US9696297B2 - Method for preparing an X chromosome inactivated female human neural cell - Google Patents

Method for preparing an X chromosome inactivated female human neural cell Download PDF

Info

Publication number
US9696297B2
US9696297B2 US13/518,842 US201013518842A US9696297B2 US 9696297 B2 US9696297 B2 US 9696297B2 US 201013518842 A US201013518842 A US 201013518842A US 9696297 B2 US9696297 B2 US 9696297B2
Authority
US
United States
Prior art keywords
cell
chromosome
rtt
cells
ipsc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US13/518,842
Other versions
US20130004985A1 (en
Inventor
Maria C. N. Marchetto
Fred H. Gage
Alysson R. Muotri
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Salk Institute for Biological Studies
Original Assignee
Salk Institute for Biological Studies
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Salk Institute for Biological Studies filed Critical Salk Institute for Biological Studies
Priority to US13/518,842 priority Critical patent/US9696297B2/en
Assigned to SALK INSTITUTE FOR BIOLOGICAL STUDIES reassignment SALK INSTITUTE FOR BIOLOGICAL STUDIES ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GAGE, FRED H., MARCHETTO, MARIA C.N., MUOTRI, ALYSSON
Publication of US20130004985A1 publication Critical patent/US20130004985A1/en
Application granted granted Critical
Publication of US9696297B2 publication Critical patent/US9696297B2/en
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058Neurological cells
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/28Neurological disorders

Definitions

  • Autism spectrum disorders are complex neurodevelopmental diseases affecting 1 in 150 children in the United States See e.g., MMWR Surveill Summ 56 (1):1-11 (2007). Such diseases are mainly characterized by impaired social interaction and repetitive behavior. Family history and twin studies suggest that, in some cases, these disorders share genetic roots, but the degree to which environmental and genetic patterns account for individual differences within ASD is currently unknown. See e.g., Piven, J. et al., 1997, The American Journal of Psychiatry 154 (2):185-190; Ronald, A. et al., 2006 , J Am Acad Child Adolesc Psychiatry 45 (6):691-699.
  • Rett syndrome is a progressive neurological disorder caused by mutations in the X-linked gene encoding MeCP2 protein. See e.g., Amir, R. E. et al. 1999, Nat Genet 23 (2):185-188. RTT patients have a large spectrum of autistic characteristics and are considered part of the ASD population. See e.g., Samaco, R. C. et al., 2004, Hum Mol Genet 13 (6):629-639; Zappella, M. et al., 2003, Am J Med Genet B Neuropsychiatr Genet 119 (1):102-107; Hammer, S.
  • MeCP2 may be involved in the epigenetic regulation of target genes, by binding to methylated CpG dinucleotides within promoters, and may function as a transcriptional repressor, although this view has been challenged recently. See e.g., Yasui, D. H. et al., 2007 , Proc Natl Acad Sci USA 104 (49):19416-19421; Chahrour, M. et al., 2008, Science 320 (5880):1224-1229. Without wishing to be bound by any theory, it is believed that genes misregulated by MeCP2 mutations are probably responsible for the phenotypic abnormalities observed rather than the MeCP2 gene itself.
  • Pluripotent human embryonic stem cells have been successfully generated from early stage human embryos and can differentiate into various cell types. See, e.g., Thomson, J. A. et al., 1998 , Science 282(5391):1145-1147. However, to develop cellular models of human disease, it is necessary to generate cell lines with genomes pre-disposed to diseases. Recently, reprogramming of somatic cells to a pluripotent state by over-expression of specific genes (induced pluripotent stem cells, iPSCs) has been accomplished. See, e.g., Takahashi, K. & Yamanaka, S., 2006 , Cell 126(4):663-676; Takahashi, K.
  • iPSCs induced pluripotent stem cells
  • iPSCs are isogenic to the donor individual, i.e., they carry the identical genetic background. Isogenic pluripotent cells are attractive not only for their potential therapeutic use with lower risk of immune rejection but also for understanding complex diseases. See, e.g., Marchetto et al., 2010 , Cell 143:527-539; Muotri, A. R., 2009 , Epilepsy Behav 14:Suppl. 1, 81-85.
  • iPSCs have been generated for several neurological diseases (Dimos et al., 2008 , Science 321:1218-1221; Ebert et al., 2009 , Nature 457:277-280; Hotta et al., 2009 , Nat. Methods 6:370-376; Lee et al., 2009 , Nature 461:402-406; Park et al., 2008 , Cell 134:877-886; Soldner et al., 2009 , Cell 136:964-977), the demonstration of disease-specific pathogenesis and phenotypic rescue in relevant cell types is a current challenge in the field (Marchetto et al. 2010, id).
  • an X chromosome inactivated female human neural cell derived from an induced pluripotent stem cell is provided.
  • a plurality of X chromosome inactivated female human neural cells are provided that are derived from a plurality of induced pluripotent stem cells.
  • the X chromosome inactivated female human neural cells can be neural progenitor cells or neuronal cells.
  • Each of the X chromosome inactivated female human neural cells includes a first X chromosome and a second X chromosome.
  • the second X chromosome includes a mutated gene, where a portion of the plurality of X chromosome inactivated female human neural cells include an inactive first X chromosome and an active second X chromosome and another portion of the plurality of X chromosome inactivated female human neural cells include an active first X chromosome and an inactive second X chromosome.
  • a method of identifying a compound useful in treating a neurological disorder includes contacting a test compound with a plurality of X chromosome inactivated female human neural cells (e.g. as described in the preceding paragraph). The level of neurological functionality of the plurality of X chromosome inactivated female human neural cells is determined. The level of neurological functionality of the plurality of X chromosome inactivated female human neural cells in the presence of the test compound is compared to a control thereby identifying a compound useful in treating a neurological disorder.
  • FIG. 1 Generation of iPSCs .
  • FIG. 1A Schematic representation of the MeCP2 gene structure and mutations as described herein. UTR, untranslated region; MBD, methyl-CpG binding domain; NLS, nuclear localization signal; Poly-A, polyadenylation signal; TRD, transcriptional repression domain; WW, domain containing WW (two tryptophans); X, stop codon. Respective cell lines codes are shown close to their mutations.
  • FIG. 1B Morphology of human fibroblasts before retroviral infection.
  • FIG. 1C Aspect of iPSCs colonies 14 days after infection.
  • FIGS. 1D-1E Representative images of established iPSC colonies as described herein.
  • FIGS. 1D-1E Representative images of established iPSC colonies as described herein.
  • FIGS. 1D-1E Representative images of established iPSC colonies as described herein.
  • FIGS. 1D-1E Representative images of established iPSC colonies as described herein.
  • FIG. 1F-1G Representative images of RTT-iPSCs showing expression of pluripotent markers Dapi, Nanog, Tra-1-81 and merge ( FIG. 1F ), and Dapi, Lin28, Sox2 and merge ( FIG. 1G ).
  • FIG. 1H No karyotypic abnormalities were observed.
  • FIG. 2 Neural differentiation of iPSCs.
  • FIG. 2A Schematic view of a neural differentiation protocol described herein.
  • FIG. 3 RTT-iPSC clones undergo X-inactivation during differentiation.
  • FIG. 3A Schematic representation of X-inactivation dynamics during reprogramming and further neural differentiation.
  • RTT fibroblasts are mosaic for the MeCP2 WT gene expression.
  • X-inactivation is erased and iPSCs express both MeCP2 alleles.
  • iPSCs express both MeCP2 alleles.
  • X-inactivation is re-established and the resultant cells are mosaic for MeCP2 WT gene expression.
  • 3 B Immunofluorescence for me3H3K27 in fibroblasts, pluripotent cells (Nanog-positive) and after neuronal differentiation (Syn::EGFP-positive).
  • FIG. 3C Quantification of cells as indicated with diffuse or foci me3H3K27 nuclear staining. Data shown as mean ⁇ s.e.m.
  • FIG. 3D RNA FISH shows that Xist RNA domains are present in the original fibroblasts before reprogramming. iPSCs show no Xist expression. Neurons derived from normal and RTT iPSCs show clear Xist clouds, indicating transcriptional silencing of the X chromosome (arrows).
  • FIG. 3G RTT-derived fibroblasts and neurons have reduced levels of WT MeCP2 protein by Western blot. See also FIG. 9 .
  • FIG. 4 Alterations in RTT neurons.
  • FIG. 4A Proliferating RTT NPCs displayed no signal of aberrant cell cycle when compared to controls.
  • FIG. 4A Proliferating RTT NPCs displayed no signal of aberrant cell cycle when compared to controls.
  • FIG. 4C Reduction of MeCP2 expression decreased the number of glutamatergic synapses in WT neurons.
  • FIG. 4D Overexpression of MeCP2 increased the number of glutamatergic synapses.
  • FIG. 4E Representative images of neurites of different genetic backgrounds. Histogram (right panel) shows the spine density from independent experiments using different RTT backgrounds and controls and after expression of shMeCP2.
  • FIG. 4G A lower dose of gentamicin was able to rescue glutamatergic synapses in RTT neurons.
  • Numbers of neurons analyzed (n) are shown within the bars in graphs ( FIG. 4E ) and ( FIG. 4G ).
  • FIG. 10 and Tables 2.1 and 2.2 Data shown as mean ⁇ s.e.m.
  • FIG. 5 Altered activity-dependent calcium transients in RTT-derived neurons.
  • FIG. 5A Representative examples of WT (upper) and RTT (lower) calcium signal traces. Observed traces correspond to the calcium rise phase detected by the algorithm used.
  • FIG. 5B Fluorescence intensity changes reflecting intracellular calcium fluctuations in RTT and WT neurons in different Regions of Interest (ROI).
  • FIG. 5C RTT neurons show a lower average of calcium spikes when compared to WT control neurons.
  • FIG. 5D The percentage of Syn::DsRed-positive neurons signaling in the RTT neuronal network is significantly reduced when compared to controls.
  • FIG. 6 Decreased frequency of spontaneous postsynaptic currents in RTT neurons.
  • FIG. 6D Cumulative probability plot of amplitudes (left panel, 1 pA bins; p ⁇ 0.001) and inter-event intervals (right panel, 20 ms bins; p ⁇ 0.05) of sEPSCs from groups of WT and RTT cells, respectively.
  • FIG. 6E Cumulative probability plot of amplitudes (left panel, 1 pA bins; p ⁇ 0.05) and inter-event intervals (right panel, 20 ms bins; p ⁇ 0.05) of sIPSCs from each group (WT and RTT).
  • FIG. 7 Generation of iPSCs derived from RTT patients' fibroblasts carrying distinct mutations in the MeCP2 gene; related to FIG. 1 .
  • FIG. 7A Morphology of fibroblasts before retroviral infection.
  • FIG. 7B Aspect of iPSCs colonies growing in the absence of feeder layer. Colonies are compact and have well-defined borders. Cells display high nucleus-to-cytoplasm ratio and are morphologically similar to hESCs.
  • FIG. 7D Hierarchical clustering and correlation coefficients of microarray profiles of triplicate WT Fibroblasts, RTT Fibroblasts, WT-iPSC clone 1, WT-iPSC clone 2, RTT-iPSC clones 15 and 18 (1155del32), RTT-iPSC clones 1 and 2 (Q244X) and the hESC line HUES6. Shade indicates the level of correlation (from 0 to 1), with bar reporting log 2 normalized expression values.
  • FIG. 7D Hierarchical clustering and correlation coefficients of microarray profiles of triplicate WT Fibroblasts, RTT Fibroblasts, WT-iPSC clone 1, WT-iPSC clone 2, RTT-iPSC clones 15 and 18 (1155del32), RTT-iPSC clones 1 and 2 (Q244X) and the hESC line HUES6. Shade indicates the level of correlation (from 0 to 1), with bar reporting log 2 normalized expression
  • FIG. 7E Reprogrammed iPSCs showed expressions similar to hESC-enriched genes (Lin28, CXADR, Nanog and PTRZ1; black bars) and showed distinct differences from fibroblast-enriched genes (GREM1, MMP1, DKK1 and PTX3; white bars).
  • the X-axis species appear in the order (left to right): HUES6; Fibroblast WT; Fibroblast RTT; iPSC-WT cl (clone) 1; iPSC-WT cl 2; iPSC-RTT cl 15; iPSC-RTT cl 18.
  • FIG. 7E Reprogrammed iPSCs showed expressions similar to hESC-enriched genes (Lin28, CXADR, Nanog and PTRZ1; black bars) and showed distinct differences from fibroblast-enriched genes (GREM1, MMP1, DKK1 and PTX3; white bars).
  • the X-axis species appear in the order (
  • RT-PCR from reprogrammed iPSCs showed endogenous expressions of hESC-enriched genes (Oct4, Sox2 and Nanog) but not from a fibroblast-enriched gene (Msx1).
  • FIG. 8 Neuronal differentiation from individual WT and RTT-iPSC clones; related to FIG. 2 . Clones from WT and RTT-iPSCs were differentiated into neurons for approximately 1 month.
  • FIG. 8A Neurons were stained with the Map2 neuronal marker. Order of X-axis entries for histogram FIG. 8A : WT-AG09319 C1; WT-ADRC40; WT-33 C1; WT-126 C5; WT-126 C8; RTT-1155del32 C15; RTT-1155del32 C18; RTT-Q244X C3; RTT-Q244X C4; RTT-T158M C3.
  • FIG. 8A WT-AG09319 C1; WT-ADRC40; WT-33 C1; WT-126 C5; WT-126 C8; RTT-1155del32 C15; RTT-1155del32 C18; RTT-Q244X C3; RTT-Q
  • FIG. 8B Neurons were infected with a lentiviral vector expressing the DsRed reporter under the control of the Synapsin promoter region. Order of X-axis entires for histogram FIG. 8B : WT-33 C1; WT-126 C8; RTT-1155del32 C15; RTT-1155del32 C18; RTT-Q244X C3.
  • FIG. 8C Inhibitory neurons were revealed in the cultures after staining with anti-GABA antibody. Each bar represents 3 independent experiments for each individual clone. Order of X-axis entries for histogram FIG.
  • FIG. 9 Androgen receptor analysis; related to FIG. 3 .
  • two different sized amplicons were detected (different peaks) and digested with a methylation-sensitive restriction enzyme (HpaII).
  • HpaII methylation-sensitive restriction enzyme
  • the PCR using undigested DNA shows if two distinct alleles are present and also allows a correction factor due to the advantage on the amplification of the smaller allele.
  • amplification occurs if the restriction sites are methylated. If the site is unmethylated, digestion will occur between the flanking oligonucleotides and amplification will not be possible.
  • FIG. 9A When random inactivation is present, the maternal and paternal alleles are represented at similar proportions.
  • FIG. 9B In contrast, in a condition where non-random inactivation is present, the more commonly inactive allele will be preferentially amplified and this will be detected by a stronger peak.
  • FIG. 9C A male control is displayed showing a single peak before HpaII digestion.
  • FIG. 9D A PCR was run without DNA template as a control.
  • FIG. 9E Fibroblasts carrying the 1155del32 MeCP2 mutant (GM11272) displayed random X-inactivation.
  • FIG. 9F RTT-1155del32-derived neurons showed highly skewed X-inactivation.
  • FIG. 10 Phenotypic analysis iPSC-derived neurons from several clones; related to FIG. 4 .
  • FIG. 10B Experimental and clonal variation of VGLUT1 puncta quantification in different individuals. The order of histogram entries is as provided in the figures.
  • FIG. 10D Histogram shows cell soma radius for several RTT and WT clones, as indicated in the figure.
  • FIG. 10E WT MeCP2 protein levels detected in control and RTT neurons (Q244X). Gentamicin treatment in RTT neurons increased protein levels after 2 weeks. Numbers of neurons analyzed (n) are shown within the bars in graphs ( FIG. 10B ) and ( FIG. 10D ). Order of X-axis entries for histogram of FIG. 10E (right panel): WT; RTT; RTT+Genta. Data shown as mean ⁇ s.e.m.
  • FIG. 11 Calcium transient analysis in iPSC-derived neurons; related to FIG. 5 . Neurons were selected after the confirmation that calcium transients were blocked with 1 ⁇ M of TTX or the glutamate receptor antagonists CNQX/APV treatments.
  • FIG. 11A Blocking glutamatergic signaling in the neuronal network using CNQX and APV resulted in significant reduction in intracellular calcium transients.
  • FIG. 11B Blocking voltage-gated sodium channels using TTX prohibited the generation of action potentials and resulted in complete elimination of neuronal intracellular calcium transients.
  • FIG. 11C Gabazine increased the number of calcium transients in the iPSC-derived neuronal networks.
  • FIG. 11D Histogram shows the normalized frequency of neurons with calcium transients after drug treatments. Order of histogram entries (left to right): KHB; +TTX; +CNQX/APV; +Gabazine.
  • FIG. 11F Bar graph shows the percentage of signaling neurons in RTT and shMeCP2-treated WT neurons compared to WT control neurons. Order of histogram entries (left to right): as in FIG. 11E .
  • Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, and complements thereof.
  • complementarity refers to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide.
  • sequence A-G-T is complementary to the sequence T-C-A.
  • Complementarity may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
  • nucleic acids refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection. See, e.g., the NCBI web site or the like.
  • sequences are then said to be “substantially identical.”
  • This definition also refers to, or may be applied to, the compliment of a test sequence.
  • the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions.
  • the preferred algorithms can account for gaps and the like.
  • identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
  • stringent hybridization conditions refers to conditions under which a probe will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but to not other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, T ECHNIQUES IN B IOCHEMISTRY AND M OLECULAR B IOLOGY —H YBRIDIZATION WITH N UCLEIC P ROBES , “Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10° C.
  • Tm thermal melting point
  • the Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, preferably 10 times background hybridization.
  • Exemplary stringent hybridization conditions can be as following: 50% formamide, 5 ⁇ SSC, and 1% SDS, incubating at 42° C., or, 5 ⁇ SSC, 1% SDS, incubating at 65° C., with wash in 0.2 ⁇ SSC, and 0.1% SDS at 65° C.
  • DNA and RNA measurement A variety of methods of specific DNA and RNA measurement that use nucleic acid hybridization techniques are known to those of skill in the art (see, Sambrook, Id.). Some methods involve electrophoretic separation (e.g., Southern blot for detecting DNA, and Northern blot for detecting RNA), but measurement of DNA and RNA can also be carried out in the absence of electrophoretic separation (e.g., by dot blot).
  • electrophoretic separation e.g., Southern blot for detecting DNA, and Northern blot for detecting RNA
  • measurement of DNA and RNA can also be carried out in the absence of electrophoretic separation (e.g., by dot blot).
  • the sensitivity of the hybridization assays may be enhanced through use of a nucleic acid amplification system that multiplies the target nucleic acid being detected.
  • a nucleic acid amplification system that multiplies the target nucleic acid being detected.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • Other methods recently described in the art are the nucleic acid sequence based amplification (NASBA, Cangene, Mississauga, Ontario) and Q Beta Replicase systems. These systems can be used to directly identify mutants where the PCR or LCR primers are designed to be extended or ligated only when a selected sequence is present.
  • the selected sequences can be generally amplified using, for example, nonspecific PCR primers and the amplified target region later probed for a specific sequence indicative of a mutation.
  • detection probes including Taqman® and molecular beacon probes can be used to monitor amplification reaction products, e.g., in real time.
  • polynucleotide refers to a linear sequence of nucleotides.
  • the nucleotides can be ribonucleotides, deoxyribonucleotides, or a mixture of both.
  • Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA (including miRNA), and hybrid molecules having mixtures of single and double stranded DNA and RNA.
  • protein protein
  • peptide and “polypeptide” are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers.
  • gene means the segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
  • the leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene.
  • a “protein gene product” is a protein expressed from a particular gene.
  • the word “expression” or “expressed” as used herein in reference to a gene means the transcriptional and/or translational product of that gene.
  • the level of expression of a DNA molecule in a cell may be determined on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88).
  • transfected gene expression of a transfected gene can occur transiently or stably in a cell.
  • transient expression the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time.
  • stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell.
  • selection advantage may be a resistance towards a certain toxin that is presented to the cell.
  • plasmid refers to a nucleic acid molecule that encodes for genes and/or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, gene and regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids.
  • a “vector” is a nucleic acid that is capable of transporting another nucleic acid into a cell.
  • a vector is capable of directing expression of a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment.
  • a “viral vector” is a viral-derived nucleic acid that is capable of transporting another nucleic acid into a cell.
  • a viral vector is capable of directing expression of a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors.
  • a “cell culture” is a population of cells residing outside of an organism. These cells are optionally primary cells isolated from a cell bank, animal, or blood bank, or secondary cells that are derived from one of these sources and have been immortalized for long-lived in vitro cultures.
  • a “stem cell” is a cell characterized by the ability of self-renewal through mitotic cell division and the potential to differentiate into a tissue or an organ.
  • embryonic and somatic stem cells can be distinguished. Embryonic stem cells reside in the blastocyst and give rise to embryonic tissues, whereas somatic stem cells reside in adult tissues for the purpose of tissue regeneration and repair.
  • pluripotent refers to cells with the ability to give rise to progeny that can undergo differentiation, under appropriate conditions, into cell types that collectively exhibit characteristics associated with cell lineages from the three germ layers (endoderm, mesoderm, and ectoderm). Pluripotent stem cells can contribute to tissues of a prenatal, postnatal or adult organism. A standard art-accepted test, such as the ability to form a teratoma in 8-12 week old SCID mice, can be used to establish the pluripotency of a cell population. However, identification of various pluripotent stem cell characteristics can also be used to identify pluripotent cells.
  • pluripotent stem cell characteristics refer to characteristics of a cell that distinguish pluripotent stem cells from other cells. Expression or non-expression of certain combinations of molecular markers are examples of characteristics of pluripotent stem cells. More specifically, human pluripotent stem cells may express at least some, and optionally all, of the markers from the following non-limiting list: SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, TRA-2-49/6E, ALP, Sox2, E-cadherin, UTF-1, Oct4, Lin28, Rex1, and Nanog. Cell morphologies associated with pluripotent stem cells are also pluripotent stem cell characteristics.
  • reprogramming refers to the process of dedifferentiating a non-pluripotent cell into a cell exhibiting pluripotent stem cell characteristics.
  • treating means ameliorating, suppressing, eradicating, and/or delaying the onset of the disease being treated.
  • induced pluripotent stem cell refers to a pluripotent stem cell artificially derived from a non-pluripotent cell.
  • a “non-pluripotent cell” can be a cell of lesser potency to self-renew and differentiate than a pluripotent stem cell.
  • Cells of lesser potency can be, but are not limited to adult stem cells, tissue specific progenitor cells, primary or secondary cells.
  • An adult stem cell is an undifferentiated cell found throughout the body after embryonic development.
  • Adult stem cells multiply by cell division to replenish dying cells and regenerate damaged tissue.
  • Adult stem cells have the ability to divide and create another cell like itself and also divide and create a cell more differentiated than itself.
  • adult stem cells are associated with the expression of pluripotency markers such as Rex1, Nanog, Oct4 or Sox2, they do not have the ability of pluripotent stem cells to differentiate into the cell types of all three germ layers.
  • Adult stem cells have a limited potency to self renew and generate progeny of distinct cell types.
  • an adult stem cell can be a hematopoietic stem cell, a cord blood stem cell, a mesenchymal stem cell, an epithelial stem cell, a skin stem cell or a neural stem cell.
  • a tissue specific progenitor refers to a cell devoid of self-renewal potential that is committed to differentiate into a specific organ or tissue.
  • a primary cell includes any cell of an adult or fetal organism apart from egg cells, sperm cells and stem cells. Examples of useful primary cells include, but are not limited to, skin cells, bone cells, blood cells, cells of internal organs and cells of connective tissue.
  • a secondary cell is derived from a primary cell and has been immortalized for long-lived in vitro cell culture.
  • a “somatic cell” is a cell forming the body of an organism. Somatic cells include cells making up organs, skin, blood, bones and connective tissue in an organism, but not germline cells.
  • the teen “transfection” or “transfecting” is defined as a process of introducing nucleic acid molecules to a cell by non-viral or viral-based methods.
  • the nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof.
  • Non-viral methods of transfection include any appropriate transfection method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell.
  • Exemplary non-viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection and electroporation.
  • the nucleic acid molecules are introduced into a cell using electroporation following standard procedures well known in the art.
  • any useful viral vector may be used in the methods described herein. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors.
  • the nucleic acid molecules are introduced into a cell using a retroviral vector following standard procedures well known in the art.
  • transfected gene can occur transiently or stably in a cell.
  • transient expression the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time.
  • stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell.
  • Expression of a transfected gene can further be accomplished by transposon-mediated insertion into the host genome. During transposon-mediated insertion the gene is positioned between two transposon linker sequences that allow insertion into the host genome as well as subsequent excision.
  • Yamanaka factors refers to Oct3/4, Sox2, Klf4, and c-Myc, which factors are highly expressed in embryonic stem (ES) cells. Without wishing to be bound by any theory, it is believed that over-expression of the Yamanaka factors can induce pluripotency in somatic cells from a variety of species, e.g., mouse and human somatic cells. See, e.g., Yamanaka, 2009 , Cell 137: 13-17.
  • KLF4 protein as referred to herein includes any of the naturally-occurring forms of the KLF4 transcription factor, or variants thereof that maintain KLF4 transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to KLF4).
  • variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring KLF4 polypeptide (e.g., SEQ ID NO:1).
  • the KLF4 protein is the protein as identified by the NCBI reference gi:194248077 (SEQ ID NO:1).
  • OCT4 protein as referred to herein includes any of the naturally-occurring forms of the Octomer 4 transcription factor, or variants thereof that maintain Oct4 transcription factor activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Oct4).
  • variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Oct4 polypeptide (e.g., SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4).
  • the Oct4 protein is the protein as identified by the NCBI reference gi:42560248 corresponding to isoform 1 (SEQ ID NO:2), gi:116235491 and gi:291167755 corresponding to isoform 2 (SEQ ID NO:3 and SEQ ID NO:4).
  • Sox2 protein as referred to herein includes any of the naturally-occurring forms of the Sox2 transcription factor, or variants thereof that maintain Sox2 transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Sox2).
  • variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Sox2 polypeptide (e.g., SEQ ID NO:5).
  • the Sox2 protein is the protein as identified by the NCBI reference gi:28195386 (SEQ ID NO:5).
  • a “cMYC protein” as referred to herein includes any of the naturally-occurring forms of the cMyc transcription factor, or variants thereof that maintain cMyc transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to cMyc).
  • variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring cMyc polypeptide (e.g., SEQ ID NO:6).
  • the cMyc protein is the protein as identified by the NCBI reference gi:71774083 (SEQ ID NO:6).
  • feeder-free refers to the absence of feeder cells.
  • the term “feeder cell” is generally well known in the art and includes all cells used to support the propagation of stem cells during the process of reprogramming. Feeder cells may be irradiated prior to being co-cultured with the cells being reprogrammed in order to avoid the feeder cells to overgrow the cells undergoing reprogramming. Feeder cells produce growth factors that support cells during the process of reprogramming and also provide a layer physical support for the reprogrammed cells to attach to. Examples of feeder cells include fibroblasts, splenocytes, macrophages and thymocytes.
  • an X chromosome inactivated female human neural cell derived from an induced pluripotent stem cell is provided.
  • Human female somatic cells have two X chromosomes, one of which is inactive such that the female cell does not contain twice the number of X chromosome gene products as a human male cell.
  • an X chromosome is referred to herein as inactive or inactivated, it is used in accordance with its generally known meaning in the art.
  • an X chromosome inactivated human female cell is a human female cell in which one of the two X chromosomes present in the human female cell is silent with respect to X chromosome gene expression.
  • a human neural cell is a cell associated with the human nervous system. Examples of human neural cells include but are not limited to neural stem cells, neural progenitor cells, neuron, and glial cells. In some embodiments, a human neural cell is a neural progenitor cell or a neuronal cell. In some embodiments, a human neural cell is a neural progenitor cell.
  • a neural progenitor cell is a neural cell capable of differentiating into a specific neuronal cell type but incapable of replicating indefinitely (e.g., can only divide a limited number of times). As used herein, the term “differentiating” refers to a process by which a less specialized cell type becomes a more specialized cell type.
  • a human neural cell is a neuronal cell.
  • a neuronal cell is a further differentiated neural cell, such as a neuron (e.g., a cholinergic, GABAergic, glutamatergic, dopaminergic and serotonergic neuron) or a glial cell (e.g., astrocyte, microglial cell, Schwann cell, etc.).
  • a neuron e.g., a cholinergic, GABAergic, glutamatergic, dopaminergic and serotonergic neuron
  • a glial cell e.g., astrocyte, microglial cell, Schwann cell, etc.
  • the X chromosome inactivated female human neural cell includes a mutated X chromosome linked gene.
  • the mutated X chromosome linked gene is capable of causing a neurological disorder when found in a human.
  • the mutated X chromosome linked gene is capable of causing an autism spectrum disorder (e.g., autism or Rett syndrome).
  • the mutated X chromosome linked gene is a mutated X-linked gene encoding MeCP2.
  • MeCP2 as referred to herein stands for methyl CpG binding protein 2 and includes any of the naturally-occurring forms of the MeCP2 gene or protein, or variants thereof that maintain MeCP2 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MeCP2). In some embodiments, variants have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g.
  • MeCP2 nucleic acid is the nucleic acid as identified by GenBank Accession Nos.
  • NM_004992 (MeCP2 isoform 1 DNA; SEQ ID NO:7) or NM_001110792 (MeCP2 isoform 2 DNA; SEQ ID NO:9).
  • the MeCP2 protein is the protein as identified by GenBank Accession Nos. NP_004983 (MeCP2 isoform 1 protein; SEQ ID NO:8) and NP_001104262 (MeCP2 isoform 2 protein; SEQ ID NO:10).
  • the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having a neurological disorder.
  • the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having an autism spectrum disorder.
  • the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having autism, Rett syndrome, Alzheimer's disease, Parkinson's disease, Charcot-Marie-Tooth disease, Myasthenia Gravis, multiple sclerosis, or chronic demyelinating polyneuropathy and the like.
  • the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having autism or Rett syndrome. In some embodiments, the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having Rett syndrome.
  • the X chromosome inactivated female human neural cell may be prepared by a process that includes differentiating an induced pluripotent stem cell (iPSC).
  • An induced pluripotent stem cell is typically a pluripotent stem cell that is derived non-naturally from a non-pluripotent cell, such as an adult somatic cell (e.g., generated from a non-pluripotent cell using any appropriate method as described herein).
  • the iPSC may have two active X chromosomes, where upon differentiation of the iPSC to the X chromosome inactivated female human neural cell, one of the two active X chromosomes of is inactivated.
  • the process may further include, prior to the differentiation of the induced pluripotent stem cell, generating the induced pluripotent stem cell from a human female somatic cell.
  • iPSCs are generated by transfecting a non-pluripotent cell (e.g., a human female somatic cell) with nucleic acid encoding one or more proteins that are one or more highly expressed in embryonic stem cells.
  • the non-pluripotent cell is transfected with nucleic acids encoding one or more proteins effective to induce pluripotency (e.g., one or more Yamanaka factors).
  • the non-pluripotent cell is transfected with nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, or a Klf4 protein. In some embodiments, the non-pluripotent cell is transfected with nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and a Klf4 protein. In some embodiments, the nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and/or a Klf4 protein are expressed in viral vectors.
  • a viral vector may be any suitable virus (e.g., retrovirus or lentivirus).
  • the non-pluripotent cell is transfected with Sox2, Oct4, c-Myc, and Klf4-expressing viral vectors.
  • iPSCs are differentiated into neural cells by culturing the iPSCs to generate embyroid bodies (EBs).
  • iPSCs may be differentiated into neural progenitor cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neural progenitor cells) to form EB-derived rosettes, which are dissociated and re-plated to generate neural progenitor cells.
  • the EBs are cultured in the absence of FGF2.
  • the EBs are cultured in the presence of a protein that promotes neural induction (e.g., Noggin).
  • iPSCs may be differentiated into neuronal cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neuronal cells) to form mature EBs, which are then dissociated and replated to generate neuronal cells.
  • the EBs are cultured in the presence of a protein that promotes neuronal induction (e.g., retinoic acid).
  • Differentiation of an iPSC into a neuronal cell can be confirmed by detecting the presence of one or more neuron markers, including but not limited to MAP2, MAP5, and Tuj1 ( ⁇ -III-tubulin) or one or more glial cell markers, including but not limited to GFAP and O4.
  • neuron markers including but not limited to MAP2, MAP5, and Tuj1 ( ⁇ -III-tubulin) or one or more glial cell markers, including but not limited to GFAP and O4.
  • the X chromosome inactivated female human neural cell may be derived from any appropriate human female somatic cell, including a human fibroblast cell.
  • the iPSC is derived from a human fibroblast cell, including but not limited to a human dermal fibroblast cell, a human lung fibroblast cell, a human dental pulp fibroblast cell, or a human adipose fibroblast cell.
  • the iPSC is derived from a human keratinocyte cell, including but not limited to a human skin keratinocyte cell or a human hair follicle keratinocyte cell.
  • the iPSC is derived from a human cell derived from tooth tissue, e.g., a cell derived from the cell rich pulp layer, preferably the innermost pulp layer, of the human tooth, cells from the odontoblastic layer, and the like as known in the art.
  • the iPSC is derived from the human fibroblast cell, human keratinocyte cell, or human cell derived from tooth tissue as described herein and used to generate the X chromosome inactivated female human neural cell.
  • the X chromosome inactivated female human neural cell that is derived from the iPSC as described herein is a neural progenitor cell.
  • the X chromosome inactivated female human neural cell that is derived from the iPSC as described herein is a neuronal cell, such as a neuron (e.g., cholinergic, GABAergic, glutamatergic, dopaminergic, or serotonergic neuron) or a glial cell (e.g., astrocytes, microglial cells, Schwann cells, etc.).
  • a neuron e.g., cholinergic, GABAergic, glutamatergic, dopaminergic, or serotonergic neuron
  • a glial cell e.g., astrocytes, microglial cells, Schwann cells, etc.
  • the X chromosome inactivated female human neural cell that is derived from the iPSC as described herein is a glutamatergic cell (e.g., a functional post-mitotic neuron which displays X-inactivation).
  • the human female somatic cell may include a first X chromosome and a second X chromosome.
  • the first X chromosome may be active and the second X chromosome may be inactive.
  • the second X chromosome may also include a mutated gene.
  • the first X chromosome is inactive, the second X chromosome is active, and the second X chromosome includes a mutated gene.
  • a “mutated gene” refers to a gene comprising one or more modifications relative to a wild-type (i.e., naturally occurring) gene, such as substitutions, insertions, deletions, and/or truncations, wherein the one or more modifications results in an alteration in the protein encoded by the gene relative to the protein encoded by the wild-type gene.
  • a method for preparing an X chromosome inactivated female human neural cell.
  • the method includes differentiating an induced pluripotent stem cell having two active X chromosome. Upon differentiation, one of the two active X chromosomes may be inactivated.
  • the method also includes, prior to differentiating the induced pluripotent stem cell, generating the induced pluripotent stem cell from a human female somatic cell (e.g., human fibroblast cell, human keratinocyte cell, or human cell derived from tooth tissue).
  • a human female somatic cell e.g., human fibroblast cell, human keratinocyte cell, or human cell derived from tooth tissue.
  • the human female somatic cell may include a first X chromosome and a second X chromosome, where the first X chromosome is active, the second X chromosome is inactive, and the second X chromosome comprises a mutated gene.
  • the X chromosome inactivated female human neural cell includes a first X chromosome and a second X chromosome, wherein the first X chromosome is inactive, the second X chromosome is active, and the second X chromosome comprises a mutated gene.
  • the method includes generating an induced pluripotent stem cell from a human female somatic cell.
  • the iPSC is generated by transfecting a human female somatic cell with nucleic acid encoding one or more proteins that are one or more highly expressed in embryonic stem cells.
  • the human female somatic cell is transfected with nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and a Klf4 protein.
  • the nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and/or a Klf4 protein are expressed in viral vectors.
  • a viral vector may be any suitable virus (e.g., retrovirus or lentivirus).
  • the human female somatic cell is transfected with Sox2, Oct4, c-Myc, and Klf4-expressing viral vectors to generate an iPSC.
  • the method includes differentiating an induced pluripotent stem cell having two active X chromosomes.
  • Induced pluripotent stem cells can be differentiated by any method known in the art (e.g., Marchetto, M. C. et al., Cell Stem Cell, 3, 649-657 (2008); Yeo, G. W. et al., PLoS Comput Biol, 3, 1951-1967 (2007)) or according to the methods described herein.
  • iPSCs having two active X chromosomes may be differentiated into X chromosome inactivated neural progenitor cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neural progenitor cells) to form EB-derived rosettes, which are dissociated and re-plated to generate neural progenitor cells.
  • the EBs are cultured in the absence of FGF2.
  • the EBs are cultured in the presence of a protein that promotes neural induction (e.g., Noggin).
  • iPSCs having two active X chromosomes may be differentiated into X chromosome inactivated neuronal cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neuronal cells) to form mature EBs, which are then dissociated and replated to generate neuronal cells.
  • the EBs are cultured in the presence of a protein that promotes neuronal induction (e.g., retinoic acid).
  • Differentiation of an iPSC into a neuronal cell can be confirmed by detecting the presence of one or more neuron markers, including but not limited to MAP2, MAP5, and Tuj1 ( ⁇ -III-tubulin) or one or more glial cell markers, including but not limited to GFAP and O4.
  • Activation or inactivation of an X chromosome can be detected by measuring the presence of a marker for X chromosome silencing.
  • inactivation of an X chromosome in a neural cell e.g., a female human neural progenitor cell or a female human neuronal cell
  • inactivation of an X chromosome in a neural cell is detected by contacting the neural cell with an antisense probe against Xist RNA.
  • a plurality of X chromosome inactivated female human neural cells are provided that are derived from a plurality of induced pluripotent stem cells.
  • Each of the X chromosome inactivated female human neural cells includes a first X chromosome and a second X chromosome.
  • the second X chromosome includes a mutated gene, where a portion of the plurality of X chromosome inactivated female human neural cells include an inactive first X chromosome and an active second X chromosome and another portion of the plurality of X chromosome inactivated female human neural cells include an active first X chromosome and an inactive second X chromosome.
  • the plurality of X chromosome inactivated female human neural cells are female human neural progenitor cells. In some embodiments, the plurality of X chromosome inactivated female human neural cells are female human neuronal cells. In some embodiments, at least a portion of the plurality of X chromosome inactivated female human neural cells are operably linked to form a neural network (i.e., a collection of neural cells in which at least some of the neural cells interact neurologically). In certain embodiments, the mutated gene is capable of causing a neurological disorder when found in a human. Applicable neurological disorders are discussed below. The mutated gene may encode MeCP2.
  • the induced pluripotent stem cell-derived X chromosome inactivated female human neural cells as described above can be used in the following methods.
  • a method of identifying a compound useful in treating a neurological disorder includes contacting a test compound with a plurality of X chromosome inactivated female human neural cells (e.g., human neural progenitor cells or human neuronal cells as described above).
  • the level of neurological functionality of the plurality of X chromosome inactivated female human neural cells is determined.
  • the level of neurological functionality of the plurality of X chromosome inactivated female human neural cells in the presence of the test compound is compared to a control, thereby identifying a compound useful in treating a neurological disorder.
  • a change in the level of neurological functionality in the presence of the test compound relative to the control that correlates to desired neurological functionality is indicative of a compound useful in treating a neurological disorder.
  • Any appropriate control may be used, including the level of neurological functionality of the plurality of X chromosome inactivated female human neural cells in the absence of the test compound.
  • a “level of neurological functionality” means any measurable characteristic of the plurality of X chromosome inactivated female human neural cells that relates to the ability of the plurality of X chromosome inactivated female human neural cells to function as desired (e.g., function similarly or superior to a plurality of X chromosome inactivated female human neural cells that do not contain a mutated gene on the second of first X chromosome).
  • the level of neural functionality is determined by measuring in a plurality of X chromosome inactivated female human neuronal cells (e.g., neurons) the number of calcium transients and/or the percentage of X chromosome inactivated female human neuronal cells (e.g., neurons) that exhibit calcium transients as compared to a control. In some embodiments, the level of neural functionality is determined by measuring in a plurality of X chromosome inactivated female human neuronal cells (e.g., neurons) the frequency and/or amplitude of spontaneous excitatory and/or inhibitory postsynaptic currents as compared to a control.
  • the neurological disorder may be an autism spectrum disorder (e.g., autism or Rett syndrome), Alzheimer's disease, Parkinson's disease, Charcot-Marie-Tooth disease, Myasthenia Gravis, multiple sclerosis, chronic demyelinating polyneuropathy and the like.
  • autism spectrum disorder refers to a disease or disorder that is characterized by varying degrees of (1) deficits in social interaction, (2) deficits in verbal and nonverbal communication, and (3) repetitive behaviors or interests. Disorders of the autism spectrum include autism, Asperger's syndrome, Rett syndrome, Childhood Disintegrative Disorder, and Pervasive Developmental Disorder Not Otherwise Specified (PDD-NOS).
  • the neurological disorder is autism spectrum disorder.
  • the neurological disorder is autism.
  • the neurological disorder is Rett syndrome.
  • a method of determining whether a human subject has a neurological disorder includes taking a somatic cell (e.g., a fibroblast cell, keratinocyte cell, or cell derived from tooth tissue as described above) from the human subject (e.g., a human female subject), generating an induced pluripotent stem cell from the somatic cell, and differentiating the induced pluripotent stem cell into a human neural cell (e.g., an X chromosome inactivated female human neural cell).
  • the level of neurological functionality of the human neural cell is determined.
  • the level of neural functionality of the human neural cell is compared to a control, thereby determining whether the subject has a neurological disorder.
  • the level of neural functionality is determined by measuring in the X human neural cell (e.g., an X chromosome inactivated female human neural cell) the number of calcium transients and/or the percentage of X chromosome inactivated female human neuronal cells (e.g., neurons) that exhibit calcium transients as compared to a control.
  • the level of neural functionality is determined by measuring in the X human neural cell (e.g., an X chromosome inactivated female human neural cell) the frequency and/or amplitude of spontaneous excitatory and/or inhibitory postsynaptic currents as compared to a control.
  • the neurological disorder may be an autism spectrum disorder (e.g., autism or Rett syndrome), Alzheimer's disease, Parkinson's disease, Charcot-Marie-Tooth disease, Myasthenia Gravis, multiple sclerosis, chronic demyelinating polyneuropathy and the like.
  • the neurological disorder is autism spectrum disorder.
  • the neurological disorder is autism.
  • the neurological disorder is Rett syndrome.
  • Induced pluripotent stem cells may be generated and differentiated into a human neural cell according to any method described herein or known in the art.
  • the human neural cell is an X chromosome inactivated female human neural cell.
  • the X chromosome inactivated female human neural cell is a human neural progenitor cell or a human neuronal cell.
  • the X chromosome inactivated female human neural cell includes a mutated X chromosome linked gene.
  • the mutated X chromosome linked gene is capable of causing a neurological disorder when found in a human.
  • the mutated X chromosome linked gene is capable of causing an autism spectrum disorder (e.g., autism or Rett syndrome).
  • the mutated X chromosome linked gene is a mutated X-linked gene encoding MeCP2.
  • the method includes determining the level of functionality of a plurality of human neural cells. In some embodiments, the method includes determining the level of functionality of a plurality of X chromosome inactivated female human neural cells. Each of the X chromosome inactivated female human neural cells includes a first X chromosome and a second X chromosome.
  • the second X chromosome includes a mutated gene, where a portion of the plurality of X chromosome inactivated female human neural cells include an inactive first X chromosome and an active second X chromosome and another portion of the plurality of X chromosome inactivated female human neural cells include an active first X chromosome and an inactive second X chromosome.
  • the plurality of X chromosome inactivated female human neural cells are female human neural progenitor cells.
  • the plurality of X chromosome inactivated female human neural cells are female human neuronal cells.
  • At least a portion of the plurality of X chromosome inactivated female human neural cells are operably linked to form a neural network (i.e., a collection of neural cells in which at least some of the neural cells interact neurologically).
  • the mutated gene is capable of causing a neurological disorder when found in a human.
  • the mutated X chromosome linked gene is capable of causing an autism spectrum disorder (e.g., autism or Rett syndrome).
  • the mutated X chromosome linked gene is a mutated X-linked gene encoding MeCP2.
  • ASD Autism and autism spectrum disorders
  • RTT Rett syndrome
  • iPSCs induced pluripotent stem cells
  • MeCP2 methyl-CpG binding protein 2
  • RTT patients' iPSCs are pluripotent in culture and able to generate proliferating neural progenitor cells and functional postmitotic neurons while displaying X-inactivation.
  • RTT iPSCs glutamatergic neurons derived from RTT iPSCs had significantly fewer synapses compared to control neurons. Moreover, we characterized significant neuronal morphological changes that may contribute to an altered network dynamics in the RTT neuronal population.
  • a human in vitro model of RTT has been generated from iPSCs from fibroblasts of a RTT patient and a control individual. The generated iPSCs-RTT surprisingly retained the capacity to generate proliferating neural progenitor cells and neurons that underwent X-inactivation. A reduced number of dendritic spines and synapses were observed in glutamatergic neurons.
  • fibroblasts Female RTT and control fibroblasts were generated from explants of dermal biopsies following informed consent under protocols approved by the University of California San Diego.
  • the Syn::EGFP or DsRed reporter vector was obtained by cloning the Synapsin-1 promoter in a lentivirus backbone.
  • the shRNA against a target sequence on the human MeCP2 gene was cloned in the LentiLox3.7 lentivirus vector.
  • Retrovirus vectors containing the Oct4, c-Myc, Klf4 and Sox2 human cDNAs from Yamanaka's group (Takahashi et al., 2007, Id.) were obtained from Addgene.
  • fibroblasts were plated on mitotically inactivated mouse embryonic fibroblasts (Chemicon) with hESC medium. After 2 weeks, iPSC colonies were directly transferred to feeder-free conditions on matrigel-coated dishes (BD) using mTeSRTM1 (StemCell Technologies), and passed manually.
  • BD matrigel-coated dishes
  • mTeSRTM1 StemCell Technologies
  • EBs embryoid bodies
  • EBs were formed by mechanical dissociation of cell clusters and plating onto low-adherence dishes in hESC medium without FGF2 for 5-7 days. After that, EBs were plated onto poly-ornithine/laminin (Sigma)-coated dishes in DMEM/F12 (Invitrogen) plus N2. Rosettes were visible to collect after 7 days.
  • Rosettes were then dissociated with accutase (Chemicon) and plated again onto coated dishes with NPC media (DMEM/F12/0.5 ⁇ N2; 0.5 ⁇ B27 and FGF2). Homogenous populations of NPCs were achieved after 1-2 passages with accutase in the same condition.
  • NPC media DMEM/F12/0.5 ⁇ N2; 0.5 ⁇ B27 and FGF2.
  • To obtain mature neurons, floating EBs were treated with 1 ⁇ M of retinoic acid for 3 more weeks (total time of differentiation 4 weeks). Mature EBs were then dissociated with Papain and DNase (Worthington) for 1 hr at 37° C. and plated in poly-ornithine/laminin-coated dishes in NPC media without FGF2.
  • RNAseA RNAseA
  • Total cellular RNA was extracted from ⁇ 5 ⁇ 10 6 cells using the RNeasy Protect Mini kit (Qiagen, Valencia, Calif.), according to the manufacturer's instructions, and reverse transcribed using the SuperScript III First-Strand Synthesis System RT-PCR from Invitrogen.
  • the cDNA was amplified by PCR using Accuprime Taq DNA polymerase system (Invitrogen).
  • the primer sequences were: hPAX6-F: 5′ acccattatccagatgtgtttgcccgag (SEQ ID NO:11) and hPAX6-R 5′ atggtgaagagggcataggeggcag (SEQ ID NO:12); hMSX1-F: 5′ cgagaggaccccgtggatgcagag (SEQ ID NO:13) and hMSX1-R: 5′ ggcggccatcttcagatctccag (SEQ ID NO:14); hKRT-18-F: tctgtggagaacgacatcca (SEQ ID NO:15) and KRT-18-R: 5′ ctgtacgtctcagctctgtga (SEQ ID NO:16); hAFP-F: 5′ aaagcccactccagcatc (SEQ ID NO:17) and hAFP-R: 5′ cagaca
  • fibroblasts or iPSCs were injected subcutaneously into the dorsal flanks of nude mice (CByJ.Cg-Foxn1nu/J) anesthetized with isoflurane.
  • nude mice CByJ.Cg-Foxn1nu/J
  • teratomas were dissected, fixed overnight in 10% buffered formalin phosphate and embedded in paraffin. Sections were stained with hematoxylin and eosin for further analysis. Control mice injected with RTT fibroblasts failed to form teratomas. Protocols were approved by the University of California San Diego Institutional Animal Care and Use Committee.
  • Xist RNA exon 6 probes (GenBank U80460: 75081-78658) were transcribed by using T7 RNA polymerase (Roche) with AlexaFluor 488-5-UTP.
  • X chromosome probe and Xist slide hybridization were performed by Molecular Diagnostic Services, Inc. (San Diego, Calif.).
  • Affymetrix Power Tools suite of programs and Affymetrix Human Gene 1.0 ST Arrays library files and annotation were obtained from the Affymetrix website.
  • Gene-level signal estimates were derived from the CEL files by RMA-sketch normalization as a method in the apt-probeset-summarize program.
  • Hierarchical clustering of the full dataset by probeset values was performed by complete linkage using Euclidean distance as a similarity metric in Matlab.
  • Neuronal networks derived from human iPSCs were previously infected with the lentiviral vector carrying the Syn::DsRed reporter construct.
  • Cell cultures were washed twice with sterile Krebs HepesHEPES Buffer (KHB) (10 mM HEPES, 4.2 mM NaHCO3, 10 mM dextrose, 1.18 mM MgSO4.2H2O, 1.18 mM KH2PO4, 4.69 mM KCl, 118 mM NaCl, 1.29 mM CaCl2; pH 7.3) and incubated with 0.2-0.5 ⁇ M Fluo-4AM (Molecular Probes/Invitrogen, Carlsbad, Calif.) in KHB for 40 minutes at room temperature.
  • KHB sterile Krebs HepesHEPES Buffer
  • Time-lapse image sequences (200 ⁇ 100 ⁇ magnification) of 5000 frames were acquired at 28 Hz with a region of 336 ⁇ 256 pixels, using a Hamamatsu ORCA-ER digital camera (Hamamatsu Photonics K.K., Hamamatsu City, Japan) with a 488 mm (FITC) filter on an Olympus IX81 inverted fluorescence confocal microscope (Olympus Optical, Tokyo, Japan). Images were acquired with MetaMorph 7.17 (MDS Analytical Technologies, Sunnyvale, Calif.). Images were subsequently processed in using ImageJ (National Instituted of Health, Washington D.C.) and Matlab 7.2 (Mathworks, Natick, Mass.).
  • ImageJ an NIH funded open source, JAVA-based morphometric application, was used to allow manual selection of individual cells on the xy-plane of each movie using circles of 4 pixels ( ⁇ 5 ⁇ m) in diameter. Each cell was considered as an individual region of interest (ROIs) and the average fluorescence intensity was calculated for each ROI in each frame using Time Series Analyzer ImageJ plugin.
  • ROIs region of interest
  • Quantitative signal analysis and processing were done in custom Matlab routines.
  • the temporal fluorescence intensity signals indicative of intracellular Ca 2+ fluctuations were filtered with low pass Gaussian filter to reduce noise. Signals were presented as relative fluorescence changes ( ⁇ F/F) after background subtraction.
  • a first-derivative filter was used to identify significant increases in calcium levels, i.e., >10 consecutive frames ( ⁇ 350 ms) with positive derivative values.
  • Non-affected control fibroblasts and cells carrying four distinct MeCP2 mutations ( FIG. 1A and Table 1 following) isolated from clinically affected female patients with RTT symptoms were infected with retroviral reprogramming vectors (Sox2, Oct4, c-Myc and Klf4), as described elsewhere. See, e.g., Takahashi et al., 2007 , Id . After 2 to 3 weeks, compact iPSC colonies emerged from a background of fibroblasts. See FIGS. 1 B 1 C. Colonies were manually picked and transferred to matrigel, as known in the art. See FIGS. 1D-1E .
  • GM11272* 1155del32 Female frameshift 1155del32 Clinically affected; classical symptoms; normal lysosomal enzymes; 46, XX in PBL; donor subject carries a frameshift mutation, 1155del32, in the gene encoding methyl-CpG binding protein 2 (MECP2).
  • MECP2 methyl-CpG binding protein 2
  • GM16548* Q244X Female nonsense 730C > T Clinically affected; abnormal sleep patterns; ambulatory; breath holding; constipation; decelerating head circumference; loss of purposeful hand use; nonverbal; poor hand and feet circulation; repetitive hand motions; self injurious behavior; small feet; teeth grinding; tremors; donor subject is heterozygous for a 730C > T transition in the MECP2 gene resulting in a stop codon.
  • GM17880* T158M Female missense 473C > T Growth and developmental delay; can walk only with assistance; nonverbal; no hand use; constant repetitive hand motions; no seizures, but significantly abnormal EEG; teeth grinding; some sleep difficulties; eating problems with minor reflux; breath holding and hyperventilation; small feet; some tremor; this culture had a lifespan of 56 population doublings (PDLs); the donor subjects carried a 473C > T transition, resulting in the substitution of threonine 158 by methionine AG09319* AG09319 Female WT — Healthy individual.
  • the karyotype is 46, XX; normal diploid female.
  • CRL2529** CRL2529 Male WT Healthy individual.
  • the karyotype is 46, XY; natrual diploid male.
  • WT-126*** 126 Male WT Healthy individual.
  • the karyotype is 46, XY; normal diploid male.
  • WT-33*** 33 Female WT Healthy individual.
  • the karyotype is 46, XX; normal diploid female.
  • WT- ARDC40 Male WT Healthy individual.
  • the ARDC40*** karyotype is 46, XY; normal diploid male. *From Coriell. **From ATCC ***From biopsies of healthy individuals.
  • FIG. 2A A protocol for neuronal differentiation is outlined in FIG. 2A .
  • Neural differentiation was initiated by plating embryoid bodies (EBs). After a week, EB-derived rosettes became apparent ( FIG. 2B ). Rosettes were then manually collected, dissociated and re-plated.
  • the NPCs neural precursor cells
  • the NPCs were positive for early neural precursor markers, such as Nestin, Sox1-2 and Musashi1 ( FIG. 2C ).
  • RA retinoic acid
  • FIG. 2D Moreover, there was detected expression of the inhibitory and excitatory neurotransmitters GABA ( ⁇ -amino butyric acid) and VGLUT1 (vesicular glutamate transporter-1), respectively. Also observed were synapsin puncta outlining Map2-positive neurites. See FIG. 2D . A significant alteration in RTT neuronal survival was not detected when compared to controls, as measured by Map2 staining. See FIGS. 2E and 8A .
  • GABA ⁇ -amino butyric acid
  • VGLUT1 vesicular glutamate transporter-1
  • both chromosomes should be active, but one X chromosome becomes silenced upon differentiation. See Dhara & Benvenisty, 2004 , Nucleic Acids Res 32:3995-4002. Similar to ESCs, female mouse iPSCs have shown reactivation of a somatically silenced X chromosome and have undergone random X-inactivation upon differentiation. See Maherali et al., 2007 , Cell Stem Cell 1:55-70.
  • MeCP2 is an X-linked gene
  • RTT-iPSCs clones described herein to reset the X chromosome (i.e., to erase X-inactivation) and whether X-inactivation would take place again after neuronal differentiation. See FIG. 3A .
  • RTT-iPSCs Some, but not all, undifferentiated RTT-iPSCs clones displayed diffuse immunoreactivity throughout the nucleus, similar to some hESCs, showing that the memory of the previous inactivation state had been erased. See FIG. 3B .
  • FISH fluorescent in situ hybridization
  • the MeCP2 protein can be detected in undifferentiated iPSCs from RTT patients. See FIG. 3F .
  • RTT-iPSC-derived neurons recapitulated X-inactivation, and the population became mosaic regarding MeCP2 expression.
  • Immunostaining was performed on several RTT-iPSC clones, and a representative example of MeCP2 expression after differentiation is shown in FIG. 3F . Clones obtained from RTT fibroblasts carrying the 1155del32 MeCP2 mutation do not produce a full-length MeCP2 protein. See Traynor et al., 2002, BMC Medical Genetics 3:12.
  • FIGS. 9A-9F The data depicted in FIGS. 9A-9F are summarized in Table 3 following, with naming scheme as follows: FIG. 9A : XI_63846, XI_63846_HapII; FIG. 9B : XI_57216, XI_57216_HapII; FIG. 9C : XI_20000, XI_20000_HapII; FIG.
  • FIG. 9D XI_NoDNA, XI_NoDNA_HapII
  • FIG. 9E XI_GM11272Fibro, XI_GM11272_HapII
  • FIG. 9F XI_GM11272Neuron, XI_GM11272Neuron_HapII.
  • the present data show that X-inactivation was erased in selected reprogrammed RTT-iPSCs clones and subsequently restored during neuronal differentiation. Importantly, the recapitulation of X-inactivation produces mosaic neuronal cultures with different ratios of cells expressing normal MeCP2 levels, mimicking what is observed in RTT patients' brains. The data do not preclude that partial reprogramming from a single fibroblast or retention of the X-inactivation would lead to clones with highly skewed X-inactivation, where neurons would express only the normal or mutant form of MePC2. In fact, we do observe WT and RTT-iPSC clones retaining X-inactivation after reprogramming. The RTT-T158M C3-derived neurons showed 100:0 distribution. The expression of the mutant MeCP2 allele was confirmed by sequencing.
  • NPCs derived from RTT-iPSCs, WT-iPSCs and hESCs were generated and kept under proliferating conditions in the presence of FGF2.
  • NPCs derived using the protocol described herein had identical passage numbers and were analyzed for cell cycle by flow cytometry. Our results showed no significant differences in any cycle phase between HESC-, WT-iPSC- and RTT-iPSC-derived NPCs ( FIG. 4A ), though we cannot exclude the possibility that altered head growth in RTT patients is caused by eventual abnormal NPC proliferation in another developmental stage.
  • VGLUT1 puncta were mostly adjacent to the postsynaptic density-95 (Psd95) protein (Niethammer et al., 1996 , J Neurosci 16:2157-2163). See FIG. 10A .
  • RTT neurons displayed any morphological alteration when compared to controls.
  • RTT patient-derived neurons display changes in neuronal morphology and in number of synapses, which belief prompted us, e.g., to explore putative circuit alterations in vitro.
  • FIGS. 11A, 11B, 11D Gabazine, an antagonist of GABAa receptors, increased the number of calcium transients in the networks, indicating the presence of glutamatergic and gabaergic synapses in our system. See FIGS. 11C-11D .
  • a representative example of calcium tracing in control and RTT neurons is depicted in FIG. 5A and shows a sharp increase in amplitude followed by a decrease over time.
  • the frequency of calcium oscillations in RTT neurons and in WT neurons expressing shMeCP2 was abnormally decreased when compared to controls, suggesting a deficiency in the neuronal network connectivity and activity dynamics. See FIGS. 5B-5C and FIGS. 11E and 11F .
  • the deficiency in connectivity was further corroborated by a decrease in the percentage of Syn::DsRed-positive neurons exhibiting calcium transients in the RTT cultures when compared to controls. See FIG. 5D and FIG. 11F .
  • the functional maturation of the iPSC-derived neurons was further determined using electrophysiological methods.
  • Whole-cell recordings were performed from cells that had differentiated for at least 6 weeks in culture. Neurons were visualized by infection with the Syn::EGFP viral vector. See FIG. 6A .
  • Both WT and RTT neurons showed similar transient sodium inward currents, sustained potassium outward currents in response to voltage step depolarizations, and action potentials evoked by somatic current injections. See FIG. 6B . Therefore, the data indicate that WT and RTT reprogramming did not affect the ability of WT-iPSC- and RTT-iPSC-derived neurons to mature and become electrophysiologically active.
  • Spontaneous excitatory and inhibitory postsynaptic currents were recorded as a way of measuring intercellular connectivity and network formation. See FIGS. 6B-6C . Cumulative probability plots of amplitudes and inter-event intervals of spontaneous postsynaptic currents revealed that RTT neurons have a significant decrease in frequency and amplitude when compared to WT neurons. See FIGS. 6D-6E . Together, our data suggest that the neuronal network is altered in RTT iPSC-derived cultures.
  • RTT iPSCs are pluripotent and able to recapitulate X-inactivation upon neuronal differentiation. Even though the ratio of neurons expressing mutant MeCP2 due to X-inactivation was variable, the phenotypes described here for all RTT-derived neurons are similar.
  • One interpretation could be that astrocytes, or other non-neuronal cells, carrying MeCP2 mutations present in our cultures could also affect neurons expressing the normal MeCP2 protein. In fact, the non-cell autonomous influence was recently described for RTT, indicating that glial cells carrying MeCP2 mutations can distress healthy neurons.
  • RTT glutamatergic neurons have a reduced number of synapses and dendritic spines when compared to non-affected controls.
  • electrophysiological recordings from RTT neurons showed a significant decrease in the frequency and amplitude of spontaneous synaptic currents compared to WT neurons.
  • the reduced frequency in RTT neurons could reflect the presence of fewer release sites or a decreased release probability.
  • the results of electrophysiology recordings are consistent with the decreased V-GLUT1 puncta observed in Map2-positive dendrites from RTT neurons.
  • the frequency of intracellular calcium transients was decreased in RTT neurons when compared to controls.
  • Our data indicate a potential imbalance in the neuronal networks associated with RTT pathology. The observations described here provide valuable information for RTT and, potentially, ASD patients, since they suggest that pre-symptomatic defects may represent novel biomarkers to be exploited as diagnostic tools and that early intervention may be beneficial.
  • IGF1 is considered to be a candidate for pharmacological treatment of RTT and potentially other CNS disorders in a future clinical trial. See Tropea et al., Id . While IFG1 treatment increased synapse number in some clones, it stimulated glutamatergic RTT neurons above normal levels. Our data indicate that the IGF1 dose and timing parameters need to be precisely tuned in future clinical trials to avoid side effects. In a different approach, we tested a read-through drug (gentamicin) to rescue neurons derived from iPSCs carrying a nonsense MeCP2 mutation. A lower dosage of gentamicin was enough to increase full-length MeCP2 levels in RTT neurons, rescuing glutamatergic synapses.
  • gentamicin read-through drug
  • MeCP2 is indeed the causative agent of the cellular phenotypes reported here that might be relevant to the clinical features of RTT.
  • the present data indicate that iPSCs not only can recapitulate some aspects of a genetic disease but also can be used to better design and anticipate results from translational medicine.
  • This cellular model has the potential to lead to the discovery of new compounds to treat RTT and other forms of ASD.
  • other CNS diseases may be modeled in vitro using a similar approach.
  • RTT-iPSCs retain the capacity to generate proliferating neural progenitor cells (NPCs) and functional neurons that undergo X-inactivation.
  • NPCs neural progenitor cells
  • Gain and loss of function experiments in iPSC-derived neurons confirmed that some of the alterations observed were related to MeCP2 expression levels.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Provided herein are methods and compositions useful in treating neurological disorders.

Description

CROSS-REFERENCES TO RELATED APPLICATIONS
This application is a national phase application of PCT Application No. PCT/US2010/062080, filed Dec. 23, 2010, which claims the benefit of U.S. Provisional Application No. 61/289,863, filed Dec. 23, 2009, all of which are incorporated herein by reference in their entirety and for all purposes.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with Government support under grant 1-DP2-OD006495-01 awarded by the National Institutes of Health.
BACKGROUND OF THE INVENTION
Autism spectrum disorders (ASD) are complex neurodevelopmental diseases affecting 1 in 150 children in the United States See e.g., MMWR Surveill Summ 56 (1):1-11 (2007). Such diseases are mainly characterized by impaired social interaction and repetitive behavior. Family history and twin studies suggest that, in some cases, these disorders share genetic roots, but the degree to which environmental and genetic patterns account for individual differences within ASD is currently unknown. See e.g., Piven, J. et al., 1997, The American Journal of Psychiatry 154 (2):185-190; Ronald, A. et al., 2006, J Am Acad Child Adolesc Psychiatry 45 (6):691-699. Several reports suggest that many autistic patients have novel genetic alterations, such as SNPs, deletions and duplications in their genomes. See e.g., Sebat, J. et al., 2007, Science 316(5823):445-449; Glessner, J. T. et al., 2009, Nature 459:1461-1465. A different combination of genetic mutations is likely to play a role in each individual. Nevertheless, the study of mutations in specific genes can help to identify molecular mechanisms responsible for subtle alterations in the nervous system, pointing to common mechanisms for ASD.
Rett syndrome (RTT) is a progressive neurological disorder caused by mutations in the X-linked gene encoding MeCP2 protein. See e.g., Amir, R. E. et al. 1999, Nat Genet 23 (2):185-188. RTT patients have a large spectrum of autistic characteristics and are considered part of the ASD population. See e.g., Samaco, R. C. et al., 2004, Hum Mol Genet 13 (6):629-639; Zappella, M. et al., 2003, Am J Med Genet B Neuropsychiatr Genet 119 (1):102-107; Hammer, S. et al., 2002, Ment Retard Dev Disabil Res Rev 8(2):94-98; Samaco, R. C. et al., 2005, Hum Mol Genet 14 (4):483-492. These individuals undergo apparently normal development until 6-18 months of age, followed by impaired motor function, stagnation and then regression of developmental skills, hypotonia, seizures and autistic behavior. See e.g., Amir, R. E. et al, 1999, Id.; Amir, R. E. & Zoghbi, H. Y., 2000, Am J Med Genet 97 (2):147-152. MeCP2 may be involved in the epigenetic regulation of target genes, by binding to methylated CpG dinucleotides within promoters, and may function as a transcriptional repressor, although this view has been challenged recently. See e.g., Yasui, D. H. et al., 2007, Proc Natl Acad Sci USA 104 (49):19416-19421; Chahrour, M. et al., 2008, Science 320 (5880):1224-1229. Without wishing to be bound by any theory, it is believed that genes misregulated by MeCP2 mutations are probably responsible for the phenotypic abnormalities observed rather than the MeCP2 gene itself. However, microarray analyses comparing gene expression in RTT patients or RTT mouse models to wild type (WT) controls have failed to identify many genes with robust changes in gene expression. See, e.g., Traynor, J. et al., 2002, BMC Medical Genetics 3:12; Tudor, M. et al., 2003, Proc Natl Acad Sci USA 99(24):15536-15541. Such subtle gene expression changes will probably target genes expressed only in specific brain regions or neurons that are, therefore, being masked in the analyses of entire brain regions. In support of this argument, a recent study revealed changes in the expression levels of thousands of genes by focusing on mouse hypothalamus only instead of whole brain. See Chahrour, M. et al., 2008, Science 320(5880):1224-1229. It is further believed that such analysis may not determine the affected cell type due to cellular heterogeneity. Furthermore, MeCP2 regulation of target genes is very likely developmental-stage specific. Finally, the majority of the work has been focused on mouse models of RTT or postmortem brain samples, and an in vitro human developmental model of RTT has been lacking.
Pluripotent human embryonic stem cells (hESCs) have been successfully generated from early stage human embryos and can differentiate into various cell types. See, e.g., Thomson, J. A. et al., 1998, Science 282(5391):1145-1147. However, to develop cellular models of human disease, it is necessary to generate cell lines with genomes pre-disposed to diseases. Recently, reprogramming of somatic cells to a pluripotent state by over-expression of specific genes (induced pluripotent stem cells, iPSCs) has been accomplished. See, e.g., Takahashi, K. & Yamanaka, S., 2006, Cell 126(4):663-676; Takahashi, K. et al., 2007, Cell 131 (5):861-872; Yu, J. et al., 2007, Science 318(5858):1917-1920. Resultant iPSCs are isogenic to the donor individual, i.e., they carry the identical genetic background. Isogenic pluripotent cells are attractive not only for their potential therapeutic use with lower risk of immune rejection but also for understanding complex diseases. See, e.g., Marchetto et al., 2010, Cell 143:527-539; Muotri, A. R., 2009, Epilepsy Behav 14:Suppl. 1, 81-85. Although iPSCs have been generated for several neurological diseases (Dimos et al., 2008, Science 321:1218-1221; Ebert et al., 2009, Nature 457:277-280; Hotta et al., 2009, Nat. Methods 6:370-376; Lee et al., 2009, Nature 461:402-406; Park et al., 2008, Cell 134:877-886; Soldner et al., 2009, Cell 136:964-977), the demonstration of disease-specific pathogenesis and phenotypic rescue in relevant cell types is a current challenge in the field (Marchetto et al. 2010, id).
Thus, there is a need in the art for methods and compositions useful in identifying compounds useful in treating a neurological disorder. The present invention addresses these and other needs in the art.
BRIEF SUMMARY OF THE INVENTION
In one aspect, an X chromosome inactivated female human neural cell derived from an induced pluripotent stem cell is provided.
In another aspect, a plurality of X chromosome inactivated female human neural cells are provided that are derived from a plurality of induced pluripotent stem cells. The X chromosome inactivated female human neural cells can be neural progenitor cells or neuronal cells. Each of the X chromosome inactivated female human neural cells includes a first X chromosome and a second X chromosome. The second X chromosome includes a mutated gene, where a portion of the plurality of X chromosome inactivated female human neural cells include an inactive first X chromosome and an active second X chromosome and another portion of the plurality of X chromosome inactivated female human neural cells include an active first X chromosome and an inactive second X chromosome.
In another aspect, a method of identifying a compound useful in treating a neurological disorder is provided. The method includes contacting a test compound with a plurality of X chromosome inactivated female human neural cells (e.g. as described in the preceding paragraph). The level of neurological functionality of the plurality of X chromosome inactivated female human neural cells is determined. The level of neurological functionality of the plurality of X chromosome inactivated female human neural cells in the presence of the test compound is compared to a control thereby identifying a compound useful in treating a neurological disorder.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1. Generation of iPSCs . FIG. 1A: Schematic representation of the MeCP2 gene structure and mutations as described herein. UTR, untranslated region; MBD, methyl-CpG binding domain; NLS, nuclear localization signal; Poly-A, polyadenylation signal; TRD, transcriptional repression domain; WW, domain containing WW (two tryptophans); X, stop codon. Respective cell lines codes are shown close to their mutations. FIG. 1B: Morphology of human fibroblasts before retroviral infection. FIG. 1C: Aspect of iPSCs colonies 14 days after infection. FIGS. 1D-1E: Representative images of established iPSC colonies as described herein. FIGS. 1F-1G: Representative images of RTT-iPSCs showing expression of pluripotent markers Dapi, Nanog, Tra-1-81 and merge (FIG. 1F), and Dapi, Lin28, Sox2 and merge (FIG. 1G). FIG. 1H: No karyotypic abnormalities were observed. FIG. 1I: Representative images of teratoma sections depicting endoderm, mesoderm and ectoderm in WT-iPSC and RTT-iPSC. Bar=100 μm. See also FIG. 7.
FIG. 2. Neural differentiation of iPSCs. FIG. 2A: Schematic view of a neural differentiation protocol described herein. FIG. 2B: Representative images depicting morphological changes during neuronal differentiation. Bar=100 μm. FIG. 2C: NPCs are positive for neural precursor markers: Sox1, Sox2, Musashi1 and Nestin. Bar=50 μm. FIG. 2D: Representative images of cells after neuronal differentiation. iPSC-derived neurons express mature neuronal markers: GABA, Map2 and Synapsin. Bar=20 μm. Similar numbers of Map2-positive and Syn::DsRed-positive (FIG. 2E) as well as GABA-positive (FIG. 2F) neurons from WT and RTT cultures. Data shown as mean±s.e.m. See also FIG. 8.
FIG. 3. RTT-iPSC clones undergo X-inactivation during differentiation. FIG. 3A: Schematic representation of X-inactivation dynamics during reprogramming and further neural differentiation. RTT fibroblasts are mosaic for the MeCP2 WT gene expression. During reprogramming, X-inactivation is erased and iPSCs express both MeCP2 alleles. Upon neuronal differentiation, X-inactivation is re-established and the resultant cells are mosaic for MeCP2 WT gene expression. 3B: Immunofluorescence for me3H3K27 in fibroblasts, pluripotent cells (Nanog-positive) and after neuronal differentiation (Syn::EGFP-positive). Pluripotent cells (hESCs and iPSCs) show diffuse staining whereas differentiated cells (fibroblasts and neurons) exhibit prominent me3H3K27 nuclear foci (arrowheads). Cells were counterstained with Dapi. Bar=15 μm. FIG. 3C: Quantification of cells as indicated with diffuse or foci me3H3K27 nuclear staining. Data shown as mean±s.e.m. FIG. 3D: RNA FISH shows that Xist RNA domains are present in the original fibroblasts before reprogramming. iPSCs show no Xist expression. Neurons derived from normal and RTT iPSCs show clear Xist clouds, indicating transcriptional silencing of the X chromosome (arrows). Bar=5 μm. FIG. 3E: Two DNA FISH signals are evident in the nuclei of iPSC-derived NPCs and neurons, revealing the presence of two X chromosomes. Bar=10 μm. FIG. 3F: RTT-iPSCs (1155del32) expressed WT MeCP2 but derived neurons displayed mosaicism regarding WT (arrowhead) and mutant (arrow) MeCP2 forms. Bar=50 μm. FIG. 3G: RTT-derived fibroblasts and neurons have reduced levels of WT MeCP2 protein by Western blot. See also FIG. 9.
FIG. 4. Alterations in RTT neurons. FIG. 4A: Proliferating RTT NPCs displayed no signal of aberrant cell cycle when compared to controls. X-axis of histogram FIG. 4A in order (left to right): hESC; WT-NPC; RTT-NPC. FIG. 4B: Representative images of neurons showing VGLUT1 puncta on Map2 neurites. Histogram (right panel) shows synaptic density in RTT and WT neurons. IGF1 treatment increased VGLUT1 puncta number in RTT-derived neurons. Bar=5 μm. X-axis of histogram FIG. 4B in order (left to right): WT; RTT; WT+IGF1; RTT+IGF1. FIG. 4C: Reduction of MeCP2 expression decreased the number of glutamatergic synapses in WT neurons. X-axis of histogram FIG. 4C in order (left to right): WT; WT+ShControl; WT+ShMeCP2. FIG. 4D: Overexpression of MeCP2 increased the number of glutamatergic synapses. X-axis of histogram FIG. 4D in order (left to right): WT+Vector; WT+MeCP2; RTT+Vector; RTT+MeCP2. FIG. 4E: Representative images of neurites of different genetic backgrounds. Histogram (right panel) shows the spine density from independent experiments using different RTT backgrounds and controls and after expression of shMeCP2. Bar=5 μm. X-axis of histogram FIG. 4E in order (left to right): WT-AG09319 C2; RTT-1155del32 C18; WT-126 C8; RTT-Q244X C3; WT-126 C8+ShControl; WT-126 C8+ShMeCP2. 4F: Representative images of neuronal cell body size. Histogram (right panel) shows the percentage of soma size decrease in RTT compared to WT neurons. Neuronal morphology was visualized using the Syn::EGFP lentiviral vector. Bar=50 μm. X-axis of histogram FIG. 4F in order (left to right): WT; RTT; WT+shMeCP2. FIG. 4G: A lower dose of gentamicin was able to rescue glutamatergic synapses in RTT neurons. X-axis of histogram FIG. 4G in order (left to right): WT; WT+Genta (400 ug/ml); RTT; RTT+Genta (400 ug/ml); RTT+Genta (100 ug/ml). Numbers of neurons analyzed (n) are shown within the bars in graphs (FIG. 4E) and (FIG. 4G). For all clones and mutations used, refer to FIG. 10 and Tables 2.1 and 2.2. Data shown as mean±s.e.m.
FIG. 5. Altered activity-dependent calcium transients in RTT-derived neurons. FIG. 5A: Representative examples of WT (upper) and RTT (lower) calcium signal traces. Observed traces correspond to the calcium rise phase detected by the algorithm used. FIG. 5B: Fluorescence intensity changes reflecting intracellular calcium fluctuations in RTT and WT neurons in different Regions of Interest (ROI). FIG. 5C: RTT neurons show a lower average of calcium spikes when compared to WT control neurons. FIG. 5D: The percentage of Syn::DsRed-positive neurons signaling in the RTT neuronal network is significantly reduced when compared to controls. X-axis of histograms FIGS. 5C-5D in order (left to right): WT; RTT; WT+ShMeCP2. Data shown as mean±s.e.m. See also FIG. 11.
FIG. 6. Decreased frequency of spontaneous postsynaptic currents in RTT neurons. FIG. 6A: Fluorescence micrographs of representative WT (left) and RTT (right) neurons. Bar=10 μm. FIG. 6B: Electrophysiological properties of WT and RTT neurons. From top to bottom: Transient Na+ currents and sustained K+ currents in response to voltage step depolarizations (command voltage varied from −20 to +30 mV in 5 mV increments when cells were voltage-clamped at −70 mV, Bars=400 pA and 50 ms). Action potentials evoked by somatic current injections (cells current-clamped at around −60 mV, injected currents from 10 to 40 pA, Bars=20 mV and 100 ms), sEPSCs (Bars=right, 20 pA, 100 ms; left: 10 pA, 500 ms), and sIPSCs (Bars=right, 20 pA, 500 ms; left: 20 pA, 400 ms). FIG. 6C: Sample 4-min recordings of spontaneous currents in WT (upper) and RTT (lower) when the cells were voltage-clamped at −70 mV (Bars=20 pA and 25 s). FIG. 6D: Cumulative probability plot of amplitudes (left panel, 1 pA bins; p<0.001) and inter-event intervals (right panel, 20 ms bins; p<0.05) of sEPSCs from groups of WT and RTT cells, respectively. FIG. 6E: Cumulative probability plot of amplitudes (left panel, 1 pA bins; p<0.05) and inter-event intervals (right panel, 20 ms bins; p<0.05) of sIPSCs from each group (WT and RTT).
FIG. 7. Generation of iPSCs derived from RTT patients' fibroblasts carrying distinct mutations in the MeCP2 gene; related to FIG. 1. FIG. 7A: Morphology of fibroblasts before retroviral infection. FIG. 7B: Aspect of iPSCs colonies growing in the absence of feeder layer. Colonies are compact and have well-defined borders. Cells display high nucleus-to-cytoplasm ratio and are morphologically similar to hESCs. FIG. 7C: Representative immunofluorescence analysis of RTT-iPSC clones. Expression of pluripotent markers such as Nanog and Tra-1-81 is observed. Bar=100 μm. Y-axis labels for FIGS. 7B-7C are as indicated for FIG. 7A. FIG. 7D: Hierarchical clustering and correlation coefficients of microarray profiles of triplicate WT Fibroblasts, RTT Fibroblasts, WT-iPSC clone 1, WT-iPSC clone 2, RTT-iPSC clones 15 and 18 (1155del32), RTT-iPSC clones 1 and 2 (Q244X) and the hESC line HUES6. Shade indicates the level of correlation (from 0 to 1), with bar reporting log 2 normalized expression values. FIG. 7E: Reprogrammed iPSCs showed expressions similar to hESC-enriched genes (Lin28, CXADR, Nanog and PTRZ1; black bars) and showed distinct differences from fibroblast-enriched genes (GREM1, MMP1, DKK1 and PTX3; white bars). Legend: for each histogram of FIG. 7E, the X-axis species appear in the order (left to right): HUES6; Fibroblast WT; Fibroblast RTT; iPSC-WT cl (clone) 1; iPSC-WT cl 2; iPSC-RTT cl 15; iPSC-RTT cl 18. FIG. 7F: RT-PCR from reprogrammed iPSCs showed endogenous expressions of hESC-enriched genes (Oct4, Sox2 and Nanog) but not from a fibroblast-enriched gene (Msx1). Lanes in FIG. 7F in order (left to right): (iPSC) GAPDH; Oct4; Sox2; Nanog; Msx1; (Fibroblast) GAPDH; Oct4; Nanog; Msx1.
FIG. 8. Neuronal differentiation from individual WT and RTT-iPSC clones; related to FIG. 2. Clones from WT and RTT-iPSCs were differentiated into neurons for approximately 1 month. FIG. 8A: Neurons were stained with the Map2 neuronal marker. Order of X-axis entries for histogram FIG. 8A: WT-AG09319 C1; WT-ADRC40; WT-33 C1; WT-126 C5; WT-126 C8; RTT-1155del32 C15; RTT-1155del32 C18; RTT-Q244X C3; RTT-Q244X C4; RTT-T158M C3. FIG. 8B: Neurons were infected with a lentiviral vector expressing the DsRed reporter under the control of the Synapsin promoter region. Order of X-axis entires for histogram FIG. 8B: WT-33 C1; WT-126 C8; RTT-1155del32 C15; RTT-1155del32 C18; RTT-Q244X C3. FIG. 8C: Inhibitory neurons were revealed in the cultures after staining with anti-GABA antibody. Each bar represents 3 independent experiments for each individual clone. Order of X-axis entries for histogram FIG. 8C: WT-AG09319 C1; WT-33 C1; WT-126 C8; RTT-1155del32 C15; RTT-Q244X C3; RTT-T158M C3. Data shown as mean±s.e.m.
FIG. 9. Androgen receptor analysis; related to FIG. 3. Example of X-inactivation analysis using the X-linked androgen receptor locus for the RTT-1155del32 C15 genomic DNA. After the PCR, two different sized amplicons were detected (different peaks) and digested with a methylation-sensitive restriction enzyme (HpaII). The PCR using undigested DNA shows if two distinct alleles are present and also allows a correction factor due to the advantage on the amplification of the smaller allele. When the template DNA is digested, amplification occurs if the restriction sites are methylated. If the site is unmethylated, digestion will occur between the flanking oligonucleotides and amplification will not be possible. The peak areas after HpaII restriction digestion of genomic DNA are used to distinguish each parental X chromosome. FIG. 9A: When random inactivation is present, the maternal and paternal alleles are represented at similar proportions. FIG. 9B: In contrast, in a condition where non-random inactivation is present, the more commonly inactive allele will be preferentially amplified and this will be detected by a stronger peak. FIG. 9C: A male control is displayed showing a single peak before HpaII digestion. FIG. 9D: A PCR was run without DNA template as a control. FIG. 9E: Fibroblasts carrying the 1155del32 MeCP2 mutant (GM11272) displayed random X-inactivation. FIG. 9F: RTT-1155del32-derived neurons showed highly skewed X-inactivation.
FIG. 10. Phenotypic analysis iPSC-derived neurons from several clones; related to FIG. 4. FIG. 10A: Representative images showing co-localization between VGLUT1 and Psd95 (arrows). Bar=5 μm. FIG. 10B: Experimental and clonal variation of VGLUT1 puncta quantification in different individuals. The order of histogram entries is as provided in the figures. FIG. 10C: Efficient expression and knockdown of both MeCP2 isoforms by a specific shRNA against MeCP2. Bar=50 μm. Two alternatively spliced MeCP2 transcripts have been characterized, isoforms A and B, which differ only in their most 5′ regions. The MeCP2 isoform B is more prevalent in the brain and during neuronal differentiation. FIG. 10D: Histogram shows cell soma radius for several RTT and WT clones, as indicated in the figure. FIG. 10E: WT MeCP2 protein levels detected in control and RTT neurons (Q244X). Gentamicin treatment in RTT neurons increased protein levels after 2 weeks. Numbers of neurons analyzed (n) are shown within the bars in graphs (FIG. 10B) and (FIG. 10D). Order of X-axis entries for histogram of FIG. 10E (right panel): WT; RTT; RTT+Genta. Data shown as mean±s.e.m.
FIG. 11. Calcium transient analysis in iPSC-derived neurons; related to FIG. 5. Neurons were selected after the confirmation that calcium transients were blocked with 1 μM of TTX or the glutamate receptor antagonists CNQX/APV treatments. FIG. 11A: Blocking glutamatergic signaling in the neuronal network using CNQX and APV resulted in significant reduction in intracellular calcium transients. FIG. 11B: Blocking voltage-gated sodium channels using TTX prohibited the generation of action potentials and resulted in complete elimination of neuronal intracellular calcium transients. FIG. 11C: Gabazine increased the number of calcium transients in the iPSC-derived neuronal networks. Traces correspond to the calcium rise phase detected by the algorithm used. FIG. 11D: Histogram shows the normalized frequency of neurons with calcium transients after drug treatments. Order of histogram entries (left to right): KHB; +TTX; +CNQX/APV; +Gabazine. FIG. 11E: Histogram shows the event frequency decrease in RTT and shMeCP2-treated WT neurons compared to WT controls neurons. Order of histogram entries (left to right): WT-33 C1; WT-126 C8+ShControl; RTT-1155del32 C15; RTT=1155del32 C18; RTT=Q244X C3; WT-126 C8+ShMeCP2. FIG. 11F: Bar graph shows the percentage of signaling neurons in RTT and shMeCP2-treated WT neurons compared to WT control neurons. Order of histogram entries (left to right): as in FIG. 11E.
DETAILED DESCRIPTION OF THE INVENTION I. Definitions
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley & Sons (New York, N.Y. 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, N.Y. 1989). Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
“Nucleic acid” refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, and complements thereof.
The words “complementary” or “complementarity” refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
The terms “identical” or percent “identity,” in the context of two or more nucleic acids, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection. See, e.g., the NCBI web site or the like. Such sequences are then said to be “substantially identical.” This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
The phrase “stringent hybridization conditions” refers to conditions under which a probe will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but to not other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY—HYBRIDIZATION WITH NUCLEIC PROBES, “Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or, 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 65° C.
A variety of methods of specific DNA and RNA measurement that use nucleic acid hybridization techniques are known to those of skill in the art (see, Sambrook, Id.). Some methods involve electrophoretic separation (e.g., Southern blot for detecting DNA, and Northern blot for detecting RNA), but measurement of DNA and RNA can also be carried out in the absence of electrophoretic separation (e.g., by dot blot).
The sensitivity of the hybridization assays may be enhanced through use of a nucleic acid amplification system that multiplies the target nucleic acid being detected. Examples of such systems include the polymerase chain reaction (PCR) system and the ligase chain reaction (LCR) system. Other methods recently described in the art are the nucleic acid sequence based amplification (NASBA, Cangene, Mississauga, Ontario) and Q Beta Replicase systems. These systems can be used to directly identify mutants where the PCR or LCR primers are designed to be extended or ligated only when a selected sequence is present. Alternatively, the selected sequences can be generally amplified using, for example, nonspecific PCR primers and the amplified target region later probed for a specific sequence indicative of a mutation. It is understood that various detection probes, including Taqman® and molecular beacon probes can be used to monitor amplification reaction products, e.g., in real time.
The word “polynucleotide” refers to a linear sequence of nucleotides. The nucleotides can be ribonucleotides, deoxyribonucleotides, or a mixture of both. Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA (including miRNA), and hybrid molecules having mixtures of single and double stranded DNA and RNA.
The words “protein”, “peptide”, and “polypeptide” are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers.
The term “gene” means the segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene. Further, a “protein gene product” is a protein expressed from a particular gene.
The word “expression” or “expressed” as used herein in reference to a gene means the transcriptional and/or translational product of that gene. The level of expression of a DNA molecule in a cell may be determined on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell (Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88).
Expression of a transfected gene can occur transiently or stably in a cell. During “transient expression” the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time. In contrast, stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell.
The term “plasmid” refers to a nucleic acid molecule that encodes for genes and/or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, gene and regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids.
A “vector” is a nucleic acid that is capable of transporting another nucleic acid into a cell. A vector is capable of directing expression of a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment.
A “viral vector” is a viral-derived nucleic acid that is capable of transporting another nucleic acid into a cell. A viral vector is capable of directing expression of a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors.
A “cell culture” is a population of cells residing outside of an organism. These cells are optionally primary cells isolated from a cell bank, animal, or blood bank, or secondary cells that are derived from one of these sources and have been immortalized for long-lived in vitro cultures.
A “stem cell” is a cell characterized by the ability of self-renewal through mitotic cell division and the potential to differentiate into a tissue or an organ. Among mammalian stem cells, embryonic and somatic stem cells can be distinguished. Embryonic stem cells reside in the blastocyst and give rise to embryonic tissues, whereas somatic stem cells reside in adult tissues for the purpose of tissue regeneration and repair.
The term “pluripotent” or “pluripotency” refers to cells with the ability to give rise to progeny that can undergo differentiation, under appropriate conditions, into cell types that collectively exhibit characteristics associated with cell lineages from the three germ layers (endoderm, mesoderm, and ectoderm). Pluripotent stem cells can contribute to tissues of a prenatal, postnatal or adult organism. A standard art-accepted test, such as the ability to form a teratoma in 8-12 week old SCID mice, can be used to establish the pluripotency of a cell population. However, identification of various pluripotent stem cell characteristics can also be used to identify pluripotent cells.
“Pluripotent stem cell characteristics” refer to characteristics of a cell that distinguish pluripotent stem cells from other cells. Expression or non-expression of certain combinations of molecular markers are examples of characteristics of pluripotent stem cells. More specifically, human pluripotent stem cells may express at least some, and optionally all, of the markers from the following non-limiting list: SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, TRA-2-49/6E, ALP, Sox2, E-cadherin, UTF-1, Oct4, Lin28, Rex1, and Nanog. Cell morphologies associated with pluripotent stem cells are also pluripotent stem cell characteristics.
The term “reprogramming” refers to the process of dedifferentiating a non-pluripotent cell into a cell exhibiting pluripotent stem cell characteristics.
The term “treating” means ameliorating, suppressing, eradicating, and/or delaying the onset of the disease being treated.
The terms “induced pluripotent stem cell,” “iPS,” “iPSC” and the like refer to a pluripotent stem cell artificially derived from a non-pluripotent cell. A “non-pluripotent cell” can be a cell of lesser potency to self-renew and differentiate than a pluripotent stem cell. Cells of lesser potency can be, but are not limited to adult stem cells, tissue specific progenitor cells, primary or secondary cells. An adult stem cell is an undifferentiated cell found throughout the body after embryonic development. Adult stem cells multiply by cell division to replenish dying cells and regenerate damaged tissue. Adult stem cells have the ability to divide and create another cell like itself and also divide and create a cell more differentiated than itself. Even though adult stem cells are associated with the expression of pluripotency markers such as Rex1, Nanog, Oct4 or Sox2, they do not have the ability of pluripotent stem cells to differentiate into the cell types of all three germ layers. Adult stem cells have a limited potency to self renew and generate progeny of distinct cell types. Without limitation, an adult stem cell can be a hematopoietic stem cell, a cord blood stem cell, a mesenchymal stem cell, an epithelial stem cell, a skin stem cell or a neural stem cell. A tissue specific progenitor refers to a cell devoid of self-renewal potential that is committed to differentiate into a specific organ or tissue. A primary cell includes any cell of an adult or fetal organism apart from egg cells, sperm cells and stem cells. Examples of useful primary cells include, but are not limited to, skin cells, bone cells, blood cells, cells of internal organs and cells of connective tissue. A secondary cell is derived from a primary cell and has been immortalized for long-lived in vitro cell culture.
A “somatic cell” is a cell forming the body of an organism. Somatic cells include cells making up organs, skin, blood, bones and connective tissue in an organism, but not germline cells.
The teen “transfection” or “transfecting” is defined as a process of introducing nucleic acid molecules to a cell by non-viral or viral-based methods. The nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof.
Non-viral methods of transfection include any appropriate transfection method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell. Exemplary non-viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection and electroporation. In some embodiments, the nucleic acid molecules are introduced into a cell using electroporation following standard procedures well known in the art. For viral-based methods of transfection any useful viral vector may be used in the methods described herein. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors. In some embodiments, the nucleic acid molecules are introduced into a cell using a retroviral vector following standard procedures well known in the art.
Expression of a transfected gene can occur transiently or stably in a cell. During “transient expression” the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time. In contrast, stable expression of a transfected gene can occur when the gene is co-transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell. Expression of a transfected gene can further be accomplished by transposon-mediated insertion into the host genome. During transposon-mediated insertion the gene is positioned between two transposon linker sequences that allow insertion into the host genome as well as subsequent excision.
The term “Yamanaka factors” refers to Oct3/4, Sox2, Klf4, and c-Myc, which factors are highly expressed in embryonic stem (ES) cells. Without wishing to be bound by any theory, it is believed that over-expression of the Yamanaka factors can induce pluripotency in somatic cells from a variety of species, e.g., mouse and human somatic cells. See, e.g., Yamanaka, 2009, Cell 137: 13-17.
A “KLF4 protein” as referred to herein includes any of the naturally-occurring forms of the KLF4 transcription factor, or variants thereof that maintain KLF4 transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to KLF4). In some embodiments, variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring KLF4 polypeptide (e.g., SEQ ID NO:1). In other embodiments, the KLF4 protein is the protein as identified by the NCBI reference gi:194248077 (SEQ ID NO:1).
An “OCT4 protein” as referred to herein includes any of the naturally-occurring forms of the Octomer 4 transcription factor, or variants thereof that maintain Oct4 transcription factor activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Oct4). In some embodiments, variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Oct4 polypeptide (e.g., SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4). In other embodiments, the Oct4 protein is the protein as identified by the NCBI reference gi:42560248 corresponding to isoform 1 (SEQ ID NO:2), gi:116235491 and gi:291167755 corresponding to isoform 2 (SEQ ID NO:3 and SEQ ID NO:4).
A “Sox2 protein” as referred to herein includes any of the naturally-occurring forms of the Sox2 transcription factor, or variants thereof that maintain Sox2 transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Sox2). In some embodiments, variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Sox2 polypeptide (e.g., SEQ ID NO:5). In other embodiments, the Sox2 protein is the protein as identified by the NCBI reference gi:28195386 (SEQ ID NO:5).
A “cMYC protein” as referred to herein includes any of the naturally-occurring forms of the cMyc transcription factor, or variants thereof that maintain cMyc transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to cMyc). In some embodiments, variants have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring cMyc polypeptide (e.g., SEQ ID NO:6). In other embodiments, the cMyc protein is the protein as identified by the NCBI reference gi:71774083 (SEQ ID NO:6).
The term “feeder-free” refers to the absence of feeder cells. The term “feeder cell” is generally well known in the art and includes all cells used to support the propagation of stem cells during the process of reprogramming. Feeder cells may be irradiated prior to being co-cultured with the cells being reprogrammed in order to avoid the feeder cells to overgrow the cells undergoing reprogramming. Feeder cells produce growth factors that support cells during the process of reprogramming and also provide a layer physical support for the reprogrammed cells to attach to. Examples of feeder cells include fibroblasts, splenocytes, macrophages and thymocytes.
II. Methods and Compositions
iPSC-Derived X Chromosome Inactivated Female Human Neural Cells
In one aspect, an X chromosome inactivated female human neural cell derived from an induced pluripotent stem cell is provided. Human female somatic cells have two X chromosomes, one of which is inactive such that the female cell does not contain twice the number of X chromosome gene products as a human male cell. Where an X chromosome is referred to herein as inactive or inactivated, it is used in accordance with its generally known meaning in the art. As such, an X chromosome inactivated human female cell is a human female cell in which one of the two X chromosomes present in the human female cell is silent with respect to X chromosome gene expression.
A human neural cell is a cell associated with the human nervous system. Examples of human neural cells include but are not limited to neural stem cells, neural progenitor cells, neuron, and glial cells. In some embodiments, a human neural cell is a neural progenitor cell or a neuronal cell. In some embodiments, a human neural cell is a neural progenitor cell. A neural progenitor cell is a neural cell capable of differentiating into a specific neuronal cell type but incapable of replicating indefinitely (e.g., can only divide a limited number of times). As used herein, the term “differentiating” refers to a process by which a less specialized cell type becomes a more specialized cell type. In some embodiments, a human neural cell is a neuronal cell. A neuronal cell is a further differentiated neural cell, such as a neuron (e.g., a cholinergic, GABAergic, glutamatergic, dopaminergic and serotonergic neuron) or a glial cell (e.g., astrocyte, microglial cell, Schwann cell, etc.).
In some embodiments, the X chromosome inactivated female human neural cell includes a mutated X chromosome linked gene. In some embodiments, the mutated X chromosome linked gene is capable of causing a neurological disorder when found in a human. In some embodiments, the mutated X chromosome linked gene is capable of causing an autism spectrum disorder (e.g., autism or Rett syndrome). In some embodiments, the mutated X chromosome linked gene is a mutated X-linked gene encoding MeCP2. “MeCP2” as referred to herein stands for methyl CpG binding protein 2 and includes any of the naturally-occurring forms of the MeCP2 gene or protein, or variants thereof that maintain MeCP2 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MeCP2). In some embodiments, variants have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MeCP2 polypeptide (e.g., SEQ ID NO:8 (MeCP2 isoform 1 protein) or SEQ ID NO:10 (MeCP2 isoform 2 protein)) or polynucleotide encoding an MeCP2 polypeptide (e.g., SEQ ID NO:7 (MeCP2 isoform 1 nucleic acid) or SEQ ID NO:9 (MeCP2 isoform 2 nucleic acid)). In some embodiments, the MeCP2 nucleic acid is the nucleic acid as identified by GenBank Accession Nos. NM_004992 (MeCP2 isoform 1 DNA; SEQ ID NO:7) or NM_001110792 (MeCP2 isoform 2 DNA; SEQ ID NO:9). In some embodiments, the MeCP2 protein is the protein as identified by GenBank Accession Nos. NP_004983 (MeCP2 isoform 1 protein; SEQ ID NO:8) and NP_001104262 (MeCP2 isoform 2 protein; SEQ ID NO:10). In some embodiments, the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having a neurological disorder. In some embodiments, the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having an autism spectrum disorder. In some embodiments, the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having autism, Rett syndrome, Alzheimer's disease, Parkinson's disease, Charcot-Marie-Tooth disease, Myasthenia Gravis, multiple sclerosis, or chronic demyelinating polyneuropathy and the like. In some embodiments, the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having autism or Rett syndrome. In some embodiments, the induced pluripotent stem cell from which the X chromosome inactivated female human neural cell is obtained (e.g., derived) from a patient having Rett syndrome.
The X chromosome inactivated female human neural cell may be prepared by a process that includes differentiating an induced pluripotent stem cell (iPSC). An induced pluripotent stem cell is typically a pluripotent stem cell that is derived non-naturally from a non-pluripotent cell, such as an adult somatic cell (e.g., generated from a non-pluripotent cell using any appropriate method as described herein). The iPSC may have two active X chromosomes, where upon differentiation of the iPSC to the X chromosome inactivated female human neural cell, one of the two active X chromosomes of is inactivated. The process may further include, prior to the differentiation of the induced pluripotent stem cell, generating the induced pluripotent stem cell from a human female somatic cell.
Any appropriate synthetic method may be used to produce an induced pluripotent stem cell, including genomic alterations (e.g., by transfection with transcriptional regulators) or treatment with proteins (e.g., protein-induced pluripotent stem cells) and/or methods as described herein. In some embodiments, iPSCs are generated by transfecting a non-pluripotent cell (e.g., a human female somatic cell) with nucleic acid encoding one or more proteins that are one or more highly expressed in embryonic stem cells. In some embodiments, the non-pluripotent cell is transfected with nucleic acids encoding one or more proteins effective to induce pluripotency (e.g., one or more Yamanaka factors). In some embodiments, the non-pluripotent cell is transfected with nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, or a Klf4 protein. In some embodiments, the non-pluripotent cell is transfected with nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and a Klf4 protein. In some embodiments, the nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and/or a Klf4 protein are expressed in viral vectors. A viral vector may be any suitable virus (e.g., retrovirus or lentivirus). In some embodiments, the non-pluripotent cell is transfected with Sox2, Oct4, c-Myc, and Klf4-expressing viral vectors.
In some embodiments, iPSCs are differentiated into neural cells by culturing the iPSCs to generate embyroid bodies (EBs). In some embodiments, iPSCs may be differentiated into neural progenitor cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neural progenitor cells) to form EB-derived rosettes, which are dissociated and re-plated to generate neural progenitor cells. In some embodiments, the EBs are cultured in the absence of FGF2. In some embodiments, the EBs are cultured in the presence of a protein that promotes neural induction (e.g., Noggin). Differentiation of an iPSC into a neural progenitor cell can be confirmed by detecting the presence of one or more neural precursor markers, including but not limited to Sox2, Pax6, and Musashi1. In some embodiments, iPSCs may be differentiated into neuronal cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neuronal cells) to form mature EBs, which are then dissociated and replated to generate neuronal cells. In some embodiments, the EBs are cultured in the presence of a protein that promotes neuronal induction (e.g., retinoic acid). Differentiation of an iPSC into a neuronal cell can be confirmed by detecting the presence of one or more neuron markers, including but not limited to MAP2, MAP5, and Tuj1 (β-III-tubulin) or one or more glial cell markers, including but not limited to GFAP and O4.
The X chromosome inactivated female human neural cell may be derived from any appropriate human female somatic cell, including a human fibroblast cell. In some embodiments, the iPSC is derived from a human fibroblast cell, including but not limited to a human dermal fibroblast cell, a human lung fibroblast cell, a human dental pulp fibroblast cell, or a human adipose fibroblast cell. In some embodiments, the iPSC is derived from a human keratinocyte cell, including but not limited to a human skin keratinocyte cell or a human hair follicle keratinocyte cell. In some embodiments, the iPSC is derived from a human cell derived from tooth tissue, e.g., a cell derived from the cell rich pulp layer, preferably the innermost pulp layer, of the human tooth, cells from the odontoblastic layer, and the like as known in the art. In some embodiments, the iPSC is derived from the human fibroblast cell, human keratinocyte cell, or human cell derived from tooth tissue as described herein and used to generate the X chromosome inactivated female human neural cell. In some embodiments, the X chromosome inactivated female human neural cell that is derived from the iPSC as described herein is a neural progenitor cell. In some embodiments, the X chromosome inactivated female human neural cell that is derived from the iPSC as described herein is a neuronal cell, such as a neuron (e.g., cholinergic, GABAergic, glutamatergic, dopaminergic, or serotonergic neuron) or a glial cell (e.g., astrocytes, microglial cells, Schwann cells, etc.). In some embodiments, the X chromosome inactivated female human neural cell that is derived from the iPSC as described herein is a glutamatergic cell (e.g., a functional post-mitotic neuron which displays X-inactivation).
The human female somatic cell may include a first X chromosome and a second X chromosome. The first X chromosome may be active and the second X chromosome may be inactive. The second X chromosome may also include a mutated gene. In other embodiments the first X chromosome is inactive, the second X chromosome is active, and the second X chromosome includes a mutated gene. As used herein, a “mutated gene” refers to a gene comprising one or more modifications relative to a wild-type (i.e., naturally occurring) gene, such as substitutions, insertions, deletions, and/or truncations, wherein the one or more modifications results in an alteration in the protein encoded by the gene relative to the protein encoded by the wild-type gene.
In another aspect, a method is provided for preparing an X chromosome inactivated female human neural cell. The method includes differentiating an induced pluripotent stem cell having two active X chromosome. Upon differentiation, one of the two active X chromosomes may be inactivated. In some embodiments, the method also includes, prior to differentiating the induced pluripotent stem cell, generating the induced pluripotent stem cell from a human female somatic cell (e.g., human fibroblast cell, human keratinocyte cell, or human cell derived from tooth tissue). The human female somatic cell may include a first X chromosome and a second X chromosome, where the first X chromosome is active, the second X chromosome is inactive, and the second X chromosome comprises a mutated gene. In other embodiments, the X chromosome inactivated female human neural cell includes a first X chromosome and a second X chromosome, wherein the first X chromosome is inactive, the second X chromosome is active, and the second X chromosome comprises a mutated gene.
In some embodiments, the method includes generating an induced pluripotent stem cell from a human female somatic cell. In some embodiments, the iPSC is generated by transfecting a human female somatic cell with nucleic acid encoding one or more proteins that are one or more highly expressed in embryonic stem cells. In some embodiments, the human female somatic cell is transfected with nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and a Klf4 protein. In some embodiments, the nucleic acids encoding a Sox2 protein, an Oct4 protein, a c-Myc protein, and/or a Klf4 protein are expressed in viral vectors. A viral vector may be any suitable virus (e.g., retrovirus or lentivirus). In some embodiments, the human female somatic cell is transfected with Sox2, Oct4, c-Myc, and Klf4-expressing viral vectors to generate an iPSC.
In some embodiments, the method includes differentiating an induced pluripotent stem cell having two active X chromosomes. Induced pluripotent stem cells can be differentiated by any method known in the art (e.g., Marchetto, M. C. et al., Cell Stem Cell, 3, 649-657 (2008); Yeo, G. W. et al., PLoS Comput Biol, 3, 1951-1967 (2007)) or according to the methods described herein. In some embodiments, iPSCs having two active X chromosomes may be differentiated into X chromosome inactivated neural progenitor cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neural progenitor cells) to form EB-derived rosettes, which are dissociated and re-plated to generate neural progenitor cells. In some embodiments, the EBs are cultured in the absence of FGF2. In some embodiments, the EBs are cultured in the presence of a protein that promotes neural induction (e.g., Noggin). Differentiation of an iPSC into a neural progenitor cell can be confirmed by detecting the presence of one or more neural precursor markers, including but not limited to Sox2, Pax6, and Musashi1. In some embodiments, iPSCs having two active X chromosomes may be differentiated into X chromosome inactivated neuronal cells by culturing the EBs (e.g., in the presence of a medium suitable for the growth of neuronal cells) to form mature EBs, which are then dissociated and replated to generate neuronal cells. In some embodiments, the EBs are cultured in the presence of a protein that promotes neuronal induction (e.g., retinoic acid). Differentiation of an iPSC into a neuronal cell can be confirmed by detecting the presence of one or more neuron markers, including but not limited to MAP2, MAP5, and Tuj1 (β-III-tubulin) or one or more glial cell markers, including but not limited to GFAP and O4. Activation or inactivation of an X chromosome can be detected by measuring the presence of a marker for X chromosome silencing. In some embodiments, inactivation of an X chromosome in a neural cell (e.g., a female human neural progenitor cell or a female human neuronal cell) is detected by contacting the neural cell with an antibody against trimethylated histone 3 Lysine 27 (me3H3K27). In some embodiments, inactivation of an X chromosome in a neural cell (e.g., a female human neural progenitor cell or a female human neuronal cell) is detected by contacting the neural cell with an antisense probe against Xist RNA.
In another aspect, a plurality of X chromosome inactivated female human neural cells are provided that are derived from a plurality of induced pluripotent stem cells. Each of the X chromosome inactivated female human neural cells includes a first X chromosome and a second X chromosome. The second X chromosome includes a mutated gene, where a portion of the plurality of X chromosome inactivated female human neural cells include an inactive first X chromosome and an active second X chromosome and another portion of the plurality of X chromosome inactivated female human neural cells include an active first X chromosome and an inactive second X chromosome. In some embodiments, the plurality of X chromosome inactivated female human neural cells are female human neural progenitor cells. In some embodiments, the plurality of X chromosome inactivated female human neural cells are female human neuronal cells. In some embodiments, at least a portion of the plurality of X chromosome inactivated female human neural cells are operably linked to form a neural network (i.e., a collection of neural cells in which at least some of the neural cells interact neurologically). In certain embodiments, the mutated gene is capable of causing a neurological disorder when found in a human. Applicable neurological disorders are discussed below. The mutated gene may encode MeCP2.
The induced pluripotent stem cell-derived X chromosome inactivated female human neural cells as described above can be used in the following methods.
Methods of Identifying a Compound Useful in Treating a Neurological Disorder
In another aspect, a method of identifying a compound useful in treating a neurological disorder is provided. The method includes contacting a test compound with a plurality of X chromosome inactivated female human neural cells (e.g., human neural progenitor cells or human neuronal cells as described above). The level of neurological functionality of the plurality of X chromosome inactivated female human neural cells is determined. The level of neurological functionality of the plurality of X chromosome inactivated female human neural cells in the presence of the test compound is compared to a control, thereby identifying a compound useful in treating a neurological disorder.
A change in the level of neurological functionality in the presence of the test compound relative to the control that correlates to desired neurological functionality is indicative of a compound useful in treating a neurological disorder. Any appropriate control may be used, including the level of neurological functionality of the plurality of X chromosome inactivated female human neural cells in the absence of the test compound. A “level of neurological functionality” means any measurable characteristic of the plurality of X chromosome inactivated female human neural cells that relates to the ability of the plurality of X chromosome inactivated female human neural cells to function as desired (e.g., function similarly or superior to a plurality of X chromosome inactivated female human neural cells that do not contain a mutated gene on the second of first X chromosome). In some embodiments, the level of neural functionality is determined by measuring in a plurality of X chromosome inactivated female human neuronal cells (e.g., neurons) the number of calcium transients and/or the percentage of X chromosome inactivated female human neuronal cells (e.g., neurons) that exhibit calcium transients as compared to a control. In some embodiments, the level of neural functionality is determined by measuring in a plurality of X chromosome inactivated female human neuronal cells (e.g., neurons) the frequency and/or amplitude of spontaneous excitatory and/or inhibitory postsynaptic currents as compared to a control.
The neurological disorder may be an autism spectrum disorder (e.g., autism or Rett syndrome), Alzheimer's disease, Parkinson's disease, Charcot-Marie-Tooth disease, Myasthenia Gravis, multiple sclerosis, chronic demyelinating polyneuropathy and the like. As used herein, “autism spectrum disorder” refers to a disease or disorder that is characterized by varying degrees of (1) deficits in social interaction, (2) deficits in verbal and nonverbal communication, and (3) repetitive behaviors or interests. Disorders of the autism spectrum include autism, Asperger's syndrome, Rett syndrome, Childhood Disintegrative Disorder, and Pervasive Developmental Disorder Not Otherwise Specified (PDD-NOS). In some embodiments, the neurological disorder is autism spectrum disorder. In some embodiments, the neurological disorder is autism. In some embodiments, the neurological disorder is Rett syndrome.
Methods of Determining Whether a Subject has a Neurological Disorder
In another aspect, a method of determining whether a human subject has a neurological disorder is provided. The method includes taking a somatic cell (e.g., a fibroblast cell, keratinocyte cell, or cell derived from tooth tissue as described above) from the human subject (e.g., a human female subject), generating an induced pluripotent stem cell from the somatic cell, and differentiating the induced pluripotent stem cell into a human neural cell (e.g., an X chromosome inactivated female human neural cell). The level of neurological functionality of the human neural cell is determined. The level of neural functionality of the human neural cell is compared to a control, thereby determining whether the subject has a neurological disorder. In some embodiments, the level of neural functionality is determined by measuring in the X human neural cell (e.g., an X chromosome inactivated female human neural cell) the number of calcium transients and/or the percentage of X chromosome inactivated female human neuronal cells (e.g., neurons) that exhibit calcium transients as compared to a control. In some embodiments, the level of neural functionality is determined by measuring in the X human neural cell (e.g., an X chromosome inactivated female human neural cell) the frequency and/or amplitude of spontaneous excitatory and/or inhibitory postsynaptic currents as compared to a control. The neurological disorder may be an autism spectrum disorder (e.g., autism or Rett syndrome), Alzheimer's disease, Parkinson's disease, Charcot-Marie-Tooth disease, Myasthenia Gravis, multiple sclerosis, chronic demyelinating polyneuropathy and the like. In some embodiments, the neurological disorder is autism spectrum disorder. In some embodiments, the neurological disorder is autism. In some embodiments, the neurological disorder is Rett syndrome. Induced pluripotent stem cells may be generated and differentiated into a human neural cell according to any method described herein or known in the art.
In some embodiments, the human neural cell is an X chromosome inactivated female human neural cell. In some embodiments, the X chromosome inactivated female human neural cell is a human neural progenitor cell or a human neuronal cell. In some embodiments, the X chromosome inactivated female human neural cell includes a mutated X chromosome linked gene. In some embodiments, the mutated X chromosome linked gene is capable of causing a neurological disorder when found in a human. In some embodiments, the mutated X chromosome linked gene is capable of causing an autism spectrum disorder (e.g., autism or Rett syndrome). In some embodiments, the mutated X chromosome linked gene is a mutated X-linked gene encoding MeCP2.
In some embodiments, the method includes determining the level of functionality of a plurality of human neural cells. In some embodiments, the method includes determining the level of functionality of a plurality of X chromosome inactivated female human neural cells. Each of the X chromosome inactivated female human neural cells includes a first X chromosome and a second X chromosome. The second X chromosome includes a mutated gene, where a portion of the plurality of X chromosome inactivated female human neural cells include an inactive first X chromosome and an active second X chromosome and another portion of the plurality of X chromosome inactivated female human neural cells include an active first X chromosome and an inactive second X chromosome. In some embodiments, the plurality of X chromosome inactivated female human neural cells are female human neural progenitor cells. In some embodiments, the plurality of X chromosome inactivated female human neural cells are female human neuronal cells. In some embodiments, at least a portion of the plurality of X chromosome inactivated female human neural cells are operably linked to form a neural network (i.e., a collection of neural cells in which at least some of the neural cells interact neurologically). In some embodiments, the mutated gene is capable of causing a neurological disorder when found in a human. In some embodiments, the mutated X chromosome linked gene is capable of causing an autism spectrum disorder (e.g., autism or Rett syndrome). In some embodiments, the mutated X chromosome linked gene is a mutated X-linked gene encoding MeCP2.
III. Examples
Autism and autism spectrum disorders (ASD) are heritable complex neurodevelopmental diseases in which different combinations of genetic mutations may contribute to the phenotype in different individuals. Herein is provided a cellular approach to study ASD. Using Rett syndrome (RTT) as an ASD genetic model, we developed an in vitro system by deriving induced pluripotent stem cells (iPSCs) from a RTT patient's fibroblast. Most RTT patients have mutations in the X-linked gene encoding the methyl-CpG binding protein 2 (MeCP2). RTT patients' iPSCs are pluripotent in culture and able to generate proliferating neural progenitor cells and functional postmitotic neurons while displaying X-inactivation. Although we found no differences in neural progenitor cell replication, glutamatergic neurons derived from RTT iPSCs had significantly fewer synapses compared to control neurons. Moreover, we characterized significant neuronal morphological changes that may contribute to an altered network dynamics in the RTT neuronal population. Thus, a human in vitro model of RTT has been generated from iPSCs from fibroblasts of a RTT patient and a control individual. The generated iPSCs-RTT surprisingly retained the capacity to generate proliferating neural progenitor cells and neurons that underwent X-inactivation. A reduced number of dendritic spines and synapses were observed in glutamatergic neurons. Moreover, using calcium imaging, an altered frequency of intracellular Ca2+ spikes were detected in RTT-derived neuronal networks, revealing earlier markers for RTT pathology. Together, these results allow, inter alia, modeling and chemical screening of RTT and other ASD in a relevant cellular system. The model provides a reproducible assay to reveal and understand the common molecular mechanisms present in ASDs and is a promising human cellular tool for in vitro drug screening aimed at reverting neuronal phenotypes.
Cell Culture and Retrovirus Infection.
Female RTT and control fibroblasts were generated from explants of dermal biopsies following informed consent under protocols approved by the University of California San Diego. The Syn::EGFP or DsRed reporter vector was obtained by cloning the Synapsin-1 promoter in a lentivirus backbone. The shRNA against a target sequence on the human MeCP2 gene was cloned in the LentiLox3.7 lentivirus vector. Retrovirus vectors containing the Oct4, c-Myc, Klf4 and Sox2 human cDNAs from Yamanaka's group (Takahashi et al., 2007, Id.) were obtained from Addgene. Two days after infection, fibroblasts were plated on mitotically inactivated mouse embryonic fibroblasts (Chemicon) with hESC medium. After 2 weeks, iPSC colonies were directly transferred to feeder-free conditions on matrigel-coated dishes (BD) using mTeSRTM1 (StemCell Technologies), and passed manually. To obtain neural progenitor cells, embryoid bodies (EBs) were formed by mechanical dissociation of cell clusters and plating onto low-adherence dishes in hESC medium without FGF2 for 5-7 days. After that, EBs were plated onto poly-ornithine/laminin (Sigma)-coated dishes in DMEM/F12 (Invitrogen) plus N2. Rosettes were visible to collect after 7 days. Rosettes were then dissociated with accutase (Chemicon) and plated again onto coated dishes with NPC media (DMEM/F12/0.5×N2; 0.5×B27 and FGF2). Homogenous populations of NPCs were achieved after 1-2 passages with accutase in the same condition. To obtain mature neurons, floating EBs were treated with 1 μM of retinoic acid for 3 more weeks (total time of differentiation 4 weeks). Mature EBs were then dissociated with Papain and DNase (Worthington) for 1 hr at 37° C. and plated in poly-ornithine/laminin-coated dishes in NPC media without FGF2. For the rescue experiments, 10 μg/mL of IGF1 (Peprotech) or Gentamicin (Invitrogen; at 100 or 400 μg/mL) was added to neuronal cultures for 1 week. Protocols were previously approved by the University of California San Diego and Salk Institute Institutional Review Board and the Embryonic Stem Cell Research Oversight Committee.
Immunocytochemistry and Synapse Quantification.
Cells were briefly fixed in 4% paraformaldehyde and then permeabilized with 0.5% Triton-X100 in PBS. Cells were then blocked in PBS containing 0.5% Triton-X100 and 5% donkey serum for 1 hour before incubation with primary antibody overnight at 4° C. After 3 washes with PBS, cells were incubated with secondary antibodies (Jackson ImmunoResearch) for 1 hour at room temperature. Fluorescent signals were detected using a Zeiss inverted microscope and images were processed with Photoshop CS3 (Adobe Systems). Primary antibodies used in this study are described herein. Cell soma size was measure in bright field using ImageJ software after identification of neurons using the Syn::EGFP. The morphologies of neuronal dendrites and spines were studied from an individual projection of z-stacks optical sections and scanned at 0.5-μm increments that correlated with the resolution valued at z-plane. Each optical section was the result of 3 scans at 500 lps followed by Kalman filtering. For synapse quantification, images were taken by a z-step of 1 μm using Biorad radiance 2100 confocal microscope. Synapse quantification was done blinded to genotype. Only VGLUT1 puncta along Map2-positive processes were counted. Statistical significances were tested using Two-way ANOVA test and Bonferroni post-test.
Cell Cycle Analysis.
One million NPCs were fixed in 70% EtOH for at least 2 hours at 4° C. After PBS washing, cells were stained with 1 mL of propidium iodide (PI) solution (50 μg/mL PI in 3.8 Mm sodium citrate) and treated with 20 μL/mL of RNAseA. Cells were analyzed by fluorescence-activated cell sorting (FACS) on a Becton-Dickinson LSRI and cell cycle gating was examined using FLOWJO—Flow Cytometry Analysis Software.
RNA Extraction and RT-PCR.
Total cellular RNA was extracted from ˜5×106 cells using the RNeasy Protect Mini kit (Qiagen, Valencia, Calif.), according to the manufacturer's instructions, and reverse transcribed using the SuperScript III First-Strand Synthesis System RT-PCR from Invitrogen. The cDNA was amplified by PCR using Accuprime Taq DNA polymerase system (Invitrogen). The primer sequences were: hPAX6-F: 5′ acccattatccagatgtgtttgcccgag (SEQ ID NO:11) and hPAX6-R 5′ atggtgaagagggcataggeggcag (SEQ ID NO:12); hMSX1-F: 5′ cgagaggaccccgtggatgcagag (SEQ ID NO:13) and hMSX1-R: 5′ ggcggccatcttcagatctccag (SEQ ID NO:14); hKRT-18-F: tctgtggagaacgacatcca (SEQ ID NO:15) and KRT-18-R: 5′ ctgtacgtctcagctctgtga (SEQ ID NO:16); hAFP-F: 5′ aaaagcccactccagcatc (SEQ ID NO:17) and hAFP-R: 5′ cagacaatccagcacatctc (SEQ ID NO:18); hGAPDH-Fw: 5′ accacagtccatgccatcac (SEQ ID NO:19), hGAPDH-Rv: 5′ tccaccaccctgttgctgta (SEQ ID NO:20). PCR products were separated by electrophoresis on a 2% agarose gel, stained with ethidium bromide and visualized by UV illumination.
Teratoma Formation in Nude Mice.
Around 1−3×106 fibroblasts or iPSCs were injected subcutaneously into the dorsal flanks of nude mice (CByJ.Cg-Foxn1nu/J) anesthetized with isoflurane. Five to six weeks after injection, teratomas were dissected, fixed overnight in 10% buffered formalin phosphate and embedded in paraffin. Sections were stained with hematoxylin and eosin for further analysis. Control mice injected with RTT fibroblasts failed to form teratomas. Protocols were approved by the University of California San Diego Institutional Animal Care and Use Committee.
Karyotyping and DNA Fingerprinting.
Standard G-banding chromosome and DNA fingerprinting analysis was performed by Cell Line Genetics (Madison, Wis.).
DNA and RNA FISH.
Xist RNA exon 6 probes (GenBank U80460: 75081-78658) were transcribed by using T7 RNA polymerase (Roche) with AlexaFluor 488-5-UTP. X chromosome probe and Xist slide hybridization were performed by Molecular Diagnostic Services, Inc. (San Diego, Calif.).
Protein Isolation and Western Blot Analysis.
Cells were isolated, suspended in 1×RIPA lyses buffer (Upstate) supplemented with 1% protease inhibitor cocktail (Sigma), triturated and centrifuged at 10,000×g for 10 minutes at 4° C. Twenty micrograms of total protein was separated on 12% SDS-polyacrylamide gel, transferred to a nitrocellulose membrane and probed with a primary antibody against MeCP2 (1:5,000; Diagenode), followed by horseradish-peroxidase-conjugated secondary antibody (1:5,000; Promega), and then visualized using ECL chemiluminescence (Amersham). As a control, membranes were stripped and re-probed for β-actin (1:10,000; Ambion) or α-tubulin (1:5,000, Ambion). For semi-quantitative analysis, MeCP2 signal intensity was analyzed and corrected with respect to β-actin.
Microarray Analysis.
The Affymetrix Power Tools (APT) suite of programs and Affymetrix Human Gene 1.0 ST Arrays library files and annotation were obtained from the Affymetrix website. Gene-level signal estimates were derived from the CEL files by RMA-sketch normalization as a method in the apt-probeset-summarize program. Hierarchical clustering of the full dataset by probeset values was performed by complete linkage using Euclidean distance as a similarity metric in Matlab.
Electrophysiology.
Whole-cell patch clamp recordings were performed from cells co-cultured with astrocytes after 6 weeks of differentiation. The bath was constantly perfused with fresh HEPES-buffered saline as described herein. The recording micropipettes (tip resistance 3-6 MΩ) were filled with internal solution described in the Supplemental materials. Recordings were made using Axopatch 200B amplifier (Axon Instruments). Signals were filtered at 2 kHz and sampled at 5 kHz. The whole-cell capacitance was fully compensated. The series resistance was uncompensated but monitored during the experiment by the amplitude of the capacitive current in response to a 10-mV pulse. All recordings were performed at room temperature and chemicals were purchased from Sigma. Frequency and amplitude of spontaneous postsynaptic currents were measured with the Mini Analysis Program software (Synaptosoft, Leonia, N.J.). Statistical comparisons of WT and RTT groups were made using the non-parametric Kolmogorov-Smirnov two-tailed test, with a significance criterion of p=0.05. EPSCs were blocked by CNQX or DNQX (10-20 μM) and IPSPs were inhibited by bicuculine (20 μM).
Calcium Imaging.
Neuronal networks derived from human iPSCs were previously infected with the lentiviral vector carrying the Syn::DsRed reporter construct. Cell cultures were washed twice with sterile Krebs HepesHEPES Buffer (KHB) (10 mM HEPES, 4.2 mM NaHCO3, 10 mM dextrose, 1.18 mM MgSO4.2H2O, 1.18 mM KH2PO4, 4.69 mM KCl, 118 mM NaCl, 1.29 mM CaCl2; pH 7.3) and incubated with 0.2-0.5 μM Fluo-4AM (Molecular Probes/Invitrogen, Carlsbad, Calif.) in KHB for 40 minutes at room temperature. Excess dye was removed by washing twice with KHB and an additional 20-minute minutes incubation was done to equilibrate intracellular dye concentration and allow de-esterification. Time-lapse image sequences (200×100× magnification) of 5000 frames were acquired at 28 Hz with a region of 336×256 pixels, using a Hamamatsu ORCA-ER digital camera (Hamamatsu Photonics K.K., Hamamatsu City, Japan) with a 488 mm (FITC) filter on an Olympus IX81 inverted fluorescence confocal microscope (Olympus Optical, Tokyo, Japan). Images were acquired with MetaMorph 7.17 (MDS Analytical Technologies, Sunnyvale, Calif.). Images were subsequently processed in using ImageJ (National Instituted of Health, Washington D.C.) and Matlab 7.2 (Mathworks, Natick, Mass.).
Quantification of Ca2+ Transients.
ImageJ, an NIH funded open source, JAVA-based morphometric application, was used to allow manual selection of individual cells on the xy-plane of each movie using circles of 4 pixels (˜5 μm) in diameter. Each cell was considered as an individual region of interest (ROIs) and the average fluorescence intensity was calculated for each ROI in each frame using Time Series Analyzer ImageJ plugin.
Quantitative signal analysis and processing were done in custom Matlab routines. The temporal fluorescence intensity signals indicative of intracellular Ca2+ fluctuations were filtered with low pass Gaussian filter to reduce noise. Signals were presented as relative fluorescence changes (ΔF/F) after background subtraction. A first-derivative filter was used to identify significant increases in calcium levels, i.e., >10 consecutive frames (˜350 ms) with positive derivative values.
Results
Generation of RTT and Control iPSCs
Non-affected control fibroblasts and cells carrying four distinct MeCP2 mutations (FIG. 1A and Table 1 following) isolated from clinically affected female patients with RTT symptoms were infected with retroviral reprogramming vectors (Sox2, Oct4, c-Myc and Klf4), as described elsewhere. See, e.g., Takahashi et al., 2007, Id. After 2 to 3 weeks, compact iPSC colonies emerged from a background of fibroblasts. See FIGS. 1B1C. Colonies were manually picked and transferred to matrigel, as known in the art. See FIGS. 1D-1E. We obtained at least 10 clones from each control (WT)-iPSC and RTT-iPSC that continuously expressed pluripotent markers such as Nanog, Lin28, Tra-1-81 and Sox2. See FIGS. 1F-1G and FIGS. 7A-7C. All iPSC clones used in this study maintained a normal karyotype. See FIG. 1H. Teratomas containing derivatives from all 3 embryonic germ layers confirmed that the iPSCs were able to differentiate in vivo. See FIG. 1I. PCR fingerprinting confirmed their derivation from respective fibroblasts. Next, we asked if the global molecular signatures of RTT-iPSC clones carrying the two distinct MeCP2 mutations (1155del32 and Q244X) and WT-iPSC clones (from AG09319) resembled those of available hESC lines (HUES6). Gene expression profiles measured using human genome Affymetrix Gene Chip arrays were grouped by hierarchical clustering, and correlation coefficients were computed for all pair-wise comparisons (GEO accession number GSE21037). We observed that the WT-iPSC and RTT-iPSC clones were almost indistinguishable. The results clearly revealed that the iPSC and hESC lines were more similar to each other than to the respective original fibroblasts. See FIG. 7D. These findings, combined with manual inspection of the gene expression of known pluripotent- and fibroblast-related genes (FIGS. 7E-7F), indicated that the reprogramming was successful. In Tables 2.1 and 2.2 following, there is presented a summary of iPSC subjects and clones utilized for the experiments described herein.
TABLE 1
MeCP2 mutations, phenotype description and respective cell lines.
Cell line iPSC MeCP2 Nucleotide
name code Gender Mutation change Individual phenotype
GM11270* R306C Female missense 916C > T Clinically affected; classical
symptoms; normal lysosomal
enzymes; 46, XX in PBL;
donor carries missense
mutation, 916C > T, in the
gene encoding methyl-CpG
binding protein 2 (MECP2).
GM11272* 1155del32 Female frameshift 1155del32 Clinically affected; classical
symptoms; normal lysosomal
enzymes; 46, XX in PBL;
donor subject carries a
frameshift mutation,
1155del32, in the gene
encoding methyl-CpG
binding protein 2 (MECP2).
GM16548* Q244X Female nonsense 730C > T Clinically affected; abnormal
sleep patterns; ambulatory;
breath holding; constipation;
decelerating head
circumference; loss of
purposeful hand use;
nonverbal; poor hand and feet
circulation; repetitive hand
motions; self injurious
behavior; small feet; teeth
grinding; tremors; donor
subject is heterozygous for a
730C > T transition in the
MECP2 gene resulting in a
stop codon.
GM17880* T158M Female missense 473C > T Growth and developmental
delay; can walk only with
assistance; nonverbal; no
hand use; constant repetitive
hand motions; no seizures,
but significantly abnormal
EEG; teeth grinding; some
sleep difficulties; eating
problems with minor reflux;
breath holding and
hyperventilation; small feet;
some tremor; this culture had
a lifespan of 56 population
doublings (PDLs); the donor
subjects carried a 473C > T
transition, resulting in the
substitution of threonine 158
by methionine
AG09319* AG09319 Female WT Healthy individual. The
karyotype is 46, XX; normal
diploid female.
CRL2529** CRL2529 Male WT Healthy individual. The
karyotype is 46, XY; natrual
diploid male.
WT-126*** 126 Male WT Healthy individual. The
karyotype is 46, XY; normal
diploid male.
WT-33***  33 Female WT Healthy individual. The
karyotype is 46, XX; normal
diploid female.
WT- ARDC40 Male WT Healthy individual. The
ARDC40*** karyotype is 46, XY; normal
diploid male.
*From Coriell.
**From ATCC
***From biopsies of healthy individuals.
TABLE 2.1
Summary of the iPSC subjects and clones utilized for each experiment.
Numbers represent experimental replications for each individual clone.
The clones utilized in neuronal differentiation experiments
were determined by availability at the end time-point.
SUBJECTS
ADRC40 AG09319 CRL2529 WT-33
Experiments/clones C1 C1 C2 C1 C1 C7
Pluripotency assays
2 2 2 2 2 2
Gene expression 3 3
Map2 Labeling 3 3 3
Syn::DsRed labeling 3 3
GABA labeling 3 3
H3K27me3 labeling 3 3
Xist FISH 2
Androgen receptor 2
Cell cycle 3 3
VGLUT puncta 3 3 3
Soma size 2 2 2
Spine Density 3
Calcium Transients 3
Electrophysiology 3
TABLE 2.2
Continuation of Table 2.1.
SUBJECTS
WT-126 1155del32 Q244X T158M R306C
clones
Experiments C5 C8 C13 C15 C18 C3 C4 C3 C1
Pluripotency assays
2 2 2 2 2 2 2 2 2
Gene expression 3 3 3 3
Map2 Labeling 3 3 3 3 3 3 3
Syn::DsRed labeling 3 3 3 3
GABA labeling 3 3 3 3
H3K27me3 labeling 3 3 3
Xist FISH 2 2 2
Androgen receptor 2 2 2
Cell cycle 3 3 3 3
VGLUT puncta 3 3 3 3 3 3
Soma size 2 2 2 2 2 2 2
Spine Density 3 3 3
Calcium Transients 3 3 3 3
Electrophysiology 4 4 4

Neural Induction of iPSCs
A protocol for neuronal differentiation is outlined in FIG. 2A. Neural differentiation was initiated by plating embryoid bodies (EBs). After a week, EB-derived rosettes became apparent (FIG. 2B). Rosettes were then manually collected, dissociated and re-plated. The NPCs (neural precursor cells) derived from rosettes formed a homogeneous population after a couple of passages. NPCs were positive for early neural precursor markers, such as Nestin, Sox1-2 and Musashi1 (FIG. 2C). To obtain mature neurons, EBs in the presence of retinoic acid (RA) were dissociated and re-plated (FIG. 2B). At this stage, cells were positive for Tuj1 (β-III-Tubulin) and Map2 (Microtubule-associated protein 2). See FIG. 2D. Moreover, there was detected expression of the inhibitory and excitatory neurotransmitters GABA (γ-amino butyric acid) and VGLUT1 (vesicular glutamate transporter-1), respectively. Also observed were synapsin puncta outlining Map2-positive neurites. See FIG. 2D. A significant alteration in RTT neuronal survival was not detected when compared to controls, as measured by Map2 staining. See FIGS. 2E and 8A. In addition, infection with a lentivirus expressing the DsRed gene under the control of Synapsin promoter (Syn::DsRed) did not reveal any difference in neuronal survival between RTT and controls. See FIGS. 2E and 8B. Interestingly, the number of GABA-positive neurons was also not affected between RTT and controls. See FIGS. 2F and 8C.
X-Inactivation During Neuronal Differentiation of iPSCs-RTT
In female hESCs, both chromosomes should be active, but one X chromosome becomes silenced upon differentiation. See Dhara & Benvenisty, 2004, Nucleic Acids Res 32:3995-4002. Similar to ESCs, female mouse iPSCs have shown reactivation of a somatically silenced X chromosome and have undergone random X-inactivation upon differentiation. See Maherali et al., 2007, Cell Stem Cell 1:55-70. Because MeCP2 is an X-linked gene, we examined the ability of the RTT-iPSCs clones described herein to reset the X chromosome (i.e., to erase X-inactivation) and whether X-inactivation would take place again after neuronal differentiation. See FIG. 3A. We stained RTT-iPSCs clones and their respective fibroblasts with an antibody against trimethylated histone 3 Lysine 27 (me3H3K27), an epigenetic silencing mark present on the inactive X chromosome in interphase nuclei. See Silva et al., 2003, Developmental Cell 4:481-495. Some, but not all, undifferentiated RTT-iPSCs clones displayed diffuse immunoreactivity throughout the nucleus, similar to some hESCs, showing that the memory of the previous inactivation state had been erased. See FIG. 3B. For further analysis, we only selected clones that displayed a diffuse me3H3K27 pattern to differentiate into neurons. Upon neuronal differentiation, intense nuclear foci staining, a prominent diagnostic of the inactive X, was found in 80% of neurons labeled by the infection of a lentivirus carrying the neuron-specific Synapsin promoter driving the EGFP reporter (Syn::EGFP). Nuclear foci were also present in RTT fibroblasts before reprogramming. See FIG. 3B. We quantified the percentage of cells displaying either a diffuse or intense X-inactivation (nuclear foci). See FIG. 3C. Without wishing to be bound by any theory, it is believed that these data suggest that the majority of cells in selected clones from both hESCs (99%) and iPSCs (95%) have a diffuse pattern. In contrast, differentiated populations of fibroblasts and iPSC-derived neurons have me3H3K27 nuclear foci staining, indicating X-inactivation.
We also used fluorescent in situ hybridization (FISH) to visualize Xist RNA, a noncoding transcript involved in X chromosome silencing that physically wraps the inactive X. See Lucchesi et al., 2005, Annu Rev Genet 39:615-651. Before reprogramming, the majority of fibroblasts exhibit a clear Xist cloud. The signal is lost after reprogramming, indicating that selected iPSC clones have two active X chromosomes under the culture conditions. A Xist cloud is also observed in iPSC-derived neurons. See FIG. 3D. Fluorescent in situ hybridization (FISH) analysis using a centromeric X-chromosome probe in iPSC-derived NPCs and neurons showed the presence of two X chromosomes. See FIG. 3E. As a consequence of both X-chromosomes' activation after reprogramming, the MeCP2 protein can be detected in undifferentiated iPSCs from RTT patients. See FIG. 3F. However, after differentiation, RTT-iPSC-derived neurons recapitulated X-inactivation, and the population became mosaic regarding MeCP2 expression. Immunostaining was performed on several RTT-iPSC clones, and a representative example of MeCP2 expression after differentiation is shown in FIG. 3F. Clones obtained from RTT fibroblasts carrying the 1155del32 MeCP2 mutation do not produce a full-length MeCP2 protein. See Traynor et al., 2002, BMC Medical Genetics 3:12.
Next, we selected one WT-iPSC clone (WT-33 C1) and one RTT-iPSC clone (1155del32 C15) to determine whether the RTT-iPSC-derived neuronal population showed reduced MeCP2 protein levels. As expected, we observed a reduction in the full-length MeCP2 protein amounts in both fibroblasts and neurons derived from the RTT-iPSC clone. See FIG. 3G. We tested the original fibroblasts and iPSC-derived neurons from this patient for X-inactivation using standard methodology for the androgen receptor locus. See Allen et al., 1992, Am J Hum Genet 51:1229-1239. RTT fibroblasts carrying the 1155del32 MeCP2 mutation had a 55:45 distribution, but RTT-derived neurons showed highly skewed X-inactivation, with a 96:4 distribution. See FIGS. 9A-9F. The data depicted in FIGS. 9A-9F are summarized in Table 3 following, with naming scheme as follows: FIG. 9A: XI_63846, XI_63846_HapII; FIG. 9B: XI_57216, XI_57216_HapII; FIG. 9C: XI_20000, XI_20000_HapII; FIG. 9D: XI_NoDNA, XI_NoDNA_HapII; FIG. 9E: XI_GM11272Fibro, XI_GM11272_HapII; FIG. 9F: XI_GM11272Neuron, XI_GM11272Neuron_HapII.
TABLE 3
Androgen receptor analysis. See FIGS. 9A-9F.
Corr.
Peak Peak Corr. Peak2 Corr. Peak1 Peak2
Sample Name Area1 Area2 Factor (Hpa) Total % % X1:Xa
XI_63846 156508 87390 1.7909
XI_63846_Hapll 100309 103847 185981.08 286290.08 35 65 65:35
(Random
Control)
XI_57216 87250 73588 1.1857
XU7216_Hapll 79106 0 79106 100 0 100
(Highly
Control)
XI_20000 325981 Male
Control
XI_20000_Hapll Male
Control
XI_NoDNA No DNA
XI_NoDNA_Hpall No DNA
XI_GM11272 273822 245617 1.1148
Fibro
XI_GM11272 85193 61995 69114.09 154307.09 55.2 44.8 55:45
Fibro_Hapll (Random)
XI_GM11272 330180 150314 2.1966
Neuron
XI_GM11272 19851 229017 503059.15 522910.15 3.8 96.2 96:4 
Neuron_Hapll (Highly)
In view of the data disclosed herein, and without wishing to be bound by any theory, it is believed that the outcome of the X-inactivation process, measured by the androgen receptor locus, is consistent within the same clone. An independent differentiation of the same clone (RTT-1155del32 C15) yielded a 98:2 distribution. It is further believed that the androgen receptor locus analysis was not conclusive for the MeCP2 mutation Q244X cells. However, a reduction of 50% in the amount of MeCP2 protein level (FIG. 10E) is consistent with a random X-inactivation.
The present data show that X-inactivation was erased in selected reprogrammed RTT-iPSCs clones and subsequently restored during neuronal differentiation. Importantly, the recapitulation of X-inactivation produces mosaic neuronal cultures with different ratios of cells expressing normal MeCP2 levels, mimicking what is observed in RTT patients' brains. The data do not preclude that partial reprogramming from a single fibroblast or retention of the X-inactivation would lead to clones with highly skewed X-inactivation, where neurons would express only the normal or mutant form of MePC2. In fact, we do observe WT and RTT-iPSC clones retaining X-inactivation after reprogramming. The RTT-T158M C3-derived neurons showed 100:0 distribution. The expression of the mutant MeCP2 allele was confirmed by sequencing.
Normal Cellular Proliferation from iPSCs-RTT-Derived NPCs
An increased incidence of large head size has been reported in autism. See e.g., Piven et al., 1995, Id. Other studies have suggested that the autistic brain is smaller at birth, followed by rapid head growth during early development and then a period of reduced brain growth (Courchesne et al., 2003, J Am Med Asso 290:337-344). Head growth deceleration has also been reported for RTT patients. See Hagberg et al., 2001, Brain Dev 23 Suppl 1:S227-229. Since the cellular mechanism behind this phenomenon is unknown, we investigated whether a perturbed NPC replication cycle was affected in RTT. NPCs derived from RTT-iPSCs, WT-iPSCs and hESCs (Cyth25 and HUES6) were generated and kept under proliferating conditions in the presence of FGF2. NPCs derived using the protocol described herein had identical passage numbers and were analyzed for cell cycle by flow cytometry. Our results showed no significant differences in any cycle phase between HESC-, WT-iPSC- and RTT-iPSC-derived NPCs (FIG. 4A), though we cannot exclude the possibility that altered head growth in RTT patients is caused by eventual abnormal NPC proliferation in another developmental stage. We then investigated potential phenotypic changes in RTT neurons compared to controls.
Reduced Glutamatergic Synapse Number and Morphological Alterations in RTT Neurons
Strong evidence implicates synapse alteration with ASD, including RTT. See e.g., Zoghbi, 2003, Science 302:826-830. Loss of MeCP2 and doubling of MeCP2 dosage in mice have opposite effects on excitatory synapse numbers in individual neurons. See Chao et al., 2007, Neuron 56:58-65. These results suggest that MeCP2 may be a rate-limiting factor in regulating glutamatergic synapse formation and indicate that changes in excitatory synaptic strength may underlie global network alterations in RTT. Therefore, we determined whether excitatory synapse numbers were reduced in human RTT neurons. After 8 weeks of differentiation, glutamatergic neurons were identified using antibodies against VGLUT1 (Takamori et al., 2000, Nature 407:189-194), and dendrites were labeled with Map2. See FIG. 4B. To confirm the specificity of glutamatergic neurons in our cultures, we showed that VGLUT1 puncta were mostly adjacent to the postsynaptic density-95 (Psd95) protein (Niethammer et al., 1996, J Neurosci 16:2157-2163). See FIG. 10A. We found a reduction in the density of VGLUT1 puncta from RTT-iPSCs clones carrying 3 different MeCP2 mutations compared to HUES6 and distinct WT-iPSCs-derived Map2-positive neurons, suggesting a specific defect in glutamate transport in RTT cultures. See FIG. 4B and FIG. 10B. Since neurons carrying different MeCP2 mutations showed reduced VGLUT1 puncta in our cultures, we tested whether loss of function of MeCP2 was directly related to the number of glutamatergic synapses in our neuronal cultures. We cloned an shRNA against MeCP2 in a lentiviral vector that is able to knockdown both isoforms of MeCP2. See FIG. 10C. Neurons derived from WT-iPSCs expressing the shMeCP2 showed a similar reduction in VGLUT1 puncta when compared to control neurons expressing a scramble shRNA (shControl). See FIG. 4C and FIG. 10B. Overexpression of MeCP2 using a lentiviral vector (FIG. 10C) increased the number of VGLUT1 puncta in WT and RTT neurons. See FIG. 4D and FIG. 10B. Our data strongly suggest that MeCP2 is a rate-limiting factor in regulating glutamatergic synapse number in human neurons.
We also investigated whether RTT neurons displayed any morphological alteration when compared to controls. To visualize neuronal anatomy, we infected the cultures with the Syn::EGFP lentivirus. Morphological analysis of RTT neurons revealed that the number of spines in RTT neurites was reduced when compared to WT neurons and after ectopic expression of shMeCP2. See FIG. 4E. Consistent with this observation, the number of spines in dendrites of neurons from postmortem RTT patient brain was previously reported to be lower than that in normal individuals. See Chapleau et al., 2009, Neurobiol Dis. 35:219-233. Finally, we documented that the cell soma sizes from neurons derived from the RTT-iPSCs carrying different MeCP2 mutations were smaller when compared to controls (reduction of 14.31±4.83%). Similarly, loss of function using the shMeCP2 knockdown strategy in WT neurons reduced soma size at levels comparable to RTT levels (reduction of 14.52±4.31%). See FIG. 4F and FIG. 10D.
Rescuing a RTT Neuronal Phenotype
Recent studies have shown that re-activation of MeCP2 expression knockout mice led to a prolonged life span and delayed onset or reversal of certain neurological symptoms. See e.g., Giacometti et al., 2007, Proc Natl Acad Sci USA 104:1931-1936; Guy et al., 2007, Science 315:1143-1147. These reports suggest that some RTT phenotypes can be rescued in vivo. We used our model to analyze the effect of selected compounds that may revert the neuronal phenotype in culture as a validation, e.g., for high-throughput drug screening platforms. Administration of IGF1 was recently described to promote a partial reversal of the RTT-like symptoms in a mouse model. See Tropea et al., 2009, Proc Natl Acad Sci USA 106:2029-2034. We treated RTT-derived neurons carrying different MeCP2 mutations in culture with IGF1 and observed an increase in glutamatergic synapse number, suggesting that the drug treatment could correct the RTT neuronal phenotype. See FIG. 4B and FIG. 10B.
It is believed that around 60% of MeCP2 mutations in RTT are nonsense mutations. See Laccone et al., 2001, Hum Mutat 17:183-190. Thus, we tested whether we could increase MeCP2 expression levels in affected neurons by suppressing the nonsense mutation (Q244X) with read-through of the premature stop codon using pharmacological treatments. For example, high concentrations of aminoglycosides antibiotics, such as gentamicin and the like as known in the art, can bind to the 16S rRNA, impairing ribosomal proofreading. See Kellermayer, 2006, Eur J Med Genet 49:445-450. As a consequence, a full-length protein is produced by incorporating random amino acid at the stop codon position. We treated RTT-Q244X clones 3- and 4-derived neurons with two different doses of gentamicin and found that MeCP2 protein levels and glutamatergic synapse numbers were increased after 1 week. See FIGS. 4G and 10E. Treatment with higher gentamicin dose (400 ug/ml) for the same period did not rescue RTT neurons and lowered the number of VGLUT1 puncta in control neurons. See FIG. 4G.
Accordingly, without wishing to be bound by any theory, it is believed that RTT patient-derived neurons display changes in neuronal morphology and in number of synapses, which belief prompted us, e.g., to explore putative circuit alterations in vitro.
Altered Activity-Dependent Calcium Transients in RTT-iPSC-Derived Cells
Early in neural development, spontaneous electrical activity leads to increases in intracellular calcium levels and activation of signaling pathways that are important in regulating several neuronal processes. See Spitzer et al., 2004, Trends Neurosci 27:415-421. Recently, a disturbance in calcium homeostasis during early postnatal development was reported in a MeCP2 knockout model. See Mironov et al., 2009, J Physiol 587:2473-2485. Moreover, several studies have shown that functional mutations in genes encoding voltage-gated calcium channels and in genes whose activity is modulated by calcium, such as MeCP2, could lead to ASD. See e.g., Splawski et al., 2006, J Biol Chem 281:22085-22091; Zhou et al., 2006, Neuron 52:255-269. Neuronal activity-induced calcium influx can trigger the calcium/calmodulin-dependent protein kinase (CamK). CamK activation has been reported to induce phosphorylation of MeCP2, which was further postulated to regulate neuronal spine maturation. See e.g., Tao et al., 2009, Proc Natl Acad Sci USA 106:4882-4887; Zhou et al., 2006, Id. Although these studies raised an interesting link between neuronal activity and spine maturation, the extent of cellular alteration in human ASD neurons was never characterized. To test if RTT-iPSCs-derived neuronal networks are affected in our system, we pre-loaded the cells with the calcium indicator fluo-4AM and highlighted neurons using the Syn::DsRed vector. Cultures with similar cell density and numbers of DsRed-positive neurons were used. See FIG. 8B. Spontaneous calcium transients were analyzed from WT and RTT neuronal networks in several independent experiments over time. See FIGS. 5A-5B.
In our analyses, we considered calcium transients generated by synaptic activity. Neurons were selected after confirmation that calcium transients were blocked with TTX or with the glutamate receptor antagonists CNQX (AMPA) and APV (NMDA) treatments, indicating neuronal signaling dependence on local synaptic connections. See FIGS. 11A, 11B, 11D. Gabazine, an antagonist of GABAa receptors, increased the number of calcium transients in the networks, indicating the presence of glutamatergic and gabaergic synapses in our system. See FIGS. 11C-11D. A representative example of calcium tracing in control and RTT neurons is depicted in FIG. 5A and shows a sharp increase in amplitude followed by a decrease over time. The frequency of calcium oscillations in RTT neurons and in WT neurons expressing shMeCP2 was abnormally decreased when compared to controls, suggesting a deficiency in the neuronal network connectivity and activity dynamics. See FIGS. 5B-5C and FIGS. 11E and 11F. The deficiency in connectivity was further corroborated by a decrease in the percentage of Syn::DsRed-positive neurons exhibiting calcium transients in the RTT cultures when compared to controls. See FIG. 5D and FIG. 11F.
Decreased Frequency of Spontaneous Postsynaptic Currents in RTT Neurons
The functional maturation of the iPSC-derived neurons was further determined using electrophysiological methods. Whole-cell recordings were performed from cells that had differentiated for at least 6 weeks in culture. Neurons were visualized by infection with the Syn::EGFP viral vector. See FIG. 6A. Both WT and RTT neurons showed similar transient sodium inward currents, sustained potassium outward currents in response to voltage step depolarizations, and action potentials evoked by somatic current injections. See FIG. 6B. Therefore, the data indicate that WT and RTT reprogramming did not affect the ability of WT-iPSC- and RTT-iPSC-derived neurons to mature and become electrophysiologically active. Spontaneous excitatory and inhibitory postsynaptic currents (sEPSCs and sIPSCs) were recorded as a way of measuring intercellular connectivity and network formation. See FIGS. 6B-6C. Cumulative probability plots of amplitudes and inter-event intervals of spontaneous postsynaptic currents revealed that RTT neurons have a significant decrease in frequency and amplitude when compared to WT neurons. See FIGS. 6D-6E. Together, our data suggest that the neuronal network is altered in RTT iPSC-derived cultures.
Discussion
The lack of detectable symptoms in female RTT patients until 6-18 months of age and the apparent phenotypic reversibility of some RTT phenotypes in MeCP2 knockout animals indicate that MeCP2 is not essential for early wiring of the nervous system but instead may only be required at late stages. It is possible that RTT patients have aberrant excitatory synaptic strength at very early stages, when the disease phenotype is not yet clearly observed. In fact, increasing evidence from clinical studies and mouse models indicates the presence of alterations during the so-called pre-symptomatic developmental phase. See e.g., Charman et al., 2002, Brain Dev 24:281-283; De Filippis et al., 2010, Genes Brain Behav 9:213-233; Kerr et al., 1987, Brain Dev 9:487-490; Picker et al., 2006, Neuroreport 17:541-544; Santos et al., 2007, Genes Brain Behav 6:277-286.
To study human RTT neurons in culture, we derived iPSCs from RTT fibroblasts. RTT iPSCs are pluripotent and able to recapitulate X-inactivation upon neuronal differentiation. Even though the ratio of neurons expressing mutant MeCP2 due to X-inactivation was variable, the phenotypes described here for all RTT-derived neurons are similar. One interpretation could be that astrocytes, or other non-neuronal cells, carrying MeCP2 mutations present in our cultures could also affect neurons expressing the normal MeCP2 protein. In fact, the non-cell autonomous influence was recently described for RTT, indicating that glial cells carrying MeCP2 mutations can distress healthy neurons. See e.g., Ballas et al., 2009, Nat Neurosci 12:311-317; Kishi & Macklis, Exp Neurol 222:51-58; Maezawa et al., 2009, J Neurosci 29:5051-5061.
Using human neurons carrying MeCP2 mutations, we showed that RTT glutamatergic neurons have a reduced number of synapses and dendritic spines when compared to non-affected controls. Moreover, electrophysiological recordings from RTT neurons showed a significant decrease in the frequency and amplitude of spontaneous synaptic currents compared to WT neurons. The reduced frequency in RTT neurons could reflect the presence of fewer release sites or a decreased release probability. The results of electrophysiology recordings are consistent with the decreased V-GLUT1 puncta observed in Map2-positive dendrites from RTT neurons. Also consistent with these findings, the frequency of intracellular calcium transients was decreased in RTT neurons when compared to controls. Our data indicate a potential imbalance in the neuronal networks associated with RTT pathology. The observations described here provide valuable information for RTT and, potentially, ASD patients, since they suggest that pre-symptomatic defects may represent novel biomarkers to be exploited as diagnostic tools and that early intervention may be beneficial.
Therapies aiming at earlier stages of development may attenuate the downstream consequences of MeCP2 mutations. Restoring protein levels may be challenging, since MeCP2 levels are tightly regulated and chronically overdosing neurons with the WT allele can be as harmful as a loss of expression. See e.g., Collins et al., 2004, Hum Mol Genet 13:2679-2689; Ramocki et al., 2009, Ann Neurol 66:771-782; Van Esch et al., 2005, Am J Hum Genet 77:442-453. Thus, we tested pharmacological treatment as a way to recover the RTT neuronal phenotype. We investigated the use of IGF1 in human neuronal cultures. Without wishing to be bound by any theory, IGF1 is considered to be a candidate for pharmacological treatment of RTT and potentially other CNS disorders in a future clinical trial. See Tropea et al., Id. While IFG1 treatment increased synapse number in some clones, it stimulated glutamatergic RTT neurons above normal levels. Our data indicate that the IGF1 dose and timing parameters need to be precisely tuned in future clinical trials to avoid side effects. In a different approach, we tested a read-through drug (gentamicin) to rescue neurons derived from iPSCs carrying a nonsense MeCP2 mutation. A lower dosage of gentamicin was enough to increase full-length MeCP2 levels in RTT neurons, rescuing glutamatergic synapses.
The gain and loss of function data provided herein strongly suggest that MeCP2 is indeed the causative agent of the cellular phenotypes reported here that might be relevant to the clinical features of RTT. Indeed, the present data indicate that iPSCs not only can recapitulate some aspects of a genetic disease but also can be used to better design and anticipate results from translational medicine. This cellular model has the potential to lead to the discovery of new compounds to treat RTT and other forms of ASD. Finally, without wishing to be bound by any theory, it is believed that other CNS diseases may be modeled in vitro using a similar approach.
In summary, we have developed a human model of RTT by generating iPSCs from fibroblasts of RTT patients carrying different MeCP2 mutations and unaffected individuals. We show that RTT-iPSCs retain the capacity to generate proliferating neural progenitor cells (NPCs) and functional neurons that undergo X-inactivation. We observed a reduced number of dendritic spines and synapses in iPSC-derived neurons. Moreover, we detected an altered frequency of intracellular calcium spikes and electrophysiological defects in RTT-derived neuronal networks, revealing new biomarkers for RTT pathology. Gain and loss of function experiments in iPSC-derived neurons confirmed that some of the alterations observed were related to MeCP2 expression levels. Finally, we used the iPSC system to test candidate drugs to rescue synaptic deficiency in RTT neurons. Without wishing to be bound by any theory, it is believed that RTT and other complex CNS diseases can be modeled using iPSC technology to investigate the cellular and molecular mechanisms underlying their abnormalities.

Claims (4)

What is claimed is:
1. An in vitro method for preparing an X chromosome inactivated female human neuronal cell comprising introducing nucleic acids encoding Oct4, c-Myc, Klf4 and Sox2 proteins into a somatic cell derived from a female human subject with Rett syndrome, wherein the cell comprises a mutated endogenous MeCP2 gene, wherein the nucleic acids are comprised in one or more retroviral vectors, wherein the proteins are expressed by the cell thereby generating an induced pluripotent stem cell (iPSC), culturing the iPSC under human embryonic stem cell (hESC) culture conditions, identifying and isolating an iPSC comprising two active X chromosomes, differentiating the iPSC comprising two active X chromosomes into a neuronal cell in vitro, wherein the neuronal cell exhibits a reduction in the frequency of intracellular calcium transients or the transient rise of intracellular calcium levels, and a decrease in the frequency and amplitude of spontaneous excitatory and inhibitory postsynaptic currents, compared to a control cell without the mutated endogenous MeCP2 gene, wherein upon differentiation one of the two active X chromosomes is inactivated, selecting a neuronal cell comprising an active X chromosome comprising the mutated MeCP2 gene, and determining the neural functionality of the neuronal cell.
2. The method of claim 1, wherein said human female somatic cell comprises a first X chromosome and a second X chromosome, wherein said first X chromosome is active and said second X chromosome is inactive, and wherein said second X chromosome comprises the mutated MeCP2 gene.
3. An in vitro method for preparing an X chromosome inactivated female human neural cell comprising introducing nucleic acids encoding Oct4, c-Myc, Klf4 and Sox2 proteins into a somatic cell derived from a female human subject with Rett syndrome, wherein the cell comprises a mutated endogenous MeCP2 gene, wherein the nucleic acids are comprised in one or more retroviral vectors, wherein the proteins are expressed by the cell thereby generating an induced pluripotent stem cell (iPSC), culturing the iPSC under human embryonic stem cell (hESC) culture conditions, identifying and isolating an iPSC comprising two active X chromosomes, differentiating the iPSC comprising two active X chromosomes into a neural cell in vitro, wherein the neural cell exhibits a reduction in the frequency of intracellular calcium transients or the transient rise of intracellular calcium levels, and a decrease in the frequency and amplitude of spontaneous excitatory and inhibitory postsynaptic currents, compared to a control cell without the mutated endogenous MeCP2 gene, wherein upon differentiation one of the two active X chromosomes is inactivated, and selecting a neural cell comprising an active X chromosome comprising the mutated MeCP2 gene.
4. The method of claim 3, wherein said human female somatic cell comprises a first X chromosome and a second X chromosome, wherein said first X chromosome is active and said second X chromosome is inactive, and wherein said second X chromosome comprises the mutated MeCP2 gene.
US13/518,842 2009-12-23 2010-12-23 Method for preparing an X chromosome inactivated female human neural cell Expired - Fee Related US9696297B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/518,842 US9696297B2 (en) 2009-12-23 2010-12-23 Method for preparing an X chromosome inactivated female human neural cell

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US28986309P 2009-12-23 2009-12-23
US13/518,842 US9696297B2 (en) 2009-12-23 2010-12-23 Method for preparing an X chromosome inactivated female human neural cell
PCT/US2010/062080 WO2011079307A2 (en) 2009-12-23 2010-12-23 Methods and compositions for treating neurological disorders

Publications (2)

Publication Number Publication Date
US20130004985A1 US20130004985A1 (en) 2013-01-03
US9696297B2 true US9696297B2 (en) 2017-07-04

Family

ID=44196423

Family Applications (1)

Application Number Title Priority Date Filing Date
US13/518,842 Expired - Fee Related US9696297B2 (en) 2009-12-23 2010-12-23 Method for preparing an X chromosome inactivated female human neural cell

Country Status (2)

Country Link
US (1) US9696297B2 (en)
WO (1) WO2011079307A2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013163455A2 (en) * 2012-04-25 2013-10-31 The Regents Of The University Of California A drug screening platform for rett syndrome
US9833519B2 (en) 2012-09-25 2017-12-05 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for the diagnosis and treatment of sjögren's syndrome
US11129844B2 (en) 2015-03-03 2021-09-28 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating MECP2 expression
US10961532B2 (en) * 2015-04-07 2021-03-30 The General Hospital Corporation Methods for reactivating genes on the inactive X chromosome
ES2794628T3 (en) * 2015-04-15 2020-11-18 Univ Massachusetts Compositions and methods for the reactivation of chromosomes XI
AU2016335563B2 (en) 2015-10-08 2022-10-27 Neurona Therapeutics Inc. Neural precursor cell populations and uses thereof
WO2018230505A1 (en) * 2017-06-12 2018-12-20 国立大学法人京都大学 Method for screening drugs for treatment of x-linked sideroblastic anemia
CN112159793B (en) * 2020-09-11 2023-10-27 希诺谷(江苏)生物科技有限公司 Application of stem cells of dental pulp of deciduous teeth of human being
JP2023140198A (en) * 2022-03-22 2023-10-04 株式会社リコー In vitro genetic disease model cells and their production method
JP2025532127A (en) 2022-09-23 2025-09-29 アイオーニス ファーマシューティカルズ, インコーポレーテッド Compounds and methods for reducing MECP2 expression

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2683056A1 (en) * 2007-04-07 2008-10-16 Whitehead Institute For Biomedical Research Reprogramming of somatic cells
US20090047263A1 (en) * 2005-12-13 2009-02-19 Kyoto University Nuclear reprogramming factor and induced pluripotent stem cells
US20090136456A1 (en) 2006-12-22 2009-05-28 Yadong Huang Methods of treating neurodegenerative disorders
US20100184051A1 (en) * 2007-05-30 2010-07-22 The General Hospital Corporation Methods of generating pluripotent cells from somatic cells

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090047263A1 (en) * 2005-12-13 2009-02-19 Kyoto University Nuclear reprogramming factor and induced pluripotent stem cells
US20090136456A1 (en) 2006-12-22 2009-05-28 Yadong Huang Methods of treating neurodegenerative disorders
CA2683056A1 (en) * 2007-04-07 2008-10-16 Whitehead Institute For Biomedical Research Reprogramming of somatic cells
US20100184051A1 (en) * 2007-05-30 2010-07-22 The General Hospital Corporation Methods of generating pluripotent cells from somatic cells

Non-Patent Citations (75)

* Cited by examiner, † Cited by third party
Title
Amir, et al., "Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2", Nature Genetics, 23:185-188 (1999).
Amir, et al., "Rett Syndrome: Methyl-CpG-Binding protein 2 mutations and phenotype-genotype correlations", American Journal of Medical Genetics, 97:147-152 (2000).
Bain et al. "Embryonic stem cells express neuronal properties in vitro." Dev Biol. Apr. 1995;168(2):342-57. *
Ballas, et al., "Non-cell autonomous influence of MeCP2-deficient glia neuronal dendritic morphology", Nature Neuroscience, 12(3):311-317 (2009).
Chahrour, et al., "Material for MeCP2, a key contributor to neurological disease, activates and represses transcription", Science, 320:1224-1229 (2008).
Chahrour, et al., "Supporting Online Material for MeCP2, a key contributor to neurological disease, activates and represses transcription", Science, 320: 208 pages (2008).
Chao, et al., "MeCP2 controls excitatory synaptic strength by regulating glutamatergic synapse number", Neuron, 56:58-65 (2007) (Supplemental Data).
Chao, et al., "MeCP2 controls excitatory synaptic strength by regulating glutamatergic synapse number", Neuron, 56:58-65 (2007).
Chapleau, et al., "Dendritic spine pathologies in hippocampal pyramid neurons from Rett syndrome brain and after expression of Rett-associated MECP2 mutations", Neurobiology of Disease, 35:219-233 (2009).
Collins, et al., "Mild overexpression of MeCP2 causes a progressive neurological disorder in mice", Human Molecular Genetics, 13(21):2679-2689 (2004).
Collins, et al., "Mild overexpression of MeCP2 causes a progressive neurological disorder in mice", Human Molecular Genetics, 13(21):2679-2689 (Supplemental Captions) (2004).
Collins, et al., "Mild overexpression of MeCP2 causes a progressive neurological disorder in mice", Human Molecular Genetics, 13(21):2679-2689 (Supplemental Figure 1) (2004).
Collins, et al., "Mild overexpression of MeCP2 causes a progressive neurological disorder in mice", Human Molecular Genetics, 13(21):2679-2689 (Supplemental Figure 2) (2004).
Collins, et al., "Mild overexpression of MeCP2 causes a progressive neurological disorder in mice", Human Molecular Genetics, 13(21):2679-2689 (Supplemental Figure 3) (2004).
Collins, et al., "Mild overexpression of MeCP2 causes a progressive neurological disorder in mice", Human Molecular Genetics, 13(21):2679-2689 (Supplemental Table 1) (2004).
Courchesne, et al., "Evidence of brain overgrowth in the first year of life in Autism", JAMA, 290(3):337-344 (2003).
De Filippis, et al., "Early postnatal behavioral changes in the Mecp2-308 truncation mouse model of Rett syndrome", Genes, Brain and Behavior, 9:213-223 (2010).
Dhara, et al., Gene trap as a tool for genome annotation and analysis of X chromosome inactivation in human embryonic stem cells, Nucleic Acids Research, 32(13):3998-4002 (2004).
Dimos, et al., "Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons", Science, 321:1218-1221 (2008).
Ebert, et al., "Induced pluripotent stem cells from a spinal muscular atrophy patient", Nature, 457:277-280 (2009).
Esch et al. "A unique Oct4 interface is crucial for reprogramming to pluripotency." Nat Cell Biol. Mar. 2013;15(3):295-301. *
Giacometti, et al., "Partial rescue of MeCP2 deficiency by postnatal activation of MeCP2", PNAS, 104(6):1931-1936 (2007).
Gonzalez et al. "Generation of mouse-induced pluripotent stem cells by transient expression of a single nonviral polycistronic vector." Proc. Natl. Acad. Sci.Okita U S A. Jun. 2, 2009;106(22):8918-22. Epub May 19, 2009. *
Hagberg, et al., "Head growth in Rett syndrome", Brian & Development, 23:S227-S229 (2001).
Hammer, et al., "The phenotypic consequences of MECP2 mutations extend beyond Rett syndromw", Mental Retardation and Developmental Disabilities Research Reviews, 8:94-98 (2002).
Hoffbuhr et al. "Associations between MeCP2 mutations, X-chromosome inactivation, and phenotype." Ment Retard Dev Disabil Res Rev. 2002;8(2):99-105. *
Hotta et al. "Isolation of human iPS cells using EOS lentiviral vectors to select for pluripotency." Nature Methods (May 2009); 6: pp. 370-376. *
Hotta, et al., "Isolation of human iPS cells using EOS lentiviral vectors to select for pluripotency", Nature Methods, 6(5):370-376 (2009).
Hotta, et al., "Isolation of human iPS cells using EOS lentiviral vectors to select for pluripotency", Nature Methods, 6(5):370-376 (Supplemental Figures and Text) (2009).
Jensen et al. "Strengths and Limitations of the Neurosphere Culture System." Mol Neurobiol. Dec. 2006;34(3):153-61. *
Kim et al. "Direct reprogramming of mouse fibroblasts to neural progenitors." Proc. Natl. Acad Sci U S A. May 10, 2011;108(19):7838-43. Epub Apr. 26, 2011. *
Kishi, et al., "MeCP2 functions largely cell-autonomously, but also non-cell-autonomously, in neuronal maturation and dendritic arborization of cortical pyramidal neurons", Experimental Neurology, 222:51-58 (2010).
Laccone, et al., "Mutation spectrum in patients with Rett syndrome in the German population: Evidence of hot spot regions", Human Mutation, 17:183-190 (2001).
Lee, et al., "Modelling pathogenesis and treatment of familial dysautonomia using patient-specific iPSCs", Nature, 461:402-406 (2009).
Lee, et al., "Modelling pathogenesis and treatment of familial dysautonomia using patient-specific iPSCs", Nature, 461:402-406 (Supplemental Data) (2009).
Lewitzky et al. "Reprogramming somatic cells towards pluripotency by defined factors." Curr Opin Biotechnol. Oct. 2007;18(5):467-73. *
Luikenhuis et al. "Expression of MeCP2 in postmitotic neurons rescues Rett syndrome in mice." Proc Natl Acad Sci U S A. Apr. 20, 2004;101(16):6033-8. *
Maezawa, et al., Rett syndrome astrocytes are abnormal and spread MeCP2 deficiency through gap junctions, The Journal of Neuroscience, 29(16):5051-5061 (2009).
Maezawa, et al., Rett syndrome astrocytes are abnormal and spread MeCP2 deficiency through gap junctions, The Journal of Neuroscience, 29(16):5051-5061 (Supplemental Material) 2009.
Maherali, et al., "Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution", Cell Stem Cell, 1:55-70 (2007).
Makedonski et al. "MeCP2 deficiency in Rett syndrome causes epigenetic aberrations at the PWS/AS imprinting center that affects UBE3A expression." Hum Mol Genet. Apr. 15, 2005;14(8):1049-58. Epub Mar. 9, 2005. *
Marchetto, et al., "A model for neural development and treatment of Rett syndrome using human induced pluripotent stem cells", Cell, 143:527-239 (2010).
Marchetto, et al., "Non-cell-autonomous effect of human SOD1G37R astrocytes on motor neurons derived from human embryonic stem cells", Cell Stem Ceel, 3:649-657 (2008).
Minks et al. "A skewed view of X chromosome inactivation." J. Clin. Invest. (2008);118(1):pp. 20-23. *
Mironov, et al., "Remodelling of the respiratory network in a mouse model of Rett syndrome depends on brain-derived neurotrophic factor regulated slow calcium buffering", J. Physiol., 11:2473-2485 (2009).
Muotri, "Modeling epilepsy with pluripotent human cells", Epilepsy & Behavior, 14:81-85 (2009).
Niwa et al. "Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells." Nat Genet. Apr. 2000;24(4):372-6. *
Okita et al. "Generation of mouse induced pluripotent stem cells without viral vectors." Science. Nov. 7, 2008;322(5903):949-53. 1164270. Epub Oct. 9, 2008. *
Park, et al., "Disease-specific induced pluripotent stem cells", Cell, 134:877-886 (2008).
Ramocki, et al., "Autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome", Ann. Neurol., 66:771-782 (2009).
Samaco, et al., "Epigenetic overlap in autism-spectrum neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and GABRB3", Human Molecular Genetics, 14(4):483-492 (2005).
Samaco, et al., "Multiple pathways regulate MeCP@ expression in normal brain development and exhibit defects in autism-spectrum disorders", Human Molecular Genetics, 13(6):629-639 (2004).
Santos, et al., "Evidence for abnormal early development in a mouse model of Rett syndrome", Genes, Brain and Behavior, 6:277-286 (2007).
Soldner, et al., "Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogamming factors", Cell, 136:964-977 (2009).
Spitzer, et al,, "Orchestrating neuronal differentiation: patterns of Ca2+ spikes specify transmitter choice", Trends in Neurosciences, 27(7):415-421 (2004).
Splawski, et al., "CACNA1H Mutations in autism spectrum disorders", The Journal of Biological Chemistry, 281(31):22085-22091 (2006).
Stadtfeld et al. "Induced pluripotent stem cells generated without viral integration." Science. Nov. 7, 2008;322(5903):945-949. 1162494. Epub Sep. 25, 2008. *
Takahashi, et al., "Induction of pluripotent stem cells from adult human fibroblasts by defined factors", Cell, 131:861-872 (2007).
Tao, et al., "Phosphorylation of MeCP2 at serine 80 regulates its chromatin association and neurological function", PNAS, 106(12):4882-4887 (2009).
Traynor, et al., "Gene expression patterns vary in clonal cell cultures from Rett syndrome females with eight different MECP2 mutations", BMC Medical Genetics, 3: 15 pages (2002).
Tropea, et al., "Partial reversal of Rett syndrome-like symptoms in MeCP2 mutant mice", PNAS, 106(6):2029-2034 (2009).
Tudor, et al., "Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain", PNAS, 99(24): Figure 3 (2002).
Tudor, et al., "Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain", PNAS, 99(24): Figure 4 (2002).
Tudor, et al., "Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain", PNAS, 99(24): Table 3 (2002).
Tudor, et al., "Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain", PNAS, 99(24): Table 4 (2002).
Tudor, et al., "Transcriptional profiling of a mouse model for Rett syndrome reveals subtle transcriptional changes in the brain", PNAS, 99(24):15536-15541 (2002).
Van Esch, et al., "Duplication of the MECP2 region is a frequent cause of severe mental retardation and progressive neurological symptoms in males", Am. J. Hum. Genet., 77:442-453 (2005) (Supplemental Data).
Van Esch, et al., "Duplication of the MECP2 region is a frequent cause of severe mental retardation and progressive neurological symptoms in males", Am. J. Hum. Genet., 77:442-453 (2005).
Yamanaka, S. "Induction of pluripotent stem cells from mouse fibroblasts by four transcription factors." Cell Prolif. Feb. 2008;41 Suppl 1:51-6. *
Yamanka, "A fresh look at iPS Cells", Cell, 137:13-17 (2009).
Yasui, et al., :Integrated epigenomic analyses of neuronal MeCP2 reveal a role for long-range interaction with active genes, PNAS, 104(49):19416-19421 (2007).
Yeo, et al., :Alternative splicing events identified in human embryonic stem cells and neural progenitors, PLoS, 3(10):e196 (pp. 1951-1967) (2007).
Zapella, et al., "Study of MECP2 gene in Rett syndrome variants and autistic girls", American Journal of Medical Genetics Part B (Neuropsychiatric Genetics), 119B:102-107 (2003).
Zhou, et al., "Brain-specific phosphorylation of MeCP2 regulates activity-dependent Bdnftranscription, dendritic growth, and spine maturation", Neuron, 52:255-269 (2006).
Zoghbi, "Postnatal neurodevelopmental disorders: Meeting at the synapse?", Science, 302:826-830 (2003).

Also Published As

Publication number Publication date
US20130004985A1 (en) 2013-01-03
WO2011079307A2 (en) 2011-06-30
WO2011079307A3 (en) 2011-11-10

Similar Documents

Publication Publication Date Title
US9696297B2 (en) Method for preparing an X chromosome inactivated female human neural cell
Marchetto et al. A model for neural development and treatment of Rett syndrome using human induced pluripotent stem cells
Moyon et al. TET1-mediated DNA hydroxymethylation regulates adult remyelination in mice
Ishii et al. In vitro modeling of the bipolar disorder and schizophrenia using patient-derived induced pluripotent stem cells with copy number variations of PCDH15 and RELN
Andoh-Noda et al. Differentiation of multipotent neural stem cells derived from Rett syndrome patients is biased toward the astrocytic lineage
Le Grand et al. Neural stem cells in Parkinson’s disease: a role for neurogenesis defects in onset and progression
Song et al. Neural differentiation of patient specific iPS cells as a novel approach to study the pathophysiology of multiple sclerosis
JP6774333B2 (en) Methods for Producing Age-Modified Cells and Age-Modified Cells
US20170363618A1 (en) Age-modified cells and methods for making age-modified cells
Li et al. Shp2-dependent ERK signaling is essential for induction of Bergmann glia and foliation of the cerebellum
US20120129835A1 (en) Schizophrenia methods and compositions
Gracia-Diaz et al. Gain and loss of function variants in EZH1 disrupt neurogenesis and cause dominant and recessive neurodevelopmental disorders
Mao et al. Distinctive in vitro phenotypes in iPSC-derived neurons from patients with gain-and loss-of-function SCN2A developmental and epileptic encephalopathy
Rylaarsdam et al. iPSC-derived models of PACS1 syndrome reveal transcriptional and functional deficits in neuron activity
KR102187148B1 (en) Methods for providing information on the diagnosis of sporadic Parkinson&#39;s disease and drug screening methods
Musante et al. CACNA1A loss-of-function affects neurogenesis in human iPSC-derived neural models: I. Musante et al.
Nieto-Estevez et al. Dual effects of ARX poly-alanine mutations in human cortical and interneuron development
Hettige Characterizing the Functional Role of FOXG1 on Neurodevelopment and Disease
US20230042176A1 (en) Method for treating angelman syndrome and related disorders
Lima et al. Integrated multiomic profiling of SCN2A loss-of-function reveals widespread molecular remodeling in patient hiPSC-derived neurons
Lépine et al. Homozygous ALS-linked mutations in TARDBP/TDP-43 lead to progressive synaptic dysfunction in human iPSC-derived motor neurons
Nakamura et al. Chromosome 2q31. 2 Deletion Impairs Neuronal Plasticity through Integrated Stress Response Activation
Boshans The Neurogenic Fate Potential of OPCs
Steinberg et al. WWOX deficiency impairs neurogenesis and neuronal function in human organoids
Minotti High Throughput Approaches to Advance Human Pluripotent Stem Cell Models of Neurodegeneration

Legal Events

Date Code Title Description
AS Assignment

Owner name: SALK INSTITUTE FOR BIOLOGICAL STUDIES, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MUOTRI, ALYSSON;GAGE, FRED H.;MARCHETTO, MARIA C.N.;REEL/FRAME:029028/0189

Effective date: 20101101

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20250704