US9296995B2 - Vaccines against Bordetella pertussis based on LPS glycosyltransferase mutants - Google Patents

Vaccines against Bordetella pertussis based on LPS glycosyltransferase mutants Download PDF

Info

Publication number
US9296995B2
US9296995B2 US12/593,346 US59334608A US9296995B2 US 9296995 B2 US9296995 B2 US 9296995B2 US 59334608 A US59334608 A US 59334608A US 9296995 B2 US9296995 B2 US 9296995B2
Authority
US
United States
Prior art keywords
cell
lps
wild
acid sequence
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US12/593,346
Other versions
US20100291153A1 (en
Inventor
Jeroen Johannes Gerardus Geurtsen
Johannes Petrus Maria Tommassen
Peter André Van Der Ley
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nederlanden Staat
Original Assignee
Nederlanden Staat
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nederlanden Staat filed Critical Nederlanden Staat
Assigned to DE STAAT DER NEDERLANDEN, VERT. DOOR DE MINISTER VAN VWS reassignment DE STAAT DER NEDERLANDEN, VERT. DOOR DE MINISTER VAN VWS ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: GEURTSEN, JEROEN JOHANNES GERARDUS, TOMMASSEN, JOHANNES PETRUS MARIA, VAN DER LEY, PETER ANDRE
Publication of US20100291153A1 publication Critical patent/US20100291153A1/en
Application granted granted Critical
Publication of US9296995B2 publication Critical patent/US9296995B2/en
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/14Antitussive agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/235Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bordetella (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K2039/10Brucella; Bordetella, e.g. Bordetella pertussis; Not used, see subgroups
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/099Bordetella
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to an improved vaccine against pertussis comprising mutants of Bordetella pertussis having a modified LPS molecule and/or the LPS molecules obtainable from these mutants. These mutants and/or the obtainable LPS molecules may further be used as an adjuvant.
  • LPS is an amphiphilic molecule located in the outer leaflet of the outer membrane of Gram-negative bacteria. LPS possesses both endotoxic activity and adjuvant activity. Both properties are based upon its recognition by the host TLR4/MD-2 receptor complex (reviewed in P ⁇ lsson-McDermott and O'Neill, 2004; O'Neill, 2006). LPS consists of three distinct structural domains: lipid A, the core, and the O-antigen. Lipid A functions as a hydrophobic membrane anchor and forms the bioactive component of the molecule (Takada and Kotani, 1989). The core region consists of a complex oligosaccharide, which, as compared to the O-antigen, shows only limited structural variability.
  • the core oligosaccharide can be divided into an inner core and an outer core.
  • the outer core primarily consists of pyranosidic hexoses, e.g., D-glucose, D-galactose, and D-glucosamine, whereas the inner core primarily consists of octulosonic acids and heptopyranoses.
  • the core domain is connected to the lipid A domain by a specific carbohydrate, 2-keto-3-deoxyoctulosonic acid (Kdo) (Raetz and Whitfield, 2002).
  • the O-antigen comprises the most variable part of the LPS and confers bacteria serotype specificity. It is composed of repeating sugar subunits of one to eight sugars. Each O-chain can contain up to 50 of these subunits.
  • the O-antigen has been implicated in bacterial immune escape, especially the escape from serum complement-mediated lysis (Raetz and Whitfield, 2002).
  • B. pertussis LPS is often referred to as lipooligosaccharide.
  • B. pertussis produces two dominant LPS forms, band A and band B LPS (Peppler, 1984).
  • Band B LPS is composed of lipid A and a core oligosaccharide consisting of 9 carbohydrates (Caroff et al., 2000).
  • band A Addition of a terminal trisaccharide, consisting of N-acetyl glucosamine, 2,3-diacetamido-2,3-dideoxy-mannuronic acid, and 2-acetamido-4-N-methyl-2,4-dideoxy-fucose, to band B LPS forms the LPS referred to as band A.
  • a terminal trisaccharide consisting of N-acetyl glucosamine, 2,3-diacetamido-2,3-dideoxy-mannuronic acid, and 2-acetamido-4-N-methyl-2,4-dideoxy-fucose
  • the core OS biosynthesis gene cluster consists of three operons, designated the gmhD, waaQ, and WaaA operons.
  • the gmhD operon consists of four genes, gmhD and waaFCL, which are involved in the synthesis of the inner core (Schnaitman and Klena, 1993).
  • the gmhD, waaF, and waaC genes encode proteins involved in the biosynthesis and transfer of Heptoses I and II to Kdo 2 -lipid A (Schnaitman and Klena, 1993), whereas the waaL gene product is a ligase that is involved in the attachment of the O-antigen (MacLachlan et al., 1991).
  • the waaQ operon is the largest of the three operons and encodes proteins that are involved in the biosynthesis of the outer core and in modification/decoration of the core OS. The number and types of genes present within in the waaQ operon differs per strain, which explains the strain-specific differences in core composition (Heinrichs et al., 1998).
  • the waaA operon often encodes only one protein, KdtA. Only in E. coli K-12, an additional non LPS-related open reading frame (ORF) is present (Raetz and Whitfield, 2002).
  • ORF open reading frame
  • the kdtA gene of Enterobacteriaceae encodes the bifunctional Kdo transferase that adds the two Kdo residues in the Kdo 2 -lipid A biosynthesis (Clementz and Raetz, 1991).
  • the Bordetella and E. coli core OS show some resemblance, the exact composition and configuration of residues display marked differences.
  • the Bordetella core OS contains only one Kdo residue, instead of the two or three residues that are found in most other Gram-negative bacteria, including E. coli .
  • the enzymes responsible for the synthesis of the remaining portion of the Bordetella core OS are currently unknown and await further identification.
  • the oligosaccharide region can also play an important role in its interaction with antigen-presenting cells (APCs).
  • APCs antigen-presenting cells
  • Receptors implicated in this type of LPS recognition include the complement receptor CR3 and the scavenger receptor SR-A (van Amersfoort et al., 2003; Plüddemann et al., 2006).
  • pertussis cases were predominantly reported in young children, adults and adolescents have accounted for an increasing proportion of the cases in recent years.
  • reasons for the re-emergence of reported pertussis have been proposed, including: (1) genetic changes in circulating B. pertussis strains that decrease vaccine efficacy, (2) reduced potency of pertussis vaccines, (3) waning immunity, (4) increased reporting of pertussis cases, and (5) the improved diagnosis of pertussis disease.
  • the present invention is based on the hypothesis that B. pertussis mutants with an altered oligosaccharide chain might be affected in their interaction with dendritic cells (DC)s.
  • DC dendritic cells
  • APC antigen presenting cells
  • DCs could conceivably affect the outcome of the immune response against a whole-cell pertussis vaccine.
  • the invention provides two polypeptides.
  • the first polypeptide is a polysaccharide deacetylase and has an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:1.
  • the second polypeptide is a glycosyltransferase and has an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:2.
  • the activity of the polysaccharide deacetylase respectively of the glycosyltransferase polypeptide is preferably assessed by overexpressing respectively inactivating the respective encoded gene in a Bordetella pertussis strain as later defined herein and analyzing the obtainable LPS.
  • the LPS produced by the transformed Bordetella pertussis strain comprises at least detectable amounts of the LPS of the invention as later defined herein, the polysaccharide deacetylase, respectively the glycosyltransferase polypeptides would be said to be active and functional.
  • Detectable amounts of LPS are preferably detectable as described in the examples: after isolation with hot phenol/water extraction (Westphal and Jann, 1965), O-deacylation by mild hydrolysis (Holst 2000) and analysis by ESI-MS (Electrospray-ionization Mass spectrometry) in the negative ion-mode.
  • the polypeptide has at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%, even more preferably at least 90%, 92%, 95%, 97%, 98% or 99% identity with the amino acid sequence of SEQ ID NO:1.
  • the polysaccharide deacetylase has the SEQ ID NO:1. This polysaccharide deacetylase originates from Bordetella pertussis .
  • the nucleic acid sequence coding for the amino acid sequence of SEQ ID NO:1 is given in SEQ ID NO:3.
  • the polypeptide has at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%, even more preferably at least 90%, 92%, 95%, 97%, 98% or 99% identity with the amino acid sequence of SEQ ID NO:2.
  • the glycosyltransferase has the SEQ ID NO:2. This glycosyltransferase originates from Bordetella pertussis .
  • the nucleic acid sequence coding for the amino acid sequence of SEQ ID NO:2 is given in SEQ ID NO:4. Percentage of identity is calculated as the number of identical amino acid residues between aligned sequences divided by the length of the aligned sequences minus the length of all the gaps. Multiple sequence alignment was performed using DNAman 4.0 optimal alignment program using default settings. The alignment is usually performed between sequences identified by their SEQ ID NO or parts thereof. Preferably, the alignment is carried out using sequences identified by their SEQ ID NO.
  • each polypeptide as identified above is obtained from a Bordetella species such as pertussis, bronchiseptica, parapertussis . Most preferably, each polypeptide as identified above is obtained from Bordetella pertussis .
  • Bordetella pertussis One single Bordetella pertussis strain or several distinct Bordetella pertussis strains may have several homologues polypeptides according to the present invention.
  • the polypeptide of the invention is a variant of any one of the polypeptide sequences as defined before.
  • a variant polypeptide may be a non-naturally occurring form of the polypeptide.
  • a polypeptide variant may differ in some engineered way from the polypeptide isolated from its native source.
  • a variant may be made by site-directed mutagenesis starting from the amino acid sequence of SEQ ID NO:1 or from SEQ ID NO:2 or from the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:1, which is SEQ ID NO:3, or from the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2, which is SEQ ID NO:4.
  • the polypeptide variant contains mutations that do not alter the biological function of the encoded polypeptide. Biological function or activity of either the polysaccharide deacetylase or the glycosyltransferase has already been defined herein.
  • a polysaccharide deacetylase respectively a glycosyltransferase as earlier defined both being for use for preparing a medicament.
  • said medicament is a vaccine or an adjuvant as later defined herein.
  • the first one codes for a polysaccharide deacetylase having an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:1, preferably having the amino acid sequence SEQ ID NO:1, and/or originating from a Bordetella species, preferably Bordetella pertussis.
  • the first nucleic acid sequence is preferably a nucleic acid sequence having at least 50% identity with the nucleic acid sequence of SEQ ID NO:3.
  • the identity is of at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98% and even more preferably at least 99%.
  • the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:3.
  • SEQ ID NO:3 corresponds to NP_8809668.
  • the second nucleic acid sequence codes for a glycosyltransferase having an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:2, preferably having the amino acid sequence SEQ ID NO:2, and/or originating from a Bordetella species, preferably Bordetella pertussis.
  • the second nucleic acid sequence is preferably a nucleic acid sequence having at least 50% identity with the nucleic acid sequence of SEQ ID NO:4.
  • the identity is of at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98% and even more preferably at least 99%.
  • the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:4.
  • SEQ ID NO:4 corresponds to NP_8809669.
  • Percentage of identity was determined by calculating the ratio of the number of identical nucleotides in the sequence divided by the length of the total nucleotides minus the lengths of any gaps.
  • DNA multiple sequence alignment was performed using DNAman version 4.0 using the Optimal Alignment (Full Alignment) program.
  • the minimal length of a relevant DNA sequence showing 50% or higher identity level should be 40 nucleotides or longer.
  • the alignment is usually performed between sequences identified by their SEQ ID NO or parts thereof. Preferably, the alignment is carried out using sequences identified by their SEQ ID NO.
  • the nucleic acid sequence of the invention is a variant of any of the nucleic acid sequences as defined above.
  • Nucleic acid sequence variants may be used for preparing polypeptide variants as defined earlier.
  • a nucleic acid variant may be a fragment of any of the nucleic acid sequences as defined above.
  • a nucleic acid variant may also be a nucleic acid sequence that differs from SEQ ID NO:3 or SEQ ID NO:4 by virtue of the degeneracy of the genetic code.
  • a nucleic acid variant may also be an allelic variant of SEQ ID NO:3 or SEQ ID NO:4.
  • An allelic variant denotes any of two or more alternative forms of a gene occupying the same chromosome locus.
  • a preferred nucleic acid variant is a nucleic acid sequence, which contains silent mutation(s).
  • a nucleic acid variant may also be obtained by introduction of nucleotide substitutions, which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleic acid sequence, but which corresponds to the codon usage of the host organism intended for production of the polypeptide of the invention.
  • the nucleic acid variant encodes a polypeptide still exhibiting its biological function as earlier defined herein. More preferably, the nucleic acid sequence variant encodes a polypeptide exhibiting polysaccharide deacetylase or glycosyltransferase activity respectively. Nucleic acid sequences encoding such a polypeptide may be isolated from any microorganism.
  • All these variants can be obtained using techniques known to the skilled person, such as screening of library by hybridisation (southern blotting procedures) under low to medium to high hybridisation conditions with for the nucleic acid sequence SEQ ID NO:3 or SEQ ID NO:4 or a variant thereof which can be used to design a probe.
  • Low to medium to high stringency conditions means prehybridization and hybridization at 42° C. in 5 ⁇ SSPE, 0.3% SDS, 200 ⁇ g/ml sheared and denatured salmon sperm DNA, and either 25% 35% or 50% formamide for low to medium to high stringencies respectively.
  • the hybridization reaction is washed three times for 30 minutes each using 2 ⁇ SSC, 0.2% SDS and either 55° C., 65° C., or 75° C. for low to medium to high stringencies.
  • sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases.
  • the skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors.
  • nucleic acid coding for a polysaccharide deacetylase respectively a glycosyltransferase as earlier defined both nucleic acids being for use for preparing a medicament.
  • said medicament is a vaccine or an adjuvant as later defined herein.
  • the invention relates to a nucleic acid construct comprising any of the nucleic acid sequences defined in the former section, said nucleic acid sequence encoding a polypeptide exhibiting:
  • nucleic acid sequence present in the nucleic acid construct is operably linked to one or more control sequences, which direct the production of the polypeptide in a suitable expression host.
  • Operably linked is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the nucleic acid sequence coding for the polypeptide of the invention such that the control sequence directs the production of the polypeptide of the invention.
  • Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.
  • Nucleic acid construct is defined as a nucleid acid molecule, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid which are combined or juxtaposed in a manner which would not otherwise exist in nature.
  • Control sequence is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide. At a minimum, the control sequences include a promoter and trancriptional and translational stop signals.
  • the invention further relates to an expression vector comprising a nucleic acid construct comprising a nucleic acid sequence encoding a polypeptide exhibiting polysaccharide deacetylase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:1 as defined in the former section.
  • the expression vector comprises said nucleic acid sequence, which is operably linked to one or more control sequences, which direct the production of the encoded polypeptide in a suitable expression host.
  • control sequences include a promoter and transcriptional and translational stop signals.
  • the expression vector may be seen as a recombinant expression vector.
  • the expression vector may be any vector (e.g.
  • plasmic, virus which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence encoding the polypeptide.
  • this expression vector will be introduced and on the origin of the nucleic acid sequence of the invention, the skilled person will know how to choose the most suited expression vector and control sequences. Most preferred host cells are presented in the section entitled host cells.
  • an expression vector when introduced into a host cell will lead to a cell having an increased expression level of the nucleic acid sequence present in the expression vector, and/or an increased expression level of the polypeptide encoded by the nucleic acid sequence present in the expression vector and/or an increased activity level of the polypeptide encoded by the nucleic acid sequence present in the expression vector.
  • the increase is assessed by comparison with the host cell which does not comprise said expression vector and/or with the host cell which does not comprise an endogenous polypeptide having at least 50% identity with SEQ ID NO:1.
  • an expression vector as earlier defined being for use for preparing a medicament.
  • said medicament is a vaccine or an adjuvant as later defined herein.
  • the invention further relates to an inactivation vector comprising a nucleic acid construct comprising a nucleic acid sequence encoding a polypeptide exhibiting glycosyltransferase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2 as defined in the former section.
  • An inactivation vector is designed to lower or inactivate the expression of the nucleic acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2 in a given host.
  • the inactivation vector may be seen as a recombinant expression vector.
  • the inactivation vector may be any vector (e.g. plasmic, virus), which can be conveniently subjected to recombinant DNA procedures and can bring about the inactivation of the expression of the nucleic acid sequence as defined above.
  • plasmic, virus e.g. plasmic, virus
  • the skilled person will know how to choose the most suited inactivation vector. Most preferred host cells are presented in the section entitled host cells.
  • an inactivation vector when introduced into a host cell will lead to a cell having a decreased (or lowered) expression level of the nucleic acid sequence present in the expression vector, and/or a decreased expression level of the polypeptide encoded by the nucleic acid sequence present in the expression vector and/or a decreased activity level of the polypeptide encoded by the nucleic acid sequence present in the expression vector.
  • the decrease is preferably assessed by comparison with the host cell which does not comprise said inactivation vector.
  • the decrease of the expression level of the polypeptide exhibiting glycosyltransferase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2 and/or the lowering of its activity level may have been achieved by conventional methods known in the art, such as by inactivating or down-regulating the expression of the endogenous nucleic acid sequence encoding said glycosyltransferase in the host. This inactivation or down regulation may have been achieved by deletion of one or more nucleotides in the nucleic acid sequence encoding said polypeptide.
  • the invention relates to a host, preferably a Bordetella which has a mutation in its nucleic acid sequence encoding said glycosyltransferase.
  • a replacement or inactivation vector is prepared and is subsequently introduced into the host by transformation.
  • the skilled person will know how to construct such a vector.
  • the expression of the nucleic acid sequence encoding the glycosyltransferase can be lowered by fusing it to a weak promoter suitable for low level protein expression in the selected organism.
  • the expression of the nucleic acid sequence encoding the glycosyltransferase may be rendered inducible by fusing it to an inducible promoter suitable for inducible level protein expression in the selected organism.
  • the inactivation of the nucleic acid sequence encoding the endogenous glycosyltransferase is preferably achieved by using a suicide vector. More preferably, the suicide vector is pSS1129 (Stibitz et al, 1994).
  • an inactivation vector as earlier defined for use for preparing a medicament.
  • said medicament is a vaccine or an adjuvant as later defined herein.
  • the invention provides a host cell comprising the expression vector of the invention and/or the inactivation vector of the invention both as defined in former sections.
  • the choice of the host cell will to a large extent depend upon the source of the nucleic acid sequence of the invention. Depending on the identity of the host cell, the skilled person would know how to transform it with the construct or vector of the invention.
  • the host cell may be any microbial, prokaryotic or eukaryotic cell, which is suitable for expression of the LPS of the invention.
  • the host cell is a Bordetella species as earlier mentioned herein.
  • the Bordetella is a Bordetella pertussis.
  • Suitable procedures for transformation of Bordetella may involve a process comprising conjugation in a manner known to the skilled person. Suitable transformation procedures for Bordetella are described in Stibitz et al, 1994.
  • the host cell hence obtained has an increased expression level of the nucleic acid sequence present in the expression vector, and/or has an increased expression level of the polypeptide encoded by the nucleic acid sequence present in the expression vector and/or has an increased activity level of the polypeptide encoded by the nucleic acid sequence present in the expression vector.
  • the nucleic acid sequence present in the expression construct codes for a polypeptide having at least 50% identity with SEQ ID NO:1.
  • the increase is assessed by comparison with the host cell which does not comprise said expression vector and/or with the host cell which does not comprise an endogenous polypeptide having at least 50% identity with SEQ ID NO:1 when both cultured and/or assayed under the same conditions.
  • “Increase expression level of the polypeptide” is herein preferably defined as producing more of the polypeptide as earlier defined than what the parental host cell the transformed host cell derives from will produce when both types of cells (parental and transformed cells) are cultured under the same conditions.
  • the host cell of the invention produces at least 3%, 6%, 10% or 15% more of the polypeptide of the invention having at least 50% identity with SEQ ID NO:1 than the parental host cell the transformed host cell derives from will produce when both types of cells (parental and transformed cells) are cultured under the same conditions.
  • hosts which produce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% more of said polypeptide than the parental cell are preferred.
  • the production level of this polypeptide of the host cell of the invention is compared to the production level of the B213 Bordetella pertussis strain (Kasuga et al 1953, see also Table 1), which is taken as control.
  • the production level of the polypeptide of the host cell of the invention is compared to the production level of the B213 strain as defined above, which is taken as control.
  • the assessment of the production level of the polypeptide may be performed at the mRNA level by carrying out a Northern Blot or an array analysis and/or at the polypeptide level by carrying out a Western blot. All these methods are well known to the skilled person.
  • “Increase in the polypeptide activity” is herein defined as exhibiting a higher polysaccharide deacetylase activity than the one of the parental host cell the transformed host cell derives from using an assay specific for said activity.
  • the assay is the one mentioned under the section polypeptides.
  • the host cell of the invention exhibits at least 3%, 6%, 10% or 15% higher polysaccharide deacetylase activity than the parental host cell the transformed host cell derives from will exhibit as assayed using a specific assay for said activity, which is preferably the assay mentioned under the section polypeptides.
  • the level of polysaccharide deacetylase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control.
  • the level of polysaccharide deacetylase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control.
  • the increase in polypeptide expression and/or activity may have been achieved by conventional methods known in the art, such as by introducing more copies of the nucleic acid sequence encoding the polysaccharide deacetylase into the host, be it on a carrier or in the chromosome, than naturally present.
  • the nucleic acid sequence encoding the polysaccharide deacetylase can be overexpressed by fusing it to highly expressed or strong promoter suitable for high level protein expression in the selected organism, or combination of the two approaches. The skilled person will know which strong promoter is the most appropriate depending on the identity of the host cell.
  • the strong promoter is the tac-promoter of the vector pMMB67EH (Methods for General and Molecular Bacteriology, Editors P. Gerhardt et al., American Society for Microbiology, Washington D.C., 1994, p. 409-410).
  • the invention provides a second preferred embodiment, wherein the host cell has a decreased expression level of the nucleic acid sequence encoding the polypeptide having at least 50% identity with the amino acid sequence of SEQ ID NO:2, and/or has a decreased expression level of said polypeptide and/or has a decreased activity level of said polypeptide, preferably via the use of the inactivation vector of the invention as earlier defined herein.
  • the nucleic acid sequence present in the inactivation vector codes for a polypeptide having at least 50% identity with SEQ ID NO:2.
  • the decrease is assessed by comparison with the host cell which does not comprise said inactivation vector when both cultured and/or assayed under the same conditions.
  • “Decrease expression level of the polypeptide” is herein preferably defined as producing less of the polypeptide (as earlier defined) than what was produced by the parental host cell from which the transformed host cell was derived when both types of cells (parental and transformed cells) are cultured under the same conditions.
  • the host cell of the invention produces at least 3%, 6%, 10% or 15% less of the polypeptide of the invention having at least 50% identity with SEQ ID NO:2 than that produced by the parental host cell from which the transformed host cell was derived when both types of cells (parental and transformed cells) are cultured under the same conditions.
  • hosts which produce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% less of said polypeptide than the parental cell are preferred.
  • the production level of this polypeptide of the host cell of the invention is compared to the production level of the B213 strain as defined before, which is taken as control.
  • the production level of the polypeptide of the host cell of the invention is compared to the production level of the B213 strain as defined before, which is taken as control.
  • the assessment of the production level of the polypeptide may be performed at the mRNA level by carrying out a Northern Blot or an array analysis and/or at the polypeptide level by carrying out a Western blot. All these methods are well known to the skilled person.
  • “Decrease in the polypeptide activity” is herein defined as exhibiting a lower glycosyltransferase activity than the one of the parental host cell from which the transformed host cell was derived, using an assay specific for said activity.
  • the assay is the one which has been already described herein under the section “Polypeptides.”
  • the host cell of the invention exhibits at least 3%, 6%, 10% or 15% lower glycosyltransferase activity than that of the parental host cell from which the transformed host cell was derived as assayed using a specific assay for said activity, which is preferably the assay described under the section “Polypeptides.”
  • hosts which exhibit at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% less of said activity than the parental cell are preferred.
  • the level of glycosyltransferase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control.
  • the host cell of the invention is a Bordetella pertussis strain
  • the level of polysaccharide deacetylase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control.
  • the decrease in polypeptide expression and/or activity may have been achieved by conventional methods known in the art, such as by introducing more copies of the nucleic acid sequence encoding the polysaccharide deacetylase into the host, be it on a carrier or in the chromosome, than naturally present.
  • the nucleic acid seqeunce encoding the polysaccharide deacetylase can be overexpressed by fusing it to highly expressed or strong promoter suitable for high level protein expression in the selected organism, or combination of the two approaches.
  • the skilled person will know which strong promoter is the most appropriate depending on the identity of the host cell.
  • the strong promoter is the tac-promoter of the vector pMMB67EH as defined before.
  • the host cell does not produce any detectable amounts of glycosyltransferase of the invention and/or does not exhibit any detectable glycsosyltransferase activity.
  • the host cell does not produce or produces substantially no glycosyltransferase.
  • the host cell produces an inducible amount of the glycosyltransferase of the invention and/or exhibit an inducible glycosyltransferase activity.
  • the decreasing of the expression level of the glycosyltransferase of the invention and/or the decreasing of its activity level may have been achieved by conventional methods known in the art, such as by inactivating or down-regulating the nucleic acid sequence encoding the endogenous glycosyltransferase of the host. This inactivation or down regulation may have been achieved by deletion of one or more nucleotides in the encoding gene.
  • the invention relates to a host, preferably a Bordetella pertussis which has a mutation in its nucleic acid sequence encoding the glycosyltransferase.
  • a replacement or inactivation vector is prepared and is subsequently introduced into the host by transformation.
  • the skilled person will know how to construct such a vector.
  • the expression of the nucleic acid sequence encoding the glycosyltransferase can be decreased by fusing it to a weak promoter suitable for low level protein expression in the selected organism.
  • the expression of the nucleic acid sequence encoding the glycosyltransferase can be rendered inducible by fusing it to an inducible promoter suitable for inducible level protein expression in the selected organism.
  • the inducible promoter is the tac-promoter of the vector pMMB67EH as defined before
  • the host cell of the invention has attractive properties, which renders it very attractive to be used as a whole pertussis vaccine or as an adjuvant: improved potentiality to interact with DC, and to subsequently induce their maturation, and induce the production of proinflammatory cytokines.
  • the LPS obtainable from these cells is also very suited to be used as a vaccine or as an adjuvant as presented below.
  • a host cell as earlier defined for use as a medicament.
  • said medicament is a vaccine or an adjuvant as later defined herein.
  • the invention relates to the LPS obtainable from the host cell of the invention as earlier defined herein.
  • the host cell is a Bordetella species, more preferably a Bordetella pertussis , even more preferably a Bordetella pertussis carrying an overexpression of the polysaccharide deacetylase of the invention and/or an inactivation of the glycosyltransferase of the invention.
  • the LPS is of the invention is obtainable from mutant 2331 as prepared in the examples.
  • the ESI-MS spectrum of the LPS of the invention is characterized by giving more ions than the corresponding ESI-MS spectrum of the LPS derived from a wild type Bordetella pertussis , named wild type LPS.
  • the wild type Bordetella pertussis is strain B213 as defined before.
  • these additional ions may reflect at least partly the increased substitution of the 1 or 4′ phosphate groups of the lipid A part of LPS with hexosamine residues.
  • the ESI-MS spectrum of the wild type LPS is characterized by giving 7 ions (see table 3), whereas the ESI-MS spectrum of the LPS of the invention is characterized by giving more than 7 ions, at least 8, at least 10, at least 12 and more preferably 14 ions.
  • the ESI-MS spectrum of the LPS of the invention comprises more ions comprising hexosamine than the ESI-MS spectrum of the wild type LPS.
  • the ESI-MS spectrum of the wild type LPS gives two ions with hexosamine (see table 3), whereas the ESI-MS spectrum of the LPS of the invention is characterized by giving more than two ions, at least 4, at least 6, and more preferably 8 ions.
  • the invention further relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the host cell of the invention and/or the LPS of the invention both as earlier defined herein.
  • the pharmaceutical composition may be used as a vaccine or as an adjuvant.
  • the vaccine may be used for immunisation (raising an immune response) or vaccination of a mammal.
  • Adjuvants are herein defined to include any substance or compound that, when used in combination with an antigen, to immunise a mammal, preferably a human, stimulates the immune system, thereby provoking, enhancing or facilitating the immune response against the antigen, preferably without generating a specific immune response to the adjuvant itself.
  • Preferred adjuvants enhance the immune response against a given antigen by at least a factor of 1.5, 2, 2.5, 5, 10 or 20, as compared to the immune response generated against the antigen under the same conditions but in the absence of the adjuvant. Tests for determining the statistical average enhancement of the immune response against a given antigen as produced by an adjuvant in a group of animals or humans over a corresponding control group are available in the art.
  • the adjuvant preferably is capable of enhancing the immune response against at least two different antigens.
  • the adjuvant of the invention will usually be a compound that is foreign to a mammal, thereby excluding immunostimulatory compounds that are endogenous to mammals, such as e.g. interleukins, interferons and other hormones.
  • the composition when used as an adjuvant, the composition further comprises an antigen.
  • the antigen is present at the surface of the host cell of the invention and/or is present within the LPS obtainable from such cells.
  • the vaccine is preferably a vaccine against the host of the invention and/or against any host capable of expressing a related LPS molecule.
  • an antigen is present.
  • the antigen is preferably an antigen from or produced by a bacterium, a virus, a fungus, a parasite, a cancer cell or an allergen as further defined below.
  • the antigen and the host cell of the invention and/or the LPS obtainable by such cells are preferably used in the treatment and/or prevention of an infectious disease caused by the bacterium, virus, fungus, or parasite, or the tumor caused by the cancer cell, or the allergy caused by the allergen.
  • the pharmaceutical composition comprising a host cell of the invention and/or a LPS obtainable therefrom and optionally an antigen as herein defined above further comprises a pharmaceutically acceptable carrier.
  • the pharmaceutical compositions may further comprise pharmaceutically acceptable stabilizing agents, osmotic agents, buffering agents, dispersing agents, and the like.
  • the preferred form of the pharmaceutical composition depends on the intended mode of administration and therapeutic application.
  • the pharmaceutical carrier can be any compatible, non-toxic substance suitable to deliver the active ingredients, i.e. the host cell of the invention and/or the LPS obtainable from this host cell and optionally the antigen, to the patient.
  • Pharmaceutically acceptable carriers for intranasal delivery are exemplified by water, buffered saline solutions, glycerin, polysorbate 20, cremophor EL, and an aqueous mixture of caprylic/capric glyceride, and may be buffered to provide a neutral pH environment.
  • Pharmaceutically acceptable carriers for parenteral delivery are exemplified by sterile buffered 0.9% NaCl or 5% glucose optionally supplemented with a 20% albumin.
  • Preparations for parental administration must be sterile.
  • the parental route for administration of the active ingredients is in accord with known methods, e.g. injection or infusion by subcutaneous, intravenous, intraperitoneal, intramuscular, intraarterial or intralesional routes.
  • compositions of the invention are preferably administered by bolus injection.
  • a typical pharmaceutical composition for intramuscular injection would be made up to contain, for example, 1-10 ml of phosphate buffered saline and 1 to 100 ⁇ g, preferably 15-45 ⁇ g of antigen and 1 to 100 ⁇ g, preferably 15-45 ⁇ g of the host cell and/or LPS of the invention.
  • the active ingredient can be administered in liquid dosage forms, such as elixirs, syrups, and suspensions.
  • Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance.
  • compositions are well known in the art and described in more detail in various sources, including, for example, Remington's Pharmaceutical Science (15th ed., Mack Publishing, Easton, Pa., 1980) (incorporated by reference in its entirety for all purposes).
  • the antigen in the composition of the invention preferably is an antigen that is from or produced by a bacterium, a virus, a fungus, a parasite, a cancer cell or an allergen.
  • Viral antigens that may be combined with the host cell and/or LPS of the invention can be derived from all sorts of viruses, non-limiting examples of such viruses are: Retroviridae such as Human Immunodeficiency virus (HIV); a rubellavirus; paramyxoviridae such as parainfluenza viruses, measles, mumps, respiratory syncytial virus, human metapneumovirus; flaviviridae such as yellow fever virus, dengue virus, Hepatitis C Virus (HCV), Japanese Encephalitis Virus (JEV), tick-borne encephalitis, St.
  • Retroviridae such as Human Immunodeficiency virus (HIV); a rubellavirus
  • paramyxoviridae such as parainfluenza viruses, meas
  • Herpesviridae such as Herpes Simplex virus, cytomegalovirus, Epstein-Barr virus; Bunyaviridae; Arenaviridae; Hantaviridae such as Hantaan; Coronaviridae; Papovaviridae such as human Papillomavirus; Rhabdoviridae such as rabies virus.
  • Coronaviridae such as human coronavirus; Alphaviridae, Arteriviridae, filoviridae such as Ebolavirus, Arenaviridae, poxyiridae such as smallpox virus, and African swine fever virus.
  • the host cell and/or LPS of the invention may be combined with antigens derived from pathogenic bacteria, fungi (including yeasts), or parasites.
  • antigens include bacterial antigens of e.g. Helicobacter , such as H. pylori, Neisseria , such as N. mengitidis, Haemophilus , such as H. influenza, Bordetella , such as B. pertussis, Chlamydia, Streptococcus , such as Streptococcus sp. serotype A, Vibrio , such as V. cholera , Gram-negative enteric pathogens including e.g.
  • Antigens from parasites e.g. include antigens from protozoans, such as Babeosis bovis, Plasmodium, Leishmania spp. Toxoplasma gondii , and Trypanosoma , such as T. cruzi .
  • Fungal antigens may include antigens from fungi such as Aspergillus sp., Candida albicans, Cryptococcus , such as e.g C. neoformans , and Histoplasma capsulatum.
  • fungi such as Aspergillus sp., Candida albicans, Cryptococcus , such as e.g C. neoformans , and Histoplasma capsulatum.
  • tumor-specific proteins are found to be proper entities that can be targeted by human or humanized antibodies. Such tumor-specific proteins are also within the scope of the present invention.
  • Many tumor specific antigens are known in the art. Therefore, in one preferred embodiment, the invention provides compositions comprising a tumor-specific antigen and a host cell and/or LPS as defined above. Suitable tumor antigens include e.g.
  • carcinoembryonic antigen prostate-specific membrane antigen, prostate specific antigen, protein MZ2-E, polymorphic epithelial mucin (PEM), folate-binding-protein LK26, (truncated) epidermal growth factor receptor (EGRF), HER2, Thomsen-Friedenreich (T) antigen, GM-2 and GD-2 gangliosides, Ep-CAM, mucin-1, epithialial glycoprotein-2, and colon specific antigen.
  • PEM polymorphic epithelial mucin
  • EGRF epidermal growth factor receptor
  • T Thomsen-Friedenreich
  • antigens can be targeted to DC's in order to induce tolerance in the prevention of auto-immune disease.
  • allergens are also within the scope of the present invention.
  • the host cell of the invention preferably a Bordetella pertussis and/or the LPS obtainable from such cell is/are for use as a medicine.
  • the medicine is a vaccine against pertussis.
  • the host cell of the invention preferably a Bordetella pertussis and/or the LPS obtainable from such cell is/are for use as an adjuvant. More preferably, the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell are used in combination with an antigen.
  • the invention relates to the use of the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell for the preparation of a medicament for the prevention and/or treatment of pertussis .
  • the host cell of the invention preferably a Bordetella pertussis and/or the LPS obtainable from such cell are used as adjuvant for the preparation of a medicament for raising an immune response against an antigen. More preferably, the host cell of the invention and/or the LPS obtainable from such cell are used as adjuvant in combination with said antigen.
  • the invention relates to the use of a polypeptide of the invention as earlier defined herein and/or a nucleic acid sequence of the invention as defined herein for the preparation of a medicament for the prevention and/or treatment of pertussis.
  • the invention relates to the use of a polypeptide of the invention as earlier defined herein and/or a nucleic acid sequence of the invention as earlier defined herein for the preparation of an adjuvant.
  • the polypeptide of the invention as earlier defined herein and/or the nucleic acid sequence of the invention as earlier defined herein are used in combination with an antigen for the preparation of a medicament for raising an immune response against the antigen.
  • the mammal is preferably a human.
  • FIG. 1 (A) Schematic representation of the identified glycosyltransferase operon. Dark gray arrows indicate the genes that encode putative glycosyltransferases, whereas the light grey and white arrows indicate the gene encoding a putative monosaccharide deacetylase and the flanking ORFs, respectively. (B) Analysis of LPS profiles from the wild-type B. pertussis strain (WT), and the BP2329-, BP2328-, and BP2331-mutant strains by Tricine-SDS-PAGE.
  • WT wild-type B. pertussis strain
  • BP2329-, BP2328-, and BP2331-mutant strains by Tricine-SDS-PAGE.
  • FIG. 2 Negative ion ESI-MS of O-deacylated LPS of wild-type B. pertussis (A) and B. pertussis mutant strains BP2328 (B), BP2329 (C) and BP2331 (D).
  • FIG. 3 Negative mode tandem mass spectrometric analysis of O-deacylated LPS from the BP2331-mutant strain.
  • A extracted MS/MS spectrum of the ion at m/z 1108.3
  • B extracted MS/MS spectrum of the ion at m/z 1162.0
  • C extracted MS 3 spectrum of the ion at m/z 1112.6 from the ion at m/z 1162.0.
  • FIG. 4 DC activation after stimulation with the wild-type and mutant B. pertussis cells.
  • A Analysis of CD83, HLA-DR, CD86, and CD40 cell-surface expression in human DCs after 24 h stimulation with PFA-fixed wild-type and mutant B. pertussis cells at MOI 10 (black line) or 100 (dashed line). Unstimulated DCs served as control (grey-filled histogram). Shown are FACS histograms for the indicated B. pertussis strains from 5,000 events counted. The vertical axis represents the cell number, while the horizontal axis represents the intensity of staining (B) IL-10 and IL-12p70 production by cultured human DCs after stimulation with PFA-fixed wild-type and mutant B. pertussis cells at MOI 10 or 100. Results are expressed as mean cytokine concentrations ( ⁇ SD).
  • FIG. 5 DC activation after stimulation with purified wild-type and mutant B. pertussis LPS.
  • A Analysis of CD83, CD86, and CD40 cell-surface expression in human DCs after 24 h stimulation with 1 ⁇ g/ml purified LPS. Unstimulated DCs served as control (grey-filled histogram). Shown are FACS histograms for the LPS of the indicated B. pertussis strains from 5,000 events counted. The vertical axis represents the cell number, while the horizontal axis represents the intensity of staining (B) IL-10 production by cultured human DCs after stimulation with 1 ⁇ g/ml purified LPS. Results are expressed as mean cytokine concentrations.
  • FIG. 6 IL-6 induction by purified B. pertussis LPS and whole bacterial cells.
  • the production of IL-6 by the human macrophage cell line MM6 was stimulated with serial dilutions of stock solutions of purified LPS (A) or whole bacterial cells (B) from the wild-type B. pertussis strain (WT), or the BP2328-, BP2329-, and BP2331-mutant strains.
  • IL-6 concentrations in the culture supernatants were quantified in an ELISA against human IL-6. The data represent the averages of three individual experiments.
  • FIG. 7 Structure of B. pertussis LPS. Proposed truncated core OS structures of the BP2328- and BP2329-mutant strains are indicated by red arrows. Adapted from Caroff et al. (2000).
  • All bacterial strains used are described in Table 1. Typically, the E. coli strains were grown at 37° C. in Luria-Bertani broth while shaking at 200 rpm. When appropriate, bacteria were grown in the presence of 100 ⁇ g/ml ampicillin, 50 ⁇ g/ml kanamycin, or 10 ⁇ g/ml gentamicin, for plasmid maintenance or strain selection. B. pertussis was grown at 35° C. on Bordet-Gengou (BG) agar supplemented with 15% defibrinated sheep blood (Tritium).
  • BG Bordet-Gengou
  • Chromosomal template DNA for PCR reactions was prepared by resuspending ⁇ 10 9 bacteria in 50 ⁇ l of distilled water, after which the suspension was heated for 15 min at 95° C. The suspension was then centrifuged for 1 min at 16,100 ⁇ g, after which the supernatant was used as template DNA.
  • B. pertussis mutant strains B213 ⁇ BP2328 and ⁇ BP2329 we amplified DNA segments encompassing the 5′ region and upstream sequences of the corresponding ORFs by using primers BP2328_FW up , BP2329_FW up , and primers BP2328_REV up and BP2329_REV up , which both contained a BamHI site.
  • DNA fragments containing the 3′ regions and downstream sequences of the ORFs were obtained by PCR with primers BP2328_FW down , BP2329_FW down , both containing a BamHI site, and primers BP2328_REV down and BP2329_REV up .
  • primers BP2328_FW down , BP2329_FW down , both containing a BamHI site, and primers BP2328_REV down and BP2329_REV up derived B. pertussis BP2331 mutant strain.
  • the PCRs were performed using pure Taq Ready-to-go PCR beads (Amersham Biosciences) in a 25- ⁇ l total reaction volume with 5 pmol of each primer.
  • the temperature program was as follows: 95° C.
  • PCR products were purified from agarose gel and subsequently cloned into pGEM-T Easy resulting in plasmids pGEM-BP2328 up , pGEM-BP2328 down , pGEM-BP2329 up , pGEM-BP2329 down , and pGEM-BP2331, respectively.
  • the BamHI-SpeI fragments of pGEM-BP2328 down and pGEM-BP2329 down were ligated into BamHI-SpeI-restricted pGEM-BP2328 up and pGEM-BP2329 up , respectively.
  • the resulting plasmids and plasmid pGEM-BP2331 were cut with BamHI and EcoRV, respectively, to allow for insertion of the kanamycin-resistance cassette from plasmid pBSL128 obtained by BamHI and HindIII digestion, respectively.
  • EcoRI fragments of the constructs obtained were ligated into the EcoRI-restricted suicide plasmid pSS1129.
  • the final constructs designated pSS1129-BP2328 KO , pSS1129-BP2329 KO , and pSS1129-BP2331 KO , respectively, contained the kanamycin-resistance cassette in the same orientation as the transcription direction of the operon.
  • the pSS1129-based plasmids were used to transform E. coli SM10( ⁇ pir), which allowed for subsequent transfer of the plasmids to B. pertussis and construction of B. pertussis BP2328, BP2329, and BP2331 mutants by allelic exchange. Transformants were screened by PCR using various primer sets.
  • LPS was isolated using the hot phenol/water extraction method (Westphal and Jann, 1965) with slight modifications (Geurtsen et al., 2006).
  • De-O-acylation of LPS was achieved by mild hydrazinolysis (Hoist, 2000). Briefly, LPS was dissolved in anhydrous hydrazine (200 ⁇ l), and incubated at 37° C. for 50 min with constant stirring to release the O-linked fatty acyl chains. The mixture was cooled and 600 ⁇ l of cold acetone were added in small portions to convert hydrazine to acetone hydrazone. The precipitate of the de-O-acylated LPS was collected by centrifugation (4000 ⁇ g, at 7° C. for 30 min). The pellet was washed twice with 600 ⁇ l of cold acetone, centrifuged and dissolved in water before lyophilisation.
  • a Prince CE system (Prince Technologies) was coupled to a 4000 QTRAP mass spectrometer (Applied Biosystems/MDS Sciex).
  • a sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1.0 ⁇ l/min. Separations were obtained on a ⁇ 90-cm length bare fused-silica capillary using 15 mM ammonium acetate in deionised water, pH 9.0.
  • the 5 kV and ⁇ 5 kV of electrospray ionisation voltage were used for positive and negative ion mode detections, respectively.
  • nitrogen was used as curtain and collision gas.
  • the scan speed was set to 4000 Da/s with Q 0 trapping, the trap fill time was set as “dynamic” and the resolution of Q1 was set as “unit”.
  • the excitation coefficient was set at a value to excite only the first isotope for a single charged precursor with excitation time set at 100 ms.
  • Bacteria were inactivated in 0.5% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) for 30 min and washed thoroughly in RPMI 1640 medium without phenol red (Gibco). Bacterial suspensions with an optical density at 600 nm (OD 600 ) of 1, corresponding to ⁇ 10 9 bacteria/ml, were prepared in RPMI 1640 medium without phenol red.
  • PFA paraformaldehyde
  • PBS phosphate-buffered saline
  • PBMCs peripheral blood mononuclear cells
  • monocytes were prepared from PBMCs by centrifugation over a three-layer PERCOLL® gradient (GE Healthcare Bio-Sciences AB) (60%, 47.5%, and 34% Percoll in RPMI 1640, 10% FCS). Monocytes were harvested from the upper interface and washed three times with RPMI 1640, 10% FCS medium and incubated in a six-well plate (4 ml per well, 0.5 ⁇ 10 6 cells/ml) in RPMI 1640, 10% FCS, supplemented with 2.4 mM L-glutamine (Sigma-Aldrich), 100 U/ml penicillin-streptomycin (Gibco), 100 ng/ml of human recombinant GM-CSF (Peprotech), and 50 ng/ml of human recombinant IL-4 (Strathmann-Biotec AG). After six days of culture, immature DC (imDC) were harvested, which were negative for CD14 and CD83, expressed low levels of CD86 and H
  • ImDC were washed and resuspended at a concentration of 5 ⁇ 10 5 cells/ml in RPMI 1640 10% FCS, and co-incubated with either PFA-fixed B. pertussis cells at a multiplicity of infection (MOI) of 10 or 100, or purified LPS at a concentration of 10 or 1000 ng/ml. Unstimulated imDC served as control in all experiments. DC were harvested after 24 h and directly stained for expression of cell surface markers; the supernatants were stored at ⁇ 80° C. before cytokine measurements.
  • MOI multiplicity of infection
  • DC maturation markers and co-stimulatory molecules were assessed by flow cytometry. Immature or stimulated DC were harvested, washed in RPMI 1640, 10% FCS and resuspended in filter-sterilised PBS containing 0.1% bovine serum albumin (FACS buffer). Next, cells were incubated for 30 min at 4° C.
  • Cells were washed twice with FACS buffer and analysed using flow cytometry (FACScan, Becton Dickinson).
  • IL-10 and IL-12p70 concentrations in the supernatants of stimulated DCs were determined using an Enzyme-linked Immunosorbent Assay (ELISA) according to the manufacturer's instructions (BD Biosciences Pharmingen).
  • the human macrophage cell line MM6 (Ziegler-Heitbrock et al., 1988) was stimulated with serial dilutions of whole bacterial cell suspensions or purified LPS as described (Geurtsen et al., 2006).
  • the bacterial cell suspensions were prepared by collecting the cells from cultures by centrifugation, after which they were resuspended in PBS at an OD 590 of 1.0, heat-inactivated for 10 min in the presence of 8 mM formaldehyde, and stored at 4° C.
  • IL-6 concentrations in the culture supernatants were quantified with an ELISA against human IL-6 according to the manufacturer's instructions (PeliKine CompactTM)
  • BP2330 shows the highest similarity to a polysaccharide deacetylase from Xylella fastidiosa .
  • the four ORFs are close to each other and in some cases even overlap, suggesting that they constitute an operon ( FIG. 1A ).
  • putative LPS glycosyltransferases we made constructs in suicide plasmid pSS1129 carrying the individual BP2328, BP2329, and BP2331 genes interrupted by a kanamycin-resistance cassette for insertional inactivation by allelic exchange. Using this approach, knockout mutants for all three genes could be readily obtained in B. pertussis strain B213.
  • LPS from the wild-type and BP2328-, BP2329-, and BP2331-mutant strains was isolated, O-deacylated, and analysed by ESI-MS in the negative-ion mode ( FIG. 2 ).
  • the proposed LPS compositions are summarised in Table 3.
  • the spectrum of wild-type LPS revealed a major triply-charged ion at m/z 1108.5 corresponding to full-length B. pertussis LPS with the composition GlcNAco•Man2NAc3NAcA•Fuc2NAc4NMe•GalNA•Glc•GlcN 2 •GlcA•Hep 3 •P•Kdo•lipid A-OH.
  • the most complete core structure was represented by the doubly-charged ion at m/z 1067.1 corresponding to the composition GlcN 2 •GlcA•Hep 2 •P•Kdo•lipid A-OH, BP2331 mutant LPS ( FIG. 2D ) showed a large number of peaks, including triply-charged ions at m/z 1108.3 and 1162.0 corresponding to full-length B. pertussis LPS and full-length B. pertussis LPS substituted with an additional hexosamine, respectively.
  • the BP2329- and BP2331-mutant bacteria were clearly less and more stimulatory, respectively, than the wild-type bacteria, whereas the BP2328-mutant strain was as efficient as the wild type.
  • the lower DC maturation observed in the case of the BP2329-mutant strain was accompanied by lower induction of IL-10 and IL-12p70 ( FIG. 4B ).
  • the BP2331 mutant which displayed an enhanced DC-maturation capacity, induced higher amounts of IL-10 and IL-12p70.
  • the wild-type strain and the BP2328-mutant strain induced comparable levels of IL-10, which is in agreement with the equal expression of co-stimulatory molecules and maturation markers on the DCs in response to these strains.
  • the wild-type strain clearly induced IL-12p70 production, this was hardly the case for the BP2328-mutant strain ( FIG. 4B ), suggesting that IL-10 and IL-12p70 expression can be differentially regulated.
  • FIGS. 5A and 5B demonstrate that, in accordance with the results obtained with intact bacteria, the highest DC activation capacity was found for the LPS isolated from the BP2331-mutant strain, followed by those of the BP2328-mutant strain and the wild-type strain, whereas that of the BP2329-mutant strain was incapable of maturing DCs.
  • the alterations in the LPS structure of the mutants differentially affect DC activation capacity.
  • the goal of the present study was to identify new LPS glycosyltransferases in the B. pertussis genome. By using sequences of known LPS glycosyltransferases as leads, we were able to identify a four-gene operon.
  • an gene cluster homologous to the one here identified was described as being involved in LPS biosynthesis (Sebaihia et al., 2006). However, no functional studies were reported which could confirm this assignment.
  • the proposed truncated oligosaccharide structures for the BP2328- and BP2329-mutant strains are summarised in FIG. 7 .
  • the most complete core OS structure in the BP2328 mutant strain consisted of GalNA•Glc•GlcN 2 •GlcA•Hep 2 •P•Kdo•lipid A-OH•HexN, indicating that the BP2328 mutant strain lacks the terminal trisaccharide, a heptose residue, and one of the GlcN residues.
  • This composition suggests that the BP2328-encoded protein functions as a GlcN (1-4) to Glc transferase ( FIG. 7 ).
  • lipid A with amino sugars has been described in various bacteria, e.g., substitution with 4-aminoarabinose in E. coli and Salmonella (Trent et al., 2001b), and with galactosamine in Francisella tularensis (Phillips et al., 2004).
  • the aminoarabinose pathway has been studied in detail in E. coli and has been shown to involve the assembly of the sugar moiety on a separate undecaprenyl phosphate carrier prior to its transfer to lipid A (Trent et al., 2001a).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Physics & Mathematics (AREA)
  • Pulmonology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to an improved vaccine against pertussis wherein mutants of Bordetella pertussis having a modified LPS molecule or the obtainable LPS molecules are used. These mutants or the obtainable LPS molecules may further be used as an adjuvant.

Description

FIELD OF THE INVENTION
The invention relates to an improved vaccine against pertussis comprising mutants of Bordetella pertussis having a modified LPS molecule and/or the LPS molecules obtainable from these mutants. These mutants and/or the obtainable LPS molecules may further be used as an adjuvant.
BACKGROUND OF THE INVENTION
LPS is an amphiphilic molecule located in the outer leaflet of the outer membrane of Gram-negative bacteria. LPS possesses both endotoxic activity and adjuvant activity. Both properties are based upon its recognition by the host TLR4/MD-2 receptor complex (reviewed in Pålsson-McDermott and O'Neill, 2004; O'Neill, 2006). LPS consists of three distinct structural domains: lipid A, the core, and the O-antigen. Lipid A functions as a hydrophobic membrane anchor and forms the bioactive component of the molecule (Takada and Kotani, 1989). The core region consists of a complex oligosaccharide, which, as compared to the O-antigen, shows only limited structural variability. In some bacteria, e.g., Enterobacteriaceae, the core oligosaccharide (core OS) can be divided into an inner core and an outer core. The outer core primarily consists of pyranosidic hexoses, e.g., D-glucose, D-galactose, and D-glucosamine, whereas the inner core primarily consists of octulosonic acids and heptopyranoses. In the vast majority of Gram-negative bacteria, the core domain is connected to the lipid A domain by a specific carbohydrate, 2-keto-3-deoxyoctulosonic acid (Kdo) (Raetz and Whitfield, 2002). The O-antigen comprises the most variable part of the LPS and confers bacteria serotype specificity. It is composed of repeating sugar subunits of one to eight sugars. Each O-chain can contain up to 50 of these subunits. The O-antigen has been implicated in bacterial immune escape, especially the escape from serum complement-mediated lysis (Raetz and Whitfield, 2002).
In contrast to the LPS of Bordetella bronchiseptica and Bordetella parapertussis, the LPS of Bordetella pertussis never contains an O-antigen domain (Peppler, 1984; Di Fabio et al., 1992). Therefore, B. pertussis LPS is often referred to as lipooligosaccharide. B. pertussis produces two dominant LPS forms, band A and band B LPS (Peppler, 1984). Band B LPS is composed of lipid A and a core oligosaccharide consisting of 9 carbohydrates (Caroff et al., 2000). Addition of a terminal trisaccharide, consisting of N-acetyl glucosamine, 2,3-diacetamido-2,3-dideoxy-mannuronic acid, and 2-acetamido-4-N-methyl-2,4-dideoxy-fucose, to band B LPS forms the LPS referred to as band A.
In Escherichia coli and Salmonella enterica serovar Typhimurium, the core OS biosynthesis gene cluster consists of three operons, designated the gmhD, waaQ, and WaaA operons. The gmhD operon consists of four genes, gmhD and waaFCL, which are involved in the synthesis of the inner core (Schnaitman and Klena, 1993). The gmhD, waaF, and waaC genes encode proteins involved in the biosynthesis and transfer of Heptoses I and II to Kdo2-lipid A (Schnaitman and Klena, 1993), whereas the waaL gene product is a ligase that is involved in the attachment of the O-antigen (MacLachlan et al., 1991). The waaQ operon is the largest of the three operons and encodes proteins that are involved in the biosynthesis of the outer core and in modification/decoration of the core OS. The number and types of genes present within in the waaQ operon differs per strain, which explains the strain-specific differences in core composition (Heinrichs et al., 1998). The waaA operon often encodes only one protein, KdtA. Only in E. coli K-12, an additional non LPS-related open reading frame (ORF) is present (Raetz and Whitfield, 2002). The kdtA gene of Enterobacteriaceae encodes the bifunctional Kdo transferase that adds the two Kdo residues in the Kdo2-lipid A biosynthesis (Clementz and Raetz, 1991).
Although the Bordetella and E. coli core OS show some resemblance, the exact composition and configuration of residues display marked differences. For example, the Bordetella core OS contains only one Kdo residue, instead of the two or three residues that are found in most other Gram-negative bacteria, including E. coli. Recently, this was shown to be due to the functioning of Bordetella KdtA as a monofunctional, rather than as a bifunctional Kdo transferase (Isobe et al., 1999). The enzymes responsible for the synthesis of the remaining portion of the Bordetella core OS are currently unknown and await further identification.
Although its lipid A part is generally seen as the main determinant for the biological activity of LPS through the activation of the TLR4/MD-2 receptor complex, the oligosaccharide region can also play an important role in its interaction with antigen-presenting cells (APCs). Receptors implicated in this type of LPS recognition include the complement receptor CR3 and the scavenger receptor SR-A (van Amersfoort et al., 2003; Plüddemann et al., 2006).
Several Bordetella pertussis vaccines were already used. Introduction of whole-cell pertussis (wP) vaccines in the 1940s and 1950s, and later of acellular pertussis (aP) vaccines in the 1980s and 1990s, led to a gradual decline in pertussis incidence and reduced morbidity and mortality of the disease to low levels. Despite high vaccination coverage, pertussis disease has remained endemic and kept showing a cyclic pattern with peaks in incidence every 2 to 5 years. During the last two decades, several countries, including the Netherlands, have experienced increases in numbers of reported pertussis cases. Interestingly, in some areas, a shift in age distribution has also been observed. Whereas in the pre-vaccination and early vaccine era pertussis cases were predominantly reported in young children, adults and adolescents have accounted for an increasing proportion of the cases in recent years. Several reasons for the re-emergence of reported pertussis have been proposed, including: (1) genetic changes in circulating B. pertussis strains that decrease vaccine efficacy, (2) reduced potency of pertussis vaccines, (3) waning immunity, (4) increased reporting of pertussis cases, and (5) the improved diagnosis of pertussis disease.
Therefore, there is still a need for new vaccines against Bordetella pertussis which does not exhibit all the drawbacks of the existing vaccines.
DESCRIPTION OF THE INVENTION
The present invention is based on the hypothesis that B. pertussis mutants with an altered oligosaccharide chain might be affected in their interaction with dendritic cells (DC)s. Specific targeting to antigen presenting cells (APC)s, such as DCs, could conceivably affect the outcome of the immune response against a whole-cell pertussis vaccine. As a first step towards improvement of whole-cell vaccines by this route, we have now identified a gene cluster involved in LPS oligosaccharide biosynthesis in B. pertussis. Especially two genes within this cluster when inactivated or overexpressed give mutants having an improved potentiality to interact with and activate DC.
Polypeptides
In a first aspect, the invention provides two polypeptides.
The first polypeptide is a polysaccharide deacetylase and has an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:1.
The second polypeptide is a glycosyltransferase and has an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:2.
The activity of the polysaccharide deacetylase respectively of the glycosyltransferase polypeptide is preferably assessed by overexpressing respectively inactivating the respective encoded gene in a Bordetella pertussis strain as later defined herein and analyzing the obtainable LPS. When the LPS produced by the transformed Bordetella pertussis strain comprises at least detectable amounts of the LPS of the invention as later defined herein, the polysaccharide deacetylase, respectively the glycosyltransferase polypeptides would be said to be active and functional. Detectable amounts of LPS are preferably detectable as described in the examples: after isolation with hot phenol/water extraction (Westphal and Jann, 1965), O-deacylation by mild hydrolysis (Holst 2000) and analysis by ESI-MS (Electrospray-ionization Mass spectrometry) in the negative ion-mode.
According to an even more preferred embodiment, the polypeptide has at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%, even more preferably at least 90%, 92%, 95%, 97%, 98% or 99% identity with the amino acid sequence of SEQ ID NO:1. In a most preferred embodiment, the polysaccharide deacetylase has the SEQ ID NO:1. This polysaccharide deacetylase originates from Bordetella pertussis. The nucleic acid sequence coding for the amino acid sequence of SEQ ID NO:1 is given in SEQ ID NO:3.
According to another even more preferred embodiment, the polypeptide has at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%, even more preferably at least 90%, 92%, 95%, 97%, 98% or 99% identity with the amino acid sequence of SEQ ID NO:2. In a preferred embodiment, the glycosyltransferase has the SEQ ID NO:2. This glycosyltransferase originates from Bordetella pertussis. The nucleic acid sequence coding for the amino acid sequence of SEQ ID NO:2 is given in SEQ ID NO:4. Percentage of identity is calculated as the number of identical amino acid residues between aligned sequences divided by the length of the aligned sequences minus the length of all the gaps. Multiple sequence alignment was performed using DNAman 4.0 optimal alignment program using default settings. The alignment is usually performed between sequences identified by their SEQ ID NO or parts thereof. Preferably, the alignment is carried out using sequences identified by their SEQ ID NO.
The skilled person will understand that the polypeptides of the present invention could be obtained from other organisms than Bordetella pertussis as long as they have the required activity and identity. In a preferred embodiment, each polypeptide as identified above is obtained from a Bordetella species such as pertussis, bronchiseptica, parapertussis. Most preferably, each polypeptide as identified above is obtained from Bordetella pertussis. One single Bordetella pertussis strain or several distinct Bordetella pertussis strains may have several homologues polypeptides according to the present invention.
According to another preferred embodiment, the polypeptide of the invention, is a variant of any one of the polypeptide sequences as defined before. A variant polypeptide may be a non-naturally occurring form of the polypeptide. A polypeptide variant may differ in some engineered way from the polypeptide isolated from its native source. A variant may be made by site-directed mutagenesis starting from the amino acid sequence of SEQ ID NO:1 or from SEQ ID NO:2 or from the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:1, which is SEQ ID NO:3, or from the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:2, which is SEQ ID NO:4. Preferably, the polypeptide variant contains mutations that do not alter the biological function of the encoded polypeptide. Biological function or activity of either the polysaccharide deacetylase or the glycosyltransferase has already been defined herein.
In another aspect of the invention, there is provided a polysaccharide deacetylase, respectively a glycosyltransferase as earlier defined both being for use for preparing a medicament. Preferably said medicament is a vaccine or an adjuvant as later defined herein.
Nucleic Acid Sequences
In a second aspect of the invention, there are provided two nucleic acid sequences. The first one codes for a polysaccharide deacetylase having an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:1, preferably having the amino acid sequence SEQ ID NO:1, and/or originating from a Bordetella species, preferably Bordetella pertussis.
The first nucleic acid sequence is preferably a nucleic acid sequence having at least 50% identity with the nucleic acid sequence of SEQ ID NO:3. Preferably, the identity is of at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98% and even more preferably at least 99%. Most preferably, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:3. SEQ ID NO:3 corresponds to NP_8809668.
The second nucleic acid sequence codes for a glycosyltransferase having an amino acid sequence with at least 50% identity with the amino acid sequence of SEQ ID NO:2, preferably having the amino acid sequence SEQ ID NO:2, and/or originating from a Bordetella species, preferably Bordetella pertussis.
The second nucleic acid sequence is preferably a nucleic acid sequence having at least 50% identity with the nucleic acid sequence of SEQ ID NO:4. Preferably, the identity is of at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98% and even more preferably at least 99%. Most preferably, the nucleic acid sequence has the nucleic acid sequence of SEQ ID NO:4. SEQ ID NO:4 corresponds to NP_8809669.
Percentage of identity was determined by calculating the ratio of the number of identical nucleotides in the sequence divided by the length of the total nucleotides minus the lengths of any gaps. DNA multiple sequence alignment was performed using DNAman version 4.0 using the Optimal Alignment (Full Alignment) program. The minimal length of a relevant DNA sequence showing 50% or higher identity level should be 40 nucleotides or longer. The alignment is usually performed between sequences identified by their SEQ ID NO or parts thereof. Preferably, the alignment is carried out using sequences identified by their SEQ ID NO.
According to another preferred embodiment, the nucleic acid sequence of the invention is a variant of any of the nucleic acid sequences as defined above. Nucleic acid sequence variants may be used for preparing polypeptide variants as defined earlier. A nucleic acid variant may be a fragment of any of the nucleic acid sequences as defined above. A nucleic acid variant may also be a nucleic acid sequence that differs from SEQ ID NO:3 or SEQ ID NO:4 by virtue of the degeneracy of the genetic code. A nucleic acid variant may also be an allelic variant of SEQ ID NO:3 or SEQ ID NO:4. An allelic variant denotes any of two or more alternative forms of a gene occupying the same chromosome locus. A preferred nucleic acid variant is a nucleic acid sequence, which contains silent mutation(s). Alternatively or in combination, a nucleic acid variant may also be obtained by introduction of nucleotide substitutions, which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleic acid sequence, but which corresponds to the codon usage of the host organism intended for production of the polypeptide of the invention. According to a preferred embodiment, the nucleic acid variant encodes a polypeptide still exhibiting its biological function as earlier defined herein. More preferably, the nucleic acid sequence variant encodes a polypeptide exhibiting polysaccharide deacetylase or glycosyltransferase activity respectively. Nucleic acid sequences encoding such a polypeptide may be isolated from any microorganism.
All these variants can be obtained using techniques known to the skilled person, such as screening of library by hybridisation (southern blotting procedures) under low to medium to high hybridisation conditions with for the nucleic acid sequence SEQ ID NO:3 or SEQ ID NO:4 or a variant thereof which can be used to design a probe. Low to medium to high stringency conditions means prehybridization and hybridization at 42° C. in 5×SSPE, 0.3% SDS, 200 μg/ml sheared and denatured salmon sperm DNA, and either 25% 35% or 50% formamide for low to medium to high stringencies respectively. Subsequently, the hybridization reaction is washed three times for 30 minutes each using 2×SSC, 0.2% SDS and either 55° C., 65° C., or 75° C. for low to medium to high stringencies.
The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors.
In another aspect of the invention, there is provided a nucleic acid coding for a polysaccharide deacetylase, respectively a glycosyltransferase as earlier defined both nucleic acids being for use for preparing a medicament. Preferably said medicament is a vaccine or an adjuvant as later defined herein.
Nucleic Acid Construct
In a further aspect, the invention relates to a nucleic acid construct comprising any of the nucleic acid sequences defined in the former section, said nucleic acid sequence encoding a polypeptide exhibiting:
    • polysaccharide activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:1 or
    • glycosyltransferase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2.
Optionally, the nucleic acid sequence present in the nucleic acid construct is operably linked to one or more control sequences, which direct the production of the polypeptide in a suitable expression host.
Operably linked is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the nucleic acid sequence coding for the polypeptide of the invention such that the control sequence directs the production of the polypeptide of the invention.
Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to transcription, post-transcriptional modification, translation, post-translational modification and secretion.
Nucleic acid construct is defined as a nucleid acid molecule, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid which are combined or juxtaposed in a manner which would not otherwise exist in nature.
Control sequence is defined herein to include all components, which are necessary or advantageous for the expression of a polypeptide. At a minimum, the control sequences include a promoter and trancriptional and translational stop signals.
Expression Vector
The invention further relates to an expression vector comprising a nucleic acid construct comprising a nucleic acid sequence encoding a polypeptide exhibiting polysaccharide deacetylase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:1 as defined in the former section. Preferably, the expression vector comprises said nucleic acid sequence, which is operably linked to one or more control sequences, which direct the production of the encoded polypeptide in a suitable expression host. At a minimum control sequences include a promoter and transcriptional and translational stop signals. The expression vector may be seen as a recombinant expression vector. The expression vector may be any vector (e.g. plasmic, virus), which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence encoding the polypeptide. Depending on the identity of the host wherein this expression vector will be introduced and on the origin of the nucleic acid sequence of the invention, the skilled person will know how to choose the most suited expression vector and control sequences. Most preferred host cells are presented in the section entitled host cells.
In the context of the invention, an expression vector when introduced into a host cell will lead to a cell having an increased expression level of the nucleic acid sequence present in the expression vector, and/or an increased expression level of the polypeptide encoded by the nucleic acid sequence present in the expression vector and/or an increased activity level of the polypeptide encoded by the nucleic acid sequence present in the expression vector. In this context, the increase is assessed by comparison with the host cell which does not comprise said expression vector and/or with the host cell which does not comprise an endogenous polypeptide having at least 50% identity with SEQ ID NO:1.
In another aspect of the invention, there is provided an expression vector as earlier defined being for use for preparing a medicament. Preferably said medicament is a vaccine or an adjuvant as later defined herein.
Inactivation Vector
The invention further relates to an inactivation vector comprising a nucleic acid construct comprising a nucleic acid sequence encoding a polypeptide exhibiting glycosyltransferase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2 as defined in the former section. An inactivation vector is designed to lower or inactivate the expression of the nucleic acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2 in a given host.
The inactivation vector may be seen as a recombinant expression vector. The inactivation vector may be any vector (e.g. plasmic, virus), which can be conveniently subjected to recombinant DNA procedures and can bring about the inactivation of the expression of the nucleic acid sequence as defined above. Depending on the identity of the host wherein this inactivation vector will be introduced and on the origin of the nucleic acid sequence of the invention, the skilled person will know how to choose the most suited inactivation vector. Most preferred host cells are presented in the section entitled host cells.
In the context of the invention, an inactivation vector when introduced into a host cell will lead to a cell having a decreased (or lowered) expression level of the nucleic acid sequence present in the expression vector, and/or a decreased expression level of the polypeptide encoded by the nucleic acid sequence present in the expression vector and/or a decreased activity level of the polypeptide encoded by the nucleic acid sequence present in the expression vector. In this context, the decrease is preferably assessed by comparison with the host cell which does not comprise said inactivation vector.
The decrease of the expression level of the polypeptide exhibiting glycosyltransferase activity and having an amino acid sequence which has at least 50% identity with the amino acid sequence of SEQ ID NO:2 and/or the lowering of its activity level may have been achieved by conventional methods known in the art, such as by inactivating or down-regulating the expression of the endogenous nucleic acid sequence encoding said glycosyltransferase in the host. This inactivation or down regulation may have been achieved by deletion of one or more nucleotides in the nucleic acid sequence encoding said polypeptide. In another embodiment, the invention relates to a host, preferably a Bordetella which has a mutation in its nucleic acid sequence encoding said glycosyltransferase. Preferably to construct a host having an inactivated nucleic acid sequence encoding a glycosyltransferase, a replacement or inactivation vector is prepared and is subsequently introduced into the host by transformation. The skilled person will know how to construct such a vector.
Alternatively or in combination with the inactivation of the endogenous nucleic acid sequence encoding the glycosyltransferase, the expression of the nucleic acid sequence encoding the glycosyltransferase can be lowered by fusing it to a weak promoter suitable for low level protein expression in the selected organism.
Alternatively or in combination with the inactivation of the nucleic acid sequence encoding the endogenous glycosyltransferase, the expression of the nucleic acid sequence encoding the glycosyltransferase may be rendered inducible by fusing it to an inducible promoter suitable for inducible level protein expression in the selected organism.
Alternatively or in combination with former defined preferred embodiment, the inactivation of the nucleic acid sequence encoding the endogenous glycosyltransferase is preferably achieved by using a suicide vector. More preferably, the suicide vector is pSS1129 (Stibitz et al, 1994).
In another aspect of the invention, there is provided an inactivation vector as earlier defined for use for preparing a medicament. Preferably said medicament is a vaccine or an adjuvant as later defined herein.
Host Cell
In a further aspect, the invention provides a host cell comprising the expression vector of the invention and/or the inactivation vector of the invention both as defined in former sections. The choice of the host cell will to a large extent depend upon the source of the nucleic acid sequence of the invention. Depending on the identity of the host cell, the skilled person would know how to transform it with the construct or vector of the invention.
The host cell may be any microbial, prokaryotic or eukaryotic cell, which is suitable for expression of the LPS of the invention. In a preferred embodiment, the host cell is a Bordetella species as earlier mentioned herein. Most preferably, the Bordetella is a Bordetella pertussis.
Suitable procedures for transformation of Bordetella may involve a process comprising conjugation in a manner known to the skilled person. Suitable transformation procedures for Bordetella are described in Stibitz et al, 1994.
According to a first preferred embodiment, the host cell hence obtained has an increased expression level of the nucleic acid sequence present in the expression vector, and/or has an increased expression level of the polypeptide encoded by the nucleic acid sequence present in the expression vector and/or has an increased activity level of the polypeptide encoded by the nucleic acid sequence present in the expression vector. In this embodiment, the nucleic acid sequence present in the expression construct codes for a polypeptide having at least 50% identity with SEQ ID NO:1. In this context, the increase is assessed by comparison with the host cell which does not comprise said expression vector and/or with the host cell which does not comprise an endogenous polypeptide having at least 50% identity with SEQ ID NO:1 when both cultured and/or assayed under the same conditions.
“Increase expression level of the polypeptide” is herein preferably defined as producing more of the polypeptide as earlier defined than what the parental host cell the transformed host cell derives from will produce when both types of cells (parental and transformed cells) are cultured under the same conditions. Preferably, the host cell of the invention produces at least 3%, 6%, 10% or 15% more of the polypeptide of the invention having at least 50% identity with SEQ ID NO:1 than the parental host cell the transformed host cell derives from will produce when both types of cells (parental and transformed cells) are cultured under the same conditions. Also hosts which produce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% more of said polypeptide than the parental cell are preferred. According to another preferred embodiment, the production level of this polypeptide of the host cell of the invention is compared to the production level of the B213 Bordetella pertussis strain (Kasuga et al 1953, see also Table 1), which is taken as control. According to an even more preferred embodiment, when the host cell of the invention is an Bordetella pertussis strain, the production level of the polypeptide of the host cell of the invention is compared to the production level of the B213 strain as defined above, which is taken as control.
The assessment of the production level of the polypeptide may be performed at the mRNA level by carrying out a Northern Blot or an array analysis and/or at the polypeptide level by carrying out a Western blot. All these methods are well known to the skilled person.
“Increase in the polypeptide activity” is herein defined as exhibiting a higher polysaccharide deacetylase activity than the one of the parental host cell the transformed host cell derives from using an assay specific for said activity. Preferably, the assay is the one mentioned under the section polypeptides. Preferably, the host cell of the invention exhibits at least 3%, 6%, 10% or 15% higher polysaccharide deacetylase activity than the parental host cell the transformed host cell derives from will exhibit as assayed using a specific assay for said activity, which is preferably the assay mentioned under the section polypeptides. Also host which exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% more of said activity than the parental cell are preferred. According to another preferred embodiment, the level of polysaccharide deacetylase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control. According to a more preferred embodiment, when the host cell of the invention is an Bordetella pertussis strain, the level of polysaccharide deacetylase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control.
The increase in polypeptide expression and/or activity may have been achieved by conventional methods known in the art, such as by introducing more copies of the nucleic acid sequence encoding the polysaccharide deacetylase into the host, be it on a carrier or in the chromosome, than naturally present. Alternatively, the nucleic acid sequence encoding the polysaccharide deacetylase can be overexpressed by fusing it to highly expressed or strong promoter suitable for high level protein expression in the selected organism, or combination of the two approaches. The skilled person will know which strong promoter is the most appropriate depending on the identity of the host cell. Preferably when the host cell is a Bordetella pertussis strain, the strong promoter is the tac-promoter of the vector pMMB67EH (Methods for General and Molecular Bacteriology, Editors P. Gerhardt et al., American Society for Microbiology, Washington D.C., 1994, p. 409-410).
Alternatively or in combination with first preferred embodiment, the invention provides a second preferred embodiment, wherein the host cell has a decreased expression level of the nucleic acid sequence encoding the polypeptide having at least 50% identity with the amino acid sequence of SEQ ID NO:2, and/or has a decreased expression level of said polypeptide and/or has a decreased activity level of said polypeptide, preferably via the use of the inactivation vector of the invention as earlier defined herein. In this embodiment, the nucleic acid sequence present in the inactivation vector codes for a polypeptide having at least 50% identity with SEQ ID NO:2. In this context, the decrease is assessed by comparison with the host cell which does not comprise said inactivation vector when both cultured and/or assayed under the same conditions.
“Decrease expression level of the polypeptide” is herein preferably defined as producing less of the polypeptide (as earlier defined) than what was produced by the parental host cell from which the transformed host cell was derived when both types of cells (parental and transformed cells) are cultured under the same conditions. Preferably, the host cell of the invention produces at least 3%, 6%, 10% or 15% less of the polypeptide of the invention having at least 50% identity with SEQ ID NO:2 than that produced by the parental host cell from which the transformed host cell was derived when both types of cells (parental and transformed cells) are cultured under the same conditions. Also hosts which produce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% less of said polypeptide than the parental cell are preferred. According to another preferred embodiment, the production level of this polypeptide of the host cell of the invention is compared to the production level of the B213 strain as defined before, which is taken as control. According to an even more preferred embodiment, when the host cell of the invention is a Bordetella pertussis strain, the production level of the polypeptide of the host cell of the invention is compared to the production level of the B213 strain as defined before, which is taken as control.
The assessment of the production level of the polypeptide may be performed at the mRNA level by carrying out a Northern Blot or an array analysis and/or at the polypeptide level by carrying out a Western blot. All these methods are well known to the skilled person.
“Decrease in the polypeptide activity” is herein defined as exhibiting a lower glycosyltransferase activity than the one of the parental host cell from which the transformed host cell was derived, using an assay specific for said activity. Preferably, the assay is the one which has been already described herein under the section “Polypeptides.” Preferably, the host cell of the invention exhibits at least 3%, 6%, 10% or 15% lower glycosyltransferase activity than that of the parental host cell from which the transformed host cell was derived as assayed using a specific assay for said activity, which is preferably the assay described under the section “Polypeptides.” Also hosts which exhibit at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% less of said activity than the parental cell are preferred. According to another preferred embodiment, the level of glycosyltransferase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control. According to a more preferred embodiment, when the host cell of the invention is a Bordetella pertussis strain, the level of polysaccharide deacetylase activity of the host cell of the invention is compared to the corresponding activity of the B213 strain as defined before, which is taken as control.
The decrease in polypeptide expression and/or activity may have been achieved by conventional methods known in the art, such as by introducing more copies of the nucleic acid sequence encoding the polysaccharide deacetylase into the host, be it on a carrier or in the chromosome, than naturally present. Alternatively, the nucleic acid seqeunce encoding the polysaccharide deacetylase can be overexpressed by fusing it to highly expressed or strong promoter suitable for high level protein expression in the selected organism, or combination of the two approaches. The skilled person will know which strong promoter is the most appropriate depending on the identity of the host cell. Preferably when the host cell is a Bordetella pertussis strain, the strong promoter is the tac-promoter of the vector pMMB67EH as defined before.
According to a more preferred embodiment, the host cell does not produce any detectable amounts of glycosyltransferase of the invention and/or does not exhibit any detectable glycsosyltransferase activity. Preferably, the host cell does not produce or produces substantially no glycosyltransferase.
Alternatively, according to another more preferred embodiment, the host cell produces an inducible amount of the glycosyltransferase of the invention and/or exhibit an inducible glycosyltransferase activity.
The decreasing of the expression level of the glycosyltransferase of the invention and/or the decreasing of its activity level may have been achieved by conventional methods known in the art, such as by inactivating or down-regulating the nucleic acid sequence encoding the endogenous glycosyltransferase of the host. This inactivation or down regulation may have been achieved by deletion of one or more nucleotides in the encoding gene. In another embodiment, the invention relates to a host, preferably a Bordetella pertussis which has a mutation in its nucleic acid sequence encoding the glycosyltransferase. Preferably to construct a host having an inactivated nucleic acid sequence encoding the glycosyltransferase, a replacement or inactivation vector is prepared and is subsequently introduced into the host by transformation. The skilled person will know how to construct such a vector.
Alternatively or in combination with the inactivation of the endogenous nucleic acid sequence, the expression of the nucleic acid sequence encoding the glycosyltransferase can be decreased by fusing it to a weak promoter suitable for low level protein expression in the selected organism.
Alternatively or in combination with the inactivation of the endogenous nucleic acid sequence, the expression of the nucleic acid sequence encoding the glycosyltransferase can be rendered inducible by fusing it to an inducible promoter suitable for inducible level protein expression in the selected organism. Preferably when the host cell is a Bordetella pertussis strain, the inducible promoter is the tac-promoter of the vector pMMB67EH as defined before Surprisingly, the host cell of the invention has attractive properties, which renders it very attractive to be used as a whole pertussis vaccine or as an adjuvant: improved potentiality to interact with DC, and to subsequently induce their maturation, and induce the production of proinflammatory cytokines. Alternatively or in combination, the LPS obtainable from these cells is also very suited to be used as a vaccine or as an adjuvant as presented below.
Accordingly, in another aspect of the invention, there is provided a host cell as earlier defined for use as a medicament. Preferably said medicament is a vaccine or an adjuvant as later defined herein.
LPS Obtainable by the Host Cell
In a further aspect, the invention relates to the LPS obtainable from the host cell of the invention as earlier defined herein. Preferably, the host cell is a Bordetella species, more preferably a Bordetella pertussis, even more preferably a Bordetella pertussis carrying an overexpression of the polysaccharide deacetylase of the invention and/or an inactivation of the glycosyltransferase of the invention. More preferably, the LPS is of the invention is obtainable from mutant 2331 as prepared in the examples. Even more preferably, when analysed after isolation with hot phenol/water extraction (Westphal and Jann, 1965), O-deacylation by mild hydrolysis (Holst 2000) and analysis by ESI-MS in the negative ion-mode, the ESI-MS spectrum of the LPS of the invention is characterized by giving more ions than the corresponding ESI-MS spectrum of the LPS derived from a wild type Bordetella pertussis, named wild type LPS. Preferably the wild type Bordetella pertussis is strain B213 as defined before. Without willing to be bound by any theory, these additional ions may reflect at least partly the increased substitution of the 1 or 4′ phosphate groups of the lipid A part of LPS with hexosamine residues.
Typically the ESI-MS spectrum of the wild type LPS is characterized by giving 7 ions (see table 3), whereas the ESI-MS spectrum of the LPS of the invention is characterized by giving more than 7 ions, at least 8, at least 10, at least 12 and more preferably 14 ions.
Alternatively or in combination with former embodiment, preferably, the ESI-MS spectrum of the LPS of the invention comprises more ions comprising hexosamine than the ESI-MS spectrum of the wild type LPS. Typically, the ESI-MS spectrum of the wild type LPS gives two ions with hexosamine (see table 3), whereas the ESI-MS spectrum of the LPS of the invention is characterized by giving more than two ions, at least 4, at least 6, and more preferably 8 ions.
Pharmaceutical Compositions and Medical Uses
The invention further relates to a pharmaceutical composition comprising the host cell of the invention and/or the LPS of the invention both as earlier defined herein. The pharmaceutical composition may be used as a vaccine or as an adjuvant. The vaccine may be used for immunisation (raising an immune response) or vaccination of a mammal.
Adjuvants are herein defined to include any substance or compound that, when used in combination with an antigen, to immunise a mammal, preferably a human, stimulates the immune system, thereby provoking, enhancing or facilitating the immune response against the antigen, preferably without generating a specific immune response to the adjuvant itself. Preferred adjuvants enhance the immune response against a given antigen by at least a factor of 1.5, 2, 2.5, 5, 10 or 20, as compared to the immune response generated against the antigen under the same conditions but in the absence of the adjuvant. Tests for determining the statistical average enhancement of the immune response against a given antigen as produced by an adjuvant in a group of animals or humans over a corresponding control group are available in the art. The adjuvant preferably is capable of enhancing the immune response against at least two different antigens. The adjuvant of the invention will usually be a compound that is foreign to a mammal, thereby excluding immunostimulatory compounds that are endogenous to mammals, such as e.g. interleukins, interferons and other hormones.
In a preferred embodiment, when the pharmaceutical composition is used as an adjuvant, the composition further comprises an antigen.
When the composition is used as a vaccine, the antigen is present at the surface of the host cell of the invention and/or is present within the LPS obtainable from such cells. In this case the vaccine is preferably a vaccine against the host of the invention and/or against any host capable of expressing a related LPS molecule.
When the composition is used as an adjuvant, preferably an antigen is present. The antigen is preferably an antigen from or produced by a bacterium, a virus, a fungus, a parasite, a cancer cell or an allergen as further defined below. The antigen and the host cell of the invention and/or the LPS obtainable by such cells are preferably used in the treatment and/or prevention of an infectious disease caused by the bacterium, virus, fungus, or parasite, or the tumor caused by the cancer cell, or the allergy caused by the allergen.
In a further preferred embodiment, the pharmaceutical composition comprising a host cell of the invention and/or a LPS obtainable therefrom and optionally an antigen as herein defined above further comprises a pharmaceutically acceptable carrier. The pharmaceutical compositions may further comprise pharmaceutically acceptable stabilizing agents, osmotic agents, buffering agents, dispersing agents, and the like. The preferred form of the pharmaceutical composition depends on the intended mode of administration and therapeutic application. The pharmaceutical carrier can be any compatible, non-toxic substance suitable to deliver the active ingredients, i.e. the host cell of the invention and/or the LPS obtainable from this host cell and optionally the antigen, to the patient. Pharmaceutically acceptable carriers for intranasal delivery are exemplified by water, buffered saline solutions, glycerin, polysorbate 20, cremophor EL, and an aqueous mixture of caprylic/capric glyceride, and may be buffered to provide a neutral pH environment. Pharmaceutically acceptable carriers for parenteral delivery are exemplified by sterile buffered 0.9% NaCl or 5% glucose optionally supplemented with a 20% albumin. Preparations for parental administration must be sterile. The parental route for administration of the active ingredients is in accord with known methods, e.g. injection or infusion by subcutaneous, intravenous, intraperitoneal, intramuscular, intraarterial or intralesional routes. The compositions of the invention are preferably administered by bolus injection. A typical pharmaceutical composition for intramuscular injection would be made up to contain, for example, 1-10 ml of phosphate buffered saline and 1 to 100 μg, preferably 15-45 μg of antigen and 1 to 100 μg, preferably 15-45 μg of the host cell and/or LPS of the invention. For oral administration, the active ingredient can be administered in liquid dosage forms, such as elixirs, syrups, and suspensions. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance. Methods for preparing parenterally, orally or intranasally administrable compositions are well known in the art and described in more detail in various sources, including, for example, Remington's Pharmaceutical Science (15th ed., Mack Publishing, Easton, Pa., 1980) (incorporated by reference in its entirety for all purposes).
The antigen in the composition of the invention preferably is an antigen that is from or produced by a bacterium, a virus, a fungus, a parasite, a cancer cell or an allergen. Viral antigens that may be combined with the host cell and/or LPS of the invention can be derived from all sorts of viruses, non-limiting examples of such viruses are: Retroviridae such as Human Immunodeficiency virus (HIV); a rubellavirus; paramyxoviridae such as parainfluenza viruses, measles, mumps, respiratory syncytial virus, human metapneumovirus; flaviviridae such as yellow fever virus, dengue virus, Hepatitis C Virus (HCV), Japanese Encephalitis Virus (JEV), tick-borne encephalitis, St. Louis encephalitis or West Nile virus; Herpesviridae such as Herpes Simplex virus, cytomegalovirus, Epstein-Barr virus; Bunyaviridae; Arenaviridae; Hantaviridae such as Hantaan; Coronaviridae; Papovaviridae such as human Papillomavirus; Rhabdoviridae such as rabies virus. Coronaviridae such as human coronavirus; Alphaviridae, Arteriviridae, filoviridae such as Ebolavirus, Arenaviridae, poxyiridae such as smallpox virus, and African swine fever virus. Likewise the host cell and/or LPS of the invention may be combined with antigens derived from pathogenic bacteria, fungi (including yeasts), or parasites. Such antigens include bacterial antigens of e.g. Helicobacter, such as H. pylori, Neisseria, such as N. mengitidis, Haemophilus, such as H. influenza, Bordetella, such as B. pertussis, Chlamydia, Streptococcus, such as Streptococcus sp. serotype A, Vibrio, such as V. cholera, Gram-negative enteric pathogens including e.g. Salmonella, Shigella, Campylobacter and Escherichia, as well as antigen from bacteria causing anthrax, leprosy, tuberculosis, diphtheria, Lyme disease, syphilis, typhoid fever, and gonorrhea. Antigens from parasites e.g. include antigens from protozoans, such as Babeosis bovis, Plasmodium, Leishmania spp. Toxoplasma gondii, and Trypanosoma, such as T. cruzi. Fungal antigens may include antigens from fungi such as Aspergillus sp., Candida albicans, Cryptococcus, such as e.g C. neoformans, and Histoplasma capsulatum.
Although vaccination is generally applied for the prophylactic protection against pathogens or for the treatment of diseases following pathogenic infection, the person skilled in the art is aware of the application of vaccines for tumor-treatment. Moreover, an increasing number of tumor-specific proteins are found to be proper entities that can be targeted by human or humanized antibodies. Such tumor-specific proteins are also within the scope of the present invention. Many tumor specific antigens are known in the art. Therefore, in one preferred embodiment, the invention provides compositions comprising a tumor-specific antigen and a host cell and/or LPS as defined above. Suitable tumor antigens include e.g. carcinoembryonic antigen, prostate-specific membrane antigen, prostate specific antigen, protein MZ2-E, polymorphic epithelial mucin (PEM), folate-binding-protein LK26, (truncated) epidermal growth factor receptor (EGRF), HER2, Thomsen-Friedenreich (T) antigen, GM-2 and GD-2 gangliosides, Ep-CAM, mucin-1, epithialial glycoprotein-2, and colon specific antigen.
In addition, antigens can be targeted to DC's in order to induce tolerance in the prevention of auto-immune disease. Such allergens are also within the scope of the present invention.
Accordingly, in a further aspect, the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell is/are for use as a medicine. Preferably, the medicine is a vaccine against pertussis.
In another preferred embodiment, the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell is/are for use as an adjuvant. More preferably, the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell are used in combination with an antigen.
Accordingly in a further aspect, the invention relates to the use of the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell for the preparation of a medicament for the prevention and/or treatment of pertussis. In a preferred embodiment, the host cell of the invention, preferably a Bordetella pertussis and/or the LPS obtainable from such cell are used as adjuvant for the preparation of a medicament for raising an immune response against an antigen. More preferably, the host cell of the invention and/or the LPS obtainable from such cell are used as adjuvant in combination with said antigen.
Accordingly in a further aspect, the invention relates to the use of a polypeptide of the invention as earlier defined herein and/or a nucleic acid sequence of the invention as defined herein for the preparation of a medicament for the prevention and/or treatment of pertussis.
Accordingly in a further aspect, the invention relates to the use of a polypeptide of the invention as earlier defined herein and/or a nucleic acid sequence of the invention as earlier defined herein for the preparation of an adjuvant. Preferably, in this aspect, the polypeptide of the invention as earlier defined herein and/or the nucleic acid sequence of the invention as earlier defined herein are used in combination with an antigen for the preparation of a medicament for raising an immune response against the antigen.
In the methods and uses of the invention, the mammal is preferably a human.
In this document and in its claims, the verb “to comprise” and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article “a” or “an” does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article “a” or “an” thus usually means “at least one”.
DESCRIPTION OF THE FIGURES
FIG. 1. (A) Schematic representation of the identified glycosyltransferase operon. Dark gray arrows indicate the genes that encode putative glycosyltransferases, whereas the light grey and white arrows indicate the gene encoding a putative monosaccharide deacetylase and the flanking ORFs, respectively. (B) Analysis of LPS profiles from the wild-type B. pertussis strain (WT), and the BP2329-, BP2328-, and BP2331-mutant strains by Tricine-SDS-PAGE.
FIG. 2. Negative ion ESI-MS of O-deacylated LPS of wild-type B. pertussis (A) and B. pertussis mutant strains BP2328 (B), BP2329 (C) and BP2331 (D).
FIG. 3. Negative mode tandem mass spectrometric analysis of O-deacylated LPS from the BP2331-mutant strain. (A) extracted MS/MS spectrum of the ion at m/z 1108.3, (B) extracted MS/MS spectrum of the ion at m/z 1162.0, (C) extracted MS3 spectrum of the ion at m/z 1112.6 from the ion at m/z 1162.0.
FIG. 4. DC activation after stimulation with the wild-type and mutant B. pertussis cells. (A) Analysis of CD83, HLA-DR, CD86, and CD40 cell-surface expression in human DCs after 24 h stimulation with PFA-fixed wild-type and mutant B. pertussis cells at MOI 10 (black line) or 100 (dashed line). Unstimulated DCs served as control (grey-filled histogram). Shown are FACS histograms for the indicated B. pertussis strains from 5,000 events counted. The vertical axis represents the cell number, while the horizontal axis represents the intensity of staining (B) IL-10 and IL-12p70 production by cultured human DCs after stimulation with PFA-fixed wild-type and mutant B. pertussis cells at MOI 10 or 100. Results are expressed as mean cytokine concentrations (±SD).
FIG. 5. DC activation after stimulation with purified wild-type and mutant B. pertussis LPS. (A) Analysis of CD83, CD86, and CD40 cell-surface expression in human DCs after 24 h stimulation with 1 μg/ml purified LPS. Unstimulated DCs served as control (grey-filled histogram). Shown are FACS histograms for the LPS of the indicated B. pertussis strains from 5,000 events counted. The vertical axis represents the cell number, while the horizontal axis represents the intensity of staining (B) IL-10 production by cultured human DCs after stimulation with 1 μg/ml purified LPS. Results are expressed as mean cytokine concentrations.
FIG. 6. IL-6 induction by purified B. pertussis LPS and whole bacterial cells. The production of IL-6 by the human macrophage cell line MM6 was stimulated with serial dilutions of stock solutions of purified LPS (A) or whole bacterial cells (B) from the wild-type B. pertussis strain (WT), or the BP2328-, BP2329-, and BP2331-mutant strains. IL-6 concentrations in the culture supernatants were quantified in an ELISA against human IL-6. The data represent the averages of three individual experiments.
FIG. 7. Structure of B. pertussis LPS. Proposed truncated core OS structures of the BP2328- and BP2329-mutant strains are indicated by red arrows. Adapted from Caroff et al. (2000).
EXAMPLES
Materials and Methods
Bacterial Strains and Growth Conditions
All bacterial strains used are described in Table 1. Typically, the E. coli strains were grown at 37° C. in Luria-Bertani broth while shaking at 200 rpm. When appropriate, bacteria were grown in the presence of 100 μg/ml ampicillin, 50 μg/ml kanamycin, or 10 μg/ml gentamicin, for plasmid maintenance or strain selection. B. pertussis was grown at 35° C. on Bordet-Gengou (BG) agar supplemented with 15% defibrinated sheep blood (Tritium).
Recombinant DNA Techniques
All plasmids used are described in Table 1. Plasmid DNA was isolated using the Promega Wizard®Plus SV Minipreps system. Restriction endonucleases were used according to the instructions of the manufacturer (Roche). DNA fragments were isolated from agarose gels using the Promega Wizard® SV Gel and PCR Clean-Up system. Ligations were performed using the rapid DNA ligation kit (Roche).
All primers used are described in Table 2. Chromosomal template DNA for PCR reactions was prepared by resuspending ˜109 bacteria in 50 μl of distilled water, after which the suspension was heated for 15 min at 95° C. The suspension was then centrifuged for 1 min at 16,100×g, after which the supernatant was used as template DNA. To construct B. pertussis mutant strains B213ΔBP2328 and ΔBP2329, we amplified DNA segments encompassing the 5′ region and upstream sequences of the corresponding ORFs by using primers BP2328_FWup, BP2329_FWup, and primers BP2328_REVup and BP2329_REVup, which both contained a BamHI site. Additionally, DNA fragments containing the 3′ regions and downstream sequences of the ORFs were obtained by PCR with primers BP2328_FWdown, BP2329_FWdown, both containing a BamHI site, and primers BP2328_REVdown and BP2329_REVup. To construct a B. pertussis BP2331 mutant strain, the corresponding ORF was amplified by using primers BP2331_FW and BP2331_REV. The PCRs were performed using pure Taq Ready-to-go PCR beads (Amersham Biosciences) in a 25-μl total reaction volume with 5 pmol of each primer. The temperature program was as follows: 95° C. for 3 min, 30 cycles of 15 s at 95° C., 30 s at 55° C., and 1 min at 72° C., followed by 7 min at 72° C. and subsequent cooling to 4° C. The PCR products were purified from agarose gel and subsequently cloned into pGEM-T Easy resulting in plasmids pGEM-BP2328up, pGEM-BP2328down, pGEM-BP2329up, pGEM-BP2329down, and pGEM-BP2331, respectively. The BamHI-SpeI fragments of pGEM-BP2328down and pGEM-BP2329down were ligated into BamHI-SpeI-restricted pGEM-BP2328up and pGEM-BP2329up, respectively. The resulting plasmids and plasmid pGEM-BP2331 were cut with BamHI and EcoRV, respectively, to allow for insertion of the kanamycin-resistance cassette from plasmid pBSL128 obtained by BamHI and HindIII digestion, respectively. Finally, EcoRI fragments of the constructs obtained were ligated into the EcoRI-restricted suicide plasmid pSS1129. The final constructs, designated pSS1129-BP2328KO, pSS1129-BP2329KO, and pSS1129-BP2331KO, respectively, contained the kanamycin-resistance cassette in the same orientation as the transcription direction of the operon. The pSS1129-based plasmids were used to transform E. coli SM10(λpir), which allowed for subsequent transfer of the plasmids to B. pertussis and construction of B. pertussis BP2328, BP2329, and BP2331 mutants by allelic exchange. Transformants were screened by PCR using various primer sets.
LPS Isolation and Preparation of De-O-Acylated LPS
LPS was isolated using the hot phenol/water extraction method (Westphal and Jann, 1965) with slight modifications (Geurtsen et al., 2006). De-O-acylation of LPS was achieved by mild hydrazinolysis (Hoist, 2000). Briefly, LPS was dissolved in anhydrous hydrazine (200 μl), and incubated at 37° C. for 50 min with constant stirring to release the O-linked fatty acyl chains. The mixture was cooled and 600 μl of cold acetone were added in small portions to convert hydrazine to acetone hydrazone. The precipitate of the de-O-acylated LPS was collected by centrifugation (4000×g, at 7° C. for 30 min). The pellet was washed twice with 600 μl of cold acetone, centrifuged and dissolved in water before lyophilisation.
Capillary Electrophoresis-Electrospray Mass Spectrometry
A Prince CE system (Prince Technologies) was coupled to a 4000 QTRAP mass spectrometer (Applied Biosystems/MDS Sciex). A sheath solution (isopropanol-methanol, 2:1) was delivered at a flow rate of 1.0 μl/min. Separations were obtained on a ˜90-cm length bare fused-silica capillary using 15 mM ammonium acetate in deionised water, pH 9.0. The 5 kV and −5 kV of electrospray ionisation voltage were used for positive and negative ion mode detections, respectively. For all the mass spectrometric experiments, nitrogen was used as curtain and collision gas. In the MS2 (enhanced product ion scan or EPI) and MS3 experiments, the scan speed was set to 4000 Da/s with Q0 trapping, the trap fill time was set as “dynamic” and the resolution of Q1 was set as “unit”. For MS3 experiments, the excitation coefficient was set at a value to excite only the first isotope for a single charged precursor with excitation time set at 100 ms.
LPS Analysis by Tricine-SDS-PAGE
Approximately 109 bacteria were suspended in 50 μl of sample buffer (Laemmli, 1970), and 0.5 mg/ml proteinase K (end concentration) was added. The samples were incubated for 60 min at 55° C., followed by 10 min at 95° C. to inactivate proteinase K. The samples were then diluted 10 fold by adding sample buffer, after which 2 μl of each sample were applied to a Tricine-SDS-PAGE gel (Lesse et al., 1990). The bromophenol blue was allowed to run into the separating gel at 35 V, after which the voltage was increased to 105 V. After the front reached the bottom of the gel, electrophoresis was continued for another 45 min. The gels were fixed overnight in water/ethanol/acetic acid 11:8:1 (v/v/v) and subsequently stained with silver as described (Tsai and Frasch, 1982).
Preparation of Bacterial Cell Suspensions
Bacteria were inactivated in 0.5% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) for 30 min and washed thoroughly in RPMI 1640 medium without phenol red (Gibco). Bacterial suspensions with an optical density at 600 nm (OD600) of 1, corresponding to ˜109 bacteria/ml, were prepared in RPMI 1640 medium without phenol red.
Human DC Generation and Culture
Immature human DC were generated from human peripheral blood mononuclear cells (PBMCs) as described previously with minor modifications (Sallusto and Lanzavecchia, 1994). Briefly, PBMCs were isolated from heparinised blood from healthy volunteers using density-gradient centrifugation over a FICOLL® gradient (Amersham Biosciences). Recovered PBMC fractions were washed three times in RPMI 1640 medium, supplemented with 10% heat-inactivated fetal calf serum (FCS) (Bodinco BV). Next, monocytes were prepared from PBMCs by centrifugation over a three-layer PERCOLL® gradient (GE Healthcare Bio-Sciences AB) (60%, 47.5%, and 34% Percoll in RPMI 1640, 10% FCS). Monocytes were harvested from the upper interface and washed three times with RPMI 1640, 10% FCS medium and incubated in a six-well plate (4 ml per well, 0.5×106 cells/ml) in RPMI 1640, 10% FCS, supplemented with 2.4 mM L-glutamine (Sigma-Aldrich), 100 U/ml penicillin-streptomycin (Gibco), 100 ng/ml of human recombinant GM-CSF (Peprotech), and 50 ng/ml of human recombinant IL-4 (Strathmann-Biotec AG). After six days of culture, immature DC (imDC) were harvested, which were negative for CD14 and CD83, expressed low levels of CD86 and HLA-DR, and expressed high levels of CD40 and CD11c as assessed by flow cytometry.
DC Stimulation
ImDC were washed and resuspended at a concentration of 5×105 cells/ml in RPMI 1640 10% FCS, and co-incubated with either PFA-fixed B. pertussis cells at a multiplicity of infection (MOI) of 10 or 100, or purified LPS at a concentration of 10 or 1000 ng/ml. Unstimulated imDC served as control in all experiments. DC were harvested after 24 h and directly stained for expression of cell surface markers; the supernatants were stored at −80° C. before cytokine measurements.
Flow Cytometric Analysis of Cell Surface Markers
Surface expression of DC maturation markers and co-stimulatory molecules was assessed by flow cytometry. Immature or stimulated DC were harvested, washed in RPMI 1640, 10% FCS and resuspended in filter-sterilised PBS containing 0.1% bovine serum albumin (FACS buffer). Next, cells were incubated for 30 min at 4° C. with either one of the following antibodies: FITC-conjugated anti-human CD11c (mIgG1) and CD83 (mIgG1), phycoerythrin-conjugated anti-human CD86 (mIgG1) and CD40 (mIgG1), allophycocyanin-conjugated anti-human CD14 (mIgG1) and HLA-DR (mIgG2b) and appropriate fluorochrome-labelled isotype controls (CD11c, CD40 and CD14 from eBioscience; CD83, CD86 and HLA-DR from BD Pharmingen). Cells were washed twice with FACS buffer and analysed using flow cytometry (FACScan, Becton Dickinson).
Cytokine Measurements
Human IL-10 and IL-12p70 concentrations in the supernatants of stimulated DCs were determined using an Enzyme-linked Immunosorbent Assay (ELISA) according to the manufacturer's instructions (BD Biosciences Pharmingen).
Endotoxic Activity Assays
The human macrophage cell line MM6 (Ziegler-Heitbrock et al., 1988) was stimulated with serial dilutions of whole bacterial cell suspensions or purified LPS as described (Geurtsen et al., 2006). The bacterial cell suspensions were prepared by collecting the cells from cultures by centrifugation, after which they were resuspended in PBS at an OD590 of 1.0, heat-inactivated for 10 min in the presence of 8 mM formaldehyde, and stored at 4° C. Following stimulation, IL-6 concentrations in the culture supernatants were quantified with an ELISA against human IL-6 according to the manufacturer's instructions (PeliKine Compact™)
Results
Identification of a Novel LPS-Biosynthesis Operon in B. pertussis
We found a cluster of four genes (BP2328 to BP2331, GenBank Accession Numbers NP_880966 to NP_880969) three of which showed high sequence similarity to LPS glycosyltransferases from various bacteria, i.e., BP2328, BP2329 and BP2331. BP2330 shows the highest similarity to a polysaccharide deacetylase from Xylella fastidiosa. The four ORFs are close to each other and in some cases even overlap, suggesting that they constitute an operon (FIG. 1A). The genes upstream and, in the reverse orientation, downstream of the operon, putatively encode homologues of the DNA polymerase III subunit alpha DnaE and of the putative sulfatase YhbX of E. coli, respectively. In order to study the role of the putative LPS glycosyltransferases, we made constructs in suicide plasmid pSS1129 carrying the individual BP2328, BP2329, and BP2331 genes interrupted by a kanamycin-resistance cassette for insertional inactivation by allelic exchange. Using this approach, knockout mutants for all three genes could be readily obtained in B. pertussis strain B213. Analysis of their LPS by Tricine-SDS-PAGE of whole-cell lysates showed clearly truncated LPS for the BP2328 and BP2329 mutants (FIG. 1B). In contrast, the LPS of the BP2331 mutant strain was more heterogenic and consisted of multiple bands, including the wild-type length.
LPS Structural Analysis
To determine their structure, LPS from the wild-type and BP2328-, BP2329-, and BP2331-mutant strains was isolated, O-deacylated, and analysed by ESI-MS in the negative-ion mode (FIG. 2). The proposed LPS compositions are summarised in Table 3. The spectrum of wild-type LPS (FIG. 2A) revealed a major triply-charged ion at m/z 1108.5 corresponding to full-length B. pertussis LPS with the composition GlcNAco•Man2NAc3NAcA•Fuc2NAc4NMe•GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•lipid A-OH. Additional ions were present at m/z 770.1 ([M−3H]3−), 811.1 ([M−4H]4−), 831.4 ([M−4H]4−), 888.3 ([M−3H]3−), 951.8 ([M−H]), 987.1 ([M−2H]2−), 1081.7 ([M−3H]3−), 1121.1 ([M−3H+K]3−), 1155.0 ([M−2H]2−), and 1162.1 ([M−3H]3−). Most of these ions corresponded to dephosphorylated or truncated glycoforms; however, the triply-charged ion at m/z 1162.1 corresponded to full-length B. pertussis LPS substituted with an additional hexosamine moiety (Table 3). The ESI-MS spectrum of the BP2328-mutant LPS (FIG. 2B) showed triply-charged ions at m/z 743.6, 770.0 and 823.7, together with their corresponding doubly-charged ions at m/z. 1115.2, 1155.1, and 1235.7. Additional peaks were present at m/z 777.3 ([M−3H+Na]3−), 952.1 ([M−H]), 1034.6 ([M−2H]2−), 1074.6 ([M−2H]2−), and 1166.1 ([M−2H+Na]2−). Assignment of the peaks revealed that the most complete core OS structure was represented by the ions at m/z 823.7 and 1235.7 corresponding to the composition GalNA•Glc•GlcN2•GlcA•Hep2•P•Kdo•lipid A-OH. BP2329 mutant LPS (FIG. 2C) showed triply charged ions at 603.9 and 657.6, together with their corresponding doubly-charged ions at m/z 906.0 and 986.6. In addition, sodium and potassium adducts of these ions were present at m/z 917.4 and 997.6, and m/z 925.0 and 1005.6, respectively. Additional peaks were present at m/z 866.0 ([M−2H]2−), 937.4 ([M−2H—H2O]2−), and 1067.1 ([M−2H]2−). In this case, the most complete core structure was represented by the doubly-charged ion at m/z 1067.1 corresponding to the composition GlcN2•GlcA•Hep2•P•Kdo•lipid A-OH, BP2331 mutant LPS (FIG. 2D) showed a large number of peaks, including triply-charged ions at m/z 1108.3 and 1162.0 corresponding to full-length B. pertussis LPS and full-length B. pertussis LPS substituted with an additional hexosamine, respectively.
To resolve the location of the additional hexosamine moiety, which was observed in both wild-type and BP2331-mutant LPS, ESI-MS2 studies were performed in negative-ion mode (FIG. 3). MS/MS spectra of the ions at m/z 1108.3 (FIG. 3A) and 1162.0 (FIG. 3B) both showed a singly charged fragment ion at m/z 951.5, which revealed that lipid A-OH, resulting from the cleavage between the Kdo-lipid A bond under collision-induced dissociation, consisted of a β-(1→6)-linked disaccharide of N-acylated (3OH C14) glucosamine residues, each residue being substituted with a phosphate group. The spectrum of ion at m/z 1162.0 also showed an additional ion at m/z 1112.6, which indicates that the extra hexosamine residue was directly attached to lipid A. MS3 on m/z 1112.6 further supported this conclusion (FIG. 3C).
Dendritic Cell Activation by B. pertussis LPS Mutants
To determine the influence of the LPS mutations on DC activation, immature DCs were co-cultured with PFA-fixed B. pertussis wild-type and mutant bacteria at an MOI of 10 and 100. DC activation was monitored by analysis of maturation marker (CD83 and HLA-DR) and co-stimulatory molecule (CD86 and CD40) expression by flow cytometry (FIG. 4A) and IL-10 and IL12p70 induction by ELISA (FIG. 4B). Wild-type and all mutant bacteria induced CD83, HLA-DR, CD86, and CD40 expression, demonstrating that all strains were capable of activating DCs. However, the BP2329- and BP2331-mutant bacteria were clearly less and more stimulatory, respectively, than the wild-type bacteria, whereas the BP2328-mutant strain was as efficient as the wild type. The lower DC maturation observed in the case of the BP2329-mutant strain was accompanied by lower induction of IL-10 and IL-12p70 (FIG. 4B). Similarly, the BP2331 mutant, which displayed an enhanced DC-maturation capacity, induced higher amounts of IL-10 and IL-12p70. The wild-type strain and the BP2328-mutant strain induced comparable levels of IL-10, which is in agreement with the equal expression of co-stimulatory molecules and maturation markers on the DCs in response to these strains. However, whereas the wild-type strain clearly induced IL-12p70 production, this was hardly the case for the BP2328-mutant strain (FIG. 4B), suggesting that IL-10 and IL-12p70 expression can be differentially regulated.
To assess whether the observed differences in DC activation capacity between the wild-type and mutant strains are directly related to the differences in the LPS composition, DC activation studies were performed with 10 and 1000 ng/ml of purified LPS. In contrast to the high increase in expression of maturation markers and co-stimulatory molecules on DCs in response to wild-type, BP2328-, and BP2331-mutant bacteria, only minor increases in CD83, CD86, and CD40 expression (FIG. 5A) and no increase in HLA-DR expression (data not shown) was found even with 1000 ng/ml LPS of these strains. Similarly, IL-10 induction was low (FIG. 5B) and IL-12p70 could not be detected in supernatants of DCs stimulated with LPS (data not shown). Nevertheless, mutual comparison (FIGS. 5A and 5B) demonstrated that, in accordance with the results obtained with intact bacteria, the highest DC activation capacity was found for the LPS isolated from the BP2331-mutant strain, followed by those of the BP2328-mutant strain and the wild-type strain, whereas that of the BP2329-mutant strain was incapable of maturing DCs. Thus, the alterations in the LPS structure of the mutants differentially affect DC activation capacity.
Endotoxic Activity of LPS and Whole Bacterial Cells
To assess the consequences of the LPS mutations on the endotoxic activity of LPS, the potency of the purified LPS to stimulate the human macrophage cell line MM6 for IL-6 production was tested. As compared with wild-type LPS, purified LPS from the BP2331-mutant strain had a strongly increased potency to stimulate the macrophages (FIG. 6A). In contrast, LPS from the BP2329-mutant strain had a reduced potency to stimulate IL-6 production, whereas LPS from the BP2328 mutant was similarly active as wild-type LPS (FIG. 6A). Only at the two highest LPS concentrations tested, the latter LPS was more active than wild-type LPS was. Consistent with the data obtained with purified LPS, whole-cell suspensions of the BP2331 mutant showed, as compared to wild-type cells, a clearly increased potency to stimulate the macrophages (FIG. 6B). However, also the BP2328-mutant cells showed this effect (FIG. 6B), while BP2329-mutant cells had similar activity as the wild-type cells in spite of their less active purified LPS (FIG. 6A).
Discussion
The goal of the present study was to identify new LPS glycosyltransferases in the B. pertussis genome. By using sequences of known LPS glycosyltransferases as leads, we were able to identify a four-gene operon. In a previous study, in which the genome sequence of the poultry pathogen Bordetella avium was compared to the genome sequences of other Bordetellae, an gene cluster homologous to the one here identified was described as being involved in LPS biosynthesis (Sebaihia et al., 2006). However, no functional studies were reported which could confirm this assignment.
To study the role of this operon in B. pertussis LPS biosynthesis, we inactivated the putative glycosyltransferase genes by allelic exchange and compared the LPS profiles of the wild-type and mutant strains using Tricine-SDS-PAGE and ESI-MS. Unexpectedly, we found that the wild-type strain not only contained full-length B. pertussis LPS, but also harboured a full-length species substituted with an extra hexosamine moiety, which, as we showed, was directly attached to lipid A. Substitution of B. pertussis lipid A with hexosamine has previously not been observed and therefore represents a novel modification of B. pertussis lipid A.
The proposed truncated oligosaccharide structures for the BP2328- and BP2329-mutant strains are summarised in FIG. 7. The most complete core OS structure in the BP2328 mutant strain consisted of GalNA•Glc•GlcN2•GlcA•Hep2•P•Kdo•lipid A-OH•HexN, indicating that the BP2328 mutant strain lacks the terminal trisaccharide, a heptose residue, and one of the GlcN residues. This composition suggests that the BP2328-encoded protein functions as a GlcN (1-4) to Glc transferase (FIG. 7). Analysis of the BP2329-mutant LPS showed that this LPS was further truncated and that its most complete structure consisted of GlcN•GlcA•Hep2•P•Kdo•lipid A-OH•HexN. Since this structure misses the Glc to which the second GlcN of the core OS should be connected, the remaining GlcN residue present must be attached to the second heptose. Therefore, this composition suggests that the BP2329-encoded protein functions as a glucosyltransferase that attaches Glc to the first heptose subunit (FIG. 7). This would agree with the high homology of this gene product with glucose (β1-4) heptose transferases, such as rfaK and lgtF/icsB, which were used to identify the gene in the first place. The most complicated phenotype was observed in the case of the BP2331 mutant. Although the protein shows high sequence similarity to various LPS glycosyltransferases, full-length B. pertussis LPS was still present in the mutant strain. This observation suggests either that the BP2331 gene does not encode an active LPS glycosyltransferase or that the encoded enzyme shows redundancy. Consistent with this last option, we have identified a gene, i.e., BP3671 with GenBank Accession Number CAE43928, in the genome of B. pertussis which encodes for a protein that shows 69% identity to the BP2331-encoded protein. Albeit the LPS profiles of the wild-type and BP2331-mutant strain were more or less comparable, one striking observation was that the mutant LPS was more heterogenic. Although the exact reason for this phenomenon remains to be elucidated, one possible explanation could be that the BP2331 mutant somehow displays an increased non-stoichiometrical substitution of its LPS, possibly with hexosamine. Modification of lipid A with amino sugars has been described in various bacteria, e.g., substitution with 4-aminoarabinose in E. coli and Salmonella (Trent et al., 2001b), and with galactosamine in Francisella tularensis (Phillips et al., 2004). The aminoarabinose pathway has been studied in detail in E. coli and has been shown to involve the assembly of the sugar moiety on a separate undecaprenyl phosphate carrier prior to its transfer to lipid A (Trent et al., 2001a). Since it is conceivable that insertion of the kanamycin-resistance cassette in BP2331 has increased the expression of the downstream BP2330 gene, one could speculate that an increased BP2330 expression may have led to an increased hexosamine modification of lipid A, and, consequently, an increased LPS heterogeneity in the BP2331-mutant cells. Supporting this interpretation is the increased level of hexosamine modification in the BP2331 mutant, see Table 3.
After having addressed the structure of the LPS, purified LPS and whole bacterial cells were tested for their ability to induce maturation of DCs and to stimulate the production of pro-inflammatory cytokines by human macrophages. The results showed that, as compared to the wild-type strain, the BP2331-mutant strain displayed an increased capacity to induce DC maturation and pro-inflammatory cytokine production. Similar outcomes were obtained with purified LPS. In contrast, whole bacterial cells and purified LPS from the BP2328- and BP2329-mutant strains displayed a similar and decreased capacity to maturate DCs and stimulate macrophages, respectively. These results show that alterations in LPS core OS-composition differentially affect the biological properties of B. pertussis LPS. From the perspective of vaccine development, this is an interesting finding, since this may allow for the development of strains that more efficiently prime immune responses. Furthermore, mutants that display an increased LPS heterogeneity, such as the BP2331-mutant strain, may elicit a larger variety of anti-LPS antibodies, which, on itself, may positively influence vaccine efficacy. The good correlation found between the level of DC and macrophage activation on the one hand, and the degree of hexosamine modification of lipid A on the other (see Table 3), strongly suggests that the increased modification in the BP2331 mutant is crucial in this regard.
TABLE 1
Bacterial strains and plasmids
Strain or plasmid Genotype or description Source or reference
Strains
B. pertussis
B213 Streptomycin resistant derivative of B. pertussis strain Tohama Kasuga et al., 1953
B213 ΔBP2328 BP2328 mutant of strain B213, StrR, KmR This study
B213 ΔBP2329 BP2329 mutant of strain B213, StrR, KmR This study
B213 ΔBP2331 BP2331 mutant of strain B213, StrR, KmR This study
E. coli
TOP10F′ F′{laclq Tn10 (TetR)} mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 Invitrogen
deoR recA1 araD139 Δ (ara-leu)7697 galU galK rpsL endA1 nupG
DH5α F Δ(lacZYA-algF)U169 thi-1 hsdR17 gyrA96 recA1 endA1 supE44 relA1 Hanahan, 1983
phoA Φ80 dlacZΔM15
SM10(λpir) thi thr leu fhyA lacY supE recA::RP4-2-Tc::Mu λ pir R6K KmR N.V.I.a
Plasmids
pGEM-T Easy E. coli cloning vector AmpR Promega
pUC4K E. coli vector harbouring kanamycin-resistance cassette, AmpR KmR Vieira and Messing, 1982
pSS1129 Allelic exchange vector, bla gen rpsL oriVColE1 oriT λ cos Stibitz, 1994
pGEM-BP2328up pGEM-T Easy derivative harbouring BP2328 upstream sequence This study
pGEM-BP2328down pGEM-T Easy derivative harbouring BP2328 downstream sequence This study
pGEM-BP2329up pGEM-T Easy derivative harbouring BP2329 upstream sequence This study
pGEM-BP2329down pGEM-T Easy derivative harbouring BP2329 downstream sequence This study
pGEM-BP2331 pGEM-T Easy derivative harbouring BP2331 sequence This study
pSS1129-BP2328KO pSS1129 derivative harbouring BP2328 knock out construct, KmR This study
pSS1129-BP2329KO pSS1129 derivative harbouring BP2329 knock out construct, KmR This study
pSS1129-BP2331KO) pSS1129 derivative harbouring BP2331 knock out construct, KmR This study
aNetherlands Vaccine Institute, Bilthoven, The Netherlands
TABLE 2
Primers
Name Sequence (5′-3′)a
BP2328_FWup TTCCGCACTTACTGGCTGAG SEQ ID NO: 5
BP2328_FWdown GGATCCTCGCGGTACGACAGCACAT SEQ ID NO: 6
BP2328_REVup GGATCCTGTTGCGCGAGATGCTGGAG SEQ ID NO: 7
BP2328_REVdown CCTCATCGCCAAGGTCAATC SEQ ID NO: 8
BP2329_FWup TCACCTTCGACGACGGATAC SEQ ID NO: 9
BP2329_FWdown GGATCCGTGCGCATCTACCTGATCC SEQ ID NO: 10
BP2329_REVup GGATCCGAATCGACCACGATGAAC SEQ ID NO: 11
BP2329_REVdown GATCCAGCTTGGCCTGGTTG SEQ ID NO: 12
BP2331_FW GTGACGTGGTGGTACATCAG SEQ ID NO: 13
BP2331_REV TGGTCTACCGCAGGAACAAT SEQ ID NO: 14
aBamHI restriction sites are underlined
TABLE 3
Negative ion ESI-MS data and proposed compositions for O-deacylated LPS of wild-type B.
pertussis and B. pertussis mutant strains BP2331, BP2328, and BP239. Average mass units
were used for calcuation of molecular mass values based on proposed compositions as 
follows: glucose (Glc), 162.14; heptose (Hep), 192.17; 2-keto-3-deoxyoctulosonic acid (Kdo),
220.18; phosphate (P), 79.98; glucosamine (GlcN), 161.17; hexosamine (HexN), 161.17;
glucuronic acid (GlcA), 176.13; N-acetyl-glucosamine (GlcNAc), 203.19; 2-acetamido-4-N- 
methyl-2,4-dideoxy-fucose (Fuc2NAc4NMe), 200.12; 2,3-acetamido-2,3-dideoxy-mannuronicacid
(Man2NAc3NAcA), 258.09; galactosaminuronic acid (GalNA), 175.13 and lipid A-OH, 953.02.
Table does not include sodium and potassium adducts and singly-charged lipid A-OH ions 
(m/z 952 ([M − H])).
Observed ions Molecular mass Relative
[m/z] [Da] abundance
Sample [M − 4H]4− [M − 3H]3− [M − 2H]2− Observed Calculated [%] Proposed composition
WT 987.1 1976.2 1975.8 16.6 Glc•GlcA•Hep2•P•Kdo•lipid A-OH
770.1 1155.0 2312.7 2312.1 12.8 GalNA•Glc•GlcN•GlcA•Hep2•P•Kdo•
lipid A-OH
888.3 2667.9 2665.4 4.9 GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•
lipid A-OH
811.1 1081.7 3248.3 3246.9 11.8 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN2•GlcA•Hep3•Kdo•
lipid A-OH
831.4 1108.5 3329.0 3326.8 27.4 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•
lipid A-OH
9.8 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN•GlcA•Hep3•P•Kdo•
lipid A-OH•HexN
1162.1 3489.3 3488.0 16.7 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•
lipid A-OH•HexN
BP2328 743.6 1115.2 2233.1 2232.1 13.8 GalNA•Glc•GlcN•GlcA•Hep2•Kdo•
lipid A-OH
770.0 1155.1 2312.6 2312.1 46.5 GalNA•Glc•GlcN•GlcA•Hep2•P•Kdo•
lipid A-OH
15.3 GalNA•Glc•GlcA•Hep2•P•Kdo•lipid
A-OH•HexN
823.7 1235.7 2473.8 2473.3 12.1 GalNA•Glc•GlcN•GlcA•Hep2•P•Kdo•
lipid A-OH•HexN
1034.6 2071.2 2070.8 6.7 GalNA•Glc•GlcA•Hep2•Kdo•lipid A-
OH
1074.6 2151.2 2150.8 5.6 GalNA•Glc•GlcA•Hep2•P•Kdo•lipid
A-OH
BP2329 866.0 1734.0 1733.7 8.6 GlcA•Hep2•Kdo•lipid A-OH
603.9 906.0 1814.4 1813.6 36.8 GlcA•Hep2•P•Kdo•lipid A-OH
657.6 986.6 1975.5 1974.8 28.8 GlcN•GlcA•Hep2•P•Kdo•lipid A-OH
8.4 GlcA•Hep2•P•Kdo•lipid A-OH•HexN
1067.1 2136.2 2136.0 6.6 GlcN•GlcA•Hep2•P•Kdo•lipid A-OH•
HexN
BP2331 684.9 1027.5 2057.4 2057.0 16.3 Glc•GlcN•GlcA•Hep2•Kdo•lipid A-
OH
4.3 Glc•GlcA•Hep2•Kdo•lipid A-OH•
HexN
711.5 1067.4 2137.2 2137.0 6.4 Glc•GlcN•GlcA•Hep2•P•Kdo•lipid
A-OH
6.1 Glc•GlcA•Hep2•P•Kdo•lipid A-OH•
HexN
738.5 2218.5 2218.2 3.7 Glc•GlcN•GlcA•Hep2•Kdo•lipid A-
OH•HexN
765.2 1148.0 2298.3 2298.1 6.3 Glc•GlcN•GlcA•Hep2•P•Kdo•lipid
A-OH•HexN
1291.6 2585.2 2585.5 4.1 GalNA•Glc•GlcN2•GlcA•Hep3•Kdo•
lipid A-OH
4.9 GalNA•Glc•GlcN•GlcA•Hep3•Kdo•
lipid A-OH•HexN
887.8 1332.0 2666.2 2665.4 5.6 GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•
lipid A-OH
4.2 GalNA•Glc•GlcN•GlcA•Hep3•P•Kdo•
lipid A-OH•HexN
810.9 1081.7 3247.9 3246.9 9.8 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN2•GlcA•Hep3•Kdo•
lipid A-OH
831.1 1108.3 3328.2 3326.8 11.7 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•
lipid A-OH
7.3 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN•GlcA•Hep3•P•Kdo•
lipid A-OH•HexN
871.2 1162.0 3488.9 3488.0 9.3 GlcNAc•Man2NAc3NAcA•Fuc2NAc4NMe•
GalNA•Glc•GlcN2•GlcA•Hep3•P•Kdo•
lipid A-OH•HexN

References
  • Alexeyev, M. F., Shokolenko, I. N., and Croughan, T. P. (1995) Improved antibiotic-resistance gene cassettes and omega elements for Escherichia coli vector construction and in vitro deletion/insertion mutagenesis. Gene 160: 63-67.
  • Allen, A. G., Isobe, T., and Maskell, D. J. (1998a) Identification and cloning of waaF (rfaF) from Bordetella pertussis and use to generate mutants of Bordetella spp. with deep rough lipopolysaccharide. J. Bacteriol. 180: 35-40.
  • Allen, A. G., Thomas, R. M., Cadisch, J. T., and Maskell, D. J. (1998b) Molecular and functional analysis of the lipopolysaccharide biosynthesis locus wlb from Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Mol. Microbiol. 29: 27-38.
  • Allen, A., and Maskell, D. (1996) The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol. Microbiol. 19: 37-52.
  • Caroff, M., Brisson, J., Martin, A., and Karibian, D. (2000) Structure of the Bordetella pertussis 1414 endotoxin. FEBS Lett. 477: 8-14.
  • Clementz, T., and Raetz, C. R. H. (1991) A gene coding for 3-deoxy-D-manno-octulosonic-acid transferase in Escherichia coli. Identification, mapping, cloning, and sequencing. J. Biol. Chem. 266: 9687-9696.
  • Di Fabio, J. L., Caroff, M., Karibian, D., Richards, J. C., and Perry, M. B. (1992) Characterisation of the common antigenic lipopolysaccharide O-chains produced by Bordetella bronchiseptica and Bordetella parapertussis. FEMS Microbiol. Lett. 76: 275-281.
  • Geurtsen, J., Steeghs, L., Hamstra, H-J., ten Hove, J., de Haan, A., Kuipers, B., Tommassen, J., and van der Ley, P. (2006) Expression of the lipopolysaccharide-modifying enzymes PagP and PagL modulates the endotoxic activity of Bordetella pertussis. Infect. Immun. 74: 5574-5585.
  • Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166: 557-580.
  • Hoist, O. (2000) Deacylation of lipopolysaccharides and isolation of oligosaccharides phosphates. in Methods in Molecular Biology, Bacterial Toxins: Methods and Protocols (Holst, O., Ed.) pp 345-353, Humana Press, Totowa, N.J.
  • Heinrichs, D. E., Yethon, J. A., and Whitfield, C. (1998) Molecular basis for structural diversity in the core regions of the lipopolysaccharides of Escherichia coli and Salmonella enterica. Mol. Microbiol. 30: 221-232.
  • Isobe, T., White, K. A., Allen, A. G., Peacock, M., Raetz, C. R. H., and Maskell, D. J. (1999) Bordetella pertussis waaA encodes a monofunctional 2-keto-3-deoxy-D-manno-octulosonic acid transferase that can complement an Escherichia coli waaA mutation. J. Bacteriol. 181: 2648-2651.
  • Kasuga, B., Nakase, Y., Ukishima, K., and Takatsu, K. (1953) Studies on Haemophilus pertussis. Kitasato Arch. Exp. Med. 27: 21-28.
  • Kurzai, O., Schmitt, C., Claus, H., Vogel, U, Frosch, M, and Kolb-Maurer, A. (2005) Carbohydrate composition of meningococcal lipopolysaccharide modulates the interaction of Neisseria meningitidis with human dendritic cells. Cell. Microbiol. 7: 1319-1334.
  • Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685.
  • Lesse, A. J., Campagnari, A. A., Bittner, W. E., and Apicella, M. A. (1990) Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis. J. Immunol. Methods 126: 109-117.
  • MacLachlan, P. R., Kadam, S. K., and Sanderson, K. E. (1991) Cloning, characterization, and DNA sequence of the rfaLK region for lipopolysaccharide synthesis in Salmonella typhimurium LT2. J. Bacteriol. 173: 7151-7163.
  • O'Neill, L. A. J. (2006) How Toll-like receptors signal: what we know and what we don't know. Curr. Opin. Immunol. 18: 3-9.
  • Pålsson-McDermott, E. M., and O'Neill, L. A. J. (2004) Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4. Immunology 113: 153-162.
  • Peppler, M. S. (1984) Two physically and serologically distinct lipopolysaccharide profiles in strains of Bordetella pertussis and their phenotype variants. Infect. Immun. 43: 224-232.
  • Phillips, N. J., Schilling, B., McLendon, M. K., Apicella, M. A., and Gibson, B. W. (2004) Novel modification of lipid A of Francisella tularensis. Infect. Immun. 72: 5340-5348.
  • Plüiddeman, A., Mukhopadhyay, S., and Gordon, S. (2006) The interaction of macrophage receptors with bacterial ligands. Exp. Rev. Mol. Med. 8: 1-25.
  • Raetz, C. R. H., and Whitfield, C. (2002) Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71: 635-700.
  • Sallusto, F., and Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor α. J. Exp. Med. 179: 1109-1118.
  • Schnaitman, C. A., and Klena, J. D. (1993) Genetics of lipopolysaccharide biosynthesis in enteric bacteria. Microbiol. Rev. 57: 655-682.
  • Sisti, F., Fernandez, J., Rodriguez, M. E., Lagares, A., Guiso, N., and Hozbor, D. F. (2002) In vitro and in vivo characterization of a Bordetella bronchiseptica mutant strain with a deep rough lipopolysaccharide structure. Infect. Immun. 70: 1791-1798.
  • Steeghs, L., van Vliet, S. J., Uronen-Hansson, H., van Mourik, A., Engering, A., Sanchez-Hernandez, M., Klein, N., Callard, R., van Putten, J. P. M., van der Ley, P., van Kooyk, Y., and van de Winkel, J. G. J. (2006) Neisseria meningitidis expressing lgtB lipopolysaccharide targets DC-SIGN and modulates dendritic cell function. Cell. Microbiol. 8: 316-325.
  • Stibitz, S. (1994) Use of conditionally counterselectable suicide vectors for allelic exchange.
  • Methods Enzymol. 235: 458-465.
  • Takada H, and Kotani S. (1989) Structural requirements of lipid A for endotoxicity and other biological activities. Crit. Rev. Microbiol. 16: 477-523.
  • Trent, M. S., Ribeiro, A. A., Doerrler, W. T., Lin, S., Cotter, R. J., and Raetz, C. R. H. (2001a) Accumulation of a polyisoprene-linked amino sugar in polymyxin-resistant Salmonella typhimurium and Escherichia coli: structural characterization and transfer to lipid A in the periplasm. J. Biol. Chem. 276: 43132-43144.
  • Trent, M. S., Ribeiro, A. A., Lin, S., Cotter, R. J., and Raetz, C. R. H. (2001b) An inner membrane enzyme in Salmonella and Escherichia coli that transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor. J. Biol. Chem. 276: 43122-43131.
  • Tsai, C. M., and Frasch, C. E. (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal. Biochem. 119: 115-119.
  • Uronen-Hansson, H., Steeghs, L., Allen, J., Dixon, G. L. J., Osman, M., van der Ley, P., Wong, S. Y. C., Callard, R., and Klein, N. (2004) Human dendritic cell activation by Neisseria meningitidis: phagocytosis depends on expression of lipooligosaccharide (LOS) by the bacteria and is required for optimal cytokine production. Cell. Microbiol. 6: 625-637.
  • van Amersfoort, E. S., Van Berkel, T. J., and Kuiper, J. (2003) Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock. Clin. Microbiol. Rev. 16: 379-414.
  • Westphal, O., and Jann, J. K. (1965) Bacterial lipopolysaccharides, extraction with phenol-water and further applications of the procedure. Methods Carbohydr. Chem. 5: 83-91.
  • Ziegler-Heitbrock, H. W. L., Thiel, E., Futterer, A., Herzog, V., Wirtz, A., and Riethmüller, G. (1988) Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes. Int. J. Cancer 41: 456-461.

Claims (18)

The invention claimed is:
1. A mutant cell of a wild-type parental Bordetella pertussis cell, of a wild-type parental Bordetella bronchiseptica cell, or of a wild-type parental Bordetella parapertussis cell comprising a mutated nucleic acid sequence, wherein:
(a) the wild-type Bordetella pertussis cell, the wild-type Bordetella bronchiseptica cell, or the wild-type Bordetella parapertussis cell comprises an endogenous nucleic acid sequence encoding an endogenous lipopolysaccharide (LPS) glycosyltransferase polypeptide, wherein the polypeptide has at least 99% sequence identity with SEQ ID NO: 2 and
(b) the mutated nucleic acid sequence
(i) encodes a mutant LPS glycosyltransferase polypeptide having glycosyltransferase enzymatic activity that is at least 3% lower compared to the glycosyltransferase enzymatic activity of the endogenous LPS glycosyltransferase polypeptide of (a), or
(ii) results in production of at least 3% less of the endogenous LPS glycosyltransferase polypeptide of (a) by the mutant cell compared to the production of the endogenous LPS glycosyltransferase polypeptide of (a) by the wild-type Bordetella pertussis cell, the wild-type Bordetella bronchiseptica cell, or the wild-type Bordetella parapertussis cell when cultivated under the same culture conditions,
wherein, compared to the wild-type parental cell, the mutant cell induces increased immune stimulation as determined by activation of human dendritic cells or stimulation of human macrophages.
2. The mutant cell of claim 1, wherein the endogenous nucleic acid sequence is mutated by insertional inactivation.
3. The mutant cell of claim 1, in which the mutant LPS glycosyltransferase polypeptide does not exhibit any detectable glycosyltransferase enzymatic activity.
4. The mutant cell of claim 1, wherein the amino acid sequence of said polypeptide is SEQ ID NO: 2.
5. A pharmaceutical composition comprising the mutant cell of claim 1 and a pharmaceutically acceptable carrier.
6. A pharmaceutical composition comprising the mutant cell of claim 4 and a pharmaceutically acceptable carrier.
7. The pharmaceutical composition of claim 5, further comprising an antigen.
8. The mutant cell of claim 1, wherein the LPS glycosyltransferase polypeptide of (a) produced by the mutant cell is at least 90% less compared to that produced by the wild-type Bordetella pertussis cell, the wild-type Bordetella bronchiseptica cell, or the wild-type Bordetella parapertussis cell.
9. The mutant cell of claim 8, wherein the amino acid sequence of said polypeptide is SEQ ID NO: 2.
10. A pharmaceutical composition comprising the mutant cell of claim 8 and a pharmaceutically acceptable carrier.
11. A pharmaceutical composition comprising the mutant cell of claim 9 and a pharmaceutically acceptable carrier.
12. The pharmaceutical composition of claim 10, further comprising an antigen.
13. A method of inducing an immune response to an antigen in a mammalian subject comprising administering to the subject the pharmaceutical composition of claim 7.
14. The pharmaceutical composition of claim 6, further comprising an antigen.
15. The pharmaceutical composition of claim 11, further comprising an antigen.
16. A method of inducing an immune response to an antigen in a mammalian subject comprising administering to the subject the pharmaceutical composition of claim 12.
17. A method of inducing an immune response to an antigen in a mammalian subject comprising administering to the subject the pharmaceutical composition of claim 14.
18. A method of inducing an immune response to an antigen in a mammalian subject comprising administering to the subject the pharmaceutical composition of claim 15.
US12/593,346 2007-03-26 2008-03-25 Vaccines against Bordetella pertussis based on LPS glycosyltransferase mutants Expired - Fee Related US9296995B2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP07104885 2007-03-26
EP07104885 2007-03-26
EP07104885.4 2007-03-26
PCT/NL2008/050169 WO2008118015A2 (en) 2007-03-26 2008-03-25 Improved vaccines against bordetella pertussis based on lps glycosyltransferase mutants

Publications (2)

Publication Number Publication Date
US20100291153A1 US20100291153A1 (en) 2010-11-18
US9296995B2 true US9296995B2 (en) 2016-03-29

Family

ID=38134330

Family Applications (1)

Application Number Title Priority Date Filing Date
US12/593,346 Expired - Fee Related US9296995B2 (en) 2007-03-26 2008-03-25 Vaccines against Bordetella pertussis based on LPS glycosyltransferase mutants

Country Status (17)

Country Link
US (1) US9296995B2 (en)
EP (1) EP2134743B1 (en)
JP (1) JP5683260B2 (en)
KR (1) KR101667551B1 (en)
CN (1) CN101801997B (en)
AU (1) AU2008230238B2 (en)
BR (1) BRPI0809321A2 (en)
CA (1) CA2681924C (en)
ES (1) ES2393682T3 (en)
IL (1) IL201241A (en)
MX (1) MX2009010347A (en)
NZ (1) NZ579940A (en)
PL (1) PL2134743T3 (en)
PT (1) PT2134743E (en)
RU (1) RU2542667C2 (en)
SI (1) SI2134743T1 (en)
WO (1) WO2008118015A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180332778A1 (en) * 2017-05-16 2018-11-22 Martin W. Taylor Impermeable Sectional Apparatus for Soil Moisture Retention

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018023000A1 (en) * 2016-07-29 2018-02-01 The Regents Of The University Of Michigan Recombinant gram negative bacteria and methods of generating and utilizing same
ES2992907T3 (en) * 2017-03-13 2024-12-19 Intravacc B V Bordetella vaccines comprising lps with reduced reactogenicity
CN110373438B (en) * 2019-07-31 2021-05-04 江南大学 A kind of method for improving γ-aminobutyric acid output
CN117947054B (en) * 2024-03-25 2024-06-21 上海羽冠生物技术有限公司 A method for seamless gene editing of Bordetella pertussis

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
WO2006065139A2 (en) 2004-12-17 2006-06-22 Nvi Nederlands Vaccininstituut Deacylation of lps in gram negative bacteria

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1292028B (en) * 1998-02-27 2013-08-14 诺维信公司 Maltogenic alpha-amylase variants
AU762369B2 (en) * 1998-11-03 2003-06-26 De Staat Der Nederlanden Vertegenwoordigd Door De Minister Van Welzijn, Volksgezonheid En Cultuur LPS with reduced toxicity from genetically modified gram negative bacteria

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040029129A1 (en) * 2001-10-25 2004-02-12 Liangsu Wang Identification of essential genes in microorganisms
WO2006065139A2 (en) 2004-12-17 2006-06-22 Nvi Nederlands Vaccininstituut Deacylation of lps in gram negative bacteria
US20080274145A1 (en) 2004-12-17 2008-11-06 Johannes Petrus Maria Tommassen Deacylation of Lps in Gram Negative Bacteria

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
A. Preston & D. Maskell, "The Molecular Genetics and Role in Infection of Lipopolysaccharide Biosynthesis in the Bordetellae", J. Endotoxin Research 7:251-261(2001).
Parkhill et al.,"Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica," Nature Genetics, 2003, 35: 32-40.
Preston et al.,"The molecular genetics and role in infection of lipopolysaccharide biosynthesis in the Bordetellae," Journal of Endotoxin Research, 2001, 7:251-261.
Q2KYR3 (Sequence Database) , "Lipopolysaccharide core biosynthesis glycosyl transferase," 2006, retrieved from EBI accession No. UNIPROT:Q2KYR3.
Q7VWC9 (Sequence Database) "Putative transferase," 2003, retrieved from EBI accession No. UNIPROT: Q7VWC9.
Reckseidler et al. Infect. Immun. 69: 134-144, 2001. *
Sebaihia et al."Comparison of the genome sequence of the poultry pathogen Bordetella avium with those of B. bronchiseptica, B. pertussis, and B. parapertussis reveals extensive diversity in surface structures associated with host interaction," Journal of Bacteriology, 2006, 188:6002-6005.
Seffernick et al. J. Bacteriol. 183: 2405-2410, Apr. 2001. *
Skolnick et al. Trends in Biotechnology 18: 34-39, 2000. *
Stibitz et al. Methods Enzymol. 235: 458-465, 1994. *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180332778A1 (en) * 2017-05-16 2018-11-22 Martin W. Taylor Impermeable Sectional Apparatus for Soil Moisture Retention

Also Published As

Publication number Publication date
PL2134743T3 (en) 2013-01-31
ES2393682T3 (en) 2012-12-27
JP2010522557A (en) 2010-07-08
MX2009010347A (en) 2009-12-10
CA2681924A1 (en) 2008-10-02
RU2542667C2 (en) 2015-02-20
BRPI0809321A2 (en) 2014-09-23
CA2681924C (en) 2019-12-31
PT2134743E (en) 2012-12-21
IL201241A (en) 2015-02-26
WO2008118015A2 (en) 2008-10-02
CN101801997B (en) 2016-06-01
EP2134743A2 (en) 2009-12-23
WO2008118015A3 (en) 2009-06-25
KR101667551B1 (en) 2016-10-19
EP2134743B1 (en) 2012-09-05
NZ579940A (en) 2012-03-30
IL201241A0 (en) 2010-05-31
AU2008230238B2 (en) 2013-06-06
AU2008230238A1 (en) 2008-10-02
US20100291153A1 (en) 2010-11-18
JP5683260B2 (en) 2015-03-11
KR20100015812A (en) 2010-02-12
CN101801997A (en) 2010-08-11
SI2134743T1 (en) 2013-01-31
RU2009139262A (en) 2011-05-10

Similar Documents

Publication Publication Date Title
CA2757224C (en) Salmonella enterica presenting c. jejuni n-glycan or derivatives thereof
US9296995B2 (en) Vaccines against Bordetella pertussis based on LPS glycosyltransferase mutants
EP2214840A1 (en) Compositions and methods of enhancing immune responses to flagellated bacterium
CN108778322A (en) Pseudomonas aeruginosa PCRV-linked antigen vaccine
KR20190128056A (en) LPS-containing Bordetella vaccine with reduced reactiveity
Geurtsen et al. Identification of a novel lipopolysaccharide core biosynthesis gene cluster in Bordetella pertussis, and influence of core structure and lipid A glucosamine substitution on endotoxic activity
US11491215B2 (en) Antigenic combinations against Francisella bacteria and related nanolipoprotein particles, compositions, methods and systems
WO2017201193A1 (en) Compositions and methods for the expression of eukaryotic oligosaccharides on bacterial outer membrane vesicles
EP4004224A1 (en) Quantification of bioconjugate glycosylation
AU2003239125A1 (en) Neisseria mutants, lipooligosaccharides and immunogenic compositions
Geurtsen et al. Gene cluster involved in lipopolysaccharide-core biosynthesis and identification of a novel lipid A modification in Bordetella
AU2020293566B2 (en) Rhamnose-polysaccharides
US7759070B2 (en) Conserved inner core lipopolysaccharide epitopes as multi-species vaccine candidates
CA2377427A1 (en) Glycosyltransferases of helicobacter pylori as a new target in prevention and teatment of h. pylori infections
Yang et al. Reducing the endotoxic activity or enhancing the vaccine immunogenicity by altering the length of lipid A acyl chain in Salmonella
Chen Glycoengineered vesicle vaccines against bacterial pathogens
CN121693343A (en) Modified proteins
Stroeher et al. Genetics of Vibrio cholerae O1 and O139 surface polysaccharides
Chen GLYCOENGINEERED VESICLE VACCINES AGAINST BACTERIAL PATHOGENS

Legal Events

Date Code Title Description
AS Assignment

Owner name: DE STAAT DER NEDERLANDEN, VERT. DOOR DE MINISTER V

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GEURTSEN, JEROEN JOHANNES GERARDUS;TOMMASSEN, JOHANNES PETRUS MARIA;VAN DER LEY, PETER ANDRE;REEL/FRAME:023894/0754

Effective date: 20091015

ZAAA Notice of allowance and fees due

Free format text: ORIGINAL CODE: NOA

ZAAB Notice of allowance mailed

Free format text: ORIGINAL CODE: MN/=.

STCF Information on status: patent grant

Free format text: PATENTED CASE

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20240329