US8921110B1 - Red iris - Google Patents
Red iris Download PDFInfo
- Publication number
- US8921110B1 US8921110B1 US14/023,909 US201314023909A US8921110B1 US 8921110 B1 US8921110 B1 US 8921110B1 US 201314023909 A US201314023909 A US 201314023909A US 8921110 B1 US8921110 B1 US 8921110B1
- Authority
- US
- United States
- Prior art keywords
- red
- iris
- orange
- plant
- flowers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related, expires
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G5/00—Floral handling
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
Definitions
- the present invention relates to the field of transgenic plants. More particularly, the present invention relates to transgenic plants exhibiting modified flower color.
- Horticultural and ornamental markets are driven by innovation in color, shape and other esthetic parameters of the ornamental plants. New colors of roses and carnations, new shapes and colors of flowers find their way to the marketplace every year and the outdated varieties are replaced by new ones. Generation of new and esthetically pleasing varieties is known to be the key force driving the floriculture industry and allowing its growth.
- Iris is a winter hardy, herbaceous perennial consisting of approximately 300 species, many of which are popular ornamentals in the temperate regions of the Northern Hemisphere. While being amongst the most horticulturally important species, and having variety of flower colors including yellow, blue, and burgundy, there are currently no iris species with truly red flower color.
- Iris flowers have almost no red pigment naturally, and irises currently commercialized as “red” are actually shades of wine, brick, or reddish brown.
- Two types of pigments contained within iris plant cells e.g., oil-soluble xanthophylls and carotenoids that produce yellows, pinks, and oranges in flowers, and water-soluble anthocyanins that produce blues and purples, mix in the epidermal layer, resulting in a combination of pigments perceived by the eye as reddish.
- Iris germanica is one of the most popular iris species. Flower color in I. germanica is determined by two distinct biochemical pathways, the carotenoid pathway creates yellow, orange, and pink flowers, while the anthocyanin pathway produces blue and purple flowers. Similarly to the other members of the iris genus, there are no truly red I. germanica flowers. Conventional breeding methods have so far failed to generate them due to lack of genes capable of generating truly red pigment within the iris gene pool.
- U.S. Pat. No. 5,880,332 discloses the nucleotide sequence of the capsanthin-capsorubin synthase (ccs) gene from pepper ( C. annum ), which catalyzes the biosynthesis of the red carotenoids capsanthin and capsorubin, and does not suggest the newly discovered ccs sequence of lily ( L. lancifolium ) disclosed herein, there being less than 60% sequence homology between the genes. Notably, the lack of significant relationship between the lily and pepper ccs prevented identification of the lily gene using heterologous non-degenerate primers based on the pepper sequence (Jeknic et al. (2012) Plant & Cell Physiol.
- U.S. Pat. No. 5,880,332 does not disclose or suggest L. lancifolium ccs, transgenic iris plants containing a ccs gene, or red, or red/orange, irises.
- U.S. Pat. No. 6,459,017 discloses methods for transformation and regeneration of transgenic iris plants; however, this patent does not disclose or suggest capsanthin-capsorubin synthase for such transformation, and does not disclose the ccs sequence of lily ( L. lancifolium ), or red, or red/orange, irises.
- a truly red bearded iris like a truly blue rose, has remained an unattained goal for decades despite frequent hybridizing and selection.
- I. fulva beardless rhizomatous Copper iris
- introducing this color into a modern bearded iris breed has proven very difficult, and the vast majority of irises are in the purple and blue to blue violet color range, with yellow, pink, orange, and white breeds available.
- the present invention addresses the need in the art for iris plants with truly red, and red/orange, pigment in their flowers.
- the methods disclosed herein enable the production of new varieties of red and red/orange colored iris flowers, containing capsanthin and/or capsorubin, satisfying consumer desire for an increase in the assortment and variety of these commercially important ornamental plants.
- the present invention describes materials and methods for generating transgenic iris plants expressing red or red/orange pigment in their flowers, which have not existed prior to this invention, and will enable production of novel red and red/orange iris cultivars and varieties for the horticulture industry.
- the present invention describes the identification of a novel kcapsanthin-capsorubin synthase (ccs) gene from Lilium lancifolium (Llccs), suitable for the production of the red pigments capsanthin and capsorubin in plant flowers.
- ccs novel kcapsanthin-capsorubin synthase
- the present invention discloses expression of the Llccs gene in iris cells and generation of red pigment. While exemplified by the use of Llccs from a lily ( Lilium lancifolium ), the present invention is not limited to a liliaceous-derived Llccs, and is intended to encompass expression of all known, and to be discovered, enzymes with capsanthin-capsorubin synthase activity in iris, as well as the expression of Llccs in any other appropriate transgenic plants, in order to generate desired red or red/orange pigmentation.
- the invention describes the identification and functional characterization of the Llccs promoter, suitable for tissue-specific expression of Llccs and other transgenes in iris flowers.
- Other plant promoters including flower-specific promoters and constitutive promoters, such as the maize ubiquitin promoter, can be used to express Llccs in transgenic plants.
- the present invention includes:
- Non-genomic nucleotide sequences encoding Lilium lancifolium capsanthin-capsorubin synthase include, for example, mRNA, and synthetically produced Llccs DNA including, for example, codon-optimized Llccs sequences for efficient expression in different monocots and dicots, etc.
- any one of 11-13 encompasses application of the nucleotide sequences and methods disclosed herein to genera, species, cultivars, and varieties of ornamental plants that produce yellow or yellow/orange pigments, or yellow or yellow/orange flowers, but no red flowers, to produce novel red-, red/orange-, or orange/red-flowering plants.
- Plants normally producing the yellow pigments antheraxanthin and/or violaxanthin, or yellow or yellow/orange flowers are preferred for such modification using the presently disclosed, or similar, methods employing capsanthin-capsorubin synthase coding sequences.
- Such iris plant can be a cultivar or variety of Iris germanica or Iris hollandica .
- a flower, or flowers, of such iris plant can have one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color.
- red include all colors falling within the range of from about RHS Colour Chart (2001 Edition) chip 30A to about 56D.
- Preferred red colors fall within the range of from about RHS Colour Chart chip 36 to about 55; about 40 to about 47; about 42 to about 47; and about 42 to about 45.
- Preferred orange/red or red/orange colors fall within the range of from about N30 to about N34, preferably from about 32-34, and even more preferably N34.
- Each of the foregoing ranges includes the end point chips, as well as each of the individual color chips therein, including all the gradients from A through D. All these are contained in Table 1, below, listing RHS Colour Chart chips from 30A through 56D.
- the flower-specific promoter can comprise the nucleotide sequence shown in SEQ ID NO:2, a promoter of a phenylpropanoid or flavonoid biosynthetic gene in flowers such as the promoter of a phenylanlanine ammonia lyase (PAL) gene from bean (gPAL2) and the promoters of the chalcone synthase (CHS) and 4-coumarate-CoA-ligase (4-CL) genes; a flower-specific promoter of Brassica spp.; a promoter of a chalcone flavanone isomerase gene from Petunia hybrida ; a Petunia hybrida chalcone synthase (chs A) gene; a bean chalcone synthase gene promoter; the region between ⁇ 1800 bp and ⁇ 800 bp of petunia EPSPS; or an Arabidopsis APETALA3 (AP3) promoter.
- PAL phenylanlanine
- the constitutive promoter can comprise the maize ubiquitin promoter, the CaMV 19S promoter, the CaMV35S promoter, the FMV35S promoter, enhanced or duplicate versions of the CaMV35S and FMV35S promoters, the nopaline synthase promoter, the octopine synthase (OCS) promoter, or the rice Act1 promoter.
- Such iris plant can be a cultivar or variety of Iris germanica or Iris hollandica including, but not limited to, ‘Hot Property’, ‘Dance Man’, ‘Asian Treasure’, ‘Strike it Rich’, ‘Harvest of Memories’, ‘Early Girl’, ‘Kissed by the Sun’, ‘It's Magic’, ‘Acapulco Gold’, ‘City of Gold’, ‘Just a Kiss Away’, ‘King of Light’, ‘Dance Till Dawn’, or ‘Done Me Wrong’.
- the flower-specific promoter can comprise the nucleotide sequence shown in SEQ ID NO:2, a promoter of a phenylpropanoid or flavonoid biosynthetic gene in flowers such as the promoter of a phenylanlanine ammonia lyase (PAL) gene from bean (gPAL2) and the promoters of the chalcone synthase (CHS) and 4-coumarate-CoA-ligase (4-CL) genes; a flower-specific promoter of Brassica spp.; a promoter of a chalcone flavanone isomerase gene from Petunia hybrida ; a Petunia hybrida chalcone synthase (chsA) gene; a bean chalcone synthase gene promoter; the region between ⁇ 1800 bp and ⁇ 800 bp of petunia EPSPS; or an Arabidopsis APETALA3 (AP3) promoter.
- PAL phenylanlanine
- the constitutive promoter can comprise the maize ubiquitin promoter, the CaMV 19S promoter, the CaMV35S promoter, the FMV35S promoter, enhanced or duplicate versions of the CaMV35S and FMV35S promoters, the nopaline synthase promoter, the octopine synthase (OCS) promoter, or the rice Act1 promoter.
- the flower-specific promoter can comprise the nucleotide sequence shown in SEQ ID NO:2, a promoter of a phenylpropanoid or flavonoid biosynthetic gene in flowers such as the promoter of a phenylanlanine ammonia lyase (PAL) gene from bean (gPAL2) and the promoters of the chalcone synthase (CHS) and 4-coumarate-CoA-ligase (4-CL) genes; a flower-specific promoter of Brassica spp.; a promoter of a chalcone flavanone isomerase gene from Petunia hybrida ; a Petunia hybrida chalcone synthase (chsA) gene; a bean chalcone synthase gene promoter; the region between ⁇ 1800 bp and ⁇ 800 bp of petunia EPSPS; or an Arabidopsis APETALA3 (AP3) promoter.
- PAL phenylanlanine
- the constitutive promoter can comprise the maize ubiquitin promoter, the CaMV 19S promoter, the CaMV35S promoter, the FMV35S promoter, enhanced or duplicate versions of the CaMV35S and FMV35S promoters, the nopaline synthase promoter, the octopine synthase (OCS) promoter, or the rice Act1 promoter.
- Also encompassed by the present invention is the application of the methods of 25-29, and the use of the recombinant, double-stranded DNA molecules and expression constructs of 31-34 and 35, respectively, to modify the pigment composition of flowers of other genera, species, cultivars, and varieties of ornamental plants beyond irises in which red, red/orange, or orange/red flowers have been desired, but which are not currently available and/or have proven difficult to produce.
- the present invention encompasses application of the nucleotide sequences and methods disclosed herein to genera, species, cultivars, and varieties of ornamentals that produce yellow pigments, or yellow or yellow/orange flowers, but no red, red/orange, or orange/red flowers, to produce novel red-, red/orange-, or orange/red-flowering plants.
- Plants that normally produce yellow or yellow/orange flowers, especially those containing the yellow pigments antheraxanthin and/or violaxanthin are preferred for such modification using the presently disclosed, or similar, methods employing ccs-encoding nucleotide sequences.
- FIG. 1 Steps in biolistic transformation and regeneration of transgenic his plants.
- A Effect of increasing concentrations of osmoticum (equimolar concentration of mannitol and sorbitol) on transient expression of the GUS gene 48 hours after transformation.
- B Several cell clumps that proliferated on selection medium (MS-C containing 10 mg L-1 Basta) about 2 weeks later.
- C Stable transformation of callus lines #54 and #51 confirmed by GUS staining several weeks later.
- D Regenerated transgenic plants from callus #54 on MS-R medium.
- E Transgenic plant derived about 4 weeks after transfer to soil.
- F Staining of the leaf section for expression of the GUS gene.
- G Separation of a 250 bp fragment from the coding region of uidA (GUS) gene, amplified using PCR from genomic DNA of several independent transgenic plants, and separated by agarose electrophoresis. Key: 1 100 bp ladder, 2-7 transgenic plants, 8 positive control (plasmid), 9 negative control (non-transformed plant).
- FIG. 2 (A) Wild-type callus tissue of Iris germanica ‘Hot Property’ (left panel) and representative picture of same iris cells transformed and expressing Llccs gene from Lilium lancifolium (right panel); bars represent 1 mm. Color versions of these panels are presented in panels (b) and (c), respectively, of FIG. 5 of Jeknic et al. (2012) Plant & Cell Physiol . 53(11):1899-1912, where it is shown that wild-type callus of Iris germanica ‘Hot Property’ (left panel) is yellow, while representative picture of same iris cells transformed with and expressing Llccs gene from Lilium lancifolium (right panel) are red.
- the term “about” as used herein is a flexible word with a meaning similar to “approximately” or “nearly”. The term “about” indicates that exactitude is not claimed, but rather a contemplated variation. Thus, as used herein, the term “about” means within 1 or 2 standard deviations from the specifically recited value, or ⁇ a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 4%, 3%, 2%, or 1% compared to the specifically recited value.
- ranges are disclosed, the endpoints of all ranges directed to the same component or property are inclusive and independently combinable (e.g., ranges of “up to about 25 wt. %, or, more specifically, about 5 wt. % to about 20 wt. %,” is inclusive of the endpoints and all intermediate values of the ranges of “about 5 wt. % to about 25 wt. %,” etc.).
- Cultivars and varieties These terms encompass all cultivars, plants selected for desirable characteristics that can be maintained by propagation, and cultivars recognized as varieties, belonging to the iris genus.
- a typical flower comprises a pedicel, sepals, petals, stamens, and one or more pistils, which are composed of two or more hollow subunit structures called carpals fused together.
- a stamen comprises an anther, pollen, and filament.
- a carpel comprises a stigma, style and ovary.
- An ovary comprises an ovule, embryo sac, and egg cell.
- a “flower cell” is a cell from any one of these structures.
- flower-specific promoters include promoters that direct gene expression in any of the above tissues or cell types.
- Flower-specific promoters and flower-preferred promoters can be used interchangeably, and refer to promoters active in flowers, with promoter activity being significantly higher in flower tissue versus non-flower tissue. Such promoters preferentially initiate transcription in flower cells compared to cells in other parts of a plant. Preferably, the promoter activity in terms of expression levels of an operably linked sequence is more than two-, three-, four- or five-fold, or more than ten-fold, higher in flower cells and tissues than in non-flower cells and tissues. Thus, such promoters can be active in flowers, while being essentially inactive, or active at very low levels, in non-flower tissues and cells.
- flower-specific promoters include those of phenylpropanoid and flavonoid biosynthetic genes in flowers, such as the promoter of a phenylanlanine ammonia lyase (PAL) gene from bean (gPAL2) and the promoters of the chalcone synthase (CHS) and 4-coumarate-CoA-ligase (4-CL) genes (discussed in Sablowski et al. (1994) EMBO Journal 13(1):128-137; four flower-specific promoters of Brassica spp. (Geng et al.
- Constitutive promoters While flower-specific and flower-preferred promoters are useful for producing plants with flowers exhibiting red, red/orange, or orange/red coloration, constitutive promoters can also be employed in the methods of the present invention to achieve the same effect.
- the promoter typically provides for the constant and substantially uniform production of proteins in all tissues.
- the promoter can be a viral promoter such as a CaMV35S or FMV35S promoter.
- the CaMV35S and FMV35S promoters are active in a variety of transformed plant tissues and most plant organs (e.g., callus, leaf, seed, and root).
- Enhanced or duplicate versions of the CaMV35S and FMV35S promoters can be particularly useful in the practice of the present invention.
- constitutive promoters include the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of A. tumefaciens ), the cauliflower mosaic virus (CaMV) 19S promoter, the maize ubiquitin promoter, and the rice Act1 promoter.
- NOS nopaline synthase
- OCS octopine synthase
- constitutive promoters in the presently disclosed methods is that the required precursor pigments antheraxanthin and/or violaxanthin for capsanthin and capsorubin biosynthesis, respectively, are not present in significant amounts in plant tissues other than flowers. Thus, the activity of such promoters will not be evident in these other tissues. The same reasoning applies to flower-specific promoters with low specificity that also exhibit some level of activity in non-flower cells and tissues. Accordingly, both of these types of promoters will be useful in the present methods.
- Heterologous refers to a nucleic acid fragment or protein that is foreign to its surroundings. In the context of a nucleic acid fragment, this is typically accomplished by introducing such fragment, derived from one source, into a different host. Heterologous nucleic acid fragments, such as coding sequences that have been inserted into a host organism, are not normally found in the genetic complement of the host organism. As used herein, the term “heterologous” also refers to a nucleic acid fragment derived from the same organism, but which is located in a different, e.g., non-native, location within the genome of this organism.
- the organism can have more than the usual number of copy(ies) of such fragment located in its(their) normal position within the genome and in addition, in the case of plant cells, within different genomes within a cell, for example in the nuclear genome and within a plastid or mitochondrial genome as well.
- a nucleic acid fragment that is heterologous with respect to an organism into which it has been inserted or transferred is sometimes referred to as a “transgene.”
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter effects the transcription or expression of the coding sequence.
- Plant encompasses transformed plants, progeny of such transformed plants, and parts of plants, including reproductive units of a plant, fruit, flowers, seeds, etc.
- the transformation methods and compositions of the present invention are particularly useful for transformation of monocots, including ornamental monocots such as members of the family Iridaceae, especially species, varieties, and cultivars of the genus Iris .
- Other species of monocotyledonous and dicotyledonous plants can also be transformed using the disclosed methods.
- the nucleotide sequences disclosed herein may have to be codon-optimized for maximum activity using methods well known in the art.
- a recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
- Desirable shades of the red in I. germanica and the other iris species disclosed herein include, for example, those close to vermilion (a brilliant red); scarlet (a bright red color with a hue that is somewhat toward orange and which is redder than vermilion); crimson (a strong, bright, deep red color); carmine; and orange red.
- red and “orange/red” or “red/orange” include colors falling within the range of from about RHS color chart chip 30A to about 56D.
- Preferred red colors fall within the range of from about RHS color chart chip 36 to about 55; about 40 to about 47; about 42 to about 47; and about 42 to about 45.
- Preferred orange/red or red/orange colors fall within the range of from about N30 to about N34, preferably from about 32-34, and even more preferably N34.
- Each of the foregoing ranges (and individual color chips) includes the end points, as well as each of the individual color chips therein, including all the gradients from A through D, where present in the color chart.
- Voss ((1992) Hort. Science 27(12):1256-1260) describes an instrumental colorimetric method for converting RHS color chart colors into quantitative criteria based on the CIELAB system, which established a system of numerical coordinates to locate individual colors in a “color solid” based on uniform visual color spacing, standardizing colorimetric practice for the scientifically and industrially important problems of color discrimination and color spacing.
- the axes are designated as L*, a*, and b* (pronounced “L-star,” etc.).
- This method substitutes instrumental measurement for visual color evaluation, providing accurate color notation and avoiding possible pitfalls associated with visual evaluation, and correlates the measurements with the RHS Colour Chart widely used by botanists and horticulturalists.
- the present invention therefore also incorporates the CIELAB values corresponding to the RHS Colour Chart chips disclosed herein, obtained via the method described by Voss.
- Table 2 in Voss discloses CIE coordinates for a number of RHS color chips from the 1986 edition of the RHS Colour Chart.
- Transformed A cell, tissue, organ, or organism into which a foreign nucleic acid, such as a recombinant nucleic acid molecule (e.g., a recombinant vector), has been introduced is considered “transformed” or “transgenic,” as are progeny thereof in which the foreign nucleic acid is present.
- transformation encompasses all techniques by which a nucleic acid molecule (e.g., a recombinant nucleic acid molecule) can be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA, e.g., via particle gun bombardment and other methods, or Agrobacterium -mediated transformation.
- Irises are one of the most horticulturally important plant species. In Iris germanica , flower color is determined by two distinct biochemical pathways. The carotenoid pathway creates yellow, orange, and pink flowers, while the anthocyanin pathway produces blue and purple flowers. In nature, there are no truly red iris flowers, and conventional breeding methods have so far failed to generate them. Genetic engineering provides a means of introducing new traits by expanding the gene pool beyond what is available in the iris genome.
- Llccs capsanthin-capsorubin synthase
- these genes are known only through their sequence annotations, and none of these enzymes has been shown to have ccs-like activity, or to produce and/or result in accumulation of capsanthin and capsorubin. However, they are mentioned here as they may be useful in the present invention.
- the inventors identified a novel ccs gene from a lily species, Lilium lancifolium (SEQ ID NO:1), designated as Llccs.
- Llccs a novel ccs gene from a lily species, Lilium lancifolium (SEQ ID NO:1), designated as Llccs.
- initial attempts to identify the gene using heterologous non-degenerate primers based on the sequence of the homologous ccs gene from C. annuum failed.
- a different and novel approach to identity the L. lancifolium Llccs gene was utilized and demonstrated to be successful.
- the inventors have identified the promoter of the Llccs gene (SEQ ID NO:2), and have shown its utility for expression of transgenes in monocots and in flowers Importantly, other promoters active in plant cells (e.g., maize ubiquitin promoter, etc.) can be used to express Llccs in transgenic plants (e.g., iris), and the present invention encompasses all these alternatives.
- Promoters expressible in plant cells including constitutive promoters such as the maize ubiqutin promoter, and flower-specific promoters, are well known in the art.
- the inventors previously developed protocols for the transformation and regeneration of transgenic iris plants (U.S. Pat. No. 6,459,017), enabling introduction of novel transgenes and traits into irises.
- the inventors have utilized this technology to introduce the L. lancifolium Llccs gene into iris cells, and thus demonstrate production of red or red/orange pigment in iris tissues.
- Iris cells harboring the Llccs transgene changed color from their normal yellow into orange/red.
- Analysis of carotenoid extracts from the orange/red callus revealed that the new pigmentation was due to the accumulation of capsanthin and capsorubin, indicating that the Llccs gene was functioning correctly in transgenic iris (Jeknic et al. (2012) Plant & Cell Physiol. 53(11): 1899-1912).
- cultivars and varieties are preferred for use with this invention.
- cultivars and varieties producing yellow pigments e.g., antheraxanthin and violaxanthin, capable of being transformed to red or red/orange derivatives by the action of a capsanthin-capsorubin synthase, are suitable for generation of flowers exhibiting the red or red/orange pigments.
- Any yellow- or yellow/orange-flowering iris species, cultivar, or variety, particularly those containing antheraxanthin and/or violaxanthin, are suitable for transformation with the Llccs or any other ccs gene, cDNA, synthetic DNA (such as codon-optimized DNA), etc., encoding a protein exhibiting capsanthin-capsorubin synthase activity.
- Useful iris plants include, for example, yellow-flowering Iris germanica and Iris hollandica that produce antheraxanthin and/or violaxanthin in their flowers.
- Species, cultivars, and varieties that contain higher amounts of the precursor carotenoids antheraxanthin and/or violaxanthin in flower cells are more likely to produce deeper shades of red color.
- these carotenoid precursors in flower cells their ratio relative to one another; their ratios to other naturally occurring pigments within cells of flowers in a selected species, cultivar, or variety; the strength and tissue/cell specificity of the promoter used for ccs expression; the location of cells within various flower parts in which the heterologous capsanthin-capsorubin synthase enzyme is expressed; the level of enzymatic activity of expressed heterologous capsanthin-capsorubin synthase in flower cells of a particular species, cultivar, or variety; etc., one can expect to obtain transgenic plants whose flowers exhibit a range of colors within the red to red/orange or orange/red spectrum exemplified by the RHS Colour Chart chips listed in Table 1, and in different flower parts, such as standards, falls,
- rhizomatous irises especially Iris germanica and its numerous cultivars and varieties, especially those whose flower cells contain antheraxanthin and/or violaxanthin.
- Specific cultivars and varieties include, but are not limited to, ‘Hot Property’, ‘Dance Man’, ‘Asian Treasure’, ‘Strike it Rich’, ‘Harvest of Memories’, ‘Early Girl’, ‘Kissed by the Sun’, ‘It's Magic’, ‘Acapulco Gold’, ‘City of Gold’, ‘Just a Kiss Away’, ‘King of Light’, ‘Dance Till Dawn’, and ‘Done Me Wrong’.
- cultivars and varieties of Iris hollandica (“Dutch” iris, cut iris), especially those having yellow flowers, cells of which contain antherxanthin and/or violaxanthin.
- the present invention encompasses application of the nucleotide sequences and methods disclosed herein to genera, species, cultivars, and varieties of ornamental plants that produce yellow pigments, or yellow or yellow/orange flowers, but no red flowers, to produce novel red or red/orange-flowering plants.
- Plants normally producing the yellow pigments antheraxanthin and/or violaxanthin, or yellow or yellow/orange flowers, are preferred for such modification using the presently disclosed, or similar, methods employing ccs genes, codon-optimized coding sequences, cDNAs, etc.
- the present invention further encompasses variants of the nucleotide sequences described herein.
- Variants may occur naturally, such as a natural allelic variant.
- Other variants include those produced by nucleotide substitutions, deletions, or additions.
- the substitutions, deletions, or additions may involve one or more nucleotides.
- These variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, or amino acid deletions or additions.
- the variant is a silent substitution, addition, or deletion, which does not alter the properties and activities of the polypeptide encoded by the nucleotide sequence described herein. Conservative substitutions are also preferred.
- a variant of a sequence disclosed herein encompassed by the present invention comprises a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence disclosed herein.
- a variant nucleotide sequence that is at least 95% identical to a disclosed nucleotide sequence is identical to the latter sequence, except that the variant nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence described herein.
- Variant Llccs enzymes encompassed by the present invention preferably exhibit about ⁇ 25% of the enzymatic activity exhibited by the Llccs enzyme encoded by the nucleotide sequence disclosed herein (SEQ ID NO:1).
- sequence identity means the percentage of identical nucleotide or amino acid residues at corresponding positions in two or more sequences when the sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology , Lesk, A. M., ed., Oxford University Press, New York, 1988 ; Biocomputing: Informatics and Genome Projects , Smith, D. W., ed., Academic Press, New York, 1993 ; Computer Analysis of Sequence Data, Part I , Griffin, A. M., and Griffin, H.
- Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm of Smith & Waterman, by the homology alignment algorithms, by the search for similarity method or, by computerized implementations of these algorithms (GAP, BESTFIT, PASTA, and TFASTA in the GCG Wisconsin Package, available from Accelrys, Inc., San Diego, Calif., United States of America), or by visual inspection. See generally, (Altschul, S. F. et al., J. Mol. Biol. 215: 403-410 (1990) and Altschul et al. Nucl. Acids Res. 25: 3389-3402 (1997)).
- BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in (Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894; & Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990).
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.
- This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold.
- HSPs high scoring sequence pairs
- initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always; 0) and N (penalty score for mismatching residues; always; 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix.
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is in one embodiment less than about 0.1, in another embodiment less than about 0.01, and in still another embodiment less than about 0.001.
- variant sequences encompassed by the present invention include sequences that differ from those disclosed herein due to the well known degeneracy of the genetic code.
- nucleotide and amino acid sequences useful in the methods and plants of the present invention can comprise, consist essentially of, or consist of, any of the sequences disclosed herein.
- the strategy for cloning the Llccs gene from Lilium lancifolium was based on the fact that lycopene cyclase (LCY), neoxanthin synthase (NSY), and CCS have strong sequence homology and similar putative catalytic mechanisms.
- a pair of heterologous, non-degenerate primers forward (Cs-F, 5′-TGGAGTTTGGGTTGATGAGT-3′ (SEQ ID NO:3) and reverse (Cs-R, 5′-TGGGAATCTCTCCAATCCAT-3′ (SEQ ID NO:4), amplified a DNA fragment ( ⁇ 400 bp) that encoded a deduced amino acid sequence with strong similarity to that of LCYB.
- the full-length cDNA included an ORF of 1,425 bp (SEQ ID NO:1), a 5′ UTR of 94 bp and a 3′ UTR of 239 bp with a poly(A) tail downstream of the termination codon.
- the predicted protein was 474 amino acid residues long with a calculated molecular mass of 52.97 kDa and a theoretical pI of 8.4.
- FIG. 1 An example of his transformation using biolistic methods is shown in FIG. 1 .
- General methods of iris transformation have been previously disclosed in our U.S. Pat. No. 6,459,017.
- the Llccs-expressing transgenic calli changed color from their normal yellow to varying degrees of red to orange in different independent transgenic lines (an example of such a transgenic line is shown in FIG. 2A ).
- Llccs is a functional gene and is responsible for the development of novel red color.
- TargetP 1.1 software to look for the presence of a transit peptide (TP) sequence in Llccs in an effort to predict the subcellular location of the enzyme.
- TP transit peptide
- Llccs gene allows us also to clone its upstream regulatory region, namely its promoter region of 1,877 bp (SEQ ID NO:2).
- LPI-PCR long distance inverse-PCR
- L-Llccs-F 5′-GCAGCAAACCATGAACCTTTG-3′
- L-Llccs-R 5′-ATTAAGATATGTTTCGTGAT-3′
- SEQ ID NO:8 for amplification of the Llccs locus that encompassed the promoter region of 1,877 bp upstream of the site of initiation of transcription, the 5′ UTR of 94 bp, the Llccs ORF of 1,425 bp and the 3′ UTR of 425 bp with a poly(A) tail and a predicted poly(A) signal downstream of the termination codon (GenBank accession No. GU443955).
- RNA concentration and purity of RNA was determined by measuring the absorbance at 260 nm (A260) and 280 nm (A280) with Nanodrop 1000 (Thermo Fisher Scientific, Wilmington, Del.). The RNA samples were then treated with DNase I (Promega, Madison, Wis.) following the manufacturer's instructions, and cleaned using RNeasy Plant Mini Kit, following the RNA cleanup protocol. The final RNA concentration was determined as described above. For RT-PCR analysis, 1 ⁇ g of total RNA was used as a template for first-strand cDNA synthesis with Omniscript® Reverse Transcription kit (Qiagen Inc., Valencia, Calif.).).
- the primers used for RT-PCR analysis of crtB (E-crtB-F, 5′-TCTGATGATGGCCAGGGTGA-3′ (SEQ ID NO:9), and E-crtB-R, 5′-TAAACGGGACGCTGCCAAAG-3′ (SEQ ID NO:10), and the gene for 18S rRNA (E-185-F, 5′-TAGGTGAACCTGCGGAAGGATCATT-3′ (SEQ ID NO:11), and E-18S-R, 5′-CAACTTGCGTTCAAAGACTCGATG-3′ (SEQ ID NO:12).
- PCR amplification was carried out under the following conditions: initial denaturation at 95° C./3 min, followed by 33 cycles of three-step PCR (95° C./30 s, 60° C./30 s, 72° C./1 min) and a final extension at 72° C./7 min using GoTaq® Hot Start Polymerase (0.625 units) with Green GoTaq® Flexi Buffer.
- SEQ ID NO: 1 Lilium lancifolium capsanthin-capsorubin synthase (Llccs) nucleotide sequence ATGTCAACTCTTCAGTTGCCGGCGTTACTCACCGCCGGCGAACTCCGCCACCCTTCAAGGCG AACAAAGTGCAGTTCTCCGTAGCTTTCTAGATCTCACCCCAGTCTCCAAGCCCGAGCCTC TCACCATCGACATCCCATACCATGACCCCTCCTCCGCCCACCGCTACGATGCCGCCATCATC GGCTGCGGCCCCGCCGGCCTCCGCCTCGCCGAATGCGCCGCGGCCCGTGGGCTCCGCGTCTG CTGCATCGACCCCGCCCCTCTCCCTGGCCCAACAACTACGGCGCCTGGCTCGACGAGC TCCACCCCCTCGGCCTCGCCTCCATCTTCGACCACATCTGGCCCACCGCCACGATCGCCATC GACGGCGACAACATCAAGCACCTCTCACGCCCCTACGGCCGCGTCAACCGCAGTTCTCTCAA AACT
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
-
- 1. An iris cell transformed with, and which expresses, a heterologous nucleotide sequence encoding a capsanthin-capsorubin synthase (ccs). Such cell can be an Iris germanica or Iris hollandica cell.
- 2. The iris cell of 1, wherein said heterologous nucleotide sequence encoding said capsanthin-capsorubin synthase (ccs) is from Lilium lancifolium, Capsicum annuum, Citrus sinensis, Ricinus communis, Daucus carota, or Medicago truncatula.
- 3. The iris cell of 1 or 2, wherein said cell is transformed using Agrobacterium-mediated or biolistic transformation.
- 4. The iris cell of any one of 1-3, wherein said heterologous nucleotide sequence encoding said capsanthin-capsorubin synthase (ccs) comprises the nucleotide sequence shown in SEQ ID NO:1.
- 5. A transgenic iris plant, comprising said cell of any one of 1-4.
- 6. The transgenic iris plant of 5, wherein said iris plant is cultivar or variety ‘Hot Property’, ‘Dance Man’, ‘Asian Treasure’, ‘Strike it Rich’, ‘Harvest of Memories’, ‘Early Girl’, ‘Kissed by the Sun’, ‘It's Magic’, ‘Acapulco Gold’, ‘City of Gold’, ‘Just a Kiss Away’, ‘King of Light’, ‘Dance Till Dawn’, or ‘Done Me Wrong’.
- 7. A non-genomic nucleotide sequence encoding Lilium lancifolium capsanthin-capsorubin synthase (Llccs).
-
- 8. The non-genomic nucleotide sequence of 7, comprising the nucleotide sequence shown in SEQ ID NO:1.
- 9. A plant, cells of which are transformed with, and which express, any of the ccs-encoding nucleotide sequences of 2.
- 10. The plant of 9, wherein said ccs-encoding nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO:1.
- 11. Use of a capsanthin-capsorubin synthase (ccs)-encoding nucleotide sequence to modify the pigment composition in a flower of a plant.
- 12. The use of 11, wherein said capsanthin-capsorubin synthase (ccs) is from Lilium lancifolium or Capsicum annuum.
- 13. The use of 11 or 12, wherein said pigment composition in said flower of said plant comprises yellow or yellow/orange pigments.
-
- 14. An isolated gene promoter sequence comprising the nucleotide sequence shown in SEQ ID NO:2.
- 15. A plant, other than Lilium lancifolium, cells of which comprise SEQ ID NO:2 in their genome.
- 16. The plant of 15, wherein said SEQ ID NO:2 is operably linked for expression to a nucleotide sequence encoding a peptide, polypeptide, or protein.
- 17. A plant cell, comprising a heterologous nucleotide sequence encoding Lilium lancifolium or Capsicum annuum capsanthin-capsorubin synthase (ccs) operably linked to, or co-expressed with, a nucleotide sequence encoding a selection marker or screenable marker functional in a plant. Such plant cell can be other than a Lilium lancifolium or Capsicum annuum plant cell.
- 18. A transgenic plant, comprising said cell of 17.
- 19. An iris plant having one or more flowers exhibiting red, red/orange, or orange/red color.
-
- 20. The iris plant of 19, produced by a method comprising:
- a) inserting into the genome of an iris plant cell a recombinant, double-stranded DNA molecule comprising, operably linked for expression:
- (i) a promoter sequence that functions in plant cells to cause the transcription of an adjacent coding sequence to RNA;
- (ii) a capsanthin-capsorubin synthase coding sequence;
- b) obtaining a transformed iris plant cell; and
- c) regenerating from said transformed iris plant cell a genetically transformed iris plant, cells of which express said capsanthin-capsorubin synthase.
- a) inserting into the genome of an iris plant cell a recombinant, double-stranded DNA molecule comprising, operably linked for expression:
- 21. The iris plant of 20, wherein said capsanthin-capsorubin synthase is expressed in an amount in cells of said transformed iris plant effective to produce one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color in one or more flowers.
- 22. The iris plant of 20 or 21, one or more flowers of which comprises one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color.
- 23. The iris plant of any one of 20-22, wherein said capsanthin-capsorubin synthase coding sequence comprises the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence encoding capsanthin-capsorubin synthase of Capsicum annuum.
- 24. The iris plant of any one of 20-23, wherein said promoter is a flower-specific promoter or a constitutive promoter.
- 20. The iris plant of 19, produced by a method comprising:
-
- 25. A method of producing an iris plant having one or more flowers comprising one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color, comprising:
- a) inserting into the genome of an iris plant cell a recombinant, double-stranded DNA molecule comprising, operably linked for expression:
- (i) a promoter sequence that functions in plant cells to cause the transcription of an adjacent coding sequence to RNA;
- (ii) a capsanthin-capsorubin synthase coding sequence;
- a) inserting into the genome of an iris plant cell a recombinant, double-stranded DNA molecule comprising, operably linked for expression:
- b) obtaining a transformed iris plant cell; and
- c) regenerating from said transformed iris plant cell a genetically transformed iris plant, cells of which express said capsanthin-capsorubin synthase.
- 25. A method of producing an iris plant having one or more flowers comprising one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color, comprising:
-
- 26. The method of 25, wherein said capsanthin-capsorubin synthase is expressed in an amount in cells of said transformed iris plant effective to produce one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color in one or more flowers.
- 27. The method of 25 or 26, wherein said iris plant has one or more flowers that comprises one or more standards, all standards, one or more falls, all falls, a beard, a style crest, a signal, or a combination of any of the foregoing, exhibiting red, red/orange, or orange/red color.
- 28. The method of any one of 25-27, wherein said capsanthin-capsorubin synthase coding sequence comprises the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence encoding capsanthin-capsorubin synthase of Capsicum annuum.
- 29. The method of any one of 25-28, wherein said promoter is a flower-specific promoter.
-
- 30. An iris plant produced by the method of any one of 25-29.
- 31. A recombinant, double-stranded DNA molecule comprising, operatively linked for expression:
- a) a promoter that functions in plant cells to cause transcription of an adjacent coding sequence to RNA; and
- b) a nucleotide sequence encoding a capsanthin-capsorubin synthase selected from the group consisting of the nucleotide sequences recited in 2.
- 32. The recombinant, double-stranded DNA molecule of 31, wherein said promoter is a flower-specific promoter or a constitutive promoter.
-
- 33. The recombinant, double-stranded DNA molecule of 31 or 32, which is codon-optimized for expression in a monocot or a dicot of interest.
- 34. The recombinant, double-stranded DNA molecule of 33, wherein said monocot is an iris. Such iris can be Iris germanica or Iris hollandica.
- 35. An expression construct, comprising said recombinant, double-stranded DNA molecule of any one of 31-34.
- 36. A part of said plant of any one of 5-6, 9-10, 15-16, 18-24, or 30.
- 37. The part of 36, which is selected from the group consisting of a protoplast, a cell, a tissue, an organ, a cutting, and an explant.
- 38. The plant part of 36 or 37, which is selected from the group consisting of an inflorescence, a flower, one or more flowers with stem attached, a sepal, a petal, a pistil, a stigma, a style, an ovary, an ovule, an embryo, a receptacle, a seed, a fruit, a stamen, a filament, an anther, a male or female gametophyte, a pollen grain, a meristem, a terminal bud, an axillary bud, a leaf, a stem, a root, a tuberous root, a rhizome, a bulb, a tuber, a stolon, a corm, a bulb, an offset, a cell of said plant in culture, a tissue of said plant in culture, an organ of said plant in culture, and a callus.
- 39. Progeny of said plant of any one of 5-6, 9-10, 15-16, 18-24, or 30.
- 40. The progeny of 39, which is produced sexually or asexually.
- 41. A seed, tuber, or rhizome of said plant of any one of 5-6, 9-10, 15-16, 18-24, or 30.
- 42. A flower arrangement or bouquet, comprising one or more flowers, or one or more flowers with stem attached, of said plant of any one of 5-6, 9-10, 15-16, 18-24, or 30.
- 43. A method of making a flower arrangement or bouquet, comprising including in a flower arrangement or bouquet one or more flowers, or one or more flowers with stem attached, of said plant of any one of 5-6, 9-10, 15-16, 18-24, or 30.
| TABLE 1 |
| RHS Colour Chart Chips, |
| 2001 Edition |
| 30A |
| 30B |
| 30C |
| 30D |
| N30A |
| N30B |
| N30C |
| N30D |
| 31A |
| 31B |
| 31C |
| 31D |
| 32A |
| 32B |
| 32C |
| 32D |
| 33A |
| 33B |
| 33C |
| 33D |
| 34A |
| 34B |
| 34C |
| 34D |
| N34A |
| N34B |
| N34C |
| N34D |
| 35A |
| 35B |
| 35C |
| 35D |
| 36A |
| 36B |
| 36C |
| 36D |
| 37A |
| 37B |
| 37C |
| 37D |
| 38A |
| 38B |
| 38C |
| 38D |
| 39A |
| 39B |
| 39C |
| 39D |
| 40A |
| 40B |
| 40C |
| 40D |
| 41A |
| 41B |
| 41C |
| 41D |
| 42A |
| 42B |
| 42C |
| 42D |
| 43A |
| 43B |
| 43C |
| 43D |
| 44A |
| 44B |
| 44C |
| 44D |
| 45A |
| 45B |
| 45C |
| 45D |
| 46A |
| 46B |
| 46C |
| 46D |
| 47A |
| 47B |
| 47C |
| 47D |
| 48A |
| 48B |
| 48C |
| 48D |
| 49A |
| 49B |
| 49C |
| 49D |
| 50A |
| 50B |
| 50C |
| 50D |
| 51A |
| 51B |
| 51C |
| 51D |
| 52A |
| 52B |
| 52C |
| 52D |
| 53A |
| 53B |
| 53C |
| 53D |
| 54A |
| 54B |
| 54C |
| 54D |
| 55A |
| 55B |
| 55C |
| 55D |
| 56A |
| 56B |
| 56C |
| 56D |
| SEQ ID NO: 1: Lilium lancifolium capsanthin-capsorubin synthase | |
| (Llccs) nucleotide sequence | |
| ATGTCAACTCTTCAGTTGCCGGCGTTACTCACCGCCGGCGAACTCCGCCACCCTTCAAGGCG | |
| AACAAAGTGCAGTTCTCTCCGTAGCTTTCTAGATCTCACCCCAGTCTCCAAGCCCGAGCCTC | |
| TCACCATCGACATCCCATACCATGACCCCTCCTCCGCCCACCGCTACGATGCCGCCATCATC | |
| GGCTGCGGCCCCGCCGGCCTCCGCCTCGCCGAATGCGCCGCGGCCCGTGGGCTCCGCGTCTG | |
| CTGCATCGACCCCGCCCCCCTCTCCCCCTGGCCCAACAACTACGGCGCCTGGCTCGACGAGC | |
| TCCACCCCCTCGGCCTCGCCTCCATCTTCGACCACATCTGGCCCACCGCCACGATCGCCATC | |
| GACGGCGACAACATCAAGCACCTCTCACGCCCCTACGGCCGCGTCAACCGCAGTTCTCTCAA | |
| AACTCTATTACTAGAAAACTGTACCACCACCGGAGTCAGATTCCACCCCTCCAAAGCCTGGA | |
| ACATCGAGCACGAGGAGCTCCGCTCCTCCGTCTCCTGCTCCGACGGCAGCGCCGTCACCGCC | |
| AGCCTCGTCATCGACGCTGGCGGCTTCAGCACCCCCTTCATCGAGTACGACAGACCGAGAAA | |
| CCGCCGCGGGTACCAGATCGCCCACGGCATCCTCGCCGAGGTCAACCGCCACCCGTTCGACC | |
| TCAACCAGATGCTGCTCATGGACTGGAGCGACGCCCACCTCGACAACGAGCCGCATCTCCGT | |
| GCTCACAACGCTGCTATTCCAACTTTTCTATATGCAATGCCATTCAACGAAAATCTAGTTTT | |
| CCTCGAGGAGACCTCGCTGGTGGGCCGGCCGGTGCTGGACTACAGTGAGGTGAAGAAGAGAA | |
| TGGTGGCGAGGCTGCGACATTTGGGGATTAAGGTGGAGCGGGTGCTGGAGGAGGAGAAGTGT | |
| TTGTTTCCAATGGGAGGTCCGCTGCCGCGGATGCCGCAGAGGGTGATGGGGTATGGCGGGGC | |
| AGGCGGGATGGTGCATCCGTCGTCCGGGTACCAGATTGCTCGGGCGCTGGCGCTCGCGCCGG | |
| AGTTGGCAGAGGCTATGGTGGAGTGTTTGGGATCGACGAGGATGATAACGGGGAAATCGATG | |
| AATTGTAAAGTGTGGGGGAGTTTGTGGCCGGCGGGGAGGAGGTGGGAGAGGGAGTATTACTG | |
| TTTTGGGATGGAGACATTGTTGAGTCTCGATTTGAAGCAGACGAGGAGGTTCTTTGATGCGT | |
| TTTTCAATCTGGAACCGAGGTATTGGCATGGGTTTATGTCGTCGAGGCTGTCGATTACGGAG | |
| CTGGCGCAGCTGAGTTTGTCACTGTTTGCTCATGCGTCTTGGAAGAGTAGGGTGGATGTTGT | |
| GACCAAGTGCCCTTTGCCTTTGGCCAGGATGATTGGCAATCTTGCCTTACAAGCGATTTAG | |
| SEQ ID NO: 2: Lilium lancifolium Llccs promoter nucleotide | |
| sequence | |
| GCAGCAAACCATGAACCTTTGTGTTGTACATATATTTATAACCAATTCTCAGTAACTTACTT | |
| GATTATCGAAATCAGCTTCACTGTAACTTCCACTGTTCAGTTTGAGTCTATATATATTTATA | |
| ACCAATTCTCAGTAACTTACTTGATTATCGAAATCAGCTTCACTGTAACTTCCACTGTTCAG | |
| TTTGAGTCTATATGTTCTTTAGCCGTGGCACCTGTTACCAAAACGGGTGCATGTTCATGTAG | |
| CTCAAGACTCACTTTGGGTTAATTCGACTTACCTCCCTTTATTTTAGTTCTGTTGTCTTATA | |
| TTCTGTAGTTTTCGTTGCTTGTCTGGCCTGATTGGTTGATTGTGAAGTAAATTCTTTAGAAT | |
| GAAGCCATAATGGTAGAAAAGTTGTAATACAAAACTAAGAAAAAGAAAAATTAAAAATATTA | |
| ATTATATCTGTTGAGTTTAGTCCCACATCGGTTAGTCTAACCTTACAATCTAAATATAAATA | |
| TGTTATGGGGATACGTTGGATGCTCCGGTTTTTTAAAATGATATCTTGGCAGGTTTGGTTTT | |
| ATGTTGGATGTTCCGGTATTTTAACGTGACATCTTGGCATGTTATCTTTGGCCCAGATGTGT | |
| CACACGTAAGTCACCTTACACCAGATGTGTCACACATAAGTGACCTTATTCCTAACACAGTG | |
| TGTCACACATAAGTCACCTTATTCTCCACCTAATGTATCACACATAAGTGACCTTACAAATT | |
| GACTATGCGGTACCTCTACTACAAGACATTAAAAAGCAAGTCACTATCTTACAAAATAGCAA | |
| TGCCCGTCTTTCCTTTCCTTTCCTTACTTTAATAAAGAAAGACATATATTAATGTCTTTGAT | |
| TCTCTCGGACTCCTCGATTCAATTAGATTTAATTGAGGGTTTGGTATGAGTTTTACGTCCGC | |
| CTTTTTACATGGGAACAGAACATGTTTTATTTTCCAAGAATGTATCCTAATTTTGGGCCTAA | |
| TTCTACCTTCTCCTCGATTCAATTAGATTTAATTGAGGGTTCGGTATGAGCTCTACGCCCTC | |
| CTTTTTACATGGGAACAAAATGACATGTTTTATTTTCCAAGAATGTATCCTAATTTTGGGCC | |
| TAATTCAACCTTTGATACTCGATTCAACTTCTGATAAAAAATCTTATAAAGACAAAGACCTT | |
| GTGGCTTTCCTTTTATACCAGTGCGGGTGGGTTTGTTGGTCTAAAGCGACATTTAACCCAAC | |
| GGTTTTCTAATCAGTGTGTGTTAGTGGTCTCATGTTCTTTTTCTATGATAGTAGATCCCGCG | |
| GTAGCAAGAAAAAAAAGATTGAGTTCATGCATCAAAACTAATTTATTTTAATACCAACCCGG | |
| AACAAGGGGAGTTTATGCGTGATGGAGGACATAGCTTACAATCATCGGATTTGTTCATGTCA | |
| CTATGCATTTGATTAAGACATTGCACAATGATCCGAACTATCATGCTTACGCCGCCGACACT | |
| TAGAGGCCTCTCATACTATATTTCTTTATTCGAAAGAAAGCTACACAACAATGTTGCCTGAC | |
| ATTAGGCTTAAGTTTGGTGGCCAAACTCTTTTGGCCACCACAACACAACAATGTTGCCTAAT | |
| ATTAGGCTGAATTGTGGCCAAACTCTTTTGGCCACCACAACACAACAATGTTGCCTAATGTT | |
| GTTGCCTGACATTAGGCATGATTTGTGGCCAAACTCTTTTATCGTGAATTTGTGTTATACTC | |
| CCCGCCACGCATCAACATGTCATGTTTTTGTATTCGACATGTCATGTTTTAATCATGTGCTT | |
| CTGTATTCGAATGAACTAAAGGGCAATATGCAATTCCAAGATACCAGACTATAAATTCCCCC | |
| TTTTCAGTGAGCATCAT | |
| SEQ ID NO: 3 | |
| TGGAGTTTGGGTTGATGAGT | |
| SEQ ID NO: 4 | |
| TGGGAATCTCTCCAATCCAT | |
| SEQ ID NO: 5 | |
| AGAAGAGACTTCTTTGGTTGCTC | |
| SEQ ID NO: 6 | |
| TCTGGATAAGATGCTCTTCATGGATTGGAG | |
| SEQ ID NO: 7 | |
| GCAGCAAACCATGAACCTTTG | |
| SEQ ID NO: 8 | |
| ATTAAGATATGTTTCGTGAT | |
| SEQ ID NO: 9 | |
| TCTGATGATGGCCAGGGTGA | |
| SEQ ID NO: 10 | |
| TAAACGGGACGCTGCCAAAG | |
| SEQ ID NO: 11 | |
| TAGGTGAACCTGCGGAAGGATCATT | |
| SEQ ID NO: 12 | |
| CAACTTGCGTTCAAAGACTCGATG |
Claims (9)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/023,909 US8921110B1 (en) | 2013-09-11 | 2013-09-11 | Red iris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/023,909 US8921110B1 (en) | 2013-09-11 | 2013-09-11 | Red iris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US8921110B1 true US8921110B1 (en) | 2014-12-30 |
Family
ID=52112440
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/023,909 Expired - Fee Related US8921110B1 (en) | 2013-09-11 | 2013-09-11 | Red iris |
Country Status (1)
| Country | Link |
|---|---|
| US (1) | US8921110B1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5880332A (en) | 1994-03-01 | 1999-03-09 | Centre National De La Recherche Scientifique | DNA constructs related to capsanthin capsorubin synthase, cells and plants derived therefrom |
| US6459017B1 (en) * | 2000-06-29 | 2002-10-01 | The State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of Oregon State University | Iris transformation method |
| US8143478B2 (en) * | 2004-11-29 | 2012-03-27 | Kirin Beer Kabushiki Kaisha | Peptide transporting to chromoplasts in petals and method of constructing plant having yellowish petals by using the same |
-
2013
- 2013-09-11 US US14/023,909 patent/US8921110B1/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5880332A (en) | 1994-03-01 | 1999-03-09 | Centre National De La Recherche Scientifique | DNA constructs related to capsanthin capsorubin synthase, cells and plants derived therefrom |
| US6459017B1 (en) * | 2000-06-29 | 2002-10-01 | The State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of Oregon State University | Iris transformation method |
| US8143478B2 (en) * | 2004-11-29 | 2012-03-27 | Kirin Beer Kabushiki Kaisha | Peptide transporting to chromoplasts in petals and method of constructing plant having yellowish petals by using the same |
Non-Patent Citations (14)
| Title |
|---|
| Bouvier et al. (1994) Xanthophyll biosynthesis in chromoplasts: isolation and molecular cloning of an enzyme catalyzing the conversion of 5,6-epoxycarotenoid into ketocarotenoid. Plant J. 6:45-54. |
| Dave'sGarden (online retailer of plants, page for Iris cultivar Harvest of Memories; available at http://davesgarden.com/guides/pf/go/35227; accessed Jan. 28, 2014). * |
| GenBank Accession No. GU443955 (available at http://www.ncbi.nlm.nih.gov/nuccore/GU443955; first published Jan. 11, 2010; accessed Jan. 20, 2014; of record IDS Sep. 11, 2013). * |
| GenBank accession No. GU443955.1: Llccs genomic sequence; submitted Jan. 11, 2010. Released Oct. 6, 2012. |
| GenBank Accession No. JF304153 (available at http://www.ncbi.nlm.nih.gov/nuccore/JF304153; first published Feb. 7, 2011; accessed Jan. 20, 2014; of record IDS Sep. 11, 2013). * |
| GenBank accession No. JF304153.1: Llccs mRNA (cDNA) sequence; submitted Feb. 7, 2011. Released Oct. 6, 2012. |
| Jeknic et al. (1999) Genetic transformation of Iris germanica mediated by Agrobacterium tumefaciens. J. Amer. Soc. Hort. Sci. 124:575-580. |
| Jeknic et al. (2012) Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. ‘Splendens’). Plant Cell Physiol. 53:1899-1912. |
| Jeknic et al. (2012) Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens'). Plant Cell Physiol. 53:1899-1912. |
| Kumagai et al. (1998) Functional integration of non-native carotenoids into chloroplasts by viral-derived expression of capsanthin-capsorubin synthase in Nicotiana benthamiana. Plant J. 14:305-315. |
| Martin et al. (Detecting Adaptive Trait Introgression Between Iris fulva and I. brevicaulis in Highly Selective Field Conditions, 172 Genetics, 2481-2489 (2006)). * |
| Meckenstock (Breeding Red Irises: The Carotenoids, Aug. 2005). * |
| Ohmiya, A. (2013; in press) Qualitative and quantitative control of carotenoid accumulation in flower petals. Sci.Hortic. (2013), http://dx.doi.org/10.1016/j.scienta.2013.06.018. |
| Voss, D.H. (1992) Relating Colorimeter Measurement of Plant Color to the Royal Horticultural Society Colour Chart. Hort. Science 27(12):1256-1260. |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| North et al. | The Arabidopsis ABA‐deficient mutant aba4 demonstrates that the major route for stress‐induced ABA accumulation is via neoxanthin isomers | |
| van Tunen et al. | Pollen-and anther-specific chi promoters from petunia: tandem promoter regulation of the chiA gene. | |
| Nakatsuka et al. | Flower color modification of gentian plants by RNAi-mediated gene silencing | |
| Bartley et al. | Molecular biology of carotenoid biosynthesis in plants | |
| JP5582504B2 (en) | Genetically modified chrysanthemum | |
| EP2143322B1 (en) | Method for production of moth orchid having modified flower color | |
| CA2759258C (en) | Method for production of chrysanthemum plant having delphinidin-containing petals | |
| US20120144524A1 (en) | Soybean promoter ltp4 and flower-preferred expression thereof in transgenic plants | |
| US6252141B1 (en) | Tomato gene B polynucleotides coding for lycopene cyclase | |
| CN110819603A (en) | Application of RAP gene and breeding method for changing color of strawberry fruit | |
| EP2617283B1 (en) | Method for cultivating lilies containing delphinin in the petals thereof | |
| TWI738052B (en) | Dna cassett construct and method for silencing phytoene synthase gene expression in a specific plant tissues | |
| CN101189333A (en) | Plant gene sequences related to vacuolar pH and uses thereof | |
| Zhao et al. | Isolation of a UDP-glucose: Flavonoid 5-O-glucosyltransferase gene and expression analysis of anthocyanin biosynthetic genes in herbaceous peony (Paeonia lactiflora Pall.) | |
| EP2123750A1 (en) | Novel protein having acyltransferase activity and gene encoding the same | |
| US8993861B2 (en) | Soybean promoters SC194 and flower-preferred expression thereof in transgenic plants | |
| JP4885736B2 (en) | Peptide migrating to petal colored body and method for producing plant having yellow petal using the peptide | |
| Jeknic | Alteration of flower color in Solanum lycopersicum through ectopic expression of a gene for capsanthin-capsorubin synthase from Lilium lancifolium | |
| Thamaragsa et al. | Transformation of butterfly pea (Clitoria ternatea) F3'5'H (Flavonoid-3', 5'-Hydroxylase) gene into patumma (Curcuma alismatifolia)‘Blue Moon’ | |
| WO2014007400A1 (en) | Method for promoting formation of floral buds | |
| Borthakur et al. | Utilization of Plant Metabolic Engineering for Production of Pharmaceuticals in Tea | |
| 李文立 et al. | Ectopic Expression of ζ-Carotene Desaturase Gene from Oncidium Gower Ramsey Alters Leaf Morphology and Increases Carotenoid Content in Transgenic Tobacco | |
| SARITHA | ISOLATION AND CHARACTERIZATION OF cDNA ENCODING DIHYDROFLAVONOL 4-REDUCTASE GENE FROM ORCHID DENDROBiUM VARIETY SONIA17. | |
| JP2009153402A (en) | Novel protein having 4 coumaroyl CoA ligase activity and DNA encoding the same | |
| KR20120008508A (en) | A promoter derived from the perilla from the petals |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: THE STATE OF OREGON ACTING BY AND THROUGH THE STAT Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:JEKNIC, ZORAN;REEL/FRAME:032624/0529 Effective date: 20140404 |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| FEPP | Fee payment procedure |
Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| FEPP | Fee payment procedure |
Free format text: SURCHARGE FOR LATE PAYMENT, SMALL ENTITY (ORIGINAL EVENT CODE: M2554); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY Year of fee payment: 4 |
|
| FEPP | Fee payment procedure |
Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| LAPS | Lapse for failure to pay maintenance fees |
Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20221230 |