USPP25022P3 - Corylus plant named ‘Dorris’ - Google Patents
Corylus plant named ‘Dorris’ Download PDFInfo
- Publication number
- USPP25022P3 USPP25022P3 US13/694,675 US201213694675V USPP25022P3 US PP25022 P3 USPP25022 P3 US PP25022P3 US 201213694675 V US201213694675 V US 201213694675V US PP25022 P3 USPP25022 P3 US PP25022P3
- Authority
- US
- United States
- Prior art keywords
- seq
- dorris
- fam
- ned
- corylus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active, expires
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/54—Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/08—Fruits
Definitions
- Botanical denomination Corylus avellana.
- the present invention relates to a new and distinct cultivar of Corylus plant, (hazelnut, filbert) botanically known as Corylus avellana , and hereinafter referred to by the name ‘Dorris’.
- Corylus avellana is in the family Betulaceae.
- the new Corylus resulted from a controlled cross of female parent OSU 309.074 (unpatented) and male parent ‘Delta’ (unpatented) made in 1997 by Shawn A. Mehlenbacher and David C. Smith. Hybrid seeds from the cross were harvested in August 1997, stratified, and seedlings grown in the greenhouse during the summer of 1998. From this cross, a total of 307 seedling trees were planted in the field in Corvallis, Oreg., USA in October, 1998. ‘Dorris’ was discovered and selected by the Inventors as a single plant within the progeny of the stated cross-pollination in a controlled environment in Corvallis, Oreg.
- ‘Dorris’ was originally assigned the designation OSU 876.041, which indicates the row and tree location of the original seedling.
- OSU 309.074 is from a cross of ‘Tonda Gentile delle Langhe’ (unpatented) ⁇ OSU 23.017 (unpatented).
- ‘Tonda Gentile delle Langhe’ is an important cultivar in Piemonte, northern Italy.
- OSU 23.017 is from a cross of ‘Barcelona’ (unpatented) ⁇ ‘Extra Ghiaghli’ (unpatented).
- ‘Extra Ghiaghli’, obtained from Greece, is a clone of the important Turkish cultivar ‘Tombul’ (unpatented).
- ‘Delta’ was released by the Oregon Agricultural Experiment Station in 2002.
- the new cultivar was asexually reproduced by rooted suckers annually for eight years (2003-2010) in Corvallis, Oreg.
- the new cultivar was also asexually propagated by whip grafting in 2004 in Corvallis, Oreg.
- the unique features of this new Corylus are stable and reproduced true-to-type in successive generations of asexual reproduction.
- plants of the new Corylus differed from plants of the Corylus avellana cultivar Barcelona (unpatented), and other cultivars and selections of Corylus avellana known to the Inventors primarily in nut size, nut shape, kernel percentage (ratio of kernel weight to nut weight), frequency of blank nuts (nuts lacking kernels), time of pollen shed, time of nut maturity, length of the husk or involucre, and plant size.
- FIG. 1 shows a tree of the new cultivar ‘Dorris’ growing in a field in the summer, in Corvallis, Oreg.
- FIG. 2 shows the tree of the new cultivar ‘Dorris’ growing in a field in January, in Corvallis, Oreg.
- FIG. 3 shows typical nuts, raw kernels, and blanched kernels of ‘Dorris’ hazelnut compared to those of ‘Jefferson’ hazelnut.
- FIG. 4 shows husks of ‘Dorris’ hazelnut tree.
- FIG. 5 shows the typical nuts, raw kernels, and blanched kernels of ‘Dorris’ hazelnut compared to those of ‘Barcelona’ hazelnut and other hazelnut cultivars.
- the cultivar Dorris has not been observed under all possible environmental conditions. The phenotype may vary somewhat with variations in environment such as temperature and light intensity, without, however, any variance in genotype.
- the aforementioned photographs and following observations and measurements describe plants grown in Corvallis, Oreg. under commercial practice outdoors in the field during the fall, winter and spring. Plants used for the photographs and description were propagated by tie-off layerage and growing on their own roots, and about seven years old. In the following description, color references are made to The Royal Horticultural Society Colour Chart, 1966 Edition, except where general terms of ordinary dictionary significance are used.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Physiology (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A new and distinct cultivar of Corylus plant named ‘Dorris’ characterized by a spreading plant habit and low vigor, yellowish-green developing and fully expanded leaves during the spring and summer, resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller, presence of random amplified polymorphic DNA markers 152-800 and 268-580, expression of incompatibility alleles S1 and S12 in the styles, and DNA fingerprints at 14 of 24 microsatellite marker loci differ from both parents OSU 309.074 and ‘Delta’, and from one parent at an additional 9 marker loci.
Description
This invention was made with government support under Specific Cooperative Agreement No. 58-5358-4542 awarded by the United States Department of Agriculture. The government has certain rights in the invention.
Botanical denomination: Corylus avellana.
Variety designation: ‘Dorris’.
The present invention relates to a new and distinct cultivar of Corylus plant, (hazelnut, filbert) botanically known as Corylus avellana, and hereinafter referred to by the name ‘Dorris’. Corylus avellana is in the family Betulaceae.
The new Corylus resulted from a controlled cross of female parent OSU 309.074 (unpatented) and male parent ‘Delta’ (unpatented) made in 1997 by Shawn A. Mehlenbacher and David C. Smith. Hybrid seeds from the cross were harvested in August 1997, stratified, and seedlings grown in the greenhouse during the summer of 1998. From this cross, a total of 307 seedling trees were planted in the field in Corvallis, Oreg., USA in October, 1998. ‘Dorris’ was discovered and selected by the Inventors as a single plant within the progeny of the stated cross-pollination in a controlled environment in Corvallis, Oreg.
‘Dorris’ was originally assigned the designation OSU 876.041, which indicates the row and tree location of the original seedling. OSU 309.074 is from a cross of ‘Tonda Gentile delle Langhe’ (unpatented)×OSU 23.017 (unpatented). ‘Tonda Gentile delle Langhe’ is an important cultivar in Piemonte, northern Italy. OSU 23.017 is from a cross of ‘Barcelona’ (unpatented)בExtra Ghiaghli’ (unpatented). ‘Extra Ghiaghli’, obtained from Greece, is a clone of the important Turkish cultivar ‘Tombul’ (unpatented). ‘Delta’ was released by the Oregon Agricultural Experiment Station in 2002.
The new cultivar was asexually reproduced by rooted suckers annually for eight years (2003-2010) in Corvallis, Oreg. The new cultivar was also asexually propagated by whip grafting in 2004 in Corvallis, Oreg. The unique features of this new Corylus are stable and reproduced true-to-type in successive generations of asexual reproduction.
The following traits have been repeatedly observed and are determined to be the unique characteristics of ‘Dorris’. These characteristics in combination distinguish ‘Dorris’ as a new and distinct cultivar:
-
- 1. Spreading plant habit and low vigor.
- 2. Yellowish-green developing and fully expanded leaves during the spring and summer.
- 3. Resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller.
- 4. Presence of random amplified polymorphic DNA markers 152-800 and 268-580 in DNA of ‘Dorris’ amplified by the polymerase chain reaction. These two markers are linked to a dominant allele for resistance to eastern filbert blight from the cultivar Gasaway (unpatented).
- 5. Expression of incompatibility alleles S1 and S12 in the styles,
- 6. DNA fingerprints at 14 of 24 microsatellite marker loci differ from both parents OSU 309.074 and ‘Delta’, and from one parent at an additional 9 marker loci. The microsatellite primers are shown in Table 1, and allele sizes are shown in Table 2. DNA fingerprints of grandparent ‘Tonda Gentile delle Langhe’ and great-grandparents ‘Barcelona’ and ‘Extra Ghiaghli’ are also shown in attached Table 2.
In comparisons in two replicated trials conducted in Corvallis, Oreg., plants of the new Corylus differed from plants of the Corylus avellana cultivar Barcelona (unpatented), and other cultivars and selections of Corylus avellana known to the Inventors primarily in nut size, nut shape, kernel percentage (ratio of kernel weight to nut weight), frequency of blank nuts (nuts lacking kernels), time of pollen shed, time of nut maturity, length of the husk or involucre, and plant size.
The accompanying colored photographs illustrate the overall appearance of the new cultivar, showing the colors as true as it is reasonably possible to obtain in colored reproductions of this type. Foliage colors in the photographs may differ slightly from the color values cited in the detailed botanical description which accurately describe the colors of the new Corylus.
The cultivar Dorris has not been observed under all possible environmental conditions. The phenotype may vary somewhat with variations in environment such as temperature and light intensity, without, however, any variance in genotype. The aforementioned photographs and following observations and measurements describe plants grown in Corvallis, Oreg. under commercial practice outdoors in the field during the fall, winter and spring. Plants used for the photographs and description were propagated by tie-off layerage and growing on their own roots, and about seven years old. In the following description, color references are made to The Royal Horticultural Society Colour Chart, 1966 Edition, except where general terms of ordinary dictionary significance are used.
- Botanical classification: Corylus avellana cultivar Dorris.
- Parentage:
-
- Female, or seed, parent.—Corylus avellana selection 309.074 (unpatented).
- Male, or pollen, parent.—Corylus avellana cultivar Delta (unpatented).
-
- Propagation (type rooted suckers):
-
- Time to initiate roots.—About 30 days at 20° C.
- Time to produce a rooted young plant.—About six months at 22° C.
- Root description.—Fine to thick; freely branching; creamy white in color.
-
- Propagation (type whip grafting):
-
- Time to budbreak on the scions.—Bout 14 days at 25° C.
- Time to produce a grafted plant.—About six months at 25° C.
-
- Plant description:
-
- General appearance.—Perennial shrub. Spreading plant habit.
- Growth and branching habit.—Freely branching; about 15 lateral branches develop per plant. Pinching, i.e., removal of the terminal apices, enhances branching with lateral branches potentially forming at every node.
- Size.—Plant height is about 4 meters; plant diameter or spread is about 5 meters.
- Vigor.—low vigor growth habit.
- Lenticels.—8 circular within 1 square centimeter (counted on dormant scions).
-
- Lateral branch description:
-
- Length.—About 32 cm.
- Diameter.—About 6 mm.
- Internode length.—About 3.0 cm.
- Texture.—Smooth, glabrous.
- Strength.—Strong.
- Color.—Immature — 152B; mature — 152B.
-
- Foliage description:
-
- Arrangement.—Alternate, simple.
- Length.—About 10.2 cm.
- Width.—About 9.1 cm.
- Shape.—Oblong to ovate.
- Apex.—Obtuse to acute.
- Base.—Cordate.
- Margin.—Serrate.
- Texture.—Upper and lower surfaces — slightly pubescent.
- Venation pattern.—Pinnate.
- Leaf bud shape.—Globular.
- Time of leaf bud burst.—Midseason, 11 days after ‘Barcelona’.
- Color.—Developing foliage, upper surface 144A, lower surfaces: 187A. Fully expanded foliage, upper surface: Spring and summer, 143A; late summer and fall, 143A. Fully expanded foliage, lower surface: Spring and summer, 139C; late summer and fall, 139C. Venation, upper surface: Spring and summer, 139C; late summer and fall, 139C. Venation, lower surface: Spring and summer, 139D; late summer and fall, 139D. Leaf bud, 179C.
-
- Petiole description:
-
- Length.—About 2.7 cm.
- Diameter.—About 1.8 mm.
- Texture.—Upper and lower surfaces — pubescent.
- Color.—Upper surface: Spring and summer, 139D; late summer and fall, 139D. lower surface: Spring and summer, 139D; late summer and fall, 139D.
-
- Flower description:
-
- Male inflorescences.—Catkins, color prior to elongation 194C.
- Female inflorescence.—Style color 048B.
- Stigma coloration.—048B.
- Time of female flowering.—Midseason, 2 weeks after ‘Barcelona’.
- Time of pollen shed.—Midseason, around the same time as ‘Daviana’ (unpatented).
-
- Involcure description:
-
- Involucre constriction.—Absent.
- Involucre length.—25% longer than nuts.
- Strength of serration of indentation.—Moderate.
- Pubescence.—Little.
- Thickness of callus at base.—Moderate callus at base similar to ‘Barcelona’.
- Description of jointing of bracts.—Involucre slit to the base on one side. Involucre does not adhere to nut after drop. 90% of nuts fall free of the husk. A few nuts are in tubular husks.
-
- Nut description:
-
- Length.—About 19.1 mm.
- Width.—About 20.7 mm.
- Depth.—About 18.2 mm.
- Nut shape.—Round.
- Nut shape index [(width+depth)/2*length].—1.02.
- Nut compression index (width/depth).—1.14.
- Nut shell color.—164B.
- Nut weight.—About 3.35 grams to 3.39 grams.
- Predominant number of fruits per cluster.—2-3 nuts per cluster.
- Stripes on shell.—None.
- Fruit apex.—Slight (not prominent).
- Size of the fruit pistil scar.—Small (˜1 mm×2 mm).
- Nut curvature of the basal scar.—Flat (plane).
- Frequency of blank nuts.—7%.
- Time of nut maturity.—About same time as ‘Barcelona’ (unpatented).
- Husk length.—About 25% longer than the nuts.
- Kernel weight.—About 1.40 grams.
- Kernel percentage (kernel weight/nut weight).—About 43%.
- Kernel shape.—Round-oblate.
- Kernel cross section shape.—Circular.
- Kernel base shape.—Flat.
- Lateral grooves.—Rare and not prominent in the kernel.
-
- Disease/pest resistance: Plants of the new Corylus are highly resistant to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Müller. Plants of the new Corylus are highly resistant to bud mites (Phytoptus avellanae Nal.), while plants of ‘Tonda Gentile delle Langhe’ are highly susceptible, and plants of ‘Barcelona’ are highly resistant.
- Temperature tolerance: Tolerates temperatures from −10 to 38° C. in the field in Corvallis, Oreg.
| TABLE 1 |
| Primers and annealing temperatures for the 24 |
| microsatellite marker loci used to |
| fingerprint ‘Dorris’ and other hazelnut cultivars. |
| Repeat | ||||||
| Locus | motif | Size | Ta | n | He | Ho |
| A613 | (TC)13(CA)12 | 149-177 | 60 | 14 | 0.85 | 0.85 |
| A614 | (TC)17(CA)10 | 125-156 | 60 | 14 | 0.85 | 0.85 |
| NNN(CA)6 | ||||||
| A616 | (AC)11 | 136-162 | 60 | 13 | 0.85 | 0.85 |
| A640 | (CT)15 | 354-378 | 67 | 11 | 0.80 | 0.73 |
| (CA)13 | ||||||
| B107 | (CT)14 | 112-151 | 55 | 14 | 0.85 | 0.80 |
| B617 | (GA)15 | 280-298 | 60 | 9 | 0.80 | 0.78 |
| B619 | (TC)21 | 146-180 | 60 | 14 | 0.88 | 0.88 |
| B634 | (AG)15 | 218-238 | 60 | 9 | 0.76 | 0.76 |
| B657 | (AG)15 | 210-228 | 60 | 8 | 0.84 | 0.98 |
| B671 | (AG)6NN | 221-249 | 60 | 13 | 0.86 | 0.88 |
| (GA)17 | ||||||
| B709 | (GA)21 | 219-233 | 60 | 8 | 0.74 | 0.76 |
| B733 | (TC)15 | 161-183 | 60 | 8 | 0.68 | 0.68 |
| B741 | (GT)5(GA)12 | 176-194 | 60 | 10 | 0.77 | 0.78 |
| B749 | (TC)12 | 200-210 | 60 | 6 | 0.60 | 0.64 |
| B751 | (GA)15 | 141-153 | 60 | 7 | 0.80 | 0.80 |
| B774 | (AG)15 | 195-213 | 60 | 8 | 0.80 | 0.80 |
| B776 | (GA)17 | 134-148 | 60 | 7 | 0.71 | 0.60 |
| B795 | (TC)8Ns(CT)7 | 296-332 | 60 | 12 | 0.76 | 0.74 |
| Ns(CT)10 | ||||||
| Ns(TC)5 | ||||||
| C115 | (TAA)5 | 167-226 | 60 | 14 | 0.80 | 0.80 |
| (GAA)12 | ||||||
| KG809 | (AGG)6 | 333-345 | 55 | 5 | 0.66 | 0.64 |
| KG811 | (GA)17 | 240-278 | 58 | 12 | 0.83 | 0.82 |
| KG827 | (CT)13AA | 264-282 | 67 | 9 | 0.78 | 0.84 |
| (CA)7 | ||||||
| KG830 | (CT)14 | 279-311 | 67 | 9 | 0.79 | 0.78 |
| GTATT | ||||||
| (CA)8 | ||||||
| Soman- | (AAT)5 | 54 | 3 | 0.60 | 0.98 | |
| G | ||||||
| Locus | PIC | r | LG | Primers 5′-3′ |
| A613 | 0.85 | 0.00 | 11 | Ned-CACACGCCTTGTCACTCT |
| TT (SEQ ID NO: 1) | ||||
| A614 | 0.84 | 0.00 | 6 | Hex-TGGCAGAGCTTTGTCAGC |
| TT (SEQ ID NO: 3) | ||||
| A616 | 0.83 | 0.00 | 8 | Fam-CACTCATACCGCAAACTC |
| CA (SEQ ID NO: 5) | ||||
| A640 | 0.7 | 0.04 | 10 | F-TGCCTCTGCAGTTAGTCATC |
| AAATGTAGG | ||||
| (SEQ ID NO: 7) | ||||
| B107 | 0.83 | 0.02 | 10 | Ned-GTAGGTGCACTTGATGTG |
| CTTTAC (SEQ ID NO: 9) | ||||
| B617 | 0.78 | 0.01 | 8 | Fam-TCCGTGTTGAGTATGGAC |
| GA (SEQ ID NO: 11) | ||||
| B619 | 0.7 | 0.00 | 3 | Fam-AGTCGGCTCCCCTTTTCT |
| C (SEQ ID NO: 13) | ||||
| B634 | 0.73 | 0.00 | 4 | Hex-CCTGCATCCAGGACTCAT |
| TA 60 (SEQ ID NO: 15) | ||||
| B657 | 0.82 | −0.08 | 11 | Ned-GAGAGTGCGTCTTCCTCT |
| GG (SEQ ID NO: 17) | ||||
| B671 | 0.84 | −0.01 | 9 | Hex-TTGCCAGTGCATACTCTG |
| AT G (SEQ ID NO: 19) | ||||
| B709 | 0.70 | −0.01 | 5 | Ned-CCAAGCACGAATGAACTC |
| AA (SEQ ID NO: 21) | ||||
| B733 | 0.63 | 0.00 | 7.2 | Ned-CACCCTCTTCACCACCTC |
| AT (SEQ ID NO: 23) | ||||
| B741 | 0.74 | 0.00 | 5 | Fam-GTTCACAGGCTGTTGGGT |
| TT (SEQ ID NO: 25) | ||||
| B749 | 0.51 | −0.03 | 1 | Hex-GGCTGACAACACAGCAGA |
| AA (SEQ ID NO: 27) | ||||
| B751 | 0.77 | 0.01 | 7.2 | Fam-AGCTGGTTCTTCGACATT |
| CC (SEQ ID NO: 29) | ||||
| B774 | 0.77 | 0.01 | 5 | Ned-GTTTTGCGAGCTCATTGT |
| CA (SEQ ID NO: 31) | ||||
| B776 | 0.67 | 0.07 | 6 | Fam-TGTATGTACACACGGAGA |
| GAGAGA (SEQ ID NO: 33) | ||||
| B795 | 0.74 | 0.01 | NA | Fam-GACCCACAAACAATAACC |
| TATCTC (SEQ ID NO: 35) | ||||
| C115 | 0.77 | 0.00 | 4 | Fam-ATTTTCCGCAGATAATAC |
| AGG (SEQ ID NO: 37) | ||||
| KG809 | 0.60 | 0.01 | 4 | Hex-AGGCATCAGTTCATCCAA |
| (SEQ ID NO: 39) | ||||
| KG811 | 0.81 | 0.01 | 2 | Ned-AAGGCGGCACTCGCTCAC |
| (SEQ ID NO: 41) | ||||
| KG827 | 0.75 | −0.04 | 9 | Fam-AGAACTCCGACTAATAAT |
| CCTAACCCTTGC | ||||
| (SEQ ID NO: 43) | ||||
| KG830 | 0.76 | 0.00 | 9 | Ned-TGGAGGAAGTTTTGAATG |
| GTAGTAGAGGA | ||||
| (SEQ ID NO: 45) | ||||
| Soman-G | 0.51 | −0.27 | NA | Hex-TGGCGTTGCAACATATTC |
| TC (SEQ ID NO: 47) | ||||
| Locus | Primers 5′-3′ | Reference |
| A613 | R-CCCCTTTCACATGTTTGCTT | Gurcan et al. |
| (SEQ ID NO: 2) | 2010 | |
| A614 | R-GCAGTGGAGGATTGCTGACT | Gurcan et al. |
| (SEQ ID NO: 4) | 2010 | |
| A616 | R-ATGGCTTTTGCTTCGTTTTG | Gurcan et al. |
| (SEQ ID NO: 6) | 2010 | |
| A640 | Fam-CGCCATATAATTGGGATG | Gurcan et al. |
| CTTGTTG (SEQ ID NO: 8) | 2010 | |
| B107 | R-AACACCATATTGAGTCTTTC | Boccacci et al. |
| AAAGC (SEQ ID NO: 10) | 2005; Gokirmak | |
| et al. 2009 | ||
| B617 | R TGTTTTTGGTGGAGCGATG | Gurcan et al. |
| (SEQ ID NO: 12) | 2010 | |
| B619 | R-GCGATCTGACCTCATTTTTG | Gurcan et al. |
| (SEQ ID NO: 14) | 2010 | |
| B634 | R-GTGCAGAGGTTGCACTCAAA | Gurcan et al. |
| (SEQ ID NO: 16) | 2010 | |
| B657 | R-AGCCTCACCTCCAACGAAC | Gurcan et al. |
| (SEQ ID NO: 18) | 2010 | |
| B671 | R-ACCAGCTCTGGGCTTAACAC | Gurcan et al. |
| (SEQ ID NO: 20) | 2010 | |
| B709 | R-GCGGGTTCTCGTTGTACACT | Gurcan et al. |
| (SEQ ID NO: 22) | 2010 | |
| B733 | R-CATCCCCTGTTGGAGTTTTC | Gurcan et al. |
| (SEQ ID NO: 24) | 2010 | |
| B741 | R-CGTGTTGCTCATGTGTTGTG | Gurcan et al. |
| (SEQ ID NO: 26) | 2010 | |
| B749 | R-TCGGCTAGGGTTAGGGTTTT | Gurcan et al. |
| (SEQ ID NO: 28 | 2010 | |
| B751 | R-AAACTCAAATAAAACCCCTG | Gurcan et al. |
| CTC (SEQ ID NO: 30) | 2010 | |
| B774 | R-TGTGTGTGGTCTGTAGGCACT | Gurcan et al. |
| (SEQ ID NO: 32) | 2010 | |
| B776 | R-TGAGGGGAAGAGGTTTGATG | Gurcan et al. |
| (SEQ ID NO: 34) | 2010 | |
| B795 | R-TGGGCATCATCCAGGTCTA | Gurcan et al. |
| (SEQ ID NO: 36) | 2010 | |
| C115 | GTTTCCAGATCTGCCTCCATATAA | Bassil et al. |
| T (SEQ ID NO: 38) | 2005b, | |
| Gokirmak et al. | ||
| 2009 | ||
| KG809 | F-GGAAGGTGAGAGAAATCAAGT | Gurcan and |
| (SEQ ID NO: 40) | Mehlenbacher | |
| 2010 | ||
| KG811 | F-GAACAACTGAAGACAGCAAAG | Gurcan and |
| (SEQ ID NO: 42) | Mehlenbacher | |
| 2010 | ||
| KG827 | GAGGGAGCAAQTCAAAGTTGAGA | Gurcan and |
| AGAAA (SEQ ID NO: 44) | Mehlenbacher | |
| 2010 | ||
| KG830 | AAAGCAACTCATAGCTGAAGTCCA | Gurcan and |
| ATCA (SEQ ID NO: 46) | Mehlenbacher | |
| 2010 | ||
| Soman-G | R-GCCATCTTTAGAAAGTTCGATA | unpublished |
| CAG (SEQ ID NO: 48) | ||
| Primer fluorescent tags are FAM, HEX, and NED. | ||
| Ta: annealing temperature (° C.) | ||
| N: number of alleles | ||
| He: expected heterozygosity | ||
| Ho: observed heterozygosity | ||
| PIC: polymorphism information content | ||
| r: estimated null allele frequency | ||
| LG: linkage group | ||
| TABLE 2 |
| Allele sizes in ‘Dorris’ and |
| other hazelnut cultivars at 24 microsatellite loci. |
| ‘Tonda Gentile | |||||
| Tag | Locus | ‘Dorris’ | ‘309.074’ | ‘Delta’ | delle Langhe’ |
| NED | A613 | 149/167 | 157/167 | 149/177 | 151/157 |
| HEX | A614 | 132/158 | 125/132 | 143/158 | 125/135 |
| FAM | A616 | 148/150 | 148/158 | 150/150 | 148/150 |
| FAM | A640 | 372/374 | 368/374 | 362/372 | 354/368 |
| NED | B107 | 112/122 | 112/152 | 122/130 | 134/152 |
| FAM | B617 | 286/296 | 294/296 | 286/286 | 286/296 |
| FAM | B619 | 156/164 | 164/174 | 156/164 | 148/164 |
| HEX | B634 | 226/226 | 226/226 | 226/234 | 226/226 |
| NED | B657 | 210/226 | 210/226 | 222/226 | 218/226 |
| HEX | B671 | 227/247 | 227/237 | 235/247 | 237/241 |
| NED | B709 | 227/227 | 227/227 | 227/227 | 227/227 |
| NED | B733 | 171/179 | 171/173 | 173/179 | 171/173 |
| FAM | B741 | 177/186 | 177/177 | 177/186 | 177/184 |
| HEX | B749 | 206/206 | 206/208 | 206/208 | 206/208 |
| FAM | B751 | 143/151 | 143/153 | 143/151 | 149/153 |
| NED | B774 | 203/207 | 203/203 | 207/213 | 203/211 |
| FAM | B776 | 137/137 | 137/137 | 137/150 | 137/137 |
| FAM | B795 | 330/330 | 330/330 | 314/330 | 312/330 |
| FAM | C115 | 194/215 | 173/194 | 197/215 | 173/173 |
| HEX | KG809 | 336/345 | 336/339 | 345/345 | 336/339 |
| NED | KG811 | 254/264 | 242/254 | 254/264 | 254/264 |
| FAM | KG827 | 270/282 | 268/282 | 270/270 | 266/268 |
| NED | KG830 | 295/297 | 291/295 | 291/297 | 291/295 |
| HEX | SM NG | 196/200 | 196/200 | 196/196 | 196/200 |
| Tag | Locus | ‘Barcelona’ | ‘Extra Ghiaghli’ | ‘Gasaway’ | |
| NED | A613 | 151/159 | 167/169 | 159/161 | |
| HEX | A614 | 125/131 | 125/150 | 143/158 | |
| FAM | A616 | 142/150 | 150/158 | 148/148 | |
| FAM | A640 | 354/374 | 374/374 | 362/368 | |
| NED | B107 | 112/134 | 116/116 | 122/128 | |
| FAM | B617 | 286/290 | 294/296 | 292/296 | |
| FAM | B619 | 156/170 | 164/174 | 170/174 | |
| HEX | B634 | 226/226 | 226/226 | 220/232 | |
| NED | B657 | 218/222 | 210/222 | 224/228 | |
| HEX | B671 | 223/227 | 227/247 | 235/247 | |
| NED | B709 | 225/233 | 225/227 | 227/227 | |
| NED | B733 | 171/173 | 171/171 | 173/173 | |
| FAM | B741 | 177/186 | 177/184 | 186/188 | |
| HEX | B749 | 208/208 | 208/208 | 206/208 | |
| FAM | B751 | 143/153 | 143/147 | 143/143 | |
| NED | B774 | 203/207 | 195/203 | 203/209 | |
| FAM | B776 | 135/137 | 135/137 | 146/150 | |
| FAM | B795 | 330/330 | 296/310 | 314/316 | |
| FAM | C115 | 173/194 | 182/194 | 215/218 | |
| HEX | KG809 | 336/336 | 336/339 | 336/345 | |
| NED | KG811 | 258/264 | 240/242 | 254/258 | |
| FAM | KG827 | 280/282 | 276/282 | 270/280 | |
| NED | KG830 | 291/295 | 291/295 | 291/305 | |
| HEX | SM NG | 196/200 | 196/200 | 196/196 | |
- Bassil N. V., Botta R., Mehlenbacher S. A. 2005a. Microsatellite markers in hazelnut: Isolation, characterization and cross-species amplification. J. Amer. Soc. Hort. Sci. 130:543-549.
- Bassil N. V., Botta R., Mehlenbacher S. A. 2005b. Additional microsatellite markers of the European hazelnut. Acta Hort. 686:105-110.
- Boccacci P., Akkak A., Bassil N. V., Mehlenbacher S. A., Botta R. 2005. Characterization and evaluation of microsatellite loci in European hazelnut (C. avellana) and their transferability to other Corylus species. Molec. Ecol. Notes 5:934-937.
- Boccacci P., Akkak, A. and Botta, R. 2006. DNA typing and genetic relations among European hazelnut (Corylus avellana L.) cultivars using microsatellite markers. Genome 49:598-611.
- Gökirmak T., Mehlenbacher S. A., Bassil N. V. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genetic Resources and Crop Evolution 56:147-172.
- Gürcan, K., S. A. Mehlenbacher and V. Erdogan. 2010a. Genetic diversity in hazelnut cultivars from Black Sea countries assessed using SSR markers. Plant Breeding (available on-line doi:10.1111/j.1439-0523.2009.01753.x).
- Gürcan, K., S. A. Mehlenbacher, N. V. Bassil, P. Boccacci, A. Akkak and R. Botta. 2010b. New microsatellite markers for Corylus avellana from enriched libraries. Tree Genetics and Genomes (available on-line as DOI 10.1007/s11295-010-0269-y).
- Gürcan, K. and S. A. Mehlenbacher. 2010. Development of microsatellite marker loci for European hazelnut (Corylus avellana L.) from ISSR fragments. Molecular Breeding (available on-line).
Claims (1)
1. A new and distinct cultivar of Corylus plant named ‘Dorris’, as illustrated and described.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/694,675 USPP25022P3 (en) | 2012-12-24 | 2012-12-24 | Corylus plant named ‘Dorris’ |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/694,675 USPP25022P3 (en) | 2012-12-24 | 2012-12-24 | Corylus plant named ‘Dorris’ |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20140189912P1 US20140189912P1 (en) | 2014-07-03 |
| USPP25022P3 true USPP25022P3 (en) | 2014-11-04 |
Family
ID=51019006
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/694,675 Active 2033-02-12 USPP25022P3 (en) | 2012-12-24 | 2012-12-24 | Corylus plant named ‘Dorris’ |
Country Status (1)
| Country | Link |
|---|---|
| US (1) | USPP25022P3 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| USPP34790P2 (en) | 2022-01-31 | 2022-12-06 | Z's Nutty Ridge, LLC | Hazelnut tree named ‘Photon’ |
-
2012
- 2012-12-24 US US13/694,675 patent/USPP25022P3/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| USPP34790P2 (en) | 2022-01-31 | 2022-12-06 | Z's Nutty Ridge, LLC | Hazelnut tree named ‘Photon’ |
Also Published As
| Publication number | Publication date |
|---|---|
| US20140189912P1 (en) | 2014-07-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12433236B2 (en) | Hybrid seed potato breeding | |
| Gasura et al. | Genetic variability for tuber yield, quality, and virus disease complex traits in Uganda sweetpotato germplasm | |
| US11497182B2 (en) | Methods of making and using strawberry plants resistant to fusarium oxysporum | |
| USPP25022P3 (en) | Corylus plant named ‘Dorris’ | |
| USPP24972P3 (en) | Corylus plant named ‘York’ | |
| USPP24973P3 (en) | Corylus plant named ‘Felix’ | |
| USPP32461P2 (en) | Corylus plant named ‘Hunterdon’ | |
| USPP37267P3 (en) | Corylus plant named ‘Thompson’ | |
| USPP33561P2 (en) | Corylus plant named ‘OSU 541.147’ | |
| USPP27141P3 (en) | Corylus plant named ‘Wepster’ | |
| USPP20694P3 (en) | Corylus plant named ‘Red Dragon’ | |
| USPP28200P3 (en) | Corylus plant named ‘McDonald’ | |
| USPP28216P3 (en) | Corylus plant named ‘Burgundy Lace’ | |
| USPP22715P2 (en) | Corylus plant named ‘Tonda Pacifica’ | |
| USPP32459P3 (en) | Corylus plant named ‘PollyO’ | |
| USPP32494P2 (en) | Corylus plant named ‘Somerset’ | |
| US7034207B2 (en) | Papaya (Carica papaya L) variety | |
| USPP34790P2 (en) | Hazelnut tree named ‘Photon’ | |
| USPP32462P2 (en) | Corylus plant named ‘Monmouth’ | |
| US11766008B2 (en) | Carrot variety Purple Royale | |
| USPP32460P2 (en) | Corylus plant named ‘Raritan’ | |
| USPP26899P3 (en) | Blueberry plant named ‘Pinnacle’ | |
| USPP28790P3 (en) | Blueberry plant named ‘Heintooga’ | |
| Somerset | UNIVERSITY OF NEW JERSEY |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: STATE OF OREGON ACTING BY AND THROUGH THE STATE BO Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MEHLENBACHER, SHAWN A.;SMITH, DAVID C.;MCCLUSKEY, REBECCA L.;REEL/FRAME:029683/0830 Effective date: 20121221 |