USPP15461P3 - Mandarin hybrid tree named ‘TDE2’ - Google Patents

Mandarin hybrid tree named ‘TDE2’ Download PDF

Info

Publication number
USPP15461P3
USPP15461P3 US10/178,000 US17800002V USPP15461P3 US PP15461 P3 USPP15461 P3 US PP15461P3 US 17800002 V US17800002 V US 17800002V US PP15461 P3 USPP15461 P3 US PP15461P3
Authority
US
United States
Prior art keywords
fruit
tde2
trees
tree
unpatented
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
US10/178,000
Other versions
US20040006800P1 (en
Inventor
Mikeal L. Roose
Timothy A. Williams
Robert K. Soost
James W. Cameron
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California
University of California San Diego UCSD
Original Assignee
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California San Diego UCSD filed Critical University of California San Diego UCSD
Priority to US10/178,000 priority Critical patent/USPP15461P3/en
Assigned to REGENTS OF THE UNIVERSTIY OF CALIFORNIA, THE reassignment REGENTS OF THE UNIVERSTIY OF CALIFORNIA, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: SOOST, ROBERT K., CAMERON, JAMES W., ROOSE, MIKEAL L., WILLIAMS, TIMOTHY A.
Publication of US20040006800P1 publication Critical patent/US20040006800P1/en
Application granted granted Critical
Publication of USPP15461P3 publication Critical patent/USPP15461P3/en
Assigned to REGENTS OF THE UNIVERSITY OF CALIFORNIA, THE reassignment REGENTS OF THE UNIVERSITY OF CALIFORNIA, THE RECORD TO CORRECT SECOND INVENTOR'S MIDDLE INITIAL ON ASSIGNMENT DOCUMENTS RECORDED 2/11/03 AT REEL 013426 FRAME 0781 Assignors: SOOST, ROBERT K., CAMERON, JAMES W., ROOSE, MIKEAL L., WILLIAMS, TIMOTHY E.
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/78Rutaceae, e.g. lemons or limes
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/08Fruits

Definitions

  • the pedigree of TDE2 is shown in FIG. 1 .
  • pollen from Encore mandarin (unpatented) was applied to stigmas of a tetraploid (Temple ⁇ 4N Dancy) hybrid (unpatented) and the pollinated flowers were bagged to prevent insect pollination.
  • Fruits were collected in winter 1974, seeds extracted from each fruit, and each seed was planted. The chromosome number of each seedling was determined and those identified as triploid seedlings were budded onto Troyer citrange rootstock.
  • the resulting trees were planted in the field in Riverside, Calif. in 1976. These trees were evaluated for tree vigor, bearing, and seedlings, fruit flavor, fruit color, and other fruit quality traits from bearing until 1985.
  • TDE2 Five trees were selected from the original population and repropagated by budding onto C-32 citrange, C-35 citrange, Troyer citrange, and trifoliate orange rootstocks.
  • One of these trees, now called TDE2 was selected and further asexually propagated.
  • Two trees of the selection now called TDE2 were planted in the field in Riverside in 1987. When they began fruiting (approximately in 1990), these two trees were evaluated for the same tree and fruit quality traits as the original trees.
  • the selection now called TDE2 was chosen for additional testing because it combined medium or large fruit size, low seed number, rich fruit flavor, deep orange rind and flesh color, and acceptable peelability.
  • Budwood of this selection was tested for viruses and other pathogens by the Citrus Clonal Protection Program and virus-free bud source trees were planted at Lindcove Research and Extension Center, Wales, Calif. in 1991.
  • TDE2 The plant known as TDE2 was first asexually propagated in 1975 when buds were collected from hybrid seedling 73-47-2 and grafted onto Troyer citrange rootstock in a greenhouse at the University of California, Riverside, Calif., U.S.A. This tree was grown in a greenhouse and in 1976 it was planted in Field 6D, Row 12, Tree 6 at the Citrus Research Center, University of California, Riverside, Calif., U.S.A. Additional asexual propagation took place in 1986 when buds were collected from field tree 6D-12,6 and grafted onto ‘C32’ citrange and trifoliate orange rootstocks. These trees were planted in Field 6C, Row 29, Tree positions 11 and 12 respectively in 1987.
  • the present invention provides a novel mandarin hybrid having the characteristics described and illustrated herein.
  • the hybrid, TDE2 produces fruit that combines late season maturity, large fruit size, attractive deep orange rind color and virtual absence of seeds with rich fruit flavor.
  • FIG. 1 illustrates the pedigree of TDE2. All cultivars are C. reticulata except orange, which is C. sinensis.
  • FIG. 2 illustrates, clockwise from top left: a nine-year-old tree of TDE2 on Carrizo rootstock, fruit on tree; branching pattern; flower buds; flowers; leaves; and shoots.
  • FIG. 3 illustrates fruit of TDE2 sampled from nine-year-old tree on Carrizo rootstock.
  • FIG. 4 illustrates the solids:acid ratio of TDE2 at Santa Paula, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r 2 value are shown in each figure.
  • FIG. 5 illustrates the solids:acid ratio of TDE2 at Valley Center, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r 2 value are shown in each figure.
  • FIG. 6 illustrates the solids:acid of TDE2 at Ojai, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r 2 value are shown in each figure.
  • FIG. 7 illustrates the solids:acid ratio of TDE2 at Thermal, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r 2 value are shown in each figure.
  • FIG. 8 illustrates the solids:acid ratio of TDE2 at Coachella Valley, Calif., CVARS, over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r 2 value are shown in each figure.
  • Tree shape is approximately sphereoid (FIG. 2 ), rather similar to that of orange trees.
  • the trees have not been noted as particularly susceptible to any diseases and, based on a freeze in 1999, appeared only slightly more cold hardy than oranges of similar age.
  • Leaves FIG. 2
  • the petiole shape is narrow and linear in shape.
  • trees of TDE2 are very thorny, with normal branches having medium length (15 mm) thorns at about 50% of the nodes, and watersprouts having long (31 mm) thorns at about 73% of nodes. Thorniness will probably decrease as the cultivar ages.
  • TDE2 flowers of TDE2 are typically hermaphroditic, with white (Green-White 157D, R.H.S. Colour Chart) petals and yellow (Yellow 13B, R.H.S. Colour Chart) anthers (FIG. 2 ). Trees flower from early April into May at most locations. Pollen is somewhat sparse, with 10% viability as estimated in an in vitro germination test. Pollen tube growth was also less vigorous than that of fertile, diploid mandarins.
  • TABLE 1 Fruit characteristics of TDE2 averaged over 5 locations and 4 seasons. Samples were collected from mid-January to early May at Santa Paula, Ojai, and Valley Center, and from mid-November to early April at Thermal and CVARS. “N” indicates the total number of fruit samples analyzed. Data shown are averaged over fruit from trees on various rootstocks. The trees examined for TabIe 1 ranged from 3-8 years old and were grown in the ground.
  • TDE2 fruit are oblate in shape, with little or no neck (FIG. 3 ).
  • the average fruit size is large for a mandarin (classed as Mammoth by California state standards).
  • Rind color of mature fruit is orange-red N30D (R.H.S. chart).
  • the rind texture is variable, depending on tree age and crop. For older trees with a moderate to heavy crop, rind texture is slightly pitted, with depressed oil glands. The rind of fruit from trees with very light crops is often excessively rough or bumpy. The rind is fairly easy to peel when fruit are mature, but can be more adherent early in the season.
  • the fruit flesh color using the R.H.S. chart is orange 28B. Flesh thickness is about 68 mm.
  • Albedo color is Yellow-White 158C. Albedo thickness is about 2.0 mm. Adherence of rind to pulp is medium or moderate. The number of segments per fruit is 9-10. The fruit base (stalk end) is slightly concave (FIG. 3 ), and the apex is truncate with a slight depression in the stylar end and a small (4 mm), occasionally open stylar scar.
  • Solids:acid ratio was significantly correlated with sampling date at all location except Santa Paula (FIG. 4 ).
  • the estimated dates on which fruit reached an 8:1 solids:acid was December 6 for Thermal, January 2 for Ojai, February 20 for Valley Center, and March 5 for Santa Paula.
  • the limited data for CVARS are consistent with those for the climatically similar Thermal site.
  • Yield of TDE2 was evaluated from visual ratings of crop relative to tree size at each location from 1998-99 to 2001-2002.
  • the rating scale ranged from 0 (no crop) to 5 (very heavy crop).
  • the topworked trees in Valley Center showed the highest and most consistent crops, ranging between 3 and 4 over the 4 years studied. Crops at Ojai were also good, being 2.5 or greater in all years.
  • crop ratings indicated alternate bearing, with average values of 2.17, 3.67, 1.17, and 3.50 from 1998-99 to 2001-2002, respectively.
  • Trees planted at Thermal in 1994 showed similar behavior, but with lower values of 1.83, 0.50, 2.40, and 1.40, while those planted in 1996 had crops of 0, 0, 2.87, and 1.5.
  • TDE2 Two siblings of TDE2, “TDE3” and “TDE4,” were compared to TDE2.
  • TDE2 is distinct from these cultivars in having the latest maturity date, the largest fruit size, a more oblate shape than TDE3, and distinct flavor.
  • the rind color of TDE2 is usually paler orange than that of TDE4.
  • Trees or fruit of TDE2 can be distinguished from those of other mandarins, including TDE3 and TDE4, using simple sequence repeat (SSR) DNA markers.
  • SSR simple sequence repeat
  • the seed (female) parent of TDE2 is a tetraploid hybrid between a ‘Temple’ tangor and a tetraploid tree of ‘Dancy’ mandarin.
  • the tetraploid (Temple ⁇ 4N Dancy) parent (referred to below as 4D-TD) was never released by the University of California and only two trees of this variety exist.
  • TDE2 is distinct from this variety in having less than 1 seed per fruit while 4N-TD averages 10 seeds per fruit.
  • Fruit of 4N-TD have an aspect of about 0.88, mature in December-January and hold on the tree for about 1 month, while those of TDE2 have an aspect ratio of about 0.78, mature in February and hold on the tree for 2-3 months.
  • Fruit of 4N-TD have thicker rinds (5.5 mm) than those of TDE2. Trees of 4N-TD are somewhat smaller (3.8 m tall) than those of TDE2 (6.0 m tall).
  • TDE2 The pollen (male) parent of TDE2 is ‘Encore’ mandarin.
  • TDE2 differs from ‘Encore’ in that ‘Encore’ fruit average about 20 seeds per fruit while fruit of TDE2 have less than 1 seed per fruit.
  • ‘Encore’ fruit mature in March-April, about 1 month later than those of TDE2.
  • ‘Encore’ fruit always have a distinctive green or dark brown spot or blotch on the rind which is absent on TDE2 fruit.
  • the average size of TDE2 fruit is larger than that of Encore.
  • Encore fruit have an aspect ratio of 0.71 and much thinner rinds (2.0 mm) while those of TDE2 have an aspect ratio of 0.78 and rinds 3.5 mm thick.
  • Encore fruit hold extremely well on the tree (4-6 months).
  • the height of mature (35 year old) ‘Encore’ trees is about 4.1 m, shorter than that of mature (27 year old) TDE2 trees.
  • Vigor of TDE2 trees has varied greatly across locations. In the two desert locations, canopy volumes of 7-year-old trees averaged 41.1 and 28.8 m 3 , and 5 year-old trees averaged were 9.7 m 3 . In contrast, at the cooler Santa Paula and Ojai locations, 7-year-old trees averaged 6.3 and 6.1 m 3 . Trees in the desert locations have averaged somewhat less crop relative to tree size, perhaps contributing to greater vegetative growth. Size of the topworked trees in Valley Center has not been measured since they are not comparable to trees in other locations, but in general the topworked trees are quite vigorous. Rootstocks had some effect on trees size. At Thermal, trees on Volkamer lemon had canopy volumes about twice that of trees on Carrizo or C35 citranges. Trees on Schaub rough lemon were usually larger than those on Carrizo or C35 citranges. No evidence of stock-scion incompatibilities was evident, but trees are still relatively young.
  • TDE2 can be propagated on many available citrus rootstocks by budding. Because of the high level of thorniness, great care should be taken to select budwood from upper-canopy branches having no thorns. Tree spacing in field plantings will depend on vigor of the rootstock. Trees can be grown with pollinizer cultivars such as Minneola, Valencia orange, unrelated mandarins (not Temple, Dancy, Encore or other TDE hybrids) that produce viable pollen. Maturity dates will vary with location, probably depending on the number of heat units and soil conditions.
  • sprays with gibberellic acid may increase fruit set when pollinizers and/or pollinators are inadequate.
  • Trees are winter hardy in USDA zones 9b to 11.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

A new mandarin hybrid called ‘TDE2’ is distinguished by production of fruit that combines late season maturity, large fruit size, attractive deep orange rind color and virtual absence of seeds with rich fruit flavor.

Description

Genus and species: This application is directed to a description of TDE2, which is a mandarin orange tree (Citrus reticulata).
BACKGROUND OF THE INVENTION
The pedigree of TDE2 is shown in FIG. 1. In 1973, pollen from Encore mandarin (unpatented) was applied to stigmas of a tetraploid (Temple×4N Dancy) hybrid (unpatented) and the pollinated flowers were bagged to prevent insect pollination. Fruits were collected in winter 1974, seeds extracted from each fruit, and each seed was planted. The chromosome number of each seedling was determined and those identified as triploid seedlings were budded onto Troyer citrange rootstock. The resulting trees were planted in the field in Riverside, Calif. in 1976. These trees were evaluated for tree vigor, bearing, and seedlings, fruit flavor, fruit color, and other fruit quality traits from bearing until 1985. Five trees were selected from the original population and repropagated by budding onto C-32 citrange, C-35 citrange, Troyer citrange, and trifoliate orange rootstocks. One of these trees, now called TDE2, was selected and further asexually propagated. Two trees of the selection now called TDE2 were planted in the field in Riverside in 1987. When they began fruiting (approximately in 1990), these two trees were evaluated for the same tree and fruit quality traits as the original trees. In 1987, the selection now called TDE2 was chosen for additional testing because it combined medium or large fruit size, low seed number, rich fruit flavor, deep orange rind and flesh color, and acceptable peelability. Budwood of this selection was tested for viruses and other pathogens by the Citrus Clonal Protection Program and virus-free bud source trees were planted at Lindcove Research and Extension Center, Exeter, Calif. in 1991.
Using this virus-free budwood source, additional trees were propagated and planted at several California locations between 1993 and 1996. These included two locations in the Coachella Valley (Thermal, 73 trees, and the Coachella Valley Agricultural Research Station-CVARS, 4 trees), Ojai (12 trees) and Santa Paula (6 trees) in Ventura Co., and Valley Center (11 trees) in San Diego Co. These trial plantings provide most of the available data on TDE2. Several different rootstocks have been used in these evaluations, mostly Carrizo citrange, C35 citrange, and Schaub rough lemon. The trees in Valley Center are topworked Valencia orange on Troyer citrange rootstock. In general, no major effects of these rootstocks on fruit quality of TDE2 were observed, and no incompatibilities have been evident, but longevity of trees on various rootstocks is not known.
ASEXUAL REPRODUCTION
The plant known as TDE2 was first asexually propagated in 1975 when buds were collected from hybrid seedling 73-47-2 and grafted onto Troyer citrange rootstock in a greenhouse at the University of California, Riverside, Calif., U.S.A. This tree was grown in a greenhouse and in 1976 it was planted in Field 6D, Row 12, Tree 6 at the Citrus Research Center, University of California, Riverside, Calif., U.S.A. Additional asexual propagation took place in 1986 when buds were collected from field tree 6D-12,6 and grafted onto ‘C32’ citrange and trifoliate orange rootstocks. These trees were planted in Field 6C, Row 29, Tree positions 11 and 12 respectively in 1987.
BRIEF SUMMARY OF THE INVENTION
The present invention provides a novel mandarin hybrid having the characteristics described and illustrated herein. The hybrid, TDE2, produces fruit that combines late season maturity, large fruit size, attractive deep orange rind color and virtual absence of seeds with rich fruit flavor.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates the pedigree of TDE2. All cultivars are C. reticulata except orange, which is C. sinensis.
FIG. 2 illustrates, clockwise from top left: a nine-year-old tree of TDE2 on Carrizo rootstock, fruit on tree; branching pattern; flower buds; flowers; leaves; and shoots.
FIG. 3 illustrates fruit of TDE2 sampled from nine-year-old tree on Carrizo rootstock.
FIG. 4 illustrates the solids:acid ratio of TDE2 at Santa Paula, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r2 value are shown in each figure.
FIG. 5 illustrates the solids:acid ratio of TDE2 at Valley Center, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r2 value are shown in each figure.
FIG. 6 illustrates the solids:acid of TDE2 at Ojai, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r2 value are shown in each figure.
FIG. 7 illustrates the solids:acid ratio of TDE2 at Thermal, Calif. over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r2 value are shown in each figure.
FIG. 8 illustrates the solids:acid ratio of TDE2 at Coachella Valley, Calif., CVARS, over five years. Points plotted are means of all samples collected on a given date. Solid lines connect means for sampling dates within the same season. The dashed line is a liner regression of solids:acid on sampling date using data from all years. The regression equation and r2 value are shown in each figure.
DETAILED DESCRIPTION OF THE INVENTION
All major color code designation are by reference to The R.H.S. Colour Chart (2001) provided by The Royal Horticultural Society of Great Britain.
Eight to ten year-old trees grown in the ground were examined to prepare the description in this and the following paragraph. Tree shape is approximately sphereoid (FIG. 2), rather similar to that of orange trees. The trees have not been noted as particularly susceptible to any diseases and, based on a freeze in 1999, appeared only slightly more cold hardy than oranges of similar age. Leaves (FIG. 2) are simple, brevipetiolate (i.e., petiole shorter than leaf lamina), lanceolate, with entire or slightly sinuate margins. The petiole shape is narrow and linear in shape. In comparison with mold old-line citrus cultivars, trees of TDE2 are very thorny, with normal branches having medium length (15 mm) thorns at about 50% of the nodes, and watersprouts having long (31 mm) thorns at about 73% of nodes. Thorniness will probably decrease as the cultivar ages.
Flowers of TDE2 are typically hermaphroditic, with white (Green-White 157D, R.H.S. Colour Chart) petals and yellow (Yellow 13B, R.H.S. Colour Chart) anthers (FIG. 2). Trees flower from early April into May at most locations. Pollen is somewhat sparse, with 10% viability as estimated in an in vitro germination test. Pollen tube growth was also less vigorous than that of fertile, diploid mandarins.
The height and spread of a mature (27 years old) TDE2 tree is as follows: Tree height=6.0 m; Width=6.0 m. Trunk diameter of a 27 year old tree was 21.7 cm when measured 38 cm above the ground. Trunk color using the R.H.S. Colour Chart is Brown N200B.
  • Leaf characteristics of TDE2 trees are as follows:
      • Leaf shape.—Lanceolate.
      • Blade length.—82.8 mm.
      • Blade width.—43.5 mm.
      • Apex description.—Acute with weak emargination.
      • Base description.—Convex.
      • Abaxial color (R.H.S. chart).—Yellow Green 146A.
      • Adaxial color (R.H.S. chart).—Yellow Green 147A.
  • Petiole characteristics of TDE2 trees are as follows:
      • Petiole length.—11.2 mm.
      • Petiole width.—2.3 mm.
      • Petiole color (R.H.S. chart).—Yellow Green 147A.
If sufficient fruit was available, 10-fruit samples were collected from each location two or three times each year beginning in 1997 or 1998. Generally samples were collected from two or three trees on each sampling date. These fruit were evaluated in Riverside for a range of traits as summarized in Table 1.
TABLE 1
Fruit characteristics of TDE2 averaged over 5 locations and 4 seasons.
Samples were collected from mid-January to early May at Santa Paula,
Ojai, and Valley Center, and from mid-November to early April at
Thermal and CVARS. “N” indicates the total number of fruit samples
analyzed. Data shown are averaged over fruit from trees on various
rootstocks. The trees examined for TabIe 1 ranged from 3-8 years old
and were grown in the ground.
Trait N Min Max Min SD
Fruit height (mm) 149 38.7 80.0 58.4 6.46
Fruit width (mm) 149 57.5 91.6 74.5 5.71
Fruit height:width 149 0.52 0.94 0.78 0.064
Rind color ratinga 149 4.5 13.0 11.8 1.08
Rind textureb 149 2.2 7.5 3.7 0.68
Neck ratingc 149 0 2.50 0.47 0.66
Peelability ratingd 149 6.00 9.50 7.91 0.736
Rind thickness (mm) 149 3.00 6.00 3.86 0.626
Seeds per fruit 149 0 0.40 0.02 0.065
Fruit weight (g) 149 103.5 370.0 184.5 45.12
Juice content (%) 149 32.4 62.5 49.4 4.911
Soluble solids (%) 146 7.50 15.55 12.38 1.749
Acid (%) 145 0.62 2.64 1.22 0.341
Solids:acid 145 4.10 22.90 10.84 3.204
aVisual rating on a scate of 0-13; 0 = green, 13 = red-orange
bVisual rating on a scale of 1-8; 1 = very smooth, 8 = extremely coarse
cVisual rating on a scale of 0-3; 0 = no trace of neck, 3 = neck with a diameter at least 50% of fruit diameter
dSubjective rating of ease of peeling a single fruit; 1 = very difficult, 10 = a fruit with completely seperated rind and segments. Fruit with ratings of 7 or higher would be relatively easy to peel.
Based on this data, TDE2 fruit are oblate in shape, with little or no neck (FIG. 3). The average fruit size is large for a mandarin (classed as Mammoth by California state standards). Rind color of mature fruit is orange-red N30D (R.H.S. chart). The rind texture is variable, depending on tree age and crop. For older trees with a moderate to heavy crop, rind texture is slightly pitted, with depressed oil glands. The rind of fruit from trees with very light crops is often excessively rough or bumpy. The rind is fairly easy to peel when fruit are mature, but can be more adherent early in the season. The fruit flesh color using the R.H.S. chart is orange 28B. Flesh thickness is about 68 mm. Albedo color is Yellow-White 158C. Albedo thickness is about 2.0 mm. Adherence of rind to pulp is medium or moderate. The number of segments per fruit is 9-10. The fruit base (stalk end) is slightly concave (FIG. 3), and the apex is truncate with a slight depression in the stylar end and a small (4 mm), occasionally open stylar scar.
Important determinants of maturity date for citrus fruit are the solids:acid ratio and juice content. Using data for all years, juice content did not show a statistically significant correlation with sampling date at any of the 5 locations. This indicates that there was not generally any significant drying of fruit during the sampling period. Solids:acids ratio was significantly correlated with sampling date at all location except Santa Paula (FIG. 4). Using these regressions, the estimated dates on which fruit reached an 8:1 solids:acid was December 6 for Thermal, January 2 for Ojai, February 20 for Valley Center, and March 5 for Santa Paula. The limited data for CVARS are consistent with those for the climatically similar Thermal site.
Yield of TDE2 was evaluated from visual ratings of crop relative to tree size at each location from 1998-99 to 2001-2002. The rating scale ranged from 0 (no crop) to 5 (very heavy crop). The topworked trees in Valley Center showed the highest and most consistent crops, ranging between 3 and 4 over the 4 years studied. Crops at Ojai were also good, being 2.5 or greater in all years. At Santa Paula, crop ratings indicated alternate bearing, with average values of 2.17, 3.67, 1.17, and 3.50 from 1998-99 to 2001-2002, respectively. Trees planted at Thermal in 1994 showed similar behavior, but with lower values of 1.83, 0.50, 2.40, and 1.40, while those planted in 1996 had crops of 0, 0, 2.87, and 1.5.
As discussed above, tree fruit is set in April and May. First and last harvest dates for Riverside Calif. are estimated as February 15 and May 15. Because TDE2 is a late maturing fruit, it is likely that trees will show a fairly strong tendency to alternate bearing, and this is supported by the data for some locations.
During the 1998-99 season, fruit of TDE2 and Gold Nugget, another late season mandarin with few seeds, were harvested on April 12 from Valley Center and evaluated by a taste panel before and after storage at two different temperatures. Fruit were rated on a 9 point scale, where a score of 1 is “Dislike extremely”, 5 is “Neither dislike or like”, and 9 is “Like extremely”. Results (Table 2) show that before storage TDE2 was preferred to Gold Nugget based on visual appearance, peelability, and taste, with good overall scores for these traits. After storage at 20.5 C for 11 days, both cultivars improved in visual appeal and peelability, but only Gold Nugget improved in taste. Storage for 12 days at 3.4 or 5.6 C followed by 7 days at 13.3 C did not greatly affect any of the ratings, but taste of both cultivars was decreased slightly in cold storage at 3.4 C. Waxed fruit were similar to unwaxed for nearly all traits. Storage at 5.6 C decreased visual appeal of TDE2 slightly while storage at 20.5 C increased visual appeal, peelability, and taste scores. Overall, these data indicate that TDE2 fruit can be stored without greatly affecting visual appeal or taste.
TABLE 2
Sensory evaluation of ‘Gold Nugget’ and ‘TDE 2’
harvested April 12, 1999 from Valley Center, CA.
Visual Evaluation
Gold Gold
Nugget Nugget TDE 2 TDE 2
−wax +wax −wax +wax
Initial
Mean 4.3 5.0 6.8 7.0
SD 2.1 2.0 1.6 1.5
11 days @ 68 F.
Mean 5.4 6.2 7.3 7.9
SD 1.6 1.5 1.4 0.9
12 days @ 37 F. + 7 days @ 55 F.
Mean 5.3 5.7 6.8 7.2
SD. 2.5 2.1 1.3 1.5
12 days @ 41 F. + 7 days @ 55 F.
Mean 5.5 5.7 7.4 7.1
SD. 2.3 2.1 1.4 1.4
Peelability Evaluation
Gold Gold
Nugget Nugget TDE 2 TDE 2
−wax +wax −wax +wax
Initial
Mean 4.6 4.0 7.0 6.8
SD 1.7 1.9 1.3 1.5
11 days @ 68 F.
Mean 5.3 5.4 7.6 7.5
SD 2.1 2.2 1.1 0.8
12 days @ 37 F. + 7 days @ 55 F.
Mean 5.2 5.6 7.1 7.2
SD. 1.7 1.9 1.6 1.5
12 days @ 41 F. + 7 days @ 55 F.
Mean 6.1 5.2 7.4 7.3
SD. 1.4 1.7 1.4 1.5
Taste Evaluation
Gold Gold
Nugget Nugget TDE 2 TDE 2
−wax +wax −wax +wax
Initial
Mean 5.4 5.3 6.5 6.8
SD 2.0 2.6 1.6 1.7
11 days @ 68 F.
Mean 7.3 6.8 6.5 5.7
SD 1.7 1.9 1.7 1.6
12 days @ 37 F. + 7 days @ 55 F.
Mean 6.1 6.0 5.8 6.3
SD. 1.9 2.4 1.6 1.5
12 days @ 41 F. + 7 days @ 55 F.
Mean 6.5 6.6 6.9 6.5
SD. 1.6 1.6 1.4 1.7
Two siblings of TDE2, “TDE3” and “TDE4,” were compared to TDE2. TDE2 is distinct from these cultivars in having the latest maturity date, the largest fruit size, a more oblate shape than TDE3, and distinct flavor. The rind color of TDE2 is usually paler orange than that of TDE4. Trees or fruit of TDE2 can be distinguished from those of other mandarins, including TDE3 and TDE4, using simple sequence repeat (SSR) DNA markers. Using TDE2 DNA as template, PCR primer set TAA15 (F=GAAAGGGTTACTTGACCAGGC, R=CTTCCCAGCTGCACAAGC) amplified a band of 185 bp, while TDE3 and TDE4 both had two bands of 185 and 200 bp. Bands amplified with TAA15 combined with those amplified with either CAC15 (F=TAAATCTCCACTCTGCAAAAGC, R=GATAGGAAGCGTCGTAGACCC) or TAA33 (F=GGTACTGATAGTACTGCGGCG, R=GCTAATCGCTACGTCTTCGC) distinguished TDE2 from the following cultivars: Dancy (unpatented), Temple (unpatented), Encore (unpatented), King (unpatented), Willowleaf (unpatented), Wilking (unpatented), Gold Nugget (unpatented), Pixie (unpatented), W. Murcott (unpatented), Ellendale (unpatented), Hernandina Clementine (unpatented), Fortune (unpatented), Kara (unpatented), Kinnow (unpatented), Murcott (unpatented), Nova (unpatented), and Ponkan (unpatented).
The seed (female) parent of TDE2 is a tetraploid hybrid between a ‘Temple’ tangor and a tetraploid tree of ‘Dancy’ mandarin. The tetraploid (Temple×4N Dancy) parent (referred to below as 4D-TD) was never released by the University of California and only two trees of this variety exist. TDE2 is distinct from this variety in having less than 1 seed per fruit while 4N-TD averages 10 seeds per fruit. Fruit of 4N-TD have an aspect of about 0.88, mature in December-January and hold on the tree for about 1 month, while those of TDE2 have an aspect ratio of about 0.78, mature in February and hold on the tree for 2-3 months. Fruit of 4N-TD have thicker rinds (5.5 mm) than those of TDE2. Trees of 4N-TD are somewhat smaller (3.8 m tall) than those of TDE2 (6.0 m tall).
The pollen (male) parent of TDE2 is ‘Encore’ mandarin. TDE2 differs from ‘Encore’ in that ‘Encore’ fruit average about 20 seeds per fruit while fruit of TDE2 have less than 1 seed per fruit. ‘Encore’ fruit mature in March-April, about 1 month later than those of TDE2. ‘Encore’ fruit always have a distinctive green or dark brown spot or blotch on the rind which is absent on TDE2 fruit. The average size of TDE2 fruit is larger than that of Encore. Encore fruit have an aspect ratio of 0.71 and much thinner rinds (2.0 mm) while those of TDE2 have an aspect ratio of 0.78 and rinds 3.5 mm thick. Encore fruit hold extremely well on the tree (4-6 months). The height of mature (35 year old) ‘Encore’ trees is about 4.1 m, shorter than that of mature (27 year old) TDE2 trees.
Vigor of TDE2 trees has varied greatly across locations. In the two desert locations, canopy volumes of 7-year-old trees averaged 41.1 and 28.8 m3, and 5 year-old trees averaged were 9.7 m3. In contrast, at the cooler Santa Paula and Ojai locations, 7-year-old trees averaged 6.3 and 6.1 m3. Trees in the desert locations have averaged somewhat less crop relative to tree size, perhaps contributing to greater vegetative growth. Size of the topworked trees in Valley Center has not been measured since they are not comparable to trees in other locations, but in general the topworked trees are quite vigorous. Rootstocks had some effect on trees size. At Thermal, trees on Volkamer lemon had canopy volumes about twice that of trees on Carrizo or C35 citranges. Trees on Schaub rough lemon were usually larger than those on Carrizo or C35 citranges. No evidence of stock-scion incompatibilities was evident, but trees are still relatively young.
TDE2 can be propagated on many available citrus rootstocks by budding. Because of the high level of thorniness, great care should be taken to select budwood from upper-canopy branches having no thorns. Tree spacing in field plantings will depend on vigor of the rootstock. Trees can be grown with pollinizer cultivars such as Minneola, Valencia orange, unrelated mandarins (not Temple, Dancy, Encore or other TDE hybrids) that produce viable pollen. Maturity dates will vary with location, probably depending on the number of heat units and soil conditions.
As in some other mandarins, sprays with gibberellic acid may increase fruit set when pollinizers and/or pollinators are inadequate.
Trees are winter hardy in USDA zones 9b to 11.

Claims (1)

1. A new and distinct variety of mandarin hybrid tree having the characteristics described and illustrated herein.
US10/178,000 2002-06-20 2002-06-20 Mandarin hybrid tree named ‘TDE2’ Expired - Lifetime USPP15461P3 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/178,000 USPP15461P3 (en) 2002-06-20 2002-06-20 Mandarin hybrid tree named ‘TDE2’

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US10/178,000 USPP15461P3 (en) 2002-06-20 2002-06-20 Mandarin hybrid tree named ‘TDE2’

Publications (2)

Publication Number Publication Date
US20040006800P1 US20040006800P1 (en) 2004-01-08
USPP15461P3 true USPP15461P3 (en) 2005-01-04

Family

ID=29999113

Family Applications (1)

Application Number Title Priority Date Filing Date
US10/178,000 Expired - Lifetime USPP15461P3 (en) 2002-06-20 2002-06-20 Mandarin hybrid tree named ‘TDE2’

Country Status (1)

Country Link
US (1) USPP15461P3 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
USPP23724P2 (en) 2010-08-24 2013-07-09 The United States Of America, As Represented By The Secretary Of Agriculture Mandarin tree named ‘US Early Pride’

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100170013A1 (en) * 2008-12-31 2010-07-01 Fowler Packing Company, Inc. Parga No. 2

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
USPP23724P2 (en) 2010-08-24 2013-07-09 The United States Of America, As Represented By The Secretary Of Agriculture Mandarin tree named ‘US Early Pride’

Also Published As

Publication number Publication date
US20040006800P1 (en) 2004-01-08

Similar Documents

Publication Publication Date Title
Pinto et al. Annona species
Knight et al. Important mango cultivars and their descriptors.
USPP21356P3 (en) Mandarin tree named ‘LB8-9’
Saran et al. Papaya: biology, cultivation, production and uses
Lyrene Phenotype and fertility of intersectional hybrids between tetraploid highbush blueberry and colchicine-treated Vaccinium stamineum
Lyrene Breeding cultivars from blueberry× deerberry hybrids: progress and prospects
US20070056064P1 (en) Mandarin variety named 'Tango'
USPP15461P3 (en) Mandarin hybrid tree named ‘TDE2’
USPP16289P3 (en) Mandarin hybrid tree named ‘TDE4’
USPP15703P3 (en) Mandarin hybrid tree named ‘TDE3’
USPP27581P2 (en) Mandarin tree named ‘UFGlow’
Lyrene Florida native blueberries and their use in breeding
USPP23631P2 (en) Peach rootstock ‘HBOK 27’
Lyrene Fertility and other characteristics of F1 and backcross1 progeny from an intersectional blueberry cross [(highbush cultivar× Vaccinium arboreum)× highbush cultivar]
USPP31347P2 (en) Mandarin tree named ‘Marathon’
USPP28529P3 (en) Walnut tree named ‘Durham’
USPP35852P3 (en) Blueberry plant named ‘BLUECSOL11’
USPP27249P3 (en) Satsuma hybrid named ‘Sonet’
USPP22208P3 (en) Peach rootstock named ‘HBOK 50’
USPP33383P2 (en) Walnut tree names 'wolfskill'
USPP16594P3 (en) Avocado tree named ‘Carla’
USPP31231P2 (en) Blueberry plant named ‘BB05-35FL-10’
US20110154548P1 (en) Peach Tree Rootstock Named 'HBOK 10'
USPP16496P3 (en) Walnut tree named ‘Sexton’
USPP9828P (en) Asian pear tree named "asio 3"

Legal Events

Date Code Title Description
AS Assignment

Owner name: REGENTS OF THE UNIVERSTIY OF CALIFORNIA, THE, CALI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ROOSE, MIKEAL L.;WILLIAMS, TIMOTHY A.;SOOST, ROBERT K.;AND OTHERS;REEL/FRAME:013426/0781;SIGNING DATES FROM 20020915 TO 20020922

AS Assignment

Owner name: REGENTS OF THE UNIVERSITY OF CALIFORNIA, THE, CALI

Free format text: RECORD TO CORRECT SECOND INVENTOR S MIDDLE INITIAL ON ASSIGNMENT DOCUMENTS RECORDED 2/11/03 AT REEL013426 FRAME 0781;ASSIGNORS:ROOSE, MIKEAL L.;WILLIAMS, TIMOTHY E.;SOOST, ROBERT K.;AND OTHERS;REEL/FRAME:016622/0344;SIGNING DATES FROM 20020915 TO 20020922