USPP32706P3 - Cornus kousa tree named ‘Melissa's Mountain Snowfall’ - Google Patents

Abstract

A new and distinct cultivar of flowering dogwood tree, which has fused bracts is provided. This dogwood tree is botanically known as Cornus kousa and referred to by the following cultivar name: ‘Melissa's Mountain Snowfall’.

Description

This invention was made with Government support under Contract No. NACA-58-6062-6 awarded by the U.S. Department of Agriculture. The Government has certain rights in the invention.

Latin name of the genus and species: Cornus kousa.

Variety denomination: ‘Melissa's Mountain Snowfall’.

The Sequence Listing for this application is labeled “Seq-List.txt” which was created on Nov. 1, 2019 and is 4 KB. The entire content of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

The present invention relates to a new and distinct dogwood cultivar, which has fused bracts. This dogwood is botanically known as Cornus kousa ‘Melissa's Mountain Snowfall’, hereinafter referred to as ‘Melissa's Mountain Snowfall’. The unique characteristic of this variety is the non-overlapping fusion of the bracts, shape of the tree, and bark characteristics.

This new dogwood cultivar was discovered in a planting of seedlings in the University of Tennessee Arboretum in Oak Ridge, Tenn. ‘Melissa's Mountain Snowfall’ is a half-sibling of ‘Pam's Mountain Bouquet’ (U.S. Plant Pat. No. 25,575; Wadl et al., 2014, HortScience 49(9):1230-1233). Asexual reproduction of ‘Melissa's Mountain Snowfall’ in Belvidere, Tenn. was by axillary bud grafting onto a generic Cornus kousa seedling rootstock and has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive vegetative generations.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1. Photograph of a ‘Melissa's Mountain Snowfall’ tree that is approximately 30 years old. The spread of this tree is about 7 meters. Colors in the photograph may differ from actual colors due to lighting and light reflectance.

FIG. 2. Photograph of enlarged view of bracts on ‘Melissa's Mountain Snowfall’.

FIG. 3. Photograph of the unripe fruit of ‘Melissa's Mountain Snowfall’. Also shown are the paper collars of the dried bracts that remain on the petioles and around the fruit.

FIG. 4. Photograph of the ripe fruit of ‘Melissa's Mountain Snowfall’.

FIG. 5. Photograph showing the exfoliating bark on the trunk of older specimens of ‘Melissa's Mountain Snowfall’.

DETAILED DESCRIPTION OF THE NEW VARIETY

A new and distinct cultivar of flowering dogwood having fused bracts is provided. This dogwood tree cultivar is botanically known as Cornus kousa and referred to by the cultivar name: ‘Melissa's Mountain Snowfall’. This cultivar exhibits insect resistance and disease resistance, particularly to powdery mildew caused by Erysiphe pulchra. Dogwood anthracnose caused by Discula destructiva has never been observed on ‘Melissa's Mountain Snowfall’.

The subject cultivar is different compared to the Cornus kousa varieties ‘Red Steeple’ and ‘Empire’. The following Table 1 sets forth the difference between these cultivars and ‘Melissa's Mountain Snowfall’:

TABLE 1
Characteristics of ‘Melissa's Mountain Snowfall’ compared
with two similar cultivars

‘Melissa's Mountain
Snowfall’	‘Red Steeple’	‘Empire’
Habit Spreading	Narrow Linear - short	Narrow linear Tall
	columnar	Columnar
Fused Bracts	Non-fused bracts	Non-fused bracts
Large Bracts white	Small bracts - some pink	Small bracts
	margin

This new and distinct dogwood tree cultivar was discovered in a planting of seedlings within the Arboretum at the University of Tennessee located in Oak Ridge, Tenn. The subject dogwood tree cultivar is a half-sibling of the Cornus kousa dogwood cultivar known as ‘Pam's Mountain Bouquet’. Table 2 shows the observed phenotypic similarities and differences between the two cultivars.

TABLE 2
General phenotypic differences between the dogwood cultivars
‘Melissa's Mountain Snowfall’ and ‘Pam's Mountain Bouquet’.

‘Melissa's Mountain Snowfall’	‘Pam's Mountain Bouquet’
About 80% of all bracts on the	About 82% of all bracts on the
cultivar exhibit some degree of fusion	cultivar exhibit some degree of
	fusion
Resistance to Disease and	Resistance to Disease and
Insect Damage	Insect Damage
Exfoliating bark in older specimens**	No exfoliating bark
Inverted pyramidal growth habit**	Spreading growth habit
Multiple leaders**	Single leader
Six meters in height**	3-4 meters in height
(** = Key differences)

In addition to the phenotypic differences listed above, it has also been observed that the alleles of the two cultivars differ at 5 of 8 selected loci. Asexual reproduction of ‘Melissa's Mountain Snowfall’ by grafting of axillary buds onto generic Cornus kousa seedling rootstocks has shown that the unique features of this new dogwood cultivar are stable and reproduced true-to-type in successive generations.

DETAILED BOTANICAL DESCRIPTION

The following observations, measurements and comparisons describe the cultivar ‘Melissa's Mountain Snowfall’ grown in Oak Ridge, Tenn. Trees used for this description were about thirty (30) years old. Plant hardiness is expected to be zones 3-9. The color characteristic descriptions use color references to The Royal Horticultural Society (R.H.S.) Colour Chart, The Royal Horticultural Society, London, UK, 4^th Edition, 2001, except where general terms of ordinary dictionary significance are used. It has been determined that alleles differ at 5 of 8 loci shared by ‘Melissa's Mountain Snowfall’ and ‘Pam's Mountain Bouquet’, as shown in Table 3.

TABLE 3
Allelic Comparison of ‘Melissa's Mountain Snowfall’ and
‘Pam's Mountain Bouquet’ at specified loci

	‘Melissa's Mountain	‘Pam's Mountain
	Snowfall’	Bouquet’
Locus	(bp size for each allele)	(bp size for each allele)
CK005*	228:228	222:247
CK072*	113:122	113:117
CK058*	152:152	148:148
CK031	140:140	140:140
CK040*	102:102	94:94
CK029	90:102	90:102
CK015*	119:122	130:136
CK047	128:128	128:128

Table 4 indicates the primer sequences and microsatellite markers (or single sequence repeats—SSR) in ‘Melissa's Mountain Snowfall’ compared with the same microsatellite markers (SSR) in ‘Pam's Mountain Bouquet.’ Those loci indicated with an asterisk (*) differ between the two cultivars.

TABLE 4
Primer Sequences and Microsatellite markers
compared between ‘Melissa's Mountain Snowfall’
and ‘Pam's Mountain Bouquet’

GenBank

Microsatellite Repeat Sequences

Accession			Repeat
No.	Locus	Primer Sequence (5′-3′)	Motif
EU544308	CK005*	F:GCATTTGTCCTTTGTTTGACAT	(AC)20
		(SEQ ID 1)
		R:TTTTTCGCGAAGTGTTCTCTAC
		(SEQ ID 2)
EU125523	CK015*	F:GTCAAATTTTTGATCTTTCTCTCT	(CT)10
		(SEQ ID 3)
		R:GGAGAGACAGAGTACAGTAGAGGT
		(SEQ ID 4)
EU125524	CK029	F:AATTTAGGTTAAGGTTTTGATTTG	(TC)8
		(SEQ ID 5)
		R:AGAGAGAATAGGTTACAGCATCAT
		(SEQ ID 6)
EU125525	CK031	F:TGTCACTGCTTACAGAAACAAT	(CT)7
		(SEQ ID 7)
		R:TATGACGAGATTGTATAAGTTGCT
		(SEQ ID 8)
EU125526	CK040*	F:CCAAGTCAGTTTGGTAGTAATTC	(GT)16
		(SEQ ID 9)
		R:AGTGCAACTTTTACTTGCTATGT
		(SEQ ID 10)
EU544309	CK058*	F:CTTAAGTCACAAAGACAATGAAAT	(GT)10
		(SEQ ID 11)
		R:AAGAGAGTTCAGATTTATCTTTGC
		(SEQ ID 12)
EU544312	CK072*	F:AGCACTCATAGTCCTTGCAC	(GT)10
		(SEQ ID 13)
		R:GTTAAAACGAAGAAGATACAACAA
		(SEQ ID 14)
EU125528	CK047	F:GAAAGAGATAAAAGATGGTTCAAT	(AC)6
		(SEQ ID 15)
		R:CTTATAGAGTAAGCCCACCATC
		(SEQ ID 16)

The cultivar ‘Melissa's Mountain Snowfall’ has some similarity in phenotypic characteristics to the cultivar ‘Pam's Mountain Bouquet’ (Wadl et al., 2014). The following Table 5 provides a comparison of each cultivar for those characteristics that have been observed. Measurements are provided as an average (with ranges also provided as indicated):

TABLE 5
Characteristics of ‘Melissa's Mountain Snowfall’ and Pam's
Mountain Bouquet’
Color Descriptions are based upon the Royal Horticultural Society's
(RHS) colour chart, 4th Edition 2001.

		‘Melissa's Mountain	‘Pam's Mountain
	Character	Snowfall’	Bouquet’

1	Tree form	Inverted pyramidal	spreading
	(observation)
2	Tree height	5-6 meters height	low
	(observation)	and about a 7 meter	(about 3-4
		spread	meters; spread
			about 4-5 meters,
			and dependent on
			age and
			environment)
3	Branch thickness	Medium Variable,	medium
	(measurement)	dependent on age	(age dependent)
	Thickness in the
	middle portion of
	a plant
4	Color of current	Green 144A turning	Green
	Shoot	Greyed-Green 197A	143B
	(observation)
	Current shoot
	color in the
	middle portion of
	a plant
5	Branch color	Mixture of 156A,	Greyed-Green
	(observation)	197B, 198B, 200C	198B
	Current branch	and 200D
	color in the
	middle portion of
	a plant by second
	year
6	Dark spots on	Absent	Absent
	Branch
	(observation)
	Presence of dark
	spots on the
	branch
7	Branching	High	High
	(observation)
	Density of
	branching
8	Internode length	Mostly short, but	Short
	(measurement)	some intermediate
	Internode length	(variable + 6-9 cm)
	in the middle
	portion of a plant
9	Whole shape of	Obovate	Obovate
	leaves (observation)
	see FIGS. 2, 3 and 4
	Whole shape of a
	leaf in the middle
	portion of a plant
10	Shape of leaf	Acuminate	Acuminate
	tip (observation)
	see FIG. 2
	Tip shape of a leaf in
	the middle portion
	of a plant
11	Shape of leaf	Truncate	Truncate
	Base (observation)
	see FIG. 2
	Base shape of a
	leaf in the middle
	portion of a plant
12	Shape of leaf	Entire	Entire
	Margin (observation)
	Shape of a leaf
	margin in the
	middle portion of
	a plant
13	Leaf rolling	Typically none, but	Rolling inward
	(observation) see	some inward
	Fig. 4
14	Leaf curvature	Mostly flat	Flat
	(observation)
15	Leaf margin	Some leaves	None
	Undulation	undulating
	(observation)
16	Leaf length	Averages 87.1 mm	Long
	(measurement)		(about 100-400
	Length from the		mm)
	tip to the base of
	mature leaf
17	Leaf width	Mean 44.4 mm	Narrow
	(measurement)		(about 40-50
	The maximum		mm)
	width of mature
	leaf
18	Leaf thickness	Medium	Medium
	(observation)
	Thickness of
	mature leaf
19	Bud color	Green 138B,	Greyed-red
	(observation)	unopened;	179A
	Color of bud just	Green 132D, opened;
	after sprouting	infrequently Yellow-
		Green 151C
20	Immature leaf	Not observed	Green
	color (observation)		135B
21	Presence of	Absent	Absent
	anthocyanin
	(observation)
	Coloration by
	anthocyanin on
	the immature leaf
	upperside
22	Color of leaf	Green 143A	Green
	upperside		143B
	(observation)
	Color of mature
	leaf upperside
23	Color of leaf	Green 143B;	Yellow-Green
	Lower side	Green 143C	146B
	(observation)
	Color of mature
	leaf lower side
24	Seasonal change	Changed	Changed
	of a mature leaf
	(observation)
25	Color of leaves in	Yellow to Red	Red
	autumn (observation)	(Variable) Changes	10C-46A
		in Leaf Fall Color
		10C-46A
26	Leaf variegation	Not variegated	Not variegated
	(observation)
	Variegation on leaf
	upper side
27	Variegation	NA	NA
	pattern (observation)
	Pattern of variegation
	on a leaf upperside
28	Variegation color	NA	NA
	(observation)
29	Seasonal change	NA	NA
	of variegation
	color (observation)
30	Hair on leaf	None	None
	upperside (observation)
	Hair density on a
	mature leaf upperside
31	Hair on leaf	None	None
	lowerside (observation)
	Hair density on a
	mature leaf lowerside
32	Petiole length	Short about 10.4	Short
	(measurement)	mm; unequal at base,	(about 15-25
	Length from the base	about 5-7 mm longer	mm)
	of blade to the	on one side
	base petiole
33	Petiole width	Medium (<7 mm)	Medium
	(measurement)		(<8 mm)
	The maximum width
	of a mature leaf petiole
34	Petiole color	Green 143A-143C	Green
	(observation)		143B
35	Inflorescence type	Umbel	Umbel
	(observation)
36	Inflorescence	Upright	Upright
	direction (observation)
37	Inflorescence	Average about 31.7	Medium
	diameter	mm	(diagonal mean
	(observation)		length = 74 mm;
			mean width = 53
			mm)
38	Flower diameter	Small; Each about 5-	Small
	(measurement)	7 mm
39	Floret color	Yellow-Green 151A	Yellow-Green
	(observation)		150C
40	Bract type	80% are fused, but	83% are fused,
	(observation)	variable (See Table	but variable
		6)	(See Table 2)
41	Uniformity of	Not uniform	Not uniform
	bract size (observation)
42	Bract overlapping	No overlap of	No overlap of
	(observation)	unfused bracts	unfused
			bracts
43	Bract orientation	Recurved, Reflexed,	Recurved,
	(observation)	or Flat	Reflexed, or Flat
44	Bract rolling	Varies (may roll	Varies (may roll
	(observation)	inward or outward)	inward or
			outward)
45	Degree of bract	Medium	Strong
	rolling (observation)
46	Bract curvature	Varies	Varies
	(observation)	(can be recurved,	(can be recurved,
		flat, or reflexed)	flat, or reflexed)
47	Bract twisting	None	None
	(observation)
48	Whole shape of	Ovate	Ovate
	bracts (observation)
49	Shape of bract	Acuminate	Acuminate
	apex (observation)
50	Unfused bract length	Inner Bract Average	Medium
	(measurement)	48 mm; Outer Bract
		Average 43 mm
51	Unfused Bract width	Inner Bract Average
	(measurement)	27 mm; Outer Bract
		Average 28 mm
52	Number of bracts	4 FUSED; Diameter	FUSED, but 4
	(measurement)	average 89.5 mm, all
		four bracts fused,
		after flowering
		remains as a papery
		collar (Grey-Brown
		199D) at base of the
		petiole
53	Bract color	Green-White 157B	White 155A
	(measurement)		(immature: Green-
			White 157A)
54	Bract variegation	Not variegated	Not variegated
	(observation)
55	Variegation	NA	NA
	pattern (observation)
56	Variegation color	NA	NA
	(measurement)
57	Pistil color	Yellow green 148C	Yellow green
	(observation)		(Not coded)
58	Stigma color	Green	Dark Green
	(observation)	(N138B)	(Not Coded)
59	Peduncle	Medium	Medium
	thickness
	(measurement)
60	Peduncle length	Average 69 mm	Long
	(measurement)		(mean of 68 mm)
61	Peduncle color	Green 143C	Yellow-Green
	(observation)		144B
62	Fruit shape	Globose	Globose
	(observation)
63	Fruit length	About 28.7-29.3 mm	Medium
	(measurement)		(about 40 mm)
64	Fruit width	About 28.7-29.3 mm	Medium
	(measurement)		(about 4.0 mm)
65	Fruit color	Green 134N, Fall;	Unripe: Green 143B;
	(observation)	Red-	Ripe: Orange-Red
		Purple 60D-61A,	33B to 43A. Highly
		when ripe in	variable depending
		October	on ripeness
66	Fragrance (observation)	None	Absent
67	Seed fertility	Not observed	High
	(observation)
68	Time to the first	Medium	Medium
	flowering (observation)	(Mid-April-late	(April-mid-May)
		May)
69	Blooming habit	Prolific	Many
	(observation)
70	Flowering season	One season	One season
	(observation)		flowering
71	Flowering time	About 5-6 weeks	About 5-6 weeks
	(observation)
72	Deciduous or	Deciduous	Deciduous
	evergreen (observation)
73	Cold hardiness	To −20° C.	Medium
	(observation)		(to −20° C.-no
			effect)
74	Heat tolerance	Strong	Strong
	(observation)	(to 40° C.-no	(to 40° C.-no
		effect)	effect)
75	Pest resistance	No specific pests	Strong
	(observation)	noted	some leaf (no
		spots of brown	specific pests
		anthracnose	noted)
		(Unidentified
		etiology - no control
		measures necessary)
		Brown N200A
76	Disease resistance	Strong resistant to	Strong resistant
	(observation)	dogwood	to dogwood
		anthracnose and	anthracnose and
		powdery mildew;	powdery mildew;
		some spot	some spot
		anthracnose	anthracnose
		especially on bracts	especially on
			bracts
77	Bark color	Exfoliating bark	Greyed-Green
		Greyed-Orange	198B
		177B and Green
		143C; exfoliating
		areas Greyed-Brown
		199C-199D
78	Bark texture	Exfoliating	Smooth
79	Angle of emerging	20°-35° from	20°-30° from
	branches	vertical stem	vertical stem
80	Time to first leaf bud	Mid- to late-April	Mid- to late-April
	burst
81	Leaf Vein color	Yellow-Green 145B	Greyed-Green
	(bottom side)		192A
82	Immature Leaf color	Similar to fully	Similar to fully
		expanded leaf color	expanded leaf
			color
83	Bract base	Truncate	Truncate
84	Bract margin	Entire	Entire
85	Vestiture	Puberulous,	Puberulous,
		reticulate	reticulate
86	Flower/	Mean = 31	Mean = 34
	inflorescence number
87	Seed shape	Flattened along	Flattened along
		length	length
88	Seed color	Greyed Yellow	Greyed Yellow
		162D	162D
89	Seed number	0-17 per fruit	0-17 per fruit
90	Bloom duration	3-5 weeks	3-5 weeks
		(dried, dead bracts	(dried, dead
		are retained as a	bracts are
		“collar” on peduncle	retained as a
		until fruit fall in	“ collar” on
		Autumn)	peduncle until
			fruit fall in
			Autumn)
91	Time of fruit ripening	Begins mid-August	Begins mid- to
		and Ripe in October	late-August
			through October
92	Trunk diameter	Multiple stem	18 cm at 15 years
	(at base)	variable. About 10-	of age
		14 cm; numerous
		lenticels
93	Anther color	Purple N79B	Greyed-purple
			N186A
94	Flower petal color	Yellow-green	Yellow-green
		145C	145C
95	Style/Stigma	Inconspicuous	Inconspicuous
	description

• Botanical classification: Cornus kousa ‘Melissa's Mountain Snowfall’.
• Unique features: This tree features prolific flowering and exhibits fused bracts. About 80% of all bracts on the cultivar exhibit some degree of fusion (one side, two sides or three to four sides being fused), as shown in Table 6.

TABLE 6
Types of fused bracts observed on ‘Melissa's Mountain Bouquet’

Year	Not fused	Two sides fused	3 sides fused	Fully Fused
2016 (n =	29 (29%)	23 (23%)	17 (17%)	32 (32%)
101)
2017 (n =	39 (27%)	28 (19%)	33 (23%)	45 (31%)
145)
2019 (n =	7 (6%)	12 (10%)	14 (11%)	90 (73%)
123)
Mean	25 (20.7%)	21 (17.3%)	21 (17.0%)	55.7 (45.3%)

• Disease susceptibility: None noted. Powdery mildew caused by Erysiphe pulchra was not observed. There was some minor occurrence of spot anthracnose on bracts caused by Elsinoe cornii observed in 2017-2019. Most spots were discrete, less than 1 cm in diameter and various hues in the red-purple group N74C-D. Cold damage may also result in discoloration of bracts similar to spot anthracnose or over larger areas. Dogwood anthracnose caused by Discula destructiva has never been observed on ‘Melissa's Mountain Snowfall’.
• Insect damage: Minor insect damage on leaves.

REFERENCES

• Wadl, P. A., M. T. Windham, R. E. Evans, and R. N. Trigiano. 2014. Three new cultivars of Cornus kousa: Empire, Pam's Mountain Bouquet, and Red Steeple. HortScience 49(9):1230-1233.

Claims (1)

The invention claimed is:

1. A new and distinct cultivar of Dogwood tree, Cornus kousa, named ‘Melissa's MOUNTAIN Snowfall’, as illustrated and described.

Images