US8470780B2 - Methods and compositions related to targeting wounds, regenerating tissue, and tumors - Google Patents
Methods and compositions related to targeting wounds, regenerating tissue, and tumors Download PDFInfo
- Publication number
- US8470780B2 US8470780B2 US13/450,972 US201213450972A US8470780B2 US 8470780 B2 US8470780 B2 US 8470780B2 US 201213450972 A US201213450972 A US 201213450972A US 8470780 B2 US8470780 B2 US 8470780B2
- Authority
- US
- United States
- Prior art keywords
- amino acid
- seq
- peptide
- acid sequence
- residues
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- TGF- ⁇ Transforming growth factor ⁇
- a major hurdle to advances in treating cancer is the relative lack of agents that can selectively target the cancer while sparing normal tissue.
- radiation therapy and surgery which generally are localized treatments, can cause substantial damage to normal tissue in the treatment field, resulting in scarring and loss of normal tissue.
- Chemotherapy in comparison, which generally is administered systemically, can cause substantial damage to organs such as the bone marrow, mucosae, skin and small intestine, which undergo rapid cell turnover and continuous cell division.
- undesirable side effects such as nausea, loss of hair and drop in blood cell count often occur when a cancer patient is treated intravenously with a chemotherapeutic drug.
- Such undesirable side effects can limit the amount of a drug that can be safely administered, thereby hampering survival rate and impacting the quality of patient life.
- mice treated with CAR-decorin showed diminished myofibroblast reaction and there were almost no myofibroblasts in the wound stroma of mice treated with CRK-decorin and CB-decorin; the arrows indicate ⁇ -SMA-positive smooth muscle cells in the walls of blood vessels. Magnification: x150.
- FIG. 7 shows the effect of decorins on the expression of TGF- ⁇ -induced genes in skin wounds. Wounds produced and treated as in FIG. 2 were harvested on Day 5 and mRNA expression for the indicated genes was determined. The PBS treatment control was assigned the value 100%. Error bars represent mean ⁇ SD for two pools of RNA isolated from two wounds in each of four different animals.
- CARSKNKDC CARSK, SEQ ID NO: 1
- CRKDKC CRK, SEQ ID NO: 2
- CAR displays homology to heparin-binding sites in various proteins, and binds to cell surface heparan sulfate and heparin.
- CRK is homologous to a segment in thrombospondin type 1 repeat. Intravenously injected CAR and CRK phage, and the fluorescein-labeled free peptides selectively accumulate at wound sites, partially co-localizing with blood vessels.
- the fusion proteins were strikingly effective in preventing scar formation, where an equivalent dose of decorin was inactive.
- the targeting approach can make systemic enhancement of tissue regeneration a feasible option.
- isolated peptides comprising an amino acid segment comprising, for example, the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 having one or more conservative amino acid substitutions.
- the peptide can have 1, 2, 3, 4, or 5 conservative amino acid substitutions.
- One of skill in the art is readily able to assess which amino acids can be substituted and retain the function of the peptide.
- conjugates wherein the conjugate comprises a moiety linked to a peptide comprising an amino acid segment comprising, for example, the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 having one or more conservative amino acid substitutions.
- the moiety can be a moiety is a an anti-angiogenic agent, a pro-angiogenic agent, a cancer chemotherapeutic agent, a cytotoxic agent, an anti-inflammatory agent, an anti-arthritic agent, a polypeptide, a nucleic acid molecule, a small molecule, a fluorophore, fluorescein, rhodamine, a radionuclide, indium-111, technetium-99, carbon-11, carbon-13, or a combination.
- the moiety can be a therapeutic agent.
- the moiety can be a detectable agent.
- the conjugate can comprises a virus.
- the conjugate can comprise a phage.
- homing molecules that selectively home to sites of injuries and wounds, regenerating tissue, and tumors.
- a variety of homing molecules can be used in the disclosed compositions, conjugates and methods.
- Such homing molecules include, without limitation, peptides as disclosed herein.
- the disclosed compounds, compositions, conjugates and methods can include or use the disclosed homing molecules in various forms, including peptides and peptidomimetics as disclosed.
- peptides as disclosed herein.
- the disclosed compounds, compositions, conjugates and methods can include or use the disclosed homing molecules in various forms, including peptides and peptidomimetics as disclosed.
- peptides for convenience of expression, in many places herein the use or inclusion of peptides will be recited. It is understood that, in such cases, it is considered that homing molecules in various forms can also be used or included in the same or similar ways as is described in terms of peptides, and such use and inclusion is specifically contemplated and disclosed thereby.
- molecule is used broadly to mean a polymeric or non-polymeric organic chemical such as a small molecule drug; a nucleic acid molecule such as an RNA, a DNA such as a cDNA or oligonucleotide; a peptide; or a protein such as a growth factor receptor or an antibody or fragment thereof such as an Fv, Fd, or Fab fragment or another antibody fragment containing the antigen-binding domain.
- homing molecule as used herein, means any molecule that selectively homes in vivo to the clotted plasma of one or more wound tissue, regenerating tissue, or tumors in preference to normal tissue.
- the term “homing peptide” or “homing peptidomimetic” means a peptide that selectively homes in vivo to regenerating tissue, wounds, or tumors in preference to normal tissue. It is understood that a homing molecule that selectively homes in vivo to regenerating tissue, wounds, or tumors or can exhibit preferential homing to regenerating tissue, wounds, or tumors.
- the homing molecule binds preferentially to the target as compared to non-target.
- the homing molecule can bind preferentially to regenerating tissue, wound tissue, or tumors, as compared to non-regenerating tissue, non-wound tissue, or non-tumors.
- Such a homing molecule can selectively home, for example, to regenerating tissue.
- Selective homing to, for example, regenerating tissue generally is characterized by at least a two-fold greater localization within regenerating tissue, as compared to several tissue types of non-regenerating tissue.
- a homing molecule can be a molecule that selectively homes regenerating tissue, wound tissue, or tumors and which is not an antibody or antigen-binding fragment thereof.
- antibody is an art-recognized term that refers to a peptide or polypeptide containing one or more complementarity determining regions (CDRs). See, for example, Borrabaeck, Antibody Engineering 2nd Edition, Oxford University Press, New York (1995).
- the homing molecule can have at least about a 50-fold selectivity, at least about a 100-fold selectivity, at least about a 200-fold selectivity, at least about a 300-fold selectivity, at least about a 400-fold selectivity, at least about a 500-fold selectivity, at least about a 600-fold selectivity, at least about a 700-fold selectivity, at least about an 800-fold selectivity, at least about a 1000-fold selectivity, or at least about a 1500-fold selectivity to a corresponding target.
- the homing molecule can have a K i value against a target of less than about 200 nM, less than about 150 nM, less than about 100 nM, or less than about 75 nM. In some preferred embodiments, the homing molecule can have a K i value against a target of more than about 50 nM, more than about 25 nM, more than about 20 nM, more than about 15 nM, more than about 10 nM, more than about 5 nM, more than about 3 nM, or more than about 1 nM.
- the isolated peptides can comprise, for example, an amino acid segment comprising, for example, the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 having one or more conservative amino acid substitutions.
- the disclosed peptides can selectively home to regenerating tissue, wound tissue, or tumors.
- the disclosed peptides can selectively interact with regenerating tissue, wound tissue, or tumors.
- the disclosed peptides can be in isolated form.
- isolated means a peptide that is in a form that is relatively free from material such as contaminating polypeptides, lipids, nucleic acids and other cellular material that normally is associated with the peptide in a cell or that is associated with the peptide in a library or in a crude preparation.
- the disclosed peptides can have any suitable length.
- the disclosed peptides can have, for example, a relatively short length of less than six, seven, eight, nine, ten, 12, 15, 20, 25, 30, 35 or 40 residues.
- the disclosed peptides also can be useful in the context of a significantly longer sequence.
- the CAR and CRK peptides (SEQ ID NO: 1 and SEQ ID NO: 2, respectively) maintained the ability to home when fused to a phage coat protein, confirming that the disclosed peptides can have selective homing activity when embedded in a larger protein sequence.
- the peptides can have, for example, a length of up to 50, 100, 150, 200, 250, 300, 400, 500, 1000 or 2000 residues.
- Deletions are characterized by the removal of one or more amino acid residues from the protein or peptide sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein or peptide molecule.
- These variants can be prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein or peptide, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known.
- a conservative variant can be a sequence in which a first hydrophobic amino acid is conservatively substituted with a second hydrophobic amino acid such as alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine or tryptophan or an analog thereof.
- a conservative variant can be a sequence in which a first acidic amino acid is conservatively substituted with a second acidic amino acid such as aspartic acid or glutamic acid or an analog thereof; a sequence in which an aromatic amino acid such as phenylalanine is conservatively substituted with a second aromatic amino acid or amino acid analog, for example, tyrosine; or a sequence in which a first relatively small amino acid such as alanine is substituted with a second relatively small amino acid or amino acid analog such as glycine or valine or an analog thereof.
- the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative substitution.
- a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another.
- the substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gln; Ser, Thr; Lys, Arg; and Phe, Tyr.
- Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein. It is understood that conservative variants of both CAR and CRK (SEQ ID NOs:1 and 2) encompass sequences containing one, two, three, four or more amino acid substitutions relative to SEQ ID NO: 1 and 2, and that such variants can include naturally and non-naturally occurring amino acid analogs.
- an electropositive side chain e.g., lysyl, arginyl, or histidyl
- an electronegative residue e.g., glutamyl or aspartyl
- nucleic acids can be obtained by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
- Amino acid analogs and analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, and others.
- D-amino acids can be used to generate more stable peptides, because D amino acids are not recognized by peptidases and such.
- Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type e.g., D-lysine in place of L-lysine
- Cysteine residues can be used to cyclize or attach two or more peptides together. This can be beneficial to constrain peptides into particular conformations.
- bifunctional peptides which contains a homing peptide fused to a second peptide having a separate function.
- Such bifunctional peptides have at least two functions conferred by different portions of the full-length molecule and can, for example, display anti-angiogenic activity or pro-apoptotic activity in addition to selective homing activity.
- isolated multivalent peptides that include at least two subsequences each independently containing a homing molecule (for example, the amino acid sequence SEQ ID NO: 1 or 2, or a conservative variant or peptidomimetic thereof).
- the multivalent peptide can have, for example, at least three, at least five or at least ten of such subsequences each independently containing a homing molecule (for example, the amino acid sequence of SEQ ID NO: 1 or 2, or a conservative variant or peptidomimetic thereof).
- the multivalent peptide can have two, three, four, five, six, seven, eight, nine, ten, fifteen or twenty identical or non-identical subsequences.
- peptide is used broadly to mean peptides, proteins, fragments of proteins and the like.
- peptidomimetic means a peptide-like molecule that has the activity of the peptide upon which it is structurally based. Such peptidomimetics include chemically modified peptides, peptide-like molecules containing non-naturally occurring amino acids, and peptoids and have an activity such as selective homing activity of the peptide upon which the peptidomimetic is derived (see, for example, Goodman and Ro, Peptidomimetics for Drug Design, in “Burger's Medicinal Chemistry and Drug Discovery” Vol. 1 (ed. M. E. Wolff; John Wiley & Sons 1995), pages 803-861).
- a variety of peptidomimetics are known in the art including, for example, peptide-like molecules which contain a constrained amino acid, a non-peptide component that mimics peptide secondary structure, or an amide bond isostere.
- a peptidomimetic that contains a constrained, non-naturally occurring amino acid can include, for example, an ⁇ -methylated amino acid; ⁇ , ⁇ -dialkylglycine or ⁇ -aminocycloalkane carboxylic acid; an N ⁇ —C ⁇ cyclized amino acid; an N ⁇ .-methylated amino acid; a ⁇ - or ⁇ -amino cycloalkane carboxylic acid; an ⁇ , ⁇ -unsaturated amino acid; a ⁇ , ⁇ -dimethyl or ⁇ -methyl amino acid; a ⁇ -substituted-2,3-methano amino acid; an N—C ⁇ or C ⁇ —C ⁇ cyclized amino acid; a substituted proline
- Methods for identifying a peptidomimetic include, for example, the screening of databases that contain libraries of potential peptidomimetics.
- the Cambridge Structural Database contains a collection of greater than 300,000 compounds that have known crystal structures (Allen et al., Acta Crystalloqr. Section B, 35:2331 (1979)). This structural depository is continually updated as new crystal structures are determined and can be screened for compounds having suitable shapes, for example, the same shape as a disclosed peptide, as well as potential geometrical and chemical complementarity to a target molecule.
- Residues capable of forming a disulfide bond include, for example, cysteine (Cys), penicillamine (Pen), ⁇ , ⁇ -pentamethylene cysteine (Pmc), ⁇ , ⁇ -pentamethylene- ⁇ -mercaptopropionic acid (Pmp) and functional equivalents thereof.
- the moiety can be any molecule.
- the moiety is a molecule that is usefully targeted to the target of the homing molecule.
- moieties that affect the target such as moieties with therapeutic effect, or that facilitate detection, visualization or imaging of the target, such as fluorescent molecule or radionuclides.
- Disclosed peptides that home to regenerating tissue, wound tissue, or tumors can be usefully combined with, for example, moieties that can, for example, promote wound healing, treat inflammation or pain, or treat cancer.
- Moieties useful in a conjugate incorporating multiple homing molecules include, without limitation, phage, retroviruses, adenoviruses, adeno-associated viruses and other viruses, cells, liposomes, polymeric matrices, non-polymeric matrices, particles such as gold particles, microdevices, nanodevices, and nano-scale semiconductor materials.
- a conjugate can contain, for example, a liposome or other polymeric matrix linked to at least two homing molecules. If desired, the liposome or other polymeric matrix can be linked to at least ten, at least 100 or at least 1000 homing molecules.
- Liposomes can be useful in such conjugates; liposomes consist of phospholipids or other lipids, are nontoxic, physiologically acceptable and metabolizable carriers that are relatively simple to make and administer (Gregoriadis, Liposome Technology, Vol. 1 (CRC Press, Boca Raton, Fla. (1984)).
- the liposome or other polymeric matrix can optionally include another component such as, without limitation, a therapeutic agent, cancer chemotherapeutic agent, cytotoxic agent, anti-angiogenic agent, polypeptide or nucleic acid molecule.
- compositions of the disclosed conjugates can be combined, linked and/or coupled in any suitable manner.
- moieties and homing molecules can be associated covalently or non-covalently, directly or indirectly, with or without a linker moiety.
- the moiety incorporated into a conjugate can be a therapeutic agent.
- therapeutic agent means a molecule which has one or more biological activities in a normal or pathologic tissue.
- a variety of therapeutic agents can be included in a conjugate.
- the conjugates disclosed herein can also be used to treat wounds or tissue injuries.
- Moieties useful for this purpose can include molecules belonging to several basic groups including anti-inflammatory agents which prevent inflammation, restenosis preventing drugs which prevent tissue growth, anti-thrombogenic drugs which inhibit or control formation of thrombus or thrombolytics, and bioactive agents which regulate tissue growth and enhance healing of the tissue.
- active agents include but are not limited to steroids, fibronectin, anti-clotting drugs, anti-platelet function drugs, drugs which prevent smooth muscle cell growth on inner surface wall of vessel, heparin, heparin fragments, aspirin, coumadin, tissue plasminogen activator (TPA), urokinase, hirudin, streptokinase, antiproliferatives (methotrexate, cisplatin, fluorouracil, Adriamycin), antioxidants (ascorbic acid, beta carotene, vitamin E), antimetabolites, thromboxane inhibitors, non-steroidal and steroidal anti-inflammatory drugs, beta and calcium channel blockers, genetic materials including DNA and RNA fragments, complete expression genes, antibodies, lymphokines, growth factors, prostaglandins, leukotrienes, laminin, elastin, collagen, and integrins.
- An antimicrobial peptide also can be an analog of a natural peptide, especially one that retains or enhances amphipathicity (see below).
- conjugates in which the antimicrobial peptide portion promotes disruption of mitochondrial membranes when internalized by eukaryotic cells.
- an antimicrobial peptide preferentially disrupts mitochondrial membranes as compared to eukaryotic membranes.
- Mitochondrial membranes like bacterial membranes but in contrast to eukaryotic plasma membranes, have a high content of negatively charged phospholipids.
- An antimicrobial peptide can be assayed for activity in disrupting mitochondrial membranes using, for example, an assay for mitochondrial swelling or another assay well known in the art.
- D (KLAKLAK) 2 (SEQ ID NO: 19) for example, is an antimicrobial peptide which induces marked mitochondrial swelling at a concentration of 10 ⁇ M, significantly less than the concentration required to kill eukaryotic cells.
- An antimicrobial peptide can include, for example, the sequence (KLAKLAK) 2 (SEQ ID NO: 20), (KLAKKLA) 2 (SEQ ID NO: 21), (KAAKKAA) 2 (SEQ ID NO: 22), or (KLGKKLG) 3 (SEQ ID NO: 23), and, in one embodiment, includes the sequence D (KLAKLAK) 2 (SEQ ID NO: 19).
- a conjugate can contain one or more of such therapeutic agents and that additional components can be included as part of the conjugate, if desired.
- additional components can be included as part of the conjugate, if desired.
- doxorubicin has anti-angiogenic activity (Folkman, Nature Biotechnology 15:510 (1997); Steiner, In “Angiogenesis: Key principles-Science, technology and medicine,” pp. 449-454 (eds. Steiner et al.; Birkhauser Verlag, 1992)), which can contribute to its effectiveness in treating cancer.
- An alkylating agent such as melphalan or chlorambucil also can be a cancer chemotherapeutic agent useful in a conjugate.
- a vinca alkaloid such as vindesine, vinblastine or vinorelbine; or an antimetabolite such as 5-fluorouracil, 5-fluorouridine or a derivative thereof can be a cancer chemotherapeutic agent useful in a conjugate.
- a cancer chemotherapeutic agent for treatment of breast cancer and other hormonally-dependent cancers also can be an agent that antagonizes the effect of estrogen, such as a selective estrogen receptor modulator or an anti-estrogen.
- the selective estrogen receptor modulator, tamoxifen is a cancer chemotherapeutic agent that can be used in a conjugate for treatment of breast cancer (Fisher et al., J. Natl. Cancer Instit. 90:1371-1388 (1998)).
- a therapeutic agent useful in a conjugate can be an antibody such as a humanized monoclonal antibody.
- the anti-epidermal growth factor receptor 2 (HER2) antibody, trastuzumab (Herceptin; Genentech, South San Francisco, Calif.) is a therapeutic agent useful in a conjugate for treating HER2/neu overexpressing breast cancers (White et al., Annu Rev. Med. 52:125-141 (2001)).
- Useful therapeutic agents also can be a cytotoxic agent, which, as used herein, can be any molecule that directly or indirectly promotes cell death.
- cytotoxic agents include, without limitation, small molecules, polypeptides, peptides, peptidomimetics, nucleic acid-molecules, cells and viruses.
- a therapeutic agent can be a therapeutic polypeptide.
- a therapeutic polypeptide can be any polypeptide with a biologically useful function.
- Useful therapeutic polypeptides encompass, without limitation, cytokines, antibodies, cytotoxic polypeptides; pro-apoptotic polypeptides; and anti-angiogenic polypeptides.
- useful therapeutic polypeptides can be a cytokine such as tumor necrosis factor- ⁇ (TNF- ⁇ ), tumor necrosis factor- ⁇ (TNF- ⁇ ), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interferons. (IFN- ⁇ ); interferon .gamma.
- interleukin-1 interleukin-1
- IL-2 interleukin-2
- IL-3 interleukin-3
- IL-4 interleukin-4
- IL-6 interleukin-6
- IL-7 interleukin-7
- DC-CK1 dendritic cell chemokine 1
- an anti-HER2 antibody or fragment thereof a cytotoxic polypeptide including a toxin or caspase, for example, diphtheria toxin A chain, Pseudomonas exotoxin A, cholera toxin, a ligand fusion toxin such as DAB389EGF or ricin; or an anti-angiogenic polypeptide such as angiostatin, endostatin, thrombospondin, platelet factor 4; anastellin; or one of those described further herein or known in the art (see below). It is understood that these and other organ damage factor 4
- anastellin or one of those described further herein or known in the art (see
- anti-angiogenic agents include, without limitation, small molecules; proteins such as dominant negative forms of angiogenic factors, transcription factors and antibodies; peptides; and nucleic acid molecules including ribozymes, antisense oligonucleotides, and nucleic acid molecules encoding, for example, dominant negative forms of angiogenic factors and receptors, transcription factors, and antibodies and antigen-binding fragments thereof. See, for example, Hagedorn and Bikfalvi, Crit. Rev. Oncol. Hematol. 34:89-110 (2000), and Kirsch et al., J. Neurooncol. 50:149-163 (2000).
- VEGF Vascular endothelial growth factor
- An anti-angiogenic agent can be, for example, an inhibitor or neutralizing antibody that reduces the expression or signaling of VEGF or another angiogenic factor, for example, an anti-VEGF neutralizing monoclonal antibody (Borgstrom et al., supra, 1999).
- An anti-angiogenic agent also can inhibit another angiogenic factor such as a member of the fibroblast growth factor family such as FGF-1 (acidic), FGF-2 (basic), FGF-4 or FGF-5 (Slavin et al., Cell Biol. Int. 19:431-444 (1995); Folkman and Shing, J. Biol. Chem.
- an angiogenic factor such as angiopoietin-1, a factor that signals through the endothelial cell-specific Tie2 receptor tyrosine kinase (Davis et al., Cell 87:1161-1169 (1996); and Suri et al., Cell 87:1171-1180 (1996)), or the receptor of one of these angiogenic factors. It is understood that a variety of mechanisms can act to inhibit activity of an angiogenic factor including, without limitation, direct inhibition of receptor binding, indirect inhibition by reducing secretion of the angiogenic factor into the extracellular space, or inhibition of expression, function or signaling of the angiogenic factor.
- anti-angiogenic agents include, for example, angiostatin, endostatin, metastatin and 2ME2 (EntreMed; Rockville, Md.); anti-VEGF antibodies such as Avastin (Genentech; South San Francisco, Calif.); and VEGFR-2 inhibitors such as SU5416, a small molecule inhibitor of VEGFR-2 (SUGEN; South San Francisco, Calif.) and SU6668 (SUGEN), a small molecule inhibitor of VEGFR-2, platelet derived growth factor and fibroblast growth factor I receptor. It is understood that these and other anti-angiogenic agents can be prepared by routine methods and are encompassed by the term “anti-angiogenic agent” as used herein.
- the moiety in the disclosed conjugates can also be a detectable agent.
- detectable agents are useful in the disclosed methods.
- the term “detectable agent” refers to any molecule which can be detected.
- Useful detectable agents include moieties that can be administered in vivo and subsequently detected.
- Detectable agents useful in the disclosed conjugates and imaging methods include yet are not limited to radiolabels and fluorescent molecules.
- the detectable agent can be, for example, any moiety that facilitates detection, either directly or indirectly, preferably by a non-invasive and/or in vivo visualization technique.
- a detectable agent can be detectable by any known imaging techniques, including, for example, a radiological technique.
- detectable agents include moieties which emit or can be caused to emit detectable radiation (e.g., fluorescence excitation, radioactive decay, spin resonance excitation, etc.), moieties which affect local electromagnetic fields (e.g., magnetic, ferromagnetic, ferromagnetic, paramagnetic, and/or superparamagnetic species), moieties which absorb or scatter radiation energy (e.g., chromophores and/or fluorophores), quantum dots, heavy elements and/or compounds thereof. See, e.g., detectable agents described in U.S. Publication No. 2004/0009122.
- detectable agents include a proton-emitting moiety, a radiopaque moiety, and/or a radioactive moiety, such as a radionuclide like Tc-99m and/or Xe-13. Such moieties can be used as a radiopharmaceutical.
- the disclosed compositions can comprise one or more different types of detectable agents, including any combination of the detectable agents disclosed herein.
- fluorescent moieties include fluorescein isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-1,3-diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin, BODIPY®, Cascade Blue®, Oregon Green®, pyrene, lissamine, xanthenes, acridines, oxazines, phycoerythrin, macrocyclic chelates of lanthanide ions such as quantum DyeTM, fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
- FITC fluorescein isothiocyanate
- NBD nitrobenz-2-oxa-1,3-diazol-4-yl
- fluorescein dyes include 6-carboxyfluorescein (6-FAM), 2′,4′,1,4,-tetrachlorofluorescein (TET), 2′,4′,5′,7′,1,4-hexachlorofluorescein (HEX), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyrhodamine (JOE), 2′-chloro-5′-fluoro-7′,8′-fused phenyl-1,4-dichloro-6-carboxyfluorescein (NED), and 2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC).
- 6-FAM 6-carboxyfluorescein
- TET 2′,4′,1,4,-tetrachlorofluorescein
- HEX 2′,4′,5′,7′,1,4-hexachlorofluorescein
- Fluorescent labels can be obtained from a variety of commercial sources, including Amersham Pharmacia Biotech, Piscataway, N.J.; Molecular Probes, Eugene, Oreg.; and Research Organics, Cleveland, Ohio. Fluorescent probes and there use are also described in Handbook of Fluorescent Probes and Research Products by Richard P. Haugland.
- radioactive detectable agents include gamma emitters, e.g., the gamma emitters In-111, I-125 and 1-131, Rhenium-186 and 188, and Br-77 (see. e.g., Thakur, M. L. et al., Throm Res. Vol. 9 pg. 345 (1976); Powers et al., Neurology Vol. 32 pg. 938 (1982); and U.S. Pat. No.
- radioactive detectable agents can include, for example tritium, C-14 and/or thallium, as well as Rh-105, I-123, Nd-147, Pm-151, Sm-153, Gd-159, Tb-161, Er-171 and/or Tl-201.
- Tc-99m Technitium-99m
- Tc-99m is a gamma emitter with single photon energy of 140 keV and a half-life of about 6 hours, and can readily be obtained from a Mo-99/Tc-99 generator.
- compositions comprising a radioactive detectable agent can be prepared by coupling a targeting moiety with radioisotopes suitable for detection. Coupling can occur via a chelating agent such as diethylenetriaminepentaacetic acid (DTPA), 4,7,10-tetraazacyclododecane-N-,N′,N′′,N′′′-tetraacetic acid (DOTA) and/or metallothionein, any of which can be covalently attached to the targeting moiety.
- DTPA diethylenetriaminepentaacetic acid
- DOTA 4,7,10-tetraazacyclododecane-N-,N′,N′′,N′′′-tetraacetic acid
- metallothionein any of which can be covalently attached to the targeting moiety.
- an aqueous mixture of technetium-99m, a reducing agent, and a water-soluble ligand can be prepared and then allowed to react with a disclosed targeting moiety.
- Magnetic detectable agents include paramagnetic contrasting agents, e.g., gadolinium diethylenetriaminepentaacetic acid, e.g., used with magnetic resonance imaging (MRI) (see, e.g., De Roos, A. et al., Int. J. Card. Imaging Vol. 7 pg. 133 (1991)).
- Some preferred embodiments use as the detectable agent paramagnetic atoms that are divalent or trivalent ions of elements with an atomic number 21, 22, 23, 24, 25, 26, 27, 28, 29, 42, 44, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70.
- inorganic bases e.g., hydroxides, carbonates and/or bicarbonates of sodium, potassium and/or lithium
- organic bases e.g., organic bases, and/or basic amino acids
- basic amino acids can be used to neutralize acidic groups, e.g., to facilitate isolation or purification of the composition.
- the detectable agent can be coupled to the homing molecule in such a way so as not to interfere with the ability of the homing molecule to home to the target.
- the detectable agent can be chemically bound to the homing molecule.
- the detectable agent can be chemically bound to a moiety that is itself chemically bound to the homing molecule, indirectly linking the imaging and targeting moieties.
- compositions including antibodies, can be used therapeutically in combination with a pharmaceutically acceptable carrier.
- Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A. R. Gennaro, Mack Publishing Company, Easton, Pa. 1995.
- an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
- the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
- the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
- Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers can be more preferable depending upon, for instance, the route of administration and concentration of composition being administered.
- compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives can also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- Formulations for topical administration can include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions can be administered as a pharmaceutically acceptable acid- or base-addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
- inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
- organic acids such as formic acid, acetic acid, propionic acid,
- compositions can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way. Also disclosed are the compositions that are identified through combinatorial techniques or screening techniques in which the compositions disclosed in SEQ ID NOS: 1 and 2 or portions thereof, are used as the target in a combinatorial or screening protocol.
- compositions disclosed herein have certain functions, such as interacting with the fibrin-fibronectin complex.
- Disclosed herein are certain structural requirements for performing the disclosed functions, and it is understood that there are a variety of structures which can perform the same function which are related to the disclosed structures, and that these structures will ultimately achieve the same result, for example stimulation or inhibition.
- kits that are drawn to reagents that can be used in practicing the methods disclosed herein.
- the kits can include any reagent or combination of reagent discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods.
- the kits could include CAR and CRK.
- the method involves mixing or bringing into contact compositions or components or reagents
- performing the method creates a number of different mixtures. For example, if the method includes 3 mixing steps, after each one of these steps a unique mixture is formed if the steps are performed separately. In addition, a mixture is formed at the completion of all of the steps regardless of how the steps were performed.
- the present disclosure contemplates these mixtures, obtained by the performance of the disclosed methods as well as mixtures containing any disclosed reagent, composition, or component, for example, disclosed herein.
- nucleic acids and proteins can be represented as a sequence consisting of the nucleotides of amino acids.
- nucleotide guanosine can be represented by G or g.
- amino acid valine can be represented by Val or V.
- Those of skill in the art understand how to display and express any nucleic acid or protein sequence in any of the variety of ways that exist, each of which is considered herein disclosed.
- display of these sequences on computer readable mediums, such as, commercially available floppy disks, tapes, chips, hard drives, compact disks, and video disks, or other computer readable mediums.
- binary code representations of the disclosed sequences are also disclosed.
- computer readable mediums such as, commercially available floppy disks, tapes, chips, hard drives, compact disks, and video disks, or other computer readable mediums.
- computer readable mediums such as, commercially available floppy disks, tapes, chips, hard drives, compact disks, and video disks, or other computer readable
- regenerating tissue can be at the site of a wound, such as those caused by injury or surgery. Since the peptides home to regenerating tissue, they can be used in any method associated with regenerating tissue.
- the conjugate can have a therapeutic effect on at least one of the wound sites.
- the moiety can be used to detect, visualize, or image at least one of the wound sites, or a combination.
- the conjugates disclosed herein can also be useful in subjects with arthritis and other inflammatory diseases, as such lesions are often associated with angiogenesis.
- the conjugates can be used to treat or diagnose any disease, condition, or disorder associated with angiogenesis. For example, macular degeneration and diabetic vascular complications can be diagnosed and/or treated.
- the conjugates disclosed herein can also be useful in subjects with tumors, since tumors are associated with angiogenesis.
- a method of directing a moiety to tumors comprising administering to the subject the any of the conjugates disclosed herein.
- the conjugate can have a therapeutic effect.
- the subject can have one or more sites to be targeted, wherein the moiety is directed to one or more of the sites to be targeted.
- the subject can have multiple wounds or lesions that can be treated with the moieties disclosed herein.
- the subject can also have cancer, and the moiety can be directed to tumor angiogenesis in the subject.
- the conjugate can have a therapeutic effect on the cancer.
- the size of the tumor can be reduced, or the growth of the tumor can be reduced, stopped, or reversed.
- the moiety can also be used to detect the cancer, visualize one or more tumors, or both.
- compositions can be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, including topical intranasal administration or administration by inhalant.
- topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector.
- Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
- Parenteral administration of the composition is generally characterized by injection.
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Pat. No. 3,610,795, which is incorporated by reference herein.
- compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
- a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin whereas the other fragment of a peptide or protein can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal group which is functionally blocked on the other fragment.
- peptide condensation reactions these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively, to form an antibody, or fragment thereof
- the first step is the chemoselective reaction of an unprotected synthetic peptide—thioester with another unprotected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate undergoes spontaneous, rapid intramolecular reaction to form a native peptide bond at the ligation site (Baggiolini M et al. (1992) FEBS Lett. 307:97-101; Clark-Lewis I et al., J. Biol. Chem., 269:16075 (1994); Clark-Lewis I et al., Biochemistry, 30:3128 (1991); Rajarathnam K et al., Biochemistry 33:6623-30 (1994)).
- unprotected peptide segments are chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non-peptide) bond (Schnolzer, M et al. Science, 256:221 (1992)).
- This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton R C et al., Techniques in Protein Chemistry IV. Academic Press, New York, pp. 257-267 (1992)).
- CARSKNKDC cyclic peptide CARSKNKDC
- This peptide was obtained from the tendon screens.
- BLAST analysis Altschul et al. 1997) showed that the CAR sequence is similar to the main heparin-binding site (RARKKNKNC, SEQ ID NO: 3) of bone morphogenetic protein 4 (BMP4).
- RARKKNKNC RARKKNKNC, SEQ ID NO: 3 of bone morphogenetic protein 4 (BMP4).
- BMP4 bone morphogenetic protein 4
- wounds were induced in the patellar and Achilles tendons of the left hind limb, while subjecting the right hind limb to a sham operation.
- the sham operation consisted of a skin incision that exposed the tendon but left it otherwise intact.
- the CAR phage homed 220 to 370 fold more to the wounded tendons compared to the contra-lateral intact tendons and to wounded skin compared to intact skin distant from the wound sites.
- similar numbers of the CAR phage and control phage accumulated in liver, kidney, heart, lung and spleen.
- CRKDKC (CRK, SEQ ID NO: 2) peptide was identified from skin wounds in two independent screens.
- the CRK sequence is completely identical to the portion of the thrombospondin type I repeats (TSR I) which are present in a large number of extracellular matrix proteins.
- TSR I thrombospondin type I repeats
- the sequence is shorter than the structure of the CX 7 C-library would predict; a modified peptide structure is a relatively common occurrence in phage screening (Hoffman et al. 2003).
- the sequence contains a cysteine residue at both ends; these cysteines are likely to form a cyclizing disulfide bond.
- Intravenously injected CRK phage homed to 5-day tendon and skin wounds approximately 50 times more than non-recombinant control phage.
- CARSTKATC CARSTKATC
- CAR2 SEQ ID NO: 4
- CAR mutant phage by changing two basic amino acids to neutral ones (CARSKNKDC mutated to CAQSKNKDC, SEQ ID NOS: 5 and 6, respectively).
- Both CAR2 and the mutant phage showed impaired wound-homing properties: the CAR2 phage had about 20% of the homing activity of CAR and the mutant phage was essentially inactive in homing.
- a mutant CRK phage was made by changing two amino acids (from CRKDKC to CRASKC, SEQ ID NO: 7 and 8, respectively). The mutant phage had also almost completely lost the homing ability.
- the loss of activity as a result of the sequence changes emphasizes the role of the basic amino acids in the homing activity and attests to the specificity of the homing.
- FACS analysis also revealed strong binding of the synthetic CAR peptide to the CHO-K cells, but not to the pgsA-745 cells.
- An excess of unlabeled CAR peptide inhibited the binding in a dose-dependent manner.
- the binding could also be inhibited with the CAR phage.
- the CAR2 peptide bound only weakly to the CHO-K cells, and KAREC showed no binding to either the CHO-K or pgsA-745 cells.
- CAR peptide internalization of the CAR peptide by CHO-K cells takes place.
- FITC-conjugated CAR, CAR2, CRK, KAREC, CGKRK, and F3 peptides (10 ⁇ M) were incubated with CHO-K for 4 hours, the cells were washed, fixed, stained with the nuclear stain, DAPI, and examined by confocal microscopy.
- the CAR peptide produces strong green fluorescence that mostly overlaps with nuclear DAPI staining CAR2, CRK, and KAREC peptides give no detectable fluorescence.
- CGKRK and F3 overlap with the nuclei and the cytosol.
- CAR peptide takes place by human umbilical vein endothelial cells (HUVECs).
- CAR, CAR2, CRK and KAREC peptides (10 ⁇ M) were incubated with HUVECs for 24 h, unbound peptide was removed by washing, and the cells were fixed. The nuclei were visualized by staining with DAPI and the slides were mounted for analysis under an inverted fluorescence microscope.
- the CAR peptide binds to cells and appears to enter the cells co-localizing with the nuclei.
- the CRK peptide binds to the cells, but does not internalize.
- the control peptides show no binding to the cells.
- CGKRK and F3 Two cell-penetrating peptides, CGKRK and F3, have been characterized, which specifically recognize angiogenic endothelial cells and tumor cells (Hoffman 2003; Porkka 2002). Each of these peptides contains basic residues, raising the question whether they might bind to the same sites at the cell surface as the CAR peptide. F3 and GCKRK accumulated in the cytosol and nuclei both in the CHO-K and pgsA-745 cells, whereas CAR only binds to and is internalized by the CHO-K cells (and CRK does not bind significantly to either cell line).
- Two novel peptides are herein reported that specifically home to tendon and skin wounds, targeting both the vasculature and granulation tissue of the wounds.
- the target molecule of one of the peptides appears to be a cell surface heparan sulfate structure. These peptides are used to provide evidence that the molecular profile of blood vessels in wounds changes as wounds mature.
- the phage screening was performed using wounds made in two tissues, tendon and skin.
- the CAR peptide came from a tendon screen and the CRK peptide was obtained in a skin screen. Despite their different origin, both peptides homed to wounds in both tissues.
- patellar tendons Two types of injuries were used with patellar tendons: For phage screening in rats, patellar tendons were exposed through small skin incisions placed on the lateral side of the joint so that the skin wound and tendon wound were not in direct contact with each other. Six longitudinal, full-length incisions were made into the tendon. Full-thickness incision wounds, 1.5 cm in length, were made in skin on the back of the animal. The skin wounds were left uncovered without a dressing. For quantification of phage homing and peptide injections, two size 11 surgical scalpels were placed side-by-side and the central third of the patellar tendon was removed analogous to the graft used in anterior cruciate ligament reconstruction.
- the libraries were prepared by using NNK-oligonucleotides encoding a random library of cyclic peptides of the general structure CX 7 C, which were cloned into the T7Select 415-1 vector according to the manufacturer's instructions (Novagen, Madison, Wis.). This vector displays peptides in all 415 copies of the phage capsid protein as a C-terminal fusion.
- the screening process involved three in vivo-selection rounds. Eight-week-old Sprague-Dawley rats were injected with the library through the tail vein or intracardially and were perfused 10 min later through the heart with 1% BSA in DMEM to remove unbound intravascular phage.
- the first in vivo round included 19 animals with both patellar tendon and skin wounds, which were separately pooled.
- the second round used separate sets of 3 animals for tendon and skin wound screening, and the third round was performed with one wound of each kind.
- Peptides were synthesized with an automated peptide synthesizer by using standard solid-phase fluorenylmethoxycarbonyl chemistry. During synthesis, the peptides were labeled with fluorescein with an amino-hexanoic acid spacer. Each individual fluorescein-conjugated peptide was injected intravenously into the tail vein of rats or mice with wounds. The peptides were allowed to circulate for different periods of time, followed by heart perfusion. Tissues were embedded into OCT (Tissue-Tek) and processed for microscopy.
- OCT tissue-Tek
- Frozen tissue sections were fixed in acetone for 10 min and incubated with 0.5% blocking reagent for 1 hour (NEN Life Sciences, Boston, Mass.). Tissue sections were incubated with the primary antibody overnight at 4° C.
- the following monoclonal (mAbs) and polyclonal antibodies (pAbs) were used: rabbit anti-T7-phage affinity-purified pAb (1:100) [33], rat anti-mouse CD31 mAb (1:200; BD Pharmingen) and rabbit anti-FITC pAb (1:200, Invitrogen, Carlsbad, Calif.).
- the primary antibodies were detected with labeled secondary antibodies, and each staining experiment included sections stained with species-matched immunoglobulins as negative controls. The sections were washed several times with PBS, mounted in Vectashield Mounting Medium with DAPI (Vector Laboratories) and visualized under an inverted fluorescent or light microscope.
- phage binding experiments approximately 1 ⁇ 10 10 phages were added to 15 ml culture media containing approximately 1 ⁇ 10 6 cells in a test tube. The samples were rotated for 2 hours at +4° C. The cells were then washed six times and transferred to new tube. After a final wash, the cells were counted and cell-bound phage titers were determined. Heparinase treatment of the CHO-K cells was carried out using 1.5 IU/ml heparinase 1 and 1.25 IU/ml heparinase III in serum-free culture media for 2 hours.
- Peptide binding to cells was studied essentially as described above for phage. Peptides were tested at 5 ⁇ M concentration, with or without 5 ⁇ 10 9 phage. After incubation on ice for 30 min, the cells were washed and resuspended with PBS containing 2 ⁇ g/ml of propidium iodide (PI, Invitrogen, Carlsbad, Calif.) and analyzed using a FACScan flow cytometer (BD, San Jose, Calif.).
- PI propidium iodide
- CHO-K cells or HUVEC seeded on plastic coverslips were incubated with 10 ⁇ M fluorescein-conjugated peptides for 30 min to 72 hours, washed 3 times with PBS, and fixed with 4% paraformaldehyde for 20 min at room temperature. After several washes with PBS, the nuclei were visualized by staining with DAPI, and the slides were mounted with ProLong Gold antifade reagent (Invitrogen, Carlsbad, Calif.). The images were acquired using Olympus IX81 inverted and Olympus Fluoview FV1000 confocal microscopes. Z-stack images were taken by confocal microscope every 1 ⁇ m through the cells.
- heparin-coated acrylic beads 10% (v/v) were suspended in 20 mM Na 2 HPO 4 buffer, pH 7.2, containing 0.2 M NaCl. Approximately 5.0 ⁇ 10 9 phage particles were incubated with the beads for 1 hour at room temperature. The beads were washed, transferred to new tube and, bound phage was eluted with 1.2 M NaCl (pH 7.2) and titrated.
- Tissue injuries caused by trauma, surgery and inflammation are a major medical problem.
- Options in promoting tissue repair are largely limited to local intervention.
- the strategy uses two peptides that specifically recognize blood vessels in wounds and can deliver a payload to wounds with a 50- to 500-fold selectivity.
- Decorin prevents tissue fibrosis (Border 1992; Fukushima 2001; Weis 2005; Jarvelainen 2006) and promotes tissue regeneration (Davies 2004) by inhibiting TGF- ⁇ activity (Yamaguchi 1990; Yamaguchi 1988) and by some other regulatory activities (Reed 2002; Zhang 2006).
- TGF- ⁇ Transforming growth factor- ⁇
- TGF- ⁇ is likely to be an important target of decorin because it plays a key role in scar formation (Werner 2003; Brunner 2004; Leask 2004; Ashcroft 1999), and decorin inhibits TGF- ⁇ -dependent responses (Border 1992; Yamaguchi 1990; Yamaguchi 1988; Hildebrand 1994).
- the homing peptide decorins inhibited gene expression of several TGF- ⁇ -induced genes that play are associated with scar formation (Leask 2006; Grotendorst 2005; Border 1990). The inhibition was about 50% at day 5 of healing, when TGF activity peaks in wounds ( FIGS. 3 a and 7 ).
- TGF- ⁇ stimulation of fibroblast growth and extracellular matrix production is primarily mediated by CTGF/CCN2, which is one of the genes found to be down-regulated by the homing peptide decorins.
- CCN2 CCN2 requires the presence of epidermal growth factor (EGF).
- EGF epidermal growth factor
- decorin also antagonizes EGF by binding to EGF receptors (Iozzo 1999; Santra 2000).
- wound-targeted decorin by virtue of being able to block both TGF- ⁇ and EGF signaling, may be superior to therapeutic approaches that only inhibit TGF- ⁇ .
- decorin can to be a physiological regulator of scar formation, as decorin expression is induced in inflamed tissues, and decorin null mice exhibit accentuated scarring.
- TGF- ⁇ and EGF-related growth pathways are an important driver of tumor growth in a number of cancers, and TGF- ⁇ may play a particular role in progenitor-like cells of breast cancers (Shipitsin 2007).
- Decorin can inhibit the growth of tumor cells in vitro and suppress tumor growth and metastasis in vivo.
- the wound-homing peptides also recognize tumor blood vessels and bind to tumor cells.
- targeted decorins can also find application in tumor therapy.
- Peptides were synthesized with an automated peptide synthesizer by using standard solid-phase fluorenylmethoxycarbonyl chemistry. During synthesis, the peptides were labeled with fluorescein with an amino-hexanoic acid spacer as described (Laakkonen 2002).
- the decorin (Krusius 1986) constructs were expressed in 293-F cells using the FreeStyle 293 expression system from Invitrogen (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. The cells were cultured for 48 hrs and the decorins were isolated from the media on Ni-NTA agarose beads (Qiagen, GmbH, Germany) using 5 ml of beads per 500 ml of media. After an overnight incubation at +4° C., the beads were washed with PBS, and decorin was eluted with PBS containing 300 mM imidazole, dialyzed against PBS, and stored at ⁇ 80° C.
- mice Six 8-week-old male BALB/c mice were anesthetized with intraperitoneally-injected 2.5% avertin Skin was shaved, cleaned, and disinfected with betadine and 70% alcohol. All animal experiments received approval from the IACUC of Burnham Institute for Medical Research. Treatment trials were conducted on mice that had circular, 8 mm-diameter, full thickness (including panniculus carnosus muscle) excision wounds in the dorsal skin. The wounds were first marked by a biopsy bunch and then cut with scissors. All skin wounds were left uncovered without a dressing.
- the treatments were started three days after wounding and consisted of daily tail vein injections.
- the dose for decorins was 40 ⁇ g per injection, selected based on previous treatment studies (Border 1992), except that the dose was doubled on Days 4-6 to coincide with the expected peak of TGF- ⁇ expression in the wounds.
- Bovine Serum Albumin (BSA) was used as a control protein.
- Peptides were administered at 1 ⁇ g (2 ⁇ g on days 4-6) per injection.
- the daily dose consisted of 30% CRK-decorin and 70% CAR-decorin between Days 3 and 6.
- the ratio was reversed from Day 7 based on previously determined homing profiles of CRK and CAR phage to wounds at different time-points.
- the wounds were inspected and photographed daily, and scored for complete re-epithelialization.
- the animals were sacrificed and the wounds collected and processed for analyses.
- the following primers were synthesized to amplify full-length human decorin cDNA from pGEM1-PG40 cloning vector 1 and to clone EcoR I and Sal I restriction-sites and his-tag into the C-terminus of the decorin: 5′-ACGTGGATCCATGAAGGCCAC TATCATCCTCCTTC-3′ (SEQ ID NO: 11) and 5′′-ATCCGCTCGAGTTAGTGATGG TGATGGTGATGCGAGCTGCCGCGCGGCACCAGGTCGACGAATTCCGAGCCCTT ATAGTTTCCGAGTTGAATGGCAGA (SEQ ID NO: 12).
- the homing peptide coding sequences were ligated to the EcoR I and Sal I restriction sites.
- the following primers were synthesized to amplify the resulting construct flanked with a Kozak sequence from the pFastBac1-vector to mammalian expression vector pcDNA3.1/myc-his-C (Invitrogen, Carlsbad, Calif.): 5′′-ACGTGGATCCGGACCGTTTCAACAGAGAGGCTTATTTGACTTTATGCTAGA-3′′ (SEQ ID NO: 17) and 5′′-ATCCGCTCGAGTTAGTGATGGTGATGGTGATGCGAGCT-3′ (SEQ ID NO: 18).
- a map of the C-terminus of the decorin fusion proteins is shown in FIG. 4 .
- proteins were separated on 10% SDS-PAGE. Protein bands were detected by silver staining, extracted, and subjected to in-gel trypsin digestion and peptide mass fingerprinting in MALDI-TOF.
- CHO-K and glycosaminoglycan-deficient pgsA-745 cells seeded on plastic coverslips were incubated with different decorins for 4 to 72 hrs, washed 3 times with PBS, and fixed with 4% paraformaldehyde for 20 min at room temperature. After several washes with PBS, the primary antibodies against human decorin and 6-histidine were applied on slides for one hour at room temperature, and the primary antibodies were detected with AlexaFluor 488 anti-mouse and anti-rabbit IgGs (1:1,000 and 1:3,000, Invitrogen, Carlsbad, Calif.).
- Wound tissues were isolated, bisected, fixed overnight in 10% buffered zinc formalin (Statlab Medical Products, Lewisville, Tex.), dehydrated, and embedded in paraffin. Sections (6 ⁇ m) from the middle of the wound were stained with hematoxylin/eosin or using the Masson trichrome procedure, or processed for immunohistochemistry.
- Frozen sections were fixed in acetone for 10 min and pre-incubated with 0.5% blocking reagent for 1 hr (NEN Life Sciences, Boston, Mass.). Formalin fixed, paraffin embedded tissue sections were deparaffinized, incubated with the blocking reagent, and endogenous peroxidase activity was suppressed with hydrogen peroxide. Tissue sections were incubated with the primary antibody overnight at 4° C. The primary antibodies were detected with corresponding secondary antibodies, and each staining experiment included slides stained with species-matched immunoglobulins as negative controls. The slides were washed several times in PBS, mounted in Vectashield Mounting Medium with DAPI (Vector Laboratories) and visualized under an inverted fluorescent or light microscope.
- DAPI Vector Laboratories
- mice anti-human HRP-conjugated ⁇ -SMA mAb (clone 1A4, DAKO, Glostrup, Denmark)
- rabbit anti-6-histidine tag pAb (1:400, clone NB600-318, Novus Biologicals, Littleton, Colo.)
- mouse anti-human decorin mAb (30 ng/ml, clone MAB143, R&D Systems, Minneapolis, Minn.).
- RT-PCR was performed using an Mx3000p instrument (Stratagene Inc, La Jolla, Calif.) by following the procedures as described in RT Profiler PCR Array user manual (SuperArray Bioscience Corp. Frederick, Md.). Replicate analysis consisted of two pools of RNA isolated from two wounds in each of four different animals.
- CAR and CRK peptides home to hypervascular regions surrounding the tumors and to tumor tissue.
- Fluorescein-conjugated peptides CAR, control peptide CAR2, CRK and control peptide KAREC were intravenously injected into mice with MDA-MB-235 tumor xenografts. Tumor tissue was collected 4 hours later and examined for the presence of the peptides. Adjacent tissue section were stained for blood vessels (CD-31), while the FITC-labeled peptide was first detected with rabbit anti-FITC followed by biotin-conjugated anti-rabbit IgG to confirm the source of fluorescent signal to be from the FITC-labeled peptide. The sections were then stained with hematoxylin-eosin.
- Granulation tissue and scar formation during wound healing in mice treated with targeted decorins was measured.
- the area of granulation tissue/scar area was determined from both halves of the wound and expressed as the average of the two values. There were five animals (each with three wounds) in each time-point in each treatment group at day 10, 12, respectively. Those animals treated with decorin showed that the most healing had taken place.
- Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and/or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Rheumatology (AREA)
- Biophysics (AREA)
- Pain & Pain Management (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Dermatology (AREA)
- Immunology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
- Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.” Nucleic Acids Res 25:3389-3402 (1997).
- Arap, W., Haedicke, W., Bernasconi, M., Kain, R., Rajotte, D., Krajewski, S., Ellerby, H. M., Bredesen, D. E., Pasqualini, R., and Ruoslahti, E. “Targeting the prostate for destruction through a vascular address.” Proc Natl Acad Sci USA 99:1527-1531 (2002).
- Arap, W., Pasqualini, R., and Ruoslahti, E. “Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model.” Science 279:377-380 (1998).
- Ashcroft G S, et al. “Mice lacking Smad3 show accelerated wound healing and an impaired local inflammatory response.” Nat. Cell Biol. 1:260-266 (1999).
- Border W A, et al. “Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease.” Nature 360:361-364 (1992).
- Border W A, Okuda S, Languino L R, Sporn M B, Ruoslahti E: “Suppression of experimental glomerulonephritis by antiserum against transforming growth factor beta 1.” Nature 346: 371-374 (1990).
- Brunner G, Blakytny R: “Extracellular regulation of TGF-beta activity in wound repair: growth factor latency as a sensor mechanism for injury.” Thromb. Haemost. 92:253-261 (2004).
- Chargé S B P, Rudnicki M A. “Cellular and molecular regulation of muscle regeneration.” Physiol Rev. 84:209-238 (2004).
- Chen Y, Shi-Wen X, van Beek J, Kennedy L, McLeod M, Renzoni E A, Bou-Gharios G, Wilcox-Adelman S, Goetinck P F, Eastwood M, Black C M, Abraham D J, Leask A. “Matrix contraction by dermal fibroblasts requires transforming growth factor-β/activin-linked
kinase 5, heparan sulfate-containing proteoglycans, and MEK/ERK: insights into pathological scarring in chronic fibrotic disease.” Am J Pathol, 167:1699-1711 (2005). - Cheon S S, et al. “Beta-catenin regulates wound size and mediates the effect of TGF-beta in cutaneous healing.” Faseb J. 20: 692-701 (2006).
- Davies J E, Tang X, Denning J W, Archibald S J, Davies S J. “Decorin suppresses neurocan, brevican, phosphacan and NG2 expression and promotes axon growth across adult rat spinal cord injuries.” Eur J Neurosci. 19:1226-1242 (2004).
- Desmouliere A, Chaponnier C, Gabbiani G: “Tissue repair, contraction, and the myofibroblast.” Wound Repair Regen. 13:7-12 (2005).
- Esko J D, Stewart T E, Taylor W H. “Animal cell mutants defective in glycosaminoglycan biosynthesis.” Proc Natl Acad Sci USA. 82(10):3197-201 (1985 May).
- Falanga V. “Wound healing and its impairment in the diapetic foot.” Lancet 366:1736-1743 (2006).
- Folkman J. “angiogenesis.” Annu Rev Med 57:1-18 (2006).
- Fukushima K, et al. “The use of an antifibrosis agent to improve muscle recovery after laceration.” Am. J. Sports Med. 29:394-402 (2001).
- Gabbiani G. “The myofibroblast in wound healing and fibrocontractive diseases.” J Pathol 200:500-503 (2003).
- Galang, C. K., Muller, W. J., Foos, G., Oshima, R. G. & Hauser, C. A. “Changes in the expression of many Ets family transcription factors and of potential target genes in normal mammary tissue and tumors.” J. Biol. Chem. 279:11281-11292 (2004).
- Gerlag, D. M., Borges, E., Tak, P. P., Ellerby, H. M., Bredesen, D. E., Pasqualini, R., Ruoslahti, E., Firestein, G. S. “Suppression of murine collagen-induced arthritis by targeted apoptosis of synovial neovasculature.” Arthritis Research 3:357-361 (2001).
- Gorvy D A, Herrick S E, Shah M, Ferguson M W J. “Experimental manipulation of transforming growth factor-βisoforms significantly affects adhesion formation in a murine surgical model.” Am J Pathol 167:1005-1019 (2005).
- Grotendorst G R, Duncan M R. “Individual domains of connective tissue growth factor regulate fibroblast proliferation and myofibroblast differentiation.” FASEB J. 19:729-38 (2005).
- Grotendorst G R, Rahmanie H, Duncan M R. “Combinatorial signaling pathways determine fibroblast proliferation and myofibroblast differentiation.” FASEB J. 18:469-79 (2004).
- Hoffman J A, Giraudo E, Singh M, Zhang L, Inoue M, Porkka K, Hanahan D, Ruoslahti E. “Progressive vascular changes in a transgenic mouse model of squamous cell carcinoma.” Cancer Cell 4:383-91 (2003).
- Hildebrand A, Romaris M, Rasmussen L M, Heinegard D, Twardzik D R, Border W A, Ruoslahti E. “Interaction of the small interstitial proteoglycans biglycan, decorin and fibromodulin with transforming growth factor β.” Biochem J 302 (Pt 2):527-534 (1994).
- Hu Q, Ueno N, Behringer R R. “Restriction of BMP4 activity domains in the developing neural tube of the mouse embryo.” EMBO Rep 5:734-739 (2004).
- Iozzo R V, Moscatello D K, McQuillan D J, Eichstetter I. “Decorin is a biological ligand for the epidermal growth factor receptor.” J Biol Chem 274(8):4489-4492 (1999).
- Jarvelainen H, et al. “A role for decorin in cutaneous wound healing and angiogenesis.” Wound Repair Regen. 14:443-452 (2006).
- Joliot A. “Transduction peptides within naturally occurring proteins.” Sci STRE 313:pe54 (2005).
- Joyce, J. A., Laakkonen P., Bernasconi, M., Bergers, G., Ruoslahti, E., and Hanahan, D. “Stage-specific vascular markers revealed by phage display in a mouse model of pancreatic islet tumorigenesis.” Cancer Cell 4:393-403 (2003).
- Kolonin M G. Sun J. Do K A. Vidal C I. Ji Y. Baggerly K A. Pasqualini R. Arap W. “Synchronous selection of homing peptides for multiple tissues by in vivo phage display.” FASEB J. 20:979-81 (2006).
- Kreuger, J., Spillman, D. and Lindahl, Ulf. “Interactions between heparan sulfate and proteins: the concept of specificity.” J. Cell Biol. 174: 323-327 (2006).
- Krusius T, Ruoslahti E. “Primary structure of an extracellular matrix proteoglycan core protein deduced from cloned cDNA.” Proc Natl Acad Sci USA 83(20):7683-7 (1996).
- Krusius, T. & Ruoslahti, E. “Primary structure of an extracellular matrix proteoglycan core protein deduced from cloned cDNA.” Proc. Natl. Acad. Sci. USA 83:7683-7687 (1986).
- Laakkonen, P., Porkka, K., Hoffman, J. A., and Ruoslahti, E. “A tumor-homing peptide with a targeting specificity related to lymphatic vessels.” Nat Med 8:751-755 (2002).
- Laakkonen, P., Akerman, M. E., Biliran, H., Yang, M., Ferrer, F., Karpanen, T., Hoffman, R. M., and Ruoslahti, E. “Antitumor activity of a homing peptide that targets tumor lymphatics and tumor cells.” Proc. Natl. Acad. Sci. USA. 101:9381-9386 (2004).
- Laemmli, U. K. “Cleavage of structural proteins during the assembly of the head of bacteriophage T4.” Nature 227:680-685 (1970).
- Leask A, Abraham D J: “All in the CCN family: essential matricellular signaling modulators emerge from the bunker.” J. Cell Sci. 119:4803-4810 (2006).
- Leask A, Abraham D J: “TGF-beta signaling and the fibrotic response.” Faseb J. 18:816-827 (2004).
- Liu C. Bhattacharjee G. Boisvert W. Dilley R. Edgington T. “In vivo interrogation of the molecular display of atherosclerotic lesion surfaces.” Am. J. Path. 163:1859-71 (2003).
- Lyon M, Rushton G, Gallagher J T. “The interaction of the transforming growth factor-βs with heparin/heparan sulfate is isoform-specific.” J Biol Chem 272(29):18000-6 (1997).
- Martin, P. “Wound healing-aiming for perfect skin regeneration.” Science 276:75-81 (1997).
- Ohkawara B, Iemura S, ten Dijke P, Ueno N “Action range of BMP is defined by its N-terminal basic amino acid core.” Curr Biol 12: 205-209 (2002).
- Pasqualini, R., and Ruoslahti, E. “Organ targeting in vivo using phage display peptide libraries.” Nature 380:364-366 (1996).
- Pilch J, Brown D M, Komatsu M, Järvinen T A H, Yang M, Peters D, Hoffman R M, Ruoslahti E: “Peptides selected for clotted plasma accumulate in tumor stroma and wounds.” Proc. Natl. Acad. Sci. USA 103:2800-2803 (2006).
- Porkka, K., Laakkonen, P., Hoffman, J. A., Bernasconi, M., and Ruoslahti, E. “A fragment of the HMGN2 protein homes to the nuclei of tumor cells and tumor endothelial cells in vivo.” Proc Natl Acad Sci USA 99:7444-7449 (2002).
- Rajotte, D., Arap, W., Hagedorn, M., Koivunen, E., Pasqualini, R., and Ruoslahti, E. “Molecular heterogeneity of the vascular endothelium revealed by in vivo phage display.” J Clin Invest 102:430-437 (1998).
- Rajotte, D., and Ruoslahti, E. “Membrane dipeptidase is the receptor for a lung-targeting peptide identified by in vivo phage display.” J Biol Chem 274:11593-11598 (1999).
- Reed C C, Waterhouse A, Kirby S, Kay P, Owens R T, McQuillan D J, Iozzo R V. “Decorin prevents metastatic spreading of breast cancer.” Oncogene 24:1104-10 (2005).
- Reed C C, Iozzo R V: “The role of decorin in collagen fibrillogenesis and skin homeostasis.” Glycoconj. J. 19:249-255 (2002).
- Rider C C. “Heparin/heparan sulphate binding in the TGF-β cytokine superfamily.” Biochem Soc Trans 34:458-460 (2006).
- Ruoslahti, E. “Specialization of tumour vasculature.” Nat Rev Cancer 2:83-90 (2002).
- Ruoslahti E, Yamaguchi Y. “Proteoglycans as modulators of growth factor activities.” Cell 64: 867-9 (1991).
- Santra M, Reed C C, Iozzo R V. “Decorin binds to a narrow region of the epidermal growth factor (EGF) receptor, partially overlapping but distinct from the EGF-binding epitope.” J Biol Chem 277:35671-81 (2002).
- Santra M, Eichstetter I, Iozzo R V: “An anti-oncogenic role for decorin. Down-regulation of ErbB2 leads to growth suppression and cytodifferentiation of mammary carcinoma cells.” J. Biol. Chem. 275:35153-35161 (2000).
- Santra M, Eichstetter I, Iozzo R V. “An anti-oncogenic role for decorin. Down-regulation of ErbB2 leads to growth suppression and cytodifferentiation of mammary carcinoma cells.” J Biol Chem 275:35153-61 (1999).
- Seidler D G, et al. “Decorin protein core inhibits in vivo cancer growth and metabolism by hindering epidermal growth factor receptor function and triggering apoptosis via caspase-3 activation.” J Biol Chem 281:26408-26418 (2006).
- Shah M, Foreman D M, Ferguson M W. “Neutralisation of TGF-beta 1 and TGF-
beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring.” J Cell Sci. 108:985-1002 (1995). - Shipitsin M, et al. “Molecular definition of breast tumor heterogeneity.”
Cancer Cell 11, 259-273 (2007). - Singer A J, Clark R A F. “Cutaneous wound healing.” N Engl J Med 341:738-746 (1999).
- Sullivan M M, et al. “Matricellular hevin regulates decorin production and collagen assembly.” J Biol Chem 281: 27621-27632 (2006).
- Tralhao J G, Schaefer L, Micegova M, Evaristo C, Schonherr E, Kayal S, Veiga-Fernandes H, Danel C, Iozzo R V, Kresse H, Lemarchand P. “In vivo selective and distant killing of cancer cells using adenovirus-mediated decorin gene transfer.” FASEB J 17:464-6 (2003).
- Weis S M, et al. “A role for decorin in the remodeling of myocardial infarction.” Matrix Biol. 24:313-324 (2005).
- Werner S, Grose R: “Regulation of wound healing by growth factors and cytokines” Physiol Rev 83:835-870 (2003).
- Yamaguchi Y, Mann D, Ruoslahti E. “Negative regulation of transforming growth factor-β by the proteoglycan decorin.” Nature 346:281-284 (1990).
- Yamaguchi Y, Ruoslahti E. “Expression of human proteoglycan in Chinese hamster ovary cells inhibits cell proliferation.” Nature 336:244-246 (1988).
- Yang L, Qiu C X, Ludlow A, Ferguson M W, Brunner G: “Active transforming growth factor-beta in wound repair: determination using a new assay.” Am. J. Pathol. 154:105-111 (1999).
- Zhang G, et al. “Decorin regulates assembly of collagen fibrils and acquisition of biomechanical properties during tendon development.” J. Cell Biochem. 98:1436-1449 (2006).
- Zorko M, Langel U. “Cell penetrating peptides: mechanism and kinetics of cargo delivery.” Adv. Drug Deliv Rev 57:529-45 (2005).
- Zurita et al Cancer Res. 64:435-9 (2004).
Claims (58)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/450,972 US8470780B2 (en) | 2006-12-06 | 2012-04-19 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US86877206P | 2006-12-06 | 2006-12-06 | |
| US11/951,819 US8188220B2 (en) | 2006-12-06 | 2007-12-06 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
| US13/450,972 US8470780B2 (en) | 2006-12-06 | 2012-04-19 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/951,819 Division US8188220B2 (en) | 2006-12-06 | 2007-12-06 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| US20120201753A1 US20120201753A1 (en) | 2012-08-09 |
| US8470780B2 true US8470780B2 (en) | 2013-06-25 |
Family
ID=39944154
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/951,819 Active 2028-07-16 US8188220B2 (en) | 2006-12-06 | 2007-12-06 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
| US13/450,972 Expired - Fee Related US8470780B2 (en) | 2006-12-06 | 2012-04-19 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/951,819 Active 2028-07-16 US8188220B2 (en) | 2006-12-06 | 2007-12-06 | Methods and compositions related to targeting wounds, regenerating tissue, and tumors |
Country Status (2)
| Country | Link |
|---|---|
| US (2) | US8188220B2 (en) |
| WO (1) | WO2008136869A2 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9200039B2 (en) | 2013-03-15 | 2015-12-01 | Symic Ip, Llc | Extracellular matrix-binding synthetic peptidoglycans |
| US9217016B2 (en) | 2011-05-24 | 2015-12-22 | Symic Ip, Llc | Hyaluronic acid-binding synthetic peptidoglycans, preparation, and methods of use |
| US9512192B2 (en) | 2008-03-27 | 2016-12-06 | Purdue Research Foundation | Collagen-binding synthetic peptidoglycans, preparation, and methods of use |
| US10772931B2 (en) | 2014-04-25 | 2020-09-15 | Purdue Research Foundation | Collagen binding synthetic peptidoglycans for treatment of endothelial dysfunction |
| US11524077B2 (en) * | 2012-03-09 | 2022-12-13 | Vascular Biosciences | Orally active, cell-penetrating homing peptide and methods using same |
| US11529424B2 (en) | 2017-07-07 | 2022-12-20 | Symic Holdings, Inc. | Synthetic bioconjugates |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7176243B2 (en) * | 2000-06-02 | 2007-02-13 | The General Hospital Corporation | CaR receptor as a mediator of migratory cell chemotaxis and/or chemokinesis |
| WO2008085794A2 (en) * | 2007-01-03 | 2008-07-17 | Burnham Institute For Medical Research | Methods and compositions related to clot binding compounds |
| US8580749B2 (en) * | 2009-06-05 | 2013-11-12 | Cell Targeting, Inc. | Peptide-coated cell localization to diseased or damaged tissues and methods related thereto |
| WO2011043980A1 (en) | 2009-10-07 | 2011-04-14 | Sanford Burnham Medical Research Institute | Methods and compositions related to clot-binding lipid compounds |
| CA2784145A1 (en) * | 2009-12-18 | 2011-06-23 | Sanford-Burnham Medical Research Institute | Methods and compositions related to clot-binding compounds |
| EP2538957B1 (en) | 2010-02-26 | 2019-07-24 | Vascular Biosciences, Inc. | Car peptide for homing, diagnosis,&targeted therapy for pulmonary and fibrotic disorders |
| WO2011127405A1 (en) | 2010-04-08 | 2011-10-13 | Sanford-Burnham Medical Research Institute | Methods and compositions for enhanced delivery of compounds |
| US8663932B2 (en) | 2010-12-21 | 2014-03-04 | Leidos, Inc. | Methods and compositions for wound treatment |
| WO2012118778A1 (en) | 2011-02-28 | 2012-09-07 | Sanford-Burnham Medical Research Institute | Truncated car peptides and methods and compositions using truncated car peptides |
| US8748393B2 (en) | 2011-05-13 | 2014-06-10 | The Board Of Trustees Of The Leland Stanford Junior University | Inhibitors of mitochondrial fission and methods of use thereof |
| GB201302837D0 (en) * | 2013-02-19 | 2013-04-03 | Univ Singapore | Therapeutic Agents |
| WO2016022610A1 (en) | 2014-08-06 | 2016-02-11 | Vascular Biosciences | Compositions containing a pharmacophore with selectivity to diseased tissue and methods of making same |
| WO2016172515A1 (en) | 2015-04-23 | 2016-10-27 | Sanford Burnham Prebys Medical Discovery Institute | Targeted delivery system and methods of use therefor |
| CA3031955A1 (en) | 2016-07-29 | 2018-02-01 | Juno Therapeutics, Inc. | Immunomodulatory polypeptides and related compositions and methods |
| AU2021266157A1 (en) | 2020-04-28 | 2022-12-08 | Tampere University Foundation Sr | Homing peptide-guided decorin conjugates for use in treating epidermolysis bullosa |
| US12201643B2 (en) | 2021-10-15 | 2025-01-21 | The Board Of Trustees Of The University Of Illinois | Mechanochemical dynamic for focal cancer treatment |
Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0045665A1 (en) | 1980-08-06 | 1982-02-10 | Aktiebolaget Hässle | Enzyme inhibitors |
| US4418052A (en) | 1980-08-12 | 1983-11-29 | Wong Dennis W | Diagnostic compositions and method for radiologic imaging of fibrinogen deposition in the body |
| US5011686A (en) | 1987-09-21 | 1991-04-30 | Creative Biomolecules, Inc. | Thrombus specific conjugates |
| US5024829A (en) | 1988-11-21 | 1991-06-18 | Centocor, Inc. | Method of imaging coronary thrombi |
| US5789542A (en) | 1994-04-22 | 1998-08-04 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Amphipathic peptides |
| US6074832A (en) | 1996-07-19 | 2000-06-13 | The Regents Of The University Of Michigan | DNA encoding canine von Willebrand factor and methods of use |
| WO2001055210A2 (en) | 2000-01-31 | 2001-08-02 | Munin Corporation | Human cyr61 |
| WO2003101284A2 (en) | 2002-06-04 | 2003-12-11 | Metabolex, Inc. | Methods of diagnosing and treating diabetes and insulin resistance |
| US20040009122A1 (en) | 1997-04-24 | 2004-01-15 | Amersham Health As | Contrast agents |
| US20040031072A1 (en) | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| US6863889B2 (en) | 1999-03-09 | 2005-03-08 | Curagen Corporation | Polynucleotides and proteins encoded thereby |
| US7214786B2 (en) | 2000-12-14 | 2007-05-08 | Kovalic David K | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
| US7368531B2 (en) | 1997-03-07 | 2008-05-06 | Human Genome Sciences, Inc. | Human secreted proteins |
| US20080213377A1 (en) | 2006-12-08 | 2008-09-04 | Bhatia Sangeeta N | Delivery of Nanoparticles and/or Agents to Cells |
| US7745391B2 (en) | 2001-09-14 | 2010-06-29 | Compugen Ltd. | Human thrombospondin polypeptide |
| US7803769B2 (en) | 2006-10-25 | 2010-09-28 | Amgen Inc. | OSK1 peptide analogs and pharmaceutical compositions |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2265484C (en) * | 1996-09-10 | 2008-12-02 | The Burnham Institute | Tumor homing molecules, conjugates derived therefrom, and methods of using same |
| US20060084794A1 (en) * | 2001-04-12 | 2006-04-20 | Human Genome Sciences, Inc. | Albumin fusion proteins |
-
2007
- 2007-12-06 WO PCT/US2007/086627 patent/WO2008136869A2/en not_active Ceased
- 2007-12-06 US US11/951,819 patent/US8188220B2/en active Active
-
2012
- 2012-04-19 US US13/450,972 patent/US8470780B2/en not_active Expired - Fee Related
Patent Citations (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0045665A1 (en) | 1980-08-06 | 1982-02-10 | Aktiebolaget Hässle | Enzyme inhibitors |
| US4418052A (en) | 1980-08-12 | 1983-11-29 | Wong Dennis W | Diagnostic compositions and method for radiologic imaging of fibrinogen deposition in the body |
| US5011686A (en) | 1987-09-21 | 1991-04-30 | Creative Biomolecules, Inc. | Thrombus specific conjugates |
| US5024829A (en) | 1988-11-21 | 1991-06-18 | Centocor, Inc. | Method of imaging coronary thrombi |
| US5789542A (en) | 1994-04-22 | 1998-08-04 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Amphipathic peptides |
| US6074832A (en) | 1996-07-19 | 2000-06-13 | The Regents Of The University Of Michigan | DNA encoding canine von Willebrand factor and methods of use |
| US7368531B2 (en) | 1997-03-07 | 2008-05-06 | Human Genome Sciences, Inc. | Human secreted proteins |
| US20040009122A1 (en) | 1997-04-24 | 2004-01-15 | Amersham Health As | Contrast agents |
| US6863889B2 (en) | 1999-03-09 | 2005-03-08 | Curagen Corporation | Polynucleotides and proteins encoded thereby |
| US20040031072A1 (en) | 1999-05-06 | 2004-02-12 | La Rosa Thomas J. | Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement |
| WO2001055210A2 (en) | 2000-01-31 | 2001-08-02 | Munin Corporation | Human cyr61 |
| US7214786B2 (en) | 2000-12-14 | 2007-05-08 | Kovalic David K | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
| US7745391B2 (en) | 2001-09-14 | 2010-06-29 | Compugen Ltd. | Human thrombospondin polypeptide |
| WO2003101284A2 (en) | 2002-06-04 | 2003-12-11 | Metabolex, Inc. | Methods of diagnosing and treating diabetes and insulin resistance |
| US7803769B2 (en) | 2006-10-25 | 2010-09-28 | Amgen Inc. | OSK1 peptide analogs and pharmaceutical compositions |
| US20080213377A1 (en) | 2006-12-08 | 2008-09-04 | Bhatia Sangeeta N | Delivery of Nanoparticles and/or Agents to Cells |
Non-Patent Citations (141)
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9512192B2 (en) | 2008-03-27 | 2016-12-06 | Purdue Research Foundation | Collagen-binding synthetic peptidoglycans, preparation, and methods of use |
| US10689425B2 (en) | 2008-03-27 | 2020-06-23 | Purdue Research Foundation | Collagen-binding synthetic peptidoglycans, preparation, and methods of use |
| US9217016B2 (en) | 2011-05-24 | 2015-12-22 | Symic Ip, Llc | Hyaluronic acid-binding synthetic peptidoglycans, preparation, and methods of use |
| US11524077B2 (en) * | 2012-03-09 | 2022-12-13 | Vascular Biosciences | Orally active, cell-penetrating homing peptide and methods using same |
| US9200039B2 (en) | 2013-03-15 | 2015-12-01 | Symic Ip, Llc | Extracellular matrix-binding synthetic peptidoglycans |
| US9872887B2 (en) | 2013-03-15 | 2018-01-23 | Purdue Research Foundation | Extracellular matrix-binding synthetic peptidoglycans |
| US10772931B2 (en) | 2014-04-25 | 2020-09-15 | Purdue Research Foundation | Collagen binding synthetic peptidoglycans for treatment of endothelial dysfunction |
| US11529424B2 (en) | 2017-07-07 | 2022-12-20 | Symic Holdings, Inc. | Synthetic bioconjugates |
Also Published As
| Publication number | Publication date |
|---|---|
| US8188220B2 (en) | 2012-05-29 |
| WO2008136869A2 (en) | 2008-11-13 |
| WO2008136869A3 (en) | 2009-02-05 |
| US20120201753A1 (en) | 2012-08-09 |
| US20090036349A1 (en) | 2009-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8470780B2 (en) | Methods and compositions related to targeting wounds, regenerating tissue, and tumors | |
| US9522198B2 (en) | Methods and compositions related to targeting tumors and wounds | |
| US8753604B2 (en) | Methods and compositions for synaphically-targeted treatment for cancer | |
| US7488792B2 (en) | Collagen-binding molecules that selectively home to tumor vasculature and methods of using same | |
| US12195558B2 (en) | Targeted delivery system and methods of use therefor | |
| US8759300B2 (en) | Polypeptides and methods of use | |
| Järvinen et al. | Molecular changes in the vasculature of injured tissues | |
| WO2011127405A1 (en) | Methods and compositions for enhanced delivery of compounds | |
| US20230414704A1 (en) | Compositions Containing a Pharmacophore with Selectivity to Diseased Tissue and Methods of Making Same | |
| US9061079B2 (en) | Peptides that home to atherosclerotic plaques and methods of use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: BURNHAM INSTITUTE FOR MEDICAL RESEARCH, CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:RUOSLAHTI, ERKKI;JARVINEN, TERO;REEL/FRAME:028079/0292 Effective date: 20080930 Owner name: SANFORD-BURNHAM MEDICAL RESEARCH INSTITUTE, GEORGI Free format text: CHANGE OF NAME;ASSIGNOR:BURNHAM INSTITUTE FOR MEDICAL RESEARCH;REEL/FRAME:028081/0632 Effective date: 20100208 |
|
| STCF | Information on status: patent grant |
Free format text: PATENTED CASE |
|
| CC | Certificate of correction | ||
| FPAY | Fee payment |
Year of fee payment: 4 |
|
| AS | Assignment |
Owner name: SANFORD BURNHAM PREBYS MEDICAL DISCOVERY INSTITUTE, CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:SANFORD-BURNHAM MEDICAL RESEARCH INSTITUTE;REEL/FRAME:054033/0296 Effective date: 20150624 |
|
| FEPP | Fee payment procedure |
Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| FEPP | Fee payment procedure |
Free format text: 7.5 YR SURCHARGE - LATE PMT W/IN 6 MO, SMALL ENTITY (ORIGINAL EVENT CODE: M2555); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| MAFP | Maintenance fee payment |
Free format text: PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY Year of fee payment: 8 |
|
| AS | Assignment |
Owner name: NATIONAL INSTITUTES OF HEALTH - DIRECTOR DEITR, MARYLAND Free format text: CONFIRMATORY LICENSE;ASSIGNOR:SANFORD BURNHAM PREBYS MEDICAL DISCOVERY INSTITUTE;REEL/FRAME:064514/0238 Effective date: 20230802 |
|
| CC | Certificate of correction | ||
| FEPP | Fee payment procedure |
Free format text: MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| LAPS | Lapse for failure to pay maintenance fees |
Free format text: PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY |
|
| STCH | Information on status: patent discontinuation |
Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
|
| FP | Lapsed due to failure to pay maintenance fee |
Effective date: 20250625 |