USPP28790P3 - Blueberry plant named ‘Heintooga’ - Google Patents

Blueberry plant named ‘Heintooga’ Download PDF

Info

Publication number
USPP28790P3
USPP28790P3 US14/998,766 US201614998766V USPP28790P3 US PP28790 P3 USPP28790 P3 US PP28790P3 US 201614998766 V US201614998766 V US 201614998766V US PP28790 P3 USPP28790 P3 US PP28790P3
Authority
US
United States
Prior art keywords
heintooga
robeson
fruit
good
premier
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active, expires
Application number
US14/998,766
Other versions
US20170188494P1 (en
Inventor
James R. Ballington
William T. Bland
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
North Carolina State University
Original Assignee
North Carolina State University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by North Carolina State University filed Critical North Carolina State University
Priority to US14/998,766 priority Critical patent/USPP28790P3/en
Assigned to NORTH CAROLINA STATE UNIVERSITY reassignment NORTH CAROLINA STATE UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BALLINGTON, JAMES R., BLAND, WILLIAM T.
Publication of US20170188494P1 publication Critical patent/US20170188494P1/en
Application granted granted Critical
Publication of USPP28790P3 publication Critical patent/USPP28790P3/en
Active legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Definitions

  • the present invention relates to a new and distinct trispecies hybrid cultivar designated as Vaccinium ⁇ [V. formosum ⁇ ( V. constablaeii ⁇ V. virgatum )] (blueberry) grown as a fruiting woody shrub for commercial agriculture. Blueberries are typically consumed both fresh and in a number of processed products.
  • NC 2701 seedlings were established in 1979 at the Horticultural Crops Research Station at Castle Hayne, N.C., and a single “fully fruitful” seedling, designated as experimental selection NC 2701, was selected by James R. Ballington in 1984. Of the progeny, NC 2701 was the single seedling with a full crop of fruit. In addition, it was selected for medium to large fruit size, desirable fruit color, picking scar, firmness, flavor and low numbers of seeds per berry. As is typical with pentaploids, NC 2701 produces very little viable pollen and requires cross-pollination for fruit set and development.
  • NC 2701 was first established in observation trials at Jackson Springs, N.C., and based on its performance in these trials was repropagated by stem cuttings and established in replicated trials in Castle Hayne, N.C. and Jackson Springs, N.C. NC 2701 was also established in an observation trial on one commercial blueberry farm in Ivanhoe, N.C., under a Memorandum of Agreement with North Carolina State University. In addition, in 2014, NC 2701 was established in observation trials through Material Transfer Agreements between North Carolina State University, the USDA blueberry breeding program at Corvallis, Oreg., and the Rutgers University blueberry breeding program at Chatsworth, N.J. With these three agreements the University retains ownership of the plants and the grower or breeding program provides the land and care of the plants. This new variety has been named the ‘Heintooga’ cultivar, due to the similarity of its fruit quality to its wild V. constablaeii grandparent, PI 346603, which was collected on Heintooga Ridge Spur Road in western North Carolina in 1967.
  • ‘Heintooga’ produces only 3 fully developed seeds per berry, but this is still three times as many as ‘Heintooga’. Plant size is smaller and less vigorous than rabbiteye blueberry varieties such as ‘Premier’ (unpatented) or the vigorous pentaploid variety ‘Robeson’, so yield potential per plant is lower. However this can be compensated for by spacing ‘Heintooga’ plants closer together in the row resulting in higher numbers of plants per acre. ‘Heintooga’ differed consistently from ‘Robeson’ for dormant and first flush stem color, leaf dimensions, leaf margins, flower dimensions, fruit color with bloom and seed shape. ‘Heintooga’ ripens with late midseason to late ripening northern and southern highbush varieties. Fruit size is medium to large.
  • Berry color, picking scar and flavor are consistently in the very good range. Flavor is sweet and highly aromatic, similar to the Vaccinium constablaeii grandparent of ‘Heintooga’. Berry firmness of ‘Heintooga’ is moderately good to good, significantly better than ‘Premier’ or ‘Robeson’, and adequate for long distance shipping. Post harvest shelf-life is good following seven days storage at 4.5° C. Plants of ‘Heintooga’ are broadly adapted to soils. ‘Heintooga’ has a semi-upright plant habit in contrast to ‘Robeson’ which has an upright growth habit. Plants of ‘Heintooga’ have remained true to type through successive cycles of asexual propagation. Dormant buds on ‘Heintooga’ plants have an estimated chilling requirement between 800 and 1000 hours below 4.5° C. ‘Heintooga’ was first propagated by leafy cuttings in August 1984 in Raleigh, N.C.
  • FIG. 1 and FIG. 2 show the plant's form, foliage and fruit.
  • the photographs in the drawings were made using digital photography techniques and illustrate colors as true as can be reasonably obtained when using these techniques. Colors in the photographs may differ slightly from the color values cited in the detailed botanical description, which accurately describe the colors of the new Vaccinium variety.
  • FIG. 3 relates to DNA fingerprinting of ‘Heintooga’.
  • FIG. 1 illustrates the typical plant habit of ‘Heintooga’ and was taken from a five-year old plant growing at the North Carolina. Agricultural Research Service Station at Jackson Springs, N.C.
  • FIG. 2 illustrates the typical fruit of ‘Heintooga’ growing at the Horticultural Crops Research Station at Castle Hayne, N.C. The fruit was harvested from four-year old plants.
  • FIG. 3 shows a hypothetical example of one SSR marker on a panel of 6 cultivars depicted as 1-6.
  • the lane marked as M shows the standard marker lane with known fragment size in base pair (bp).
  • the top arrow shows a monomorphic band that is identical in all cultivars.
  • the bottom arrow shows a band that is monomorphic in cultivar 3, 4 and 6. Therefore the other band can be used to distinguish these three cultivars from each other.
  • This profile for these cultivars is based on one markers. As the number of markers increase the probability that two literally different cultivars have the same profile will reduced.
  • FIG. 4 provides a gel electrophoresis picture of two SSR markers run on 30 blueberry cultivars.
  • the profile of the two SSR markers for different cultivars are different and shows that while the marker on the left hand side shows more polymorphism, the marker in the right hand side is less informative for distinguishing the cultivars.
  • the phenotype of the variety may differ from the description herein with variations in the environment such as season, temperature, light intensity, day length and cultural conditions. Color notations are based on The Royal Horticultural Society Colour Chart, The Royal Horticultural Society, London, UK, 4 th edition, 2001.
  • ‘Heintooga’ does differ from NC 1827 for plant habit, semiupright for ‘Heintooga’ versus spreading for NC 1827, and leaf margins, entire for ‘Heintooga’ versus serrulate for NC 1827.
  • the botanical descriptive data presented below are averages of data collected from 2009-2013 from mature plants (seven to eleven years old) grown in Castle Hayne, N.C.
  • ‘Heintooga’ differs consistently from ‘Robeson’ for plant vigor as determined by plant dimensions, 1.5 m height by 1.5 m width for ‘Heintooga’ versus 2.4 m height by 1.8 m width for ‘Robeson’; mature stem length, 108 cm for ‘Heintooga’ versus 135 cm for ‘Robeson’; number of mature stems, 8-10 for ‘Heintooga’ versus 4-6 for ‘Robeson’; and average annual length of new stems, 36 cm for ‘Heintooga’ versus 46 cm for ‘Robeson’.
  • ‘Heintooga’ was compared to ‘Robeson’ and ‘Premier’ (unpatented) in the replicated trial at Castle Hayne, N.C., in 2005-2007. This trial is described in the previous section. ‘Premier’ was included in the trial to serve as a pollinator variety for the two pentaploid varieties, ‘Heintooga’ and ‘Robeson’. Data for time of bloom was however collected from Jackson Springs, N.C., in 2014 because it was considered to be more representative.
  • Table 1 presents representative bloom data comparing ‘Heintooga’ to ‘Robeson’ and ‘Premier’ at Jackson Springs, N.C., in 2014. Date of first bloom for ‘Heintooga’ was three days later than ‘Robeson’ and four days later than ‘Premier’. ‘Heintooga’ was one day later than ‘Robeson’ and four days earlier than ‘Premier’ for date of 50 percent bloom. ‘Heintooga’ was four days later than ‘Robeson’ for date of last bloom. It was not feasible to determine the date of last bloom for ‘Premier’ because it is a very large plant and the majority of the flowers are abnormal with only a partially developed corolla or no corolla at all (Sampson, et al., 2014).
  • ‘Heintooga’ The flowers of ‘Heintooga’ produce little or no viable pollen so they require cross pollination for fruit set and development.
  • the rabbiteye blueberry ( V. virgatum ) cultivars ‘Ira’, ‘Onslow’ and ‘Powderblue’ (all unpatented) are recommended as pollinator varieties in the southern US.
  • ‘Premier’ also overlaps in bloom with ‘Heintooga’ (Table 1) and was the pollinator in the replicated trial at Castle Hayne, N.C., however it tends to bloom early in some years and its abnormal flower morphology makes ‘Premier’ especially subject to frost and freeze injury, so it is no longer recommended as a pollinator for ‘Heintooga’.
  • the hexaploid interspecific hybrid cultivar ‘Little Giant’ (unpatented) (USDA, ARS. Release notice for ‘Little Giant’, 1995) or northern highbush varieties are recommended as pollinators for ‘Heintooga’ in colder regions because rabbiteye blueberry cultivars are not hardy outside the southern US.
  • ‘Heintooga’ berries were statistically equal to those of ‘Premier’ in size two out of the three years (Table 4), which puts them in medium to large size categories. They were significantly larger than berries of ‘Robeson’ two out of the three years, and equal in size to ‘Robeson’ the third year.
  • Fruit firmness was determined objectively in grams/mm compression by a FirmTeck II Firmness Tester (Table 6). ‘Heintooga’ was significantly more firm than either ‘Robeson’ or ‘Premier’ in all three years of evaluations. In addition, ‘Premier’ was significantly more firm than ‘Robeson’ for all three years. A threshold value of 200 g/mm is often used as the minimum standard for superior firmness for blueberry fruit. Therefore, the fruit of ‘Heintooga’ ranged from moderately firm (176 g/mm in 2005) to firm (196 g/mm in 2007). This also means that the fruit of ‘Heintooga’ is sufficiently firm for shipment to distant markets, in contrast to ‘Robeson’.
  • picking scar was also evaluated subjectively for the technical description of ‘Heintooga’ (Table 7). This was based on a subjective rating scale of 10-90 where less than 60 is unacceptable, 60-69 is acceptable, 70-74 is good, 75-79 is very good and 80 and above is superior. ‘Heintooga’ and ‘Premier’ had picking scars in the very good range all three years, and they both were superior to ‘Robeson’ two out of three years.
  • ‘Legacy’ southern highbush blueberry variety has proven to have good extended shelf-life (Cline, 2011), so it was compared to ‘Heintooga’, ‘Robeson’ and ‘Premier’ after seven days storage at 4.5° C. and 21° C. (Table 8). ‘Heintooga’ was equal to ‘Legacy’ after seven days storage at 4.5° C., but not at 21° C. Neither ‘Robeson’ nor ‘Premier’ were equal to ‘Legacy’ at either storage temperature.
  • ‘Heintooga’ has not had a problem with either of the major fungal diseases affecting blueberries in North Carolina, stem canker ( Botryosphaeria corticis ) and stem blight ( Botryosphaeria dothidea ) up to this time, but it is not claimed to be resistant to either disease. It has been susceptible to blueberry red ringspot virus, so only virus tested nursery plants should be purchased. ‘Heintooga’ is also susceptible to Phytophthora root rot ( Phytophthora cinnamon ), so it is important to only establish plants on well drained sites.
  • DNA based markers including restriction fragment length polymorphism (RFLP) (Saiki et al. 1985), random amplified polymorphic DNA (RAPD) (Williams et al. 1990), amplified fragment length polymorphism (AFLP) (Vos et al.
  • RFLP restriction fragment length polymorphism
  • RAPD random amplified polymorphic DNA
  • AFLP amplified fragment length polymorphism
  • Genotyping with molecular markers is used for cultivar fingerprinting, detection of genetic diversity, assessment of population structure, mapping genes of interest, and for selection of desirable genotypes in breeding programs.
  • the coding sequences of DNA that make up the genes are interrupted by long stretches of DNA that do not code for proteins and which are consequently called “non-coding DNA” or more loosely referred to as “junk DNA”. In this “junk DNA”, there are numerous chromosomal locations that contain short stretches of DNA where a particular sequence of 2-8 nucleotides is repeated in tandem a number of times.
  • SSRs These repeat units, known as SSRs, or microsatellites, always occur at the same chromosomal location, called “locus” and, although they are inherited stably from parent to child, they vary substantially between individuals.
  • SSR markers are tandem repeats of di-, tri-, tetra- or penta-nucleotides. For instance, common motif is ACn, where the two nucleotides A and C are repeated tandemly n times. The polymorphism occurs between two or more different cultivars when n differs among them. In another word, one cultivar can be AC 40 and another AC 50 .
  • Gel electrophoresis is a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and electrical charge ( FIGS. 3 and 4 ).
  • PCR polymerase chain reaction
  • one cultivar generates an 80 bp and other generates a 100 bp fragment, respectively.
  • PCR polymerase chain reaction
  • a number of fragments will not be polymorphic between any two cultivars.
  • Usually a few fragments will have different sizes that can be used to differential cultivars. Since each fingerprint is unique, therefore the profile of each cultivar must be checked against a pool of other cultivars that have been tested before.
  • a population database for blueberry has been developed at National Clonal Germplasm Repository in Corvallis (Oreg.), the most diverse global live genbank for blueberry and wild relatives, which includes over 1700 accessions from 39 countries and 81 blueberry species. They have genotyped these cultivars and accessions and created database of profiles for all genotypes that have been fingerprinted.
  • DNA extraction The DNA from frozen leaf tissue was extracted using QIAGEN DNeasy plant Mimi Kit (cat # 69104), according to manufacturer's recommendation. DNA quantity was measured using Qbit 3.0 Fluorometer (invitrogen, Carlsbad, Calif., USA) and Nanodrop (Desjardins and Conklin 2010) instruments.
  • PLR amplification The polymerase chain reaction (PCR) was carried out on a Bio-Rad DNA Engine Dyad PTC0220 thermocycler. A multiplexed PCR primer master mix containing 2 ⁇ M of each primer was used to assay 5 markers in the same reaction (Table 9). The QIAGEN, Type-It® kit containing Taq DNA polymerase and other PCR components was used for amplification of DNA followed by manufacturer's recommendations.
  • thermocycler was programmed according to QIAGEN recommendation. Briefly, an initial DNA denaturation and hot start step at 98° C. for 5 minutes, followed by 29 cycles of 95° C. for 30 sec, 57° C. for 1.5 min and 72° C. for 30 sec. A final extension was applied at the end of 29 cycles at 60° C. for 30 min and the samples were kept at 4° C. until further analyses were carried out.
  • SSR SSR name Size range Motif LG Forward (5′-3′) sequence Reverse (5′-3′) sequence CA23 154-175 (AGA)6 10 GAGAGGGTTTCGAGGAGGAG GTTTAGAAACGGGACTGTGAGACG Contig179F 19S-240 (AGT)5 9 CGTCGTGGAGGCTTAGAAAG GTTTCAAAATCACCAGCACCAA CfC262 237-287 (CAC)8 2 CGCCCACTCAGTTCATTCTT ATAGGTGGTGGCTGGTGAGT NA172F 295-313 (CAT)5 4 CCTCGTCCTCCTCTCTCT GTTTGACTTTGGAGAAGGCGAAG Vac.288135 291-333 (GAG)15 10 TCTCTTTCCCTTTTCAAGTGG GTTTATGATGGAATTCCGAGTTTG

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

‘Heintooga’ is a new and distinct variety of blueberry plant that has the following unique combination of desirable features outstanding in a new variety. Heinetooga has slightly less than one fully developed seed per berry so that the fruit should be perceived as seedless by most consumers. Heinetooga has a medium to large fruit size with very good fruit color, picking scar and flavor. The fruit firmness of Heinetooga is moderately good to good and post harvest shelf-life is good so the fruit is suitable for shipping. Further, Heinetooga has broad soil adaptation.

Description

STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING
A Sequence Listing in ASCII text format, submitted under 37 C.F.R. §1.821, entitled 5051-895_ST25.txt, 1,862 bytes in size, generated on Oct. 11, 2017 and filed via EFS-Web, is provided in lieu of a paper copy. This Sequence Listing is hereby incorporated by reference herein into the specification for its disclosures.
Latin name of the genus and species: The Latin name of the novel blueberry trispecies hybrid variety disclosed herein is Vaccinium×[V. formosum (syn. V. australe, V. corymbosum) (see Weakley, 2012)×(V. constablaeii×V. virgatum)].
Variety denomination: The inventive trispecies hybrid Vaccinium cultivar designated as Vaccinium×[V. formosum×(V. constablaeii×V. virgatum)] disclosed herein has been given the variety denomination ‘Heintooga’.
BACKGROUND OF THE INVENTION
The present invention relates to a new and distinct trispecies hybrid cultivar designated as Vaccinium×[V. formosum×(V. constablaeii×V. virgatum)] (blueberry) grown as a fruiting woody shrub for commercial agriculture. Blueberries are typically consumed both fresh and in a number of processed products.
This new and distinct variety of blueberry plant originated from the hand pollinated cross of ‘Bluechip’ (V. formosum) (unpatented) (2n=4X=48 chromosomes)×NC 1827 [PI346603 (V. constablaeii)בPremier’ (V. virgatum)] (unpatented) (2n=6X=72 chromosomes) made in a greenhouse in Raleigh, N.C., by James R. Ballington in 1978. The progeny that resulted from this cross is pentaploid with 2n=5X=60 chromosomes. Seedlings were established in 1979 at the Horticultural Crops Research Station at Castle Hayne, N.C., and a single “fully fruitful” seedling, designated as experimental selection NC 2701, was selected by James R. Ballington in 1984. Of the progeny, NC 2701 was the single seedling with a full crop of fruit. In addition, it was selected for medium to large fruit size, desirable fruit color, picking scar, firmness, flavor and low numbers of seeds per berry. As is typical with pentaploids, NC 2701 produces very little viable pollen and requires cross-pollination for fruit set and development.
NC 2701 was first established in observation trials at Jackson Springs, N.C., and based on its performance in these trials was repropagated by stem cuttings and established in replicated trials in Castle Hayne, N.C. and Jackson Springs, N.C. NC 2701 was also established in an observation trial on one commercial blueberry farm in Ivanhoe, N.C., under a Memorandum of Agreement with North Carolina State University. In addition, in 2014, NC 2701 was established in observation trials through Material Transfer Agreements between North Carolina State University, the USDA blueberry breeding program at Corvallis, Oreg., and the Rutgers University blueberry breeding program at Chatsworth, N.J. With these three agreements the University retains ownership of the plants and the grower or breeding program provides the land and care of the plants. This new variety has been named the ‘Heintooga’ cultivar, due to the similarity of its fruit quality to its wild V. constablaeii grandparent, PI 346603, which was collected on Heintooga Ridge Spur Road in western North Carolina in 1967.
SUMMARY OF THE INVENTION
‘Heintooga’ is a pentaploid trispecies hybrid blueberry variety. As is typical for pentaploids it produces little or no viable pollen and requires cross-pollination for fruit set and development. Rabbiteye blueberry varieties such as ‘Ira’, ‘Onslow’ and ‘Powderblue’ (all unpatented) are recommended for cross-pollination of ‘Heintooga’ in the southern US, and the hexaploid hybrid ‘Little Giant’ (unpatented), or highbush varieties, in northern regions. The fruit averages just under one fully developed seed per berry and should be perceived as seedless by most consumers. ‘Robeson’ pentaploid (U.S. Plant Pat. No. 19,756) produces only 3 fully developed seeds per berry, but this is still three times as many as ‘Heintooga’. Plant size is smaller and less vigorous than rabbiteye blueberry varieties such as ‘Premier’ (unpatented) or the vigorous pentaploid variety ‘Robeson’, so yield potential per plant is lower. However this can be compensated for by spacing ‘Heintooga’ plants closer together in the row resulting in higher numbers of plants per acre. ‘Heintooga’ differed consistently from ‘Robeson’ for dormant and first flush stem color, leaf dimensions, leaf margins, flower dimensions, fruit color with bloom and seed shape. ‘Heintooga’ ripens with late midseason to late ripening northern and southern highbush varieties. Fruit size is medium to large. Berry color, picking scar and flavor are consistently in the very good range. Flavor is sweet and highly aromatic, similar to the Vaccinium constablaeii grandparent of ‘Heintooga’. Berry firmness of ‘Heintooga’ is moderately good to good, significantly better than ‘Premier’ or ‘Robeson’, and adequate for long distance shipping. Post harvest shelf-life is good following seven days storage at 4.5° C. Plants of ‘Heintooga’ are broadly adapted to soils. ‘Heintooga’ has a semi-upright plant habit in contrast to ‘Robeson’ which has an upright growth habit. Plants of ‘Heintooga’ have remained true to type through successive cycles of asexual propagation. Dormant buds on ‘Heintooga’ plants have an estimated chilling requirement between 800 and 1000 hours below 4.5° C. ‘Heintooga’ was first propagated by leafy cuttings in August 1984 in Raleigh, N.C.
BRIEF DESCRIPTION OF THE DRAWINGS
This new blueberry plant is illustrated by the accompanying photographs provided in FIG. 1 and FIG. 2, which show the plant's form, foliage and fruit. The photographs in the drawings were made using digital photography techniques and illustrate colors as true as can be reasonably obtained when using these techniques. Colors in the photographs may differ slightly from the color values cited in the detailed botanical description, which accurately describe the colors of the new Vaccinium variety. FIG. 3 relates to DNA fingerprinting of ‘Heintooga’.
FIG. 1 illustrates the typical plant habit of ‘Heintooga’ and was taken from a five-year old plant growing at the North Carolina. Agricultural Research Service Station at Jackson Springs, N.C.
FIG. 2 illustrates the typical fruit of ‘Heintooga’ growing at the Horticultural Crops Research Station at Castle Hayne, N.C. The fruit was harvested from four-year old plants.
FIG. 3 shows a hypothetical example of one SSR marker on a panel of 6 cultivars depicted as 1-6. The lane marked as M shows the standard marker lane with known fragment size in base pair (bp). The top arrow shows a monomorphic band that is identical in all cultivars. The bottom arrow shows a band that is monomorphic in cultivar 3, 4 and 6. Therefore the other band can be used to distinguish these three cultivars from each other. This profile for these cultivars is based on one markers. As the number of markers increase the probability that two literally different cultivars have the same profile will reduced.
FIG. 4 provides a gel electrophoresis picture of two SSR markers run on 30 blueberry cultivars. The profile of the two SSR markers for different cultivars are different and shows that while the marker on the left hand side shows more polymorphism, the marker in the right hand side is less informative for distinguishing the cultivars.
DETAILED BOTANICAL DESCRIPTION
The following is a detailed botanical description of a new and distinct variety of pentaploid trispecies Vaccinium hybrid known as ‘Heintooga’. The observations below are from mature plants grown in a replicated trial at standard commercial plant spacing for rabbiteye blueberry varieties of 1.9 m between plants in rows and 3.9 m between rows, at Castle Hayne, N.C., with four replications of four plants per replication. Those skilled in the art of cultivar description and evaluation will appreciate that certain characteristics of a variety will vary with older, or conversely, younger plants. ‘Heintooga’ has not been observed under all possible environmental conditions. Where dimensions, sizes, colors and other characteristics are given, it is to be understood that such characterizations are approximations or averages set forth as accurately as practicable. The phenotype of the variety may differ from the description herein with variations in the environment such as season, temperature, light intensity, day length and cultural conditions. Color notations are based on The Royal Horticultural Society Colour Chart, The Royal Horticultural Society, London, UK, 4th edition, 2001.
For botanical description purposes ‘Heintooga’ was compared to ‘Robeson’ (U.S. Plant Pat. No. 19,756) (Ballington and Rooks, 2009), another recent pentaploid hybrid release from North Carolina State University. It was not feasible to compare ‘Heintooga’ with its female parent ‘Bluechip’ because the latter is extremely susceptible to the stern blight fungus (Botryosphaeria dothidea) to the point that it is impractical to establish and maintain for comparison purposes. Only two plants remain of the male parent, NC 1827, and they are established at the Sandhills Research Station, at Jackson Springs, rather than at Castle Hayne. So, with the exception of characters that would not vary across locations, it was not feasible to compare ‘Heintooga’ to NC 1827 either. In this regard, ‘Heintooga’ does differ from NC 1827 for plant habit, semiupright for ‘Heintooga’ versus spreading for NC 1827, and leaf margins, entire for ‘Heintooga’ versus serrulate for NC 1827. The botanical descriptive data presented below are averages of data collected from 2009-2013 from mature plants (seven to eleven years old) grown in Castle Hayne, N.C.
Technical Description of the Variety and Comparison to Blueberry Variety ‘Robeson’
  • Plant:
      • Dimensions.—Heintooga — 1.5 m height, 1,5 m width, H/W ratio 1. Robeson — 2.4 m height, 1.8 m width, H/W ratio 1.33.
      • Mature stem diameter.—Heintooga — 1.5 to 3 cm. Robeson — 2.5 to 5 cm.
      • Mature stem length.—Heintooga — 108 cm. Robeson — 135 cm.
      • Number of mature stems per bush.—Heintooga — 8 to 10. Robeson — 4 to 6.
      • Number of renewal stems.—Heintooga — 2.7. Robeson — 2.8.
      • Internode length on first flush growth.—Heintooga — 11 cm. Robeson — 13 cm.
      • Dormant mature stem color.—Heintooga — brown (RHS N200D). Robeson — brown (RHS 200C).
      • Dormant one year stem color.—Heintooga — greyed-purple (RHS 183B) on exposed surface; greyed-orange (RHS 175B) on unexposed surface. Robeson — greyed-orange (RHS 174B) on exposed surface; yellow-green (RHS 148B) on unexposed surface.
      • First flush growth stem color in summer.—Heintooga — greyed-orange (RHS 175B) on exposed surface; green (RHS 138C) on unexposed surface. Robeson — green (RHS 138C) on exposed and unexposed surfaces.
      • Pubesence on summer and one year dormant stems.—None either Heintooga or Robeson.
  • Leaves:
      • Leaf blade dimensions.—Heintooga — 55 mm length (L), 25 mm width (W), L/W ratio 2.2. Robeson — 62 mm length, 32 mm width, L/W ratio 1.9.
      • Leaf petiole length.—Heintooga — 3 mm. Robeson — 4 mm.
      • Leaf shape.—Heintooga — narrowly elliptic. Robeson — mostly acuminate to occasionally acute.
      • Leaf apex angle.—Heintooga — acuminate. Robeson — mostly acuminate to occasionally acute.
      • Leaf base angle.—Acute for both Heintooga and Robeson.
      • Leaf margin.—Heintooga — entire. Robeson — sparsely serrulate on apical one third.
      • Leaf pubescence.—None for either Heintooga or Robeson.
      • Leaf glands.—None on either surface for Heintooga or Robeson.
      • Leaf color.—Heintooga — green (RHS 136A 137A) on the adaxial surface; green (RHS 138A-139A) on the abaxial surface. Robeson — green (RHS 136B-137B) on the adaxial surface; green (RHS 138A-N138B) on the abaxial surface.
      • Vegetative bud burst.—Heintooga — mid-season. Robeson — early.
  • Flowers:
      • Number of flower petals.—Five for Heintooga and Robeson, fused completely along the margins into a corolla tube so that they cannot be separated for individual measurements.
      • Number of flowers per inflorescence.—Heintooga — 8 to 9. Robeson — 7 to 8.
      • Flower dimensions.—Heintooga — 8 mm length, 5.5 mm width, L/W ratio 1.45. Robeson — 7 mm length, 7 mm width, L/W ratio 1.
      • Length of the single style.—Heintooga and Robeson 8 mm for both.
      • Length of stamens.—Heintooga — 7 mm. Robeson — 6 mm.
      • Flower shape.—Heintooga — urceolate to cylindro-urceolate. Robeson — urceolate.
      • Color of petals on fully opened flowers.—White (RHS 155C) for both Heintooga and Robeson with red-purple (RHS N66B-N66D) on exposed corolla lobes.
      • Corolla.—Ridges are present on the corolla of Heintooga and Robeson, and indicated by red-purple Color (RHS N66B-N66D) verses white (RHS 155C) for the remainder of the corolla.
      • Bud bloom burst.—Moderate for Heintooga.
  • Fruit: (See, FIG. 2).
      • Fruit dimensions.—Heintooga — 12 mm length, 14 mm width, L/W ratio 0.86. Robeson — 13 mm length. 14 mm width, L/W ratio 0.9.
      • Fruit shape.—Heintooga — round to mostly oblate. Robeson — round to oblate.
      • Fruit cluster density.—Medium for Heintooga and Robeson.
      • Fruit pedicel length.—Heintooga — 7 mm. Robeson — 8 mm.
      • Fruit pedicel color.—Yellow-green (RHS 148B) for Heintooga and Robeson.
      • Fruit nicking scar diameter.—Heintooga — 1-2 mm. Robeson — 2 mm.
      • Fruit calyx orientation.—Heintooga — mostly appressed against the apical end of the berry. Robeson — appressed.
      • Fruit calyx prominence.—Not prominent on Heintooga or Robeson.
      • Fruit calyx diameter.—5-7 mm for Heintooga. New Hanover and O'Neal.
      • Depth of calyx basin.—Shallow to medium for Heintooga and Robeson.
      • Fruit color with bloom (epicuticular wax).—Heintooga — violet-blue (RHS 97C). Robeson — blue (RHS 100C).
      • Fruit color without bloom.—Black (RHS 202A) for both Heintooga and Robeson.
      • Fruit acidity.—Heintooga — low. Robeson — moderate.
      • Fruiting type.—Fruiting only occurs on one year old shoots for Heintooga and Robeson.
      • Fruit sweetness.—Medium for Heintooga.
  • Fruit sepals:
      • Fruit sepal number.—Five for Heintooga and Robeson.
      • Fruit sepal shape.—Ovate for Heintooga and Robeson.
      • Fruit sepal length.—Heintooga — 1.4 mm. Robeson — 1.2 mm.
      • Fruit sepal width.—Heintooga — 2.2 mm. Robeson — 2.0 mm.
      • Fruit sepal apex.—Heintooga — acute to occasionally acuminate. Robeson — acute.
      • Fruit sepal base.—Acute and fused to the fruit skin for Heintooga and Robeson.
      • Fruit sepal margin.—Entire for Heintooga and Robeson.
      • Fruit sepal outer surface color.—Heintooga — Violet-blue (RHS 97C). Robeson — Blue (RHS 100C).
      • Fruit sepal inner surface color.—Black (RHS 202A) for Heintooga and Robeson.
      • Fruit sepal attitude.—Appressed (flattened) for Heintooga and Robeson.
  • Seeds:
      • Number of fully developed seeds per berry.—Heintooga — 0.9 average (range 0.0-2.0). Robeson — 3.1 average (range 2.5-3.65).
      • Seed dimensions.—Heintooga — 1.75 mm length. 1.0 mm width, L/W ratio 1.75. Robeson — 1.5 mm length, 1.0 mm width, L/W ratio 1.5.
      • Seed shape.—Heintooga — depressed shallowly arcuate. Robeson — depressed ovate.
Distinctive Characteristics of ‘Heintooga’ Based on Botanical Data
‘Heintooga’ differs consistently from ‘Robeson’ for plant vigor as determined by plant dimensions, 1.5 m height by 1.5 m width for ‘Heintooga’ versus 2.4 m height by 1.8 m width for ‘Robeson’; mature stem length, 108 cm for ‘Heintooga’ versus 135 cm for ‘Robeson’; number of mature stems, 8-10 for ‘Heintooga’ versus 4-6 for ‘Robeson’; and average annual length of new stems, 36 cm for ‘Heintooga’ versus 46 cm for ‘Robeson’. They also consistently differ for dormant one year stem color, greyed-purple (RHS 183B) on the exposed surface and greyed-orange (RHS 175B) on the unexposed surface for ‘Heintooga’ versus greyed-orange (RHS 174B) on the exposed surface and yellow-green (RHS 148B) on the unexposed surface for ‘Robeson’; first flush stem color in summer, greyed-orange (RHS 175B) on the exposed surface for ‘Heintooga’ versus green (RHS 138C) on the exposed surface for ‘Robeson’; leaf blade dimensions, 55 mm length by 25 mm width for ‘Heintooga’ versus 62 mm length by 32 mm width for ‘Robeson’; leaf margin, entire for ‘Heintooga’ and sparsely serrulate on the apical one third for ‘Robeson’; flower dimensions, 8.0 mm length by 5.5 mm width for ‘Heintooga’ versus 7.0 mm length by 7.0 mm width for ‘Robeson’; fruit color with bloom, violet-blue (RHS 97C) for ‘Heintooga’ versus blue (RHS 100C) for ‘Robeson’; number of fully developed seeds per berry, 0.9 average for ‘Heintooga’ versus 3.1 average for ‘Robeson’; and seed shape, depressed shallowly arcuate for ‘Heintooga’ versus depressed ovate for ‘Robeson’.
For technical (pomological) description purposes ‘Heintooga’ was compared to ‘Robeson’ and ‘Premier’ (unpatented) in the replicated trial at Castle Hayne, N.C., in 2005-2007. This trial is described in the previous section. ‘Premier’ was included in the trial to serve as a pollinator variety for the two pentaploid varieties, ‘Heintooga’ and ‘Robeson’. Data for time of bloom was however collected from Jackson Springs, N.C., in 2014 because it was considered to be more representative.
Time of Flowering
Table 1 presents representative bloom data comparing ‘Heintooga’ to ‘Robeson’ and ‘Premier’ at Jackson Springs, N.C., in 2014. Date of first bloom for ‘Heintooga’ was three days later than ‘Robeson’ and four days later than ‘Premier’. ‘Heintooga’ was one day later than ‘Robeson’ and four days earlier than ‘Premier’ for date of 50 percent bloom. ‘Heintooga’ was four days later than ‘Robeson’ for date of last bloom. It was not feasible to determine the date of last bloom for ‘Premier’ because it is a very large plant and the majority of the flowers are abnormal with only a partially developed corolla or no corolla at all (Sampson, et al., 2014).
TABLE 1
Time of flowering of blueberry cultivars, ‘Heintooga’, ‘Robeson’
and ‘Premier’, Jackson Springs, NC. 20141
Bloom dates
Cultivar First bloom 50% bloom Last bloom
Heintooga
3/26 4/8  4/18
Robeson 3/23 4/7  4/22
Premier 3/22 4/12 NA2
1Estimated from field observations.
2Not available as it was not feasible to determine date of last bloom on ‘Premier’ due to the size of the plant and abnormal corolla development.
Pollen Production and Pollination Requirements
The flowers of ‘Heintooga’ produce little or no viable pollen so they require cross pollination for fruit set and development. The rabbiteye blueberry (V. virgatum) cultivars ‘Ira’, ‘Onslow’ and ‘Powderblue’ (all unpatented) are recommended as pollinator varieties in the southern US. ‘Premier’ also overlaps in bloom with ‘Heintooga’ (Table 1) and was the pollinator in the replicated trial at Castle Hayne, N.C., however it tends to bloom early in some years and its abnormal flower morphology makes ‘Premier’ especially subject to frost and freeze injury, so it is no longer recommended as a pollinator for ‘Heintooga’. The hexaploid interspecific hybrid cultivar ‘Little Giant’ (unpatented) (USDA, ARS. Release notice for ‘Little Giant’, 1995) or northern highbush varieties are recommended as pollinators for ‘Heintooga’ in colder regions because rabbiteye blueberry cultivars are not hardy outside the southern US.
Ripening Season
Season of ripening is represented by percent ripe fruit by mid-Jure (Table 2). On average, ‘Heintooga’ had 32 percent more ripe fruit by mid June than ‘Robeson’ and 52 percent more than ‘Premier’. In 2007, ripening data was available for comparison with the southern highbush cultivar ‘Legacy’ (V. formosum) (unpatented, USDA, ‘Legacy’ release notice, 2001) and the percent ripe fruit for this cultivar and ‘Heintooga’ was very similar. ‘Legacy’ is considered late midseason to late season ripening. ‘Heintooga’ appears to ripen with late midseason to late season highbush and southern highbush type blueberries as opposed to between highbush and rabbiteye, which is typical for pentaploids in Vaccinium (Galletta and Ballington, 1996).
TABLE 2
Percent ripe fruit by mid-June for Heintooga, Robeson and Premier
blueberry cultivars. Castle Hayne, NC, 2005-2007
Percent ripe by mid-June
Cultivar 2005 2006 2007 Mean
Heintooga 40 92 85 72
Robeson  0 62 39 47
Premier  0 28 28 19
Legacy1 81
1Southern highbush cultivar included for comparison in 2007.
Yield Per Plant
Yield per plant for ‘Heintooga’ was significantly lower than ‘Robeson’ or ‘Premier’ two years out of three at Castle Hayne, N.C., (Table 3). However, plant size of ‘Heintooga’ is smaller than either of the other two varieties (see Plant Dimensions under Botanical Description, and U.S. Plant Pat. No. 19,756), therefore ‘Heintooga’ does not have the same yield potential on a per plant basis as ‘Robeson’ or ‘Premier’. Since ‘Heintooga’ is a smaller plant, the difference in yield on a per hectare basis can be compensated for by closer spacing of plants within rows.
TABLE 3
Yield in grams per plant for Heintooga, Robeson and Premier
blueberry plants. Castle Hayne, NC. 2005-20071
Yield (grams/plant)2
Cultivar 2005 2006 2007
Heintooga 2532b 1530b 1384ns
Robeson 5062a 3531a 2722ns
Premier 5848a 3096a 1273ns
1Mature plants, planted in a field that is a “frost pocket” (only field available at the time), so year to year variations in yield are due to frost and freeze injury.
2Values within columns not followed by the same letter are siginficantly different, P = 0.05, LSD test.
Fruit Size
‘Heintooga’ berries were statistically equal to those of ‘Premier’ in size two out of the three years (Table 4), which puts them in medium to large size categories. They were significantly larger than berries of ‘Robeson’ two out of the three years, and equal in size to ‘Robeson’ the third year.
TABLE 4
Berry size (grams/berry) for Heintooga, Robeson and Premier
blueberry cultivars, Castle Hayne, NC. 2005-2007.
Berry size (g/berry)1
Cultivar 2005 2006 2007
Heintooga 1.97a 1,8b 1.48ns
Robeson 1.56b 1.54c 1.44ns
Premier 1.74ab 7a 1.63ns
1Values within columns not followed by the same letter are significantly different. P = 0.05, LSD test
Fruit Color
In addition to The Royal Horticultural Society Colour Chart, fruit color was also determined objectively by a Minolta Color Meter (Table 5). Objective fruit color measurements determined that ‘Heintooga’ was equal to ‘Premier’ for light blue fruit color two years out of three. It was significantly lighter blue than ‘Robeson’ two years out of three and there were no differences between the two the third year.
TABLE 5
Objective berry color measurements (L values) for Heintooga,
Robeson and Premier blueberries. Castle Hayne, NC. 2005-2007.
Berry color (L values1,2)
Cultivar 2005 2006 Average
Heintooga 19.3b 22.3a 20.8ns
Robeson 17.9c 19b 1.84ns
Premier 21.1a 21.3a 21.2ns
1Determined by Minolta Color Meter where higher “L” values indicate lighter blue color.
2Values within columns not followed by the same letter are significantly different, P = 0.05. LSD test.
Fruit Firmness
Fruit firmness was determined objectively in grams/mm compression by a FirmTeck II Firmness Tester (Table 6). ‘Heintooga’ was significantly more firm than either ‘Robeson’ or ‘Premier’ in all three years of evaluations. In addition, ‘Premier’ was significantly more firm than ‘Robeson’ for all three years. A threshold value of 200 g/mm is often used as the minimum standard for superior firmness for blueberry fruit. Therefore, the fruit of ‘Heintooga’ ranged from moderately firm (176 g/mm in 2005) to firm (196 g/mm in 2007). This also means that the fruit of ‘Heintooga’ is sufficiently firm for shipment to distant markets, in contrast to ‘Robeson’.
TABLE 6
Objective berry firmness (g/mm compression) for Heintooga,
Robeson and Premier blueberries. Castle Hayne, NC. 2005-2007.
Berry firmness (grams/mm)1,2
Cultivar 2005 2006 2007
Heintooga 176a 189a 196a
Robeson 118c 117c 128c
Premier 160b 170b 177b
1Determined by FirmTeck II where 200 g/mm is the minimum standard for supetior firmness.
2Values within columns not followed by the same letter are signific ntly different, P = 0.05, LSD test.
Fruit Picking Scar
In addition to measuring the average diameter of the picking scar of the berries as part of the botanical description, picking scar was also evaluated subjectively for the technical description of ‘Heintooga’ (Table 7). This was based on a subjective rating scale of 10-90 where less than 60 is unacceptable, 60-69 is acceptable, 70-74 is good, 75-79 is very good and 80 and above is superior. ‘Heintooga’ and ‘Premier’ had picking scars in the very good range all three years, and they both were superior to ‘Robeson’ two out of three years.
TABLE 7
Picking scar subjective ratings for fruit of Heintooga, Robeson
and Premier blueberries. Castle Hayne, NC. 2005-2007.
Picking scar ratings1,2
Cultivar 2005 2006 2007
Heintooga 75.5ns 75.6a 78.4a
Robeson 73.9ns 73.2b 77.2b
Premier 75ns 75.7a 78.2a
1Based on a subjective 10-90 rating scale where less than 60 is unacceptable, 60-69 is acceptable, 70-74 is good, 75-79 is very good, and 80 and above is supetior.
2Values within columns not followed, by the same letter are significantly different, P = 0.05, LSD test.
Fruit Flavor
There were no significant statistical differences among the three varieties with regard to subjective ratings for flavor. Overall ratings for all three were in the very good range as follows; ‘Heintooga’ (77), ‘Robeson’ (76) and ‘Premier’ (75). The flavor of ‘Heintooga’ can also be characterized as sweet and very aromatic, which is quite similar to its grandparent, V. constablaeii PI 346603.
Post Harvest Shelf-Life
‘Legacy’ southern highbush blueberry variety has proven to have good extended shelf-life (Cline, 2011), so it was compared to ‘Heintooga’, ‘Robeson’ and ‘Premier’ after seven days storage at 4.5° C. and 21° C. (Table 8). ‘Heintooga’ was equal to ‘Legacy’ after seven days storage at 4.5° C., but not at 21° C. Neither ‘Robeson’ nor ‘Premier’ were equal to ‘Legacy’ at either storage temperature.
TABLE 8
Post-harvest shelf-life of the fruit of Heintooga, Robeson and Premier,
compared to Legacy southern highbush for percent sound fruit
after seven days storage at 4.5° C. and 21° C., Castle Hayne, NC
Percent sound fruit1
Cultivar 4.5° C.1 21° C.
Heintooga 74 57
Robeson 30 19
Premier 60 56
Legacy2 78 72
1Based on four reps for each of four harvest dates.
2Legacy included for comparison as a successful cultivar for extended shelf-life and long distance shipping.
Propagation
‘Heintooga’ is easily propagated asexually by both hardwood and softwood stem cuttings. All plants have remained true to type across all generations of asexual propagation.
Chilling Requirement
Dormant buds on plants of ‘Heintooga’ require 800-1000 hours of temperatures below 4.5° C. to break dormancy in spring.
Plant Habit
‘Heintooga’ plants are semi-upright in plant habit (see FIG. 1 and H/W ratio of 1 under plant dimensions) while ‘Robeson’ has an upright plant habit (H/W ratio of 1.33).
Soil Adaptation
‘Heintooga’ is widely adapted to soils and has performed well on both light sandy soils as well as high organic soils.
Disease Reaction
‘Heintooga’ has not had a problem with either of the major fungal diseases affecting blueberries in North Carolina, stem canker (Botryosphaeria corticis) and stem blight (Botryosphaeria dothidea) up to this time, but it is not claimed to be resistant to either disease. It has been susceptible to blueberry red ringspot virus, so only virus tested nursery plants should be purchased. ‘Heintooga’ is also susceptible to Phytophthora root rot (Phytophthora cinnamon), so it is important to only establish plants on well drained sites.
DNA Fingerprinting-Background
During the past three decades several biochemical and DNA based assays have been developed to fingerprint human and plants. While biochemical assays such as isozymes were among the very first ones that were developed but they are limited in number and time consuming to generate. Genetic information is stored in cells as DNA, a long molecular chain, on which the linear order of four chemicals (called A, C, G, and T nucleotides) constitute individual genes. DNA based markers including restriction fragment length polymorphism (RFLP) (Saiki et al. 1985), random amplified polymorphic DNA (RAPD) (Williams et al. 1990), amplified fragment length polymorphism (AFLP) (Vos et al. 1995), simple sequence repeats (SSRs) (Tautz 1989), single nucleotide polymorphism (SNP) (Collins et al. 1997), single position polymorphism (SPP) (Stoffel et al. 2012), and targeted region amplification polymorphism (TRAP) (Palumbo et al. 2007). Genotyping with molecular markers is used for cultivar fingerprinting, detection of genetic diversity, assessment of population structure, mapping genes of interest, and for selection of desirable genotypes in breeding programs. The coding sequences of DNA that make up the genes are interrupted by long stretches of DNA that do not code for proteins and which are consequently called “non-coding DNA” or more loosely referred to as “junk DNA”. In this “junk DNA”, there are numerous chromosomal locations that contain short stretches of DNA where a particular sequence of 2-8 nucleotides is repeated in tandem a number of times.
These repeat units, known as SSRs, or microsatellites, always occur at the same chromosomal location, called “locus” and, although they are inherited stably from parent to child, they vary substantially between individuals. SSR markers are tandem repeats of di-, tri-, tetra- or penta-nucleotides. For instance, common motif is ACn, where the two nucleotides A and C are repeated tandemly n times. The polymorphism occurs between two or more different cultivars when n differs among them. In another word, one cultivar can be AC40 and another AC50. The fragments can then be separated by size (bp=base pairs) on an electrophoresis gel and individuals can be genotyped for their allelic composition (homozygote or heterozygote for one or more alleles). Gel electrophoresis is a method for separation and analysis of macromolecules (DNA, RNA and proteins) and their fragments, based on their size and electrical charge (FIGS. 3 and 4). When these fragments amplified by polymerase chain reaction (PCR), one cultivar generates an 80 bp and other generates a 100 bp fragment, respectively. Usually amplification occurs in multiple locations in the genome (alleles), resulting multiple fragments with different sizes. A number of fragments will not be polymorphic between any two cultivars. Usually a few fragments will have different sizes that can be used to differential cultivars. Since each fingerprint is unique, therefore the profile of each cultivar must be checked against a pool of other cultivars that have been tested before.
A population database for blueberry has been developed at National Clonal Germplasm Repository in Corvallis (Oreg.), the most diverse global live genbank for blueberry and wild relatives, which includes over 1700 accessions from 39 countries and 81 blueberry species. They have genotyped these cultivars and accessions and created database of profiles for all genotypes that have been fingerprinted.
DNA Profiling of Heintooga
Plant Materials: Leaf tissues of Heintooga cultivar were collected from our experimental station field at Castle Hayne, N.C. as well as samples at Micropropagation and Repository Unit (MPRU) in Raleigh, N.C. This allowed us to compare the samples in the field with those that were used in tissue culture facility (MPRU) to make sure they are identical and the true types. The leaf tissues were kept in −80 freezer until they were used for DNA extraction.
DNA extraction: The DNA from frozen leaf tissue was extracted using QIAGEN DNeasy plant Mimi Kit (cat # 69104), according to manufacturer's recommendation. DNA quantity was measured using Qbit 3.0 Fluorometer (invitrogen, Carlsbad, Calif., USA) and Nanodrop (Desjardins and Conklin 2010) instruments.
PLR amplification: The polymerase chain reaction (PCR) was carried out on a Bio-Rad DNA Engine Dyad PTC0220 thermocycler. A multiplexed PCR primer master mix containing 2 μM of each primer was used to assay 5 markers in the same reaction (Table 9). The QIAGEN, Type-It® kit containing Taq DNA polymerase and other PCR components was used for amplification of DNA followed by manufacturer's recommendations.
The thermocycler was programmed according to QIAGEN recommendation. Briefly, an initial DNA denaturation and hot start step at 98° C. for 5 minutes, followed by 29 cycles of 95° C. for 30 sec, 57° C. for 1.5 min and 72° C. for 30 sec. A final extension was applied at the end of 29 cycles at 60° C. for 30 min and the samples were kept at 4° C. until further analyses were carried out.
TABLE 9
List of SSR markers, their names, size range, repeat motif, linkage group (LG) on a
genetic linkage map, forward and reverse primers.
SSR name Size range Motif LG Forward (5′-3′) sequence Reverse (5′-3′) sequence
CA23 154-175 (AGA)6 10 GAGAGGGTTTCGAGGAGGAG GTTTAGAAACGGGACTGTGAGACG
Contig179F 19S-240 (AGT)5 9 CGTCGTGGAGGCTTAGAAAG GTTTCAAAATCACCAGCACCAA
CfC262 237-287 (CAC)8 2 CGCCCACTCAGTTCATTCTT ATAGGTGGTGGCTGGTGAGT
NA172F 295-313 (CAT)5 4 CCTCGTCCTCCTCTTCCTCT GTTTGACTTTGGAGAAGGCGAAG
Vac.288135 291-333 (GAG)15 10 TCTCTTTCCCTTTTCAAGTGG GTTTATGATGGAATTCCGAGTTTG
Detection: The size of each SSR marker was determined by Beckman Coulter CEQ 8000 Genetic Analysis System. This system automatically fills the capillary array with a patented linear polyacrylamide (LPA) gel, denatures and loads the sample, applies the voltage program, and analyzes the data. The fingerprint profile of Heintooga samples was developed based on five SSR markers. Each peak corresponded to one allele of markers used. The samples included a Heintooga sample collected from field F3 in Castle Hayne experimental station, a Heintooga sample collected from mother plant B grown on tissue cultured media, a Heintooga sample collected from mother plant C grown on tissue cultured media and a Heintooga sample collected from mother plant C grown in the greenhouse of MPRU, respectively.
Results: Heintooga generated a unique profile, which did not match with all cultivars that have been genotypes at National Clonal Germplasm Repository in Corvallis (Oreg.) (Table 10). The sample that was collected from our experimental station in Castle Hayne and the samples collected from MPRU (Tissue cultured plants in greenhouse and the plants that were still in the growth chamber in tissue culture media), all four generated identical profile indicating that they are true types in both locations and different sources. We cannot calculate the probability of finding an exact match with Heintooga in all blueberry populations, because allele frequency of all SSR alleles at all loci has not been calculated for blueberry. However, probability of all 19 alleles of the 5 markers tested is closed to zero.
TABLE 10
The fingerprint profile of the Heintooga based on five SSR markers. The
numbers after the “-” designate the allele (different form) number of each
marker and the numbers under each allele call is the size of the SSR
markers in base pair
Sample CA23-1 CA23-2 Contig179-1
Heintooga_F3_CH 157 160 216
Heintooga_ 157 160 216
B_TC_MPRU
Heintooga_ 157 160 216
C_TC_MPRU
Heintooga_ 157 160 216
C_GH_MPRU
Sample Contig179-2 Contig179-3 Contig179-4
Heintooga_F3_CH 218 221 237
Heintooga_ 218 221 237
B_TC_MPRU
Heintooga_ 218 221 237
C_TC_MPRU
Heintooga_ 218 221 237
C_GH_MPRU
Sample Contig179-5 CFC262-1 CFC262-2
Heintooga_F3_CH 240 246 251
Heintooga_ 240 216 251
B_TC_MPRU
Heintooga_ 240 246 251
C_TC_MPRU
Heintooga_ 240 246 251
C_GH_MPRU
Sample CFC262-3 CFC262-4 NA172-1
Heintooga_F3_CH 254 260 295
Heintooga_ 254 260 295
B_TC_MPRU
Heintooga_ 254 260 295
C_TC_MPRU
Heintooga_ 254 260 295
C_GH_MPRU
Sample NA172-2 NA172-3 Vac.288135-1
Heintooga_F3_CH 304 307 310
Heintooga_ 304 307 310
B_TC_MPRU
Heintooga_ 304 307 310
C_TC_MPRU
Heintooga_ 304 307 310
C_GH_MPRU
Sample Vac.288135-2 Vac.288135-3 Vnc.288135-4
Heintooga_F3_CH 313 315 319
Heintooga_ 313 315 319
B_TC_MPRU
Heintooga_ 313 315 319
C_TC_MPRU
Heintooga_ 313 315 319
C_GH_MPRU
Sample Vac.288135-5
Heintooga_F3_CH 321
Heintooga_B_TC_MPRU 321
Heintooga_C_TC_MPRU 321
Heintooga_C_GH_MPRU 321
Herbarium Voucher
A voucher of ‘Heintooga’ will be deposited in the Herbarium of North Carolina State University (NCSU) in Raleigh, N.C., USA, upon patenting.
Literature Cited
  • Weakley, A. S. 2012. Flora of the Southern and Mid-Atlantic States. UNC Herbarium, North Carolina Botanical Garden, UNC-CH, Chapel Hill, N.C.
  • Ballington, J. R. and Rooks, S. D. 2009. Blueberry named ‘Robeson’. U.S. Plant Pat. No. 19,756. US Patent and Copyright Office.
  • Sampson, B. J., Marshall-Shaw, D. A., Stringer, S. J., Sakhanokho, H. F., Werle, C. T. and Spiers, J. M. 2014. Improving yield and berry quality for zygomorphic bloom of blueberry; the role of plant growth regulators, gibberellic acid and coconut oil. Scientia Horticulturae. 173: 1-14.
  • United States Department of Agriculture, ARS. 1995. Release notice for ‘Little Giant’ blueberry.
  • United States Department of Agriculture. 2001. Notice of release of Legacy highbush blueberry. USDA and New Jersey Agr. Expt. Sta. 19 Dec. 2001. www.barc.usda.gov/psi/fl/ehl-leg.html
  • Galletta, G. J. and Ballington, J. R. 1996. Blueberries, cranberries and lingonberries. Pp 1-107. In J. Janick and J. N. Moore (eds.) Fruit Breeding, Vol.II: Vine and Small Fruit Crops. John Wiley and Sons, Inc.
  • Cline, W. O. 2011. Blueberry cultivar ‘Legacy’. The N.C. Blueberry Journal. Wednesday, Aug. 3, 2011.
  • Saiki R K, Scharf S, Faloona F, Mullis K B, Horn G T, Erlich H A, Amheim N: Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 1985, 230(4732):1350-1354.
  • Williams J G, Kubelik A R, Livak K J, Rafalski J A, Tingey S V: DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 1990, 18(22):6531-6535.
  • Vos P, Hogers R, Bleeker M, Reijans M, Lee Tvd, Homes M, Friters A, Pot J, Paleman J, Kuiper M et al: AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 1995, 23(21):4407-4414.
  • Tautz D: Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res 1989, 17(16):6463-6471.
  • Collins F S, Guyer M S, Charkravarti A: Variations on a theme: cataloging human DNA sequence variation. Science 1997, 278(5343):1580-1581.
  • Stoffel K, van Leeuwen H, Kozik A, Caldwell D, Ashrafi H, Cui X, Tan X, Hill T, Reyes-Chin-Wo S, Truco M-J et al: Development and application of a 6.5 million feature affymetrix genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.). BMC Genomics 2012, 13(1):185.
Palumbo R, Hong W-F, Wang G-L, Hu J, Craig R, Locke J, Krause C, Tay D: Target Region Amplification Polymorphism (TRAP) as a Tool for Detecting Genetic Variation in the Genus Pelargonium. HortScience 2007, 42(5):1118-1123.
  • Desjardins P, Conklin D: NanoDrop Microvolume Quantitation of Nucleic Acids. Journal of Visualized Experiments: JoVE 2010(45):2565.

Claims (1)

The invention claimed is:
1. A new and distinct variety of commercial blueberry plant (pentaploid trispecies Vaccinium hybrid) substantially as illustrated and described, characterized by its late midseason to late season ripening, medium to large size fruit with good color, picking scar and flavor, moderately good to good firmness and good postharvest shelf-life making it suitable for long distance shipping, and averaging slightly less than one fully developed seed per berry so that the fruit should be perceived as seedless by most consumers.
US14/998,766 2015-12-23 2016-02-12 Blueberry plant named ‘Heintooga’ Active 2036-03-26 USPP28790P3 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/998,766 USPP28790P3 (en) 2015-12-23 2016-02-12 Blueberry plant named ‘Heintooga’

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562387278P 2015-12-23 2015-12-23
US14/998,766 USPP28790P3 (en) 2015-12-23 2016-02-12 Blueberry plant named ‘Heintooga’

Publications (2)

Publication Number Publication Date
US20170188494P1 US20170188494P1 (en) 2017-06-29
USPP28790P3 true USPP28790P3 (en) 2017-12-26

Family

ID=59087450

Family Applications (1)

Application Number Title Priority Date Filing Date
US14/998,766 Active 2036-03-26 USPP28790P3 (en) 2015-12-23 2016-02-12 Blueberry plant named ‘Heintooga’

Country Status (1)

Country Link
US (1) USPP28790P3 (en)

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
10th International Symposium on Vaccinium and Other Superfruits. Jun. 17-22, 2012. Maastricht, Netherlands. Abstract entitled NC 2701, a promising trispecies pentaploid blueberry selection from North Carolina. James Ballington and Terry Bland. pp. 2.
Ballington J.R. Blueberry cultivars released from North Carolina State University blueberry breeding program. Jun. 30, 2015, pp. 3.
Current status of the NCSU Breeding Program; published in 2013; pp. 1.
North Carolina State Univ submitted to CRIS Vaccinium Breeding and Genetics Project End Date 9/30/10, 16 pp. *
North Carolina State Univ submitted to CRIS Vaccinium Breeding and Genetics Project End Date Sep. 30, 2010, 16 pp. *
North Carolina State University submission to the USDA Current Research Information System (CRIS) entitled: Blueberry and Muscadine Grape Breeding. Project No. NC02366. Project start date: Oct. 1, 2010; Project end date: Sep. 30, 2015, pp. 5.
North Carolina State University submission to the USDA Current Research Information System (CRIS) entitled: Vaccinium Breeding and Genetics. Project No. NC03647. Project start date: Oct. 1, 2005; Project end date: Sep. 30, 2010, (pp. 2, 4, and 5 discuss the new variety NC 2701 that is being developed) pp. 16.
Progress with the Blueberry Breeding Program at North Carolina State University, published in 2011; (variety NC 2701 discussed on pp. 37-39 and 43-44) pp. 8.

Also Published As

Publication number Publication date
US20170188494P1 (en) 2017-06-29

Similar Documents

Publication Publication Date Title
US11638407B2 (en) Hybrid pumpkin plant named HMX0686
US11737406B2 (en) Hybrid pumpkin plant named HMX6821
US10420316B2 (en) Hybrid pepper plant named HMX15636
US20210400903A1 (en) Hybrid tomato plant named hmc44133
Lahav et al. Genetics and classical breeding.
Conner et al. Muscadine grape breeding
US11388870B2 (en) Hybrid pepper plant named AWAKINO
US20250248360A1 (en) Hybrid tomato varieties 'vt19077208' and 'vt19108230'
US20250160291A1 (en) Hybrid tomato variety 'vt19077602'
US20200253143A1 (en) Iplants of justicia and their uses
US11399476B2 (en) Red radish cultivar SXT majestic red
US11350586B2 (en) Hybrid cucumber plant named DIXON
US20170188494P1 (en) Blueberry plant named 'Heintooga'
USPP26899P3 (en) Blueberry plant named ‘Pinnacle’
US20250268169A1 (en) Hybrid squash 'e28r.00788'
AU2023266382B2 (en) Lettuce variety NUN 07082 LTL
US20260107895A1 (en) Melon varieties 'ml3627' and 'ml3326'
AU2023263447B2 (en) Lettuce Variety NUN 06611 LTL
USPP25022P3 (en) Corylus plant named ‘Dorris’
US20260107896A1 (en) Melon variety 'e25f.01076'
AU2023216902B2 (en) Lettuce Variety NUN 07845 LTL
US11751527B2 (en) Hybrid squash ‘Renegade’
US11839189B2 (en) Hybrid cucumber ‘E23S.16382’
US20240107961A1 (en) Cucumber variety 'vc18013053'
USPP24972P3 (en) Corylus plant named ‘York’

Legal Events

Date Code Title Description
AS Assignment

Owner name: NORTH CAROLINA STATE UNIVERSITY, NORTH CAROLINA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BALLINGTON, JAMES R.;BLAND, WILLIAM T.;SIGNING DATES FROM 20160317 TO 20160321;REEL/FRAME:038067/0765