US8618048B2 - Insulin analogues of prolonged activity - Google Patents

Insulin analogues of prolonged activity Download PDF

Info

Publication number
US8618048B2
US8618048B2 US13/002,520 US200913002520A US8618048B2 US 8618048 B2 US8618048 B2 US 8618048B2 US 200913002520 A US200913002520 A US 200913002520A US 8618048 B2 US8618048 B2 US 8618048B2
Authority
US
United States
Prior art keywords
insulin
denotes
formula
circumflex over
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
US13/002,520
Other versions
US20110136736A1 (en
Inventor
Piotr Borowicz
Andrzej Plucienniczak
Jerzy Mikolajczyk
Tadeusz Glabski
Dariusz Kurzynoga
Diana Mikiewicz-Sygula
Anna Wojtowicz-Krawiec
Marcin Zielinski
Malgorzata Kesik-Brodacka
Violetta Adamczewska-Cecuda
Iwona Sokolowska
Grazyna Plucienniczak
Dorota Stadnik
Jaroslaw Antosik
Jacek Pstrzoch
Justyna Bernat
Wojciech Slawinski
Tomasz Pawlukowiec
Jacek Stepniewski
Monika Bogiel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Instytut Biotechnologii i Antybiotykow
Original Assignee
Instytut Biotechnologii i Antybiotykow
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Instytut Biotechnologii i Antybiotykow filed Critical Instytut Biotechnologii i Antybiotykow
Assigned to INSTYTUT BIOTECHNOLOGII I ANTYBIOTYKOW reassignment INSTYTUT BIOTECHNOLOGII I ANTYBIOTYKOW ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ADAMCZEWSKA -CECUDA, VIOLETTA, ANTOSIK, JAROSLAW, BERNAT, JUSTYNA, BOGIEL, MONIKA, BOROWICZ, PIOTR, GLABSKI, TADEUSZ, KESIK -BRODACKA, MALGORZATA, KURZYNOGA, DARIUSZ, MIKIEWICZ-SYGULA, DIANA, MIKOLAJCZYK, JERZY, PAWLUKOWIEC, TOMASZ, PLUCIENNICZAK, ANDRZEJ, PLUCIENNICZAK, GRAZYNA, PSTRZOCH, JACEK, SLAWINSKI, WOJCIECH, SOKOLOWSKA, IWONA, STADNIK, DOROTA, STEPNIEWSKI, JACEK, WOJTOWICZ-KRAWIEC, ANNA, ZIELINSKI, MARCIN
Publication of US20110136736A1 publication Critical patent/US20110136736A1/en
Application granted granted Critical
Publication of US8618048B2 publication Critical patent/US8618048B2/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/62Insulins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the subjects of the invention are new biosynthetic analogues of recombined human insulin of prolonged therapeutic activity, which may find use in prophylaxis and treatment of diabetes mellitus.
  • Insulin and its various derivatives are used in large amounts in treatments of diabetes mellitus and are often manufactured on a large industrial scale. While there are many different known modified derivatives of insulin and many pharmaceutical preparations of diverse activity profiles, a drug is still sought, which would enable to maintain a constant level of glucose in a human organism for an extended period of time.
  • some preparations of normal human insulin contain specific additions, e.g. various amounts of protamin, a protein that forms an insoluble complex with insulin which forms deposits in subcutaneous tissues, and from which insulin is gradually released.
  • insulin derivatives characterised by accelerated activity is lispro-insulin (Humalog®), in which the sequence of proline (28)-lysine (29) in chain B has been inverted. It makes difficult, from the sterical point, to form dimers of insulin in a solution.
  • Second such a derivative is insulin in which proline in the position 28 of chain B has been replaced with aspartic acid. Such introduced negative charge lowers possibility of self-association of insulin monomers. Both these insulin derivatives are absorbed faster due to their structure.
  • Prolonged-activity recombined human insulin analogues are constructed by elongating chain B with alkaline amino acids or acylating E-amino group in lysine in chain B with aliphatic acid of about a dozen carbon atoms.
  • LysArg sequence at C terminus of chain B of human insulin is found in human proinsulin, and one should expect transformation of lizarginsulin into human insulin by present carboxypeptidase C.
  • first metabolite of lizarginsulin in human organism can be human insulin of well known and acceptable characteristics, even in the case of exogenous hormone.
  • the aim of this invention is providing new analogues of insulin, which would be characterised by an adequate stability in acidic injection solutions (pH 3.5-5), and at the same time would possess the required biological activity. It is especially desirable that they would show characteristics of biological activity of natural insulin. It is also particularly important, that the start of activity of the new derivatives was practically immediate, just after administration to the patient, with the ability of prolonged release of a part of the dose. This would enable to provide both accelerated and prolonged activity of the pharmaceutical preparation containing insulin analogues.
  • the basic aspect of the invention is an insulin derivative or its pharmaceutically acceptable salt containing two polypeptides constituting chain A and chain B, where amino acid sequence of chain A has been chosen from SEQ ID No 1-5, while amino acid sequence of chain B has been chosen from SEQ ID No 6-8.
  • Preferred insulin derivative or its pharmaceutically acceptable salt according to the invention is characterised by being an analogue of recombined human insulin of isoelectric point 5-8.5 and formula 1:
  • R denotes an NH 2 group or a group according to formula Asn-R 2 , where R 2 denotes a neutral L-amino acid or an NH 2 group; and R1 denotes B31Lys-B32Arg or B31Arg-B32Arg or B31Arg, where B3Asn may be alternatively replaced by other amino acid, advantageously by Glu.
  • the insulin derivative or its physiologically acceptable salt according to the invention is characterised by this, that:
  • insulin derivatives of formula 1 are such as, but not limited to, these exhibited below.
  • A22Gly -human insulin- B31LysB32Arg (insulin GKR) A22Ala -human insulin- B31LysB32Arg (insulin AKR) A22Ser -human insulin- B31LysB32Arg (insulin SKR) A22Thr -human insulin- B31LysB32Arg (insulin TKR) de(A21Asn)A20Cys-NH 2 -human insulin- B31LysB32Arg (insulin XKR) A21Asn-NH 2 -human insulin- B31LysB32Arg (insulin ZKR) A22Gly -human insulin- B3GluB31LysB32Arg (insulin GEKR) A22Gly -human insulin- B31ArgB32Arg (insulin GRR) A22Ala -human insulin- B31ArgB32Arg (insulin ARR) A22Ser -human insulin- B31ArgB32Arg (insulin SRR) A22Thr
  • Insulin analogues of formula 1 were produced by a series of genetic manipulations using standard methods of genetic engineering.
  • recombined human proinsulin is understood as a polypeptide chain where chains A and B of human insulin are connected by dipeptide Lys-Arg or Arg-Arg, and the recombined preproinsulin—a combination of proinsulin and an additional leader polypeptide, for example ubiquitin, or SOD or their fragments.
  • Reaction mixture was used to transform competent cells of a proper Escherichia coli strain, as for example DH5 ⁇ , DH5, or HB101, however it is possible to use cells of other E. coli strains or cells of other microorganisms, or other known cell lines which can be used for expression of recombined proteins.
  • Plasmid containing given modification of a gene encoding recombined human proinsulin was isolated and sequenced in order to verify correctness of nucleotide sequence. According to the variant of the invention, plasmid with the modified gene encoding recombined human proinsulin was used to transform competent E.
  • Bacterial material was prepared for strain bank, samples in proportion 1:1 of bacteria culture and 40% glycerol were deposited at ⁇ 70° C.
  • Variants of recombined preproinsulin obtained by expression in E. coli strains were isolated in the form of inclusion bodies, after the cells had been disintegrated, and subsequently were subjected to standard processes of fusion proteins purification.
  • Solution of hybrid protein with insulin analog obtained after renaturation was subjected to controlled treatment with tripsine, analogously to case of many methods known beforehand and described e.g. by Kemmlera et al. in J. Biol. Chem., Vol. 246, page 6786-6791 (1971) or patents U.S. Pat. No. 6,686,177 and U.S. Pat. No. 6,100,376.
  • Obtained insulin analogues were subjected to the process of purification using known methods, mainly low-pressure chromatography, ultrafiltration and/or HPLC. The product was precipitated from sufficiently purified solution of insulin analogue.
  • Enzyme PAM peptidylglycine a-amidating monooxygenase
  • PHM protease with dual activity
  • PAL proteylamidoglycolate lyase activity
  • the amid group originates from C-terminal gycine residue, which is here direct reaction precursor (Satani M., Takahashi K., Sakamoto H., Harada S., Kaida Y., Noguchi M.; Expression and characterization of human bifunctional peptidylglycine alpha-amidating monooxygenase. Protein Expr Purif. 2003 Apr; 28(2):293-302.; Miller D. A., Sayad K. U., Kulathila R., Beaudry G. A., Merkler D. J., Bertelsen A. H.; Characterization of a bifunctional peptidylglycine alpha-amidating enzyme expressed in Chinese hamster ovary cells. Arch Biochem Biophys. 1992 Nov. 1; 298(2):380-8).
  • PAM protease is a protein which is found inter alia in eukaryotic organisms of different length of amino acid chain. In this project there was used a protease originating from human organism (Homo sapiens), in which there are found 6 genes encoding proteins exhibiting activity of a-amidating protease.
  • the basic physicochemical property of recombined human insulin analogues of formula 1, which differentiates them from human insulin, is their value of isoelectric point, which has values from about 5 to about 8. This means good solubility of the compounds in solutions of acidic to slightly acidic pH. This property enabled preparation of composition—solutions of new insulin derivatives in acidic pH.
  • An aspect of the invention is also pharmaceutical composition characterised by this, that it contains effectively acting amount of insulin derivative according to the invention or its pharmaceutically acceptable salt, which are defined above.
  • the pharmaceutical composition according to the invention contains also from 10 to 50 ⁇ g/ml of zinc.
  • Consecutive aspect of the invention is also use of insulin derivative according to the invention or its pharmaceutically acceptable salt, which were defined above, to manufacture drug for treatment or prevention of diabetes.
  • the pharmaceutical composition contains effectively acting amount of biosynthetic analogue of human insulin of formula 1 or its pharmacologically acceptable salt and auxiliary substances.
  • a salt of biosynthetic human insulin analogue according to the invention can be for example a salt of alkaline metal or ammonium salt.
  • composition according to the invention is prepared in the form of solution and contains: effectively acting amount of biosynthetic analogue of human insulin of formula 1 or its pharmacologically acceptable salt and auxiliary substances, such as: isotonic agents, preservatives agents, stabilizing agents, optionally buffering agents.
  • Amount of the active substance used in the composition according to the invention is about 1-1600, favourably 10-1200, especially favourably 10-500 u/ml.
  • 1 unit (1 u) is meant 1 auxiliary unit, containing the same number of moles of the analogue as 1 international unit of insulin, corresponding to 6 nMol (that is 6 ⁇ 10 ⁇ 9 Mol).
  • pH value of the solution is from about 3.5 to about 5, favourably 4.0-4.5.
  • auxiliary substances in compositions according to the invention are the same substances that are used in preparations containing known recombined human insulin.
  • Isotonic substance according to the invention can be any substance, which allows obtaining solution isoosmotic in respect to human blood plasma.
  • isotonic agents used in pharmacy belong such substances as sodium chloride, mannitol, glycine, preferably glycerine.
  • Favourable is use of glycerine.
  • Useful conserving agents to be used in composition according to the invention are compounds chosen from the group to which belongs m-cresole, phenol or their mixtures.
  • New derivatives similarly to recombined normal human insulin, are stabilised by addition of zinc ions, introduced into the solution in the form of, among other, zinc chloride or oxide.
  • Amount of the zinc can range from around 5 ⁇ g/ml to around 150 ⁇ g/ml.
  • a following example of a content of the composition containing derivatives of recombined human insulin according to the invention has been developed: 10-500 u/ml of biosynthetic analogue of human insulin of formula 1 or its pharmacologically acceptable salt, 16 mg/ml of glycerine, 2.7-3 mg/ml m-cresole, 10-50 ⁇ g/ml of zinc and water for injection to 1 ml.
  • FIG. 1 presents structure of plasmid p5/ZUINSGly(22A) containing a gene encoding GKR protein of recombined insulin.
  • FIG. 2 presents nucleotide and amino acid sequence of plasmid p5/ZUINSGly(22A).
  • FIG. 3 presents structure of plasmid p6/ZUINSSer(22A) containing a gene encoding insulin SKR protein.
  • FIG. 4 presents nucleotide and amino acid sequence of plasmid p6/ZUINSSer(22A).
  • FIG. 5 presents influence of single dose administration of GKR insulin (in the dose of 5 u/kg of body mass on glucose concentration in blood of normoglycaemic rats, compared with preparation of Gensulin N. Average values ⁇ SEM. Statistical significance **p ⁇ 0.01: Insulin GKR vs. initial glucose concentration; ##p ⁇ 0.01, #p ⁇ 0.05: Gensulin N vs. initial glucose concentration; ⁇ p ⁇ 0.01: Insulin GKR vs. Gensulin N.
  • FIG. 6 presents influence of single dose administration of GKR insulin (in dose of 5 u per kg of body mass) on glucose concentration in blood of rats with mild streptozotocin-induced diabetes (in comparison with Lantus preparation).
  • 0 fixed hyperglycaemia
  • control physiological salt solution 10 ⁇ l /200 g bm.
  • Statistical significance **p ⁇ 0.01*p ⁇ 0.05 GKR vs. Lantus;
  • FIG. 7 presents influence of single dose administration of GKR insulin (in doses of 2.5 u, 5u and 7.5 u per kg of body mass) on glucose concentration in blood of rats with severe streptozotocin-induced diabetes.
  • 0 fixed hyperglycaemia
  • control physiological salt solution 10 ⁇ l/200 g bm.
  • FIG. 8 presents influence of single dose administration of GKR insulin (in dose of 7.5 u per kg of body mass) on glucose concentration in blood of rats with severe streptozotocin-induced diabetes (in comparison with Lantus preparation).
  • 0 fixed hyperglycaemia
  • control physiological salt solution 10 ⁇ l/200 g bm.
  • FIG. 9 presents glucose concentration in blood of rats after multiple administrations of GKR insulin in doses of 5 u per kg of body mass in a model of mild streptozotocin-induced diabetes (in comparison with Lantus preparation); 0—fixed hyperglycaemia; control—physiological salt solution 10 ⁇ l/200 g bm.
  • FIG. 10 presents glucose concentration in blood of rats in the period after stopping administration of GKR insulin in dose of 5 u per kg of body mass in a model of mild streptozotocin-induced diabetes (in comparison with Lantus preparation);
  • FIG. 11 presents influence of single dose administration of GR insulin (in doses of 10 u per kg of body mass) on glucose concentration in blood of rats with moderate streptozotocin-induced diabetes compared with Lantus preparation.
  • 0 fixed hyperglycaemia
  • control physiological salt 10 ⁇ l/200 g bm
  • 0 fixed hyperglycaemia
  • control physiological salt solution 10 ⁇ l/200 g bm.
  • Statistical significance **p ⁇ 0.01, *p ⁇ 0.05 GR vs. Lantus;
  • FIG. 12 presents influence of single dose administration of GEKR insulin (in dose of 10 u per kg of body mass) on glucose concentration in blood of rats with moderate streptozotocin-induced diabetes compared with Levemir preparation.
  • GEKR insulin in dose of 10 u per kg of body mass
  • 0 fixed hyperglycaemia
  • p5/ZUINS plasmid in which a DNA fragment encoding recombined insulin precursor is added to a modified gene of synthetic ubiquitin.
  • ubiquitin gene arginine codons have been replaced with alanine codons and to the C terminus of ubiquitin gene there has been added aditional arginine codon.
  • Peptide which constitutes part of ubiquitin is a carrier for insulin precursor, and is a condition for high efficiency of fusion protein synthesis in E. coll.
  • the region encoding the modified fusion protein ubiquitin-human insulin is placed under control of pms (WO05066344 A2) promoter.
  • the plasmid carries ampicillin resistance gene.
  • pIGAL1 plasmid whose sequence deposited in Gene Bank has number AY424310.
  • the recombined INSGly(22A) proinsulin gene differs from the model human proinsulin gene in such a way, that it has attached additional GGT codon at C terminus of chain A.
  • amino acid sequence of chain A is being elongated at position 22 with Gly-lycine-amino acid residue.
  • Plasmid with the modified gene encoding recombined p5/ZUINSGly(22A) proinsulin has been used in transformation of competent E. coli DH5 ⁇ cells which were subsequently cultivated for 18 hours in LB medium with addition of ampicillin (0.01 mg/ml) in the volume of 500 ml, at 37° C., 200 rpm.
  • Bacteria material has been prepared for strain bank, samples containing 1:1 bacterial cultures and 40% glycerol have been deposited at ⁇ 70° C.
  • Obtained Escherichia coli strain constitutes the initial biological material in the process of obtaining GKR insulin via biosynthesis, according to Example 10.
  • Plasmid p5/ZUINSGly(22A) is 4775 base pairs long and is built of following regulatory sequences and genes:
  • Obtained Escherichia coli strain is the initial biological material in the process of manufacturing SR insulin via biosynthesis according to Example 12.
  • Obtained Escherichia coli strain is the initial biological material in the process of manufacturing AKR insulin via biosynthesis according to Example 13.
  • Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GEKR insulin via biosynthesis according to Example 14.
  • examples 1-5 as the plasmid hosts there have been used DH5 ⁇ E. coli bacteria, but in described above, model realisation of the invention there can be used also other E. coli strains, for example DH5 or HB101.
  • p6/ZUINS plasmid in which DNA fragment encoding precursor of recombined insulin is appended to modified gene encoding synthetic ubiquitin.
  • ubiquitin-encoding gene arginine codons have been replaced with alanine codons and to the C terminus of ubiquitin gene there has been added an additional arginine codon.
  • the peptide constituting part of ubiquitin is a carrier for insulin precursor, which conditions high efficiency of fusion protein expression in E. coli .
  • the region encoding the modified ubiquitin-human insulin fusion protein is placed under control of pms promoter (WO05066344 A2).
  • the plasmid carries tetracycline resistance gene.
  • p6/ZUINS vector there has been used p5/ZUINS plasmid.
  • SKRG 5′ GAACTACTGCAAT TCT TAA GTCGA 3′ Ser STOP SKRD 5′ TAGAGTCGACTTA AGA ATTGCAGTA 3′ Ser Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction, as the template has been used p6/ZUINS plasmid DNA.
  • Escherichia coli DH5 ⁇ competent cells have been transformed with the reaction mixture.
  • p6/ZUINSSer(22A) plasmid has been isolated and sequenced in order to verify presence of TCT nucleotides encoding serine and correctness of the plasmid sequence.
  • the plasmid with the modified gene encoding p6/ZUINSSer(22A) proinsulin has been used to transform E. coli DH5 ⁇ bacteria. Subsequently the bacteria were cultivated for 18 hours in LB media with addition of tetracycline (0.01 mg/ml) in 500 ml volume at 37° C., 200 rpm. Bacteria material has been preparated for strain bank samples containing 1:1 bacterial cultures and 40% glycerol have been deposited at ⁇ 70° C.
  • Obtained Escherichia coli strain constitutes initial biological material in the process of manufacturing SKR insulin via biosynthesis according to Example 15.
  • p6/ZUINSSer(22A) plasmid is 4911 base pairs long and is made of following regulatory sequences and genes:
  • FIG. 3 Structure of p6/ZUINSSer(22A) plasmid containing the gene encoding recombined human insulin protein (SKR protein) is shown schematically in FIG. 3 , and its nucleotide and amino acid sequence in FIG. 4 .
  • GLYG 5′ AACTACTGCAAT GGT TAA GTCGACTCTAGC 3′ Gly STOP GLYD 5′ GTAGCTAGAGTCGACTTA ACC ATTGCAG 3′ Gly Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5 bacteria with p6/ZUINSGly(22A) plasmid have been performed as in Example 6.
  • Obtained Escherichia coli strain constitutes initial biological material in the process of manufacturing GKR insulin via biosynthesis according to Example 16.
  • Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GEKR insulin via biosynthesis according to Example 17.
  • Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GR insulin via biosynthesis according to Example 18.
  • GKR insulin has been manufactured in a biosynthesis process realised in the classical way (inoculum, seed culture, production culture) using Escherichia coli strain with a DNA fragment encoding GKR insulin precursor obtained according to Example 1.
  • Production cultivation has been conducted in 150 dm 3 fermentation tank for 20 hours at 37° C., controlling pH, temperature, optical density, glucose concentration and aeration.
  • GKR analogue has been produced intracellulary in inclusion bodies. After the end of fermentation the fermentation broth has been concentrated and subsequently digested with lysosyme and bacterial cells have been subjected to disintegration. Obtained suspension has been diluted with water and after incubation with Triton centrifuged.
  • inclusion bodies homogenate created raw deposit of inclusion bodies was initially purified, finally obtaining inclusion bodies homogenate.
  • the obtained homogenate has been dissolved (10-15 mg/cm 3 ) in the solution of sodium carbonate with addition of EDTA, subjected to renaturation and, for protection of lysine free amino groups, subjected to reversible process of citraconylation in a reaction with citraconic anhydride.
  • the dissolved protein had been subjected to trypsine digestion in order to cleave the leader protein out and to cleave the insulin chains. In the result of trypsine activity there was obtained GKR insulin.
  • Example 10 using Escherichia coli strain with DNA fragment encoding GR insulin precursor, obtained in accordance with Example 2, there has been obtained from analogous batch of inclusion bodies 5.2 g of GR insulin of HPLC purity equal to 97.5%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding SR insulin precursor, obtained in accordance with Example 3, there has been obtained from analogous batch of inclusion bodies 5.5 g of SR insulin of HPLC purity equal to 97%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding AKR insulin precursor, obtained in accordance with Example 4, there has been obtained from analogous batch of inclusion bodies 4.7 g of AKR insulin of HPLC purity equal to 96.5%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding GEKR insulin precursor, obtained in accordance with Example 5, there has been obtained from analogous batch of inclusion bodies 5.0 g of GEKR insulin of HPLC purity equal to 97.5%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding SKR insulin precursor, obtained in accordance with Example 6, there has been obtained from analogous batch of inclusion bodies 5.3 g of SKR insulin of HPLC purity equal to 98%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding GKR insulin precursor, obtained in accordance with Example 7, there has been obtained from analogous batch of inclusion bodies 6.3 g of GKR insulin of HPLC purity equal to 95.5%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding GEKR insulin precursor, obtained in accordance with Example 8, there has been obtained from analogous batch of inclusion bodies 6.0 g of GEKR insulin of HPLC purity equal to 97%.
  • Example 10 using Escherichia coli strain with DNA fragment encoding GR insulin precursor, obtained in accordance with Example 9, there has been obtained from analogous batch of inclusion bodies 5.5 g of GR insulin of HPLC purity equal to 96.5%.
  • Main fraction containing ZKR insulin concentrated and subjected to crystallisation using sodium citrate, zinc citrate, citric acid. From one batch of reaction mixture there has been obtained about 10 mg of crystalline ZKR insulin of HPLC purity of 97%.
  • GR insulin solution manufactured according to Example 11 or 18 (2 mg/ml), in 100 mM MES/KOH buffer, pH 4.5, there has been added 1 ⁇ M CuSO 4 , 100 ⁇ g/ml catalase, 5 mM ascorbic acid and 2 ⁇ M PAM enzyme, and subsequently the solution has been mildly mixed for 1 hour at 37° C. The reaction has been stopped by addition of 1 mM Na 2 EDTA. The solution after reaction with PAM has been subjected to purification by ion-exchange and HPLC methods.
  • the main fraction containing insulin concentrated and subjected to crystallisation using sodium citrate, zinc citrate, citric acid. From one batch of reaction mixture there was obtained 22 mg of crystalline ZR insulin of HPLC purity of 98%.
  • GKR insulin 3.69 mg/ml (as 100% substance, 100 u/ml) (Example 16) m-cresol 2.7 mg/ml anhydrous glycerine 16 mg/ml zinc 30 ⁇ g/ml water for injection to 10 ml pH 4.5
  • GR insulin 3.61 mg/ml (as 100% substance, 100 u/ml) (Example 11) m-cresol 2.7 mg/ml anhydrous glycerine 16 mg/ml zinc 30 ⁇ g/ml injection water up to 1.0 ml pH 4.0
  • the procedure was identical as in Example 21, apart of that that instead of GKR insulin there was used GR insulin (in the amount of 361 mg, 10 000 u) and that the final value of pH was 4.0.
  • GEKR insulin 3.70 mg/ml (as 100% substance, 100 u/ml) (Example 14) m-cresol 2.7 mg/ml anhydrous glycerine 16 mg/ml zinc 30 ⁇ g/ml injection water up to 1.0 ml pH 4.0
  • the procedure was identical as in Example 21, apart of that that instead of GKR insulin there was used GEKR insulin (in the amount of, 10 000 u) and that the final value of pH was 4.0.
  • GKR insulin 100 u/ml
  • accelerated stability 25° C. ⁇ 2° C.
  • HPLC purity of the product (GKR insulin) and the proportional contribution: highest single contamination, deamido derivative and polymers, in HPLC test, in time points of: “0”, 28, 42 and 56 days.
  • GKR insulin Recombined human insulin analogue
  • Gensulin N Recombined isophane human insulin
  • hypoglycaemic activity of both preparations have been observed in 0.5 and 1 hour after administration. In this time there is observed fast and deep decrease of glucose concentration after GKR insulin. Peak activity of GKR insulin and Gensulin N is in 2 nd hour.
  • GKR insulin is an active analogue of prolonged hypoglycaemic activity. Decrease in glucose level after GKR insulin administration was observed for up to 12 hours, while levels of glucose after 24 hours were similar to initial. Results of reaction of normoglycaemic rats to single administration of GKR insulin and
  • Gensulin N preparations (taking into account mean values ⁇ SEM) are shown in Table 1 and FIG. 5 .
  • Activity of GR insulin after administration of single doses—5 u or 10 u/kg bm has been determined to be fast and strong. Beginning of activity occurs already after 30 minutes after administration of the preparation and remains at the same level up to 2 hours, and subsequently weakens until reaching initial levels in 24 th -36 th hour.
  • Results describing influence of GR insulin preparation on glucose concentration in blood of rats after single dose administration of 5 u and 10 u/kg bm doses in a model of moderate streptozotocin-induced diabetes (in comparison with Lantus preparation) are shown in Table 6.
  • a plot of glucose concentration/time changes after administration of 5 u/kg bm of GR insulin is shown in FIG. 11 .
  • Results describing influence of GEKR insulin on glucose concentration in rat blood after single dose administration of 10 u/kg bm in a moderate streptozotocin-induced model of diabetes, in comparison with preparation Levemir, are shown in Table 7, and a plot of glucose concentration change as a function of time after administration 10 u/kg bm of GEKR insulin in FIG. 12 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Diabetes (AREA)
  • General Health & Medical Sciences (AREA)
  • Endocrinology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Emergency Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)

Abstract

New biosynthetic analogues of recombined human insulin of prolonged therapeutical activity, which can find place in prophylactic and treatment of diabetes.

Description

The subjects of the invention are new biosynthetic analogues of recombined human insulin of prolonged therapeutic activity, which may find use in prophylaxis and treatment of diabetes mellitus.
Insulin and its various derivatives are used in large amounts in treatments of diabetes mellitus and are often manufactured on a large industrial scale. While there are many different known modified derivatives of insulin and many pharmaceutical preparations of diverse activity profiles, a drug is still sought, which would enable to maintain a constant level of glucose in a human organism for an extended period of time.
To achieve the effect of delayed and/or prolonged activity some preparations of normal human insulin contain specific additions, e.g. various amounts of protamin, a protein that forms an insoluble complex with insulin which forms deposits in subcutaneous tissues, and from which insulin is gradually released.
There are known various human insulin derivatives used in treatment of diabetes, which contain additional amino acids or have modified sequence of some amino acids. Changes of primary structure of insulin influence its secondary and tertiary structure, which affects protein's chemical and biological properties, and that in turn results in pharmacokinetic and pharmacodynamic effects. These changes are of different character, can lead to accelerated or delayed and prolonged activity of modified insulin. Active form of insulin is a monomer, which easily filters into blood after subcutaneous injection. It is known, that exogenous human insulin in solutions has hexameric form, which after application dissociates to dimers and subsequently to monomers before filtering into blood stream. One of insulin derivatives characterised by accelerated activity is lispro-insulin (Humalog®), in which the sequence of proline (28)-lysine (29) in chain B has been inverted. It makes difficult, from the sterical point, to form dimers of insulin in a solution. Second such a derivative is insulin in which proline in the position 28 of chain B has been replaced with aspartic acid. Such introduced negative charge lowers possibility of self-association of insulin monomers. Both these insulin derivatives are absorbed faster due to their structure.
Prolonged-activity recombined human insulin analogues are constructed by elongating chain B with alkaline amino acids or acylating E-amino group in lysine in chain B with aliphatic acid of about a dozen carbon atoms.
Introduction of these extra alkaline amino acids changes some chemical or physical properties of insulin. The most important change is a shift of isoelectric point in respect to unmodified natural insulin from 5.4 to the range of about 5.5 to about 8.5, which results from introduction of superfluous positive charges into the molecule. In consequence solubility of these analogues in neutral water environment is reduced, and therefore necessity of using slightly acidic environment for production of pharmaceutical preparations containing such modified insulin.
However, beside obvious advantages resulting from introduction of extra alkaline amino acids there is observed also disadvantageous reduction of stability of new analogues, stemming primarily from deamination of asparagine in position A21 occurring in acidic environment.
This issue is addressed by replacement of A21Asn with other amino acid, such as aspartic acid, glycine, alanine, threonine and others. One of such analogues is recombinant human insulin derivative in which in chain A asparagine(21) has been replaced with glycine(21) and to the C terminus of chain B have been attached two arginine residues. This is so-called glargine derivative of insulin, manufactured under the name Lantus (patent U.S. Pat. No. 5,656,722).
In the course of our research it has been established, that a human insulin derivative, where to the C terminus of chain B have been attached residues of lysine (B31 Lys) and arginine (B32Arg) shows biological activity that is similar to glargine derivative, which is already present on the market. Preliminary research performed on animals indicates, that this preparation, called lizarginsulin, is characterised by prolonged activity and a flat release profile mimicking secretion of natural insulin, and from a clinical point of view—reduction of nocturnal hypoglycaemias. Because of exceptional similarity to human insulin and also to proinsulin, there could be expected good research results, enabling gradual development of the drug candidate and its final commercialisation. It is crucial, that LysArg sequence at C terminus of chain B of human insulin is found in human proinsulin, and one should expect transformation of lizarginsulin into human insulin by present carboxypeptidase C. This means, that first metabolite of lizarginsulin in human organism can be human insulin of well known and acceptable characteristics, even in the case of exogenous hormone. There was performed extended pre-clinical research on rats, which confirmed prolonged activity of the new insulin analogue.
However it came out that this derivative apart of its advantageous biological activity is characterised by insufficient stability in acidic injection solutions. The main cause of insufficient stability, which manifests itself primarily as deamidation, is presence of asparagine residue at C terminus of chain A, where in acidic water environment can occur a deamidation autocatalysed by a proton from carboxyl group.
Therefore the aim of this invention is providing new analogues of insulin, which would be characterised by an adequate stability in acidic injection solutions (pH 3.5-5), and at the same time would possess the required biological activity. It is especially desirable that they would show characteristics of biological activity of natural insulin. It is also particularly important, that the start of activity of the new derivatives was practically immediate, just after administration to the patient, with the ability of prolonged release of a part of the dose. This would enable to provide both accelerated and prolonged activity of the pharmaceutical preparation containing insulin analogues.
The above stated goal was unexpectedly achieved in this invention.
The basic aspect of the invention is an insulin derivative or its pharmaceutically acceptable salt containing two polypeptides constituting chain A and chain B, where amino acid sequence of chain A has been chosen from SEQ ID No 1-5, while amino acid sequence of chain B has been chosen from SEQ ID No 6-8. Preferred insulin derivative or its pharmaceutically acceptable salt according to the invention is characterised by being an analogue of recombined human insulin of isoelectric point 5-8.5 and formula 1:
Figure US08618048-20131231-C00001

where R denotes an NH2 group or a group according to formula Asn-R2, where R2 denotes a neutral L-amino acid or an NH2 group;
and R1 denotes B31Lys-B32Arg or B31Arg-B32Arg or B31Arg, where B3Asn may be alternatively replaced by other amino acid, advantageously by Glu.
Advantageously, the insulin derivative or its physiologically acceptable salt according to the invention is characterised by this, that:
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2denotes Gly and R1 denotes B31 Lys-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Ala and R1 denotes B31 Lys-B32Arg or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Ser and R1 denotes B31 Lys-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Thr and R1 denotes B31 Lys-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes group NH2 and R1 denotes B31 Lys-B32Arg, or
  • R in the formula 1 denotes group NH2 and R1 denotes B31 Lys-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Gly a R1 denotes B31Arg-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Ala a R1 denotes B31Arg-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Thr a R1 denotes B31Arg-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Ser a R1 denotes B31Arg-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes group NH2 and R1 denotes B31Arg-B32Arg, or
  • R in the formula 1 denotes group NH2 a R1 denotes B31Arg-B32Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Gly a R1 denotes B31Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Ala a R1 denotes B31Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Thr a R1 denotes B31Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Ser a R1 denotes B31Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes group NH2 and R1 denotes B31Arg, or
  • R in the formula 1 denotes group NH2 a R1 denotes B31Arg, or
  • R in the formula 1 denotes group of formula Asn-R2, wherein R2 denotes Gly, R1 denotes B31 Lys-B32Arg, and B3Asn has been replaced with B3Glu.
As described before, in the case of glargin the problem of low stability has been solved by replacing asparagine in the position A21 with glycine. Research, which aimed at obtaining an insulin analogue exhibiting prolonged activity and stability in acidic injection solutions as described in the invention, went in different direction. In order to block carboxyl group responsible for low stability, there were obtained new derivatives of lizarginsulin with carboxyl group in asparagine residue modified in different ways, using methods of genetic engineering and enzymatic transformation. As a result of the conducted research it unexpectedly turned out, that chemical and biological properties, similar to these of glargine and lizargine derivative, are exhibited by derivatives of human insulin of formula 1, where chain A has been elongated at C terminus with a residuum of neutral amino acid (A22) or where carboxyl group of asparagine or cysteine at C terminus of chain A has been transformed into carboxyamid group, and to the C terminus of chain B there were attached residues of lysine and arginine (B31Lys-B32Arg), or two arginine residues (B31Arg-B32Arg), or one arginine residue (B31Arg). New analogues obtained in such a way are characterised by proper stability in acidic injection solutions (pH 3.5-5) and at the same time exhibit desired biological activity.
Introduced modification unexpectedly led to obtaining stable pharmaceutical compositions of insulin derivatives, at the same time preserving biological activity and causing a shift of isoelectric point to pH between 5 and 8, therefore reducing solubility of the new insulin derivative in physiological pH at the place of injection. This causes precipitation of insulin derivative microdeposit in subcutaneous tissue and subsequently slow release of the substance to the blood, which causes maintaining of theraupetical level by a prolonged time.
Properties of these compounds and their compositions have been confirmed by stability research and by researching their activity in animals with experimental diabetes. During these there was unexpectedly found remarkably prolonged effect of hypoglycaemic activity, which lasted also for a long time after stopping administration of the medicine, in contrast to what was observed for a reference commercially available insulin derivative of prolonged activity. This allows supposing, that properties of derivatives, which are the subject of the invention, will enable significantly less frequent administration of the medicine, which will increase effectiveness, safety and comfort of the patients therapy. It is also important, that start of activity of the new derivatives according to the invention is practically immediate, which means that these compounds unexpectedly exhibit characteristics of biological activity of known insulin analogues of both accelerated and prolonged activity.
Examples of insulin derivatives of formula 1 are such as, but not limited to, these exhibited below.
A22Gly -human insulin- B31LysB32Arg (insulin GKR)
A22Ala -human insulin- B31LysB32Arg (insulin AKR)
A22Ser -human insulin- B31LysB32Arg (insulin SKR)
A22Thr -human insulin- B31LysB32Arg (insulin TKR)
de(A21Asn)A20Cys-NH2 -human insulin- B31LysB32Arg (insulin XKR)
A21Asn-NH2 -human insulin- B31LysB32Arg (insulin ZKR)
A22Gly -human insulin- B3GluB31LysB32Arg (insulin GEKR)
A22Gly -human insulin- B31ArgB32Arg (insulin GRR)
A22Ala -human insulin- B31ArgB32Arg (insulin ARR)
A22Ser -human insulin- B31ArgB32Arg (insulin SRR)
A22Thr -human insulin- B31ArgB32Arg (insulin TRR)
de(A21Asn)A20Cys-NH2 -human insulin- B31ArgB32Arg (insulin XRR)
A21Asn-NH2 -human insulin- B31ArgB32Arg (insulin ZRR)
A22Gly -human insulin- B31Arg (insulin GR)
A22Ala -human insulin- B31Arg (insulin AR)
A22Ser -human insulin- B31Arg (insulin SR)
A22Thr -human insulin- B31Arg (insulin TR)
de(A21Asn)A20Cys-NH2 -human insulin- B31Arg (insulin XR)
A21Asn-NH2 -human insulin- B31Arg (insulin ZR)

To simplify names of recombined human insulin analogues, which are the subject of the invention, they were assigned symbols which are composed of the name “insulin” and 2-4 capital letters of alphabet, which denote amino acid residues, which were added or which replaced these present in the parent particle of human insulin. In the most cases these letters are consistent with one-letter amino acid residues code recognised in the literature. Only for two residues, that do not occur naturally, there were used additional letters, namely “Z” and “X”. In both cases the letter denotes a residue placed at C terminus of chain A, which where instead of the terminal COOH group there's CONH2 group; letter “Z” denotes corresponding asparagine amide (that is A21Asn-NH2), and letter “X”—cysteine amide (that is de(A21 Asn)A20Cys-NH2).
Insulin analogues of formula 1 were produced by a series of genetic manipulations using standard methods of genetic engineering.
To this end there were constructed modifications of the gene encoding recombined human proinsulin using genetic techniques such as for example site specific mutagenesis. Site-specific mutagenesis reaction has been performed using Stratagene kit (cat. no. 200518-5), as a template has been used plasmid DNA plGALZUINS—p5/ZUINS or plGTETZUINS—p6/ZUINS. Also any other DNA containing proper sequence encoding recombined human proinsulin or preproinsulin can be used as the template.
According to the invention, in the light of recognised terminology, recombined human proinsulin is understood as a polypeptide chain where chains A and B of human insulin are connected by dipeptide Lys-Arg or Arg-Arg, and the recombined preproinsulin—a combination of proinsulin and an additional leader polypeptide, for example ubiquitin, or SOD or their fragments.
Reaction mixture was used to transform competent cells of a proper Escherichia coli strain, as for example DH5α, DH5, or HB101, however it is possible to use cells of other E. coli strains or cells of other microorganisms, or other known cell lines which can be used for expression of recombined proteins. Plasmid containing given modification of a gene encoding recombined human proinsulin was isolated and sequenced in order to verify correctness of nucleotide sequence. According to the variant of the invention, plasmid with the modified gene encoding recombined human proinsulin was used to transform competent E. coli DH5α cells and bacteria were cultured in LB media with addition of selection antibiotic (0.01 mg/ml) in the volume of 500 ml, at temp. 37° C., 200 rpm for 18 h. Bacterial material was prepared for strain bank, samples in proportion 1:1 of bacteria culture and 40% glycerol were deposited at −70° C.
Variants of recombined preproinsulin obtained by expression in E. coli strains were isolated in the form of inclusion bodies, after the cells had been disintegrated, and subsequently were subjected to standard processes of fusion proteins purification. Solution of hybrid protein with insulin analog obtained after renaturation was subjected to controlled treatment with tripsine, analogously to case of many methods known beforehand and described e.g. by Kemmlera et al. in J. Biol. Chem., Vol. 246, page 6786-6791 (1971) or patents U.S. Pat. No. 6,686,177 and U.S. Pat. No. 6,100,376. Obtained insulin analogues were subjected to the process of purification using known methods, mainly low-pressure chromatography, ultrafiltration and/or HPLC. The product was precipitated from sufficiently purified solution of insulin analogue.
In order to obtain derivatives containing at the C terminus of chain A residue A21 Asn-NH2 or A20Cys-NH2, there were used a-amidating enzymes (α-AE), catalysing conversion of naturally appearing in living organisms prohormones, which are reaction substrates converted into active a-amid forms.
Enzyme PAM (peptidylglycine a-amidating monooxygenase) is a protease with dual activity, denoted as activity PHM (Peptidylglycine alpha-hydroxylating monooxygenase) and PAL (peptidylamidoglycolate lyase activity) (Diagram 1), which enables obtaining C terminal amide. It was investigated, that half of peptide hormones, such as oxytocin or vasopressin require achieving their optimal activity a C-terminal amid group. In this reaction the amid group originates from C-terminal gycine residue, which is here direct reaction precursor (Satani M., Takahashi K., Sakamoto H., Harada S., Kaida Y., Noguchi M.; Expression and characterization of human bifunctional peptidylglycine alpha-amidating monooxygenase. Protein Expr Purif. 2003 Apr; 28(2):293-302.; Miller D. A., Sayad K. U., Kulathila R., Beaudry G. A., Merkler D. J., Bertelsen A. H.; Characterization of a bifunctional peptidylglycine alpha-amidating enzyme expressed in Chinese hamster ovary cells. Arch Biochem Biophys. 1992 Nov. 1; 298(2):380-8).
Figure US08618048-20131231-C00002
Precursor with Gly hydroxyl derivative glyoxylate Diagram 1 Outline of α-amidation of a peptide by active PAM protease (according to Satani M., Takahashi K., Sakamoto H., Harada S., Kaida Y., Noguchi M.; Expression and characterization of human bifunctional peptidylglycine alpha-amidating monooxygenase. Protein Expr Purif. 2003 Apr; 28(2):293-302.). PAM protease is a protein which is found inter alia in eukaryotic organisms of different length of amino acid chain. In this project there was used a protease originating from human organism (Homo sapiens), in which there are found 6 genes encoding proteins exhibiting activity of a-amidating protease.
The basic physicochemical property of recombined human insulin analogues of formula 1, which differentiates them from human insulin, is their value of isoelectric point, which has values from about 5 to about 8. This means good solubility of the compounds in solutions of acidic to slightly acidic pH. This property enabled preparation of composition—solutions of new insulin derivatives in acidic pH.
An aspect of the invention is also pharmaceutical composition characterised by this, that it contains effectively acting amount of insulin derivative according to the invention or its pharmaceutically acceptable salt, which are defined above. Favourably, the pharmaceutical composition according to the invention contains also from 10 to 50 μg/ml of zinc.
Consecutive aspect of the invention is also use of insulin derivative according to the invention or its pharmaceutically acceptable salt, which were defined above, to manufacture drug for treatment or prevention of diabetes.
In accordance with the above, the pharmaceutical composition, according to the invention, contains effectively acting amount of biosynthetic analogue of human insulin of formula 1 or its pharmacologically acceptable salt and auxiliary substances.
A salt of biosynthetic human insulin analogue according to the invention can be for example a salt of alkaline metal or ammonium salt.
Intended for administration composition according to the invention is prepared in the form of solution and contains: effectively acting amount of biosynthetic analogue of human insulin of formula 1 or its pharmacologically acceptable salt and auxiliary substances, such as: isotonic agents, preservatives agents, stabilizing agents, optionally buffering agents.
Amount of the active substance used in the composition according to the invention is about 1-1600, favourably 10-1200, especially favourably 10-500 u/ml. In case of each human insulin analogue, which is subject of this invention, by 1 unit (1 u) is meant 1 auxiliary unit, containing the same number of moles of the analogue as 1 international unit of insulin, corresponding to 6 nMol (that is 6×10−9 Mol).
For pharmaceutical composition according to the invention pH value of the solution is from about 3.5 to about 5, favourably 4.0-4.5.
Generally, auxiliary substances in compositions according to the invention are the same substances that are used in preparations containing known recombined human insulin.
Isotonic substance according to the invention can be any substance, which allows obtaining solution isoosmotic in respect to human blood plasma. To typical isotonic agents used in pharmacy belong such substances as sodium chloride, mannitol, glycine, preferably glycerine. Favourable is use of glycerine.
Useful conserving agents to be used in composition according to the invention are compounds chosen from the group to which belongs m-cresole, phenol or their mixtures.
New derivatives, similarly to recombined normal human insulin, are stabilised by addition of zinc ions, introduced into the solution in the form of, among other, zinc chloride or oxide. Amount of the zinc can range from around 5 μg/ml to around 150 μg/ml.
A following example of a content of the composition containing derivatives of recombined human insulin according to the invention has been developed: 10-500 u/ml of biosynthetic analogue of human insulin of formula 1 or its pharmacologically acceptable salt, 16 mg/ml of glycerine, 2.7-3 mg/ml m-cresole, 10-50 μg/ml of zinc and water for injection to 1 ml.
To better explain the essence of the invention this description has been extended with a detailed discussion of examples of the invention's realisation, which encompasses also enclosed list of sequences and figures, of which:
FIG. 1 presents structure of plasmid p5/ZUINSGly(22A) containing a gene encoding GKR protein of recombined insulin.
FIG. 2 presents nucleotide and amino acid sequence of plasmid p5/ZUINSGly(22A).
FIG. 3 presents structure of plasmid p6/ZUINSSer(22A) containing a gene encoding insulin SKR protein.
FIG. 4 presents nucleotide and amino acid sequence of plasmid p6/ZUINSSer(22A).
FIG. 5 presents influence of single dose administration of GKR insulin (in the dose of 5 u/kg of body mass on glucose concentration in blood of normoglycaemic rats, compared with preparation of Gensulin N. Average values±SEM. Statistical significance **p<0.01: Insulin GKR vs. initial glucose concentration; ##p<0.01, #p<0.05: Gensulin N vs. initial glucose concentration; ^^p<0.01: Insulin GKR vs. Gensulin N.
FIG. 6 presents influence of single dose administration of GKR insulin (in dose of 5 u per kg of body mass) on glucose concentration in blood of rats with mild streptozotocin-induced diabetes (in comparison with Lantus preparation). 0—fixed hyperglycaemia; control—physiological salt solution 10 μl /200 g bm. Statistical significance: **p<0.01*p<0.05 GKR vs. Lantus;
FIG. 7 presents influence of single dose administration of GKR insulin (in doses of 2.5 u, 5u and 7.5 u per kg of body mass) on glucose concentration in blood of rats with severe streptozotocin-induced diabetes. 0—fixed hyperglycaemia; control—physiological salt solution 10 μl/200 g bm. Statistical significance: **p<0.01*p<0.05 GKR 2.5 u vs control; ^^p<0.01 ^p<0.05 GKR 5 u vs control; ##p<0.01 #p<0.05 GKR 7.5 u vs control
FIG. 8 presents influence of single dose administration of GKR insulin (in dose of 7.5 u per kg of body mass) on glucose concentration in blood of rats with severe streptozotocin-induced diabetes (in comparison with Lantus preparation). 0—fixed hyperglycaemia; control—physiological salt solution 10 μl/200 g bm. Statistical significance: **p<0.01, *p<0.05 GKR vs. Lantus;
FIG. 9 presents glucose concentration in blood of rats after multiple administrations of GKR insulin in doses of 5 u per kg of body mass in a model of mild streptozotocin-induced diabetes (in comparison with Lantus preparation); 0—fixed hyperglycaemia; control—physiological salt solution 10 μl/200 g bm.
FIG. 10 presents glucose concentration in blood of rats in the period after stopping administration of GKR insulin in dose of 5 u per kg of body mass in a model of mild streptozotocin-induced diabetes (in comparison with Lantus preparation);
FIG. 11 presents influence of single dose administration of GR insulin (in doses of 10 u per kg of body mass) on glucose concentration in blood of rats with moderate streptozotocin-induced diabetes compared with Lantus preparation. 0—fixed hyperglycaemia; control—physiological salt 10 μl/200 g bm. 0—fixed hyperglycaemia; control—physiological salt solution 10 μl/200 g bm. Statistical significance: **p<0.01, *p<0.05 GR vs. Lantus;
FIG. 12 presents influence of single dose administration of GEKR insulin (in dose of 10 u per kg of body mass) on glucose concentration in blood of rats with moderate streptozotocin-induced diabetes compared with Levemir preparation. 0—fixed hyperglycaemia;
EXAMPLE 1 Construction of p5/ZUINSGly(22A) Plasmid and Obtaining of a Strain Transformed with this Plasmid.
To construct a gene encoding recombined INSGly(22A) proinsulin there was used p5/ZUINS plasmid, in which a DNA fragment encoding recombined insulin precursor is added to a modified gene of synthetic ubiquitin. In the ubiquitin gene arginine codons have been replaced with alanine codons and to the C terminus of ubiquitin gene there has been added aditional arginine codon. Peptide which constitutes part of ubiquitin is a carrier for insulin precursor, and is a condition for high efficiency of fusion protein synthesis in E. coll. The region encoding the modified fusion protein ubiquitin-human insulin is placed under control of pms (WO05066344 A2) promoter. The plasmid carries ampicillin resistance gene. For construction of p5/ZUINS vector there was used pIGAL1 plasmid, whose sequence deposited in Gene Bank has number AY424310.
The recombined INSGly(22A) proinsulin gene differs from the model human proinsulin gene in such a way, that it has attached additional GGT codon at C terminus of chain A. In result amino acid sequence of chain A is being elongated at position 22 with Gly-lycine-amino acid residue.
In order to modify the gene encoding human recombined proinsulin sequence by adding of GGT (Gly) codon at its C terminus, there were designed following primers for point mutagenesis reaction:
GLYG
5′ AACTACTGCAATGGT TAAGTCGACTCTAGC 3′
              Gly  STOP
GLYD
5′ GTAGCTAGAGTCGACTTAACCATTGCAG 3′
                   Gly

The point mutagenesis reaction was carried out using Stratagene kit (catalogue no 200518-5). As the template there has been used plasmid DNA p5/ZUINS. Escherichia coli DH5 a competent cells were transformed with reaction mixture. Plasmid p5/ZUINSGly(22A) has been isolated and sequenced in order to verify presence of GGT nucleotides encoding glycine and the validity of plasmid sequence. Plasmid with the modified gene encoding recombined p5/ZUINSGly(22A) proinsulin has been used in transformation of competent E. coli DH5α cells which were subsequently cultivated for 18 hours in LB medium with addition of ampicillin (0.01 mg/ml) in the volume of 500 ml, at 37° C., 200 rpm. Bacteria material has been prepared for strain bank, samples containing 1:1 bacterial cultures and 40% glycerol have been deposited at −70° C.
Obtained Escherichia coli strain constitutes the initial biological material in the process of obtaining GKR insulin via biosynthesis, according to Example 10.
Genetic construction of p5/ZUINSGly(22A) plasmid
Plasmid p5/ZUINSGly(22A) is 4775 base pairs long and is built of following regulatory sequences and genes:
    • from 374 by to 1234 by there is ampicillin resistance gene AMP R,
    • from 4158 by to 4323 by there is a region encoding pms promoter,
    • from 4327 by to 4554 by there is a sequence encoding modified synthetic ubiquitin gene ZUBI,
    • from 4558 by to 4722 by there is a sequence encoding the recombined INSGly(22A) proinsulin gene,
    • from 4729 by to 4775 by there is a region encoding transcription terminator Ter. Structure of p5/ZUINSGly(22A) plasmid containing the gene encoding recombined human insulin protein (GKR insulin) is shown schematically in FIG. 1, and its nucleotide and amino acid sequence at FIG. 2.
EXAMPLE 2 Construction of p5/ZUINSGly(22A)Arg(31 B) Plasmid and Obtaining a Strain Transformed with it.
In construction of recombined INSGly(22A)Arg(31 B) proinsulin gene there was used p5/ZUINSGly(22A) plasmid. The recombined INSGly(22A)Arg(31 B) gene is characterised by replacement of AAG (Lys) codon with CGT (Arg) codon at position 31 of chain B.
In order to modify the gene encoding sequence of recombined INSGly(22A) proinsulin there were designed following primers for point mutagenesis reaction:
ARGG
5′ CTAAAACACGTCGCGGCATCGTTGAACAG 3′
            Arg
ARGD
5′ CGATGCCGCGACGTGTTTTAGGAGTGTAG 3′
             Arg

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5α bacteria with p5/ZUINSGly(22A)Arg(31 B) plasmid have been performed as in Example 1. Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GR insulin via the biosynthesis according the Example 11.
EXAMPLE 3 Construction of p5/ZUINSSer(22A)Arg(31B) Plasmid and Obtaining of a Strain Transformed with it
To construct a gene of recombined INSSer(22A)Arg(31 B) proinsulin there was used p5/ZUINSGly(22A)Arg(31B) plasmid. The difference between the gene encoding recombined INSSer(22A)Arg(31B) proinsulin and the gene encoding recombined proinsulin INSGly(22A)Arg(31 B) is a replacement of GGT (Gly) codon with TCT (Ser) codon at position 22 of chain A.
In order to modify the gene encoding the sequence of recombined INSGly(22A)Arg(31B) proinsulin by replacement of GGT (Gly) with TCT (Ser) codon at position 22 of chain A, there were designed following primers for point mutagenesis reaction:
SERG
5′ CAATTCT TAAGGATCCTCTAG 3′
        Ser  STOP
SERD
5′ CTTAAGAATTGCAGTAGTTCTCCAG 3′
       Ser

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5α bacteria with p5/ZUINSSer(22A)Arg(31 B) plasmid have been performed as in Example 1.
Obtained Escherichia coli strain is the initial biological material in the process of manufacturing SR insulin via biosynthesis according to Example 12.
EXAMPLE 4 Construction of p5/ZUINSAla(22A) Plasmid and Obtaining of astrain Transformed with it.
To construct a gene of recombined INSAla(22A) proinsulin there has been used 5/ZUINS plasmid. The difference between the gene of recombined INSAla(22A) proinsulin and the model human proinsulin gene is addition of GCT codon to the C terminus of chain A of the former. In result the amino acid sequence of chain A is elongated at position 22 with Ala-alanine amino acid residue.
In order to modify the gene encoding the sequence of recombined human insulin by addition of GCT (Ala) codon at its C terminus, there were designed following primers for point mutagenesis:
ALAG
5′ CAATGCT TAAGGATCCTCTAG 3′
        Ala  STOP
ALAD
5′ CTTAAGCATTGCAGTAGTTCTCCAG 3′
       Ala

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5α bacteria with p5/ZUINSAla(22A) plasmid have been performed as in Example 1.
Obtained Escherichia coli strain is the initial biological material in the process of manufacturing AKR insulin via biosynthesis according to Example 13.
EXAMPLE 5 Construction of p5/ZUINSGly(22A)Glu(3B) Plasmid and Obtaining of a Strain Transformed with it
To construct a gene of recombined p5/ZUINSGly(22A)Glu(3B) proinsulin there was used p5/ZUINSGly(22A) plasmid. The difference between the gene encoding recombined INSGly(22A)Glu(3B) proinsulin and the gene encoding recombined INSGly(22A) proinsulin is a replacement of AAC (Asn) codon with GAA (Glu) codon at position 3 of chain B.
In order to modify the gene encoding the sequence of recombined INSGly(22A) proinsulin by replacement of AAC (Asn) with GAA (Glu) codon at position 3 of chain B, there were designed following primers for point mutagenesis reaction:
GLUG
5′ GTCGAACAGCACCTGTGTGGTTC 3′
       Glu
GLUD
5′ GCTGTTCGACAAAACGAGGACCTGC 3′
       Glu

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5α bacteria with p5/ZUINSGly(22A)Glu(31 B) plasmid have been performed as in Example 1.
Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GEKR insulin via biosynthesis according to Example 14.
In examples 1-5 as the plasmid hosts there have been used DH5α E. coli bacteria, but in described above, model realisation of the invention there can be used also other E. coli strains, for example DH5 or HB101.
EXAMPLE 6 Construction of p6/ZUINSSer(22A) Plasmid and Obtaining of a Strain Transformed with it
To construct a gene encoding recombined INSSer(22A) proinsulin there was used p6/ZUINS plasmid, in which DNA fragment encoding precursor of recombined insulin is appended to modified gene encoding synthetic ubiquitin. In the ubiquitin-encoding gene arginine codons have been replaced with alanine codons and to the C terminus of ubiquitin gene there has been added an additional arginine codon. The peptide constituting part of ubiquitin is a carrier for insulin precursor, which conditions high efficiency of fusion protein expression in E. coli. The region encoding the modified ubiquitin-human insulin fusion protein is placed under control of pms promoter (WO05066344 A2). The plasmid carries tetracycline resistance gene. To construct p6/ZUINS vector there has been used p5/ZUINS plasmid.
The difference between the gene encoding recombined INSSer(22A) proinsulin and the model human proinsulin gene is that the former has appended additional TCT codon at C terminus of chain A. In result amino acid sequence of chain A is elongated at position 22 with Ser-serine amino acid residue.
In order to modify the gene encoding the sequence of recombined proinsulin by appending TCT (Ser) codon at its C terminus, there were designed following primers for point mutagenesis reaction:
SKRG
5′ GAACTACTGCAATTCT TAAGTCGA 3′
                 Ser  STOP
SKRD
5′ TAGAGTCGACTTAAGAATTGCAGTA 3′
                Ser

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction, as the template has been used p6/ZUINS plasmid DNA. Escherichia coli DH5α competent cells have been transformed with the reaction mixture. p6/ZUINSSer(22A) plasmid has been isolated and sequenced in order to verify presence of TCT nucleotides encoding serine and correctness of the plasmid sequence. The plasmid with the modified gene encoding p6/ZUINSSer(22A) proinsulin has been used to transform E. coli DH5α bacteria. Subsequently the bacteria were cultivated for 18 hours in LB media with addition of tetracycline (0.01 mg/ml) in 500 ml volume at 37° C., 200 rpm. Bacteria material has been preparated for strain bank samples containing 1:1 bacterial cultures and 40% glycerol have been deposited at −70° C.
Obtained Escherichia coli strain constitutes initial biological material in the process of manufacturing SKR insulin via biosynthesis according to Example 15.
Genetic construction of p6/ZUINSSer(22A) plasmid
p6/ZUINSSer(22A) plasmid is 4911 base pairs long and is made of following regulatory sequences and genes:
    • from 146 by to 1336 by there is a tetracycline resistance gene TET R,
    • from 4304 by to 4469 by there is a region encoding pms promoter,
    • from 4473 by to 4703 by there is a region encoding the gene encoding the modified synthetic ubiquitin; there are following modifications: replacement of arginine amino acid at positions 42, 54, 72, 74 in the ubiquitin gene with alanine and addition of arginine at position 77 which allows to remove the ubiquitin,
    • from 4704 by to 4868 by there is a sequence encoding the gene encoding recombined INSSer(22A) proinsulin,
    • from 4875 by to 4911 by there is a region encoding transcription terminator Ter.
Structure of p6/ZUINSSer(22A) plasmid containing the gene encoding recombined human insulin protein (SKR protein) is shown schematically in FIG. 3, and its nucleotide and amino acid sequence in FIG. 4.
EXAMPLE 7 Construction of p6/ZUINSGly(22A) Plasmid and Obtaining of astrain Transformed with it.
To construct a gene encoding recombined INSGly(22A) proinsulin there was used p6/ZUINS plasmid, in which DNA fragment encoding precursor of recombined insulin is appended to modified gene encoding synthetic ubiquitin.
The difference between the gene encoding recombined INSGly(22A) proinsulin and the model human proinsulin gene is that the former has appended additional GGT codon at C terminus of chain A. In result amino acid sequence of chain A is elongated at position 22 with Gly—glycine amino acid residue.
In order to modify the gene encoding the sequence of recombined human proinsulin by appending GGT (Gly) codon at its C terminus, there were designed following primers for point mutagenesis reaction:
GLYG
5′ AACTACTGCAATGGT TAAGTCGACTCTAGC 3′
                Gly  STOP
GLYD
5′ GTAGCTAGAGTCGACTTAACCATTGCAG 3′
                     Gly

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5 bacteria with p6/ZUINSGly(22A) plasmid have been performed as in Example 6.
Obtained Escherichia coli strain constitutes initial biological material in the process of manufacturing GKR insulin via biosynthesis according to Example 16.
EXAMPLE 8 Construction of p6/ZUINSGly(22A)Glu(3B) Plasmid and Obtaining of a Strain Transformed with it.
To construct a gene of recombined INSGly(22A)Glu(3B) proinsulin there has been used p6/ZUINSGly(22A) plasmid. The difference between the gene of recombined INSGly(22A)Glu(3B) proinsulin and the recombined INSGly(22A) proinsulin gene is replacement of AAC (Asn) codon with GAA (Glu) codon at position 3 of chain B.
In order to modify the gene encoding the sequence of recombined INSGly(22A) proinsulin by replacement of AAC (Asn) codon with GAA (Glu) codon at position 3 in chain B, there were designed following primers for point mutagenesis:
GLUG
5′ GTCGAACAGCACCTGTGTGGTTC 3′
      Glu
GLUD-2
5′ CACAGGTGCTGTTCGACAAAACGACC 3′
              Glu

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5 bacteria with p6/ZUINSGly(22A)Glu(31 B) plasmid have been performed as in Example 6.
Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GEKR insulin via biosynthesis according to Example 17.
EXAMPLE 9 Construction of p6/ZUINSGly(22A)Arg(31B) Plasmid and Obtaining of a Strain Transformed with it
To construct a gene of recombined INSGly(22A)Arg(31B) proinsulin there has been used p6/ZUINSGly(22A) plasmid. The gene encoding recombined INSGly(22A)Arg(31B) proinsulin is characterised by this, that it has replaced AAG (Lys) codon with CGT (Arg) codon at position 31 of chain B.
In order to modify the gene encoding the sequence of recombined INSGly(22A) proinsulin there were designed following primers for point mutagenesis:
ARGG
5′ CTAAAACACGTCGCGGCATCGTTGAACAG 3′
            Arg
ARGD
5′ CGATGCCGCGACGTGTTTTAGGAGTGTAG 3′
             Arg

Stratagene kit (cat. no 200518-5) has been used to conduct point mutagenesis reaction. Isolation, verification of validity of plasmid nucleotide sequence and obtaining E. coli DH5 bacteria with p6/ZUINSGly(22A)Arg(31B) plasmid have been performed as in Example 6.
Obtained Escherichia coli strain is the initial biological material in the process of manufacturing GR insulin via biosynthesis according to Example 18.
EXAMPLE 10 Manufacturing of GKR Insulin
GKR insulin has been manufactured in a biosynthesis process realised in the classical way (inoculum, seed culture, production culture) using Escherichia coli strain with a DNA fragment encoding GKR insulin precursor obtained according to Example 1. Production cultivation has been conducted in 150 dm3 fermentation tank for 20 hours at 37° C., controlling pH, temperature, optical density, glucose concentration and aeration. In the fermentation conditions GKR analogue has been produced intracellulary in inclusion bodies. After the end of fermentation the fermentation broth has been concentrated and subsequently digested with lysosyme and bacterial cells have been subjected to disintegration. Obtained suspension has been diluted with water and after incubation with Triton centrifuged. Created raw deposit of inclusion bodies was initially purified, finally obtaining inclusion bodies homogenate.
The obtained homogenate has been dissolved (10-15 mg/cm3) in the solution of sodium carbonate with addition of EDTA, subjected to renaturation and, for protection of lysine free amino groups, subjected to reversible process of citraconylation in a reaction with citraconic anhydride. The dissolved protein had been subjected to trypsine digestion in order to cleave the leader protein out and to cleave the insulin chains. In the result of trypsine activity there was obtained GKR insulin. The solution after digestion with trypsine has been subjected to purification with low pressure liquid chromatography on DEAE Sepharose FF gel, and subsequently diafiltration and concentration—second low pressure liquid chromatography on Q Sepharose FF gel. Main fraction has been subjected to purification with high pressure liquid chromatography on Kromasil-RPC8 100A 10μm gel. Main fraction has been concentration using dialysis to concentration of 30-40 mg/cm3 and purified GKR insulin has been separated by crystallisation, using sodium citrate, zinc acetate, citric acid. From one batch of inclusion bodies has been obtained about 5.4 g of crystallised GKR insulin of HPLC purity 97%.
The product's structure has been confirmed by following data:
    • molecular mass determined by mass spectroscopy is equal to 6149 and conforms to the theoretical value (6149.1);
    • peptide map: conforms;
    • sequence and amino acid composition: conforming to theoretical.
      Isoelectric point determined by capillary electrophoresis is 7.19.
EXAMPLE 11 Manufacturing of GR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding GR insulin precursor, obtained in accordance with Example 2, there has been obtained from analogous batch of inclusion bodies 5.2 g of GR insulin of HPLC purity equal to 97.5%.
Product's structure has been confirmed by following data:
    • molecular mass determined by mass spectroscopy equals 6021 and conforms to theoretical value (6020.9);
    • peptide map: conforms,
    • sequence and amino acid composition: conform to theoretical.
      Isoelectric point: 6.39.
EXAMPLE 12 Manufacturing of SR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding SR insulin precursor, obtained in accordance with Example 3, there has been obtained from analogous batch of inclusion bodies 5.5 g of SR insulin of HPLC purity equal to 97%.
Product's structure has been confirmed by following data:
    • molecular mass determined by mass spectroscopy equals 6051 and conforms to theoretical value (6050.9);
    • peptide map: conforms,
      Isoelectric point: 6.55.
EXAMPLE 13 Manufacturing of AKR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding AKR insulin precursor, obtained in accordance with Example 4, there has been obtained from analogous batch of inclusion bodies 4.7 g of AKR insulin of HPLC purity equal to 96.5%.
Product's structure has been confirmed by following data:
    • molecular mass determined by mass spectroscopy equals 6163 and conforms to theoretical value (6163.1);
    • peptide map: conforms.
      Isoelectric point: 7.07.
EXAMPLE 14 Manufacturing of GEKR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding GEKR insulin precursor, obtained in accordance with Example 5, there has been obtained from analogous batch of inclusion bodies 5.0 g of GEKR insulin of HPLC purity equal to 97.5%.
Product's structure has been confirmed by following data:
    • molecular mass determined by mass spectroscopy equals 6164 and conforms to theoretical value (6164.1);
    • peptide map: conforms.
      Isoelectric point: 6.29.
EXAMPLE 15 Manufacturing of SKR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding SKR insulin precursor, obtained in accordance with Example 6, there has been obtained from analogous batch of inclusion bodies 5.3 g of SKR insulin of HPLC purity equal to 98%.
Product's structure has been confirmed by following results:
    • molecular mass determined by mass spectroscopy equals 6179 and conforms to theoretical value (6179.1);
    • peptide map: conforms,
      Isoelectric point: 7.05.
EXAMPLE 16 Manufacturing of GKR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding GKR insulin precursor, obtained in accordance with Example 7, there has been obtained from analogous batch of inclusion bodies 6.3 g of GKR insulin of HPLC purity equal to 95.5%.
Remaining properties of the product (GKR insulin) as in Example 10.
EXAMPLE 17 Manufacturing of GEKR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding GEKR insulin precursor, obtained in accordance with Example 8, there has been obtained from analogous batch of inclusion bodies 6.0 g of GEKR insulin of HPLC purity equal to 97%.
Remaining properties of the product (GEKR insulin) as in Example 14.
EXAMPLE 18 Manufacturing of GR Insulin
Proceeding analogously to Example 10, using Escherichia coli strain with DNA fragment encoding GR insulin precursor, obtained in accordance with Example 9, there has been obtained from analogous batch of inclusion bodies 5.5 g of GR insulin of HPLC purity equal to 96.5%.
Remaining properties of the product (GR insulin) as in Example 11.
EXAMPLE 19 Manufacturing of ZKR Insulin
To 1000 ml of GKR insulin solution manufactured according to Example 10 or 16 (concentration 0.1 mg/ml), in 100 mM MES/KOH buffer pH 5.0-5.5 there has been added 1 μM CuSO4, 100 μg/ml catalase, 5 mM ascorbic acid and 2 μM PAM enzyme (obtained according to Satani M., Takahashi K., Sakamoto H., Harada S., Kaida Y., Noguchi M.; Expression and characterization of human bifunctional peptidylglycine alpha-amidating monooxygenase. Protein Expr Purif. 2003 Apr; 28(2):293-302.), and subsequently mixture have been left for 2 hours at 37° C. The reaction has been stopped by addition of 1 mM Na2EDTA.
After filtration the obtained solution has been subjected to purification with ion-exchange chromatography and HPLC methods.
Main fraction containing ZKR insulin concentrated and subjected to crystallisation using sodium citrate, zinc citrate, citric acid. From one batch of reaction mixture there has been obtained about 10 mg of crystalline ZKR insulin of HPLC purity of 97%.
Product's structure has been confirmed by following results:
    • molecular mass determined by mass spectroscopy equals 6091 and conforms to theoretical value (6091.1);
    • peptide map: conforms.
      Isoelectric point: 7.54.
Example 20 Manufacturing of ZR Insulin
To 100 ml of GR insulin solution, manufactured according to Example 11 or 18 (2 mg/ml), in 100 mM MES/KOH buffer, pH 4.5, there has been added 1 μM CuSO4, 100 μg/ml catalase, 5 mM ascorbic acid and 2 μM PAM enzyme, and subsequently the solution has been mildly mixed for 1 hour at 37° C. The reaction has been stopped by addition of 1 mM Na2EDTA. The solution after reaction with PAM has been subjected to purification by ion-exchange and HPLC methods.
The main fraction containing insulin concentrated and subjected to crystallisation using sodium citrate, zinc citrate, citric acid. From one batch of reaction mixture there was obtained 22 mg of crystalline ZR insulin of HPLC purity of 98%.
Product's structure has been confirmed by following results:
    • molecular mass determined by mass spectroscopy equals 5963 and conforms to theoretical value (5962.9);
    • peptide map: conforms.
      Isoelectric point: 6.97.
EXAMPLE 21 Manufacturing of pharmaceutical preparation of GKR insulin (100 u/ml)
There was made 100 ml of pharmaceutical preparation of GKR insulin (100 u/ml) of following composition (values per 1.0 ml):
GKR insulin 3.69 mg/ml (as 100% substance, 100 u/ml)
(Example 16)
m-cresol 2.7 mg/ml
anhydrous glycerine 16 mg/ml
zinc 30 μg/ml
water for injection to 10 ml
pH 4.5
Preparation Procedure was as Follows:
There were made two following solutions:
Solution 1
  • Zinc oxide in amount necessary to reach the final concentration of Zn ions of 30 μg/ml were dissolved in 40 ml of 10 mM hydrochloric acid. After that, to obtained solution was added insulin GKR in amount corresponding to 10 000 u of insulin GKR, under mild stirring until obtaining a clear solution and then pH adjusted to value 4,5.
    Solution 2
  • Separately, 270 mg of m-cresol and 1600 ml of anhydrous glycerol were dissolved in 40 ml water for injection.
    Mixing of solutions 1 and 2
  • Solution 1 was added under stirring to Solution 2, supplemented with water for injection to volume 100 ml and in case of need corrected pH to value 4,5 with 10 mM hydrochloric acid or 0.2 M solution of sodium hydroxide. Resulting mixture was in sterile condition filtered through 0.22 pm filter and aliquoted into glass 3 ml vials. It was determined that the preparation containing GKR insulin (100 u/ml) exhibits stability in room temperature investigated period of 56 days, in the accelerated stability test (Example 24).
EXAMPLE 22 Manufacturing of Pharmaceutical Preparation of GR Insulin (100 u/ml)
There was made 100 ml of pharmaceutical preparation of GR insulin (100 u/ml) of the following composition (values per 1.0 ml):
GR insulin 3.61 mg/ml (as 100% substance, 100 u/ml)
(Example 11)
m-cresol 2.7 mg/ml
anhydrous glycerine 16 mg/ml
zinc 30 μg/ml
injection water up to 1.0 ml
pH 4.0

The procedure was identical as in Example 21, apart of that that instead of GKR insulin there was used GR insulin (in the amount of 361 mg, 10 000 u) and that the final value of pH was 4.0.
EXAMPLE 23 Manufacturing of Pharmaceutical Preparation of GEKR Insulin (100 u/ml)
There was made 100 ml of pharmaceutical preparation of GEKR insulin (100 u/ml) of the following composition (values per 1.0 ml):
GEKR insulin 3.70 mg/ml (as 100% substance, 100 u/ml)
(Example 14)
m-cresol 2.7 mg/ml
anhydrous glycerine 16 mg/ml
zinc 30 μg/ml
injection water up to 1.0 ml
pH 4.0

The procedure was identical as in Example 21, apart of that that instead of GKR insulin there was used GEKR insulin (in the amount of, 10 000 u) and that the final value of pH was 4.0.
EXAMPLE 24 Examination of Accelerated Stability of Pharmaceutical Preparation of GKR insulin (100 u/ml)
Pharmaceutical preparation of GKR insulin (100 u/ml), made according to Example 21, has been subjected to examination of accelerated stability (25° C.±2° C.). During this examination there were performed analysis of purity and level of protein contamination. Below there are exhibited HPLC purity of the product (GKR insulin) and the proportional contribution: highest single contamination, deamido derivative and polymers, in HPLC test, in time points of: “0”, 28, 42 and 56 days.
HPLC purity test “0” 28 days 42 days 56 days
Main peak [%] 95.10 94.33 93.98 93.60
Highest single  1.07  1.70  1.72  1.98
contamination [%]
Deamido [%]  0.28  0.37  0.32  0.36
Polymers [%]  0.17  0.37  0.44  0.48
EXAMPLE 25 Examination of Accelerated Stability of Pharmaceutical Preparation of GEKR Insulin (100 u/ml)
Pharmaceutical preparation of GEKR insulin (100 u/ml), made according to Example 23, has been subjected to examination of accelerated stability (25° C.±2° C.). During this examination there were performed analysis of purity and level of protein contamination. Below there are exhibited HPLC purity of the product (GEKR insulin) and the proportional contribution: highest single contamination, and polymers, in HPLC test, in time points of: “0”, and 14 days and 1, 2 and 3 months.
HPLC purity test “0” 14 days 1 months 2 months 3 months
Main peak[%] 97.33 97.14 96.42 94.55 94.41
Highest single  0.55  0.45  0.67  1.08  1.26
contamination [%]
Polymers[%] not  0.09 not  0.50 not
deter- deter- deter-
mined mined mined
EXAMPLE 26 Determination of GKR Activity on Normoglycaemic Animals
Recombined human insulin analogue (GKR insulin), similarly to Gensulin N (recombined isophane human insulin) exhibits prolonged activity time, and hypoglycaemic of normoglycaemic rats has similar course. Significant differences in hypoglycaemic activity of both preparations have been observed in 0.5 and 1 hour after administration. In this time there is observed fast and deep decrease of glucose concentration after GKR insulin. Peak activity of GKR insulin and Gensulin N is in 2nd hour.
Initial research confirmed that GKR insulin is an active analogue of prolonged hypoglycaemic activity. Decrease in glucose level after GKR insulin administration was observed for up to 12 hours, while levels of glucose after 24 hours were similar to initial. Results of reaction of normoglycaemic rats to single administration of GKR insulin and
Gensulin N preparations (taking into account mean values±SEM) are shown in Table 1 and FIG. 5.
EXAMPLE 27 Determination of GKR Insulin Activity on Animals with Experimental Diabetes
Studies on experimental model of rat diabetes (induction with streptozotocin) confirmed irrefutably hypoglycaemic activity of GKR insulin. This activity has properties of prolonged activity.
After single dose administration, the lowering of glucose concentration in blood of the examined rats remains statistically significant up to 8th-10th hour (depending on intensity of diabetes and dose), in comparison with control. During the research there was demonstrated faster beginning of activity and faster achieving of peak activity (beginning 30 mins, peak 1-2 hours) by GKR insulin compared to the reference preparation—insulin glargine (Lantus). Statistical significance of this phenomenon has been confirmed in severe and moderate diabetes.
Also the research of multiple dose administration of GKR insulin and the reference preparation of insulin glargine demonstrated similar activity of that both analogues. Administered for 21 days, three times per day, preparations caused improvement of glycaemy parameters in mild diabetes and, in principle, did not differ statistically in the intensity of the effect. The only difference was noticeably more equalised activity profile of GKR insulin.
Additionally there was observed very interesting phenomenon of long-lasting hypoglycaemic effect after termination of administration of GKR preparation. This observation has been conducted on 9 rats treated with GKR preparation and 3 treated with Lantus, of the group with mild diabetes, who were administered analogues in the dose of 5 u/kg bm for 21 days. Obtained results can be an evidence of existence of very strong bounding of GKR insulin in tissues (possibly subcutaneous tissue). They support thesis of existence of compartment, in which insulin is accumulated and slowly redistributed. This phenomenon was not observed for the reference preparation. This property, after its confirmation in humans, could be a breakthrough in therapy with prolonged activity insulin analogues, allowing e.g. administration of less than one dose of the medicine per day.
The results describing glucose concentration in rat blood after single dose administration of GKR insulin in the dose of 5 u/kg bm in the mild streptozotocin-induced diabetes model (in comparison with Lantus preparation) are shown in Table 2 and FIG. 6.
The results describing influence of GKR insulin on glucose concentration in rat blood after single dose one-time administration of doses 2.5 u/kg bm, 5 u/kg bm and 7.5 u/kg bm in severe streptozotocin-induced diabetes model (in comparison with Lantus preparation and control) are shown in Table 3.
The results presenting influence of GKR insulin on glucose concentration in rat blood after single dose administration of doses 2.5 u/kg bm, 5 u/kg bm and 7.5 u/kg bm in severe streptozotocin-induced diabetes model (in comparison with control) are shown in FIG. 7.
The results presenting influence of GKR insulin on glucose concentration in rat blood after single dose administration of 7.5 u/kg bm in severe streptozotocin-induced diabetes model (in comparison with Lantus preparation) are shown in FIG. 8.
The results describing glucose concentration in rat blood after multiple dose administrations of 5 u/kg bm of GKR insulin in mild streptozotocin-induced diabetes model (in comparison with Lantus preparation) are shown in Table 4 and FIG. 9.
The results describing glucose concentration in rat blood after termination of administrations of 5 u/kg bm of GKR insulin in mild streptozotocin-induced diabetes model (in comparison with Lantus preparation) are shown in Table 5 and FIG. 10.
TABLE 1
Influence of single dose administration of GKR insulin (in the dose of 5 u/kg bm) on glucose concentration in
blood of normoglycaemic rats, in comparison with Gensulin N (isophane recombined human insulin).
Glucose concentration in blood [mg/dl]* Number
Before of
Tested Dose administra- time of determination in hours after administration animals
preparation [u/kg bm] tion 0.5 1 2 4 6 8 10 12 in groups
GKR 5 87.5 ± 1.0 45.3 ± 3.64** 32.8 ± 1.3** 26.7 ± 41.2 ± 58.2 ± 60.7 ± 59.6 ± 65.8 ± 10***
insulin {circumflex over ( )}{circumflex over ( )} {circumflex over ( )}{circumflex over ( )} 3.5** 4.1** 2.0** 2.9** 1.9** 2.7**
Gensulin N 2 87.6 ± 3.7 81.2 ± 4.2 55.6 ± 4.3## 39.1 ± 33.8 ± 46.8 ± 51.3 ± 65.3 ± 70.7 ± 10
4.4## 5.1## 5.4## 5.0## 3.2## 3.5##
0.9% NaCl Volume 91.5 ± 2.0 87.0 ± 2.1 88.7 ± 1.7 88.9 ± 87.4 ± 88.7 ± 93.0 ± 91.3 ± 93.0 ± 10
solution s.c., 3 ml/ 2.0 3.2 2.2 2.0 2.2 2.9
control 300 g bm
Experimental groups n = 10; *mean values ± SEM;
Statistical significance **p < 0.01 GKR insulin vs. initial glucose concentration; ##p < 0.01, #p < 0.05 Gensulin N vs. initial glucose concentration; {circumflex over ( )}{circumflex over ( )}p < 0.01 GKR insulin 5 u/kg bm vs. Gensulin N 2 u/kg bm.
**Noted death of one animal in the 2nd hour.
TABLE 2
Influence of single dose administration of GKR insulin in a dose of 5 u/kg bm on glucose concentration in blood of
rats with mild streptozotocyn-induced diabetes, compared with Lantus preparation (insulin glargine).
num-
ber concentration of glucose in rat blood mean value (mg/dl) ± SEM
Test- of fixed
ed rats hyper-
prep- in normo- glycae- time of blood sampling after single dose administration of the preparation
diabetes ara- dose the glycae- my (hours)
model tion s.c. group my 0 0.5 1 2 4 6 8 10 12 24 36
mild GKR 5 u/ 20 82.5 ± 250.7 ± 115.6 ± 84.1 ± 93.3 ± 106.7 ± 117.0 ± 130.3 ± 142.0 ± 173.4 ± 209.2 ± 218.2 ±
strepto- kg 3.0 22.2 16.1{circumflex over ( )}{circumflex over ( )} 7.8{circumflex over ( )}{circumflex over ( )} 4.8{circumflex over ( )}{circumflex over ( )} 7.2{circumflex over ( )}{circumflex over ( )} 4.9**{circumflex over ( )}{circumflex over ( )} 6.9{circumflex over ( )}{circumflex over ( )} 7.9{circumflex over ( )}{circumflex over ( )} 18.6 20.4 16.8
zotocyn- Lan- bm 9 103.6 ± 229.2 ± 135.6 ± 72.6 ± 69.7 ± 77.9 ± 76.8 ± 106.1 ± 128.2 ± 199.8 ± 224.3 ± 228.7 ±
induced - tus 2.9 32.5 27.1 5.2 8.4 6.8 5.7 6.0 13.1 36.6 28.8 29.7
32 mg/ con- 10 9 91.3 ± 236.1 ± 222.2 ± 205.3 ± 207.4 ± 203.4 ± 205.9 ± 212.0 ± 213.6 ± 213.2 ± 214.8 ± 215.7 ±
kg bm., trol nl/ 5.9 7.7 24.8 21.5 21.8 20.4 21.3 24.1 23.1 25.6 23.0 24.7
i.m.) 200 g
bm
Statistical significance:
**p < 0.01
*p < 0.05 GKR vs. Lantus
{circumflex over ( )}{circumflex over ( )}p < 0.01
{circumflex over ( )}p < 0.05 GKR vs. control
TABLE 4
Influence of multiple administrations of GKR insulin at a dose of 5 u/kg bm on glucose concentration in blood of rats with mild
streptozotocin-induced diabetes compared with Lantus preparation (insulin glargine).
number glucose concentration in blood of the rats, mean value (mg/dl) ± SEM
Tested of rats normo- fixed
prepa- in the gly- hyper- consecutive days of study
ration group caemia glycaemia 1 2 3 4 5 6 7 8 9 10
GKR 20 82.5 ± 198.1 ± 155.4 ± 156.8 ± 157.7 ± 148.1 ± 144.1 ± 151.6 ± 156.6 ± 152.9 ± 147.0 ± 152.3 ±
5 u/kg bm 3.0 12.1 7.1{circumflex over ( )}{circumflex over ( )} 6.2{circumflex over ( )}{circumflex over ( )} 7.4{circumflex over ( )}{circumflex over ( )} 4.5**{circumflex over ( )}{circumflex over ( )} 5.3{circumflex over ( )}{circumflex over ( )} 5.5{circumflex over ( )}{circumflex over ( )} 6.0{circumflex over ( )}{circumflex over ( )} 5.7{circumflex over ( )}{circumflex over ( )} 3.2{circumflex over ( )}{circumflex over ( )} 3.8{circumflex over ( )}{circumflex over ( )}
Lantus 9 103.6 ± 228.9 ± 136.3 ± 147.0 ± 173.7 ± 184.9 ± 163.7 ± 171.4 ± 175.8 ± 168.4 ± 142.9 ± 160.4 ±
5 u/kg bm. 2.9 30.7 8.1 9.0 10.4 12.7 11.2 10.4 8.8 15.7 20.3 14.4
control 5 88.8 ± 243.4 ± 229.4 ± 232.6 ± 227.0 ± 254.4 ± 257.0 ± 247.0 ± 258.0 ± 257.0 ± 259.8 ± 252.0 ±
10 nl/ 9.4 4.7 13.3 10.6 9.9 9.1 8.2 32.7 6.7 7.9 12.4 6.7
200 g bm
number glucose concentration in blood of the rats, mean value (mg/dl) ± SEM
Tested of rats normo- fixed
prepa- in the gly- hyper- consecutive days of study
ration group caemia glycaemia 11 12 13 14 15 16 17 18 19 20 21
GKR 20 82.5 ± 198.1 ± 152.6 ± 153.6 ± 149.7 ± 151.5 ± 151.1 ± 149.0 ± 142.7 ± 143.0 ± 149.7 ± 149.9 ± 149.2 ±
5 u/kg bm. 3.0 12.1 2.3{circumflex over ( )}{circumflex over ( )} 2.9{circumflex over ( )}{circumflex over ( )} 3.1{circumflex over ( )}{circumflex over ( )} 3.3{circumflex over ( )}{circumflex over ( )} 3.4{circumflex over ( )}{circumflex over ( )} 5.6{circumflex over ( )}{circumflex over ( )} 3.2**{circumflex over ( )}{circumflex over ( )} 4.9{circumflex over ( )}{circumflex over ( )} 4.7{circumflex over ( )} 4.3{circumflex over ( )}{circumflex over ( )} 4.2*{circumflex over ( )}{circumflex over ( )}
Lantus 9 103.6 ± 228.9 ± 164.8 ± 170.6 ± 161.6 ± 144.0 ± 124.9 ± 156.7 ± 191.3 ± 141.0 ± 172.1 ± 145.7 ± 132.2 ±
5 u/kg bm. 2.9 30.7 13.9 19.3 15.6 18.3 14.7 7.5 19.1 11.4 33.1 15.1 8.9
control 5 88.8 ± 243.4 ± 248.4 ± 255.0 ± 260.0 ± 252.0 ± 249.6 ± 256.2 ± 255.0 ± 259.4 ± 233.6 ± 270.2 ± 268.8 ±
10 nl/ 9.4 4.7 8.4 5.5 11.7 14.9 20.4 8.8 19.4 16.7 11.4 11.0 3.7
200 g bm
Statistical significance:
**p < 0.01
*p < 0.05 GKR vs. Lantus
{circumflex over ( )}{circumflex over ( )}p < 0.01
{circumflex over ( )}p < 0.05 GKR vs. control
TABLE 5
Glucose concentration in the period after termination of administration of
GKR insulin in the dose of 5 u/kg bm in the model of mild streptozotocin-induced,
in comparison with Lantus preparation (insulin glargine).
glucose concentration in rat blood, mean value (mg/dl)
fixed days after termination of
Tested normo- hyper- in the last day administration of tested preparations
preparation glycaemia glycaemia of administration 1 2 3 5 8 11
GKR 5 u/kg 86.1 ± 3.7 214.4 ± 24.3 148.3 ± 8.5 146.4 ± 136.0 ± 137.4 ± 132.8 ± 123.2 ± 126.4 ±
bm 9.4 7.8 6.6 3.1 3.1 3.5
Lantus 5 u/kg 103.3 ± 1.2 254.0 ± 67.8 141.0 ± 18.2 282.3 ± 277.7 ± 235.0 ± 158.7 ± 195.3 ± 222.3 ±
bm 58.2 72.6 89.7 40.3 63.1 86.4
TABLE 3
Influence of single dose administration of GKR insulin (in dose of 2.5 u, 5 u and 7.5 u/kg bm) on glucose concentration
in blood of rats with severe streptozotocin-induced diabetes, compared with Lantus preparation (insulin glargine).
num-
ber glucose concentration in rat blood mean value (mg/dl) ± SEM
Test- of fixed
ed rats hyper-
prep- in normo- glycae- time of blood sampling after single dose administration of the preparation
diabetes ara- dose the glycae- mia (hours)
model tion s.c. group my 0 0.5 1 2 4 6 8 10 12 24 36
severe GKR 2.5 u/ 10 86.3 ± 570.8 ± 251.4 ± 170.2 ± 250.0 ± 377.4 ± 426.0 ± 463.1 ± 524.2 ± 560.1 ± 551.0 ± 576.4 ±
strepto- kg 3.4 20.1 41.2**{circumflex over ( )}{circumflex over ( )} 28.8**{circumflex over ( )}{circumflex over ( )} 37.8**{circumflex over ( )}{circumflex over ( )} 35.0**{circumflex over ( )}{circumflex over ( )} 36.9 42.1 45.3 33.0 40.2 22.7
zotocin- Lan- bm 10 84.4 ± 596.8 ± 376.5 ± 284.3 ± 134.55 ± 209.1 ± 314.6 ± 415.2 ± 502.6 ± 546.4 ± 537.6 ± 584.0 ±
induced - tus 3.8 3.1 24.3 28.7 22.9 34.4 52.4 40.0 25.5 17.5 23.2 25.8
45 mg/ GKR 5 u/ 11 84.7 ± 585.9 ± 235.3 ± 122.6 ± 119.6 ± 245.2 ± 367.4 ± 421.1 ± 483.5 ± 546.7 ± 594.4 ± 596.0 ±
kg bm, kg 4.0 7.5 32.0{circumflex over ( )}{circumflex over ( )} 21.1{circumflex over ( )}{circumflex over ( )} 11.6{circumflex over ( )}{circumflex over ( )} 26.7**{circumflex over ( )}{circumflex over ( )} 29.9**{circumflex over ( )}{circumflex over ( )} 33.8**{circumflex over ( )}{circumflex over ( )} 30.6 40.1 3.8 3.3
i.m.) Lan- bm 11 81.6 ± 572.9 ± 302.3 ± 173.4 ± 123.1 ± 131.3 ± 152.5 ± 262.2 ± 426.7 ± 502.6 ± 580.2 ± 594.6 ±
tus 3.2 12.6 42.7 33.7 21.4 10.9 14.6 36.7 39.8 26.5 10.5 3.1
GKR 7.5 u/ 10 89.0 ± 573.9 ± 259.1 ± 133.1 ± 109.2 ± 216.1 ± 280.6 ± 350.6 ± 508.7 ± 526.4 ± 571.0 ± 583.0 ±
kg 3.4 18.8 14.2*{circumflex over ( )}{circumflex over ( )} 19.3{circumflex over ( )}{circumflex over ( )} 11.8{circumflex over ( )}{circumflex over ( )} 32.6**{circumflex over ( )}{circumflex over ( )} 42.3{circumflex over ( )}{circumflex over ( )} 49.2{circumflex over ( )}{circumflex over ( )} 34.0 27.3 20.4 17.0
Lan- bm 10 82.4 ± 594.0 ± 335.4 ± 198.3 ± 106.1 ± 105.5 ± 188.7 ± 309.5 ± 402.6 ± 461.6 ± 596.8 ± 599.3 ±
tus 3.5 6.0 28.5 36.7 22.4 16.8 28.7 54.1 49.3 38.4 3.09 0.7
con- 10 μl/ 9 74 ± 3.6 592.1 ± 578.6 ± 594.2 ± 579.2 ± 548.8 ± 526.0 ± 547.3 ± 544.9 ± 575.3 ± 593.3 ± 594.3 ±
trol 200 5.4 10.2 5.4 13.0 23.5 25.5 23.7 14.0 12.4 6.7 2.6
g bm
Statistical significance:
**p < 0.01
*p < 0.05 GKR vs. Lantus
{circumflex over ( )}{circumflex over ( )}p < 0.01
{circumflex over ( )}p < 0.05 GKR vs. control
EXAMPLE 28 Determination of GR Insulin Activity in Animals with Experimental Diabetes
Hypoglycaemic activity of GR insulin has been confirmed in a moderate streptozotocin-induced diabetes in rats.
Activity of GR insulin after administration of single doses—5 u or 10 u/kg bm has been determined to be fast and strong. Beginning of activity occurs already after 30 minutes after administration of the preparation and remains at the same level up to 2 hours, and subsequently weakens until reaching initial levels in 24th-36th hour.
Results describing influence of GR insulin preparation on glucose concentration in blood of rats after single dose administration of 5 u and 10 u/kg bm doses in a model of moderate streptozotocin-induced diabetes (in comparison with Lantus preparation) are shown in Table 6. A plot of glucose concentration/time changes after administration of 5 u/kg bm of GR insulin is shown in FIG. 11.
EXAMPLE 29 Determination of GEKR Insulin Activity in Animals with Experimental Diabetes
Hypoglycaemic activity of GEKR insulin analogue has been confirmed in a preliminary study on a rat streptozotocin-induced diabetes of moderate course.
After single administration of GEKR insulin in a dose of 10 u/kg bm there was observed very quick (already after 0.5 hour), strong activity reducing glucose concentration in animals' blood. This activity peaked already one hour after administration of the preparation and slowly decreases, still causing significant decrease of glucose level in comparison to initial values up to 12 hours after administration. This research was conducted in comparison with Levemir preparation, insulin analogue of prolonged activity (insulin detemir).
Results describing influence of GEKR insulin on glucose concentration in rat blood after single dose administration of 10 u/kg bm in a moderate streptozotocin-induced model of diabetes, in comparison with preparation Levemir, are shown in Table 7, and a plot of glucose concentration change as a function of time after administration 10 u/kg bm of GEKR insulin in FIG. 12.
TABLE 6
Influence of single dose administration of GR insulin (doses of 5 u/kg bm and 10 u/kg bm) on glucose concentration in blood
of rats with moderate streptozotocin-induced diabetes in comparison with Lantus preparation (insulin glargine).
num- glucose concentration in rat blood
ber mean (mg/dl) ± SEM
Test- of fixed
ed rats hyper- time of blood sample acquisition after
prep- in normo- glycae- single dose preparation administration
diabetes ara- dose the glycae- mia (hours)
model tion s.c. group mia 0 0.5 1 2 4 6 8 10 12 24 36
moderate GR 5.0 u/ 15 80.6 ± 507.4 ± 113.9 ± 98.5 ± 92.5 ± 160.3 ± 198.1 ± 268.7 ± 294.9 ± 353.0 ± 406.9 ± 498.4 ±
strepto- kg 2.4 22.9 10.8** 7.6 6.7 18.3 22.6* 29.3 29.4 28.5 28.3** 26.8
zotocin- Lan- bm 5 83.0 ± 600.0 ± 324.8 ± 136.6 ± 102.2 ± 97.2 ± 94.8 ± 157.6 ± 266.6 ± 401.4 ± 600.0 ± 594.0 ±
induced - tus 4.3 0.0 35.3 27.0 20.4 11.2 5.3 26.7 60.5 60.4 0.0 5.5
40 mg/kg GR 10 u/ 15 84.9 ± 498.7 ± 96.1 ± 85.7 ± 77.0 ± 151.5 ± 168.3 ± 200.3 ± 248.9 ± 326.1 ± 389.3 ± 431.6 ±
bm i.m.) kg 3.7 25.4 8.1** 4.4** 3.5 14.9 21.0 26.2* 30.6 27.9 27.6 24.4
Lan- bm 6 77.8 ± 550.2 ± 247.8 ± 134.0 ± 75.0 ± 109.3 ± 94.7 ± 103.7 ± 148.8 ± 223.3 ± 389.2 ± 453.7 ±
tus 2.3 33.9 25.6 21.8 8.1 16.0 20.0 20.9 20.4 42.2 17.8 28.3
con- 10 ul/ 6 80.5 ± 509.5 ± 527.2 ± 532.0 ± 495.5 ± 463.5 ± 497.2 ± 452.8 ± 491.7 ± 520.3 ± 503.7 ± 507.7 ±
trol 200 g 2.9 40.6 32.5 30.9 26.8 26.9 23.6 31.8 27.8 31.2 35.5 35.3
bm
Statistical significance:
**p < 0.01
*p < 0.05 GR vs. Lantus
TABLE 7
Influence of single dose administration of GEKR insulin (in a dose of 10 u/kg bm) on glucose concentration
in blood of rats with moderate diabetes, in comparison with Levemir preparation (insulin detemir).
Concentration of glucose in rat blood
Tested mean value (mg/dl) ± SEM
preparation fixed Time of blood sampling after single dose administration
diabetes and dose normo- hyper- (hours)
model s.c. glycaemia glycaemia 0.5 1 4 6 8 12
moderate GEKR 90.5 ± 6.4 469.5 ± 65.8 218.0 ± 19.7 109.3 ± 10.1 143.7 ± 22.4 242.3 ± 59.2 329.3 ± 155.3
streptozotocin- 10 u/kg bm
induced - Levemir 98.5 ± 3.5 502.5 ± 26.2 142.3 ± 22.3 384.0 ± 38.7 
40 mg/kg 10 u/kg bm
bm, i.m.

Claims (6)

The invention claimed is:
1. Insulin derivative or its pharmaceutically acceptable salt containing two polypeptides forming chain A and chain B, characterised by being a new polipeptide of the formula 1:
Figure US08618048-20131231-C00003
wherein R denotes group of formula Asn-R2, where R2 denotes neutral L-amino acid; and R1 denotes B31Lys-B32Arg, wherein B3Asn can be optionally replaced by B3Glu, or B31Arg, wherein amino acid sequence of chain A has been chosen from SEQ ID NO: 1-3, while amino acid sequence of chain B has been chosen from SEQ ID NO: 7, 9, and 10 in one of the following combinations:
SEQ ID NO: 1 with SEQ ID NO: 7, SEQ ID NO: 1 with SEQ ID NO: 9, SEQ ID NO: 1 with SEQ ID NO: 10, SEQ ID NO: 2 with SEQ ID NO: 7, SEQ ID NO: 3 with SEQ ID NO: 7, SEQ ID NO: 3 with SEQ ID NO: 10,
and wherein the new polypeptide of formula 1 is an analogue of recombined human insulin of isoelectric point 5-8.5.
2. Insulin derivative or its pharmaceutically acceptable salt according to claim 1, characterised by R2 denotes a single neutral L-amino acid.
3. Insulin derivative or its physiologically acceptable salt according to claim 2, characterised in that:
R in formula 1 denotes group of formula Asn-R2, where R2 denotes Gly and R1 denotes B31Lys-B32Arg, or
R in formula 1 denotes group of formula Asn-R2, where R2 denotes Ala and R1 denotes B31Lys-B32Arg, or
R in formula 1 denotes group of formula Asn-R2, where R2 denotes Ser and R1 denotes B31Lys-B32Arg, or
R in formula 1 denotes group of formula Asn-R2, where R2 denotes Gly, and R1 denotes B31Arg, or
R in formula 1 denotes group of formula Asn-R2, where R2 denotes Ser, and R1 denotes B31Arg, or.
4. Pharmaceutical composition, characterised in, that it contains effectively acting amount of insulin derivative or its pharmaceutically acceptable salt according to one of claims from 1 to 3.
5. Pharmaceutical composition according to claim 4, characterised in, that it contains 10 up to 50 μg/ml of zinc.
6. Insulin derivative or its pharmaceutically acceptable salt according to claim 1, wherein B3Asn is replaced by Glu.
US13/002,520 2008-07-04 2009-07-04 Insulin analogues of prolonged activity Expired - Fee Related US8618048B2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
PLPL385586 2008-07-04
PL385586A PL219335B1 (en) 2008-07-04 2008-07-04 New slow-release insulin analogues
PL385586 2008-07-04
PCT/PL2009/050010 WO2010002283A2 (en) 2008-07-04 2009-07-04 New insulin analogues of prolonged activity

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/PL2009/050010 A-371-Of-International WO2010002283A2 (en) 2008-07-04 2009-07-04 New insulin analogues of prolonged activity

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/090,496 Division US20140121353A1 (en) 2008-07-04 2013-11-26 Insulin analogues of prolonged activity

Publications (2)

Publication Number Publication Date
US20110136736A1 US20110136736A1 (en) 2011-06-09
US8618048B2 true US8618048B2 (en) 2013-12-31

Family

ID=41130257

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/002,520 Expired - Fee Related US8618048B2 (en) 2008-07-04 2009-07-04 Insulin analogues of prolonged activity
US14/090,496 Abandoned US20140121353A1 (en) 2008-07-04 2013-11-26 Insulin analogues of prolonged activity

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/090,496 Abandoned US20140121353A1 (en) 2008-07-04 2013-11-26 Insulin analogues of prolonged activity

Country Status (8)

Country Link
US (2) US8618048B2 (en)
EP (2) EP2371853B1 (en)
JP (1) JP2011526886A (en)
CN (1) CN102083855A (en)
CA (1) CA2729938C (en)
EA (1) EA023559B1 (en)
PL (2) PL219335B1 (en)
WO (1) WO2010002283A2 (en)

Families Citing this family (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10100098B2 (en) 2006-12-13 2018-10-16 Stelis Biopharma Private Limited Insulin production methods and proinsulin constructs
AU2008365557A1 (en) 2008-12-15 2011-07-21 Zealand Pharma A/S Glucagon analogues
EA020537B1 (en) 2008-12-15 2014-11-28 Зилэнд Фарма А/С Glucagon analogues
MX2011006314A (en) 2008-12-15 2011-09-22 Zealand Pharma As Glucagon analogues.
PL2370462T3 (en) 2008-12-15 2015-01-30 Zealand Pharma As Glucagon analogues
AP3329A (en) 2009-07-13 2015-06-30 Zealand Pharma As Acylated glucagon analogues
UY33462A (en) 2010-06-23 2012-01-31 Zealand Pharma As GLUCAGON ANALOGS
KR20130086343A (en) 2010-06-24 2013-08-01 질랜드 파마 에이/에스 Glucagon analogues
SG192038A1 (en) 2011-01-20 2013-08-30 Zealand Pharma As Combination of acylated glucagon analogues with insulin analogues
WO2012115638A1 (en) * 2011-02-23 2012-08-30 Elona Biotechnologies Glargine proinsulin compositions and methods of producing glargine insulin analogs therefrom
NZ702333A (en) 2012-05-03 2017-06-30 Zealand Pharma As Gip-glp-1 dual agonist compounds and methods
PL222975B1 (en) * 2012-05-23 2016-09-30 Inst Biotechnologii I Antybiotyków Insulin analog or a pharmaceutically tolerated salt thereof, a pharmaceutical composition of prolonged therapeutic use of insulin analog, dosage and method for treatment of diabetes
WO2014015078A1 (en) * 2012-07-17 2014-01-23 Michael Weiss O-linked carbohydrate-modified insulin analogues
US9624287B2 (en) 2012-07-17 2017-04-18 Case Western Reserve University O-linked carbohydrate-modified insulin analogues
MX356957B (en) 2012-07-23 2018-06-20 Zealand Pharma As Glucagon analogues.
TWI608013B (en) 2012-09-17 2017-12-11 西蘭製藥公司 Glucagon analog
EP2945643A4 (en) * 2013-01-15 2017-04-26 Phasebio Pharmaceuticals, Inc. Therapeutic agents, compositions, and methods for glycemic control
WO2014122651A1 (en) * 2013-02-07 2014-08-14 Valin Technologies Ltd. Process for preparing insulin
CN103981242A (en) * 2013-02-07 2014-08-13 华凌科技有限公司 Preparation method of insulin
WO2014122653A1 (en) * 2013-02-07 2014-08-14 Valin Technologies Ltd. Process for preparing insulin
CN103981243A (en) * 2013-02-07 2014-08-13 华凌科技有限公司 Preparation method of insulin
US9988429B2 (en) 2013-10-17 2018-06-05 Zealand Pharma A/S Glucagon analogues
LT3057984T (en) 2013-10-17 2018-12-27 Zealand Pharma A/S Acylated glucagon analogues
KR102310392B1 (en) 2013-11-06 2021-10-13 질랜드 파마 에이/에스 Glucagon-glp-1-gip triple agonist compounds
AU2014345569B2 (en) 2013-11-06 2020-08-13 Zealand Pharma A/S GIP-GLP-1 dual agonist compounds and methods
RU2716985C2 (en) 2014-10-29 2020-03-17 Зилэнд Фарма А/С Gip agonist compounds and methods
JP6989385B2 (en) 2015-04-16 2022-01-05 ジーランド ファーマ アクティーゼルスカブ Acylated glucagon analog
PL239062B1 (en) * 2016-01-22 2021-11-02 Inst Biotechnologii I Antybiotykow Method for producing insulin and its derivatives and the hybrid peptide used in this method
CA3044565A1 (en) * 2016-11-21 2018-05-24 Case Western Reserve University Rapid-acting insulin analogues of enhanced stability
KR102666154B1 (en) * 2018-08-08 2024-05-20 주식회사 대웅제약 Long-acting Insulin Analog and Derivatives Thereof
WO2020120477A1 (en) 2018-12-11 2020-06-18 Sanofi Insulin analogs having reduced insulin receptor binding affinity
WO2021081335A1 (en) * 2019-10-24 2021-04-29 University Of Utah Research Foundation Novel mini-insulin with extended c-terminal a chain

Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0376156A2 (en) 1988-12-29 1990-07-04 Hoechst Aktiengesellschaft New insulin derivatives, process for their preparation, their use and pharmaceutical compositions containing them
US4959351A (en) 1983-07-29 1990-09-25 Hoescht Aktiengesellschaft Crystal suspensions of insulin derivatives, processes for their preparation and their use
WO1993016724A1 (en) 1992-02-28 1993-09-02 Autoimmune, Inc. Bystander suppression of autoimmune diseases
US5621073A (en) 1991-12-18 1997-04-15 Hoechst Aktiengesellschaft Chromatographic process for purification of insulin
US5656722A (en) 1988-11-08 1997-08-12 Hoechst Aktiengesellschaft A21 -, B30 - modified insulin derivatives having an altered action profile
US5663291A (en) 1994-02-18 1997-09-02 Hoechst Aktiengesellschaft Process for obtaining insulin having correctly linked cystine bridges
EP0849277A2 (en) 1996-12-18 1998-06-24 Hoechst Aktiengesellschaft Process for preparation of insulin by high pressure liquid chromatography
US20020137144A1 (en) 1999-12-29 2002-09-26 Kjeldsen Thomas Borglum Method for making insulin precursors and insulin precursor analogues having improved fermentation yield in yeast
US6686177B1 (en) 1998-06-06 2004-02-03 Aventis Pharma Deutschland Gmbh Insulin analogs with enhanced zinc binding
WO2004111244A2 (en) 2003-06-17 2004-12-23 Sembiosys Genetics Inc. Methods for the production of insulin in plants
WO2005066344A2 (en) 2004-01-09 2005-07-21 Instytut Biotechnologii I Antybiotykow New plasmids, their derivatives and fragments, their methods of manufacture and application
WO2006096079A2 (en) 2005-03-10 2006-09-14 Instytut Biotechnologii I Antybiotykow Pharmaceutical composition comprising a biosynthetic analog of human insulin, and its use in the treatment of diabetes mellitus.
WO2008015099A2 (en) 2006-07-31 2008-02-07 Novo Nordisk A/S Pegylated, extended insulins
US20080051336A1 (en) 2004-08-25 2008-02-28 Pascal Bonaventure Relaxin-3 Chimeric Polypeptides and Their Preparation and Use
WO2008049931A1 (en) 2006-10-27 2008-05-02 Novo Nordisk A/S Peptide extended insulins
US20090099065A1 (en) * 2006-03-13 2009-04-16 Novo Nordisk A/S Acylated Single Chain Insulin

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5434247A (en) * 1986-10-10 1995-07-18 Board Of Regents, The University Of Texas System Peptides for inducing monocyte cytotoxicity in diagnostics
US5135736A (en) * 1988-08-15 1992-08-04 Neorx Corporation Covalently-linked complexes and methods for enhanced cytotoxicity and imaging
CA2356109C (en) * 1999-01-06 2008-04-22 Genentech, Inc. Insulin-like growth factor (igf) i mutant variants
EP2801366A3 (en) * 2004-09-02 2015-04-29 Cognosci, Inc. Improved apo E analogs and methods for their use
AU2006259307B2 (en) * 2005-06-17 2012-12-20 Mannkind Corporation Epitope analogues
DE102005051366A1 (en) * 2005-10-25 2007-04-26 Degussa Gmbh Drug delivery systems

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4959351A (en) 1983-07-29 1990-09-25 Hoescht Aktiengesellschaft Crystal suspensions of insulin derivatives, processes for their preparation and their use
US5656722A (en) 1988-11-08 1997-08-12 Hoechst Aktiengesellschaft A21 -, B30 - modified insulin derivatives having an altered action profile
US6100376A (en) 1988-11-08 2000-08-08 Hoechst Aktiengesellschaft A21, B30, modified insulin derivatives having an altered action profile
EP0376156A2 (en) 1988-12-29 1990-07-04 Hoechst Aktiengesellschaft New insulin derivatives, process for their preparation, their use and pharmaceutical compositions containing them
US5506202A (en) 1988-12-29 1996-04-09 Hoechst Aktiengesellschaft Insulin derivatives, a process for the preparation thereof, the use thereof, and a pharmaceutical formulation containing them
US5621073A (en) 1991-12-18 1997-04-15 Hoechst Aktiengesellschaft Chromatographic process for purification of insulin
WO1993016724A1 (en) 1992-02-28 1993-09-02 Autoimmune, Inc. Bystander suppression of autoimmune diseases
US5663291A (en) 1994-02-18 1997-09-02 Hoechst Aktiengesellschaft Process for obtaining insulin having correctly linked cystine bridges
US5977297A (en) 1996-12-18 1999-11-02 Hoechst Aktiengesellschaft Process for isolating insulin by high-pressure liquid chromatography
EP0849277A2 (en) 1996-12-18 1998-06-24 Hoechst Aktiengesellschaft Process for preparation of insulin by high pressure liquid chromatography
US6686177B1 (en) 1998-06-06 2004-02-03 Aventis Pharma Deutschland Gmbh Insulin analogs with enhanced zinc binding
US20020137144A1 (en) 1999-12-29 2002-09-26 Kjeldsen Thomas Borglum Method for making insulin precursors and insulin precursor analogues having improved fermentation yield in yeast
WO2004111244A2 (en) 2003-06-17 2004-12-23 Sembiosys Genetics Inc. Methods for the production of insulin in plants
WO2005066344A2 (en) 2004-01-09 2005-07-21 Instytut Biotechnologii I Antybiotykow New plasmids, their derivatives and fragments, their methods of manufacture and application
US20080051336A1 (en) 2004-08-25 2008-02-28 Pascal Bonaventure Relaxin-3 Chimeric Polypeptides and Their Preparation and Use
WO2006096079A2 (en) 2005-03-10 2006-09-14 Instytut Biotechnologii I Antybiotykow Pharmaceutical composition comprising a biosynthetic analog of human insulin, and its use in the treatment of diabetes mellitus.
US20090099065A1 (en) * 2006-03-13 2009-04-16 Novo Nordisk A/S Acylated Single Chain Insulin
WO2008015099A2 (en) 2006-07-31 2008-02-07 Novo Nordisk A/S Pegylated, extended insulins
WO2008049931A1 (en) 2006-10-27 2008-05-02 Novo Nordisk A/S Peptide extended insulins

Also Published As

Publication number Publication date
US20140121353A1 (en) 2014-05-01
CN102083855A (en) 2011-06-01
EP2371853A3 (en) 2012-10-03
JP2011526886A (en) 2011-10-20
WO2010002283A9 (en) 2011-01-20
EP2321344A2 (en) 2011-05-18
CA2729938C (en) 2018-11-06
PL385586A1 (en) 2010-01-18
EA201170149A1 (en) 2011-06-30
CA2729938A1 (en) 2010-01-07
PL2371853T3 (en) 2018-06-29
EA023559B1 (en) 2016-06-30
WO2010002283A3 (en) 2010-04-29
EP2371853A2 (en) 2011-10-05
US20110136736A1 (en) 2011-06-09
EP2371853B1 (en) 2017-09-13
WO2010002283A2 (en) 2010-01-07
PL219335B1 (en) 2015-04-30

Similar Documents

Publication Publication Date Title
CA2729938C (en) New insulin analogues of prolonged activity
US8633156B2 (en) Insulin derivatives having an extremely delayed time-action profile
RU2529952C2 (en) Novel insulin derivatives with strongly slowed profile time/action
RU2524423C2 (en) Novel insulin derivatives with extremely delayed time/action profile
US9090705B2 (en) Process for preparation of insulin compounds
CN113105536B (en) New proinsulin glargine and method for preparing insulin glargine by using same
HK1200874A1 (en) Process for preparing insulin
CN113773399B (en) Insulin glargine derivative and application thereof
EP4163376A1 (en) Insulin aspart derivative, and preparation method therefor and use thereof
WO2014122653A1 (en) Process for preparing insulin
US9585942B2 (en) Insulin analogue or its pharmaceutically acceptable salt, pharmaceutical composition with prolonged therapeutic effect, use of the insulin analogue, dosage method and method of treatment of diabetes
HK1148542B (en) Insulin derivatives having an extremely delayed time-action profile
HK1149772B (en) Novel insulin derivatives having an extremely delayed time-action profile

Legal Events

Date Code Title Description
AS Assignment

Owner name: INSTYTUT BIOTECHNOLOGII I ANTYBIOTYKOW, POLAND

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BOROWICZ, PIOTR;PLUCIENNICZAK, ANDRZEJ;MIKOLAJCZYK, JERZY;AND OTHERS;REEL/FRAME:025797/0516

Effective date: 20110105

STCF Information on status: patent grant

Free format text: PATENTED CASE

FEPP Fee payment procedure

Free format text: PAYOR NUMBER ASSIGNED (ORIGINAL EVENT CODE: ASPN); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

FPAY Fee payment

Year of fee payment: 4

FEPP Fee payment procedure

Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

LAPS Lapse for failure to pay maintenance fees

Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20211231