which contains single or multiple base changes in that codon, a designer gene may be produced that results in cys 17 being replaced with any other amino acid of choice. When deletion is desired the oligonucleotide primer lacks the codon for cys 17.
  • Conversion of cys 17 to neutral amino acids such as glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine is the preferred approach.
  • Serine and threonine are the most preferred replacements because of their chemical analogy to cysteine.
  • the cysteine is deleted, the mature mutein is one amino acid shorter than the native parent protein or the microbially produced IFN- ⁇ .
  • Human IL-2 is reported to have three cysteine residues located at positions 58, 105, and 125 of the protein.
  • IL-2 is in an aggregated oligomeric form when isolated from bacterial cells and has to be reduced with reducing agents in order to obtain a good yield from bacterial extracts.
  • the purified reduced IL-2 protein is unstable and readily reoxidized upon storage to an oligomeric inactive form.
  • the presence of three cysteines means that upon reoxidation, the protein may randomly form one of three possible intramolecular disulfide bridges, with only one of those being the correct bridge as found in the native molecule.
  • the disulfide structure of the native IL-2 protein is not known, it is possible to use the present invention to create mutations at codons 58, 105 and 125 of the IL-2 gene and identify which cysteine residues are necessary for activity and therefore most likely to be involved in native disulfide bridge formation.
  • the cysteine residue that is not necessary for activity can be modified so as to prevent the formation of incorrect intramolecular disulfide bridges and minimize the chance of intermolecular disulfide bridges by .[.removal or.]. replacement of the free cysteine residue.
  • the size of the oligonucleotide primer is determined by the requirement for stable hybridization of the primer to the region of the gene in which the mutation is to be induced, and by the limitations of the currently available methods for synthesizing oligonucleotides.
  • the factors to be considered in designing oligonucleotides for use in oligonucleotide-directed mutagenesis are described by Smith, M. and Gillam S., supra.
  • the overall length of the oligonucleotide will be such as to optimize stable, unique hybridization at the mutation site with the 5' and 3' extensions from the mutation site being of sufficient size to avoid editing of the mutation by the exonuclease activity of the DNA polymerase.
  • Oligonucleotides used for mutagenesis in accordance with the present invention usually contain from about 12 to about 24 bases, preferably from about 14 to about 20 bases and still more preferably from about 15 to about 18 bases. They will usually contain at least about three bases 3' of the altered or missing codon.
  • the method for preparing the modified IFN- ⁇ gene broadly involves inducing a site-specific mutagenesis in the IFN- ⁇ gene at codon 17 (TGT) using a synthetic nucleotide primer which omits the codon or alters it so that it codes for another amino acid.
  • TGT codon 17
  • the preferred nucleotide primer is GCAATTTTCAGACTCAG (underlining denotes the altered codon).
  • the preferred primer is AGCAATTTTCAGCAGAAGCTCCTG, which omits the TGT codon for cys.
  • a 17-nucleotide primer GCAATTTTCAGAGTCAG, which includes an AGT codon for serine is the primer of choice.
  • the T ⁇ A transition of the first base in the cys 17 codon results in changing cysteine to serine. It must be recognized that when deletions are introduced, the proper reading frame for the DNA sequence must be maintained for expression of the desired protein.
  • the primer is hybridized to single-stranded phage such as M13, fd, or ⁇ X174 into which a strand of the IFN- ⁇ gene has been cloned. It will be appreciated that the phase may carry either the sense strand or antisense strand of the gene. When the phage carries the antisense strand the primer is identical to the region of the sense strand that contains the codon to be mutated except for a mismatch with that codon that defines a deletion of the codon or a triplet that codes for another amino acid.
  • the primer When the phage carries the sense strand the primer is complementary to the region of the sense strand that contains the codon to be mutated except for an appropriate mismatch in the triplet that is paired with the codon to be deleted. Conditions that may be used in the hybridization are described by Smith, M. and Gillam, S., supra. The temperature will usually range between about 0° C. and 70° C., more usually about 10° C. to 50° C.
  • the primer is extended on the phage DNA by reaction with DNA polymerase I, T 4 DNA polymerase, reverse transcriptase or other suitable DNA polymerase.
  • the resulting dsDNA is converted to closed circular dsDNA by treatment with a DNA ligase such as T 4 DNA ligase. DNA molecules containing single-stranded regions may be destroyed by S1 endonuclease treatment.
  • Oligonucleotide-directed mutagenesis may be similarly employed to make a mutant IL-2 gene that encodes a mutein having IL-2 activity but having cys 125 changed to serine 125.
  • the preferred oligonucleotide primer used in making this mutant IL-2 gene when the phage carries the sense strand of the gene is GATGATGCTTCTGAGAAAAGGTAATC. This oligonucleotide has a C ⁇ G change at the middle base on the triplet that is paired with codon 125 of the IL-2 gene.
  • the resulting mutational heteroduplex is then used to transform a competent host organism or cell.
  • Replication of the heteroduplex by the host provides progeny from both strands.
  • the mutant gene may be isolated from progeny of the mutant strand, inserted into an appropriate expression vector, and the vector used to transform a suitable host organism or cell.
  • Preferred vectors are plasmids pBR322, pCR1, and variants thereof, synthetic vectors and the like.
  • Suitable host organisms are E.coli, Pseudomonas, Bacillus subtilis, Bacillus thuringiensis, various strains of yeast, Bacillus thermophilus, animal cells such as mice, rat or Chinese hamster ovary (CHO) cells, plant cells, animal and plant hosts and the like.
  • Hosts may be prokaryotic or eukaryotic (processes for inserting DNA into eukaryotic cells are described in PCT application Nos. US81/00239 and US81/00240 published Sept. 3, 1981). E.coli and CHO cells are the preferred hosts.
  • the muteins obtained in accordance with the present invention may be glycosylated or unglycosylated depending on the glycosylation occurring in the native parent protein and the host organism used to produce the mutein. If desired, unglycosylated mutein obtained when E.coli or a Bacillus is the host organism, may be optionally glycosylated in vitro by chemical, enzymatic and other types of modifications known in the art.
  • the cysteine residue at position 17 in the amino acid sequence of IFN- ⁇ is changed to serine by a T ⁇ A transition of the first base of codon 17 of the sense strand of the DNA sequence which codes for the mature IFN- ⁇ .
  • the site-specific mutagenesis is induced using a synthetic 17-nucleotide primer GCAATTTTCAGAGTCAG which is identical to a seventeen nucleotide sequence on the sense strand of IFN- ⁇ in the region of codon 17 except for a single base mismatch at the first base of codon 17.
  • the mismatch is at nucleotide 12 in the primer.
  • the genetic code is degenerate and that many of the amino acids may be encoded by more than one codon.
  • the base code for serine for example, is six-way degenerate such that the codons, TCT, TCG, TCC, TCA, AGT, and ACG all code for serine.
  • the AGT codon was chosen for the preferred embodiment for convenience.
  • threonine is encoded by any one of condon ACT, ACA, ACC and ACG. It is intended that when one codon is specified for a particular amino acid, it includes all degenerate codons which encode that amino acid.
  • the 17-mer is hybridized to single-stranded M13 phage DNA which carries the antisense strand of the IFN- ⁇ gene.
  • the oligonucleotide primer is then extended on the DNA using DNA polymerase I Klenow fragment and the resulting dsDNA is converted to closed circular DNA with T 4 ligase. Replication of the resulting mutational heteroduplex yields clones from the DNA strand containing the mismatch. Mutant clones may be identified and screened by the appearance or disappearance of specific restriction sites, antibiotic resistance or sensitivity, or by other methods known in the art. When cysteine is substituted with serine, the T ⁇ A transition, shown in FIG. 2, results in the creation of a new HinfI restriction site in the structural gene. The mutant clone is identified by using the oligonucleotide primer as a probe in a hybridization screening of the mutation phage plaques.
  • the primer will have a single mismatch when hybridized to the parent but will have a perfect match when hybridized to the mutated phage DNA, as indicated in FIG. 2. Hybridization conditions can then be devised where the oligonucleotide primer will preferentially hybridize to the mutation DNA but not to the parent DNA.
  • the newly generated HinfI site also serves as a means of confirming the single base mutation in the IFN- ⁇ gene.
  • the M13 phage DNA carrying the mutated gene is isolated and spliced into an appropriate expression vector, such as plasmid pTrp3, and E.coli strain MM294 is transformed with the vector. Suitable growth media for culturing the transformants and their progeny are known to those skilled in the art.
  • the expressed mutein of IFN- ⁇ is isolated, purified and characterized.
  • Examples 1-11 describe the preparation of a mutein of IFN- ⁇ .
  • Examples 12-20 describe the preparation of a mutein of IL-2.
  • M13 phage vector as a source of single-stranded DNA template has been demonstrated by G. F. Temple et al, Nature (1982) 296:537-540.
  • Plasmid p ⁇ 1trp (FIG. 3) containing the IFN- ⁇ gene under control of E.coli trp promoter, was digested with the restriction enzymes HindIII and XhoII.
  • the M13mp8 J. Messing, "Third Cleveland Symposium on Macromolecules: Recombinant DNA,” Ed. A. Walton, Elsevier Press, 143-153 (1983)
  • replicative form (RF) DNA FIG.
  • T 4 kinase Forty picomoles of the synthetic oligonucleotide GCAATTTTCAGAGTCAG (primer) was treated with T 4 kinase in the presence of 0.1 mM adenosine triphosphate (ATP), 50 mM hydroxymethylaminomethane hydrochloride (Tris-HCl) pH 8.0, 10 mM MgCl 2 , 5 mM dithiothreitol (DTT) and 9 units of T 4 kinase, in 50 ⁇ l at 37° C. for 1 hr.
  • ATP adenosine triphosphate
  • Tris-HCl hydroxymethylaminomethane hydrochloride
  • DTT dithiothreitol
  • the kinased primer (12 pmole) was hybridized to 5 ⁇ g of ss M13- ⁇ 1 DNA in 50 ⁇ l of a mixture containing 50 mM NaCl, 10 mM Tris-HCl, pH 8.0, 10 mM MgCl 2 and 10 mM ⁇ -mercaptoethanol, by heating at 67° C. for 5 min and at 42° C. for 25 min.
  • the annealed mixture was then chilled on ice and then added to 50 ⁇ l of a reaction mixture containing 0.5 mM each of deoxynucleoside triphosphate (dNTP), 80 mM Tris-HCl, pH 7.4, 8 mM MgCl 2 , 100 mM NaCl, 9 units of DNA polymerase I, Klenow fragment, 0.5 mM ATP and 2 units of T 4 DNA ligase, incubated at 37° C. for 3 hr and at 25° C. for 2 hr. The reaction was then terminated by phenol extraction and ethanol precipitation.
  • dNTP deoxynucleoside triphosphate
  • the DNA was dissolved in 10 mM Tris-HCl pH 8.0, 10 mM ethylenediaminetetraacetic acid (EDTA), 50% sucrose and 0.05% bromophenylblue and electrophoresed on 0.8% agarose gel in the presence of 2 ⁇ g/ml of ethidium bromide.
  • the DNA bands corresponding to the RF forms of M13- ⁇ 1 were eluted from gel slices by the perchlorate method (R. W. Davis, et al, "Advanced Bacterial Genetics", Cold Spring Harbor Laboratory, N.Y., p. 178-179 (1980)).
  • the eluted DNA was used to transform competent JM 103 cells, grown overnight and ssDNA isolated from the culture supernatant. This ssDNA was used as a template in a second cycle of primer extension, the gel purified RF forms of the DNA were transformed into competent JM 103 cells, plated onto agar plates and incubated overnight to obtain phage plaques.
  • Example 2 The experiment of Example 2 above is repeated except that the synthetic oligonucleotide primer used is GCAATTTTCAGACTCAG to change codon 17 of the IFN- ⁇ gene from one that codes for cysteine to one that codes for threonine.
  • the synthetic oligonucleotide primer used is GCAATTTTCAGACTCAG to change codon 17 of the IFN- ⁇ gene from one that codes for cysteine to one that codes for threonine.
  • Example 2 The experiment of Example 2 above is repeated except that the synthetic oligonucleotide primer used is AGCAATTTTCAGCAGAAGCTCCTG to delete codon 17 of the IFN- ⁇ gene.
  • the filters were then placed on thick filter papers soaked in 0.2N NaOH, 1.5M NaCl and 0.2% Triton X-100 for 5 min, and neutralized by layering onto filter papers soaked with 0.5M Tris-HCl, pH 7.5 and 1.5M NaCl for another 5 min.
  • the filters were washed in a similar fashion twice on filters soaked in 2 ⁇ SSC (standard saline citrate), dried and then baked in a vacuum oven at 80° C. for 2 hr.
  • 5 ⁇ SSC DNA hybridization buffer
  • SDS sodium dodecyl sulfate
  • 50 mM sodium phosphate buffer pH 7.0 and 100
  • 32 P-labeled probe was prepared by kinasing the oligonucleotide primer with 32 P-labeled ATP.
  • the filters were hybridized to 3.5 ⁇ 10 5 cpm/ml of 32 P-labeled primer in 5 ml per filter of DNA hybridization buffer at 55° C. for 24 hr.
  • the filters were washed at 55° C. for 30 min each in washing buffers containing 0.1% SDS and decreasing amounts of SSC.
  • the filters were washed initially with buffer containing 2 ⁇ SSC and the control filters containing unmutated M13- ⁇ 1 plaques were checked for the presence of any radioactivity using a Geiger counter.
  • the concentration of SSC was lowered stepwise and the filters washed until no detectable radioactivity remained on the control filters with the unmutated M13- ⁇ 1 plaques.
  • the lowest concentration of SSC used was 0.1 ⁇ SSC.
  • the filters were air dried and autoradiographed at -70° C. for 2-3 days. 480 plaques of mutated M13- ⁇ 1 and 100 unmutated control plaques were screened with the kinased oligonucleotide probe. None of the control plaques hybridized with the probe while 5 mutated M13- ⁇ 1 plaques hybridized with the probe.
  • M13-SY2501 One of the five mutated M13- ⁇ 1 plaques (M13-SY2501) was picked and inoculated into a culture of JM 103.
  • ssDNA was prepared from the supernatant and double-stranded (ds) DNA was prepared from the cell pellet.
  • the ssDNA was used as a template for the dideoxy-sequencing of the clone using the M13 universal primer.
  • the result of the sequence analysis is shown in FIG. 6, confirming that the TGT cys codon has been converted to an AGT ser codon.
  • RF DNA from M13-SY2501 was digested with restriction enzymes HindIII and XhoII and the 520 bp insert fragment purified on a 1% agarose gel.
  • the plasmid pTrp3 containing the E.coli trp promoter (FIG. 7) was digested with the enzymes HindIII and BamHI, mixed with the purified M13-SY2501 DNA fragment, and ligated in the presence of T 4 DNA ligase.
  • the ligated DNA was transformed into E.coli strain MM294. Ampicillin resistant transformants were screened for sensitivity to the drug tetracycline. Plasmid DNA from five ampicillin resistant, .[.tetracylcine.].
  • FIG. 8a shows the HinfI restriction pattern of one of the clones (pSY2501), comparing it with the HinfI pattern of the original IFN- ⁇ clone, p ⁇ 1 trp. As expected, there is an additional HinfI site in pSY2501, cleaving the 197 bp IFN- ⁇ internal fragment to a 169 bp fragment and a 28 bp fragment (FIG. 8b).
  • FIG. 9 The complete DNA sequence of the mutant IFN- ⁇ gene is shown in FIG. 10 together with the predicted amino acid sequence.
  • the plasmid designated as clone pSY2501 was deposited with the Agricultural Research Culture Collection (NRRL), Fermentation Laboratory, Northern Regional Research Center, Science and Education Administration, U.S. Department of Agriculture, 1815 North University St., Peoria, Ill. 60604 on Mar. 30, 1983 and was assigned accession numbers CMCC No. 1533 and NRRL No. B-15356.
  • NRRL Agricultural Research Culture Collection
  • the plasmid pSY2501 was transformed into a competent subvariant of E.coli strain MM294, designated MM294-1. A sample of the resulting transformant was deposited in the American Type Culture Collection 12301 Parklawn Dr., Rockville, Md. 20852 USA on Nov. 18, 1983 under ATCC No. 39,517.
  • IFN- ⁇ ser17 was recovered from E.coli that had been transformed to produce IFN- ⁇ ser17 .
  • the E.coli were grown in the following growth medium to an OD of 10-11 at 680 nm (dry wt 8.4 g/l).
  • a 9.9 l (9.9 kg) harvest of the transformed E.coli was cooled to 20° C. and concentrated by passing the harvest through a cross-flow filter at an average pressure drop of ⁇ 110 kpa and steady-state filtrate flow rate of 260 ml/min until the filtrate weight was 8.8 kg.
  • the concentrate (approximately one liter) was drained into a vessel and cooled to 15° C. The cells in the concentrate were then disrupted by passing the concentrate through a Manton-Gaulin homogenizer at 5° C., ⁇ 69,000 kpa.
  • the homogenizer was washed with one liter phosphate buffered saline, pH 7.4 (PBS), and the wash was added to the disruptate to give a final volume of two liters. This volume was continuously centrifuged at 12000 ⁇ g at a 50 ml/min flow rate. The solid was separated from the supernatant and resuspended in four liters PBS containing 2% by wt SDS. This suspension was stirred at room temperature for 15 min after which there was no visible suspended material The solution was then extracted with 2-butanol at a 1:1 2-butanol:solution volume ratio. The extraction was carried out in a liquid-liquid phase separator using a flow rate of 200 ml/min. The organic phase was then separated and evaporated to dryness to yield 21.3 g of protein. This was resuspended in distilled water at a 1:10 volume ratio.
  • the recovered product was assayed for human IFN- ⁇ activity using an assay based on protection against viral cytopathic effect (CPE).
  • CPE viral cytopathic effect
  • the assay was made in microtiter plates. Fifty ⁇ l minimum essential medium were charged into each well and 25 ⁇ l of the sample was placed in the first well and 1:3 volume dilutions were made serially into the following wells. Virus (vesicular stomatitus), cell (human fibroblast line GM-2767), and reference IFN- ⁇ controls were included on each plate. The reference IFN- ⁇ used was 100 units per ml. The plates were then irradiated with UV light for 10 min.
  • Example 8 The process of Example 8 was repeated except that after extraction and separation of the aqueous and organic phases and mixing of the organic phase with PBS at a volume ratio of 3:1 the pH of the mixture was lowered to about 5 by addition of glacial acetic acid. The resulting precipitate was separated by centrifugation at 10000-17000 ⁇ g for 15 min and the pellet was redissolved in 10% w/v SDS, 10 mM DTT, 50 mM sodium acetate buffer, pH 5.5, and heated to 80° C. for 5 min.
  • Amino acid compositions were determined after 24-72 hr timed hydrolysis of 40 ⁇ g samples of IFN in 200 ⁇ l of 5.7N HCl, 0.1% phenol, at 108° C. Proline and cysteine were determined in the same fashion after performic acid oxidation; in this case, phenol was omitted from the hydrolysis. Tryptophan was analyzed after 24 hr hydrolysis of 400 ⁇ l samples in 5.7N HCl, 10% mercaptoacetic acid (no phenol). Analysis was performed on a Beckman 121MB amino acid analyzer using a single column of AA10 resin.
  • the amino acid composition calculated from representative 24-, 48-, 72-hr acid hydrolyses of purified IFN- ⁇ Ser 17 agrees well with that predicted by the DNA sequence of the cloned IFN gene, minus the missing N-terminal methionine.
  • the amino acid sequence of the first 58 residues from the amino acid terminus of purified IFN was determined on a 0.7 mg sample in a Beckman 890C sequanator with 0.1M Quadrol buffer.
  • PTH amino acids were determined by reverse-phase HPLC on an Altex ultrasphere ODS column (4.6 ⁇ 250 mm) at 45° C. eluted at 1.3 min at 40% buffer B, and 8.4 min from 40-70% buffer B, where buffer A was 0.0115M sodium acetate, 5% tetrahydrofuran (THF), pH 5.11 and buffer B was 10% THF in acetonitrile.
  • the N-terminal amino acid sequence of IFN- ⁇ Ser 17 determined matches the expected sequence predicted from the DNA sequence, except for the absence of N-terminal methionine.
  • E. coli transformed with pSY2501 were grown in the following medium:
  • the harvested material was concentrated approximately 3-fold by circulating it through a microporous cross-flow filter under pressure.
  • the concentrated cells were diafiltered against deionized water until the harvest material was concentrated 4-5 fold.
  • the cells were then disrupted by passing them through a Manton-Gaulion homogenizer at ⁇ 4.1-5.5 ⁇ 10 4 kpa.
  • SDS-sodium phosphate buffer was added to a final concentration of 2% SDS, 0.08M sodium phosphate and homogenization was continued for one hr.
  • Solid DTT was then added to a final concentration of 50 mM and the homogenizate was heated to 90° ⁇ 5° C. for 10 min.
  • the resulting cell suspension was extracted with 2-butanol at a 1:1 2-butanol:suspension volume ratio in a static mixer. The mixture was then centrifuged and the 2-butanol rich phase was collected.
  • the 2-butanol rich phase was mixed with 2.5 volumes of 0.1% SDS in PBS.
  • Solid DTT was added to a final concentration of 2 mM.
  • the pH of the mixture was adjusted to 6.2 ⁇ 0.1 with glacial acetic acid and this mixture was centrifuged.
  • the resulting paste was collected and resuspended in PBS+10% SDS with pH adjustment to 8.5 ⁇ 0.1 using 1N NaOH.
  • Solid DTT was added to a final concentration of 100 mM and the suspension was heated to 90° ⁇ 5° C. for 10 min. The suspension was then cooled to ⁇ 25° C., the pH was adjusted to 5.5 ⁇ 0.1 with glacial acetic acid, and the solution was filtered.
  • the solution was then applied to a Sephacryl S-200 pre column and the fractions containing highest interferon activities were pooled and concentrated by ultrafiltration with a 10 Kdal molecular weight cutoff.
  • the concentrate was oxidized by adding equimolar amounts of protein and iodosobenzoic acid into a reaction vessel containing 2 mM sodium pyrophosphate, 0.1% SDS and 1 mM EDTA. The pH was controlled during oxidation at 9.0 ⁇ 0.1 with 0.5N NaoH and adjusted to 5.5 ⁇ 0.2 when oxidation was complete. After oxidation the concentrate was again passed through the ultrafiltration unit with a 10 Kdal molecular weight cutoff.
  • the concentrate was applied to a main Sephacryl S-200 column and the fractions were analyzed by SDS-PAGE to determine those containing no high molecular weight contaminants. Those fractions were pooled and passed through the ultrafiltration unit. The filtered concentrate was then fractionated on a Sephadex G-75 column. SDS-PAGE analysis of the fractions was made to determine those containing no low or high molecular weight contaminants. Those fractions were pooled for desalting.
  • IFN- ⁇ ser17 was compared antigenically to IFN- ⁇ produced from diploid fibroblasts using virus neutralizing tests.
  • a polyvalent antiserum to the diploid fibroblast IFN- ⁇ was prepared in rabbits. This antiserum blocked the antiviral activity of both the diploid fibroblast IFN- ⁇ and the IFN- ⁇ ser17 in the virus neutralization tests, indicating the two proteins are indistinguishable antigenically.
  • the purified IFN- ⁇ ser17 was compared in its antiviral activity to naturally produced IFN- ⁇ . Inhibition of vesicular stomatitis virus replication in diploid foreskin fibroblast (HS27F) was indistinguishable from that of the natural molecule. Similarly, inhibition of herpes simplex virus type 1 in HS27F fibroblasts by the natural and mutant proteins were comparable.
  • IFN- ⁇ ser17 for continuous cell lines was compared with that of naturally produced IFN- ⁇ .
  • T24 cells derived from a transitional cell carcinoma were treated with 200 units/ml of the proteins. Cell growth was inhibited significantly (p ⁇ 0.02) by both proteins.
  • IFN- ⁇ ser17 The ability of IFN- ⁇ ser17 to stimulate NK cell (spontaneous cell mediated cytotoxicity) activity was tested.
  • NK cell cytoxicity was determined by measuring the amount of label released into the medium. The results of these tests are reported in Table I below.
  • the target cells were killed more effectively by the IFN- ⁇ ser17 -treated cells than by the unteated cells.
  • Phase I clinical trials to verify the safety of IFN- ⁇ ser17 in humans have been initiated. These trails involve administering the protein to patients intramuscularly and intravenously at doses ranging between 1 ⁇ 10 5 units (1 ⁇ g of protein) to 400 ⁇ 10 6 units. In initial phase I clinical trials no unexpected adverse effects have occurred.
  • IFN- ⁇ ser17 preparation exhibits specific activity levels very close to or better than that of native IFN- ⁇ .
  • IFN- ⁇ ser17 has no free sulfhydryl groups but indicates one --S--S-- bond between the only remaining cysteines at positions 31 and 141.
  • the protein does not readily form oligomers and appears to be substantially in the monomeric form.
  • the IFN- ⁇ ser17 obtained in accordance with this invention may be formulated either as a single product or mixtures of the various forms, into pharmaceutically acceptable preparations in inert, nontoxic, nonallergenic, physiologically compatible carrier media for clinical and therapeutic uses in cancer therapy or in conditions where interferon therapy is indicated and for viral infections such as herpes simplex virus I and II, hepatitis B virus, common cold viruses, and rhinovirus.
  • inert, nontoxic, nonallergenic, physiologically compatible carrier media for clinical and therapeutic uses in cancer therapy or in conditions where interferon therapy is indicated and for viral infections such as herpes simplex virus I and II, hepatitis B virus, common cold viruses, and rhinovirus.
  • Such media include but are not limited to distilled water, physiological saline, Ringer's solution, Hank's solution and the like.
  • Other nontoxic stabilizing and solubilizing additives such as dextrose, HSA (human serum albumin) and the like may be optimally included.
  • the therapeutic formulations may be administered orally or parenterally such as intravenous, intramuscular, intraperitoneal and subcutaneous administrations. Preparations of the modified IFN- ⁇ of the present invention may also be used for topical applications in appropriate media normally utilized for such purposes.
  • the IFN- ⁇ mutein may be administered either locally or systemically by itself or in combination or conjunction with other therapeutic agents such as acyclovir for prophylactic or therapeutic purposes.
  • the dose of mutein administered to human patients will depend on whether it is administered continuously (including intermittant) or as a bolus.
  • the amounts administered continuously will typically be lowered than the amounts administered as a bolus. The amount will usually be in the range of about 1 ⁇ 10 5 to 4 ⁇ 10 8 units, more usually about 1 ⁇ 10 6 to 1 ⁇ 10 7 units.
  • the principal advantages of the above described mutein of IFN- ⁇ lie in the elimination of a free sulfhydryl group at position 17 in IFN- ⁇ , thereby forcing the protein to form correct disulfide links between cys 31 and cys 141 and to assume the conformation ostensibly required for full biological activity.
  • the increased specific activity of the IFN- ⁇ ser17 enables the use of smaller dosages in therapeutic uses.
  • the IFN- ⁇ ser17 protein does not form dimers and oligomers so readily as the microbially produced IFN- ⁇ . This facilitates purification of the protein and enhances its stability.
  • cDNA libraries enriched in potential IL-2 cDNA clones were made from an IL-2 enriched mRNA .[.fractions.]. .Iadd.fraction .Iaddend.obtained from induced peripheral blood lymphocytes (PBL) and Jurkat cells by conventional procedures.
  • the enrichment of the mRNA for IL-2 message was made by fractionating the mRNA and identifying the fraction having IL-2 mRNA activity by injecting the fractions in Xenopus laevis oocytes and assaying the oocyte lysates for IL-2 activity on HT-2 cells (J. Watson, J Exp Med (1979) 150:1570-1519 and S. Gillis et al, J Immun (1978) 120:2027-2032.)
  • the IL-2 cDNA libraries were screened using the colony hybridization procedure. Each microtiter plate was replicated onto duplicate nitrocellulose filter papers (S & S type BA-85) and colonies were allowed to grow at 37° C. for 14-16 hr on L agar containing 50 ⁇ g/ml ampicillin. The colonies were lysed and DNA fixed to the filter by sequential treatment for 5 min with 500 mM NaOH, 1.5M NaCl, washed twice for 5 min each time with 5 ⁇ standard saline citrate (SSC). Filters were air dried and baked at 80° C. for 2 hr. The duplicate filters were pre-hybridized at 42° C.
  • SSC standard saline citrate
  • a 32 P-labeled 20-mer oligonucleotide probe was prepared based on the IL-2 gene sequence reported by Taniguchi, T., et al, supra.
  • the nucleotide sequence of the probe was GTGGCCTTCTTGGGCATGTA.
  • the samples were hybridized at 42° C. for 24-36 hr with 5 ml/filter of DNA hybridization buffer containing the 32 P oligonucleotide probe.
  • the filters were washed two times for 30 min each time at 50° C. with 2 ⁇ SSC, 0.1% SDS, then washed twice with 1 ⁇ SSC and 0.1% SDS at 50° C. for 90 min, air dried, and autoradiographed at -70° C. for 2 to 3 days. Positive clones were identified and rescreened with the probe. Full length clones were identified and confirmed by restriction enzyme mapping and comparison with the sequence of the IL-2 cDNA clone reported by Taniguchi, T., et al, supra.
  • the IL-2 gene was cloned into M13mp9 as described in Example 1 using the plasmid pLW1 (FIG. 12) containing the IL-2 gene under the control of the E. coli trp promoter.
  • a sample of pLW1 was deposited in the American Type Culture Collection, 12301 Parklawn Dr., Rockville, Md. 20852, USA, on Aug. 4, 1983 and has been assigned ATCC number 39,405.
  • the restriction map of one clone (designated M13-IL2) containing the IL-2 insert is shown in FIG. 13.
  • Single-stranded phage DNA was prepared from clone M13-IL2 to serve as a template for oligonucleotide-directed mutagenesis.
  • IL-2 contains cysteine residues at amino acid positions 58, 105 and 125. Based on the nucleotide sequences of the portions of the IL-2 gene that contain the codons for these three cysteine residues three oligonucleotide primers were designed and synthesized for mutating the codons for these residues to codons for serine. These oligonucleotides have the following sequences.
  • CTTCTAGAGACTGCAGATGTTTC (DM27) to change cys 58
  • GATGATGCTCTGAGAAAAGGTAATC (DM29) to change cys 125.
  • each oligonucleotide Forty picomoles of each oligonucleotide were kinased separately in the presence of 0.1 mM ATP, 50 mM Tris-HCl, pH 8.0, 10 mM MgCl 2 , 5 mM DTT and 9 units of T 4 kinase in 50 ⁇ l at 37° C. for 1 hr.
  • Each of the kinased primers (10 pmoles) was hybridized to 2.6 ⁇ g of ss M13-IL2 DNA in 15 ⁇ l of a mixture containing 100 mM NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM MgCl 2 and 20 mM ⁇ -mercaptoethanol, by heating at 67° C.
  • the filters were then placed on thick filter papers soaked in 0.2N NaOH, 1.5M NaCl and 0.2% Triton for 5 min, and neutralized by layering onto filter papers soaked with 0.5M Tris-HCl, pH 7.5, and 1.5M NaCl for another 5 min.
  • the filters were washed in a similar fashion twice on filters soaked in 2 ⁇ SSC, dried and then baked in a vacuum oven at 80° C. for 2 hr.
  • 32 P-labelled probes were prepared by kinasing the oligonucleotide primers with labelled ATP.
  • the filters were hybridized to 0.1 ⁇ 10 5 cpm/ml of 32 P-labelled primers in 5 ml per filter of DNA hybridization buffer at 42° C. for 8 hr.
  • the filters were washed twice at 50° C. for 30 min each in washing buffers containing 0.1% SDS and 2 ⁇ SSC, and twice at 50° C. for 30 min each with 0.1% SDS and 0.2 ⁇ SSC.
  • the filters were air dried and autoradiographed at -70° C. for 2-3 days.
  • oligonucleotide primers DM28 and DM29 were designed to create a new DdeI restriction site in the mutagenized clones (FIG. 14), RF-DNA from a number of the clones which hybridized with each of these kinased primers were digested with the restriction enzyme DdeI.
  • One of the mutagenized M13-IL2 placques which hybridized with the primer DM28 and has a new DdeI restriction site (M13-LW44) was picked and inoculated into a culture of JM103, ssDNA was prepared from the culture supernatant and dsRF-DNA was prepared from the cell pellet.
  • a plaque which hybridized with primer DM29 was picked (M13-LW46) and ssDNA and RF-DNA prepared from it.
  • the oligonucleotide primer DM27 was designed to create a new PstI restriction site instead of a DdeI site. Therefore, the plaques that hybridized to this primer were screened for the presence of a new PstI site.
  • One such phage plaque was identified (M13-LW42) and ssDNA and RF-DNA prepared from it. The DNA from all three of these clones were sequenced to confirm that the target TGT codons for cysteine had been converted to a TCT codon for serine.
  • RF-DNA from M13-LW42, M13-LW44 and M13-LW46 were each digested with restriction enzymes HindIII and BanII and the insert fragments purified from a 1% agarose gel.
  • the plasmid pTrp3 (FIG. 7) was digested with HindIII and BanII, the large plasmid fragment containing the trp promoter was purified on an agarose gel and then ligated with each of the insert fragments isolated from M13-LW42, M13-LW44 and M13-LW46.
  • the ligated plasmids were transformed into competent E. coli K12 strain MM294.
  • FIG. 14 is a restriction map of pLW46.
  • pLW42, pLW44 and pLW46 were shown to synthesize a 14.5 kd protein similar to that found in the positive control, pLW21, which has been demonstrated to synthesize a 14.4 kd IL-2 protein.
  • FIG. 15a shows the nucleotide sequence of the coding strand of clone pLW46. As compared to the coding strand of the native human IL-2 gene clone pLW46 has a single base change of G ⁇ C at nucleotide 374.
  • FIG. 15b shows the corresponding amino acid sequence of the IL-2 mutein encoded by pLW46. This mutein is designated des-alanyl(ala) IL-2 ser125 As compared to native IL-2 the mutein has a serine instead of a cysteine at position 125, has an initial N-terminal methionine (which is processed off), and lacks the initial N-terminal alanine of the native molecule.
  • Examples 18 and 19 describe the preparation of an alternative and preferred vector for expressing alanyl(ala) IL-2 ser125 .
  • a codon (GCG) for alanine was inserted immediately after the initiation codon of the IL-2 gene of pLW1 by oligonucleotide-directed mutagenesis as follows.
  • the oligonucleotide primer, 5'-GAAGTAGGCGCCATAAG-3' was kinased, hybridized to ssM13-IL2 DNA, and extended using the general procedure of Example 15 to form a mutational heteroduplex.
  • the mutagenesis generated a new NarI restriction site in the gene.
  • the heteroduplex was converted to closed circular heteroduplex and the circular heteroduplexes were used to transform competent JM103 cells and plated onto agar plates and incubated as in Example 15.
  • FIG. 16 is a diagram of plasmid pLW32.
  • RF-DNA from M13-LW46 (Examples 16 and 17) was digested with XbaI and PstI and the 530 bp fragment containing the carboxy terminal coding region of the IL-2 ser125 gene was purified from an agarose gel.
  • pLW32 was digested with XbaI and PstI and the large fragment consisting of the plasmid vector and the ala-IL-2 N-terminal coding sequence was purified.
  • the two purified DNA fragments were pooled and ligated using T 4 DNA ligase.
  • the ligated DNA was transformed into competent E. coli K-12 strain MM294.
  • FIG. 17 is a diagram of pLW55.
  • Cell free extracts of bacterial culture containing pLW55 were found to contain over 10 5 units of IL-2 activity per ml by the HT-2 cell assay, J. Watson, supra, and S. Gillis, supra.
  • Ala-IL-2 ser125 protein is identified to the IL-2 ser125 molecule shown in FIG. 15(b) except that the former includes the initial N-terminal alanine of the native molecule.
  • E. coli transformed with pLW55 were grown in a fermenter containing the following medium:
  • the pH of the fermenter was maintained at 6.8 with 5N KOH. Residual glucose was maintained between 5-10 g/l, dissolved oxygen at 40%, and temperature at 37° ⁇ 1° C.
  • the casamino acids (20% stock solution) to a concentration of 2% were added when the OD 680 was about 10. Harvest was made three hr after the OD reached about 20.
  • the harvested material was concentrated and homogenized as in Example 11. Following DTT-heat treatment, the material was centrifuged and the resulting paste was extracted with urea to a final concentration of 4M. The suspension was centrifuged and SDS was added to the solid phase to a concentration of 5%.
  • the solution was applied to a Sephacryl S-200 column and fractions containing IL-2 (by SDS-PAGE) were pooled.
  • the pooled fractions were applied to a Whatman M-40 column packed with 18 micron Vydac C 4 300 ⁇ pore size bonded phase silica gel equilibrated in 0.1% TFA.
  • the IL-2 mutein was eluted with a gradient of 40% to 60% 2-propanol, containing 0.1% TFA, in 160 min. Fractions containing highest IL-2 activities were pooled and found to have specific activities comparable to native IL-2.
  • IL-2 muteins are useful for the diagnosis and treatment (local or systemic) of bacterial, viral, parasitic, protozoan and fungal infections; for augmenting cell-mediated cytotoxicity; for stimulating lymphokine activated killer cell activity; for mediating recovery of immune function of lymphocytes; for augmenting alloantigen responsiveness; for facilitating recovery of immune function in acquired immune deficient states; for reconsitution of normal immunofunction in aged humans and animals; in the development of diagnostic assays such as those employing enzyme amplification, radiolabelling, radioimaging, and other methods known in the art for monitoring IL-2 levels in the diseased state; for the promotion of T cell growth in vitro for therapeutic and diagnostic purposes for blocking receptor sites for lymphokines; and in various other therapeutic, diagnostic and research applications.
  • IL-2 muteins may be used by themselves or in combination with other immunologically relevent B or T cells or other therapeutic agents.
  • relevant cells are B or T cells, natural killer cells, and the like and exemplary therapeutic reagents which may be used in combination with the polypeptides of this invention are the various interferons, especially gamma interferon, B cell growth factor, IL-1 and the like.
  • IL-2 muteins may be formulated in nontoxic, nonallergenic, physiologically compatible carrier media such as distilled water, Ringer's solution, Hank's solution, physiological saline and the like.
  • Administrations of the IL-2 muteins to humans or animals may be oral or intraperitoneal or intramuscular or subcutaneous as deemed appropriate by the physician.
  • the amount of IL-2 mutein administered will usually range between about 1 ⁇ 10 4 and 2 ⁇ 10 8 units.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Muteins of biologically active proteins such as IFN-β and IL-2 in which cysteine residues that are not essential to biological activity have been deleted or replaced with other amino acids to eliminate sites for intermolecular crosslinking or incorrect intramolecular disulfide bridge formation. These muteins are made via bacterial expression of mutant genes that encode the muteins that have been synthesized from the genes for the parent proteins by oligonucleotide-directed mutagenesis.

Description

CROSS-REFERENCE TO RELATED APPLICATION
This application is a continuation-in-part of U.S. Ser. No. 486,162 filed Apr. 15, 1983, now abandoned which is a continuation-in-part of U.S. Ser. No. 435,154 filed Oct. 19, 1982.Iadd., now abandoned.Iaddend..
DESCRIPTION
1. Technical Field
This invention is in the general area of recombinant DNA technology. More specifically it relates to mutationally altered biologically active proteins that differ from their parent analogs by one or more substituents/deletions of cysteine residues.
2. Background Art
Biologically active proteins that are microbially produced via recombinant DNA (rDNA) technology may contain cysteine residues that are nonessential to their activity but are free to form undesirable intermolecular or intramolecular links. One such protein is microbially produced human beta interferon (IFN-β). In the course of the preparation of IFN-β by rDNA techniques, it has been observed that dimers and oligomers of microbially produced IFN-β are formed of E. coli extracts containing high concentrations of IFN-β. This multimer formation renders purification and separation of IFN-β very laborious and time consuming and necessitates several additional steps in purification and isolation procedures such as reducing the protein during purification and reoxidizing it to restore it to its original conformation, thereby increasing the possibility of incorrect disulfide bond formation. Furthermore, microbially produced IFN-β has also been found to exhibit consistently low specific activity due perhaps to the formation of multimers or of random intramolecular disulfide bridges. It would be desirable, therefore, to be able to alter microbially produced biologically active proteins such as IFN-β in a manner that does not affect their activity adversely but reduces or eliminates their ability to form intermolecular crosslinks or intramolecular bonds that cause the protein to adopt an undesirable tertiary structure (e.g., a conformation that reduces the activity of the protein).
The present invention is directed to producing by directed mutagenesis techniques mutationally altered biologically active proteins (such proteins are called "muteins", Glossary of Genetics and Cytogenetics, 4th Ed, p 381, Springer-Verlag (1976)) that retain the activity of their parent analogs but lack the ability to form intermolecular links or undesirable intramolecular disulfide bonds. In this regard Shepard, H. M., et al, Nature (1981) 294:563-565 describe a mutein of IFN-β in which the cysteine at position 141 of its amino acid sequence (there are three cysteines in native human IFN-β at positions 17, 31, and 141, Gene (1980) 10:11-15 and Nature (1980) 285:542-547) is replaced by tyrosine. This mutein was made by bacterial expression of a hybrid gene constructed from a partial IFN-β cDNA clone having a G→A transition at nucleotide 485 of the IFN-β gene. The mutein lacked the biological activity of native IFN-β leading the authors to conclude that the replaced cysteine was essential to activity.
Directed mutagenesis techniques are well known and have been reviewed by Lather, R. F. and Lecoq, J. P. in Genetic Engineering Academic Press (1983) pp 31-50. Oligonucleotide-directed mutagenesis is specifically reviewed by Smith, M. and Gillam, S. in Genetic Engineering: Principles and Methods, Plenum Press (1981) 3:1-32.
DISCLOSURE OF THE INVENTION
One aspect of the invention is a synthetic mutein of a biologically active protein which protein has at least one cysteine residue that is free to form a disulfide link and is nonessential to said biological activity, said mutein having at least one of said cysteine residues deleted or replaced by another amino acid.
Another aspect of the invention relates to synthetic structural genes having DNA sequences that have been specifically designed ("designer genes") to encode the above described synthetic muteins. Subaspects of this aspect are expression vectors that include such structural designer genes, host cells or organisms transformed with such vectors, and processes for making the synthetic mutein by culturing such transformants or their progeny and recovering the mutein from the culture. In the case of muteins that have therapeutic utility, therapeutic compositions that contain therapeutically effective amounts of the muteins and therapeutic methods are other aspects of the invention.
Another aspect of the invention is a method of preventing a protein having one or more cysteine residues that is free to form an undesirable disulfide link from forming such a link comprising mutationally altering the protein by deleting the cysteine residue(s) or replacing them with other amino acids.
Still another aspect of the invention is a method for making the above described synthetic structural gene by oligonucleotide-directed mutagenesis comprising the following steps:
(a) hybridizing single-stranded DNA comprising a strand of a structural gene that encodes the parent protein with a mutant oligonucleotide primer that is complementary to a region of the strand that includes the codon for the cysteine to be deleted or replaced or the antisense triplet paired with the codon, as the case may be, except for a mismatch with that codon or antisense triplet, as the case may be, that defines a deletion of the codon or a triplet that encodes said other amino acid;
(b) extending the primer with DNA polymerase to form a mutational heteroduplex; and
(c) replicating the mutational heteroduplex.
The mutant oligonucleotide primers used in this process are another aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a diagram of the amino acid sequence of IFN-β.
FIG. 2 is a schematic illustration showing the preparation of a mutant IFN-β gene by oligonucleotide-directed mutagenesis.
FIG. 3 shows a diagram of plasmid pβ1trp including the IFN-β gene.
FIG. 4 is a diagram of the cloning vector M13mp8 phage.
FIG. 5 shows the restriction map of clone M13-β1.
FIG. 6 shows the sequencing gel pattern of the mutant IFN-βser17 gene showing a single base change in the coding region.
FIG. 7 is a diagram of the expression plasmid pTrp3.
FIG. 8a shows the HinfI restriction pattern of clone pSY2501 and FIG. 8b shows the resulting two 169bp and 28bp fragments thereof.
FIG. 9 is a restriction map of clone pSY2501.
FIG. 10 shows the coding DNA sequence for the mutein IFN-βser17 with the corresponding amino acid sequence therefor.
FIG. 11 shows the single 18,000 dalton protein band corresponding to IFN-βser17 in the extracts of clones pSY2501 and pβ1trp.
FIG. 12 is a diagram of the plasmid pLW1 which contains the human interleukin-2 (IL-2) gene under the control of the E.coli trp promoter.
FIG. 13 is a restriction map of phage clone M13-IL2.
FIG. 14 is a restriction map of the plasmid pLW46.
FIGS. 15a and 15b show, respectively, the nucleotide sequence of the coding strand of the clone pLW46 and the corresponding amino acid sequence of the IL-2 mutein designated IL-2ser 125.
FIG. 16 is a diagram of the plasmid pLW32.
FIG. 17 is a diagram of the plasmid pLW55.
MODES FOR CARRYING OUT THE INVENTION
The present invention provides: muteins of biologically active proteins in which cysteine residues that are not essential to biological activity have been deliberately deleted or replaced with other amino acids to eliminate sites for intermolecular crosslinking or incorrect intramolecular disulfide bond formation; mutant genes coding for such muteins; and means for making such muteins.
Proteins that may be mutationally altered according to this invention may be identified from available information regarding the cysteine content of biologically active proteins and the roles played by the cysteine residues with respect to activity and tertiary structure. For proteins for which such information is not available in the literature this information may be determined by systematically altering each of the cysteine residues of the protein by the procedures described herein and testing the biological activity of the resulting muteins and their proclivity to form undesirable intermolecular or intramolecular disulfide bonds. Accordingly, while the invention is specifically described and exemplified below as regards muteins in IFN-β and IL-2 it will be appreciated that the following teachings apply to any other biologically active protein that contains a functionally nonessential cysteine residue that makes the protein susceptible to undesirable disulfide bond formation. Examples of proteins other than IFN-β and IL-2 that are candidates for mutational alteration according to the invention are lymphotoxin (tumor necrosis factor), colony stimulating factor-1, and IFN-α1. Candidate proteins will usually have an odd number of cysteine residues.
In the case of IFN-β it has been reported in the literature and that both the glycosylated and unglycosylated IFNs show qualitatively similar specific activities and that, therefore, the glycosyl moieties are not involved in and do not contribute to the biological activity of IFN-β. However, bacterially produced IFN-β which is unglycosylated consistently exhibits quantitatively lower specific activity than native IFN-β which is glycosylated. IFN-β is known to have three cysteine residues at positions 17, 31 and 141. Cysteine 141 has been demonstrated by Shepard, et al, supra, to be essential for biological activity. In IFN-α, which contains four cysteine residues, there are two intramolecular --S--S-- bonds: one between cys 29 and cys 138 and another between cys 1 and cys 98. Based on the homology between IFN-β and IFN-αs cys 141 of IFN-β could be involved in an intramolecular --S--S-- bond with cys 31, leaving cys 17 free to form intramolecular crosslinks. By either deleting cys 17 or substituting it by a different amino acid, one can determine whether cys 17 is essential to biological activity, and its role in --SS-- bond formation. If cys 17 is not essential for the biological activity of the protein, the resulting cys 17-deleted or cys 17-substituted protein might exhibit specific activity close to that of native IFN-β and would possibly also facilitate isolation and purification of the protein.
By the use of the oligonucleotide-directed mutagenesis procedure with a synthetic oligonucleotide primer that is complementary to the region of the IFN-β gene at the codon for cys 17 but which contains single or multiple base changes in that codon, a designer gene may be produced that results in cys 17 being replaced with any other amino acid of choice. When deletion is desired the oligonucleotide primer lacks the codon for cys 17. Conversion of cys 17 to neutral amino acids such as glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine is the preferred approach. Serine and threonine are the most preferred replacements because of their chemical analogy to cysteine. When the cysteine is deleted, the mature mutein is one amino acid shorter than the native parent protein or the microbially produced IFN-β.
Human IL-2 is reported to have three cysteine residues located at positions 58, 105, and 125 of the protein. As in the case of IFN-β, IL-2 is in an aggregated oligomeric form when isolated from bacterial cells and has to be reduced with reducing agents in order to obtain a good yield from bacterial extracts. In addition, the purified reduced IL-2 protein is unstable and readily reoxidized upon storage to an oligomeric inactive form. The presence of three cysteines means that upon reoxidation, the protein may randomly form one of three possible intramolecular disulfide bridges, with only one of those being the correct bridge as found in the native molecule. Since the disulfide structure of the native IL-2 protein is not known, it is possible to use the present invention to create mutations at codons 58, 105 and 125 of the IL-2 gene and identify which cysteine residues are necessary for activity and therefore most likely to be involved in native disulfide bridge formation. In the same vein, the cysteine residue that is not necessary for activity can be modified so as to prevent the formation of incorrect intramolecular disulfide bridges and minimize the chance of intermolecular disulfide bridges by .[.removal or.]. replacement of the free cysteine residue.
The size of the oligonucleotide primer is determined by the requirement for stable hybridization of the primer to the region of the gene in which the mutation is to be induced, and by the limitations of the currently available methods for synthesizing oligonucleotides. The factors to be considered in designing oligonucleotides for use in oligonucleotide-directed mutagenesis (e.g., overall size, size of portions flanking the mutation site) are described by Smith, M. and Gillam S., supra. In general the overall length of the oligonucleotide will be such as to optimize stable, unique hybridization at the mutation site with the 5' and 3' extensions from the mutation site being of sufficient size to avoid editing of the mutation by the exonuclease activity of the DNA polymerase. Oligonucleotides used for mutagenesis in accordance with the present invention usually contain from about 12 to about 24 bases, preferably from about 14 to about 20 bases and still more preferably from about 15 to about 18 bases. They will usually contain at least about three bases 3' of the altered or missing codon.
The method for preparing the modified IFN-β gene broadly involves inducing a site-specific mutagenesis in the IFN-β gene at codon 17 (TGT) using a synthetic nucleotide primer which omits the codon or alters it so that it codes for another amino acid. When threonine replaces the cysteine and the primer is hybridized to the antisense strand of the IFN-β gene, the preferred nucleotide primer is GCAATTTTCAGACTCAG (underlining denotes the altered codon). When it is desirable to delete cysteine, the preferred primer is AGCAATTTTCAGCAGAAGCTCCTG, which omits the TGT codon for cys. When cysteine is replaced by serine, a 17-nucleotide primer, GCAATTTTCAGAGTCAG, which includes an AGT codon for serine is the primer of choice. The T→A transition of the first base in the cys 17 codon results in changing cysteine to serine. It must be recognized that when deletions are introduced, the proper reading frame for the DNA sequence must be maintained for expression of the desired protein.
The primer is hybridized to single-stranded phage such as M13, fd, or φX174 into which a strand of the IFN-β gene has been cloned. It will be appreciated that the phase may carry either the sense strand or antisense strand of the gene. When the phage carries the antisense strand the primer is identical to the region of the sense strand that contains the codon to be mutated except for a mismatch with that codon that defines a deletion of the codon or a triplet that codes for another amino acid. When the phage carries the sense strand the primer is complementary to the region of the sense strand that contains the codon to be mutated except for an appropriate mismatch in the triplet that is paired with the codon to be deleted. Conditions that may be used in the hybridization are described by Smith, M. and Gillam, S., supra. The temperature will usually range between about 0° C. and 70° C., more usually about 10° C. to 50° C. After the hybridization, the primer is extended on the phage DNA by reaction with DNA polymerase I, T4 DNA polymerase, reverse transcriptase or other suitable DNA polymerase. The resulting dsDNA is converted to closed circular dsDNA by treatment with a DNA ligase such as T4 DNA ligase. DNA molecules containing single-stranded regions may be destroyed by S1 endonuclease treatment.
Oligonucleotide-directed mutagenesis may be similarly employed to make a mutant IL-2 gene that encodes a mutein having IL-2 activity but having cys 125 changed to serine 125. The preferred oligonucleotide primer used in making this mutant IL-2 gene when the phage carries the sense strand of the gene is GATGATGCTTCTGAGAAAAGGTAATC. This oligonucleotide has a C→G change at the middle base on the triplet that is paired with codon 125 of the IL-2 gene.
The resulting mutational heteroduplex is then used to transform a competent host organism or cell. Replication of the heteroduplex by the host provides progeny from both strands. Following replication the mutant gene may be isolated from progeny of the mutant strand, inserted into an appropriate expression vector, and the vector used to transform a suitable host organism or cell. Preferred vectors are plasmids pBR322, pCR1, and variants thereof, synthetic vectors and the like. Suitable host organisms are E.coli, Pseudomonas, Bacillus subtilis, Bacillus thuringiensis, various strains of yeast, Bacillus thermophilus, animal cells such as mice, rat or Chinese hamster ovary (CHO) cells, plant cells, animal and plant hosts and the like. It must be recognized that when a host of choice is transformed with the vector, appropriate promoter-operator sequences are also introduced in order for the mutein to be expressed. Hosts may be prokaryotic or eukaryotic (processes for inserting DNA into eukaryotic cells are described in PCT application Nos. US81/00239 and US81/00240 published Sept. 3, 1981). E.coli and CHO cells are the preferred hosts. The muteins obtained in accordance with the present invention may be glycosylated or unglycosylated depending on the glycosylation occurring in the native parent protein and the host organism used to produce the mutein. If desired, unglycosylated mutein obtained when E.coli or a Bacillus is the host organism, may be optionally glycosylated in vitro by chemical, enzymatic and other types of modifications known in the art.
In the preferred embodiment of the subject invention respecting IFN-β, the cysteine residue at position 17 in the amino acid sequence of IFN-β, as shown in FIG. 1, is changed to serine by a T→A transition of the first base of codon 17 of the sense strand of the DNA sequence which codes for the mature IFN-β. The site-specific mutagenesis is induced using a synthetic 17-nucleotide primer GCAATTTTCAGAGTCAG which is identical to a seventeen nucleotide sequence on the sense strand of IFN-β in the region of codon 17 except for a single base mismatch at the first base of codon 17. The mismatch is at nucleotide 12 in the primer. It must be recognized that the genetic code is degenerate and that many of the amino acids may be encoded by more than one codon. The base code for serine, for example, is six-way degenerate such that the codons, TCT, TCG, TCC, TCA, AGT, and ACG all code for serine. The AGT codon was chosen for the preferred embodiment for convenience. Similarly, threonine is encoded by any one of condon ACT, ACA, ACC and ACG. It is intended that when one codon is specified for a particular amino acid, it includes all degenerate codons which encode that amino acid. The 17-mer is hybridized to single-stranded M13 phage DNA which carries the antisense strand of the IFN-β gene. The oligonucleotide primer is then extended on the DNA using DNA polymerase I Klenow fragment and the resulting dsDNA is converted to closed circular DNA with T4 ligase. Replication of the resulting mutational heteroduplex yields clones from the DNA strand containing the mismatch. Mutant clones may be identified and screened by the appearance or disappearance of specific restriction sites, antibiotic resistance or sensitivity, or by other methods known in the art. When cysteine is substituted with serine, the T→A transition, shown in FIG. 2, results in the creation of a new HinfI restriction site in the structural gene. The mutant clone is identified by using the oligonucleotide primer as a probe in a hybridization screening of the mutation phage plaques. The primer will have a single mismatch when hybridized to the parent but will have a perfect match when hybridized to the mutated phage DNA, as indicated in FIG. 2. Hybridization conditions can then be devised where the oligonucleotide primer will preferentially hybridize to the mutation DNA but not to the parent DNA. The newly generated HinfI site also serves as a means of confirming the single base mutation in the IFN-β gene.
The M13 phage DNA carrying the mutated gene is isolated and spliced into an appropriate expression vector, such as plasmid pTrp3, and E.coli strain MM294 is transformed with the vector. Suitable growth media for culturing the transformants and their progeny are known to those skilled in the art. The expressed mutein of IFN-β is isolated, purified and characterized.
The following examples are presented to help in the better understanding of the subject invention and for purposes of illustration only. They are not to be construed as limiting the scope of the invention in any manner. Examples 1-11 describe the preparation of a mutein of IFN-β. Examples 12-20 describe the preparation of a mutein of IL-2.
EXAMPLE 1 Cloning of the IFN-β Gene Into M13 Vector
The use of M13 phage vector as a source of single-stranded DNA template has been demonstrated by G. F. Temple et al, Nature (1982) 296:537-540. Plasmid pβ1trp (FIG. 3) containing the IFN-β gene under control of E.coli trp promoter, was digested with the restriction enzymes HindIII and XhoII. The M13mp8 (J. Messing, "Third Cleveland Symposium on Macromolecules: Recombinant DNA," Ed. A. Walton, Elsevier Press, 143-153 (1983)) replicative form (RF) DNA (FIG. 4) was digested with restriction enzymes HindIII and BamHI, and mixed with the pβ1trp DNA which had previously been digested with HindIII and XhoII. The mixture was then ligated with T4 DNA ligase and the ligated DNA transformed into competent cells of E.coli strain JM 103 and plated on Xga1 indicator plates (J. Messing, et al, Nucleic Acids Res (1981) 9:309-321). Plaques containing recombinant phage (white plaques) were picked, inoculated into a fresh culture of JM 103 and minipreps of RF molecules prepared from the infected cells (H. D. Birnboim and J. Doly, Nucleic Acid Res (1979) 7:1513-1523). The RF molecules were digested with various restriction enzymes to identify the clones containing the IFN-β insert. The restriction map of one such close (M13-β1) is shown in FIG. 5. Single-stranded (ss) phage DNA was prepared from clone M13-β1 to serve as a template for site-specific mutagenesis using a synthetic oligonucleotide.
EXAMPLE 2 Site-Specific Mutagenesis
Forty picomoles of the synthetic oligonucleotide GCAATTTTCAGAGTCAG (primer) was treated with T4 kinase in the presence of 0.1 mM adenosine triphosphate (ATP), 50 mM hydroxymethylaminomethane hydrochloride (Tris-HCl) pH 8.0, 10 mM MgCl2, 5 mM dithiothreitol (DTT) and 9 units of T4 kinase, in 50 μl at 37° C. for 1 hr. The kinased primer (12 pmole) was hybridized to 5 μg of ss M13-β1 DNA in 50 μl of a mixture containing 50 mM NaCl, 10 mM Tris-HCl, pH 8.0, 10 mM MgCl2 and 10 mM β-mercaptoethanol, by heating at 67° C. for 5 min and at 42° C. for 25 min. The annealed mixture was then chilled on ice and then added to 50 μl of a reaction mixture containing 0.5 mM each of deoxynucleoside triphosphate (dNTP), 80 mM Tris-HCl, pH 7.4, 8 mM MgCl2, 100 mM NaCl, 9 units of DNA polymerase I, Klenow fragment, 0.5 mM ATP and 2 units of T4 DNA ligase, incubated at 37° C. for 3 hr and at 25° C. for 2 hr. The reaction was then terminated by phenol extraction and ethanol precipitation. The DNA was dissolved in 10 mM Tris-HCl pH 8.0, 10 mM ethylenediaminetetraacetic acid (EDTA), 50% sucrose and 0.05% bromophenylblue and electrophoresed on 0.8% agarose gel in the presence of 2 μg/ml of ethidium bromide. The DNA bands corresponding to the RF forms of M13-β1 were eluted from gel slices by the perchlorate method (R. W. Davis, et al, "Advanced Bacterial Genetics", Cold Spring Harbor Laboratory, N.Y., p. 178-179 (1980)). The eluted DNA was used to transform competent JM 103 cells, grown overnight and ssDNA isolated from the culture supernatant. This ssDNA was used as a template in a second cycle of primer extension, the gel purified RF forms of the DNA were transformed into competent JM 103 cells, plated onto agar plates and incubated overnight to obtain phage plaques.
EXAMPLE 3 Site Specific Mutagenesis
The experiment of Example 2 above is repeated except that the synthetic oligonucleotide primer used is GCAATTTTCAGACTCAG to change codon 17 of the IFN-β gene from one that codes for cysteine to one that codes for threonine.
EXAMPLE 4 Site Specific Deletion
The experiment of Example 2 above is repeated except that the synthetic oligonucleotide primer used is AGCAATTTTCAGCAGAAGCTCCTG to delete codon 17 of the IFN-β gene.
EXAMPLE 5 Screening And Identification of Mutagenized Plaques
Plates containing mutated M13-β1 plaques (Example 1) as well as two plates containing unmutated M13-β1 phage plaques, were chilled to 4° C. and plaques from each plate transferred onto two nitrocellulose filter circles by layering a dry filter on the agar plate for 5 min for the first filter and 15 min for the second filter. The filters were then placed on thick filter papers soaked in 0.2N NaOH, 1.5M NaCl and 0.2% Triton X-100 for 5 min, and neutralized by layering onto filter papers soaked with 0.5M Tris-HCl, pH 7.5 and 1.5M NaCl for another 5 min. The filters were washed in a similar fashion twice on filters soaked in 2×SSC (standard saline citrate), dried and then baked in a vacuum oven at 80° C. for 2 hr. The duplicate filters were prehybridized at 55° C. for 4 hr with 10 ml per filter of DNA hybridization buffer (5×SSC) pH 7.0, 4×Denhardt's solution (polyvinylpyrrolidine, ficoll and bovine serum albumin, 1×=0.02% of each), 0.1% sodium dodecyl sulfate (SDS), 50 mM sodium phosphate buffer pH 7.0 and 100 μg/ml of denatured salmon sperm DNA. 32 P-labeled probe was prepared by kinasing the oligonucleotide primer with 32 P-labeled ATP. The filters were hybridized to 3.5×105 cpm/ml of 32 P-labeled primer in 5 ml per filter of DNA hybridization buffer at 55° C. for 24 hr. The filters were washed at 55° C. for 30 min each in washing buffers containing 0.1% SDS and decreasing amounts of SSC. The filters were washed initially with buffer containing 2×SSC and the control filters containing unmutated M13-β1 plaques were checked for the presence of any radioactivity using a Geiger counter. The concentration of SSC was lowered stepwise and the filters washed until no detectable radioactivity remained on the control filters with the unmutated M13-β1 plaques. The lowest concentration of SSC used was 0.1×SSC. The filters were air dried and autoradiographed at -70° C. for 2-3 days. 480 plaques of mutated M13-β1 and 100 unmutated control plaques were screened with the kinased oligonucleotide probe. None of the control plaques hybridized with the probe while 5 mutated M13-β1 plaques hybridized with the probe.
One of the five mutated M13-β1 plaques (M13-SY2501) was picked and inoculated into a culture of JM 103. ssDNA was prepared from the supernatant and double-stranded (ds) DNA was prepared from the cell pellet. The ssDNA was used as a template for the dideoxy-sequencing of the clone using the M13 universal primer. The result of the sequence analysis is shown in FIG. 6, confirming that the TGT cys codon has been converted to an AGT ser codon.
EXAMPLE 6 Expression of Mutated IFN-β in E.coli
RF DNA from M13-SY2501 was digested with restriction enzymes HindIII and XhoII and the 520 bp insert fragment purified on a 1% agarose gel. The plasmid pTrp3 containing the E.coli trp promoter (FIG. 7) was digested with the enzymes HindIII and BamHI, mixed with the purified M13-SY2501 DNA fragment, and ligated in the presence of T4 DNA ligase. The ligated DNA was transformed into E.coli strain MM294. Ampicillin resistant transformants were screened for sensitivity to the drug tetracycline. Plasmid DNA from five ampicillin resistant, .[.tetracylcine.]. .Iadd.tetracycline .Iaddend.sensitive clones were digested with Hinf1 to screen for the presence of the M13-SY2501 insert. FIG. 8a shows the HinfI restriction pattern of one of the clones (pSY2501), comparing it with the HinfI pattern of the original IFN-β clone, pβ1 trp. As expected, there is an additional HinfI site in pSY2501, cleaving the 197 bp IFN-β internal fragment to a 169 bp fragment and a 28 bp fragment (FIG. 8b). A restriction map of the clone pSY2501 is shown in FIG. 9. The complete DNA sequence of the mutant IFN-β gene is shown in FIG. 10 together with the predicted amino acid sequence.
The plasmid designated as clone pSY2501 was deposited with the Agricultural Research Culture Collection (NRRL), Fermentation Laboratory, Northern Regional Research Center, Science and Education Administration, U.S. Department of Agriculture, 1815 North University St., Peoria, Ill. 60604 on Mar. 30, 1983 and was assigned accession numbers CMCC No. 1533 and NRRL No. B-15356.
Cultures of pSY2501 and pβ1trp, which include progeny thereof, were grown up to an optical density (OD600) of 1.0. Cell free extracts were prepared and the amount of IFN-β antiviral activity assayed on GM2767 cells in a microtiter assay. Extracts of clone pSY2501 exhibited three to ten times higher activity than pβ1trp (Table I), indicating that clone pSY2501 was either synthesizing more protein exhibiting IFN-β activity or that the protein made had a higher specific activity.
              TABLE I                                                     
______________________________________                                    
EXTRACT     ANTIVIRAL ACTIVITY (U/ml)                                     
______________________________________                                    
pSY2501     6 × 10.sup.5                                            
pβ1trp 1 × 10.sup.5                                            
ptrp3 (control)                                                           
            30                                                            
______________________________________                                    
In order to determine if clone pSY2501 was synthesizing several times more active protein, the extracts of both clones were electrophoresed on a SDS polyacrylamide gel together with a control extract and the gel stained with coomasie blue to visualize the proteins. As shown in FIG. 11, there was only one protein band corresponding to an apparent 18,000 dalton protein that was present in the extracts of clones pSY2501 and pβ1trp but not in the control extract of ptrp3. This protein, which has a molecular weight of about 20,000 daltons but shows a gel migration pattern of an 18,000 dalton protein was previously shown to be IFN-β by purification of this protein from extracts of pβ1trp. Since there is less of this protein in extracts of pSY2501 than in extracts of pβ1trp, the specific activity of the protein in extracts of clone pSY2501 was higher than that of clone pβ1trp.
EXAMPLE 7
The plasmid pSY2501 was transformed into a competent subvariant of E.coli strain MM294, designated MM294-1. A sample of the resulting transformant was deposited in the American Type Culture Collection 12301 Parklawn Dr., Rockville, Md. 20852 USA on Nov. 18, 1983 under ATCC No. 39,517.
EXAMPLE 8 Production of IFN-βser17
IFN-βser17 was recovered from E.coli that had been transformed to produce IFN-βser17. The E.coli were grown in the following growth medium to an OD of 10-11 at 680 nm (dry wt 8.4 g/l).
______________________________________                                    
Ingredient            Concentration                                       
______________________________________                                    
NH.sub.4 Cl           20      mM                                          
K.sub.2 SO.sub.4      16.1    mM                                          
KH.sub.2 PO.sub.4     7.8     mM                                          
Na.sub.2 HPO.sub.4    12.2    mM                                          
MgSO.sub.4.7H.sub.2 O 3       mM                                          
Na.sub.3 citrate.2H.sub.2 O                                               
                      1.5     mM                                          
MnSO.sub.4.4H.sub.2 O 30      μM                                       
ZnSO.sub.4.7H.sub.2 O 30      μM                                       
CuSO.sub.4.5H.sub.2 O 3       μM                                       
L-tryptophan          70      mg/l                                        
FeSO.sub.4.7H.sub.2 O 72      μM                                       
thiamine.HCl          20      mg/l                                        
glucose               40      g/l                                         
______________________________________                                    
 pH cotrol with NH.sub.4 OH                                               
A 9.9 l (9.9 kg) harvest of the transformed E.coli was cooled to 20° C. and concentrated by passing the harvest through a cross-flow filter at an average pressure drop of ˜110 kpa and steady-state filtrate flow rate of 260 ml/min until the filtrate weight was 8.8 kg. The concentrate (approximately one liter) was drained into a vessel and cooled to 15° C. The cells in the concentrate were then disrupted by passing the concentrate through a Manton-Gaulin homogenizer at 5° C., ˜69,000 kpa. The homogenizer was washed with one liter phosphate buffered saline, pH 7.4 (PBS), and the wash was added to the disruptate to give a final volume of two liters. This volume was continuously centrifuged at 12000×g at a 50 ml/min flow rate. The solid was separated from the supernatant and resuspended in four liters PBS containing 2% by wt SDS. This suspension was stirred at room temperature for 15 min after which there was no visible suspended material The solution was then extracted with 2-butanol at a 1:1 2-butanol:solution volume ratio. The extraction was carried out in a liquid-liquid phase separator using a flow rate of 200 ml/min. The organic phase was then separated and evaporated to dryness to yield 21.3 g of protein. This was resuspended in distilled water at a 1:10 volume ratio.
The recovered product was assayed for human IFN-β activity using an assay based on protection against viral cytopathic effect (CPE). The assay was made in microtiter plates. Fifty μl minimum essential medium were charged into each well and 25 μl of the sample was placed in the first well and 1:3 volume dilutions were made serially into the following wells. Virus (vesicular stomatitus), cell (human fibroblast line GM-2767), and reference IFN-β controls were included on each plate. The reference IFN-β used was 100 units per ml. The plates were then irradiated with UV light for 10 min. After irradiation 100 μl of the cell suspension (1.2×105 cells/ml) was added to each well and the trays were incubated for 18-24 hr. A virus solution at one plaque-forming unit per cell was added to each well except the cell control. The trays were then incubated until the virus control showed 100% CPE. This normally occurred 18-24 hr after adding the virus solution. Assay results were interpreted in relation to the location of the 50% CPE well of the reference IFN-β control. From this point the titer of interferon for all samples on the plate was determined. The specific activity of the recovered product was determined to be 5×107 U/mg.
EXAMPLE 9 Acid Precipitation And Chromatographic Purification
The process of Example 8 was repeated except that after extraction and separation of the aqueous and organic phases and mixing of the organic phase with PBS at a volume ratio of 3:1 the pH of the mixture was lowered to about 5 by addition of glacial acetic acid. The resulting precipitate was separated by centrifugation at 10000-17000×g for 15 min and the pellet was redissolved in 10% w/v SDS, 10 mM DTT, 50 mM sodium acetate buffer, pH 5.5, and heated to 80° C. for 5 min.
The solution was then applied to a Brownlee RP-300, 10 μM, "Aquapore" column using a Beckman gradient system. Buffer A was 0.1% trifluoroacetic acid (TFA) in H2 O; buffer B was 0.1% TFA in acetonitrile. Detection was by ultraviolet absorbance at 280 nm. The solvent program was linear gradient of 0% buffer B to 100% buffer B in three hr. Fractions containing highest interferon activities were pooled and the specific activity of the pooled interferon preparation was determined to be 9.0×107 to 3.8×108 international units per mg protein, as compared to about 2×108 U/mg for native IFN-β.
EXAMPLE 10 Biochemical Characterization of IFN-β Ser17
Amino acid compositions were determined after 24-72 hr timed hydrolysis of 40 μg samples of IFN in 200 μl of 5.7N HCl, 0.1% phenol, at 108° C. Proline and cysteine were determined in the same fashion after performic acid oxidation; in this case, phenol was omitted from the hydrolysis. Tryptophan was analyzed after 24 hr hydrolysis of 400 μl samples in 5.7N HCl, 10% mercaptoacetic acid (no phenol). Analysis was performed on a Beckman 121MB amino acid analyzer using a single column of AA10 resin.
The amino acid composition calculated from representative 24-, 48-, 72-hr acid hydrolyses of purified IFN-β Ser17 agrees well with that predicted by the DNA sequence of the cloned IFN gene, minus the missing N-terminal methionine.
The amino acid sequence of the first 58 residues from the amino acid terminus of purified IFN was determined on a 0.7 mg sample in a Beckman 890C sequanator with 0.1M Quadrol buffer. PTH amino acids were determined by reverse-phase HPLC on an Altex ultrasphere ODS column (4.6×250 mm) at 45° C. eluted at 1.3 min at 40% buffer B, and 8.4 min from 40-70% buffer B, where buffer A was 0.0115M sodium acetate, 5% tetrahydrofuran (THF), pH 5.11 and buffer B was 10% THF in acetonitrile.
The N-terminal amino acid sequence of IFN-β Ser17 determined matches the expected sequence predicted from the DNA sequence, except for the absence of N-terminal methionine.
EXAMPLE 11 Alternative IFN-βser Production and Purification Process
E. coli transformed with pSY2501 were grown in the following medium:
______________________________________                                    
                     Approximate                                          
                     Initial                                              
Ingredient           Concentration                                        
______________________________________                                    
Na.sub.3 Citrate.2H.sub.2 O                                               
                     3 mM                                                 
KH.sub.2 PO.sub.4    30 mM                                                
(NH.sub.4).sub.2 SO.sub.4                                                 
                     74 mM                                                
MgSO.sub.4.7H.sub.2 O                                                     
                     46 μM                                             
ZnSO.sub.4.7H.sub.2 O                                                     
                     46 μM                                             
CuSO.sub.4.5H.sub.2 O                                                     
                     1-2 μM                                            
L-tryptophan         350 μM                                            
FeSO.sub.4.7H.sub.2 O                                                     
                     74 μM                                             
thiamine.HCl         0.002%                                               
glucose              0.5%                                                 
______________________________________                                    
Dow Corning Antifoam polypropylene glycol, 25% solution, glucose, 50% solution, and KOH, 5N, were added on demand.
Temperature was maintained at 37°±1° C., pH at 6.5±0.1 with NaOH, and dissolved oxygen at 30% of air saturation. Optical density and residual glucose measurements were taken at 14 hr and at approximately one hr intervals thereafter. Harvest was made when gluclose consumption reached 40±6 g/l (OD at 680 nm=10-11).
The harvested material was concentrated approximately 3-fold by circulating it through a microporous cross-flow filter under pressure. The concentrated cells were diafiltered against deionized water until the harvest material was concentrated 4-5 fold. The cells were then disrupted by passing them through a Manton-Gaulion homogenizer at ˜4.1-5.5×104 kpa. After the initial pass SDS-sodium phosphate buffer was added to a final concentration of 2% SDS, 0.08M sodium phosphate and homogenization was continued for one hr. Solid DTT was then added to a final concentration of 50 mM and the homogenizate was heated to 90°±5° C. for 10 min. The resulting cell suspension was extracted with 2-butanol at a 1:1 2-butanol:suspension volume ratio in a static mixer. The mixture was then centrifuged and the 2-butanol rich phase was collected.
The 2-butanol rich phase was mixed with 2.5 volumes of 0.1% SDS in PBS. Solid DTT was added to a final concentration of 2 mM. The pH of the mixture was adjusted to 6.2±0.1 with glacial acetic acid and this mixture was centrifuged. The resulting paste was collected and resuspended in PBS+10% SDS with pH adjustment to 8.5±0.1 using 1N NaOH. Solid DTT was added to a final concentration of 100 mM and the suspension was heated to 90°±5° C. for 10 min. The suspension was then cooled to ˜25° C., the pH was adjusted to 5.5±0.1 with glacial acetic acid, and the solution was filtered.
The solution was then applied to a Sephacryl S-200 pre column and the fractions containing highest interferon activities were pooled and concentrated by ultrafiltration with a 10 Kdal molecular weight cutoff. The concentrate was oxidized by adding equimolar amounts of protein and iodosobenzoic acid into a reaction vessel containing 2 mM sodium pyrophosphate, 0.1% SDS and 1 mM EDTA. The pH was controlled during oxidation at 9.0±0.1 with 0.5N NaoH and adjusted to 5.5±0.2 when oxidation was complete. After oxidation the concentrate was again passed through the ultrafiltration unit with a 10 Kdal molecular weight cutoff.
The concentrate was applied to a main Sephacryl S-200 column and the fractions were analyzed by SDS-PAGE to determine those containing no high molecular weight contaminants. Those fractions were pooled and passed through the ultrafiltration unit. The filtered concentrate was then fractionated on a Sephadex G-75 column. SDS-PAGE analysis of the fractions was made to determine those containing no low or high molecular weight contaminants. Those fractions were pooled for desalting.
A Sephadex G-25 column equilibrated with 1 mM NaOH was loaded with the pooled fractions from the Sephadex G-75 column using distilled water adjusted to pH 10.8-11 with 50% NaOH. The purified product was collected as the void volume peak. This desalted, purified IFN-β mutein may be formulated in known manners for therapeutic administration.
Biological Testing of IFN-βser17
Antigenic Comparison
IFN-βser17 was compared antigenically to IFN-β produced from diploid fibroblasts using virus neutralizing tests. A polyvalent antiserum to the diploid fibroblast IFN-β was prepared in rabbits. This antiserum blocked the antiviral activity of both the diploid fibroblast IFN-β and the IFN-βser17 in the virus neutralization tests, indicating the two proteins are indistinguishable antigenically.
Antiviral Activity
The purified IFN-βser17 was compared in its antiviral activity to naturally produced IFN-β. Inhibition of vesicular stomatitis virus replication in diploid foreskin fibroblast (HS27F) was indistinguishable from that of the natural molecule. Similarly, inhibition of herpes simplex virus type 1 in HS27F fibroblasts by the natural and mutant proteins were comparable.
Antiproliferative Activity
The antiproliferation activity of IFN-βser17 for continuous cell lines was compared with that of naturally produced IFN-β. T24 cells derived from a transitional cell carcinoma were treated with 200 units/ml of the proteins. Cell growth was inhibited significantly (p<0.02) by both proteins.
Natural Killer (NK) Cell Stimulation
The ability of IFN-βser17 to stimulate NK cell (spontaneous cell mediated cytotoxicity) activity was tested. Ficoll-hypaque separated peripheral human mononuclear cells (PMC) or NK-enriched lymphocyte preparations (depleted of monocytes by plastic adherence and of OKT3-positive T cells by treatment with OKT3 antibody plus complement) were incubated overnight in growth medium containing various concentrations of IFN-βser17. 51 Cr-labeled target cells were incubated with the effector cells (effector cell:target cell ratio=50:1) for 2-4 hours. NK cell cytoxicity was determined by measuring the amount of label released into the medium. The results of these tests are reported in Table I below.
                                  TABLE I                                 
__________________________________________________________________________
NK Cell Cytotoxicity by Interferon (specific % .sup.51 Cr release ±    
SEM)                                                                      
IFN (units/ml)                                                            
Target                                                                    
    Effector                                                              
Cell                                                                      
    Cells                                                                 
         0     10    30    100   300   1000                               
__________________________________________________________________________
T24 PMC  7.23 ± 5.1                                                    
               23.1 ± 4.4                                              
                     24.4 ± 1.1                                        
                           34.1 ± 2.5                                  
                                 50.0 ± 2.0                            
                                       40.4 ± 4.4                      
Chang                                                                     
    PMC   4.7 ± 0.5                                                    
                7.2 ± 0.8                                              
                      9.5 ± 1.7                                        
                           15.9 ± 1.3                                  
                                 21.9 ± 1.4                            
                                       26.9 ± 1.8                      
Chang                                                                     
    NK Enr                                                                
         19.2 ± 4.6                                                    
               39.4 ± 4.1                                              
                     ND    54.2 ± 6.1                                  
                                 ND    41.7 ± 5.5                      
K562                                                                      
    NK Enr                                                                
         41.0 ± 4.6                                                    
               48.4 ± 3.6                                              
                     ND    62.2 ± 3.5                                  
                                 ND    63.2 ± 3.5                      
__________________________________________________________________________
As shown the target cells were killed more effectively by the IFN-βser17 -treated cells than by the unteated cells.
Clinical Trials
Phase I clinical trials to verify the safety of IFN-βser17 in humans have been initiated. These trails involve administering the protein to patients intramuscularly and intravenously at doses ranging between 1×105 units (1 μg of protein) to 400×106 units. In initial phase I clinical trials no unexpected adverse effects have occurred.
As indicated above, the IFN-βser17 preparation exhibits specific activity levels very close to or better than that of native IFN-β. IFN-βser17 has no free sulfhydryl groups but indicates one --S--S-- bond between the only remaining cysteines at positions 31 and 141. The protein does not readily form oligomers and appears to be substantially in the monomeric form. The IFN-βser17 obtained in accordance with this invention may be formulated either as a single product or mixtures of the various forms, into pharmaceutically acceptable preparations in inert, nontoxic, nonallergenic, physiologically compatible carrier media for clinical and therapeutic uses in cancer therapy or in conditions where interferon therapy is indicated and for viral infections such as herpes simplex virus I and II, hepatitis B virus, common cold viruses, and rhinovirus. Such media include but are not limited to distilled water, physiological saline, Ringer's solution, Hank's solution and the like. Other nontoxic stabilizing and solubilizing additives such as dextrose, HSA (human serum albumin) and the like may be optimally included. The therapeutic formulations may be administered orally or parenterally such as intravenous, intramuscular, intraperitoneal and subcutaneous administrations. Preparations of the modified IFN-β of the present invention may also be used for topical applications in appropriate media normally utilized for such purposes. The IFN-β mutein may be administered either locally or systemically by itself or in combination or conjunction with other therapeutic agents such as acyclovir for prophylactic or therapeutic purposes. The dose of mutein administered to human patients will depend on whether it is administered continuously (including intermittant) or as a bolus. The amounts administered continuously will typically be lowered than the amounts administered as a bolus. The amount will usually be in the range of about 1×105 to 4×108 units, more usually about 1×106 to 1×107 units.
The principal advantages of the above described mutein of IFN-β lie in the elimination of a free sulfhydryl group at position 17 in IFN-β, thereby forcing the protein to form correct disulfide links between cys 31 and cys 141 and to assume the conformation ostensibly required for full biological activity. The increased specific activity of the IFN-βser17 enables the use of smaller dosages in therapeutic uses. By deleting the cysteine at position 17 and eliminating the free --SH group, the IFN-βser17 protein does not form dimers and oligomers so readily as the microbially produced IFN-β. This facilitates purification of the protein and enhances its stability.
EXAMPLE 12
The nucleotide sequence for a cDNA clone coding for human IL-2, procedures for preparing IL-2 cDNA libraries, and screening same for IL-2 are described by Taniguchi, T., et al, Nature (1983) Vol 24, p 305 et seq.
cDNA libraries enriched in potential IL-2 cDNA clones were made from an IL-2 enriched mRNA .[.fractions.]. .Iadd.fraction .Iaddend.obtained from induced peripheral blood lymphocytes (PBL) and Jurkat cells by conventional procedures. The enrichment of the mRNA for IL-2 message was made by fractionating the mRNA and identifying the fraction having IL-2 mRNA activity by injecting the fractions in Xenopus laevis oocytes and assaying the oocyte lysates for IL-2 activity on HT-2 cells (J. Watson, J Exp Med (1979) 150:1570-1519 and S. Gillis et al, J Immun (1978) 120:2027-2032.)
EXAMPLE 13 Screening and Identification of IL-2 cDNA Clones
The IL-2 cDNA libraries were screened using the colony hybridization procedure. Each microtiter plate was replicated onto duplicate nitrocellulose filter papers (S & S type BA-85) and colonies were allowed to grow at 37° C. for 14-16 hr on L agar containing 50 μg/ml ampicillin. The colonies were lysed and DNA fixed to the filter by sequential treatment for 5 min with 500 mM NaOH, 1.5M NaCl, washed twice for 5 min each time with 5×standard saline citrate (SSC). Filters were air dried and baked at 80° C. for 2 hr. The duplicate filters were pre-hybridized at 42° C. for 6-8 hr with 10 ml per filter of DNA hybridization buffer (50% formamide, 5×SSC, pH 7.0, 5×Denhardt's solution (polyvinylpyrrolidine, plus ficoll and bovine serum albumin; 1×=0.2% of each), 50 mM sodium phosphate buffer at pH 7.0, 0.2% SDS, 20 μg/ml Poly U, and 50 μg/ml denatured salmon sperm DNA.
A 32 P-labeled 20-mer oligonucleotide probe was prepared based on the IL-2 gene sequence reported by Taniguchi, T., et al, supra. The nucleotide sequence of the probe was GTGGCCTTCTTGGGCATGTA.
The samples were hybridized at 42° C. for 24-36 hr with 5 ml/filter of DNA hybridization buffer containing the 32 P oligonucleotide probe. The filters were washed two times for 30 min each time at 50° C. with 2×SSC, 0.1% SDS, then washed twice with 1×SSC and 0.1% SDS at 50° C. for 90 min, air dried, and autoradiographed at -70° C. for 2 to 3 days. Positive clones were identified and rescreened with the probe. Full length clones were identified and confirmed by restriction enzyme mapping and comparison with the sequence of the IL-2 cDNA clone reported by Taniguchi, T., et al, supra.
EXAMPLE 14 Cloning of Il-2 Gene into M13 Vector
The IL-2 gene was cloned into M13mp9 as described in Example 1 using the plasmid pLW1 (FIG. 12) containing the IL-2 gene under the control of the E. coli trp promoter. A sample of pLW1 was deposited in the American Type Culture Collection, 12301 Parklawn Dr., Rockville, Md. 20852, USA, on Aug. 4, 1983 and has been assigned ATCC number 39,405. The restriction map of one clone (designated M13-IL2) containing the IL-2 insert is shown in FIG. 13. Single-stranded phage DNA was prepared from clone M13-IL2 to serve as a template for oligonucleotide-directed mutagenesis.
EXAMPLE 15 Oligonucleotide-directed Mutagenesis
As indicated previously, IL-2 contains cysteine residues at amino acid positions 58, 105 and 125. Based on the nucleotide sequences of the portions of the IL-2 gene that contain the codons for these three cysteine residues three oligonucleotide primers were designed and synthesized for mutating the codons for these residues to codons for serine. These oligonucleotides have the following sequences.
CTTCTAGAGACTGCAGATGTTTC (DM27) to change cys 58,
CATCAGCATACTCAGACATGAATG (DM28) to change cys 105 and
GATGATGCTCTGAGAAAAGGTAATC (DM29) to change cys 125.
Forty picomoles of each oligonucleotide were kinased separately in the presence of 0.1 mM ATP, 50 mM Tris-HCl, pH 8.0, 10 mM MgCl2, 5 mM DTT and 9 units of T4 kinase in 50 μl at 37° C. for 1 hr. Each of the kinased primers (10 pmoles) was hybridized to 2.6 μg of ss M13-IL2 DNA in 15 μl of a mixture containing 100 mM NaCl, 20 mM Tris-HCl, pH 7.9, 20 mM MgCl2 and 20 mM β-mercaptoethanol, by heating at 67° C. for 5 min and 42° C. for 25 min. The annealed mixtures were chilled on ice and then adjusted to a final .[.colume.]. .Iadd.volume .Iaddend.of 25 μl of a reaction mixture containing 0.5 mM of each dNTP, 17 mM Tris-HCl, pH 7.9, 17 mM MgCl2, 83 mM NaCl, 17 mM β-mercaptoethanol, 5 units of DNA polymerase I Klenow fragment, 0.5 mM ATP and 2 units of T4 DNA ligase, incubated at 37° C. for 5 hr. The reactions were terminated by heating to 80° C. and the reaction mixtures used to transform competent JM103 cells, plated onto agar plates and incubated overnight to obtain phage plaques.
EXAMPLE 16 Screening and Identification of Mutagenized Phage Plaques
Plates containing mutagenized M13-IL2 plaques as well as 2 plates containing unmutagenized M13-IL2 phage plaques, were chilled to 4° C. and phage plaques from each plate were transferred onto two nitrocellulose filter circles by layering a dry filter on the agar plate for 5 min for the first filter and 15 min for the second filter. The filters were then placed on thick filter papers soaked in 0.2N NaOH, 1.5M NaCl and 0.2% Triton for 5 min, and neutralized by layering onto filter papers soaked with 0.5M Tris-HCl, pH 7.5, and 1.5M NaCl for another 5 min. The filters were washed in a similar fashion twice on filters soaked in 2×SSC, dried and then baked in a vacuum oven at 80° C. for 2 hr. The duplicate filters were pre-hybridized at 42° C. for 4 hr with 10 ml per filter of DNA hybridization buffer (5×SSC, pH 7.0, 4×Denhardts solution (.[.polyvinylpyrrolidine.]. .Iadd.polyvinylpyrrolidone.Iaddend., ficoll and bovin serum albumin, 1x=0.02% of each), 0.1% SDS, 50 mM sodium phosphate buffer, pH 7.0 and 100 μg/ml of denatured salmon sperm DNA. 32 P-labelled probes were prepared by kinasing the oligonucleotide primers with labelled ATP. The filters were hybridized to 0.1×105 cpm/ml of 32 P-labelled primers in 5 ml per filter of DNA hybridization buffer at 42° C. for 8 hr. The filters were washed twice at 50° C. for 30 min each in washing buffers containing 0.1% SDS and 2×SSC, and twice at 50° C. for 30 min each with 0.1% SDS and 0.2×SSC. The filters were air dried and autoradiographed at -70° C. for 2-3 days.
Since the oligonucleotide primers DM28 and DM29 were designed to create a new DdeI restriction site in the mutagenized clones (FIG. 14), RF-DNA from a number of the clones which hybridized with each of these kinased primers were digested with the restriction enzyme DdeI. One of the mutagenized M13-IL2 placques which hybridized with the primer DM28 and has a new DdeI restriction site (M13-LW44) was picked and inoculated into a culture of JM103, ssDNA was prepared from the culture supernatant and dsRF-DNA was prepared from the cell pellet. Similarly, a plaque which hybridized with primer DM29 was picked (M13-LW46) and ssDNA and RF-DNA prepared from it. The oligonucleotide primer DM27 was designed to create a new PstI restriction site instead of a DdeI site. Therefore, the plaques that hybridized to this primer were screened for the presence of a new PstI site. One such phage plaque was identified (M13-LW42) and ssDNA and RF-DNA prepared from it. The DNA from all three of these clones were sequenced to confirm that the target TGT codons for cysteine had been converted to a TCT codon for serine.
EXAMPLE 17 Recloning of the Mutagenized IL-2 Gene for Expression in E. coli
RF-DNA from M13-LW42, M13-LW44 and M13-LW46 were each digested with restriction enzymes HindIII and BanII and the insert fragments purified from a 1% agarose gel. Similarly, the plasmid pTrp3 (FIG. 7) was digested with HindIII and BanII, the large plasmid fragment containing the trp promoter was purified on an agarose gel and then ligated with each of the insert fragments isolated from M13-LW42, M13-LW44 and M13-LW46. The ligated plasmids were transformed into competent E. coli K12 strain MM294. The plasmid DNAs from these transformants were analyzed by restriction enzyme mapping to confirm the presence of the plasmids pLW42, pLW44 and pLW46. FIG. 14 is a restriction map of pLW46. When each of these individual clones were grown in the absence of tryptophane to induce the trp promoter and cell free extracts analyzed on SDS-polyacrylamide gels, all three clones, pLW42, pLW44 and pLW46, were shown to synthesize a 14.5 kd protein similar to that found in the positive control, pLW21, which has been demonstrated to synthesize a 14.4 kd IL-2 protein. When these same extracts were subjected to assay for IL-2 activity on mouse HT-2 cells, only clones pLW21 (positive control) and pLW46 had significant amounts of IL-2 activity (Table II below), indicating that cys 58 and cys 105 are necessary for biological activity and changing them to serines (pLW42 and pLW44 respectively) resulted in the loss of biological activity. Cys 125 on the other hand must not be necessary for biological activity because changing it to ser 125 (pLW46) did not affect the biological activity.
              TABLE II                                                    
______________________________________                                    
Clones           IL-2 Activity (μ/ml)                                  
______________________________________                                    
pIL2-7 (negative control)                                                 
                     1                                                    
pLW21 (positive control)                                                  
                 113,000                                                  
pLW42               660                                                   
pLW44             1,990                                                   
pLW46            123,000                                                  
______________________________________                                    
FIG. 15a shows the nucleotide sequence of the coding strand of clone pLW46. As compared to the coding strand of the native human IL-2 gene clone pLW46 has a single base change of G→C at nucleotide 374. FIG. 15b shows the corresponding amino acid sequence of the IL-2 mutein encoded by pLW46. This mutein is designated des-alanyl(ala) IL-2ser125 As compared to native IL-2 the mutein has a serine instead of a cysteine at position 125, has an initial N-terminal methionine (which is processed off), and lacks the initial N-terminal alanine of the native molecule.
A sample of E. coli K12 strain MM294 transformed with pLW46 was deposited in the American Type Culture Collection, 12301 Parklawn Dr., Rockville, Md. 20852, USA on Sept. 26, 1983 and has been assigned ATCC Number 39,452.
Examples 18 and 19 describe the preparation of an alternative and preferred vector for expressing alanyl(ala) IL-2ser125.
EXAMPLE 18 Construction of Ala-IL-2 Expression Vector pLW32
A codon (GCG) for alanine was inserted immediately after the initiation codon of the IL-2 gene of pLW1 by oligonucleotide-directed mutagenesis as follows. The oligonucleotide primer, 5'-GAAGTAGGCGCCATAAG-3', was kinased, hybridized to ssM13-IL2 DNA, and extended using the general procedure of Example 15 to form a mutational heteroduplex. In addition to the insertion of the GCG codon, the mutagenesis generated a new NarI restriction site in the gene. The heteroduplex was converted to closed circular heteroduplex and the circular heteroduplexes were used to transform competent JM103 cells and plated onto agar plates and incubated as in Example 15. The plates were screened to identify mutagenized M13-IL2 by the procedure of Example 16. One mutagenized phage, identified as M13-LW32, was selected for use in additional cloning and RF-DNA was prepared from it. FIG. 16 is a diagram of plasmid pLW32.
EXAMPLE 19 Construction of Ala-IL-2ser125 Expressing Clone pLW55
RF-DNA from M13-LW46 (Examples 16 and 17) was digested with XbaI and PstI and the 530 bp fragment containing the carboxy terminal coding region of the IL-2ser125 gene was purified from an agarose gel. Similarly, pLW32 was digested with XbaI and PstI and the large fragment consisting of the plasmid vector and the ala-IL-2 N-terminal coding sequence was purified. The two purified DNA fragments were pooled and ligated using T4 DNA ligase. The ligated DNA was transformed into competent E. coli K-12 strain MM294. Tetracycline resistant transformants were analyzed by restriction enzyme mapping for the presence of a plasmid containing an ala-IL-2ser125 gene, identified as pLW55, which has a new DdeI site not found in pLW32. FIG. 17 is a diagram of pLW55. Cell free extracts of bacterial culture containing pLW55 were found to contain over 105 units of IL-2 activity per ml by the HT-2 cell assay, J. Watson, supra, and S. Gillis, supra. Ala-IL-2ser125 protein is identified to the IL-2ser125 molecule shown in FIG. 15(b) except that the former includes the initial N-terminal alanine of the native molecule.
A sample of E. coli K-12 strain MM294 transformed with pLW55 was deposited in the American Type Culture Collection on Nov. 18, 1983 and has been assigned ATCC number 39,516.
EXAMPLE 20 Ala-IL-2ser125 Production and Purification
E. coli transformed with pLW55 were grown in a fermenter containing the following medium:
______________________________________                                    
(NH.sub.4).sub.2 SO.sub.4                                                 
                      150 mM                                              
KH.sub.2 PO.sub.4     21.6 mM                                             
Na.sub.3 Citrate      1.5 mM                                              
ZnSO.sub.4.7H.sub.2 O 30 μM                                            
MnSO.sub.4.H.sub.2 O  30 μM                                            
CuSO.sub.4.5H.sub.2 O 1 μM                                             
______________________________________                                    
 pH adjusted to 6.50 with 2.5 N NaOH autoclaved                           
______________________________________                                    
Sterile Additions (post autoclave)                                        
______________________________________                                    
MgSO.sub.4.7H.sub.2 O                                                     
                     3      mM                                            
FeSO.sub.4           100    μM                                         
L-tryptophan         14     mg/l                                          
Thiamine.HCl         20     mg/l                                          
Glucose              5      g/l                                           
Tetracycline         5      mg/l                                          
Ethanol              2%                                                   
Casamino acids       2%                                                   
______________________________________                                    
Dow Corning Antifoam polypropylene glycol, 20% solution, glucose, 50% solution, and KOH, 5N, were added on demand.
The pH of the fermenter was maintained at 6.8 with 5N KOH. Residual glucose was maintained between 5-10 g/l, dissolved oxygen at 40%, and temperature at 37°±1° C. The casamino acids (20% stock solution) to a concentration of 2% were added when the OD680 was about 10. Harvest was made three hr after the OD reached about 20.
The harvested material was concentrated and homogenized as in Example 11. Following DTT-heat treatment, the material was centrifuged and the resulting paste was extracted with urea to a final concentration of 4M. The suspension was centrifuged and SDS was added to the solid phase to a concentration of 5%.
The solution was applied to a Sephacryl S-200 column and fractions containing IL-2 (by SDS-PAGE) were pooled. The pooled fractions were applied to a Whatman M-40 column packed with 18 micron Vydac C 4 300 Å pore size bonded phase silica gel equilibrated in 0.1% TFA. The IL-2 mutein was eluted with a gradient of 40% to 60% 2-propanol, containing 0.1% TFA, in 160 min. Fractions containing highest IL-2 activities were pooled and found to have specific activities comparable to native IL-2.
Muteins of IL-2 in which the cysteine at position 125 has been .[.deleted or.]. replaced with another amino acid, such as the mutein IL-2ser125, retain IL-.Badd.2 activity. They may, therefore, be formulated and used in the same manner as native IL-2. Accordingly, such IL-2 muteins are useful for the diagnosis and treatment (local or systemic) of bacterial, viral, parasitic, protozoan and fungal infections; for augmenting cell-mediated cytotoxicity; for stimulating lymphokine activated killer cell activity; for mediating recovery of immune function of lymphocytes; for augmenting alloantigen responsiveness; for facilitating recovery of immune function in acquired immune deficient states; for reconsitution of normal immunofunction in aged humans and animals; in the development of diagnostic assays such as those employing enzyme amplification, radiolabelling, radioimaging, and other methods known in the art for monitoring IL-2 levels in the diseased state; for the promotion of T cell growth in vitro for therapeutic and diagnostic purposes for blocking receptor sites for lymphokines; and in various other therapeutic, diagnostic and research applications. The various therapeutic and diagnostic applications of human IL-2 have been investigated and reported in S. A. Rosenberg, E. A. Grimm, et al, A. Mazumder, et al, and E. A. Grimm and S. A. Rosenberg. IL-2 muteins may be used by themselves or in combination with other immunologically relevent B or T cells or other therapeutic agents. Examples of relevant cells are B or T cells, natural killer cells, and the like and exemplary therapeutic reagents which may be used in combination with the polypeptides of this invention are the various interferons, especially gamma interferon, B cell growth factor, IL-1 and the like. For therapeutic or diagnostic applications, they may be formulated in nontoxic, nonallergenic, physiologically compatible carrier media such as distilled water, Ringer's solution, Hank's solution, physiological saline and the like. Administrations of the IL-2 muteins to humans or animals may be oral or intraperitoneal or intramuscular or subcutaneous as deemed appropriate by the physician. The amount of IL-2 mutein administered will usually range between about 1×104 and 2×108 units.
Modifications of the above described modes for carrying out the invention that are obvious to those of skill in the fields of genetic engineering, protein chemistry, medicine, and related fields are intended to be within the scope of the following claims.

Claims (10)

We claim:
1. Recombinant human interleukin-2 mutein, wherein the cysteine at position 125, numbered in accordance with native human interleukin-2, is .[.deleted or.]. replaced by a neutral amino acid and said mutein exhibits the biological activity of native, human interleukin-2.
2. The mutein of claim 1 wherein said neutral amino acid is serine.
3. Human recombinant alanyl-interleukin-2serine125 mutein.
4. Human recombinant des-alanyl-interleukin-2serine125 mutein.
5. Human recombinant interleukin-2serine125 mutein which exhibits the biological activity of native human interleukin-2 and which has the deduced amino acid sequence as represented in FIG. 15b with and without N-terminal methionine.
6. The mutein of claims 1, 2, 3, 4 or 5 wherein the mutein is unglycosylated.
7. A formulation for the diagnosis or therapeutic treatment (local or systemic) of bacterial, viral, parasitic, protozoan and fungal infections; for augmenting cell-mediated cytotoxicity; for stimulating lymphokine activated killer cell activity; for mediating recovery of immune function of lymphocytes; for augmenting alloantigen responsiveness; for facilitating recovery of immune function in acquired immune deficient states; for reconstitution of normal immunofunction in aged humans and animals; in the development of diagnostic assays such as those employing enzyme amplification, radiolabelling, radioimaging; for monitoring interleukin-2 levels in the diseased state; and for the promotion of T cell growth in vitro for therapeutic and diagnostic pruposes for blocking receptor sites for lymphokines; comprising:
(a) an effective amount of a recombinant human interleukin-2 mutein, wherein the cysteine residue at position 125, numbered in accordance with native human interleukin-2, is .[.deleted or.]. replaced by a neutral amino acid and said mutein exhibits the biological activity of native, human interleukin-2; and
(b) an inert, non-allergenic, pharmaceutically compatible carrier medium.
8. The formulation of claim 7 wherein the mutein is alanyl-interleukin-2serine125 or des-alanyl-interleukin-2serine125 and said carrier is selected from the group consisting of distilled water, Ringer's solution, Hank's solution and physiological saline.
9. A formulation comprising:
(a) a recombinant human interleukin-2 mutein, wherein the cysteine residue at position 125, numbered in accordance with native human interleukin-2, is .[.deleted or.]. replaced by a neutral amino acid and said mutein exhibits the biological activity of native, human interleukin-2; and
(b) a polypeptide selected from the group consisting of gamma interferon, B cell growth factor and IL-1.
10. The formulation of claim 9 wherein the mutein is alanyl-interleukin-2serine125 or des-alanyl-interleukin-2serine125.
US07/386,207 1983-04-15 1989-07-26 Human recombinant interleukin-2 muteins Expired - Lifetime USRE33653E (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US07/386,207 USRE33653E (en) 1983-04-15 1989-07-26 Human recombinant interleukin-2 muteins
BG096074A BG60506B2 (en) 1989-07-26 1992-03-16 HUMAN RECOMBINANT INTERLEUKIN-2 MUTEINS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US48616283A 1983-04-15 1983-04-15
US07/386,207 USRE33653E (en) 1983-04-15 1989-07-26 Human recombinant interleukin-2 muteins

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
US48616283A Continuation-In-Part 1982-10-19 1983-04-15
US06/564,224 Reissue US4518584A (en) 1983-04-15 1983-12-20 Human recombinant interleukin-2 muteins

Publications (1)

Publication Number Publication Date
USRE33653E true USRE33653E (en) 1991-07-30

Family

ID=23930849

Family Applications (2)

Application Number Title Priority Date Filing Date
US06/564,224 Ceased US4518584A (en) 1983-04-15 1983-12-20 Human recombinant interleukin-2 muteins
US07/386,207 Expired - Lifetime USRE33653E (en) 1983-04-15 1989-07-26 Human recombinant interleukin-2 muteins

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US06/564,224 Ceased US4518584A (en) 1983-04-15 1983-12-20 Human recombinant interleukin-2 muteins

Country Status (1)

Country Link
US (2) US4518584A (en)

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5420019A (en) * 1993-02-02 1995-05-30 Xoma Corporation Stable bactericidal/permeability-increasing protein muteins
US5545723A (en) * 1994-03-15 1996-08-13 Biogen Inc. Muteins of IFN-β
US5965726A (en) 1992-03-27 1999-10-12 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/ instability regions of mRNA
US6008319A (en) 1996-12-23 1999-12-28 University Of Southern California Vasopermeability enhancing peptide of human interleukin-2 and immunoconjugates thereof
US20030036170A1 (en) * 1992-01-31 2003-02-20 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
US20030124678A1 (en) * 2001-08-13 2003-07-03 University Of Southern California Interleukin-2 mutants with reduced toxicity
US6602705B1 (en) 1998-12-31 2003-08-05 Chiron Corporation Expression of HIV polypeptides and production of virus-like particles
US20030198621A1 (en) * 2001-07-05 2003-10-23 Megede Jan Zur Polynucleotides encoding antigenic HIV type B and/or type C polypeptides, polypeptides and uses thereof
US20030223961A1 (en) * 2000-07-05 2003-12-04 Megede Jan Zur Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US6689879B2 (en) 1998-12-31 2004-02-10 Chiron Corporation Modified HIV Env polypeptides
US6689783B2 (en) 2001-03-29 2004-02-10 Schering Corporation Aryl oxime-piperazines useful as CCR5 antagonists
US6696063B1 (en) 1998-12-30 2004-02-24 Applied Research Systems Ars Holding N.V. Treatment of HIV-associated dysmorphia/dysmetabolic syndrome (HADDS) with or without lipodystrophy
WO2004085406A1 (en) 2003-03-24 2004-10-07 F. Hoffmann-La Roche Ag Benzyl-pyridazinons as reverse transcriptase inhibitors
US20050164185A1 (en) * 2001-12-31 2005-07-28 Gideon Schreiber Ifnar2 mutants, their production and use
US20050214256A1 (en) * 2001-08-31 2005-09-29 Chiron Corporation Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US20060029572A1 (en) * 2002-06-03 2006-02-09 Applied Research Systems Ars Holding N.V. Treatment of hepatitis c in the asian population with subcutaneous interferonbeta
US20060057115A1 (en) * 1998-12-31 2006-03-16 Zur Megede Jan Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US20070020622A1 (en) * 2001-09-14 2007-01-25 Invitrogen Corporation DNA Polymerases and mutants thereof
WO2007045573A1 (en) 2005-10-19 2007-04-26 F. Hoffmann-La Roche Ag Phenyl-acetamide nnrt inhibitors
US7211659B2 (en) 2001-07-05 2007-05-01 Chiron Corporation Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US20080025957A1 (en) * 2003-11-13 2008-01-31 Yeda Research And Development Co. Ltd. P. O. Box 95 Stem Cells Suitable for Transplantation, their Preparation and Pharmaceutical Compositions Comprising Them
WO2008019968A1 (en) 2006-08-16 2008-02-21 F. Hoffmann-La Roche Ag Non-nucleoside reverse transcriptase inhibitors
WO2008071587A2 (en) 2006-12-13 2008-06-19 F. Hoffmann-La Roche Ag 2-(piperidin-4-yl)-4-phenoxy- or phenylamino-pyrimidine derivatives as non-nucleoside reverse transcriptase inhibitors
WO2008145562A1 (en) 2007-05-30 2008-12-04 F. Hoffmann-La Roche Ag Non-nucleoside reverse transcriptase inhibitors
US20090047339A1 (en) * 1998-12-31 2009-02-19 Barnett Susan W Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
EP2042509A1 (en) 1995-07-16 2009-04-01 Yeda Research And Development Company, Ltd. Modulators of the function of FAS receptors and other proteins
EP2042196A2 (en) 2001-10-10 2009-04-01 Neose Technologies, Inc. Remodelling and glycoconjugation of Granulocyte Colony Stimulating Factor (G-CSF)
EP2045265A1 (en) 2005-09-22 2009-04-08 Biocompatibles Uk Ltd. GLP-1 fusion peptides, their production and use
EP2055189A1 (en) 2003-04-09 2009-05-06 Neose Technologies, Inc. Glycopegylation methods and proteins/peptides produced by the methods
WO2009080534A1 (en) 2007-12-21 2009-07-02 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2009098700A1 (en) 2008-02-10 2009-08-13 Yeda Research And Development Co. Ltd Siva 3, its preparation and use
US8388954B2 (en) 2003-04-09 2013-03-05 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Stabilising formulation for immunoglobulin G compositions in liquid form and in lyophilised form
US9732134B2 (en) 2009-01-21 2017-08-15 Amgen Inc. Method of treating graft versus host disease using IL-2 muteins
US10174091B1 (en) 2017-12-06 2019-01-08 Pandion Therapeutics, Inc. IL-2 muteins
US10676516B2 (en) 2017-05-24 2020-06-09 Pandion Therapeutics, Inc. Targeted immunotolerance
US10851144B2 (en) 2015-04-10 2020-12-01 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
US10946068B2 (en) 2017-12-06 2021-03-16 Pandion Operations, Inc. IL-2 muteins and uses thereof
US10961310B2 (en) 2017-03-15 2021-03-30 Pandion Operations, Inc. Targeted immunotolerance
US11491205B2 (en) 2020-01-14 2022-11-08 Synthekine, Inc. Biased IL2 muteins methods and compositions
US11739146B2 (en) 2019-05-20 2023-08-29 Pandion Operations, Inc. MAdCAM targeted immunotolerance
US11981715B2 (en) 2020-02-21 2024-05-14 Pandion Operations, Inc. Tissue targeted immunotolerance with a CD39 effector
US12091441B2 (en) 2017-11-21 2024-09-17 The Board Of Trustees Of The Leland Stanford Junior University Partial agonists of interleukin-2
USRE50550E1 (en) 2017-12-06 2025-08-26 Pandion Operations, Inc. IL-2 muteins and uses thereof

Families Citing this family (350)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4925919A (en) * 1984-04-25 1990-05-15 Roland Mertelsmann Purified interleukin 2
US6936694B1 (en) 1982-05-06 2005-08-30 Intermune, Inc. Manufacture and expression of large structural genes
US4853332A (en) * 1982-10-19 1989-08-01 Cetus Corporation Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of biologically active proteins
US4966843A (en) * 1982-11-01 1990-10-30 Cetus Corporation Expression of interferon genes in Chinese hamster ovary cells
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4816566A (en) * 1983-06-01 1989-03-28 Hoffmann-La Roche, Inc. Polypeptides having interferon activity
US4921699A (en) * 1983-06-01 1990-05-01 Hoffman-La Roche Inc. Polypeptides having interferon activity
JPS60115528A (en) * 1983-11-28 1985-06-22 Takeda Chem Ind Ltd Human interleukin-2 protein, its production and pharmacological composition containing the same
JPS60118196A (en) * 1983-11-30 1985-06-25 Takeda Chem Ind Ltd Production of interferon
US5082658A (en) * 1984-01-16 1992-01-21 Genentech, Inc. Gamma interferon-interleukin-2 synergism
US4711845A (en) * 1984-08-31 1987-12-08 Cetus Corporation Portable temperature-sensitive control cassette
US4604377A (en) * 1984-03-28 1986-08-05 Cetus Corporation Pharmaceutical compositions of microbially produced interleukin-2
US4569790A (en) * 1984-03-28 1986-02-11 Cetus Corporation Process for recovering microbially produced interleukin-2 and purified recombinant interleukin-2 compositions
US4636463A (en) * 1984-04-05 1987-01-13 Scripps Clinic And Research Foundation Antibodies to human interleukin-2 induced by synthetic polypeptides
EP0158487B1 (en) * 1984-04-09 1991-08-28 Takeda Chemical Industries, Ltd. Stable composition of interleukin-2
US4908434A (en) * 1984-04-25 1990-03-13 Sloan-Kettering Institute For Cancer Research Process for preparing purified interleukin-2
US4908433A (en) * 1984-04-25 1990-03-13 Sloan-Kettering Institute For Cancer Research Uses of interleukin-2
EP0569687B1 (en) * 1984-05-18 2002-08-21 New England Medical Center Hospitals, Inc. Human IL-1 cDNA sequences encoding biologically-active human IL-1 proteins
US4666848A (en) * 1984-08-31 1987-05-19 Cetus Corporation Polypeptide expression using a portable temperature sensitive control cassette with a positive retroregulatory element
FI862531A0 (en) 1984-10-15 1986-06-13 Cetus Corp TUMOERNEKROSISFAKTOR.
US4959314A (en) * 1984-11-09 1990-09-25 Cetus Corporation Cysteine-depleted muteins of biologically active proteins
US5342614A (en) * 1984-12-21 1994-08-30 Otsuka Pharmaceutical Co., Ltd. Method of treating arthritus or inflammation with IL-1β or derivatives thereof
US6107465A (en) * 1984-12-21 2000-08-22 Otsuka Pharmaceutical Co., Ltd. IL-1β and derivatives thereof and drugs
US4752585A (en) * 1985-12-17 1988-06-21 Cetus Corporation Oxidation-resistant muteins
CA1340265C (en) 1985-01-18 1998-12-15 Kirston E. Koths Oxidation resistant muteins
US5104650A (en) * 1985-02-05 1992-04-14 Cetus Corporation Uses of recombinant colony stimulating factor-1
US4847201A (en) * 1985-02-05 1989-07-11 Cetus Corporation DNA encoding for CSF-1 and accompanying recombinant systems
US5422105A (en) * 1985-02-05 1995-06-06 Cetus Oncology Corporation Use of recombinant colony stimulating factor 1
US5556620A (en) * 1985-02-05 1996-09-17 Cetus Oncology Corporation Use of recombinant colony stimulating factor-1 to enhance wound healing
DE3683186D1 (en) 1985-04-25 1992-02-13 Hoffmann La Roche RECOMBINANT HUMANINTERLEUKIN-1.
US4690915A (en) * 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US5239065A (en) * 1985-08-23 1993-08-24 Asahi Kasei Kogyo Kabushiki Kaisha DNA encoding human CV/2n superoxide dismutase muteins with at least serine or alanine at either or both residues 6 and 111
US4818698A (en) * 1985-08-23 1989-04-04 Toyo Jozo Co., Ltd. Polypeptides and preparation process thereof
CA1297003C (en) * 1985-09-20 1992-03-10 Jack H. Nunberg Composition and method for treating animals
US4818769A (en) * 1985-09-20 1989-04-04 Cetus Corporation Method of controlling stress-related disease in livestock by administration of human IL-2
US5643565A (en) * 1985-09-20 1997-07-01 Chiron Corporation Human IL-2 as a vaccine adjuvant
US5102872A (en) * 1985-09-20 1992-04-07 Cetus Corporation Controlled-release formulations of interleukin-2
US5100664A (en) * 1985-09-20 1992-03-31 Cetus Corporation Human IL-2 as a vaccine adjuvant
US5955315A (en) * 1985-11-19 1999-09-21 Schering Corporation Nucleic acids encoding human interleukin-4
US5017691A (en) * 1986-07-03 1991-05-21 Schering Corporation Mammalian interleukin-4
US5807996A (en) * 1985-11-19 1998-09-15 Schering Corporation Fused polypeptides comprising interleukin-4 polypeptide fragments
DK585886A (en) * 1985-12-24 1987-06-25 Takeda Chemical Industries Ltd IMMUNSTIMENTAL AGENTS AND USE THEREOF
US4933433A (en) * 1986-01-31 1990-06-12 E. I. Du Pont De Nemours And Company Recombinant interleukin-2 composition and process for making it
US4863727A (en) * 1986-04-09 1989-09-05 Cetus Corporation Combination therapy using interleukin-2 and tumor necrosis factor
US5425940A (en) * 1986-04-09 1995-06-20 Cetus Oncology Corporation Combination therapy using interleukin-2 and tumor necrosis factor
US4879111A (en) * 1986-04-17 1989-11-07 Cetus Corporation Treatment of infections with lymphokines
US5451521A (en) * 1986-05-29 1995-09-19 Genetics Institute, Inc. Procoagulant proteins
US5900476A (en) * 1986-05-30 1999-05-04 The Scripps Research Institute Therapeutic domains of van Willebrand factor
US4832686A (en) * 1986-06-24 1989-05-23 Anderson Mark E Method for administering interleukin-2
US4745180A (en) * 1986-06-27 1988-05-17 Cetus Corporation Solubilization of proteins for pharmaceutical compositions using heparin fragments
GR871029B (en) 1986-07-14 1987-11-02 Genetics Inst Novel osteoinductive factors
WO1988000970A2 (en) * 1986-08-08 1988-02-11 Regents Of The University Of Minnesota Method of culturing leukocytes
US4777242A (en) * 1986-10-10 1988-10-11 Phillips Petroleum Company Purification of recombinant tumor necrosis factor
EP0335900A4 (en) * 1986-12-19 1990-12-27 Immunex Corporation Human interleukin-4 muteins
AU1369088A (en) * 1987-02-06 1988-08-24 Genetics Institute Inc. Colony stimulating factors having reduced levels of carbohydrate
WO1988007084A1 (en) * 1987-03-12 1988-09-22 Amgen Inc. Bovine growth hormone analogs
US4938956A (en) * 1987-04-01 1990-07-03 International Minerals & Chemical Corp. Synergistic immunostimulating composition and method
CA1339757C (en) * 1987-04-16 1998-03-17 Robert F. Halenbeck Production of purified biologically active, bacterially produced recombinant human csf-1
US4931543A (en) * 1987-05-11 1990-06-05 Cetus Corporation Process for recovering microbially produced interleukin-2
US5266311A (en) * 1987-05-28 1993-11-30 Immunex Corporation Bovine interleukin-1α
US4894333A (en) * 1987-05-28 1990-01-16 Immunex Corporation Bovine interleukin-1α
US5443964A (en) * 1987-08-10 1995-08-22 Duke University Poxvirus insertion/expression vector
US5578468A (en) * 1987-08-10 1996-11-26 Duke University Site-specific RNA cleavage
US5162226A (en) 1987-08-24 1992-11-10 University Of Tennessee Research Corp. (U.T.R.C.) Therapeutic compositions against streptococcal infections, transformed hosts, methods of immunization and genetically engineered products
US5312911A (en) * 1987-10-22 1994-05-17 Merck & Co., Inc. Cysteine-modified acidic fibroblast growth factor
US5328988A (en) * 1987-10-26 1994-07-12 Immunex Corporation Interleukin-7
US5714585A (en) * 1987-10-26 1998-02-03 Sterling Winthrop, Inc. Antibodies that are immunoreactive with interleukin-7
ZA887773B (en) 1987-10-26 1989-07-26 Immunex Corp Interleukin-7
US4999339A (en) * 1988-03-28 1991-03-12 Cetus Corporation Combination therapy of IL-2 and DTIC for the treatment of melanoma
US5066489A (en) * 1988-03-28 1991-11-19 Cetus Corporation Combination therapy of IL-2 and DTIC for the treatment of melanoma
FR2635527B1 (en) * 1988-07-28 1992-06-12 Roussel Uclaf NON-GLYCOSYLATED RECOMBINANT HUMAN IL2 IN REDUCED FORM, PROCESS FOR OBTAINING IT, AND APPLICATION THEREOF AS A MEDICAMENT
US5763573A (en) * 1988-08-10 1998-06-09 Chiron Corporation GTPase activating protein fragments
US5760203A (en) * 1988-08-10 1998-06-02 Chiron Corporation Gap gene sequences
AU4525589A (en) * 1988-10-27 1990-05-14 Regents Of The University Of Minnesota Liposome immunoadjuvants containing il-2
US5811523A (en) 1988-11-10 1998-09-22 Trinchieri; Giorgio Antibodies to natural killer stimulatory factor
US5621078A (en) * 1989-03-22 1997-04-15 Merck & Co., Inc. Modified pseudomonas exotoxin PE40
AU5355790A (en) * 1989-04-19 1990-11-16 Cetus Corporation Multifunctional m-csf proteins and genes encoding therefor
US5100378A (en) * 1989-06-09 1992-03-31 Neorx Corporation Enhancement of target cell localization of lymphoid cells
US6207798B1 (en) * 1989-08-03 2001-03-27 Merck & Co., Inc. Modified PE40 toxin fusion proteins
EP0897987B1 (en) * 1989-10-24 2001-02-28 Chiron Corporation Secretion of human protein linked to gamma interferon signal peptide
CA2042093C (en) * 1990-05-09 2002-12-24 Gyula Hadlaczky Cell line carrying an excess of mammalian centromeres
IL98528A0 (en) * 1990-06-21 1992-07-15 Merck & Co Inc Pharmaceutical compositions containing hybrid for killing bladder cancer cells
US5849694A (en) * 1990-07-16 1998-12-15 Synenki; Richard M. Stable and bioactive modified porcine somatotropin and pharmaceutical compositions thereof
US5830452A (en) * 1990-11-20 1998-11-03 Chiron Corporation Method for enhancing the anti-tumor therapeutic index of interleukin-2
DE69119869T2 (en) * 1990-11-23 1996-12-12 American Cyanamid Co Chimeric fibroblast growth factor
US5250296A (en) * 1990-11-29 1993-10-05 Takeda Chemical Industries, Ltd. Immunostimulant agent containing interleukin-2 and 5'-deoxy-5-fluorouridine
AU647566B2 (en) * 1990-12-13 1994-03-24 Immunex Corporation Leukemia inhibitory factor receptors
JP3303211B2 (en) * 1991-04-26 2002-07-15 武田薬品工業株式会社 bFGF mutein and method for producing the same
IE922233A1 (en) * 1991-07-10 1993-01-13 Augusto C Ochoa Short-term anti-cd3 stimulation of lymphocytes to increase¹their in vivo activity
JPH07502734A (en) * 1991-12-31 1995-03-23 ザイモジェネティクス,インコーポレイティド Methods and compositions for reducing blood loss
US5602301A (en) * 1993-11-16 1997-02-11 Indiana University Foundation Non-human mammal having a graft and methods of delivering protein to myocardial tissue
US20030220233A1 (en) * 1994-01-24 2003-11-27 Neorx Corporation Radiolabeled annexins
US5968477A (en) * 1994-01-24 1999-10-19 Neorx Corporation Radiolabeled annexin conjugates with hexose and a chelator
US5888814A (en) * 1994-06-06 1999-03-30 Chiron Corporation Recombinant host cells encoding TNF proteins
US5582821A (en) * 1994-07-22 1996-12-10 Genetics Institute, Inc. Methods for treating bleeding disorders
US5632983A (en) 1994-11-17 1997-05-27 University Of South Florida Method for treating secondary immunodeficiency
US5814485A (en) * 1995-06-06 1998-09-29 Chiron Corporation Production of interferon-β (IFN-β) in E. coli
KR100510234B1 (en) 1995-06-29 2005-11-25 임뮤넥스 코포레이션 Cytokine that Induces Apoptosis
US6184200B1 (en) * 1995-09-28 2001-02-06 Amgen Inc. Truncated glial cell line-derived neurotrophic factor
US5731284A (en) * 1995-09-28 1998-03-24 Amgen Inc. Method for treating Alzheimer's disease using glial line-derived neurotrophic factor (GDNF) protein product
US5641750A (en) * 1995-11-29 1997-06-24 Amgen Inc. Methods for treating photoreceptors using glial cell line-derived neurotrophic factor (GDNF) protein product
US5641749A (en) * 1995-11-29 1997-06-24 Amgen Inc. Method for treating retinal ganglion cell injury using glial cell line-derived neurothrophic factor (GDNF) protein product
US5837681A (en) * 1996-02-23 1998-11-17 Amgen Inc. Method for treating sensorineural hearing loss using glial cell line-derived neurotrophic factor (GDNF) protein product
US5929041A (en) * 1996-02-23 1999-07-27 Amgen Inc. Method for preventing and treating sensorineural hearing loss and vestibular disorders using glial cell line-derived neurotrophic factor(GDNF) protein product
US5741778A (en) * 1996-03-19 1998-04-21 Amgen Inc. Method for treating Huntington's disease using glial cell line-derived neurotrophic factor (GDNF) protein product
US6025155A (en) * 1996-04-10 2000-02-15 Chromos Molecular Systems, Inc. Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
US20030033617A1 (en) * 1996-04-10 2003-02-13 Gyula Hadlaczky Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
US6077697A (en) * 1996-04-10 2000-06-20 Chromos Molecular Systems, Inc. Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
US20020160970A1 (en) * 1996-04-10 2002-10-31 Gyula Hadlaczky Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
US6455277B1 (en) * 1996-04-22 2002-09-24 Amgen Inc. Polynucleotides encoding human glial cell line-derived neurotrophic factor receptor polypeptides
US7138251B1 (en) 1996-04-22 2006-11-21 Amgen Inc. Polynucleotides encoding a neurotrophic factor receptor
ATE325621T1 (en) * 1996-05-31 2006-06-15 Nat Univ Ireland Maynooth IL-12 AS AN ADJUVANCE FOR BORDETELLA PERTUSSIS VACCINES
JP4024366B2 (en) * 1996-11-29 2007-12-19 株式会社林原生物化学研究所 Polypeptide
PT951551E (en) 1996-12-23 2008-10-28 Immunex Corp Ligand for receptor activator of nf-kappa b, ligand is member of tnf superfamily
EP2336313A1 (en) 1997-01-08 2011-06-22 Life Technologies Corporation Methods for production of proteins
AU735459B2 (en) 1997-01-30 2001-07-12 University Of Virginia Patent Foundation Cysteine-depleted peptides recognized by A3-restricted cytotoxic lymphocytes, and uses therefor
US6852508B1 (en) 1997-02-28 2005-02-08 Genetics Institute, Llc Chemokine with amino-terminal modifications
US6100387A (en) * 1997-02-28 2000-08-08 Genetics Institute, Inc. Chimeric polypeptides containing chemokine domains
US6159688A (en) 1997-03-18 2000-12-12 Novo Nordisk A/S Methods of producing polynucleotide variants
US7005295B1 (en) 1997-04-16 2006-02-28 Wyeth β-amyloid peptide-binding proteins and polynucleotides encoding the same
US6787319B2 (en) * 1997-04-16 2004-09-07 American Home Products Corp. β-amyloid peptide-binding proteins and polynucleotides encoding the same
US6384203B1 (en) 1999-05-12 2002-05-07 Immunex Corporation Family of immunoregulators designated leukocyte immunoglobulin-like receptors (LIR)
US6043221A (en) 1997-07-30 2000-03-28 Amgen Inc. Method for preventing and treating hearing loss using a neuturin protein product
WO1999012579A1 (en) 1997-09-08 1999-03-18 The General Hospital Corporation Imaging agents for early detection and monitoring of cardiovascular plaque
AU1288099A (en) 1997-10-30 1999-05-24 Cornell Research Foundation Inc. A method of inhibiting an immune response to a recombinant vector
US6110718A (en) 1998-03-20 2000-08-29 Wayne State University Mammalian putative phosphatidylinositol-4-phosphate-5-kinase
US6426191B1 (en) 1998-04-03 2002-07-30 Hyseq, Inc. Assays involving an IL-1 receptor antagonist
US6294655B1 (en) 1998-04-03 2001-09-25 Hyseq, Inc. Anti-interleukin-1 receptor antagonist antibodies and uses thereof
US6337072B1 (en) 1998-04-03 2002-01-08 Hyseq, Inc. Interleukin-1 receptor antagonist and recombinant production thereof
US6541623B1 (en) 1998-04-03 2003-04-01 Hyseq, Inc. Interleukin—1 receptor antagonist and uses thereof
US6893838B1 (en) 1998-04-07 2005-05-17 Genetics Institute Llc DADD, death activator death domain protein
US6955807B1 (en) 1998-05-15 2005-10-18 Bayer Pharmaceuticals Corporation IL-2 selective agonists and antagonists
WO1999064603A2 (en) 1998-06-12 1999-12-16 Henry M. Jackson Foundation For The Advancement Of Military Medicine ENHANCEMENT OF B CELL ACTIVATION AND IMMUNOGLOBULIN SECRETION BY CO-STIMULATION OF RECEPTORS FOR ANTIGEN AND EBV Gp350/220
US7439061B2 (en) * 1998-07-21 2008-10-21 The Regents Of The University Of Michigan DNA encoding the novel mammalian protein, Ire1p
DE69932247T2 (en) * 1998-08-21 2007-05-31 Immunex Corp., Thousand Oaks HUMAN IL-1 EPSILON DNA AND POLYPEPTIDE
US6537554B1 (en) 1998-09-10 2003-03-25 Curagen Corporation Nucleotide sequences and amino acid sequences of secreted proteins involved in angiogenesis
EP1939297A1 (en) 1998-09-24 2008-07-02 Pharmacia & Upjohn Company LLC Alzheimer's disease secretase
JP2002527064A (en) * 1998-10-13 2002-08-27 アメリカン・ホーム・プロダクツ・コーポレイション 6-protein coupled receptor-like proteins, polynucleotides encoded by them, and methods of using them
US6191256B1 (en) * 1998-11-20 2001-02-20 Bayer Corporation Recombinant factor VIII binding peptides
US6225113B1 (en) 1998-12-04 2001-05-01 Genvec, Inc. Use of trans-activation and cis-activation to modulate the persistence of expression of a transgene in an at least E4-deficient adenovirus
RU2140283C1 (en) * 1998-12-15 1999-10-27 Товарищество с ограниченной ответственностью "Биотех" Interleukin-2-base pharmaceutical preparation (variants)
JP2002534119A (en) 1999-01-14 2002-10-15 ボルダー バイオテクノロジー, インコーポレイテッド Method for producing a protein having a free cysteine residue
US6953777B2 (en) 1999-03-11 2005-10-11 Genetics Indtitute LLC Use of interleukin-11 to prevent immune-mediated cytotoxicity
ATE377077T1 (en) 1999-04-28 2007-11-15 Genetics Inst Llc HUMAN GIL-19/AE289 PROTEINS AND POLYNUCLEOTIDES CODING THEREOF
US6514729B1 (en) 1999-05-12 2003-02-04 Xencor, Inc. Recombinant interferon-beta muteins
EP1054018B1 (en) 1999-05-18 2009-01-28 Dyax Corp. Fab fragment libraries and methods for their use
US6455290B1 (en) 1999-07-09 2002-09-24 Pharmacia Italia S.P.A. Tankyrase homolog protein (THP), nucleic acids, and methods related to the same
CA2388865A1 (en) * 1999-11-16 2001-05-25 Pharmacia & Upjohn Company Novel g protein-coupled receptors
US20030082534A1 (en) * 1999-11-16 2003-05-01 Peter Lind Novel G protein-coupled receptors
WO2001062797A2 (en) * 2000-02-23 2001-08-30 Pharmacia & Upjohn Company G protein-coupled receptors
EP1274720A4 (en) 2000-04-12 2004-08-18 Human Genome Sciences Inc ALBUMIN FUSED PROTEINS
EP1935431A3 (en) 2000-05-15 2008-08-13 Health Research, Inc. Cancer treatments by using a combination of an antibody against her2 and interleukin-2
WO2001092340A2 (en) 2000-05-26 2001-12-06 Immunex Corporation Use of interleukin-4 antagonists and compositions thereof
US7259244B2 (en) 2000-06-16 2007-08-21 Nerviano Medical Sciences S.R.L. Human homologue of the DBF4/ASK1 protein, nucleic acids, and methods related to the same
US20040014082A1 (en) * 2000-08-11 2004-01-22 Invitrogen Corporation Highly homogeneous molecular markers for electrophoresis
US20030104573A1 (en) * 2000-09-11 2003-06-05 Shimkets Richard A. Nucleotide sequences and amino acid sequences of secreted proteins involved in angiogenesis
JP4071622B2 (en) * 2000-09-28 2008-04-02 バイオリジナル フード アンド サイエンス コーポレーション FAD4, FAD5, FAD5-2 and FAD6 which are members of the fatty acid desaturase family, and methods for their use
US20030215813A1 (en) * 2000-12-14 2003-11-20 Roberds Steven L. Human ion channels
US7829084B2 (en) 2001-01-17 2010-11-09 Trubion Pharmaceuticals, Inc. Binding constructs and methods for use thereof
CN101684158A (en) 2001-01-17 2010-03-31 特鲁比昂药品公司 Binding domain-immunoglobulin fusion proteins
US20050069976A1 (en) * 2001-02-14 2005-03-31 Peter Lind Protein-coupled receptor
DE60231606D1 (en) * 2001-02-27 2009-04-30 Virco Bvba CIRCULAR PROBLEMS AMPLIFICATION (CPA) OF CIRCULARIZED NUCLEIC ACID MOLECULES
US6887462B2 (en) 2001-04-09 2005-05-03 Chiron Corporation HSA-free formulations of interferon-beta
US7364890B2 (en) * 2001-07-28 2008-04-29 Midwest Research Institute Thermal tolerant avicelase from Acidothermus cellulolyticus
US7270960B2 (en) 2001-08-29 2007-09-18 Pacific Northwest Research Institute Diagnosis of ovarian carcinomas
CA2463935A1 (en) * 2001-09-18 2003-03-27 Chiron Corporation Methods for treating multiple sclerosis
ATE434624T1 (en) 2001-10-04 2009-07-15 Immunex Corp UL16 BINDING PROTEIN 4
AU2002362088A1 (en) * 2001-12-06 2003-06-23 Catholic University Method and composition for inducing weight loss
US6911321B2 (en) * 2001-12-19 2005-06-28 Genentech, Inc. Non-human primate Fc receptors and methods of use
KR101271635B1 (en) * 2001-12-21 2013-06-12 휴먼 게놈 사이언시즈, 인코포레이티드 Albumin fusion proteins
US6982080B2 (en) * 2002-03-15 2006-01-03 Wyeth Hydroxyethyl starch—containing polypeptide compositions
CA2480437A1 (en) * 2002-04-05 2003-10-30 Richard A. Fishel Methods of identifying compounds that modulate a dna repair pathway and/or retroviral infectivity, the compounds, and uses thereof
WO2003089648A1 (en) 2002-04-22 2003-10-30 Novozymes Biotech, Inc. Methods for preparing variants of a dna sequence in filamentous fungi
CA2485120C (en) 2002-05-06 2013-02-19 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services Identification of novel broadly cross-reactive hiv-1 neutralizing human monoclonal antibodies
MXPA05002219A (en) 2002-08-28 2005-07-05 Immunex Corp Compositions and methods for treating cardiovascular disease.
CA2498319A1 (en) * 2002-09-09 2004-03-18 Nautilus Biotech Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules
CN1688293A (en) * 2002-09-16 2005-10-26 韦思公司 Delayed release formulations for oral administration of a polypeptide therapeutic agent and methods of using same
ATE546521T1 (en) 2002-10-04 2012-03-15 Firmenich & Cie SESQUITERPENE SYNTHASES AND METHODS OF USE
AU2003273640A1 (en) * 2002-10-10 2004-05-04 K.U. Leuven Research And Development Autism gene
US20040175359A1 (en) * 2002-11-12 2004-09-09 Desjarlais John Rudolph Novel proteins with antiviral, antineoplastic, and/or immunomodulatory activity
US7847084B2 (en) 2002-12-20 2010-12-07 Board Of Regents, The University Of Texas System VMP-like sequences of pathogenic Borrelia species and strains
ATE554108T1 (en) 2003-07-25 2012-05-15 Amgen Inc PROCEDURES REGARDING LDCAM AND CRTAM
WO2005016380A1 (en) * 2003-07-30 2005-02-24 Chiron Corporation Methods of therapy for chronic lymphocytic leukemia
US20070274988A1 (en) * 2003-10-10 2007-11-29 Five Prime Therapeautics, Inc. Kiaa0779, Splice Variants Thereof, and Methods of Their Use
JP4746552B2 (en) 2003-11-04 2011-08-10 ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド Use of antagonist anti-CD40 antibodies for the treatment of autoimmune and inflammatory diseases and organ transplant rejection
AU2004297988A1 (en) * 2003-12-04 2005-06-23 Laboratoires Serono Sa Methods for identifying modulators of active KIT tyrosine kinase receptor
EP1723251A4 (en) * 2004-03-05 2008-04-23 Novartis Vaccines & Diagnostic IN VITRO TESTING SYSTEM FOR PREDICTING THE TOLERABILITY OF THERAPEUTIC AGENTS IN PATIENTS
MY146381A (en) 2004-12-22 2012-08-15 Amgen Inc Compositions and methods relating relating to anti-igf-1 receptor antibodies
CN101238214A (en) * 2005-05-19 2008-08-06 拜尔先灵制药股份公司 Treating Disease Using Improved Regulatory Expression Systems
US20070179113A1 (en) * 2005-05-19 2007-08-02 Schering Aktiengesellachaft GM-CSF gene therapy for Crohn's disease using an improved regulated expression system
US20080076729A1 (en) * 2005-05-19 2008-03-27 Schering Aktiengesellachaft Interferon-beta gene therapy using an improved, regulated expression system
GT200600210A (en) * 2005-05-19 2007-01-03 Schering Ag GENE INTERFERON-BETA THERAPY USDANDO AN IMPROVED REGULATED EXPRESSION SYSTEM
BRPI0617057A2 (en) 2005-08-30 2011-07-12 Univ Miami isolated antibody, tumor necrosis factor 25 receptor-specific toxin (tnfr25), method for activating tumor necrosis factor 25 receptor (tnfr25), method for inhibiting tumor necrosis factor 25 receptor (tnfr25) signaling in a cell , antitumor vaccine, method for immunizing a patient against tumor, method for treating cancer in a patient, method for treating and / or preventing intestinal inflammation, therapeutic composition for facilitating an organ transplant, method for transplanting tissue from a donor to a host, method for inhibiting clonal expression of a cognate cd8 t cell population, method for treating and / or preventing pulmonary inflammation, isolated tnfr25 antagonist, composition and expression vector
US8026354B2 (en) 2005-11-23 2011-09-27 Institut Pasteur Recombinant plasmodium falciparum merozoite surface proteins 4 and 5 and their use
US8088729B2 (en) 2005-12-01 2012-01-03 The United States Of America As Represented By The Secretary, Department Of Health And Human Services Anti-viral griffithsin compounds, compositions and methods of use
DK1971361T3 (en) 2005-12-23 2014-09-08 James D Kelly Enhanced glycoforms of thyroid stimulating hormone receptor polypeptide agonist for the treatment of metabolic syndrome
US7868228B2 (en) 2006-01-31 2011-01-11 Monsanto Technology Llc Phosphopantetheinyl transferases from bacteria
WO2007110231A2 (en) * 2006-03-28 2007-10-04 Nautilus Biotech, S.A. MODIFIED INTERFERON-β (IFN-β) POLYPEPTIDES
US8129334B2 (en) 2006-03-31 2012-03-06 The Regents Of The University Of California Methods and compositions for treating neurodegenerative disorders and Alzheimer'S disease and improving normal memory
EP1872790A1 (en) 2006-06-26 2008-01-02 DeveloGen Aktiengesellschaft New formulation for increasing bioavailability of neurturin
US20080069796A1 (en) * 2006-07-31 2008-03-20 Kim Jong-Mook Low Dose Treatment with an Interleukin-11 Analog
CL2007002567A1 (en) 2006-09-08 2008-02-01 Amgen Inc ISOLATED PROTEINS FROM LINK TO ACTIVINE TO HUMAN.
WO2008125222A2 (en) * 2007-04-11 2008-10-23 Bayer Schering Pharma Aktiengesellschaft New modulation molecules for an improved regulated expression system
KR20100019467A (en) * 2007-05-02 2010-02-18 암브룩스, 인코포레이티드 Modified interferon beta polypeptides and their uses
US7982016B2 (en) 2007-09-10 2011-07-19 Amgen Inc. Antigen binding proteins capable of binding thymic stromal lymphopoietin
US8273561B2 (en) * 2007-10-05 2012-09-25 Nuron Biotech, Inc. High pressure treatment of aggregated interferons
KR101041986B1 (en) 2008-03-06 2011-06-16 (주)한국비엠아이 Novel Strains for Mass Production of Human Interleukin-2
WO2009152610A1 (en) * 2008-06-20 2009-12-23 The Royal Institution For The Advancement Of Learning/Mcgill University Interleukin-2/soluble tgf-beta type ii receptor b conjugates and methods and uses thereof
WO2010045324A1 (en) 2008-10-14 2010-04-22 Monsanto Technology Llc Utilization of fatty acid desaturases from hemiselmis spp.
CA2741373A1 (en) 2008-10-30 2010-06-03 Peixuan Guo Membrane-integrated viral dna-packaging motor protein connector biosensor for dna sequencing and other uses
WO2010062960A2 (en) 2008-11-26 2010-06-03 Cedars-Sinai Medical Center METHODS OF DETERMINING RESPONSIVENESS TO ANTI-TNFα THERAPY IN INFLAMMATORY BOWEL DISEASE
WO2010113039A1 (en) 2009-04-03 2010-10-07 Medical Research Council Mutants of activation-induced cytidine deaminase (aid) and methods of use
DK2462165T3 (en) 2009-08-03 2016-08-29 Univ Miami Method for in vivo proliferation of regulatory T cells
US20120219583A1 (en) 2009-10-16 2012-08-30 Los Alamos National Security, Llc Nucleic acid sequences encoding expandable hiv mosaic proteins
US20110117092A1 (en) * 2009-10-20 2011-05-19 The Regents Of The University Of Michigan Compositions and methods for inhibiting g-csfr
JP6139885B2 (en) * 2009-10-26 2017-05-31 ジェネンテック, インコーポレイテッド Assays for detecting antibodies specific for therapeutic anti-IgE antibodies and their use in anaphylaxis
US9078448B2 (en) 2009-10-28 2015-07-14 Fundo de Defesa da Citricultura—Fundecitrus Repellent compositions and genetic approaches for controlling huanglongbing
KR102591732B1 (en) * 2010-11-12 2023-10-19 넥타르 테라퓨틱스 Conjugates of an il-2 moiety and a polymer
WO2012083297A2 (en) 2010-12-17 2012-06-21 Genvec, Inc. Adenoviral vectors with modified hexon regions
WO2012088041A1 (en) 2010-12-20 2012-06-28 Genvec, Inc. Adenoviral vector-based dengue fever vaccine
WO2015089217A2 (en) 2013-12-10 2015-06-18 Bionz, Llc Methods of developing selective peptide antagonists
ES2778053T3 (en) 2011-01-18 2020-08-07 Bioniz Llc Compositions to modulate gamma-c cytokine activity
EP2670426B1 (en) 2011-01-31 2017-05-10 The General Hospital Corporation Multimodal trail molecules and uses in cellular therapies
AU2012212075A1 (en) 2011-02-02 2013-07-18 Amgen Inc. Methods and compositons relating to inhibition of IGF-1R
HUE029139T2 (en) 2011-02-10 2017-02-28 Roche Glycart Ag Mutant interleukin-2 polypeptides
RU2766157C2 (en) 2011-06-01 2022-02-08 Интрексон Актобиотикс Н.В. Polycistronic expression system for bacteria
WO2013009971A1 (en) 2011-07-12 2013-01-17 E. I. Du Pont De Nemours And Company Detection and screening method and materials useful in performance thereof
CA2865170C (en) 2012-02-21 2020-12-22 Cytonics Corporation Systems, compositions, and methods for transplantation
US9434779B2 (en) 2012-03-19 2016-09-06 The Brigham And Women's Hospital, Inc. Growth differentiation factor 11 (GDF-11) for treatment of diastolic heart failure
EP2847219A1 (en) 2012-05-07 2015-03-18 Amgen Inc. Anti-erythropoietin antibodies
PT2854840T (en) 2012-05-30 2018-03-02 Harvard College GENETICALLY MODIFIED BOTULINAL NEUROTOXIN
WO2014004549A2 (en) 2012-06-27 2014-01-03 Amgen Inc. Anti-mesothelin binding proteins
WO2014018113A1 (en) 2012-07-24 2014-01-30 The General Hospital Corporation Oncolytic virus therapy for resistant tumors
AU2013295647B2 (en) 2012-07-26 2018-02-08 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Multimeric fusion protein vaccine and immunotherapeutic
US20140044675A1 (en) 2012-08-10 2014-02-13 Roche Glycart Ag Interleukin-2 fusion proteins and uses thereof
WO2014035474A1 (en) 2012-08-30 2014-03-06 The General Hospital Corporation Compositions and methods for treating cancer
US9309318B2 (en) 2012-10-17 2016-04-12 Amgen, Inc. Compositions relating to anti-IL-21 receptor antibodies
US20140161767A1 (en) * 2012-11-15 2014-06-12 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Follicle-stimulating hormone (fsh)/lytic domain fusion constructs and methods of making and using same
CA2897826C (en) 2013-01-09 2022-09-27 Taylor H. Schreiber Compositions and methods for the regulation of t regulatory cells using tl1a-ig fusion protein
SG11201505960VA (en) 2013-02-01 2015-08-28 Santa Maria Biotherapeutics Inc Administration of an anti-activin-a compound to a subject
US9951340B2 (en) 2013-03-07 2018-04-24 The General Hospital Corporation Compositions and methods for bacterial delivery of polypeptides
JP6469644B2 (en) 2013-03-15 2019-02-13 アムジエン・インコーポレーテツド Methods and compositions related to anti-CCR7 antigen binding proteins
KR20230109779A (en) 2013-03-27 2023-07-20 세다르스-신나이 메디칼 센터 Mitigation and reversal of fibrosis and inflammation by inhibition of tl1a function and related signaling pathways
US10092627B2 (en) 2013-04-08 2018-10-09 President And Fellows Of Harvard College Methods and compositions for rejuvenating skeletal muscle stem cells
US9988617B2 (en) 2013-05-21 2018-06-05 President And Fellows Of Harvard College Engineered heme-binding compositions and uses thereof
EP3007719B1 (en) 2013-06-11 2021-03-17 President and Fellows of Harvard College Methods and compositions for increasing neurogenesis and angiogenesis
US9803017B2 (en) 2013-07-05 2017-10-31 University Of Washington Through Its Center For Commercialization Soluble MIC neutralizing monoclonal antibody for treating cancer
EP4105236A1 (en) 2013-07-19 2022-12-21 Cedars-Sinai Medical Center Anti-tl1a (tnfsf15) antibody for treatment of inflammatory bowel disease
WO2015031654A2 (en) 2013-08-28 2015-03-05 Cytonics Corporation Systems, compositions, and methods for transplantation and treating conditions
EP3082834B1 (en) 2013-12-11 2020-03-11 The General Hospital Corporation DBA Massachusetts Stem cell delivered oncolytic herpes simplex virus and methods for treating brain tumors
AU2015204680B2 (en) 2014-01-09 2019-07-11 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Anti-viral cnidarins
US9994885B2 (en) 2014-01-22 2018-06-12 Regents Of The University Of Michigan Nonribosomal peptide synthetases
US9487763B2 (en) 2014-01-22 2016-11-08 Regents Of The University Of Michigan Nonribosomal peptide synthetases
RS58149B1 (en) 2014-02-06 2019-02-28 Hoffmann La Roche Interleukin-2 fusion proteins and uses thereof
JP6861152B2 (en) 2014-11-20 2021-04-21 サイトニックス コーポレイション Therapeutic variant alpha 2-macroglobulin composition
US10889631B2 (en) 2014-11-20 2021-01-12 Cytonics Corporation Therapeutic variant alpha-2-macroglobulin compositions
CN105669863B (en) 2014-12-05 2019-09-13 鸿运华宁(杭州)生物医药有限公司 An antibody that can specifically bind to human endothelin receptor and its application
HK1248737A1 (en) 2015-03-26 2018-10-19 哈佛大学校长及研究员协会 Engineered botulinum neurotoxin
WO2016168601A1 (en) 2015-04-17 2016-10-20 Khalid Shah Agents, systems and methods for treating cancer
JP2018522547A (en) 2015-06-15 2018-08-16 モナッシュ ユニバーシティ IL-37 variant
US11753633B2 (en) 2015-08-27 2023-09-12 President And Fellows Of Harvard College Compositions and methods for treatment of pain
JP7628764B2 (en) 2015-09-29 2025-02-12 アムジエン・インコーポレーテツド mod folkpon edge cargogo search carrier Signalsure procedure always Subaturch curl carrieresert match experiencesch suffer with Japan missed crgoc car
EP3359556B1 (en) 2015-10-09 2021-05-26 Bioniz, LLC Modulating gamma - c -cytokine activity
US10703786B2 (en) 2015-10-30 2020-07-07 The University Of Melbourne Methods and compositions for improving glucose metabolism
AU2016368469B2 (en) 2015-12-09 2023-11-02 F. Hoffmann-La Roche Ag Type II anti-CD20 antibody for reducing formation of anti-drug antibodies
EP3178848A1 (en) 2015-12-09 2017-06-14 F. Hoffmann-La Roche AG Type ii anti-cd20 antibody for reducing formation of anti-drug antibodies
US10905727B2 (en) 2016-01-14 2021-02-02 Intrexon Actobiotics N.V. Compositions and methods for the treatment of type 1 diabetes
KR20180127416A (en) 2016-03-17 2018-11-28 세다르스-신나이 메디칼 센터 Diagnosis of Inflammatory Bowel Disease through RNASET2
CN109478421B (en) 2016-05-25 2024-07-09 豪夫迈·罗氏有限公司 Materials and methods related to dosage regimen design
TWI826351B (en) 2016-05-31 2023-12-21 大陸商鴻運華寧(杭州)生物醫藥有限公司 R antibodies, their pharmaceutical compositions and uses
EP3504226A1 (en) 2016-08-24 2019-07-03 President and Fellows of Harvard College Engineered botulinum neurotoxin
EP3529616B1 (en) 2016-10-20 2023-09-06 President and Fellows of Harvard College In vitro and cell based assays for measuring the activity of botulinum neurotoxins
CN118240830A (en) 2016-10-26 2024-06-25 西达-赛奈医疗中心 Neutralizing anti-TL1A monoclonal antibody
EP3568466A4 (en) 2017-01-10 2020-07-15 The General Hospital Corporation TARGETED T-CELLS WITH CYTOTOXICITY TO IMMUNE-SUPPRESSIVE CELLS
CA3048648A1 (en) 2017-01-10 2018-07-19 The General Hospital Corporation T cells expressing a chimeric antigen receptor
CA3092434A1 (en) 2017-02-27 2018-08-30 Caerus Therapeutics, Inc. Compositions of a novel anti-human ceacam6 antibody and uses thereof
CN110913954A (en) 2017-03-03 2020-03-24 黑曜石疗法公司 Compositions and methods of immunotherapy
EP3595721B1 (en) 2017-03-16 2025-07-09 The General Hospital Corporation Chimeric antigen receptors targeting cd37
EP4201953A1 (en) 2017-04-03 2023-06-28 F. Hoffmann-La Roche AG Immunoconjugates of an anti-pd-1 antibody with a mutant il-2 or with il-15
JP7148539B2 (en) 2017-04-03 2022-10-05 エフ・ホフマン-ラ・ロシュ・アクチェンゲゼルシャフト immunoconjugate
KR20240142577A (en) 2017-04-07 2024-09-30 바이오니즈 테라퓨틱스, 아이엔씨. Stable modulators of gamma-c-cytokine activity
CA3058279A1 (en) 2017-04-13 2018-10-18 F.Hoffmann-La Roche Ag An interleukin-2 immunoconjugate, a cd40 agonist, and optionally a pd-1 axis binding antagonist for use in methods of treating cancer
CA3059444A1 (en) 2017-04-14 2018-10-18 The General Hospital Corporation Chimeric antigen receptor t cells targeting the tumor microenvironment
CN112105632A (en) * 2018-01-24 2020-12-18 北京智康博药肿瘤医学研究有限公司 Cytokine fusion proteins
EP3743095A1 (en) 2018-01-26 2020-12-02 Celldex Therapeutics, Inc. Methods of treating cancer with dendritic cell mobilizing agents
CN117003874A (en) 2018-03-20 2023-11-07 鸿运华宁(杭州)生物医药有限公司 GIPR antibodies and their fusion proteins with GLP-1, as well as pharmaceutical compositions and applications thereof
US12337027B2 (en) 2018-03-22 2025-06-24 The Children's Medical Center Corporation Methods and compositions relating to lung repair
CN110357959B (en) 2018-04-10 2023-02-28 鸿运华宁(杭州)生物医药有限公司 GCGR antibody, fusion protein of GCGR antibody and GLP-1, and pharmaceutical composition and application of GCGR antibody and fusion protein
CN112585165B8 (en) 2018-04-25 2025-02-14 普罗米修斯生物科学公司 Optimized anti-TL1A antibody
US12522811B2 (en) 2018-05-01 2026-01-13 The Children's Medical Center Corporation Enhanced BCL11A RNP / CRISPR delivery and editing using a 3XNLS-CAS9
US20220403001A1 (en) 2018-06-12 2022-12-22 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
SG11202012299SA (en) 2018-06-13 2021-01-28 Akron Biotechnology Llc Method to prepare therapeutically active aldesleukin highly stable in liquid pharmaceutical compositions
CN112566931A (en) 2018-06-13 2021-03-26 儿童医疗中心有限公司 Methods and compositions relating to high throughput models for antibody discovery and/or optimization
CN119613548A (en) 2018-06-13 2025-03-14 鸿运华宁(杭州)生物医药有限公司 APJ antibody and its fusion protein with Elabela, as well as its pharmaceutical composition and application
EP3854805A4 (en) 2018-09-21 2022-08-24 Innovent Biologics (Suzhou) Co., Ltd. NEW INTERLEUKIN 2 AND ITS USE
US12269855B2 (en) 2018-09-21 2025-04-08 Innovent Biologics (Suzhou) Co., Ltd. Interleukin-2 and use thereof
US20220000976A1 (en) 2018-11-09 2022-01-06 The Children's Medical Center Corporation Methods and compositions for treating or preventing the development of food allergies
EP3930757A1 (en) 2019-03-01 2022-01-05 President And Fellows Of Harvard College Methods and compositions for protein delivery
US20220257767A1 (en) 2019-04-03 2022-08-18 President And Fellows Of Harvard College Ionic liquids for drug delivery
JP2022530677A (en) 2019-05-03 2022-06-30 バイオニズ リミテッド ライアビリティー カンパニー Modulation of the effects of γc cytokine signaling for the treatment of alopecia and alopecia-related disorders
TW202115115A (en) 2019-07-02 2021-04-16 瑞士商赫孚孟拉羅股份公司 Immunoconjugates
JP2022540865A (en) 2019-07-12 2022-09-20 モナッシュ ユニバーシティ Methods for making recombinant proteins
CN112239507A (en) 2019-07-17 2021-01-19 鸿运华宁(杭州)生物医药有限公司 Fusion protein of ETA antibody and TGF-β Trap, and its pharmaceutical composition and application
CN112521501A (en) 2019-09-18 2021-03-19 鸿运华宁(杭州)生物医药有限公司 GIPR antibody and fusion protein thereof with GLP-1, and pharmaceutical composition and application thereof
AU2020356592A1 (en) 2019-09-27 2022-04-07 Intrexon Actobiotics Nv D/B/A Precigen Actobio Treatment of celiac disease
CN114901311A (en) 2019-10-24 2022-08-12 普罗米修斯生物科学公司 Humanized antibodies to TNF-like ligand 1A (TL1A) and uses thereof
WO2021102084A1 (en) 2019-11-22 2021-05-27 President And Fellows Of Harvard College Ionic liquids for drug delivery
IL293978A (en) 2019-12-20 2022-08-01 Regeneron Pharma Novel il2 agonists and methods of use thereof
JP7751581B2 (en) 2019-12-20 2025-10-08 エフ・ホフマン-ラ・ロシュ・アクチェンゲゼルシャフト IL-37 fusion proteins and uses thereof
IL294715A (en) 2020-01-23 2022-09-01 Childrens Medical Ct Corp Inducible t-cell differentiation from human pluripotent stem cells
GB2594683A (en) 2020-02-17 2021-11-10 Vaxbio Ltd Vaccine
GB202003611D0 (en) 2020-03-12 2020-04-29 Univ Oxford Innovation Ltd Stabilised viral fusion proteins
JP2023518434A (en) 2020-03-19 2023-05-01 イノベント バイオロジクス(スーチョウ)カンパニー,リミティド Interleukin-2 mutants and uses thereof
EP4122951A4 (en) 2020-03-19 2024-05-29 Innovent Biologics (Singapore) Pte. Ltd. INTERLEUKIN-2 MUTANT AND USE THEREOF
GB202006803D0 (en) 2020-05-07 2020-06-24 Imperial College Innovations Ltd Method for identifying RNA binding protein binding sites on RNA
CA3177288A1 (en) 2020-05-11 2021-11-18 F.Hoffmann-La Roche Ag Combination therapy with modified pbmcs and an immunoconjugate
MX2022015203A (en) 2020-06-19 2023-01-05 Hoffmann La Roche BINDING MOLECULES TO THE FC DOMAIN OF IMMUNE ACTIVATION.
GB2596820A (en) 2020-07-07 2022-01-12 Spicona Inc Combination vaccine
KR20230152783A (en) 2020-07-07 2023-11-03 칸큐어 엘엘씨 Mic antibodies and binding agents and methods of using the same
CA3184852A1 (en) 2020-07-10 2022-01-13 Lida Katsimpardi Use of gdf11 to diagnose and treat anxiety and depression
KR20230040359A (en) 2020-07-17 2023-03-22 트르스티스 오브 보스톤 유니버시티 Virus detection system and its use
TW202406932A (en) 2020-10-22 2024-02-16 美商基利科學股份有限公司 Interleukin-2-fc fusion proteins and methods of use
US12024559B2 (en) 2020-10-23 2024-07-02 Asher Biotherapeutics, Inc. Fusions with CD8 antigen binding molecules for modulating immune cell function
AU2021393752A1 (en) 2020-12-04 2023-05-18 F. Hoffmann-La Roche Ag Ph-dependent mutant interleukin-2 polypeptides
WO2022148853A1 (en) 2021-01-11 2022-07-14 F. Hoffmann-La Roche Ag Immunoconjugates
CN117062611A (en) 2021-01-26 2023-11-14 惠和生物技术(上海)有限公司 Chimeric Antigen Receptor (CAR) constructs and NK cells expressing the CAR constructs
KR20230152032A (en) 2021-02-03 2023-11-02 모차르트 쎄라퓨틱스 인코포레이티드 Binding agents and how to use them
CN115141276A (en) 2021-03-31 2022-10-04 鸿运华宁(杭州)生物医药有限公司 Antibody capable of being specifically combined with human endothelin receptor and application thereof in treatment of diabetic nephropathy and chronic nephropathy
EP4319820A1 (en) 2021-04-10 2024-02-14 Profoundbio Us Co. Folr1 binding agents, conjugates thereof and methods of using the same
JP7742892B2 (en) 2021-04-23 2025-09-22 ジェンマブ エー/エス Anti-CD70 antibodies, conjugates thereof and methods of using same
TW202317623A (en) 2021-06-14 2023-05-01 美商再生元醫藥公司 Il2-based therapeutics and methods of use thereof
JP2024529341A (en) 2021-07-15 2024-08-06 プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ Compositions and methods relating to particle-attached cells - Patents.com
PE20241994A1 (en) 2021-09-22 2024-09-27 Fortvita Biologics Singapore Pte Ltd INTERLEUKIN-2 MUTANT PROTEIN AND FUSION OF THE SAME
IL311885A (en) 2021-10-08 2024-06-01 Harvard College Ionic liquids for drug delivery
WO2023076876A1 (en) 2021-10-26 2023-05-04 Mozart Therapeutics, Inc. Modulation of immune responses to viral vectors
CA3238167A1 (en) 2021-11-19 2023-05-25 Maria Leia Smith Gpc3 binding agents, conjugates thereof and methods of using the same
AU2023276766A1 (en) 2022-05-27 2024-12-05 Regeneron Pharmaceuticals, Inc. Interleukin-2 proproteins and uses thereof
US20230391844A1 (en) 2022-06-04 2023-12-07 Regeneron Pharmaceuticals, Inc. Interleukin-2 proproteins and uses thereof
JP2025531814A (en) 2022-09-08 2025-09-25 ジーマックス バイオファーム エルエルシー GIPR antibody, fusion protein with FGF21, pharmaceutical composition thereof, and use thereof
EP4651886A1 (en) 2023-01-20 2025-11-26 F. Hoffmann-La Roche AG Immunoconjugates
EP4713356A1 (en) 2023-05-16 2026-03-25 F. Hoffmann-La Roche AG Pd-1-regulated il-2 immunocytokine and uses thereof
TW202506733A (en) 2023-06-12 2025-02-16 美商安進公司 Lymphotoxin beta receptor agonist binding proteins
WO2025072406A1 (en) 2023-09-26 2025-04-03 Profoundbio Us Co. Ptk7 binding agents, conjugates thereof and methods of using the same
WO2025117639A1 (en) 2023-11-27 2025-06-05 Profoundbio Us Co. Antibodies and methods for ptk7 detection
TW202547866A (en) 2024-01-10 2025-12-16 丹麥商珍美寶股份有限公司 Slitrk6 binding agents, conjugates thereof and methods of using the same
TW202545980A (en) 2024-02-01 2025-12-01 瑞典商阿斯特捷利康公司 Cd8-binding cytokine engagers and methods of use thereof
US20250381289A1 (en) 2024-02-29 2025-12-18 Genmab A/S Egfr and c-met bispecific binding agents, conjugates thereof and methods of using the same
WO2025232879A1 (en) 2024-05-10 2025-11-13 Cytocares (Shanghai) Inc. Anti-lilrb2 monospecific and bispecific antibody constructs and uses thereof
US20260048137A1 (en) 2024-08-16 2026-02-19 Ardeagen Corporation Anti-mesothelin antibody conjugates and methods of use thereof
WO2026076013A1 (en) 2024-10-01 2026-04-09 Regeneron Pharmaceuticals, Inc. Tumor-targeted il2 receptor agonists and multispecific t-cell engagers

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0028033A2 (en) * 1979-10-30 1981-05-06 Juridical Foundation Japanese Foundation for Cancer Research Double-stranded DNA which codes for a polypeptide with human fibroblast interferon activity, cloned DNA, recombinant plasmid containing the DNA and microorganism containing the recombinant plasmid
EP0041313A2 (en) * 1980-04-03 1981-12-09 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing human fibroblast interferon
EP0042246A2 (en) * 1980-06-12 1981-12-23 The Cancer Institute Of Japanese Foundation For Cancer Research Plasmid
US4401756A (en) * 1981-04-14 1983-08-30 Immunex Corporation Process for preparing human interleukin 2
US4414150A (en) * 1980-11-10 1983-11-08 Genentech, Inc. Hybrid human leukocyte interferons
US4448879A (en) * 1981-03-26 1984-05-15 Hooper Trading Company High yield process for in vitro production of serum-free and mitogen-free interleukin-2
US4490289A (en) * 1982-09-16 1984-12-25 Hoffmann-La Roche Inc. Homogeneous human interleukin 2
US4564593A (en) * 1981-12-28 1986-01-14 Takeda Chemical Industries, Ltd. Messenger RNA, production and use thereof
US4738927A (en) * 1982-03-31 1988-04-19 Ajinomoto Co. Inc. Gene coded for interleukin-2 polypeptide, recombinant DNA carrying the said gene, a living cell line possessing the recombinant DNA, and method for producing interleukin-2 using the said cell
US4778879A (en) * 1982-04-20 1988-10-18 Sloan-Kettering Institute For Cancer Research Highly purified human interleukin 2 and method

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0028033A2 (en) * 1979-10-30 1981-05-06 Juridical Foundation Japanese Foundation for Cancer Research Double-stranded DNA which codes for a polypeptide with human fibroblast interferon activity, cloned DNA, recombinant plasmid containing the DNA and microorganism containing the recombinant plasmid
EP0041313A2 (en) * 1980-04-03 1981-12-09 Biogen, Inc. DNA sequences, recombinant DNA molecules and processes for producing human fibroblast interferon
EP0042246A2 (en) * 1980-06-12 1981-12-23 The Cancer Institute Of Japanese Foundation For Cancer Research Plasmid
US4414150A (en) * 1980-11-10 1983-11-08 Genentech, Inc. Hybrid human leukocyte interferons
US4448879A (en) * 1981-03-26 1984-05-15 Hooper Trading Company High yield process for in vitro production of serum-free and mitogen-free interleukin-2
US4401756A (en) * 1981-04-14 1983-08-30 Immunex Corporation Process for preparing human interleukin 2
US4564593A (en) * 1981-12-28 1986-01-14 Takeda Chemical Industries, Ltd. Messenger RNA, production and use thereof
US4738927A (en) * 1982-03-31 1988-04-19 Ajinomoto Co. Inc. Gene coded for interleukin-2 polypeptide, recombinant DNA carrying the said gene, a living cell line possessing the recombinant DNA, and method for producing interleukin-2 using the said cell
US4778879A (en) * 1982-04-20 1988-10-18 Sloan-Kettering Institute For Cancer Research Highly purified human interleukin 2 and method
US4490289A (en) * 1982-09-16 1984-12-25 Hoffmann-La Roche Inc. Homogeneous human interleukin 2

Non-Patent Citations (30)

* Cited by examiner, † Cited by third party
Title
Allen et al., Nature, vol. 287, pp. 408 410, (1980). *
Allen et al., Nature, vol. 287, pp. 408-410, (1980).
Altman et al., Proc. Natl. Acad. Sci., vol. 81, pp. 2176 2180, (1984). *
Altman et al., Proc. Natl. Acad. Sci., vol. 81, pp. 2176-2180, (1984).
Glossary of Genetics and Cytogenetics, 4th Ed., p. 381, Springer Verlag, (1976). *
Glossary of Genetics and Cytogenetics, 4th Ed., p. 381, Springer-Verlag, (1976).
Goeddel et al., Nucleic Acids Research, vol. 8, No. 18, pp. 4057 4074, (1980). *
Goeddel et al., Nucleic Acids Research, vol. 8, No. 18, pp. 4057-4074, (1980).
Knight et al., J. Interferon Res., vol. 2, No. 3, pp. 421 429, (1982). *
Knight et al., J. Interferon Res., vol. 2, No. 3, pp. 421-429, (1982).
Lathe et al., Genetic Engineering, Academic Press, (1983), pp. 31 50. *
Lathe et al., Genetic Engineering, Academic Press, (1983), pp. 31-50.
Levy et al., PNAS, vol. 78, No. 10, pp. 6186 6190, (1981). *
Levy et al., PNAS, vol. 78, No. 10, pp. 6186-6190, (1981).
Liang et al., J. Biol. Chem., vol. 261, No. 1, pp. 334 337, (1986). *
Liang et al., J. Biol. Chem., vol. 261, No. 1, pp. 334-337, (1986).
Shepard et al., Nature, vol. 294, pp. 563 565, (1981). *
Shepard et al., Nature, vol. 294, pp. 563-565, (1981).
Shiroishi et al., Proc. Natl. Acad. Sci., vol. 81, pp. 7544 7548, (1984). *
Shiroishi et al., Proc. Natl. Acad. Sci., vol. 81, pp. 7544-7548, (1984).
Smith et al., Genetic Engineering, Principles and Methods, Plenum Press, (1981), 3:1 32. *
Smith et al., Genetic Engineering, Principles and Methods, Plenum Press, (1981), 3:1-32.
Stern et al., Proc. Natl. Acad. Sci., vol. 81, pp. 871 875, (1984). *
Stern et al., Proc. Natl. Acad. Sci., vol. 81, pp. 871-875, (1984).
Taniguchi et al., Gene, vol. 10, pp. 11 15, (1980). *
Taniguchi et al., Gene, vol. 10, pp. 11-15, (1980).
Taniguchi et al., Nature, vol. 285, pp. 547 549, (1980). *
Taniguchi et al., Nature, vol. 285, pp. 547-549, (1980).
Taniguchi et al., PNAS, vol. 77, No. 9, pp. 5230 5233, (1980). *
Taniguchi et al., PNAS, vol. 77, No. 9, pp. 5230-5233, (1980).

Cited By (111)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030036170A1 (en) * 1992-01-31 2003-02-20 Aventis Behring L.L.C. Fusion polypeptides of human serum albumin and a therapeutically active polypeptide
US7081354B2 (en) 1992-01-31 2006-07-25 Aventis Behring L.L.C. Interleukin and albumin fusion protein
US6291664B1 (en) 1992-03-27 2001-09-18 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/instability regions of mRNA
US6414132B1 (en) 1992-03-27 2002-07-02 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/instability regions of mRNA
US6794498B2 (en) 1992-03-27 2004-09-21 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/instability regions of mRNA
US5965726A (en) 1992-03-27 1999-10-12 The United States Of America As Represented By The Department Of Health And Human Services Method of eliminating inhibitory/ instability regions of mRNA
US5972596A (en) 1992-03-27 1999-10-26 The United States Of America As Represented By The Department Of Health And Human Services Nucleic acid constructs containing HIV genes with mutated inhibitory/instability regions and methods of using same
US5827816A (en) * 1993-02-02 1998-10-27 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5674834A (en) * 1993-02-02 1997-10-07 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US6433140B1 (en) 1993-02-02 2002-08-13 Xoma Corporation Stable bactericidal permeability-increasing protein products and pharmaceutical compositions containing the same
US20060009383A1 (en) * 1993-02-02 2006-01-12 Georgia Theofan Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5420019A (en) * 1993-02-02 1995-05-30 Xoma Corporation Stable bactericidal/permeability-increasing protein muteins
US6828418B2 (en) 1993-02-02 2004-12-07 Xoma Corporation Stable bactericidal/permeability-increasing protein products and pharmaceutical compositions containing the same
US5545723A (en) * 1994-03-15 1996-08-13 Biogen Inc. Muteins of IFN-β
EP2042509A1 (en) 1995-07-16 2009-04-01 Yeda Research And Development Company, Ltd. Modulators of the function of FAS receptors and other proteins
US6737064B2 (en) 1996-12-23 2004-05-18 The University Of Southern California Method for the diagnosis of neoplastic tissue comprising administering a vasopermeability enhancing peptide of human interleukin-2
US6403096B1 (en) 1996-12-23 2002-06-11 University Of Southern California Vasopermeability enhancing peptide of human interleukin-2 and immunoconjugates thereof
US6008319A (en) 1996-12-23 1999-12-28 University Of Southern California Vasopermeability enhancing peptide of human interleukin-2 and immunoconjugates thereof
US20080004217A1 (en) * 1998-12-30 2008-01-03 Applied Research Systems Ars Treatment of hiv-associated dysmorphia/dysmetabolic syndrome (hadds) with or without lipodystrophy
US6696063B1 (en) 1998-12-30 2004-02-24 Applied Research Systems Ars Holding N.V. Treatment of HIV-associated dysmorphia/dysmetabolic syndrome (HADDS) with or without lipodystrophy
US7144577B2 (en) 1998-12-30 2006-12-05 Applied Research Systems Ars Treatment of HIV-associated dysmorphia/dysmetabolic syndrome (HADDS) with or without lipodystrophy
US20060057115A1 (en) * 1998-12-31 2006-03-16 Zur Megede Jan Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US20080261271A1 (en) * 1998-12-31 2008-10-23 Novartis Vaccines & Diagnostics, Inc. Expression of hiv polypeptides and production of virus-like particles
US8263394B2 (en) 1998-12-31 2012-09-11 Novartis Vaccines & Diagnostics Inc. Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides, and uses thereof
US6602705B1 (en) 1998-12-31 2003-08-05 Chiron Corporation Expression of HIV polypeptides and production of virus-like particles
US20110212164A1 (en) * 1998-12-31 2011-09-01 Novartis Vaccines & Diagnostics, Inc. Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
US8541230B2 (en) 1998-12-31 2013-09-24 Novartis Vaccines And Diagnostics, Inc Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US7943375B2 (en) 1998-12-31 2011-05-17 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US7348177B2 (en) 1998-12-31 2008-03-25 Novartis Vaccines And Diagnostics, Inc. Expression of HIV polypeptides and production of virus-like particles
US20030223964A1 (en) * 1998-12-31 2003-12-04 Susan Barnett Expression of HIV polypeptides and production of virus-like particles
US8168418B2 (en) 1998-12-31 2012-05-01 Susan W Barnett Expression of HIV polypeptides and production of virus-like particles
US7935805B1 (en) 1998-12-31 2011-05-03 Novartis Vaccines & Diagnostics, Inc Polynucleotides encoding antigenic HIV Type C polypeptides, polypeptides and uses thereof
US20100316698A1 (en) * 1998-12-31 2010-12-16 Novartis Vaccines And Diagnostics, Inc. Polynucleotides encoding antigenic hiv type c polypeptides, polypeptides and uses thereof
US7718401B2 (en) 1998-12-31 2010-05-18 Novartis Vaccines And Diagnostics, Inc. Expression of HIV polypeptides and production of virus-like particles
US20100092502A1 (en) * 1998-12-31 2010-04-15 Novartis Vaccines And Diagnostics, Inc. Modified hiv env polypeptides
US7662916B2 (en) 1998-12-31 2010-02-16 Novartis Vaccines & Diagnostics, Inc Modified HIV Env polypeptides
US20090004733A1 (en) * 1998-12-31 2009-01-01 Novartis Vaccines & Diagnostics, Inc. Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides, and uses thereof
US6689879B2 (en) 1998-12-31 2004-02-10 Chiron Corporation Modified HIV Env polypeptides
US20090047339A1 (en) * 1998-12-31 2009-02-19 Barnett Susan W Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US20030223961A1 (en) * 2000-07-05 2003-12-04 Megede Jan Zur Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US6689783B2 (en) 2001-03-29 2004-02-10 Schering Corporation Aryl oxime-piperazines useful as CCR5 antagonists
US8133494B2 (en) 2001-07-05 2012-03-13 Novartis Vaccine & Diagnostics Inc Expression cassettes endcoding HIV-1 south african subtype C modified ENV proteins with deletions in V1 and V2
US20030198621A1 (en) * 2001-07-05 2003-10-23 Megede Jan Zur Polynucleotides encoding antigenic HIV type B and/or type C polypeptides, polypeptides and uses thereof
US7211659B2 (en) 2001-07-05 2007-05-01 Chiron Corporation Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US9598469B2 (en) 2001-07-05 2017-03-21 Novartis Vaccines And Diagnostics, Inc. HIV-1 south african subtype C env proteins
US20080089908A1 (en) * 2001-07-05 2008-04-17 Megede Jan Z Polynucleotides encoding antigenic HIV type C polypeptides, polypeptides and uses thereof
US20110091413A1 (en) * 2001-08-13 2011-04-21 University Of Southern California Therapeutic use of interleukin-2 mutants
US8124066B2 (en) 2001-08-13 2012-02-28 University Of Southern California Methods of using interleukin-2 mutants with reduced toxicity
US7514073B2 (en) 2001-08-13 2009-04-07 University Of Southern California Therapeutic use of interleukin-2 mutants
US20030124678A1 (en) * 2001-08-13 2003-07-03 University Of Southern California Interleukin-2 mutants with reduced toxicity
US20060292116A1 (en) * 2001-08-13 2006-12-28 University Of Southern California Interleukin-2 mutants with reduced toxicity
US7803361B2 (en) 2001-08-13 2010-09-28 University Of Southern California Therapeutic use of interleukin-2 mutants
US7371371B2 (en) 2001-08-13 2008-05-13 University Of Southern California Interleukin-2 mutants with reduced toxicity
US20090274653A1 (en) * 2001-08-13 2009-11-05 University Of Southern California Interleukin-2 mutants with reduced toxicity
US7282364B2 (en) 2001-08-31 2007-10-16 Novartis Vaccines And Diagnostics, Inc. Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US20050214256A1 (en) * 2001-08-31 2005-09-29 Chiron Corporation Polynucleotides encoding antigenic HIV type B polypeptides, polypeptides and uses thereof
US20080095833A1 (en) * 2001-08-31 2008-04-24 Novartis Vaccines And Diagnostics, Inc. Polynucleotides encoding antigenic hiv type b polypeptides, polypeptides, and uses thereof
US20070020622A1 (en) * 2001-09-14 2007-01-25 Invitrogen Corporation DNA Polymerases and mutants thereof
EP2322229A2 (en) 2001-10-10 2011-05-18 Novo Nordisk A/S Remodelling and glycoconjugation of Granulocyte Colony Stimulating Factor (G-CSF)
EP2305314A2 (en) 2001-10-10 2011-04-06 BioGeneriX AG Remodelling and glycoconjugation of antibodies
EP2305312A2 (en) 2001-10-10 2011-04-06 BioGeneriX AG Remodelling and glycoconjugation of follicle-stimulating hormone (FSH)
EP2080525A1 (en) 2001-10-10 2009-07-22 BioGeneriX AG Remodeling and Glycoconjugation of Peptides
EP2305313A2 (en) 2001-10-10 2011-04-06 BioGeneriX AG Remodelling and glycoconjugation of interferon-alpha (IFNa)
EP2305311A2 (en) 2001-10-10 2011-04-06 BioGeneriX AG Glycoconjugation of peptides
EP2279754A2 (en) 2001-10-10 2011-02-02 BioGeneriX AG Remodelling and glycoconjugation of human growth hormone (hGH)
EP2298354A2 (en) 2001-10-10 2011-03-23 BioGeneriX AG Remodelling and glycoconjugation of interferon-beta
EP2042196A2 (en) 2001-10-10 2009-04-01 Neose Technologies, Inc. Remodelling and glycoconjugation of Granulocyte Colony Stimulating Factor (G-CSF)
EP2279753A2 (en) 2001-10-10 2011-02-02 Novo Nordisk A/S Remodeling and glycoconjugation of peptides
EP2279755A2 (en) 2001-10-10 2011-02-02 BioGeneriX AG Remodelling and glycoconjugation of Fibroblast Growth Factor (FGF)
EP2174955A1 (en) 2001-12-31 2010-04-14 Yeda Research And Development Co. Ltd. Ifnar2 muteins, their production and use
US7749735B2 (en) 2001-12-31 2010-07-06 Yeda Research And Development Co., Ltd. IFNAR2 mutants, their production and use
US20050164185A1 (en) * 2001-12-31 2005-07-28 Gideon Schreiber Ifnar2 mutants, their production and use
US7344709B2 (en) 2002-06-03 2008-03-18 Laboratories Serono Sa Treatment of hepatitis C in the Asian population with subcutaneous interferon-beta
US20060029572A1 (en) * 2002-06-03 2006-02-09 Applied Research Systems Ars Holding N.V. Treatment of hepatitis c in the asian population with subcutaneous interferonbeta
WO2004085406A1 (en) 2003-03-24 2004-10-07 F. Hoffmann-La Roche Ag Benzyl-pyridazinons as reverse transcriptase inhibitors
EP2338333A2 (en) 2003-04-09 2011-06-29 BioGeneriX AG Glycopegylation methods and proteins/peptides produced by the methods
US9463241B2 (en) 2003-04-09 2016-10-11 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Method for stabilising an immunoglobulin G composition in liquid form
US8388954B2 (en) 2003-04-09 2013-03-05 Laboratoire Francais Du Fractionnement Et Des Biotechnologies Stabilising formulation for immunoglobulin G compositions in liquid form and in lyophilised form
EP2055189A1 (en) 2003-04-09 2009-05-06 Neose Technologies, Inc. Glycopegylation methods and proteins/peptides produced by the methods
US8367057B2 (en) 2003-11-13 2013-02-05 Yeda Research And Development Co. Ltd. Stem cells suitable for transplantation, their preparation and pharmaceutical compositions comprising them
US20080025957A1 (en) * 2003-11-13 2008-01-31 Yeda Research And Development Co. Ltd. P. O. Box 95 Stem Cells Suitable for Transplantation, their Preparation and Pharmaceutical Compositions Comprising Them
EP2045265A1 (en) 2005-09-22 2009-04-08 Biocompatibles Uk Ltd. GLP-1 fusion peptides, their production and use
EP2261245A1 (en) 2005-09-22 2010-12-15 Biocompatibles Uk Ltd. GLP-1 (glucagon-like peptide-1) fusion polypeptides with increased peptidase resistance
EP2174952A2 (en) 2005-09-22 2010-04-14 Biocompatibles Uk Ltd. glp-1 (glucagon-like peptide-1) fusion polypeptides with increased peptidase resistance
WO2007045573A1 (en) 2005-10-19 2007-04-26 F. Hoffmann-La Roche Ag Phenyl-acetamide nnrt inhibitors
WO2008019968A1 (en) 2006-08-16 2008-02-21 F. Hoffmann-La Roche Ag Non-nucleoside reverse transcriptase inhibitors
WO2008071587A2 (en) 2006-12-13 2008-06-19 F. Hoffmann-La Roche Ag 2-(piperidin-4-yl)-4-phenoxy- or phenylamino-pyrimidine derivatives as non-nucleoside reverse transcriptase inhibitors
WO2008145562A1 (en) 2007-05-30 2008-12-04 F. Hoffmann-La Roche Ag Non-nucleoside reverse transcriptase inhibitors
WO2009080534A1 (en) 2007-12-21 2009-07-02 F. Hoffmann-La Roche Ag Heterocyclic antiviral compounds
WO2009098700A1 (en) 2008-02-10 2009-08-13 Yeda Research And Development Co. Ltd Siva 3, its preparation and use
US9732134B2 (en) 2009-01-21 2017-08-15 Amgen Inc. Method of treating graft versus host disease using IL-2 muteins
US11560415B2 (en) 2009-01-21 2023-01-24 Amgen Inc. Method of promoting regulatory T-cell proliferation
US12297248B2 (en) 2009-01-21 2025-05-13 Amgen Inc. Methods of treating graft versus host disease using IL-2 muteins
US11976103B2 (en) 2015-04-10 2024-05-07 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
US10851144B2 (en) 2015-04-10 2020-12-01 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
US10961310B2 (en) 2017-03-15 2021-03-30 Pandion Operations, Inc. Targeted immunotolerance
US11466068B2 (en) 2017-05-24 2022-10-11 Pandion Operations, Inc. Targeted immunotolerance
US10676516B2 (en) 2017-05-24 2020-06-09 Pandion Therapeutics, Inc. Targeted immunotolerance
US12091441B2 (en) 2017-11-21 2024-09-17 The Board Of Trustees Of The Leland Stanford Junior University Partial agonists of interleukin-2
US10174091B1 (en) 2017-12-06 2019-01-08 Pandion Therapeutics, Inc. IL-2 muteins
US11091527B2 (en) 2017-12-06 2021-08-17 Pandion Operations, Inc. IL-2 muteins and uses thereof
US11779632B2 (en) 2017-12-06 2023-10-10 Pandion Operation, Inc. IL-2 muteins and uses thereof
US11945852B2 (en) 2017-12-06 2024-04-02 Pandion Operations, Inc. IL-2 muteins and uses thereof
US11965008B2 (en) 2017-12-06 2024-04-23 Pandion Operations, Inc. IL-2 muteins and uses thereof
US11091526B2 (en) 2017-12-06 2021-08-17 Pandion Operations, Inc. IL-2 muteins and uses thereof
US10946068B2 (en) 2017-12-06 2021-03-16 Pandion Operations, Inc. IL-2 muteins and uses thereof
US10174092B1 (en) 2017-12-06 2019-01-08 Pandion Therapeutics, Inc. IL-2 muteins
USRE50550E1 (en) 2017-12-06 2025-08-26 Pandion Operations, Inc. IL-2 muteins and uses thereof
US11739146B2 (en) 2019-05-20 2023-08-29 Pandion Operations, Inc. MAdCAM targeted immunotolerance
US11491205B2 (en) 2020-01-14 2022-11-08 Synthekine, Inc. Biased IL2 muteins methods and compositions
US11981715B2 (en) 2020-02-21 2024-05-14 Pandion Operations, Inc. Tissue targeted immunotolerance with a CD39 effector

Also Published As

Publication number Publication date
US4518584A (en) 1985-05-21

Similar Documents

Publication Publication Date Title
US4518584A (en) Human recombinant interleukin-2 muteins
US4853332A (en) Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of biologically active proteins
US4588585A (en) Human recombinant cysteine depleted interferon-β muteins
EP0192811B1 (en) Cysteine-depleted muteins of biologically active proteins, their preparation, formulations containing them, and structural genes, vectors and organisms, and their production, suitable for use in the preparation of said muteins
US4959314A (en) Cysteine-depleted muteins of biologically active proteins
US4737462A (en) Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of interferon-β
EP0077670B1 (en) Human immune interferon
Goeddel et al. The structure of eight distinct cloned human leukocyte interferon cDNAs
US6610830B1 (en) Microbial production of mature human leukocyte interferons
EP0043980B1 (en) Mature human leukocyte interferon a, process for its microbial preparation, intermediates therefor and compositions containing it.
US5096705A (en) Human immune interferon
US5004689A (en) DNA sequences, recombinant DNA molecules and processes for producing human gamma interferon-like polypeptides in high yields
US5582824A (en) Recombinant DES-CYS-TYR-CYS human immune interferon
US4801685A (en) Microbial production of mature human leukocyte interferon K and L
JPH057996B2 (en)
EP0299782A2 (en) Expression vectors for the production of human Granulocyte-Macrophage Colony Stimulation Factor in a mammalian cell host(18.05.92)
EP0099389A1 (en) Interferon-alpha 54
WO1983002460A1 (en) Interferon-alpha 74
BG60506B2 (en) HUMAN RECOMBINANT INTERLEUKIN-2 MUTEINS
BG60510B2 (en) STRUCTURAL GENES, PLASMIDS AND TRANSFORMED CELLS FOR OBTAINING CYSTEINE-POOR MUTEINS OF BIOLOGICALLY ACTIVE PROTEINS
FI87233B (en) GEN VILKEN KODAR EN MUTEIN.
AU2131688A (en) Human granulocyte-macrophage colony stimulating factor and muteins thereof
NO306951B1 (en) DNA sequence encoding a modified human IFM (beta) and method for its preparation

Legal Events

Date Code Title Description
FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

AS Assignment

Owner name: CETUS ONCOLOGY CORPORATION

Free format text: CHANGE OF NAME;ASSIGNOR:CETUS CORPORATION, A CORP. OF DE;REEL/FRAME:006163/0225

Effective date: 19920304

PTEF Application for a patent term extension

Free format text: PRODUCT NAME: PROLEUKIN (ALDESLEUKIN); REQUESTED FOR 1445 DAYS

Filing date: 19920616

Expiry date: 20020521

AS Assignment

Owner name: CETUS ONCOLOGY CORPORATION

Free format text: CHANGE OF NAME;ASSIGNOR:CETUS CORPORATION;REEL/FRAME:006268/0881

Effective date: 19920304

FPAY Fee payment

Year of fee payment: 8

PTEG Grant of a patent term extension

Free format text: PRODUCT NAME: PROLEUKIN (ALDESLEUKIN)

Filing date: 19920616

Expiry date: 20020521

FPAY Fee payment

Year of fee payment: 12

AS Assignment

Owner name: CHIRON CORPORATION, CALIFORNIA

Free format text: MERGER;ASSIGNOR:CETUS ONCOLOGYCORPORATION (FORMERLY CETUS CORPORATION);REEL/FRAME:008209/0087

Effective date: 19960325