US8921331B2 - Methods for slowing familial ALS disease progression - Google Patents

Methods for slowing familial ALS disease progression Download PDF

Info

Publication number
US8921331B2
US8921331B2 US13/406,256 US201213406256A US8921331B2 US 8921331 B2 US8921331 B2 US 8921331B2 US 201213406256 A US201213406256 A US 201213406256A US 8921331 B2 US8921331 B2 US 8921331B2
Authority
US
United States
Prior art keywords
antisense
sod1
wing segment
modified
sugar
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US13/406,256
Other versions
US20120214865A1 (en
Inventor
C. Frank Bennett
Susan M. Freier
Kenneth W. Dobie
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Isis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/633,843 external-priority patent/US7132530B2/en
Application filed by Isis Pharmaceuticals Inc filed Critical Isis Pharmaceuticals Inc
Priority to US13/406,256 priority Critical patent/US8921331B2/en
Assigned to ISIS PHARMACEUTICALS, INC. reassignment ISIS PHARMACEUTICALS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: DOBIE, KENNETH W.
Publication of US20120214865A1 publication Critical patent/US20120214865A1/en
Application granted granted Critical
Publication of US8921331B2 publication Critical patent/US8921331B2/en
Assigned to IONIS PHARMACEUTICALS, INC. reassignment IONIS PHARMACEUTICALS, INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: ISIS PHARMACEUTICALS, INC.
Adjusted expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y115/00Oxidoreductases acting on superoxide as acceptor (1.15)
    • C12Y115/01Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
    • C12Y115/01001Superoxide dismutase (1.15.1.1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02PCLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00Technologies relating to chemical industry
    • Y02P20/50Improvements relating to the production of bulk chemicals
    • Y02P20/582Recycling of unreacted starting or intermediate materials

Definitions

  • the present invention provides compositions and methods for slowing disease progression in an individual suffering from familial amyotrophic lateral sclerosis.
  • this invention relates to antisense compounds, particularly antisense oligonucleotides, complementary to SOD1 nucleic acids.
  • antisense oligonucleotides have been shown to inhibit the expression of SOD1.
  • the superoxide anion (O 2 ) is a potentially harmful cellular by-product produced primarily by errors of oxidative phosphorylation in mitochondria (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321).
  • Some of the targets for oxidation by superoxide in biological systems include the iron-sulfur dehydratases, aconitase and fumarases. Release of Fe (II) from these superoxide-inactivated enzymes results in Fenton-type production of hydroxyl radicals which are capable of attacking virtually any cellular target, most notably DNA (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112).
  • SODs superoxide dismutases
  • H 2 O 2 hydrogen peroxide
  • the soluble superoxide dismutase 1 enzyme also known as SOD1 and Cu/Zn superoxide dismutase contains a zinc- and copper-type active site (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112).
  • Lee et al. reported the molecular cloning and high-level expression of human cytoplasmic superoxide dismutase gene in E. coli in 1990 (Lee et al., Misaengmul Hakhoechi, 1990, 28, 91-97).
  • transgenic mice carrying a mutant human superoxide dismutase 1 gene for example, transgenic mice expressing a human SOD1 gene bearing glycine 93 to alanine (G93A) mutation.
  • ALS amyotrophic lateral sclerosis
  • ALS amyotrophic lateral sclerosis
  • ALS also known as Lou Gehrig's disease
  • the deleterious effects of various mutations on superoxide dismutase 1 are most likely mediated through a gain of toxic function rather than a loss of superoxide dismutase 1 activity, as the complete absence of superoxide dismutase 1 in mice neither diminishes life nor provokes overt disease (Al-Chalabi and Leigh, Curr. Opin. Neurol., 2000, 13, 397-405; Alisky and Davidson, Hum. Gene Ther., 2000, 11, 2315-2329).
  • Riluzole a glutamate regulatory drug, is approved for use in ALS patients in some countries, but has only a modest effect on survival. Accordingly, there remains an unmet need for therapeutic regimens that slow familial ALS disease progression and increase survival of familial ALS patients.
  • the present invention provides methods of slowing disease progression in an individual suffering from familial amyotrophic lateral sclerosis (ALS), comprising administering to the individual a therapeutically effective amount of a pharmaceutical composition comprising an antisense oligonucleotide 17 to 25 nucleobases in length complementary to nucleobases 66 to 102 of SEQ ID NO: 1, thereby slowing disease progression.
  • the administering may comprise delivery to the cerebrospinal fluid of the individual, and may further comprise intrathecal infusion.
  • a slowing of disease progression is measured by an improvement in one or more indicators of ALS disease progression selected from ALSFRS-R, FEV 1 , FVC, or muscle strength measurements.
  • the methods further comprise increasing the survival time of an individual suffering from familial ALS.
  • the methods provided herein comprise the administration of an antisense oligonucleotide complementary to nucleobases 83 to 102 of SEQ ID NO: 1.
  • the antisense oligonucleotide may be fully complementary to nucleotides 83 to 102 of SEQ ID NO: 1. Further, the antisense oligonucleotide may consist essentially of ISIS 333611. Additionally, the antisense oligonucleotide may consist of ISIS 333611.
  • the antisense oligonucleotides employed in the methods provided herein comprise at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage, a modified sugar moiety, such as a 2′-O-methoxyethyl sugar moiety or a bicyclic nucleic acid sugar moiety, or a modified nucleobase, such as a 5-methylcytosine.
  • modified internucleoside linkage such as a phosphorothioate internucleoside linkage
  • a modified sugar moiety such as a 2′-O-methoxyethyl sugar moiety or a bicyclic nucleic acid sugar moiety
  • a modified nucleobase such as a 5-methylcytosine.
  • the present invention provides methods of slowing disease progression in an individual suffering from familial ALS comprising administering an antisense oligonucleotide that is a chimeric oligonucleotide.
  • the chimeric oligonucleotide comprises a 2′-deoxynucleotide gap segment positioned between 5′ and 3′ wing segments.
  • the wing segments are comprised of nucleosides containing a sugar moiety selected from a 2′-O-methoxyethyl sugar moiety or a bicyclic nucleic acid sugar moiety.
  • the gap segment may be ten 2′-deoxynucleotides in length and each of the wing segments may be five 2′-O-methoxyethyl nucleotides in length.
  • the chimeric oligonucleotide may be uniformly comprised of phosphorthioate internucleoside linkages. Further, each cytosine of the chimeric oligonucleotide may be a 5′-methylcytosine.
  • ALS familial amyotrophic lateral sclerosis
  • the present invention provides methods for the slowing of disease progression in an individual suffering from familial ALS by delivering to the cerebrospinal fluid of the individual a therapeutically effective amount of a pharmaceutical composition comprising an antisense oligonucleotide targeted to SOD1. Such methods further comprise increasing survival time of an individual suffering from familial ALS. Slowing of disease progression is indicated by an improvement in one or more indicators of ALS disease progression, including, without limitation, the revised ALS functional rating scale, pulmonary function tests, and muscle strength measurements.
  • the present invention employs antisense compounds, particularly antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding SOD1, ultimately modulating the amount of SOD1 protein produced. This is accomplished by providing antisense oligonucleotides which hybridize to and inhibit the expression of one or more nucleic acids encoding SOD1. Such antisense oligonucleotides are considered to be “targeted to SOD1.” Antisense oligonucleotides of the present invention do not necessarily distinguish between wild-type SOD1 mRNA and SOD1 mRNAs bearing mutations.
  • an object of the present invention is to reduce SOD1 mRNAs bearing mutations, the conconmitant reduction of wild-type SOD1 appear to be safe, as reductions or complete loss of SOD1 does not produce overt disease or compromise life span in experimental animal models.
  • Targeting an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding superoxide dismutase 1, soluble.
  • the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result.
  • a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”.
  • translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo.
  • the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding superoxide dismutase 1, soluble, regardless of the sequence(s) of such codons.
  • a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon.
  • Other target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene.
  • 5′UTR 5′ untranslated region
  • 3′UTR 3′ untranslated region
  • the 5′ cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage.
  • the 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap.
  • the 5′ cap region may also be a preferred target region.
  • an antisense oligonucleotide targeted to SOD1 is complementary to nucleobases 66 to 102 of a nucleic acid molecule encoding SOD1 (GENBANK® accession no. X02317.1, incorporated herein as SEQ ID NO: 1).
  • an antisense oligonucleotide targeted to SOD1 is complementary to nucleotides 83 to 102 of SEQ ID NO: 1.
  • an antisense oligonucleotide targeted to SOD1 is fully complementary to nucleotides 83 to 102 of SEQ ID NO: 1.
  • the antisense oligonucleotide is ISIS 333611.
  • an “individual suffering from familial ALS” is an individual who has received from a health professional, such as a physician, a diagnosis of familial ALS.
  • Relevant diagnostic tests are well known in the art and are understood to include, without limitation, genetic testing to determine the presence of a mutation in the SOD1 gene, neurological examination, and the El Escorial criteria (see, for example, Brooks et al., Amyothoph. Lateral Scler. other Motor Neuron Disorders, 2000, 293-299).
  • An “individual prone to familial ALS” is understood to include an individual who, based on a physician's assessment, is not yet suffering from familial ALS but is likely to develop familial ALS.
  • an antisense oligonucleotide targeted to SOD1 to the central nervous system (CNS) of an individual suffering from familial ALS, and in particular to the regions of the CNS affected by familial ALS.
  • CNS central nervous system
  • a preferred method of providing antisense oligonucleotides targeted to SOD1 to the tissues of the CNS is via administration of the antisense oligonucleotides directly into the cerebrospinal fluid (CSF).
  • CSF cerebrospinal fluid
  • means for delivery to the CSF include intrathecal (IT) and intracerebroventricular (ICV) administration.
  • IT or ICV administration may be achieved through the use of surgically implanted pumps that infuse a therapeutic agent into the cerebrospinal fluid.
  • delivery to the CSF and “administration to the CSF” encompass the IT infusion or ICV infusion of antisense oligonucleotides targeted to SOD1 through the use of an infusion pump.
  • IT infusion is a preferred means for delivery to the CSF.
  • the antisense oligonucleotide is continuously infused into the CSF for the entire course of treatment; such administration is referred to as “continuous infusion” or, in the case of IT infusion, “continuous IT infusion.”
  • a preferred means for delivery of antisense oligonucleotide to the CSF employs an infusion pump such as Medtronic SyncroMed® II pump.
  • the SyncroMed® II pump is surgically implanted according the procedures set forth by the manufacturer.
  • the pump contains a resevoir for retaining a drug solution, which is pumped at a programmed dose into a catheter that is surgically implanted.
  • the catheter is surgically intrathecally implanted.
  • the drug is the pharmaceutical composition comprising an antisense oligonucleotide targeted to SOD1.
  • a “pharmaceutical composition comprising an antisense oligonucleotide” refers to a composition comprising an antisense oligonucleotide targeted to SOD1 in a pharmaceutically acceptable diluent.
  • a suitable pharmaceutically acceptable diluent is phosphate-buffered saline.
  • the pharmaceutical composition comprises an antisense oligonucleotide complementary to nucleotides 66 to 102 of SOD1 in phosphate-buffered saline.
  • the pharmaceutical composition comprises an antisense oligonucleotide complementary to nucleotides 83 to 102 of SEQ ID NO: 1 in phosphate-buffered saline. In further preferred embodiments, the pharmaceutical composition comprises an antisense oligonucleotide fully complementary to nucleotides 83 to 102 of SEQ ID NO: 1 in phosphate-buffered saline. In more preferred embodiments, the pharmaceutical composition comprises ISIS 333611 in phosphate-buffered saline.
  • ISIS 333611 is the nonadecasodium salt of the antisense oligonucleotide having the nucleobase sequence CCGTCGCCCTTCAGCACGCA (SEQ ID NO: 2), where nucleosides 1 to 5 and 16 to 20 have 2′-O-methoxyethyl sugar moieties, nucleosides 6 to 15 are 2′-deoxynucleotides, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.
  • a “therapeutically effective amount” is an amount of an antisense oligonucleotide targeted to SOD1 required to produce a slowing of disease progression and/or an increase in survival time in an individual suffering from familial ALS. Accordingly, a therapeutically effect amount is an amount that will result in an improvement in one or more indicators of ALS progression, such as, for example, the revised ALSFSR, FEV 1 , FCV, and muscle strength measurements. In some embodiments, a therapeutically effective amount of an antisense oligonucleotide targeted to SOD1 ranges from 8 mg to 12 mg of antisense oligonucleotide.
  • a therapeutically effect amount of an antisense oligonucleotide targeted to SOD1 is 10 mg. In one embodiment, a therapeutically effective amount of an antisense oligonucleotide targeted to SOD1 is administered via continuous infusion for a minimum of 28 days. In preferred embodiments, antisense oligonucleotide is delivered via IT infusion. In further preferred embodiments, the antisense oligonucleotide administered is ISIS 333611.
  • slowing disease progression means the prevention of a clinically undesirable change in one or more disabilities in an individual suffering from familial ALS, and is assessed by methods routinely practiced in the art, for example, the revised ALSFSR, pulmonary function tests, and muscle strength measurements. Such methods are herein referred to as “indicators of ALS disease progression.”
  • an “improvement in a indicator of ALS disease progession” refers to slowing of the rate of change in one or more of the indicators of ALS disease progression described herein.
  • An improvement in an indicator of ALS disease progression further includes a lack of a measurable change in one or more of the indicators of ALS disease progression described herein.
  • An improvement in an indicator of ALS disease progression additionally includes a positive change in one of the indicators of ALS disease progression described herein, such as, for example, an increase in an ALSFSR-R score.
  • One of skill in the art will appreciate that is well within the abilities of a physician to identify a slowing of disease progression in an individual suffering from familial ALS, using one or more of the disease assessment tests described herein. Additionally, it is understood that a physician may administer to the individual diagnostic tests other than those described herein, such as additional pulmonary function tests or muscle strength measurement tests, to assess the rate of disease progression in an individual suffering from familial ALS.
  • a slowing of disease progression may further comprise an “increase in survival time” in an individual suffering from familial ALS. It is understood that a physician can use one or more of the disease assessment tests described herein to predict an approximate survival time of an individual suffering from familial ALS. A physician may additionally use the known disease course of a particular familial ALS mutation to predict survival time.
  • the “revised ALS functional rating scale” or “ALSFRS-R” is routinely used by physicians and is a validated rating instrument for monitoring the progression of disability in ALS patients.
  • the ALSFRS-R includes 12 questions that ask a physician to rate his or her impression of an ALS patient's level of functional impairment in performing one of ten common tasks, for example, climbing stairs. Each task is rated on a five-point scale, where a score of zero indicates an inability to perform a task and a score of four indicates normal ability in performing a task. Individual item scores are summed to produce a reported score of between zero (worst) and 48 (best).
  • Pulmonary function tests are employed to reveal the extent and progression respiratory muscle weakness. Pulmonary function tests include measurements of the “forced expiratory volume in one second” (FEV 1 ), which is the amount of air than an individual can forcefully exhale during the first second of exhalation following inhalation, as well as measurements of “forced vital capacity” (FVC), which is the total amount of air that an individual can forcefully exhale following inhalation. FEV 1 and FVC are typically reduced in individuals with neuromuscular diseases, such as ALS. Pulmonary function tests may be administered using instrument that directly measures the volume of air displaced during exhalation, or measures airflow during exhalation by a flow sensing device.
  • Muscle strength measurements include, but are not limited to, hand held dynamometry, maximum voluntary isometric contraction (MVIC) strain gauge measurements, and manual muscle testing. Muscle strength tests routinely use an instrument that measures how much force (for example, pounds of force) an individual can apply to the instrument using a selected group of muscles, such as the hand muscles. Such an instrument includes a dynamometer.
  • oligomeric compound(s) refers to polymeric structures which are capable of hybridizing to at least a region of an RNA molecule.
  • an oligomeric compound is “antisense” to a target nucleic acid when it comprises the reverse complement of the corresponding region of the target nucleic acid.
  • oligomeric compounds are known as “antisense compounds”, which include, without limitation, oligonucleotides (i.e. antisense oligonucleotides), oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and combinations of these.
  • an antisense compound comprises a backbone of linked monomeric subunits (sugar moieties) where each linked monomeric subunit is directly or indirectly attached to a heterocyclic base moiety.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or heterocyclic base moieties, such as those described below.
  • the term “modification” includes substitution and/or any change from a starting or natural nucleoside or nucleotide. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Antisense compounds are often defined in the art to comprise the further limitation of, once hybridized to a target, being able to induce or trigger a reduction in target gene expression or target gene levels.
  • the antisense compounds e.g. antisense oligonucleotides, trigger a reduction in the levels of a nucleic acid encoding SOD1.
  • Targeting an antisense oligonucleotide to a nucleic acid encoding SOD1 includes the determination of at least one target segment within a nucleic acid encoding SOD1 for hybridization to occur such that the desired effect, e.g., inhibition of SOD1 mRNA expression, will result.
  • SOD1 target nucleic acid and “nucleic acid encoding SOD1” encompass RNA (including pre-mRNA and mRNA) transcribed from DNA encoding SOD1, and also cDNA derived from such RNA.
  • RNA to be interfered with include, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA.
  • the overall effect of such interference with target nucleic acid function is modulation of the SOD1 protein.
  • modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
  • inhibition is the preferred form of modulation of gene expression and SOD1 mRNA (e.g. SEQ ID NO: 1) is a preferred target.
  • a “target segment” means a sequence of an SOD1 target nucleic acid to which one or more antisense oligonucleotides are complementary. Multiple antisense oligonucleotides complementary to a given target segment may or may not have overlapping sequences.
  • target site is defined as a sequence of an SOD1 nucleic acid to which one antisense oligonucleotide is complementary.
  • the nucleobase sequence of ISIS 333611 is complementary to nucleobases 83 to 102 of SEQ ID NO: 1, thus these nucleobases represent a target site of an SOD1 nucleic acid.
  • antisense oligonucleotides of the invention have target sites within nucleobases 66 to 102 of SEQ ID NO: 1, thus these nucleobases represent a target segment of an SOD1 nucleic acid.
  • a target segment and target site are represented by the same nucleobase sequence.
  • particularly preferred SOD1 target segments include, without limitation, nucleobases 66 to 102 of SEQ ID NO: 1; nucleobases 73 to 102 of SEQ ID NO: 1; and nucleobases 79 to 102 of SEQ ID NO: 1.
  • Particularly preferred target sites include nucleobases 81 to 100 of SEQ ID NO: 1, to which ISIS 146145 is complementary; and nucleobases 83 to 102 of SEQ ID NO: 1, to which ISIS 333611 is complementary.
  • the antisense oligonucleotides in accordance with this invention comprise from 15 to 30 nucleosides in length, i.e., from 15 to 30 linked nucleosides.
  • the antisense oligonucleotides in accordance with this invention comprise from 15 to 30 nucleosides in length, i.e., from 15 to 30 linked nucleosides.
  • One of skill in the art will appreciate that this embodies antisense oligonucleotides of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length.
  • the antisense oligonucleotides of the invention are 17 to 25 nucleosides in length, as exemplified herein.
  • the antisense oligonucleotides of the invention are 19, 20, 21, 22 or 23 nucleosides in length.
  • Base complementarity refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization).
  • the mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between corresponding nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Hybridization can occur under varying circumstances.
  • an antisense oligonucleotide is “fully complementary” to a target nucleic acid when each nucleobase of the antisense oligonucleotide is capable of undergoing precise base pairing with an equal number of nucleobases in the target nucleic acid. It is understood in the art that the sequence of the antisense oligonucleotide need not be fully complementary to that of its target nucleic acid to be active in inhibiting the activity of the target nucleic acid.
  • non-complementary positions also known as “mismatches”
  • mismatches there are “non-complementary” positions, also known as “mismatches”, between the antisense oligonucleotide and the target nucleic acid, and such non-complementary positions may be tolerated between an antisense oligonucleotide and the target nucleic acid provided that the antisense oligonucleotide remains specifically hybridizable to the target nucleic acid.
  • ISIS 333611 having two non-complementary nucleobases with respect to monkey SOD1, is capable of reducing monkey SOD1 mRNA levels in cultured cells.
  • non-complementary nucleobase means a nucleobase of an antisense oligonucleotide that is unable to undergo precise base pairing with a nucleobase at a corresponding position in a target nucleic acid.
  • non-complementary and “mismatch” are interchangeable.
  • antisense oligonucleotides having no more than three non-complementary nucleobases with respect to a nucleic acid encoding SOD1 are considered “complementary” to a nucleic acid encoding SOD1.
  • the antisense oligonucleotide contains no more than two non-complementary nucleobases with respect to a nucleic acid encoding SOD1. In further preferred embodiments, the antisense oligonucleotide contains no more than one non-complementary nucleobases with respect to a nucleic acid encoding SOD1.
  • non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense oligonucleotide.
  • the non-complementary nucleobase may be at an internal position in the antisense oligonucleotide.
  • two or more non-complementary nucleobases may be contiguous (i.e. linked) or non-contiguous.
  • the antisense oligonucleotides comprise at least 90% sequence complementarity to an SOD1 target nucleic acid. In further embodiments of the invention, the antisense oligonucleotides comprise at least 95% sequence complementarity to an SOD1 target nucleic acid. Percent complementarity of an antisense oligonucleotide with a region of a target nucleic acid can be determined routinely by those having ordinary skill in the art, and may be accomplished using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • Antisense oligonucleotides may have a defined percent identity to a SEQ ID NO, or an antisense oligonucleotide having a specific ISIS number. This identity may be over the entire length of the antisense oligonucleotide, or over less than the entire length of the antisense oligonucleotide. Calculating percent identity is well within the ability of those skilled in the art. It is understood by those skilled in the art that an antisense oligonucleotide need not have an identical sequence to those described herein to function similarly to the antisense oligonucleotides described herein. For example, antisense oligonucleotides having at least 90%, or at least 95%, identity to antisense oligonucleotides taught herein are contemplated in the present invention.
  • Shortened or truncated versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted, and are contemplated in the present invention.
  • the deleted nucleosides may be adjacent to each other, for example, in an antisense oligonucleotide having two nucleosides truncated from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation), of the antisense oligonucleotide.
  • the deleted nucleosides may be dispersed through out the antisense, for example, in an antisense oligonucleotide having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.
  • antisense oligonucleotides taught herein i.e. antisense oligonucleotides having one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein.
  • the added nucleosides may be adjacent to each other, for example, in an antisense oligonucleotide having two nucleosides added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the antisense oligonucleotide.
  • the added nucleosides may be dispersed throughout the antisense oligonucleotide, for example, in an antisense oligonucleotide having one nucleoside added to the 5′ end and one nucleoside added to the 3′ end.
  • Antisense oligonucleotides of the invention may be also be described as complementary to a portion of a target site.
  • a “portion” is defined as at least 18 contiguous nucleobases of a target site. In other embodiments, a portion is 19 or 20 contiguous nucleobases of a target site.
  • antisense oligonucleotides may be complementary, or alternatively fully complementary, to a 19 nucleobase portion of SEQ ID NO: 1.
  • antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
  • antisense compounds taught herein may contain modifications which confer desirable properties to the antisense compound including, but are not limited to, increased affinity of an antisense oligonucleotide for its target RNA and increased resistance to nucleases.
  • nucleoside is a base-sugar combination.
  • the base (also known as nucleobase) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
  • the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar.
  • the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • this linear polymeric structure can be joined to form a circular structure by hybridization or by formation of a covalent bond.
  • the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • the normal internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • oligonucleotide refers generally to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and may be used to refer to unmodified oligonucleotides or oligonucleotide analogs.
  • unmodified oligonucleotide refers generally to oligonucleotides composed of naturally occurring nucleobases, sugars, and covalent internucleoside linkages.
  • oligonucleotide analog refers to oligonucleotides that have one or more non-naturally occurring nucleobases, sugars, and/or internucleoside linkages. Such non-naturally occurring oligonucleotides are often selected over naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, increased stability in the presence of nucleases, or increased inhibitory activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense compound for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
  • antisense compounds useful in this invention include oligonucleotides containing one or more modified, i.e. non-naturally occurring, internucleoside linkages.
  • Such non-naturally internucleoside linkages are often selected over naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets and increased stability in the presence of nucleases.
  • oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be “oligonucleosides”. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known to those skilled in the art.
  • Antisense compounds of the invention may also contain one or more nucleosides having modified sugar moieties.
  • the base moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
  • Sugar modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the antisense compounds.
  • the furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, particularly at the 2′ position, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA) and substitution of an atom or group such as —S—, —N(R)— or —C(R 1 )(R 2 ) for the ring oxygen at the 4′-position.
  • BNA bicyclic nucleic acid
  • Sugars can also be replaced with sugar mimetic groups. Methods for the preparations of modified sugars are well known to those skilled in the art.
  • Antisense compounds of the invention may also contain one or more nucleobase (often referred to in the art simply as “base”) modifications or substitutions which are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the antisense compounds.
  • “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases also referred to herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl(—C ⁇ C—CH 3 )uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8
  • Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Nucleobases that are particularly useful for increasing the binding affinity of the antisense compounds of the invention include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
  • nucleobase substitutions including 5-methylcytosinse substitutions, are particularly useful for increasing the binding affinity of the oligonucleotides of the invention.
  • 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications , CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with T-O-methoxyethyl sugar modifications.
  • Antisense compounds can also include an “oligonucleotide mimetic,” which refers to oligonucleotides in which only the furanose ring or both the furanose ring and the internucleoside linkage are replaced with novel groups.
  • oligonucleotide mimetic refers to oligonucleotides in which only the furanose ring or both the furanose ring and the internucleoside linkage are replaced with novel groups.
  • mimetic refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino.
  • Representative examples of a mimetic for a sugar-internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages.
  • PNA peptide nucleic acids
  • nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc. Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.
  • One substitution that can be appended to the antisense compounds of the invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense compounds.
  • such modified antisense compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups.
  • Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of the antisense compounds.
  • Typical conjugate groups include cholesterol moieties and lipid moieties.
  • Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Antisense compounds used in the compositions of the present invention can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. By “cap structure” or “terminal cap moiety” is meant chemical modifications, which have been incorporated at either terminus of an antisense compound (see for example Wincott et al., WO 97/26270). These terminal modifications protect the antisense compounds having terminal nucleic acid molecules from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini.
  • the cap may be present at either or both termini of either strand.
  • Cap structures are well known in the art and include, for example, inverted deoxy abasic caps.
  • 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.
  • Antisense compounds of this invention may have the chemically modified subunits arranged in patterns enhance the inhibitory activity of the antisense compounds. These patterns are described herein as “motifs.”
  • the term “gapped motif” or “gapmer” is meant to include an antisense compound having an internal region (also referred to as a “gap” or “gap segment”) positioned between two external regions (also referred to as “wing” or “wing segment”). The regions are differentiated by the types of sugar moieties comprising each distinct region.
  • sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include ⁇ -D-ribonucleosides, ⁇ -D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE, and 2′-O—CH 3 , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include LNATM or ENATM, among others).
  • each distinct region comprises uniform sugar moieties.
  • Gapped motifs or gapmers are further defined as being either “symmetric” or “asymmetric”.
  • a gapmer wherein the nucleosides of the first wing have the same sugar modifications as the nucleosides of the second wing is termed a symmetric gapped antisense compound.
  • Symmetric gapmers can have, for example, an internal region comprising a first sugar moiety, and external regions each comprising a second sugar moiety, wherein at least one sugar moiety is a modified sugar moiety.
  • Chimeric antisense compounds are antisense compounds that at least 2 chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide or nucleoside in the case of a nucleic acid based antisense compound. Accordingly, antisense compounds having a gapmer motif considered chimeric antisense compounds.
  • Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity.
  • an antisense compound may be designed to comprise a region that serves as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex. In the case of gapmer, the internal region generally serves as the substrate for endonuclease cleavage.
  • antisense compounds of the invention may also be admixed with pharmaceutically acceptable substances, active and/or inert, that are well known to those skilled in the art.
  • compositions and formulations that include the antisense compounds and compositions of the invention.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Such considerations are well understood by those skilled in the art.
  • the antisense compounds and compositions of the invention can be utilized in pharmaceutical compositions by adding an effective amount of the compound or composition to a suitable pharmaceutically acceptable diluent or carrier.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
  • PBS is a diluent suitable for use in compositions to be delivered to the CNS.
  • the antisense compounds and compositions of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the antisense compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. This can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the antisense compounds and compositions of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Suitable examples include, but are not limited to, sodium and potassium salts.
  • the effects of antisense oligonucleotides on the level, activity or expression of SOD1 target nucleic acids can be tested in vitro in a variety of cell types.
  • Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.).
  • Illustrative cell types include, but are not limited to, A549 cells, fibroblasts, and neuronal cells.
  • One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, Calif.).
  • Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
  • Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE® (Invitrogen, Carlsbad, Calif.).
  • Antisense oligonucleotide is mixed with LIPOFECTAMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense compound.
  • Cells are treated with antisense oligonucleotides by routine methods well known to those skilled in the art. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
  • the concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM.
  • Antisense oligonucleotides are tested in animals to assess their ability to inhibit expression of a target nucleic acid and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models.
  • antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline.
  • Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous, and further includes intrathecal and intracerebroventricular routes of administration. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight.
  • RNA is isolated from various tissues and changes in target nucleic acid expression are measured. Changes in proteins encoded by target nucleic acids may also be measured. The types of phenotypic changes selected for monitoring are dependent upon the cellular pathway and disease with which the target nucleic acid is associated.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.
  • Target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR.
  • RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
  • Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • RNA Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification.
  • RT reverse transcriptase
  • cDNA complementary DNA
  • the RT and real-time PCR reactions are performed sequentially in the same sample well.
  • RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as GAPDH, or by quantifying total RNA using RIBOGREEN® (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.
  • Probes and primers are designed to hybridize to an SOD1 target nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, Calif.). Primers and probes useful for detection of human and rat SOD1 mRNA are described in U.S. application Ser. No. 10/672,866, published as US 2005/0019915, which is herein incorporated by reference in its entirety.
  • Protein levels of SOD1 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS).
  • Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
  • Antibodies useful for the detection of human and rat SOD1 are well known in the art.
  • antisense oligonucleotides In order to inhibit the gene expression in the central nervous system, antisense oligonucleotides must be delivered directly to the cerebrospinal fluid by, for example, intracerebroventricular (ICV) administration.
  • ICV intracerebroventricular
  • SOD1 mRNA levels were measured in rat brain following ICV administration.
  • SOD1 mRNA levels were measured in both rat spinal cord and rat brain following ICV administration of ISIS 146192, an antisense oligonucleotide targeted to SOD1.
  • Administration was performed daily at either 33 ⁇ g/day or 50 ⁇ g/day for 14 days.
  • an embodiment of the present invention is the delivery of antisense oligonucleotides to the cerebrospinal fluid by way of ICV administration.
  • the A4V mutation of SOD1 accounts for 50% of SOD1-mediated familial ALS in the United States.
  • Antisense oligonucleotides targeting SOD1 were tested for their ability to inhibit SOD1 expression in fibroblasts isolated from an individual harboring the A4V mutation.
  • ISIS 333611, ISIS 333624 (complementary to nucleotides 440 to 459 of SEQ ID NO: 1), and ISIS 333636 (complementary to nucleobases 452 to 471 of SEQ ID NO: 1) inhibited SOD1 expression in a dose dependent manner when tested at doses of 3, 10, 30, 100, or 300 nM. SOD2 mRNA levels were not affected.
  • transgenic mice have been engineered to express the human G85R SOD1 variant.
  • Transgenic rats expressing the human SOD1 G93A variant develop symptoms similar to ALS and do not survive beyond three to five months after birth. As such, these transgenic rats are useful for the testing of antisense oligonucleotides targeted to SOD1.
  • the presence of the human G93A SOD1 variant causes human SOD1 mRNA to accumulate to levels approximately 5 to 10 times that of endogenous wild-type rat SOD1.
  • Antisense oligonucleotide was infused into the right lateral ventricle of 65 day old rats expressing the human G93A SOD1 variant at a dose of 100 ⁇ g/day for 28 days, using Alzet minipumps. Following the treatment period, RNA was isolated from different regions of the brain, and SOD1 mRNA levels were measured by real-time PCR. Despite the high level of human SOD1 mRNA, ISIS 146145, ISIS 333611, ISIS 333624, and ISIS 333636 were effective at reducing human SOD1 mRNA in different regions of the brain.
  • ISIS 333611 effectively reduced human SOD1 mRNA levels in the right cortex, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord by approximately 69%, 45%, 50%, and 42%, respectively.
  • Human SOD1 protein levels were reduced following treatment with ISIS 333611 by approximately 40% and 35%, respectively, in the right cortex and cervical spinal cord. Reduction of SOD1 protein was greater at one month than at two weeks, reflecting the known long half-life of SOD1 protein.
  • An embodiment of the present invention is a method of the slowing of disease progression in an individual suffering from familial ALS by delivering to the cerebrospinal fluid an antisense oligonucleotide targeted to SOD1.
  • the method further comprises extending the survival of an individual suffering from familial ALS.
  • the antisense oligonucleotide is ISIS 333611.
  • ISIS 13920 an antisense oligonucleotide having a gapped motif
  • ISIS 13920 an antisense oligonucleotide having a gapped motif
  • ISIS 13920 distributed broadly throughout the central nervous system, with the highest concentrations found in the cortex and the lowest concentrations found in the hypothalamus.
  • antisense oligonucleotides was broadly distributed throughout the central nervous system, with the highest concentrations of oligonucleotides found in the tissue adjacent to the site of infusion, the lumbar cord.
  • an embodiment of the present invention is the delivery of antisense oligonucleotide targeted to SOD1 to the central nervous system, as well as the cerebrospinal fluid, through intracerebroventricular or intrathecal infusion.
  • the present invention provides methods of slowing disease progression in an individual suffering from familial ALS.
  • Such methods comprise the administration to the cerebrospinal fluid of the individual a pharmaceutical composition comprising ISIS 333611. Delivery of the pharmaceutical composition to the cerebrospinal fluid allows for contact of the antisense oligonucleotide with the cells of central nervous system tissues, including tissues affected by ALS.
  • the physician's assessment includes the El Escorial criteria, genetic testing to verify the presence of a mutation in the SOD1 gene, and a neurological examination.
  • a Medtronic SyncroMed® II pump is used to deliver a pharmaceutical composition comprising ISIS 333611 to the cerebrospinal fluid of an individual suffering from familial ALS.
  • the pump is surgically implanted per the procedures outlined by the manufacturer. Drug is retained in the reservoir of the pump, and is pumped at a programmed dose into a catheter that is surgically intrathecally implanted.
  • the reservoir is loaded with a pharmaceutical composition comprising ISIS 333611 in phosphate-buffered saline.
  • the pharmaceutical composition is administered at an amount that yields an infusion of 8 mg to 12 mg of ISIS 333611 into the cerebrospinal fluid.
  • the amount of ISIS 333611 infused is 10 mg.
  • Administration is for a period of at least 28 days.
  • Disease progression is measured by methods routine in the art and described herein, for example, using the ALSFSR-R, and measurements of FEV 1 , FVC, and muscle strength. These methods are used by a physician to assess disease state at initiation of treatment, and this assessment serves as a baseline for disease state. Subsequent assessments are performed at regular intervals during the pharmaceutical composition delivery period; these intervals are determined by the physician. Administration of a pharmaceutical composition comprising ISIS 333611 to the CSF of individuals suffering from familial ALS slows the progression of ALS.
  • the ALSFSR-R score is not reduced relative to the baseline ALSFSR-R score.
  • FEV 1 is not reduced relative to baseline values.
  • FVC is not reduced relative to baseline values.
  • muscle strength such as hand grip strength, is not reduced relative to baseline values.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Neurology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Methods for slowing disease progression in an individual suffering from familial ALS are provided. Also provided are methods of increasing the survival time of an individual suffering from familial ALS. These methods employ antisense oligonucleotides targeted to SOD1, for use in inhibiting the expression of SOD1 in the central nervous system of an individual suffering from familial ALS.

Description

RELATED APPLICATIONS
This application is a continuation of U.S. application Ser. No. 12/566,549, filed Sep. 24, 2009, which is a continuation of U.S. application Ser. No. 11/526,134, filed Sep. 21, 2006, now U.S. Pat. No. 7,622,455, issued Nov. 24, 2009, which is a continuation-in-part of U.S. application Ser. No. 11/449,446, filed Jun. 7, 2006, now U.S. Pat. No. 7,902,163, issued Mar. 8, 2011, which is a continuation of U.S. application Ser. No. 10/672,866, filed Sep. 26, 2003, now abandoned, which is a continuation-in-part of U.S. application Ser. No. 10/633,843, filed Aug. 4, 2003, now U.S. Pat. No. 7,132,530, issued Nov. 7, 2006, which is a continuation of U.S. application Ser. No. 09/888,360, filed Jun. 21, 2001, now abandoned. Further, U.S. application Ser. No. 11/526,134 claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application Ser. No. 60/719,936, filed Sep. 21, 2005. The entire contents of these documents are incorporated herein by reference.
SEQUENCE LISTING
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled RTS0242USC6SEQ.txt, created on Feb. 27, 2012 which is 4 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
The present invention provides compositions and methods for slowing disease progression in an individual suffering from familial amyotrophic lateral sclerosis. In particular, this invention relates to antisense compounds, particularly antisense oligonucleotides, complementary to SOD1 nucleic acids. Such antisense oligonucleotides have been shown to inhibit the expression of SOD1.
BACKGROUND OF THE INVENTION
The superoxide anion (O2) is a potentially harmful cellular by-product produced primarily by errors of oxidative phosphorylation in mitochondria (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). Some of the targets for oxidation by superoxide in biological systems include the iron-sulfur dehydratases, aconitase and fumarases. Release of Fe (II) from these superoxide-inactivated enzymes results in Fenton-type production of hydroxyl radicals which are capable of attacking virtually any cellular target, most notably DNA (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112).
The enzymes known as the superoxide dismutases (SODs) provide defense against oxidative damage of biomolecules by catalyzing the dismutation of superoxide to hydrogen peroxide (H2O2) (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112). Two major classes of superoxide dismutases exist. One consists of a group of enzymes with active sites containing copper and zinc while the other class has either manganese or iron at the active site (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112).
The soluble superoxide dismutase 1 enzyme (also known as SOD1 and Cu/Zn superoxide dismutase) contains a zinc- and copper-type active site (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112). Lee et al. reported the molecular cloning and high-level expression of human cytoplasmic superoxide dismutase gene in E. coli in 1990 (Lee et al., Misaengmul Hakhoechi, 1990, 28, 91-97). Studies of transgenic mice carrying a mutant human superoxide dismutase 1 gene, for example, transgenic mice expressing a human SOD1 gene bearing glycine 93 to alanine (G93A) mutation.
Mutations in the superoxide dismutase 1 gene are associated with a dominantly-inherited form of amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease) a disorder characterized by a selective degeneration of upper and lower motor neurons (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). The deleterious effects of various mutations on superoxide dismutase 1 are most likely mediated through a gain of toxic function rather than a loss of superoxide dismutase 1 activity, as the complete absence of superoxide dismutase 1 in mice neither diminishes life nor provokes overt disease (Al-Chalabi and Leigh, Curr. Opin. Neurol., 2000, 13, 397-405; Alisky and Davidson, Hum. Gene Ther., 2000, 11, 2315-2329).
Cleveland and Liu proposed two models for mutant superoxide dismutase 1 toxicity (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). The “oxidative hypothesis” ascribes toxicity to binding of aberrant substrates such as peroxynitrite or hydrogen peroxide which gain access to the catalytic copper ion through mutation-dependent loosening of the native superoxide dismutase 1 protein conformation (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). A second possible mechanism for mutant superoxide dismutase 1 toxicity involves the misfolding and aggregation of mutant superoxide dismutase 1 proteins (Cleveland and Liu, Nat. Med., 2000, 6, 1320-1321). The idea that aggregates contribute to ALS has received major support from the observation that murine models of superoxide dismutase 1 mutant-mediated disease feature prominent intracellular inclusions in motor neurons and, in some cases, in the astrocytes surrounding them as well (Bruijn et al., Science, 1998, 281, 1851-1854). Furthermore, Brujin et al. also demonstrate that neither elimination nor elevation of wild-type superoxide dismutase 1 was found to affect disease induced by mutant superoxide dismutase 1 in mice (Bruijn et al., Science, 1998, 281, 1851-1854).
Riluzole, a glutamate regulatory drug, is approved for use in ALS patients in some countries, but has only a modest effect on survival. Accordingly, there remains an unmet need for therapeutic regimens that slow familial ALS disease progression and increase survival of familial ALS patients.
SUMMARY OF THE INVENTION
The present invention provides methods of slowing disease progression in an individual suffering from familial amyotrophic lateral sclerosis (ALS), comprising administering to the individual a therapeutically effective amount of a pharmaceutical composition comprising an antisense oligonucleotide 17 to 25 nucleobases in length complementary to nucleobases 66 to 102 of SEQ ID NO: 1, thereby slowing disease progression. The administering may comprise delivery to the cerebrospinal fluid of the individual, and may further comprise intrathecal infusion. A slowing of disease progression is measured by an improvement in one or more indicators of ALS disease progression selected from ALSFRS-R, FEV1, FVC, or muscle strength measurements. The methods further comprise increasing the survival time of an individual suffering from familial ALS.
The methods provided herein comprise the administration of an antisense oligonucleotide complementary to nucleobases 83 to 102 of SEQ ID NO: 1. The antisense oligonucleotide may be fully complementary to nucleotides 83 to 102 of SEQ ID NO: 1. Further, the antisense oligonucleotide may consist essentially of ISIS 333611. Additionally, the antisense oligonucleotide may consist of ISIS 333611.
The antisense oligonucleotides employed in the methods provided herein comprise at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage, a modified sugar moiety, such as a 2′-O-methoxyethyl sugar moiety or a bicyclic nucleic acid sugar moiety, or a modified nucleobase, such as a 5-methylcytosine.
The present invention provides methods of slowing disease progression in an individual suffering from familial ALS comprising administering an antisense oligonucleotide that is a chimeric oligonucleotide. The chimeric oligonucleotide comprises a 2′-deoxynucleotide gap segment positioned between 5′ and 3′ wing segments. The wing segments are comprised of nucleosides containing a sugar moiety selected from a 2′-O-methoxyethyl sugar moiety or a bicyclic nucleic acid sugar moiety. The gap segment may be ten 2′-deoxynucleotides in length and each of the wing segments may be five 2′-O-methoxyethyl nucleotides in length. The chimeric oligonucleotide may be uniformly comprised of phosphorthioate internucleoside linkages. Further, each cytosine of the chimeric oligonucleotide may be a 5′-methylcytosine.
Further provided are methods comprising selecting an individual who has received a diagnosis of familial amyotrophic lateral sclerosis (ALS), administering to the individual a therapeutically effective amount of a pharmaceutical composition comprising an antisense oligonucleotide 17 to 25 nucleobases in length complementary to nucleobases 66 to 102 of SEQ ID NO: 1, and monitoring ALS disease progression in the individual.
DETAILED DESCRIPTION OF THE INVENTION
Over 100 mutations of the human SOD1 gene have been identified, and altogether account for approximately 20% of familial amyotrophic lateral sclerosis (ALS) cases. Some mutations, such as the A4V mutation most commonly found in the United States, are highly lethal and result in survival only nine months from the onset of disease symptoms. Other mutations of SOD1 manifest in a slower disease course.
It has been discovered that antisense inhibition of superoxide dismutase 1 (SOD1) in an animal model of familial ALS reduces both SOD1 mRNA and protein, and further results in a slowing of disease progression and, importantly, increased survival time. Accordingly, the present invention provides methods for the slowing of disease progression in an individual suffering from familial ALS by delivering to the cerebrospinal fluid of the individual a therapeutically effective amount of a pharmaceutical composition comprising an antisense oligonucleotide targeted to SOD1. Such methods further comprise increasing survival time of an individual suffering from familial ALS. Slowing of disease progression is indicated by an improvement in one or more indicators of ALS disease progression, including, without limitation, the revised ALS functional rating scale, pulmonary function tests, and muscle strength measurements.
The present invention employs antisense compounds, particularly antisense oligonucleotides, for use in modulating the function of nucleic acid molecules encoding SOD1, ultimately modulating the amount of SOD1 protein produced. This is accomplished by providing antisense oligonucleotides which hybridize to and inhibit the expression of one or more nucleic acids encoding SOD1. Such antisense oligonucleotides are considered to be “targeted to SOD1.” Antisense oligonucleotides of the present invention do not necessarily distinguish between wild-type SOD1 mRNA and SOD1 mRNAs bearing mutations. While an object of the present invention is to reduce SOD1 mRNAs bearing mutations, the conconmitant reduction of wild-type SOD1 appear to be safe, as reductions or complete loss of SOD1 does not produce overt disease or compromise life span in experimental animal models.
It is preferred to target specific nucleic acids for antisense. “Targeting” an antisense compound to a particular nucleic acid, in the context of this invention, is a multistep process. The process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent. In the present invention, the target is a nucleic acid molecule encoding superoxide dismutase 1, soluble. The targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., detection or modulation of expression of the protein, will result. Within the context of the present invention, a preferred intragenic site is the region encompassing the translation initiation or termination codon of the open reading frame (ORF) of the gene. Since, as is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the “AUG codon,” the “start codon” or the “AUG start codon”. A minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′-UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the terms “translation initiation codon” and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “start codon” and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding superoxide dismutase 1, soluble, regardless of the sequence(s) of such codons.
It is also known in the art that a translation termination codon (or “stop codon”) of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively). The terms “start codon region” and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. Similarly, the terms “stop codon region” and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon.
The open reading frame (ORF) or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene. The 5′ cap of an mRNA comprises an N7-methylated guanosine residue joined to the 5′-most residue of the mRNA via a 5′-5′ triphosphate linkage. The 5′ cap region of an mRNA is considered to include the 5′ cap structure itself as well as the first 50 nucleotides adjacent to the cap. The 5′ cap region may also be a preferred target region.
In certain embodiments, an antisense oligonucleotide targeted to SOD1 is complementary to nucleobases 66 to 102 of a nucleic acid molecule encoding SOD1 (GENBANK® accession no. X02317.1, incorporated herein as SEQ ID NO: 1). In additional embodiments, an antisense oligonucleotide targeted to SOD1 is complementary to nucleotides 83 to 102 of SEQ ID NO: 1. In preferred embodiments, an antisense oligonucleotide targeted to SOD1 is fully complementary to nucleotides 83 to 102 of SEQ ID NO: 1. In further preferred embodiments, the antisense oligonucleotide is ISIS 333611.
As used herein, an “individual suffering from familial ALS” is an individual who has received from a health professional, such as a physician, a diagnosis of familial ALS. Relevant diagnostic tests are well known in the art and are understood to include, without limitation, genetic testing to determine the presence of a mutation in the SOD1 gene, neurological examination, and the El Escorial criteria (see, for example, Brooks et al., Amyothoph. Lateral Scler. other Motor Neuron Disorders, 2000, 293-299). An “individual prone to familial ALS” is understood to include an individual who, based on a physician's assessment, is not yet suffering from familial ALS but is likely to develop familial ALS.
In order for antisense inhibition of SOD1 to have a clinically desirable effect on familial ALS progression, it is beneficial to deliver an antisense oligonucleotide targeted to SOD1 to the central nervous system (CNS) of an individual suffering from familial ALS, and in particular to the regions of the CNS affected by familial ALS. As the blood-brain barrier is generally impermeable to antisense oligonucleotides administered systemically, a preferred method of providing antisense oligonucleotides targeted to SOD1 to the tissues of the CNS is via administration of the antisense oligonucleotides directly into the cerebrospinal fluid (CSF). As is known in the art, means for delivery to the CSF include intrathecal (IT) and intracerebroventricular (ICV) administration. As is further known in the art, IT or ICV administration may be achieved through the use of surgically implanted pumps that infuse a therapeutic agent into the cerebrospinal fluid. As used herein, “delivery to the CSF” and “administration to the CSF” encompass the IT infusion or ICV infusion of antisense oligonucleotides targeted to SOD1 through the use of an infusion pump. In some embodiments, IT infusion is a preferred means for delivery to the CSF. In preferred embodiments, the antisense oligonucleotide is continuously infused into the CSF for the entire course of treatment; such administration is referred to as “continuous infusion” or, in the case of IT infusion, “continuous IT infusion.”
In the context of the present invention, a preferred means for delivery of antisense oligonucleotide to the CSF employs an infusion pump such as Medtronic SyncroMed® II pump. The SyncroMed® II pump is surgically implanted according the procedures set forth by the manufacturer. The pump contains a resevoir for retaining a drug solution, which is pumped at a programmed dose into a catheter that is surgically implanted. For intrathecal administration of a drug, the catheter is surgically intrathecally implanted. In the context of the present invention, the drug is the pharmaceutical composition comprising an antisense oligonucleotide targeted to SOD1.
As used herein, a “pharmaceutical composition comprising an antisense oligonucleotide” refers to a composition comprising an antisense oligonucleotide targeted to SOD1 in a pharmaceutically acceptable diluent. By way of example, a suitable pharmaceutically acceptable diluent is phosphate-buffered saline. In some embodiments, the pharmaceutical composition comprises an antisense oligonucleotide complementary to nucleotides 66 to 102 of SOD1 in phosphate-buffered saline. In preferred embodiments, the pharmaceutical composition comprises an antisense oligonucleotide complementary to nucleotides 83 to 102 of SEQ ID NO: 1 in phosphate-buffered saline. In further preferred embodiments, the pharmaceutical composition comprises an antisense oligonucleotide fully complementary to nucleotides 83 to 102 of SEQ ID NO: 1 in phosphate-buffered saline. In more preferred embodiments, the pharmaceutical composition comprises ISIS 333611 in phosphate-buffered saline. ISIS 333611 is the nonadecasodium salt of the antisense oligonucleotide having the nucleobase sequence CCGTCGCCCTTCAGCACGCA (SEQ ID NO: 2), where nucleosides 1 to 5 and 16 to 20 have 2′-O-methoxyethyl sugar moieties, nucleosides 6 to 15 are 2′-deoxynucleotides, each internucleoside linkage is a phosphorothioate linkage, and each cytosine is a 5-methylcytosine.
As used herein, a “therapeutically effective amount” is an amount of an antisense oligonucleotide targeted to SOD1 required to produce a slowing of disease progression and/or an increase in survival time in an individual suffering from familial ALS. Accordingly, a therapeutically effect amount is an amount that will result in an improvement in one or more indicators of ALS progression, such as, for example, the revised ALSFSR, FEV1, FCV, and muscle strength measurements. In some embodiments, a therapeutically effective amount of an antisense oligonucleotide targeted to SOD1 ranges from 8 mg to 12 mg of antisense oligonucleotide. In preferred embodiments, a therapeutically effect amount of an antisense oligonucleotide targeted to SOD1 is 10 mg. In one embodiment, a therapeutically effective amount of an antisense oligonucleotide targeted to SOD1 is administered via continuous infusion for a minimum of 28 days. In preferred embodiments, antisense oligonucleotide is delivered via IT infusion. In further preferred embodiments, the antisense oligonucleotide administered is ISIS 333611.
As used herein, “slowing disease progression” means the prevention of a clinically undesirable change in one or more disabilities in an individual suffering from familial ALS, and is assessed by methods routinely practiced in the art, for example, the revised ALSFSR, pulmonary function tests, and muscle strength measurements. Such methods are herein referred to as “indicators of ALS disease progression.”
As used herein, an “improvement in a indicator of ALS disease progession” refers to slowing of the rate of change in one or more of the indicators of ALS disease progression described herein. An improvement in an indicator of ALS disease progression further includes a lack of a measurable change in one or more of the indicators of ALS disease progression described herein. An improvement in an indicator of ALS disease progression additionally includes a positive change in one of the indicators of ALS disease progression described herein, such as, for example, an increase in an ALSFSR-R score. One of skill in the art will appreciate that is well within the abilities of a physician to identify a slowing of disease progression in an individual suffering from familial ALS, using one or more of the disease assessment tests described herein. Additionally, it is understood that a physician may administer to the individual diagnostic tests other than those described herein, such as additional pulmonary function tests or muscle strength measurement tests, to assess the rate of disease progression in an individual suffering from familial ALS.
A slowing of disease progression may further comprise an “increase in survival time” in an individual suffering from familial ALS. It is understood that a physician can use one or more of the disease assessment tests described herein to predict an approximate survival time of an individual suffering from familial ALS. A physician may additionally use the known disease course of a particular familial ALS mutation to predict survival time.
The “revised ALS functional rating scale” or “ALSFRS-R” is routinely used by physicians and is a validated rating instrument for monitoring the progression of disability in ALS patients. The ALSFRS-R includes 12 questions that ask a physician to rate his or her impression of an ALS patient's level of functional impairment in performing one of ten common tasks, for example, climbing stairs. Each task is rated on a five-point scale, where a score of zero indicates an inability to perform a task and a score of four indicates normal ability in performing a task. Individual item scores are summed to produce a reported score of between zero (worst) and 48 (best).
ALS eventually results in progressive muscle weakness. Pulmonary function tests (PFTs) are employed to reveal the extent and progression respiratory muscle weakness. Pulmonary function tests include measurements of the “forced expiratory volume in one second” (FEV1), which is the amount of air than an individual can forcefully exhale during the first second of exhalation following inhalation, as well as measurements of “forced vital capacity” (FVC), which is the total amount of air that an individual can forcefully exhale following inhalation. FEV1 and FVC are typically reduced in individuals with neuromuscular diseases, such as ALS. Pulmonary function tests may be administered using instrument that directly measures the volume of air displaced during exhalation, or measures airflow during exhalation by a flow sensing device. An example of such an instrument is a spirometer. ALS disease progression is also evaluated by assessing the extent and progression of whole body muscle weakness. Muscle strength measurements, include, but are not limited to, hand held dynamometry, maximum voluntary isometric contraction (MVIC) strain gauge measurements, and manual muscle testing. Muscle strength tests routinely use an instrument that measures how much force (for example, pounds of force) an individual can apply to the instrument using a selected group of muscles, such as the hand muscles. Such an instrument includes a dynamometer.
Antisense Compounds
In the context of the present invention, the term “oligomeric compound(s)” refers to polymeric structures which are capable of hybridizing to at least a region of an RNA molecule. Generally, an oligomeric compound is “antisense” to a target nucleic acid when it comprises the reverse complement of the corresponding region of the target nucleic acid. Such oligomeric compounds are known as “antisense compounds”, which include, without limitation, oligonucleotides (i.e. antisense oligonucleotides), oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics and combinations of these. In general, an antisense compound comprises a backbone of linked monomeric subunits (sugar moieties) where each linked monomeric subunit is directly or indirectly attached to a heterocyclic base moiety. Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or heterocyclic base moieties, such as those described below. As used herein, the term “modification” includes substitution and/or any change from a starting or natural nucleoside or nucleotide. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity. Antisense compounds are often defined in the art to comprise the further limitation of, once hybridized to a target, being able to induce or trigger a reduction in target gene expression or target gene levels. In one embodiment, the antisense compounds, e.g. antisense oligonucleotides, trigger a reduction in the levels of a nucleic acid encoding SOD1.
“Targeting” an antisense oligonucleotide to a nucleic acid encoding SOD1 includes the determination of at least one target segment within a nucleic acid encoding SOD1 for hybridization to occur such that the desired effect, e.g., inhibition of SOD1 mRNA expression, will result. As used herein, the terms “SOD1 target nucleic acid” and “nucleic acid encoding SOD1” encompass RNA (including pre-mRNA and mRNA) transcribed from DNA encoding SOD1, and also cDNA derived from such RNA. The inhibition of gene expression that results from the hybridization of an antisense oligonucleotide with a target nucleic acid is generally referred to as “antisense inhibition”. The functions of RNA to be interfered with include, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. The overall effect of such interference with target nucleic acid function is modulation of the SOD1 protein. In the context of the present invention, “modulation” means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene. In the context of the present invention, inhibition is the preferred form of modulation of gene expression and SOD1 mRNA (e.g. SEQ ID NO: 1) is a preferred target.
As used herein, a “target segment” means a sequence of an SOD1 target nucleic acid to which one or more antisense oligonucleotides are complementary. Multiple antisense oligonucleotides complementary to a given target segment may or may not have overlapping sequences. Within the context of the present invention, the term “target site” is defined as a sequence of an SOD1 nucleic acid to which one antisense oligonucleotide is complementary. For example, the nucleobase sequence of ISIS 333611 is complementary to nucleobases 83 to 102 of SEQ ID NO: 1, thus these nucleobases represent a target site of an SOD1 nucleic acid. Several antisense oligonucleotides of the invention have target sites within nucleobases 66 to 102 of SEQ ID NO: 1, thus these nucleobases represent a target segment of an SOD1 nucleic acid. In some embodiments, a target segment and target site are represented by the same nucleobase sequence.
In the practice of the methods of the present invention, particularly preferred SOD1 target segments include, without limitation, nucleobases 66 to 102 of SEQ ID NO: 1; nucleobases 73 to 102 of SEQ ID NO: 1; and nucleobases 79 to 102 of SEQ ID NO: 1. Particularly preferred target sites include nucleobases 81 to 100 of SEQ ID NO: 1, to which ISIS 146145 is complementary; and nucleobases 83 to 102 of SEQ ID NO: 1, to which ISIS 333611 is complementary.
The antisense oligonucleotides in accordance with this invention comprise from 15 to 30 nucleosides in length, i.e., from 15 to 30 linked nucleosides. One of skill in the art will appreciate that this embodies antisense oligonucleotides of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides in length.
In one embodiment, the antisense oligonucleotides of the invention are 17 to 25 nucleosides in length, as exemplified herein.
In preferred embodiments, the antisense oligonucleotides of the invention are 19, 20, 21, 22 or 23 nucleosides in length.
“Base complementarity” as used herein, refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization). In the context of the present invention, the mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between corresponding nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Hybridization can occur under varying circumstances.
As used herein, an antisense oligonucleotide is “fully complementary” to a target nucleic acid when each nucleobase of the antisense oligonucleotide is capable of undergoing precise base pairing with an equal number of nucleobases in the target nucleic acid. It is understood in the art that the sequence of the antisense oligonucleotide need not be fully complementary to that of its target nucleic acid to be active in inhibiting the activity of the target nucleic acid. In some embodiments there are “non-complementary” positions, also known as “mismatches”, between the antisense oligonucleotide and the target nucleic acid, and such non-complementary positions may be tolerated between an antisense oligonucleotide and the target nucleic acid provided that the antisense oligonucleotide remains specifically hybridizable to the target nucleic acid. For example, ISIS 333611, having two non-complementary nucleobases with respect to monkey SOD1, is capable of reducing monkey SOD1 mRNA levels in cultured cells. A “non-complementary nucleobase” means a nucleobase of an antisense oligonucleotide that is unable to undergo precise base pairing with a nucleobase at a corresponding position in a target nucleic acid. As used herein, the terms “non-complementary” and “mismatch” are interchangeable. In the context of the present invention, antisense oligonucleotides having no more than three non-complementary nucleobases with respect to a nucleic acid encoding SOD1 are considered “complementary” to a nucleic acid encoding SOD1. In preferred embodiments, the antisense oligonucleotide contains no more than two non-complementary nucleobases with respect to a nucleic acid encoding SOD1. In further preferred embodiments, the antisense oligonucleotide contains no more than one non-complementary nucleobases with respect to a nucleic acid encoding SOD1.
The location of a non-complementary nucleobase may be at the 5′ end or 3′ end of the antisense oligonucleotide. Alternatively, the non-complementary nucleobase may be at an internal position in the antisense oligonucleotide. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous.
In other embodiments of the invention, the antisense oligonucleotides comprise at least 90% sequence complementarity to an SOD1 target nucleic acid. In further embodiments of the invention, the antisense oligonucleotides comprise at least 95% sequence complementarity to an SOD1 target nucleic acid. Percent complementarity of an antisense oligonucleotide with a region of a target nucleic acid can be determined routinely by those having ordinary skill in the art, and may be accomplished using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
Antisense oligonucleotides may have a defined percent identity to a SEQ ID NO, or an antisense oligonucleotide having a specific ISIS number. This identity may be over the entire length of the antisense oligonucleotide, or over less than the entire length of the antisense oligonucleotide. Calculating percent identity is well within the ability of those skilled in the art. It is understood by those skilled in the art that an antisense oligonucleotide need not have an identical sequence to those described herein to function similarly to the antisense oligonucleotides described herein. For example, antisense oligonucleotides having at least 90%, or at least 95%, identity to antisense oligonucleotides taught herein are contemplated in the present invention.
Shortened or truncated versions of antisense oligonucleotides taught herein have one, two or more nucleosides deleted, and are contemplated in the present invention. When an antisense oligonucleotide has two or more deleted nucleosides, the deleted nucleosides may be adjacent to each other, for example, in an antisense oligonucleotide having two nucleosides truncated from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation), of the antisense oligonucleotide. Alternatively, the deleted nucleosides may be dispersed through out the antisense, for example, in an antisense oligonucleotide having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.
Also falling within the scope of the invention are lengthened versions of antisense oligonucleotides taught herein, i.e. antisense oligonucleotides having one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein. When two are more additional nucleosides are present, the added nucleosides may be adjacent to each other, for example, in an antisense oligonucleotide having two nucleosides added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the antisense oligonucleotide. Alternatively, the added nucleosides may be dispersed throughout the antisense oligonucleotide, for example, in an antisense oligonucleotide having one nucleoside added to the 5′ end and one nucleoside added to the 3′ end.
Antisense oligonucleotides of the invention may be also be described as complementary to a portion of a target site. A “portion” is defined as at least 18 contiguous nucleobases of a target site. In other embodiments, a portion is 19 or 20 contiguous nucleobases of a target site. By way of example, antisense oligonucleotides may be complementary, or alternatively fully complementary, to a 19 nucleobase portion of SEQ ID NO: 1.
The antisense compounds of the invention are synthesized in vitro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis of antisense molecules.
Antisense Compound Modifications
Any of the antisense compounds taught herein, including antisense oligonucleotides taught herein, may contain modifications which confer desirable properties to the antisense compound including, but are not limited to, increased affinity of an antisense oligonucleotide for its target RNA and increased resistance to nucleases.
As is known in the art, a nucleoside is a base-sugar combination. The base (also known as nucleobase) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. The respective ends of this linear polymeric structure can be joined to form a circular structure by hybridization or by formation of a covalent bond. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide. The normal internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
In the context of this invention, the term “oligonucleotide” refers generally to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), and may be used to refer to unmodified oligonucleotides or oligonucleotide analogs. The term “unmodified oligonucleotide” refers generally to oligonucleotides composed of naturally occurring nucleobases, sugars, and covalent internucleoside linkages. The term “oligonucleotide analog” refers to oligonucleotides that have one or more non-naturally occurring nucleobases, sugars, and/or internucleoside linkages. Such non-naturally occurring oligonucleotides are often selected over naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, increased stability in the presence of nucleases, or increased inhibitory activity.
Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense compound for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
Modified Internucleoside Linkages
Specific examples of antisense compounds useful in this invention include oligonucleotides containing one or more modified, i.e. non-naturally occurring, internucleoside linkages. Such non-naturally internucleoside linkages are often selected over naturally occurring forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets and increased stability in the presence of nucleases.
As defined in this specification, oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. For the purposes of this specification, and as sometimes referenced in the art, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be “oligonucleosides”. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known to those skilled in the art.
Modified Sugar Moieties
Antisense compounds of the invention may also contain one or more nucleosides having modified sugar moieties. The base moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target. Sugar modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the antisense compounds. The furanosyl sugar ring of a nucleoside can be modified in a number of ways including, but not limited to, addition of a substituent group, particularly at the 2′ position, bridging of two non-geminal ring atoms to form a bicyclic nucleic acid (BNA) and substitution of an atom or group such as —S—, —N(R)— or —C(R1)(R2) for the ring oxygen at the 4′-position. A representative list of preferred modified sugars includes but is not limited to: substituted sugars, especially 2′-substituted sugars having a 2′-F, 2′-OCH2(2′-OMe) or a 2′-O(CH2)2—OCH3(2′-O-methoxyethyl or 2′-MOE) substituent group; and bicyclic modified sugars (BNAs), having a 4′-(CH2)n—O-2′ bridge, where n=1 or n=2. Sugars can also be replaced with sugar mimetic groups. Methods for the preparations of modified sugars are well known to those skilled in the art.
Modified Nucleobases
Antisense compounds of the invention may also contain one or more nucleobase (often referred to in the art simply as “base”) modifications or substitutions which are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Such nucleobase modifications may impart nuclease stability, binding affinity or some other beneficial biological property to the antisense compounds. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases also referred to herein as heterocyclic base moieties include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl(—C≡C—CH3)uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
Heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of the antisense compounds of the invention include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.
Certain nucleobase substitutions, including 5-methylcytosinse substitutions, are particularly useful for increasing the binding affinity of the oligonucleotides of the invention. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with T-O-methoxyethyl sugar modifications.
Oligonucleotide Mimetics
Antisense compounds can also include an “oligonucleotide mimetic,” which refers to oligonucleotides in which only the furanose ring or both the furanose ring and the internucleoside linkage are replaced with novel groups.
As used herein the term “mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target. Representative examples of a sugar mimetic include, but are not limited to, cyclohexenyl or morpholino. Representative examples of a mimetic for a sugar-internucleoside linkage combination include, but are not limited to, peptide nucleic acids (PNA) and morpholino groups linked by uncharged achiral linkages. In some instances a mimetic is used in place of the nucleobase. Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc. Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods of synthesis of sugar, nucleoside and nucleobase mimetics are well known to those skilled in the art.
Conjugated Antisense Compounds
One substitution that can be appended to the antisense compounds of the invention involves the linkage of one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense compounds. In one embodiment such modified antisense compounds are prepared by covalently attaching conjugate groups to functional groups such as hydroxyl or amino groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of the antisense compounds. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
Antisense compounds used in the compositions of the present invention can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. By “cap structure” or “terminal cap moiety” is meant chemical modifications, which have been incorporated at either terminus of an antisense compound (see for example Wincott et al., WO 97/26270). These terminal modifications protect the antisense compounds having terminal nucleic acid molecules from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. For double-stranded antisense compounds, the cap may be present at either or both termini of either strand. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.
Antisense Compound Motifs
Antisense compounds of this invention may have the chemically modified subunits arranged in patterns enhance the inhibitory activity of the antisense compounds. These patterns are described herein as “motifs.”
As used in the present invention the term “gapped motif” or “gapmer” is meant to include an antisense compound having an internal region (also referred to as a “gap” or “gap segment”) positioned between two external regions (also referred to as “wing” or “wing segment”). The regions are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides may include 2′-MOE, and 2′-O—CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include LNA™ or ENA™, among others). In general, each distinct region comprises uniform sugar moieties.
Gapped motifs or gapmers are further defined as being either “symmetric” or “asymmetric”. A gapmer wherein the nucleosides of the first wing have the same sugar modifications as the nucleosides of the second wing is termed a symmetric gapped antisense compound. Symmetric gapmers can have, for example, an internal region comprising a first sugar moiety, and external regions each comprising a second sugar moiety, wherein at least one sugar moiety is a modified sugar moiety.
“Chimeric antisense compounds” or “chimeras,” in the context of this invention, are antisense compounds that at least 2 chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide or nucleoside in the case of a nucleic acid based antisense compound. Accordingly, antisense compounds having a gapmer motif considered chimeric antisense compounds.
Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. By way of example, an antisense compound may be designed to comprise a region that serves as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex. In the case of gapmer, the internal region generally serves as the substrate for endonuclease cleavage.
Compositions and Methods for Formulating Pharmaceutical Compositions
The antisense compounds of the invention may also be admixed with pharmaceutically acceptable substances, active and/or inert, that are well known to those skilled in the art.
The present invention also includes pharmaceutical compositions and formulations that include the antisense compounds and compositions of the invention. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Such considerations are well understood by those skilled in the art.
The antisense compounds and compositions of the invention can be utilized in pharmaceutical compositions by adding an effective amount of the compound or composition to a suitable pharmaceutically acceptable diluent or carrier. In the context of the present invention, a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered to the CNS.
The antisense compounds and compositions of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the antisense compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
The term “prodrug” indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions. This can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.
The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the antisense compounds and compositions of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Suitable examples include, but are not limited to, sodium and potassium salts.
Cell Culture and Antisense Oligonucleotide Treatment
The effects of antisense oligonucleotides on the level, activity or expression of SOD1 target nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, A549 cells, fibroblasts, and neuronal cells.
In Vitro Testing of Antisense Oligonucleotides
In general, when cells reach approximately 60-80% confluency, they are treated with antisense oligonucleotides of the invention.
One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.
Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense compound.
Cells are treated with antisense oligonucleotides by routine methods well known to those skilled in the art. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM.
In Vivo Testing of Antisense Oligonucleotides
Antisense oligonucleotides are tested in animals to assess their ability to inhibit expression of a target nucleic acid and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous, and further includes intrathecal and intracerebroventricular routes of administration. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from various tissues and changes in target nucleic acid expression are measured. Changes in proteins encoded by target nucleic acids may also be measured. The types of phenotypic changes selected for monitoring are dependent upon the cellular pathway and disease with which the target nucleic acid is associated.
RNA Isolation
RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.
Analysis of Inhibition of Target Levels or Expression
Inhibition of levels or expression of an SOD1 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
Quantitative Real-Time PCR Analysis of Target RNA Levels
Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.
Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as GAPDH, or by quantifying total RNA using RIBOGREEN® (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.
Probes and primers are designed to hybridize to an SOD1 target nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, Calif.). Primers and probes useful for detection of human and rat SOD1 mRNA are described in U.S. application Ser. No. 10/672,866, published as US 2005/0019915, which is herein incorporated by reference in its entirety.
Analysis of Protein Levels
Protein levels of SOD1 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. Antibodies useful for the detection of human and rat SOD1 are well known in the art.
Example 1 Inhibition of SOD1 mRNA in Rat Brain Following Intracerebroventricular Administration
In order to inhibit the gene expression in the central nervous system, antisense oligonucleotides must be delivered directly to the cerebrospinal fluid by, for example, intracerebroventricular (ICV) administration. To evaluate antisense inhibition of SOD1 in the brains of normal rats, SOD1 mRNA levels were measured in rat brain following ICV administration. SOD1 mRNA levels were measured in both rat spinal cord and rat brain following ICV administration of ISIS 146192, an antisense oligonucleotide targeted to SOD1. Administration was performed daily at either 33 μg/day or 50 μg/day for 14 days. ICV administration of ISIS 146192 significantly reduced SOD1 mRNA levels in the spinal cord and right temporal parietal section of the brain. Thus, antisense oligonucleotides that are delivered to the cerebrospinal fluid via ICV administration are able to inhibit the expression of SOD1 in central nervous system tissues that are affected in ALS. Accordingly, an embodiment of the present invention is the delivery of antisense oligonucleotides to the cerebrospinal fluid by way of ICV administration.
Example 2 Antisense Inhibition of SOD1 in Human Fibroblasts
The A4V mutation of SOD1 accounts for 50% of SOD1-mediated familial ALS in the United States. Antisense oligonucleotides targeting SOD1 were tested for their ability to inhibit SOD1 expression in fibroblasts isolated from an individual harboring the A4V mutation. ISIS 333611, ISIS 333624 (complementary to nucleotides 440 to 459 of SEQ ID NO: 1), and ISIS 333636 (complementary to nucleobases 452 to 471 of SEQ ID NO: 1) inhibited SOD1 expression in a dose dependent manner when tested at doses of 3, 10, 30, 100, or 300 nM. SOD2 mRNA levels were not affected.
Example 3 Slowed Disease Progression in a Rat Model of Familial ALS
Several lines of transgenic mice and rats have been generated and extensively studied as experimental models of familial ALS. For example, transgenic mice have been engineered to express the human G85R SOD1 variant. Transgenic rats expressing the human SOD1 G93A variant develop symptoms similar to ALS and do not survive beyond three to five months after birth. As such, these transgenic rats are useful for the testing of antisense oligonucleotides targeted to SOD1. The presence of the human G93A SOD1 variant causes human SOD1 mRNA to accumulate to levels approximately 5 to 10 times that of endogenous wild-type rat SOD1.
Antisense oligonucleotide was infused into the right lateral ventricle of 65 day old rats expressing the human G93A SOD1 variant at a dose of 100 φg/day for 28 days, using Alzet minipumps. Following the treatment period, RNA was isolated from different regions of the brain, and SOD1 mRNA levels were measured by real-time PCR. Despite the high level of human SOD1 mRNA, ISIS 146145, ISIS 333611, ISIS 333624, and ISIS 333636 were effective at reducing human SOD1 mRNA in different regions of the brain. For example, ISIS 333611 effectively reduced human SOD1 mRNA levels in the right cortex, cervical spinal cord, thoracic spinal cord, and lumbar spinal cord by approximately 69%, 45%, 50%, and 42%, respectively. Human SOD1 protein levels were reduced following treatment with ISIS 333611 by approximately 40% and 35%, respectively, in the right cortex and cervical spinal cord. Reduction of SOD1 protein was greater at one month than at two weeks, reflecting the known long half-life of SOD1 protein.
An additional study was performed to test the effects of antisense inhibition of SOD1 on ALS disease onset in rats expressing the human G93A SOD1 variant. Animals were treated by ICV infusion of 100 ug/day of ISIS 333611 (n=12) for a period of 28 days. Saline-treated (n=11) animals and control oligonucleotide-treated (n=8) animals served as controls. The timing of disease onset, at approximately 95 days of age, was similar in each group. While antisense inhibition of SOD1 did not slow early disease onset, infusion of ISIS 333611 slowed disease progression, extending survival from 122±8 days to 132±7 days. Infusion of the control oligonucleotide had no effect on disease progression.
An embodiment of the present invention is a method of the slowing of disease progression in an individual suffering from familial ALS by delivering to the cerebrospinal fluid an antisense oligonucleotide targeted to SOD1. In other embodiments, the method further comprises extending the survival of an individual suffering from familial ALS. In preferred embodiments, the antisense oligonucleotide is ISIS 333611.
Example 4 Distribution of Antisense Oligonucleotides in Primate Tissues
To assess the distribution of antisense oligonucleotides following delivery to the cerebrospinal fluid, ISIS 13920 (an antisense oligonucleotide having a gapped motif) was infused intracerebroventricularly or intrathecally into non-human primates at a dose of 1 mg/day for 14 days. A monoclonal antibody that recognizes oligonucleotides allowed for the immunohistochemical detection of antisense oligonucleotide. Following ICV infusion, ISIS 13920 distributed broadly throughout the central nervous system, with the highest concentrations found in the cortex and the lowest concentrations found in the hypothalamus. Following IT infusion, antisense oligonucleotides was broadly distributed throughout the central nervous system, with the highest concentrations of oligonucleotides found in the tissue adjacent to the site of infusion, the lumbar cord.
Accordingly, an embodiment of the present invention is the delivery of antisense oligonucleotide targeted to SOD1 to the central nervous system, as well as the cerebrospinal fluid, through intracerebroventricular or intrathecal infusion.
Example 5 Administration of ISIS 333611 to Individuals Suffering from Familial ALS
The present invention provides methods of slowing disease progression in an individual suffering from familial ALS. Such methods comprise the administration to the cerebrospinal fluid of the individual a pharmaceutical composition comprising ISIS 333611. Delivery of the pharmaceutical composition to the cerebrospinal fluid allows for contact of the antisense oligonucleotide with the cells of central nervous system tissues, including tissues affected by ALS.
Individuals suffering from familial ALS receive a diagnosis of familial ALS from a physician. The physician's assessment includes the El Escorial criteria, genetic testing to verify the presence of a mutation in the SOD1 gene, and a neurological examination.
A Medtronic SyncroMed® II pump is used to deliver a pharmaceutical composition comprising ISIS 333611 to the cerebrospinal fluid of an individual suffering from familial ALS. The pump is surgically implanted per the procedures outlined by the manufacturer. Drug is retained in the reservoir of the pump, and is pumped at a programmed dose into a catheter that is surgically intrathecally implanted.
The reservoir is loaded with a pharmaceutical composition comprising ISIS 333611 in phosphate-buffered saline. The pharmaceutical composition is administered at an amount that yields an infusion of 8 mg to 12 mg of ISIS 333611 into the cerebrospinal fluid. In preferred embodiments, the amount of ISIS 333611 infused is 10 mg. Administration is for a period of at least 28 days.
Disease progression is measured by methods routine in the art and described herein, for example, using the ALSFSR-R, and measurements of FEV1, FVC, and muscle strength. These methods are used by a physician to assess disease state at initiation of treatment, and this assessment serves as a baseline for disease state. Subsequent assessments are performed at regular intervals during the pharmaceutical composition delivery period; these intervals are determined by the physician. Administration of a pharmaceutical composition comprising ISIS 333611 to the CSF of individuals suffering from familial ALS slows the progression of ALS. In one embodiment, the ALSFSR-R score is not reduced relative to the baseline ALSFSR-R score. In another embodiment, FEV1 is not reduced relative to baseline values. In an additional embodiment, FVC is not reduced relative to baseline values. In a further embodiment, muscle strength, such as hand grip strength, is not reduced relative to baseline values.

Claims (20)

What is claimed is:
1. A method of treating amyotrophic lateral sclerosis (ALS) comprising administering to the cerebrospinal fluid of a subject in need thereof a therapeutically or prophylactically effective amount of a composition comprising:
a modified oligonucleotide consisting of 12 to 30 linked nucleosides targeted to SOD-1, wherein the modified oligonucleotide is specifically hybridizable to the 3′ untranslated region (3′UTR) of SOD-1, and
a pharmaceutically acceptable diluent or carrier.
2. The method of claim 1, wherein administering is intrathecal administration.
3. The method of claim 1, wherein administering is intraventricular administration.
4. The method of claim 1, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
5. The method of claim 1, wherein at least one nucleoside comprises a modified sugar.
6. The method of claim 5, wherein the modified sugar is a 2′-O-methoxyethyl.
7. The method of claim 1, wherein at least one nucleoside comprises a modified nucleobase.
8. The method of claim 7, wherein the modified nucleobase is a 5-methylcytosine.
9. The method of claim 1, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is position between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
10. The method of claim 9, wherein the modified oligonucleotide comprises:
a gap segment consisting of ten linked deoxynucleosides;
a 5′ wing segment consisting of five linked nucleosides;
a 3′ wing segment consisting of five linked nucleosides;
wherein the gap segment is position between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar;
wherein each cytosine is a 5′methylcytosine, and wherein each internucleoside linkage is a phosphorothioate linkage.
11. A method of treating amyotrophic lateral sclerosis (ALS) comprising administering to the cerebrospinal fluid of a subject in need thereof a therapeutically or prophylactically effective amount of a composition comprising:
a modified oligonucleotide consisting of 12 to 30 linked nucleosides targeted to SOD-1, wherein the modified oligonucleotide is 100% complementary to a region of the 3′ untranslated region (3′UTR) of SOD-1, and
a pharmaceutically acceptable diluent or carrier.
12. The method of claim 11, wherein administering is intrathecal administration.
13. The method of claim 11, wherein administering is intraventricular administration.
14. The method of claim 11, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.
15. The method of claim 11, wherein at least one nucleoside comprises a modified sugar.
16. The method of claim 15, wherein the modified sugar is a 2′-O-methoxyethyl.
17. The method of claim 11, wherein at least one nucleoside comprises a modified nucleobase.
18. The method of claim 17, wherein the modified nucleobase is a 5-methylcytosine.
19. The method of claim 11, wherein the modified oligonucleotide comprises:
a gap segment consisting of linked deoxynucleosides;
a 5′ wing segment consisting of linked nucleosides;
a 3′ wing segment consisting of linked nucleosides;
wherein the gap segment is position between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
20. The method of claim 19, wherein the modified oligonucleotide comprises:
a gap segment consisting of ten linked deoxynucleosides;
a 5′ wing segment consisting of five linked nucleosides;
a 3′ wing segment consisting of five linked nucleosides;
wherein the gap segment is position between the 5′ wing segment and the 3′ wing segment, wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar;
wherein each cytosine is a 5′methylcytosine, and wherein each internucleoside linkage is a phosphorothioate linkage.
US13/406,256 2001-06-21 2012-02-27 Methods for slowing familial ALS disease progression Expired - Fee Related US8921331B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/406,256 US8921331B2 (en) 2001-06-21 2012-02-27 Methods for slowing familial ALS disease progression

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
US88836001A 2001-06-21 2001-06-21
US10/633,843 US7132530B2 (en) 2001-06-21 2003-08-04 Antisense modulation of superoxide dismutase 1, soluble expression
US10/672,866 US20050019915A1 (en) 2001-06-21 2003-09-26 Antisense modulation of superoxide dismutase 1, soluble expression
US71993605P 2005-09-21 2005-09-21
US11/449,446 US7902163B2 (en) 2001-06-21 2006-06-07 Antisense modulation of superoxide dismutase 1, soluble expression
US11/526,134 US7622455B2 (en) 2001-06-21 2006-09-21 Methods for slowing familial ALS disease progression
US12/566,549 US20100081705A1 (en) 2001-06-21 2009-09-24 Methods for slowing familial als disease progression
US13/406,256 US8921331B2 (en) 2001-06-21 2012-02-27 Methods for slowing familial ALS disease progression

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US12/566,549 Continuation US20100081705A1 (en) 2001-06-21 2009-09-24 Methods for slowing familial als disease progression

Publications (2)

Publication Number Publication Date
US20120214865A1 US20120214865A1 (en) 2012-08-23
US8921331B2 true US8921331B2 (en) 2014-12-30

Family

ID=34520475

Family Applications (4)

Application Number Title Priority Date Filing Date
US10/672,866 Abandoned US20050019915A1 (en) 2001-06-21 2003-09-26 Antisense modulation of superoxide dismutase 1, soluble expression
US11/526,134 Expired - Lifetime US7622455B2 (en) 2001-06-21 2006-09-21 Methods for slowing familial ALS disease progression
US12/566,549 Abandoned US20100081705A1 (en) 2001-06-21 2009-09-24 Methods for slowing familial als disease progression
US13/406,256 Expired - Fee Related US8921331B2 (en) 2001-06-21 2012-02-27 Methods for slowing familial ALS disease progression

Family Applications Before (3)

Application Number Title Priority Date Filing Date
US10/672,866 Abandoned US20050019915A1 (en) 2001-06-21 2003-09-26 Antisense modulation of superoxide dismutase 1, soluble expression
US11/526,134 Expired - Lifetime US7622455B2 (en) 2001-06-21 2006-09-21 Methods for slowing familial ALS disease progression
US12/566,549 Abandoned US20100081705A1 (en) 2001-06-21 2009-09-24 Methods for slowing familial als disease progression

Country Status (2)

Country Link
US (4) US20050019915A1 (en)
WO (1) WO2005040180A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016138353A1 (en) * 2015-02-26 2016-09-01 Ionis Pharmaceuticals, Inc. Allele specific modulators of p23h rhodopsin
US10385341B2 (en) 2014-04-01 2019-08-20 Biogen Ma Inc. Compositions for modulating SOD-1 expression

Families Citing this family (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
EP2221376B1 (en) * 2001-06-21 2012-11-21 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
US7840270B2 (en) 2003-07-23 2010-11-23 Synapse Biomedical, Inc. System and method for conditioning a diaphragm of a patient
AU2005276117C1 (en) 2004-08-23 2013-04-18 Yeda Research And Development Co. Ltd. At The Weizmann Institute Of Science Peptide inhibitors for mediating stress responses
US20060205704A1 (en) * 2005-03-04 2006-09-14 Alsgen, Llc Modulation of neurodegenerative diseases through the progesterone receptor
EP1924294A4 (en) * 2005-05-24 2010-11-03 Isis Pharmaceuticals Inc COMPOSITIONS AND USES FOR MODULATING EXPRESSION OF PTPRU
US9050005B2 (en) 2005-08-25 2015-06-09 Synapse Biomedical, Inc. Method and apparatus for transgastric neurostimulation
EP1996284A2 (en) * 2006-03-09 2008-12-03 Synapse Biomedical, Inc. Ventilatory assist system and method to improve respiratory function
JP2009536222A (en) 2006-05-05 2009-10-08 アイシス ファーマシューティカルズ, インコーポレーテッド Compounds and methods for modulating the expression of PCSK9
EP2505648A1 (en) * 2006-05-05 2012-10-03 Isis Pharmaceuticals, Inc. Compounds and methods for modulating expression of PTP1B
US20080097153A1 (en) * 2006-08-24 2008-04-24 Ignagni Anthony R Method and apparatus for grasping an abdominal wall
US9079016B2 (en) * 2007-02-05 2015-07-14 Synapse Biomedical, Inc. Removable intramuscular electrode
WO2008144578A1 (en) * 2007-05-17 2008-11-27 Synapse Biomedical, Inc. Devices and methods for assessing motor point electromyogram as a biomarker
US8428726B2 (en) 2007-10-30 2013-04-23 Synapse Biomedical, Inc. Device and method of neuromodulation to effect a functionally restorative adaption of the neuromuscular system
US8478412B2 (en) * 2007-10-30 2013-07-02 Synapse Biomedical, Inc. Method of improving sleep disordered breathing
CA2715289C (en) 2008-02-11 2019-12-24 Rxi Pharmaceuticals Corporation Modified rnai polynucleotides and uses thereof
EP2342340A1 (en) 2008-09-22 2011-07-13 Rxi Pharmaceuticals Corporation Rna interference in skin indications
CN102282155B (en) 2008-12-02 2017-06-09 日本波涛生命科学公司 The synthetic method of the nucleic acid of phosphorus atoms modification
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
ES2762610T3 (en) 2009-02-12 2020-05-25 Curna Inc Treatment of diseases related to brain-derived neurotrophic factor (BDNF) by inhibition of natural antisense transcript for BDNF
CN102439149B (en) 2009-02-12 2018-01-02 库尔纳公司 By suppressing to treat the related diseases of GDNF for the natural antisense transcript of the glial derived neurotrophic factor (GDNF)
WO2010102058A2 (en) 2009-03-04 2010-09-10 Curna, Inc. Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirt 1
CN102482677B (en) 2009-03-16 2017-10-17 库尔纳公司 Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2)-associated diseases by inhibiting the natural antisense transcript of NRF2
WO2010107740A2 (en) 2009-03-17 2010-09-23 Curna, Inc. Treatment of delta-like 1 homolog (dlk1) related diseases by inhibition of natural antisense transcript to dlk1
ES2609655T3 (en) 2009-05-06 2017-04-21 Curna, Inc. Treatment of diseases related to tristetraproline (TTP) by inhibition of natural antisense transcript for TTP
CN103223177B (en) 2009-05-06 2016-08-10 库尔纳公司 By suppression therapy lipid transfer and the metabolic gene relevant disease of the natural antisense transcript for lipid transfer and metabolic gene
DK2432881T3 (en) 2009-05-18 2018-02-26 Curna Inc TREATMENT OF REPROGRAMMING FACTOR-RELATED DISEASES BY INHIBITING NATURAL ANTISENSE TRANSCRIPTS TO A REPROGRAMMING FACTOR
CA2762987A1 (en) 2009-05-22 2010-11-25 Joseph Collard Treatment of transcription factor e3 (tfe3) and insulin receptor substrate 2 (irs2) related diseases by inhibition of natural antisense transcript to tfe3
KR101704988B1 (en) 2009-05-28 2017-02-08 큐알엔에이, 인크. Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US8951981B2 (en) 2009-06-16 2015-02-10 Curna, Inc. Treatment of paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
WO2010148050A2 (en) 2009-06-16 2010-12-23 Curna, Inc. Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
WO2010151671A2 (en) 2009-06-24 2010-12-29 Curna, Inc. Treatment of tumor necrosis factor receptor 2 (tnfr2) related diseases by inhibition of natural antisense transcript to tnfr2
EP2446037B1 (en) 2009-06-26 2016-04-20 CuRNA, Inc. Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
RU2612521C2 (en) 2009-07-06 2017-03-09 Онтории, Инк. Novel prodrugs of nucleic acids and their application methods
CN102762731B (en) 2009-08-05 2018-06-22 库尔纳公司 By inhibiting to treat insulin gene (INS) relevant disease for the natural antisense transcript of insulin gene (INS)
CA2771172C (en) 2009-08-25 2021-11-30 Opko Curna, Llc Treatment of 'iq motif containing gtpase activating protein' (iqgap) related diseases by inhibition of natural antisense transcript to iqgap
JP6025567B2 (en) 2009-12-16 2016-11-16 カッパーアールエヌエー,インコーポレイテッド Treatment of MBTPS1-related diseases by inhibition of the natural antisense transcript against the membrane-bound transcription factor peptidase, site 1 (MBTPS1)
RU2619185C2 (en) 2009-12-23 2017-05-12 Курна, Инк. Treatment of diseases associated with uncoupling proteins 2 (ucp2), by inhibiting of natural antisense transcript to ucp2
CN102869776B (en) 2009-12-23 2017-06-23 库尔纳公司 HGF relevant diseases are treated by suppressing the natural antisense transcript of HGF (HGF)
EP2519633B1 (en) 2009-12-29 2017-10-25 CuRNA, Inc. Treatment of nuclear respiratory factor 1 (nrf1) related diseases by inhibition of natural antisense transcript to nrf1
ES2585829T3 (en) 2009-12-29 2016-10-10 Curna, Inc. Treatment of diseases related to tumor protein 63 (p63) by inhibition of natural antisense transcription to p63
CA2785832A1 (en) 2010-01-04 2011-07-07 Curna, Inc. Treatment of interferon regulatory factor 8 (irf8) related diseases by inhibition of natural antisense transcript to irf8
KR101853509B1 (en) 2010-01-06 2018-04-30 큐알엔에이, 인크. Treatment of Pancreatic Developmental Gene Related Diseases By Inhibition of Natural Antisense Transcript to A Pancreatic Developmental Gene
JP6027893B2 (en) 2010-01-11 2016-11-16 カッパーアールエヌエー,インコーポレイテッド Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcripts against sex hormone binding globulin (SHBG)
EP2529015B1 (en) 2010-01-25 2017-11-15 CuRNA, Inc. Treatment of rnase h1 related diseases by inhibition of natural antisense transcript to rnase h1
CN102844435B (en) 2010-02-22 2017-05-10 库尔纳公司 Treatment of PYCR1-associated diseases by inhibiting the natural antisense transcript of pyrroline-5-carboxylate reductase 1 (PYCR1)
RU2615143C2 (en) 2010-03-24 2017-04-04 Адвирна Self-delivered rnai compounds of reduced size
WO2011127337A2 (en) 2010-04-09 2011-10-13 Opko Curna Llc Treatment of fibroblast growth factor 21 (fgf21) related diseases by inhibition of natural antisense transcript to fgf21
WO2011139387A1 (en) 2010-05-03 2011-11-10 Opko Curna, Llc Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
TWI531370B (en) 2010-05-14 2016-05-01 可娜公司 Treatment of PAR4-related diseases by inhibiting PAR4 natural anti-strand transcript
ES2664585T3 (en) 2010-05-26 2018-04-20 Curna, Inc. Treatment of diseases related to methionine sulfoxide reductase (MSRA) by inhibiting the natural antisense transcript to MSRA
US8895528B2 (en) 2010-05-26 2014-11-25 Curna, Inc. Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
JP5998131B2 (en) 2010-07-14 2016-09-28 カッパーアールエヌエー,インコーポレイテッド DISCSLARGEHOMOLOG (DLG) Treatment of DLG-related diseases by inhibition of natural antisense transcripts on DLG1
JP5868324B2 (en) 2010-09-24 2016-02-24 株式会社Wave Life Sciences Japan Asymmetric auxiliary group
CN103210086B (en) 2010-10-06 2017-06-09 库尔纳公司 Treatment of NEU4-associated diseases by inhibiting the natural antisense transcript of sialidase 4 (NEU4)
KR101865433B1 (en) 2010-10-22 2018-07-13 큐알엔에이, 인크. Treatment of alpha-l-iduronidase (idua) related diseases by inhibition of natural antisense transcript to idua
KR101913232B1 (en) 2010-10-27 2018-10-30 큐알엔에이, 인크. Treatment of interferon-related developmental regulator 1(ifrd1) related diseases by inhibition of natural antisense transcript to ifrd1
WO2012071238A2 (en) 2010-11-23 2012-05-31 Opko Curna Llc Treatment of nanog related diseases by inhibition of natural antisense transcript to nanog
CA2836503C (en) 2011-05-23 2020-09-22 Yeda Research And Development Co. Ltd. Use of akt phosphorylation as a biomarker for prognosing neurodegenerative diseases and treating same
KR102043422B1 (en) 2011-06-09 2019-11-11 큐알엔에이, 인크. Treatment of frataxin (fxn) related diseases by inhibition of natural antisense transcript to fxn
CN103796657B (en) 2011-07-19 2017-07-11 波涛生命科学有限公司 Methods of Synthesizing Functionalized Nucleic Acids
HK1210211A1 (en) 2012-03-15 2016-04-15 科纳公司 Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
EP2831232A4 (en) * 2012-03-30 2015-11-04 Univ Washington METHODS OF MODULATING THE EXPRESSION OF TAU TO REDUCE THE STROKE AND MODIFY A NEURODEGENERATIVE SYMPTOM
PL2872485T3 (en) 2012-07-13 2021-05-31 Wave Life Sciences Ltd. Asymmetric auxiliary group
US9539307B2 (en) 2012-09-17 2017-01-10 The Research Institute At Nationwide Children's Hospital Compositions and methods for treating amyotrophic lateral sclerosis
ES2762326T5 (en) * 2012-10-15 2023-04-27 Ionis Pharmaceuticals Inc Methods to modulate the expression of C9ORF72
CN104968783B (en) 2012-10-15 2019-12-10 Ionis制药公司 Compositions for modulating expression of C9ORF72
EP2906697A4 (en) * 2012-10-15 2016-06-22 Ionis Pharmaceuticals Inc METHODS OF MONITORING C9ORF72 EXPRESSION
US10260089B2 (en) 2012-10-29 2019-04-16 The Research Foundation Of The State University Of New York Compositions and methods for recognition of RNA using triple helical peptide nucleic acids
CN105264091B (en) 2013-03-14 2020-02-28 Ionis制药公司 Compositions and methods for modulating TAU expression
TW202246503A (en) 2013-07-19 2022-12-01 美商百健Ma公司 Compositions for modulating tau expression
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US9725719B2 (en) 2013-11-05 2017-08-08 The Research Institute At Nationwide Children's Hospital Compositions and methods for inhibiting NF-κB and SOD-1 to treat amyotrophic lateral sclerosis
BR112016016400A2 (en) 2014-01-16 2017-10-03 Wave Life Sciences Ltd COMPOSITIONS OF CHIRALLY CONTROLLED OLIGONUCLEOTIDES, THEIR USE, THEIR PHARMACEUTICAL COMPOSITION, AND METHODS
CA2942515C (en) 2014-03-18 2025-12-09 University Of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
WO2015171918A2 (en) 2014-05-07 2015-11-12 Louisiana State University And Agricultural And Mechanical College Compositions and uses for treatment thereof
RS60230B1 (en) 2015-04-16 2020-06-30 Ionis Pharmaceuticals Inc Compositions for modulating c9orf72 expression
EP3862005A1 (en) 2015-07-06 2021-08-11 Phio Pharmaceuticals Corp. Nucleic acid molecules targeting superoxide dismutase 1 (sod1)
US10808247B2 (en) 2015-07-06 2020-10-20 Phio Pharmaceuticals Corp. Methods for treating neurological disorders using a synergistic small molecule and nucleic acids therapeutic approach
WO2017079291A1 (en) 2015-11-02 2017-05-11 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating c90rf72
HUE065170T2 (en) 2016-09-29 2024-05-28 Biogen Ma Inc Compounds and methods for reducing tau expression
US11859179B2 (en) 2017-05-09 2024-01-02 University Of Massachusetts Methods of treating amyotrophic lateral sclerosis (ALS)
CN111448321A (en) 2017-09-22 2020-07-24 马萨诸塞大学 SOD1 dual expression vector and its use
KR20200109311A (en) 2018-01-16 2020-09-22 다이서나 파마수이티컬, 인크. Composition and method for inhibiting ALDH2 expression
US12429487B2 (en) 2018-12-06 2025-09-30 Biogen Ma Inc. Neurofilament protein for guiding therapeutic intervention in amyotrophic lateral sclerosis
US11471683B2 (en) 2019-01-29 2022-10-18 Synapse Biomedical, Inc. Systems and methods for treating sleep apnea using neuromodulation
BR112021019793A2 (en) * 2019-04-04 2021-12-07 Dicerna Pharmaceuticals Inc Compositions and methods for inhibiting gene expression in the central nervous system
WO2020222182A1 (en) * 2019-05-01 2020-11-05 Black Swan Pharmaceuticals, Inc. Treatment for sod1 associated disease
EP4093409A4 (en) * 2020-01-23 2024-01-10 University of Southern California ANTAGONISM AS THERAPY FOR TDP-43 PROTEINOPATHIES
JP2024516168A (en) 2021-04-22 2024-04-12 デイナ ファーバー キャンサー インスティチュート,インコーポレイテッド Compositions and methods for treating cancer

Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005181A1 (en) 1988-11-07 1990-05-17 Cl-Pharma Aktiengesellschaft PURIFICATION OF Cu/Zn SUPEROXIDEDISMUTASE________________________
WO1994019493A1 (en) 1993-02-26 1994-09-01 The General Hospital Corporation Compounds and methods for the diagnosis, treatment and prevention of diseases of cell death
US5536638A (en) 1990-04-18 1996-07-16 N.V. Innogenetics S.A. Hybridization probes derived from the spacer region between the 16S and 23S rRNA genes for the detection of Neisseria gonorrhoeae
WO1997026270A2 (en) 1996-01-16 1997-07-24 Ribozyme Pharmaceuticals, Inc. Synthesis of methoxy nucleosides and enzymatic nucleic acid molecules
WO1997031012A1 (en) 1996-02-22 1997-08-28 The Regents Of The University Of Michigan Gene specific universal mammalian sequence-tagged sites
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5994076A (en) 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
US6077833A (en) 1996-12-31 2000-06-20 Isis Pharmaceuticals, Inc. Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US6194150B1 (en) 1995-07-07 2001-02-27 Ribozyme Pharmaceuticals, Inc. Nucleic acid based inhibition of CD40
US6303374B1 (en) 2000-01-18 2001-10-16 Isis Pharmaceuticals Inc. Antisense modulation of caspase 3 expression
US20010053519A1 (en) 1990-12-06 2001-12-20 Fodor Stephen P.A. Oligonucleotides
WO2002003979A2 (en) 2000-07-12 2002-01-17 Board Of Regents, The University Of Texas System Combination of 2-methoxyestradiol and an agent that increases intracellular superoxide anion
US6352829B1 (en) 1997-05-21 2002-03-05 Clontech Laboratories, Inc. Methods of assaying differential expression
WO2002044321A2 (en) 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
US20020156040A1 (en) 2000-11-14 2002-10-24 Oberley Larry Wayne Reduction of antioxidant enzyme levels in tumor cells using antisense oligonucleotides
WO2003000707A2 (en) 2001-06-21 2003-01-03 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US6784290B1 (en) 1992-10-05 2004-08-31 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of ras
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
US20060229268A1 (en) 2004-12-16 2006-10-12 Alsgen, Llc Small interference RNA (siRNA) molecules for modulating superoxide dismutase (SOD)
US20070031844A1 (en) 2002-11-14 2007-02-08 Anastasia Khvorova Functional and hyperfunctional siRNA

Patent Citations (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1990005181A1 (en) 1988-11-07 1990-05-17 Cl-Pharma Aktiengesellschaft PURIFICATION OF Cu/Zn SUPEROXIDEDISMUTASE________________________
US5536638A (en) 1990-04-18 1996-07-16 N.V. Innogenetics S.A. Hybridization probes derived from the spacer region between the 16S and 23S rRNA genes for the detection of Neisseria gonorrhoeae
US20010053519A1 (en) 1990-12-06 2001-12-20 Fodor Stephen P.A. Oligonucleotides
US6582908B2 (en) 1990-12-06 2003-06-24 Affymetrix, Inc. Oligonucleotides
US6784290B1 (en) 1992-10-05 2004-08-31 Isis Pharmaceuticals, Inc. Antisense oligonucleotide inhibition of ras
WO1994019493A1 (en) 1993-02-26 1994-09-01 The General Hospital Corporation Compounds and methods for the diagnosis, treatment and prevention of diseases of cell death
US5843641A (en) 1993-02-26 1998-12-01 Massachusetts Institute Of Technology Methods for the daignosis, of familial amyotrophic lateral sclerosis
US5849290A (en) 1993-02-26 1998-12-15 The General Hospital Corporation Compounds and methods for the diagnosis, treatment and prevention of diseases of cell death
US5801154A (en) 1993-10-18 1998-09-01 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of multidrug resistance-associated protein
US6194150B1 (en) 1995-07-07 2001-02-27 Ribozyme Pharmaceuticals, Inc. Nucleic acid based inhibition of CD40
WO1997026270A2 (en) 1996-01-16 1997-07-24 Ribozyme Pharmaceuticals, Inc. Synthesis of methoxy nucleosides and enzymatic nucleic acid molecules
WO1997031012A1 (en) 1996-02-22 1997-08-28 The Regents Of The University Of Michigan Gene specific universal mammalian sequence-tagged sites
US6077833A (en) 1996-12-31 2000-06-20 Isis Pharmaceuticals, Inc. Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US6352829B1 (en) 1997-05-21 2002-03-05 Clontech Laboratories, Inc. Methods of assaying differential expression
US5994076A (en) 1997-05-21 1999-11-30 Clontech Laboratories, Inc. Methods of assaying differential expression
US20030228597A1 (en) 1998-04-13 2003-12-11 Cowsert Lex M. Identification of genetic targets for modulation by oligonucleotides and generation of oligonucleotides for gene modulation
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
US6303374B1 (en) 2000-01-18 2001-10-16 Isis Pharmaceuticals Inc. Antisense modulation of caspase 3 expression
WO2002003979A2 (en) 2000-07-12 2002-01-17 Board Of Regents, The University Of Texas System Combination of 2-methoxyestradiol and an agent that increases intracellular superoxide anion
US20020156040A1 (en) 2000-11-14 2002-10-24 Oberley Larry Wayne Reduction of antioxidant enzyme levels in tumor cells using antisense oligonucleotides
WO2002044321A2 (en) 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
WO2003000707A2 (en) 2001-06-21 2003-01-03 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
US7622455B2 (en) 2001-06-21 2009-11-24 Isis Pharmaceuticals, Inc. Methods for slowing familial ALS disease progression
US20040091919A1 (en) 2001-06-21 2004-05-13 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
US20120029049A1 (en) 2001-06-21 2012-02-02 Isis Corporation Antisense Modulation of Superoxide Dismutase 1, Soluble Expression
US20050019915A1 (en) 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
US7902163B2 (en) 2001-06-21 2011-03-08 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
US7678895B2 (en) 2001-06-21 2010-03-16 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
WO2003000707A3 (en) 2001-06-21 2003-04-17 Isis Pharmaceuticals Inc Antisense modulation of superoxide dismutase 1, soluble expression
US7132530B2 (en) 2001-06-21 2006-11-07 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
US20060293269A1 (en) 2001-06-21 2006-12-28 Bennett C F Antisense modulation of superoxide dismutase 1, soluble expression
US20070117772A1 (en) 2001-06-21 2007-05-24 Bennett C F Methods for slowing familial ALS disease progression
US20070054869A1 (en) 2001-06-21 2007-03-08 Bennett C F Antisense modulation of superoxide dismutase 1, soluble expression
WO2003004602A2 (en) 2001-07-03 2003-01-16 Isis Pharmaceuticals, Inc. Nuclease resistant chimeric oligonucleotides
US20070031844A1 (en) 2002-11-14 2007-02-08 Anastasia Khvorova Functional and hyperfunctional siRNA
WO2005040180A3 (en) 2003-09-26 2005-10-20 Isis Pharmaceuticals Inc Antisense modulation of superoxide dismutase 1, soluble (sod-1) expression
WO2005040180A2 (en) 2003-09-26 2005-05-06 Isis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble (sod-1) expression
US20060229268A1 (en) 2004-12-16 2006-10-12 Alsgen, Llc Small interference RNA (siRNA) molecules for modulating superoxide dismutase (SOD)

Non-Patent Citations (70)

* Cited by examiner, † Cited by third party
Title
Agrawal, S., et al., "Antisense therapeutics: is it as simple as complementary base recognition?," Mol. Medicine Today (2000) 6:72-81.
Al-Chalabi, A. et al., "Recent advances in amyotrophic lateral sclerosis," Curr Opin Neurol. (2000) 13(4):397-405.
Alisky, J.M. et al., "Gene therapy for amyotrophic lateral sclerosis and other motor neuron diseases," Hum Gene Ther. (2000) 11(17):2315-29.
Amorfix Life Sciences Ltd. "Amorfix Life Sciences Discovers Common Link Between ALS and Alzheimer's Disease" Press Reldase, Nov. 27, 2007.
Berger, I., et al., "Crystal structures of B-DNA with incorporated 2′-deoxy-2′-fluoro-arabino-furanosyl thymines: implications of conformational preorganization for duplex stability," Nucleic Acids Res. (1998) 26(10):2473-80.
Berger, I., et al., "Crystal structures of B-DNA with incorporated 2'-deoxy-2'-fluoro-arabino-furanosyl thymines: implications of conformational preorganization for duplex stability," Nucleic Acids Res. (1998) 26(10):2473-80.
Berger, M. et al., "Universal bases for hybridization, replication and chain termination," Nucleic Acids Research (2000) 28(15): 2911-2914.
Braasch et al., "Novel Antisense and Peptide Nucleic Acid Strategies for Controlling Gene Expression" Biochemistry (2002) 41(14):4503-4510.
Branch, A. D., "A good antisense molecule is hard to find," TIBS (1998) 23:45-50.
Brooks, B.R. et al., "El Escorial revisited: Revisited criteria for the diagnosis of amyotrophic lateral sclerosis," ALS and Other Motor Neuron Disorders (2000) 1:293-299.
Bruijn, L. I., et al., "Aggregation and motor neuron toxicity of an ALS-linked SOD1 mutant independent from wild-type SOD1," Science (1998) 281(5384):1851-4.
Chin, Andrew "On the Preparation and Utilization of Isolated and Purified Oligonucleotides" Document purportedly located on a CD-ROM and contributed to the public collection of the Katherine R. Everett Law Library of the University of North Carolina on Mar. 14, 2002.
Cleveland, D. W., et al., "Oxidation versus aggregation-how do SOD1 mutants cause ALS?" Nat Med. (2000) 6(12):1320-1.
Crooke, S.T., "Basic Principles of Antisense Therapeutics," (1998), Chapter 1, Springer-Verlag, New York.
Dean et al., "Antisense Oligonucleotide-based Therapeutics for Cancer," Oncogene (2003) 22:9087-9096.
Final Rejection for U.S. Appl. No. 09/888,360 dated Feb. 11, 2003.
Final Rejection for U.S. Appl. No. 10/672,866 dated Mar. 7, 2006.
Final Rejection for U.S. Appl. No. 11/449,446 dated Feb. 23, 2009.
Final Rejection for U.S. Appl. No. 11/449,446 dated Jan. 4, 2008.
Final Rejection for U.S. Appl. No. 11/526,134 dated Dec. 10, 2008.
Final Rejection for U.S. Appl. No. 12/566,549 dated Oct. 27, 2010.
Final Rejection for U.S. Appl. No. 12/987,929 dated May 25, 2012.
Final Rejecton for U.S. Appl. No. 10/633,843 dated Apr. 5, 2006.
Fridovich, I., "Superoxide radical and superoxide dismutases," Annu. Rev. Biochem. (1995) 64:97-112.
Green, D. W., et al, "Antisense Oligonucleotides: An Evolving Technology for the Modulation of Gene Expression in Human Disease," J Am Coll Surg. (2000) 191(1):93-105.
Grzanna, R., et al, "Intrastriatal and intraventricular injections of oligodeoxynucleotides in the rat brain: tissue penetration, intracellular distribution and c-fos antisense effects," Mol Brain Res. (1998) 63(1):35-52.
Gulesserian, T., et al., "Superoxide Dimutase SOD 1, Encoded on Chromosome 21, but Not SOD2 Is Overexpressed in Brains of Patients With Down Syndrome," J. Investig Med. (2001) 49(1):41-6.
Hammond, S.M. et al., "Post-Transcriptional Gene Silencing by Double-Stranded RNA," Nature (2001) 2:110-119.
Hottinger, A. F., "The copper chelator d-penicillamine delays onset of disease and extends survival in a transgenic mouse model of familial amyotrophic lateral sclerosis," Eur J Neurosci. (1997) 9(7):1548-51.
Huang, P. et al., "Superoxide dismutase as a target for the selective killing of cancer cells," Nature. (2000) 407(6802):390-5.
Jen, K.Y., et al., "Suppression of Gene Expression by Targeted Disruption of Messenger RNA: Available Options and Current Strategies," Stem Cells (2000) 18:307-19.
Kagiyama et al., "Antisense inhibition of angiotensinogen attenuates vasopressin release in the paraventricular hypothalamic nucleus of spontaneously hypertensive rats" Brain Research (1999) 829:120-124.
Kawata, A., et al., "Aberrant splicing of human Cu/Zn superoxide dimutase (SOD1) RNA transcripts," Neuroreport. (2000) 11(12):2649-53.
Klivenyi, P., et al., "Neuroprotective effects of creatine in a transgenic animal model of amyotrophic lateral sclerosis," Nat Med. (1999) 5(3):347-50.
Klug et al. European Journal of Physiology. (2001) 441(6): R205. Abstract No. P20-7.
Lee, W. G., et al., "Molecular Cloning and High-Level Expression of Human Cytoplasmic Superoxide Dismutase Gene in Escherichia coli," Kor. Jour. Microbiol. (1990) 28(2): 91-7.
Milner, N., et al., "Selecting effective antisense reagents on combinatorial oligonucleotide arrays," Nature Biotechnology (1997) 15:537-41.
Misra, A., et al, "Drug delivery to the central nervous system: a review," J Pharm Pharmaceut Sci (2003) 6(2):252-273.
Muramatsu, H., et al., "Superoxide Dismutase in SAS Human Tongue Carcinoma Cell Line Is a Factor Defining Invasiveness and Cell Motility," Cancer Research (1995) 55:6210-4.
New England Biolabs 1998/99 Catalog (cover page and pp. 121 and 284).
Notice of Allowance for U.S. Appl. No. 10/633,843 dated Jul. 3, 2006.
Notice of Allowance for U.S. Appl. No. 11/449,207 dated Aug. 6, 2009.
Notice of Allowance for U.S. Appl. No. 11/449,446 dated Dec. 4, 2009.
Notice of Allowance for U.S. Appl. No. 11/449,446 dated Oct. 6, 2010.
Office Action for U.S. App. No. 10/633,843 dated Nov. 15, 2005.
Office Action for U.S. Appl. No. 11/449,207 dated Feb. 12, 2007.
Office Action for U.S. Appl. No. 11/449,446 dated Aug. 11, 2009.
Office Action for U.S. Appl. No. 11/449,446 dated Jul. 20, 2007.
Office Action for U.S. Appl. No. 11/449,446 dated Jun. 6, 2008.
Office Action for U.S. Appl. No. 11/449,446 dated Mar. 23, 2010.
Office Action for U.S. Appl. No. 11/526,134 dated Apr. 4, 2008.
Office Action for U.S. Appl. No. 12/566,549 dated Feb. 17, 2010.
Office Action for U.S. Appl. No. 12/987,929 dated Dec. 28, 2011.
Office Action for U.S. Appl. No. 12/987,929 dated Oct. 9, 2012.
Office Action from U.S. Appl. No. 09/888,360 dated May 21, 2002.
Office Action from U.S. Appl. No. 10/672,866 dated May 3, 2005.
Partial European Search Report for Application EP 02742241 dated Nov. 8, 2004.
PCT International Search Report for PCT/US2002/19664 dated Jan. 14, 2003.
PCT International Search Report for PCT/US2004/031673 dated Aug. 22, 2005.
Reynolds et al., "Rational siRNA design for RNA interference" Nature Biotechnology (2004) 22:326-330.
Rothstein, J. D., et al, "Chronic inhibition of superoxide dismutase produces apoptotic death of spinal Neurons" Proc Natl Acad Sci U S A. (1994) 91(10):4155-9.
Rowland, L. P., "Six important themes in amyotrophic lateral sclerosis (ALS) research, 1999," J. Neurol. Sci. (2000) 180:2-6.
Sanghvi, Y.S., "Heterocyclic Base Modifications in Nucleic Acids and Their Applications in Antisense Oligonucleotides, " Antisense Research and Applications (1993) CRC Press, Boca Raton, pp. 276-278.
Scanlon, "Anti-Genes: siRNA, Ribozymes and Antisense" Current Pharmaceutical Biotechnology (2004) 5:415-420.
Sinnayah et al., "Effects of angiotensinogen antisense oligonucleotides on fluid intake in response to different dipsogenic stimuli in the rat" Molecular Brain Research (1997) 50:43-50.
Skerra, A., "Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity," Nucleic Acids Research (1992) 20(14):3551-4.
Smith et al., "Antisense oligonucleotide therapy for neurodegenerative disease" Journal of Clinical Investigation (2006) 116(8):2290-2296.
Trotti, D., et al., "SOD1 mutants linked to amyotrophic lateral sclerosis selectively inactivate a glial glutamate transporter," Nat Neurosci. (1999) 2(5):427-33.
Troy, C. M., et al., "Down-regulation of copper/zinc superoxide dismutase causes apoptotic death in PC12 neuronal cells," Proc Natl Acad Sci U S A. (1994) 91(14):6384-7.
Troy, C. M., et al., "Down-regulation of Cu/Zn superoxide dismutase leads to cell death via the nitric oxide-peroxynitrite pathway," J Neurosci. (1996) 16(1):253-61.

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10385341B2 (en) 2014-04-01 2019-08-20 Biogen Ma Inc. Compositions for modulating SOD-1 expression
US10669546B2 (en) 2014-04-01 2020-06-02 Biogen Ma Inc. Compositions for modulating SOD-1 expression
US10968453B2 (en) 2014-04-01 2021-04-06 Biogen Ma Inc. Compositions for modulating SOD-1 expression
WO2016138353A1 (en) * 2015-02-26 2016-09-01 Ionis Pharmaceuticals, Inc. Allele specific modulators of p23h rhodopsin
US10426789B2 (en) 2015-02-26 2019-10-01 Ionis Pharmaceuticals, Inc. Allele specific modulators of P23H rhodopsin
US11013758B2 (en) 2015-02-26 2021-05-25 Ionis Pharmaceuticals, Inc. Allele specific modulators of P23H rhodopsin
US11744846B2 (en) 2015-02-26 2023-09-05 Ionis Pharmaceuticals, Inc. Allele specific modulators of P23H rhodopsin

Also Published As

Publication number Publication date
WO2005040180A2 (en) 2005-05-06
US20050019915A1 (en) 2005-01-27
WO2005040180A3 (en) 2005-10-20
US20070117772A1 (en) 2007-05-24
US7622455B2 (en) 2009-11-24
US20100081705A1 (en) 2010-04-01
US20120214865A1 (en) 2012-08-23

Similar Documents

Publication Publication Date Title
US8921331B2 (en) Methods for slowing familial ALS disease progression
US11761000B2 (en) Compositions and their uses directed to huntingtin
AU2022200002A1 (en) Compositions for modulating sod-1 expression
US20110237646A1 (en) Modulation of transthyretin expression for the treatment of cns related disorders
EP2455471A2 (en) Methods for treating hypercholesterolemia
RU2858547C2 (en) Compositions for modulating sod-1 expression
KR20140014365A (en) Modulation of inflammatory responses by factor xi

Legal Events

Date Code Title Description
AS Assignment

Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:DOBIE, KENNETH W.;REEL/FRAME:028144/0910

Effective date: 20120430

STCF Information on status: patent grant

Free format text: PATENTED CASE

AS Assignment

Owner name: IONIS PHARMACEUTICALS, INC., CALIFORNIA

Free format text: CHANGE OF NAME;ASSIGNOR:ISIS PHARMACEUTICALS, INC.;REEL/FRAME:042822/0152

Effective date: 20151218

MAFP Maintenance fee payment

Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551)

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20221230