US8263379B2 - Modified family 6 glycosidases with altered substrate specificity - Google Patents

Modified family 6 glycosidases with altered substrate specificity Download PDF

Info

Publication number
US8263379B2
US8263379B2 US12/504,070 US50407009A US8263379B2 US 8263379 B2 US8263379 B2 US 8263379B2 US 50407009 A US50407009 A US 50407009A US 8263379 B2 US8263379 B2 US 8263379B2
Authority
US
United States
Prior art keywords
glycosidase
family
modified
seq
beta
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related, expires
Application number
US12/504,070
Other versions
US20100016570A1 (en
Inventor
John Tomashek
James Lavigne
Annie Tremblay
Patrick St-Pierre
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Iogen Energy Corp
Original Assignee
Iogen Energy Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Iogen Energy Corp filed Critical Iogen Energy Corp
Priority to US12/504,070 priority Critical patent/US8263379B2/en
Assigned to IOGEN ENERGY CORPORATION reassignment IOGEN ENERGY CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LAVIGNE, JAMES, TOMASHEK, JOHN, ST-PIERRE, PATRICK, TREMBLAY, ANNIE
Publication of US20100016570A1 publication Critical patent/US20100016570A1/en
Application granted granted Critical
Publication of US8263379B2 publication Critical patent/US8263379B2/en
Expired - Fee Related legal-status Critical Current
Adjusted expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/22—Processes using, or culture media containing, cellulose or hydrolysates thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/244—Endo-1,3(4)-beta-glucanase (3.2.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01006—Endo-1,3(4)-beta-glucanase (3.2.1.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01091—Cellulose 1,4-beta-cellobiosidase (3.2.1.91)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • the present invention relates to modified glycosyl hydrolase (GH) enzymes. More specifically, the invention relates to modified enzymes of the GH Family 6 (GH6) with altered substrate specificity. The present invention also relates to genetic constructs comprising nucleotide sequences that encode and direct the expression and secretion of modified GH enzymes, methods for the production of modified GH enzymes from host strains, and the use of the modified GH enzymes.
  • GH glycosyl hydrolase
  • Glycosyl hydrolases are a large group of enzymes that cleave glycosidic bonds between individual carbohydrate monomers in large polysaccharide molecules. For example, cellulases cleave the beta 1-4 bond between glucose monomers in the cellulose polymer; arabinofuranosidases cleave the alpha 1-2 and/or alpha 1-3 bonds between arabinose and xylose in arabinoxylan; amylases cleave the alpha 1-4 bonds between glucose molecules in starch, etc. As a result of the diversity of polysaccharide molecules, there are also many different GH enzymes. However, these enzymes all share one of two common mechanisms, called inverting and retaining, for introducing a water molecule at a glycosidic bond thus cleaving the polysaccharide. The majority of GH enzymes utilize the retaining mechanism.
  • the GH enzymes are grouped into more than 100 different families based on commonality in their primary and tertiary structures and their catalytic mechanism (CAZy website, URL: malariay.org: Coutinho and Henrissat, 1999). Some GH enzymes families are grouped into larger clans. Depending upon the particular family (all numbers are according to the CAZy website as of 13 March 2008), it may have only a few known examples (e.g., family GH82) or many (e.g. family GH34); more than half of the families have fewer than 200 members.
  • all the members of a particular family may represent essentially a single activity, which is to say activity against a single specific substrate (e.g., GH11, all of which are xylanases), whereas other families may have enzymes that cover a wide range of activities (e.g., GH5, comprising cellulases, xylanases, mannanases, chitosanases, galactanases, etc.).
  • GH5 comprising cellulases, xylanases, mannanases, chitosanases, galactanases, etc.
  • enzymes have their highest activity for a single substrate, although there are examples of particular enzymes that have high activity against several substrates (e.g. Cel7B from Trichoderma reesei , which has both cellulase and xylanase activity).
  • the GH Family 6 belongs to no clan; it comprises over 100 members, all of which exhibit primarily cellulase activity using the inverting mechanism. Both endo- and exo-cellulases have been identified from a variety of bacterial and fungal sources. In addition, some GH6 members, including Cel6A from Trichoderma reesei , have been shown to have hydrolytic activity against beta-glucan, which is a linear polymer of glucose with mixed linkages (Henriksson et al., 1995).
  • beta-glucans form a large group of industrially important polysaccharides. Because of their mixed linkages, the beta-glucans have higher solubility in aqueous solutions than more regular polymers such as cellulose. In the soluble form, the beta-glucans confer viscosity and/or gel-like properties to a solution.
  • beta 1-3, 1-6 glucan also known as laminaran because a major source of this glucan is Laminaria brown algae (kelp)
  • beta 1-3, 1-4 glucan also known as lichenan because a major source of this glucan is lichen.
  • beta 1-3, 1-4 glucan is also found as a major component of oat and barley endosperm.
  • Hydrolysis of beta 1-3, 1-4 glucan from grains is desirable on the industrial scale to reduce viscosity in processes such as brewing, in the production of grain ethanol for fuel, and also to increase nutrient accessibility in animal feeds.
  • Trichoderma reesei Cel6A expressed in brewer's yeast is used to aid in the malting and brewing processes (Enari et al., 1987).
  • the GH6 family of enzymes have been the target of mutational and protein engineering studies.
  • the exocellulase Cel6A from Trichoderma reesei the exocellulase Cel6A from Humicola insolens , and the cellulases Cel6A (endo) and Cel6B (exo) from Thermobifida fusca are representative enzymes that have been particularly well characterized. Specific sites of investigation include what are known as the loop regions. These are the principal determinants of whether an enzyme is an endocellulase (lacking loops) or an exocellulase (possessing loops).
  • T. reesei Cel6A (or TrCel6A) is one of the two major cellobiohydrolases secreted by this fungus and has been shown to be efficient in the enzymatic hydrolysis of crystalline cellulose, with low but measurable activity in the hydrolysis of beta 1,3-1,4 mixed linkage glucans such beta-glucan and lichenan.
  • the tryptophan amino acid residue at position 367 (W367) of the Trichoderma reesei Cel6A represents a highly conserved residue within a strongly conserved region of the enzyme ( FIG. 1 ). Generally, mutation of conserved residues results in enzyme inactivation, or a severe loss of activity.
  • the present invention relates to modified glycosyl hydrolase (GH) enzymes. More specifically, to modified enzymes of the GH Family 6 (GH6) with altered substrate specificity.
  • the present invention also relates to genetic constructs comprising nucleotide sequences that encode and direct the expression and secretion of modified GH enzymes, methods for the production of modified GH enzymes from host strains, and the use of the modified GH enzymes.
  • the present invention provides modified glycosidase with an altered substrate preference from EC 3.2.1.91 (cellulase) to EC 3.2.1.73 (beta-glucanase).
  • the present invention relates to a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Familiy 6 glycosidase having an amino acid sequence in which the amino acids corresponding to those from position 83 to position 447 of TrCel6A (SEQ ID NO: 1) exhibit from about 47% to about 99.9% identity to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1.
  • the one or more amino acid substitutions may be selected from the group consisting of N182S, N182R, N182G, N182A, W367A, W367C, W367G, W367N, W367R, W367S, W367T, W367V, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
  • the present invention also provides a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Family 6 glycosidase having an amino acid sequence in which the amino acids corresponding to those from position 83 to position 447 of TrCel6A (SEQ ID NO: 1) exhibit from about 70% to about 99.9% identity to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through SEQ ID NO: 36.
  • the one or more amino acid substitutions may be selected from the group consisting of N182S, N182R, N182G, N182A, W367A, W367C, W367G, W367N, W367R, W367S, W367T, W367V, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
  • the position of the one or more amino acid substitution defined above may be determined from sequence alignment of the amino acids corresponding to positions 83-447 of SEQ ID NO: 1 of a parental Family 6 glycosidase enzyme with amino acids 83-447 of the Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1.
  • the modified Family 6 glyocosidase may be derived from a parental Family 6 glycosidase that is otherwise identical to the modified Family 6 glycosidase except for the substitution of the naturally occurring amino acid at one or more of positions 182, 367, 399, 400 and 427.
  • this invention includes a modified Family 6 glycosidase as defined above and further comprising a proline residue at position 413.
  • the modified Family 6 glycosidase comprising these mutations may be from a filamentous fungus, such as Trichoderma reesei.
  • the present invention also relates to a modified Family 6 glycosidase as defined above and that has from about a 1.2-fold increase in activity in the hydrolysis of beta 1-3, 1-4-linked or beta 1-3, 1-6-linked polysaccharides and may also exhibit at least a 1.2-fold decrease in activity in the hydrolysis of beta 1-4 -linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
  • the present invention also relates to a modified Family 6 glycosidases selected from the group consisting of:
  • TrCe16A-N182S-S413P TrCe16A-N182S-S413P; (SEQ ID NO: 83) TrCe16A-N182R-D350E-S413P; (SEQ ID NO: 84) TrCe16A-N182G-S413P; (SEQ ID NO: 85) TrCe16A-N182A-S413P; (SEQ ID NO: 86) TrCe16A-W367A-S413P; (SEQ ID NO: 37) TrCe16A-W367C-S413P; (SEQ ID NO: 38) TrCe16A-W367G-S413P; (SEQ ID NO: 39) TrCe16A-W367N-S413P; (SEQ ID NO: 40) TrCe16A-W367R-S413P; (SEQ ID NO: 41) TrCe16A-W367S-S413P;
  • the present invention relates to genetic constructs comprising a nucleic acid sequence encoding a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Family 6 glycosidase having an amino acid sequence that exhibits from 47% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1 or an amino acid sequence that exhibits from 70% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through SEQ ID NO: 36.
  • a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X
  • the modified Family 6 glycosidase having an amino acid sequence that exhibits from 47% to 99.
  • the nucleic acid sequence may be operably linked to other nucleic acid sequences regulating its expression and secretion from a host microbe.
  • the other nucleic sequences regulating the expression and secretion of the modified Family 6 glycosidase are derived from the host microbe used for expression of the modified Family 6 glycosidase.
  • the host microbe may be a yeast, such as Saccharomyces cerevisiae , or a filamentous fungus, such as Trichoderma reesei.
  • the invention also relates to a genetic construct as defined above, wherein the modified Family 6 glycosidase encoded by the genetic construct further comprises a substitution of the amino acid at position 413 with a proline or any other additional mutations at positions other than 182, 367, 399, 400 or 427.
  • the invention also relates to a genetically modified microbe comprising a genetic construct encoding the modified Family 6 glycosidase and capable of expression and secretion of a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Family 6 glycosidase having an amino acid sequence that exhibits 70% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1 or an amino acid sequence that exhibits from 70% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through SEQ ID NO: 36.
  • a genetically modified microbe comprising a genetic construct encoding the modified Family 6 glycosidase and capable of expression and secretion of a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of
  • the genetically modified microbe is capable of expression and secretion of a modified Family 6 glycosidase further comprising a substitution of the amino acid at position 413 with a proline or any other additional mutations at positions other than 182, 367, 399, 400 or 427.
  • the genetically modified microbe may be a yeast or filamentous fungus.
  • the genetically modified microbe may be a species of Saccharomyces, Pichia, Hansenula, Trichoderma, Hypocrea, Aspergillus, Fusarium, Humicola or Neurospora.
  • the present invention also relates to a process for hydrolysing a beta 1-3, 1-4 -linked polysaccharide substrate with modified Family 6 glycosidase.
  • the invention also relates to a process of producing the modified Family 6 glycosidase as defined above, including transformation of a yeast or fungal host with a genetic construct comprising a DNA sequence encoding the modified Family 6 glycosidase, selection of recombinant yeast or fungal strains expressing the modified Family 6 glycosidase, culturing the selected recombinant strains in submerged liquid fermentations under conditions that induce the expression of the modified Family 6 glycosidase and recovering the modified Family 6 glycosidase by separation of the culture filtrate from the host microbe.
  • the inventors have made the surprising discovery that although substitution of N182, W367, E399, C/S400 or A427 by another amino acid generally results in loss of activity against the beta 1-4 linked substrate cellulose, several of these mutations significantly increase the activity of the enzyme towards beta 1-3, 1-4 glucans. Since these amino acids all participate in substrate binding within the active site, the inventors postulate, without wishing to be bound by theory, that the altered substrate specificity of such modified Family 6 glycosidases may be a consequence of an expansion of the enzyme active site to accommodate the branched beta 1-3, 1-4 linked substrates. This altered substrate specificity has potential value applied to industries where reduction of viscosity caused by beta 1-3, 1-4 glucan is desirable, as described above.
  • the modified Family 6 glycosidase exhibits at least about 1.2-fold increase in activity on a beta-1-3, 1-4 linked polysaccharide and may also exhibit at least a 1.2-fold decrease in activity on a beta 1-4 linked polysaccharide such as cellulose.
  • the modified Family 6 glycosidase may exhibit from about a 1.2—to about a 4-fold increase in activity on a beta 1-3, 1-4 linked polysaccharide and may also exhibit from about a 1.2-fold to about a 10-fold decrease in activity on a beta 1-4 linked polysaccharide such as cellulose
  • the modified Family 6 glycosidases of the present display increased activity on beta 1-3, 1-4 -linked polysaccharides and decreased activity on beta 1-4 linked polysaccharides relative to the parental Family 6 glycosidase from which they are derived.
  • glycosidases find use in a variety of applications in industry that require high activity on beta 1-3, 1-4 -linked or beta 1-3, 1-6-linked polysaccharide substrates.
  • modified Family 6 glycosidases as described herein, may be used in industrial grain processing applications such as brewing, production of grain ethanol for fuel, and also to increase nutrient accessibility in animal feeds.
  • FIG. 1 shows an amino acid sequence alignment among selected fungal glycosidases from Glycosyl Hydrolase Family 6 and a consensus Family 6 glycosidase sequence.
  • a graphical representation of the frequency of occurrence of the amino acid at each position of the consensus Family 6 glycosidase among the 36 fungal Family 6 glycosidases is shown underneath the aligned sequences.
  • the catalytic aspartic acid residues at the equivalent positions 175 and 221 in TrCel6A are indicated by arrows.
  • the highly conserved amino acids at the equivalent of positions 182, 367, 399, 400 and 427 in TrCel6A are indicated with an asterisk.
  • FIG. 2 shows an identity matrix for the alignment of the amino acids corresponding to amino acids 83-447 of SEQ ID NO: 1 for each of 36 Family 6 glycosidase amino acid sequences to each other.
  • FIG. 3 depicts plasmid vectors a) YEp352/PGK91-1 ⁇ NheI- ⁇ ss -TrCel6A-S413P, and b) YEpFLAG ⁇ Kpn10-cbh2 directing the expression and secretion of native and modified TrCel6A from recombinant Saccharomyces cerevisiae , c) YEp/PGK- ⁇ ss-NKE-PcCel6A directing the expression and secretion of native and modified PcCel6A from recombinant Saccharomyces cerevisiae (The same organization if found for the PcCel6 variants cloned in the same vectors), d) YEp/PGK- ⁇ ss-NKE-HiAvi2 directing the expression and secretion of native and modified HiAvi2 from recombinant Saccharomyces cerevisiae (The same organization if found for
  • FIG. 4 shows the relative activity of modified TrCel6A glycosidases on cellulose, barley beta-glucan and lichenan to the activity of a parental TrCel6A glycosidase on each substrate.
  • FIG. 5 shows the relative activity of parental and modified TrCel6A, PcCel6A and HiAvi2 glycosidases on (A) barley betaglucan: cellulose and (B) lichenan: cellulose.
  • FIG. 6 shows the maps of Trichoderma transformation vectors pCel6Apst-S413P-pyr4-TV (A) and pCel6A413pst-hph-BB (B).
  • FIG. 7 shows the verification of targeting of the TrCel6A genetic locus to native cel6A locus by Southern hybridization.
  • Genomic DNA was isolated from transformants P577A, B, C and parental strains BTR213, BTR213aux28 digested with EcoRI restriction enzyme, separated on a 1% agarose gel, transferred to a nitrocellulose membrane and hybridized using the TrCel6A coding nucleic acid sequence as a probe.
  • pCel6ApXT-S413P-pyr4-TV transformation plasmid digested with EcoRI was used as a control (lane pCel6ApXt-pyr4-TV).
  • FIG. 8 shows the expression of the modified TrCel6A-W367G-S413P glycosidase by Trichoderma reesi transformants (P988A, P989A, B, C, P990A, P991B, P992A, P1005A, C, D) and the expression of wild-type TrCel6A by the host strain (P577C) and parental strain BTR213aux in microcultures.
  • the abundance of TrCel6A-W367G-S413P or TrCel6A protein is indicated on each bar as a percent of total protein.
  • FIG. 9 shows the crystal structure of TrCel6A (using coordinates from PDB file 1QK2) represented in ribbon form with the active-site ligand (cellotetraose) in black sticks and the amino acids at positions 182, 367, 399, 400 and 427 represented as black ball-and-sticks and are labeled. Residues 403 to 424 were removed for ease of visualization.
  • the present invention relates to modified glycosidases. More specifically, the invention relates to modified Family 6 glycosidases with altered substrate specificity.
  • the present invention also relates to genetic constructs comprising nucleotide sequences encoding for modified Family 6 glycosidases, methods for the production of the modified Family 6 glycosidase from host strains and the use of the modified Family 6 glycosidase in the hydrolysis of beta-glucan.
  • a glycosyl hydrolase enzyme is classified as a Family 6 glycosidase if exhibits similarity in its primary, secondary and tertiary protein structures to those of other Family 6 glycosidases.
  • all Family 6 glycosidases comprise two aspartic acid (D) residues which may serve as catalytic residues. These aspartic acid residues are found at positions 175 and 221 (see FIG. 1 ; based on TrCel6A, Trichoderma reesei Cel6A, amino acid numbering).
  • Family 6 glycosidases identified thus far are mesophilic; however, this family also includes thermostable cellulases from Thermobifida fusca (TfCel6A and TfCel6B) and the alkalophilic cellulases from Humicola insolens (HiCel6A and HiCel6B).
  • Family 6 glycosidases also share a similar three dimensional structure: an alphalbeta-barrel with a central beta-barrel containing seven parallel beta-strands connected by five alpha-helices.
  • the three dimensional structures of several Family 6 glycosidases are known, such as TrCel6A (Rouvinen, J., et al.
  • Thermobifida fusca endo-beta-1,4-glucanase Cel6A (TfCel6A, Spezio, M., et al. 1993), Humicola insolens cellobiohydrolase Cel6A (HiCel6A, Varrot, A., et al. 1999), Humicola insolens endo-beta-1,4-glucanase Cel6B (HiCel6B, Davies, G. J., et al. 2000) and Mycobacterium tuberculosis H37Rv Cel6A (MtCel6A, Varrot, A., et al. 2005).
  • W135, W269, W272 and W367 are highly conserved amino acids that interact with the glucose subunits in the cellulose substrate at the ⁇ 2, +1, +2 and +4 subsites in the active site tunnel of TrCel6A.
  • N182, E399, and A427 are other highly conserved residues found in the ⁇ 2 subsite in the active site tunnel of TrCel6A.
  • TrCel6A numbering it is meant the numbering corresponding to the position of amino acids based on the amino acid sequence of TrCel6A (Table 1; FIG. 1 ; SEQ ID NO: 1). As set forth below, and as is evident by FIG. 1 , Family 6 glycosidases exhibit a substantial degree of sequence similarity. Therefore, by aligning the amino acids to optimize the sequence similarity between glycosidase enzymes, and by using the amino acid numbering of TrCel6A as the basis for numbering, the positions of amino acids within other Family 6 glycosidases can be determined relative to TrCel6A.
  • Methods to align amino acid sequences are well known and available to those of skill in the art and include BLAST (Basic Local Alignment Search Tool, URL: blast.ncbi.nlm.nih.gove/Blast.chi; Altschul et al., 1990; using the published default settings) which is useful for aligning two sequences and CLUSTALW (URL: ebi.cak.ak/Tools/clustalw2/index.html) for alignment of two or more sequences.
  • BLAST Basic Local Alignment Search Tool, URL: blast.ncbi.nlm.nih.gove/Blast.chi; Altschul et al., 1990; using the published default settings
  • CLUSTALW URL: ebi.cak.ak/Tools/clustalw2/index.html
  • modified Family 6 glycosidase or “modified glycosidase”, it is meant a Family 6 glycosidase which comprises one or more amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of: N182X(i.e. N at position 182 is substituted by X), W367X, E399X, C/S400X, and A427X, where X is any amino acid and the position is determined from sequence alignment of the modified Family 6 glycosidase with a Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1.
  • the modified Family 6 glycosidase comprises one or more amino acid substitutions selected from the group consisting of: N182S, N182R, N182G, N182A, W367A, W367C, W367G, W367N, W367R, W367S, W367T, W367V, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
  • modified Family 6 glycosidase may be derived from any Family 6 glycosidase.
  • the modified Family 6 glycosidase may be derived from a wild-type glycosidase or from a glycosidase that already contains other amino acid substitutions.
  • a “modified Family 6 glycosidase” may also be defined as an enzyme capable of hydrolyzing polysaccharides using an inverting mechanism and having one or more amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of: N182X, W367X, E399X, C/S400X, and A427X, which is characterized by having an amino acid sequence that is from about 47% to about 99.9% identical to the amino acids 83 to 447 of the TrCel6A amino acid sequence (SEQ ID NO: 1) or having an amino acid sequence that is from about 70% to about 99.9% identical to amino acids 83-447 (TrCel6A) of any of the Family 6 glycosidases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, S
  • a modified Family 6 glycosidase may have an amino acid sequence that is about 47%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99.9% identical to the amino acids 83-447 of SEQ ID NO: 1 or that is about 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%. 94%, 96%.
  • Family 6 glycosidases useful for the present invention, which are not meant to be limiting, include Trichoderma reesei Cel6A, Humicola insolens Cel6A, Phanerochaete chrysosporium Cel6A, Cellulomonas fimi Cel6B, Thermobifida fusca Cel6B.
  • the modified Family 6 glycosidase of the present invention comprises a modified Trichoderma reesei Cel6A glycosidase.
  • modified Family 6 glycosidase amino acid sequences “derived from” refers to the isolation of a target nucleic acid sequence element encoding the desired modified Family 6 glycosidase using genetic material or nucleic acid or amino acid sequence information specific to the corresponding parental Family 6 glycosidase. As is known by one of skill in the art, such material or sequence information can be used to generate a nucleic acid sequence encoding the desired modified Family 6 glycosidase using one or more molecular biology techniques including, but not limited to, cloning, sub-cloning, amplification by PCR, in vitro synthesis, and the like.
  • the modified Family 6 glycosidase comprises an amino acid sequence that is from about 70% to 99.9% identical to amino acids 83-447 of SEQ ID NO: 1 and exhibits from about a 1.2-fold, for example from about 1.2-fold to 4-fold, increase in activity in the hydrolysis of beta 1-3, 1-4-linked polysaccharides and may also exhibit at least a 1.2-fold, for example from about 1.2-fold to 10-fold, decrease in activity in the hydrolysis of beta 1-4-linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
  • the modified Family 6 glycosidase comprises an amino acid sequence that is from about 80% to about 99.9% identical to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through 36 and exhibits from about a 1.2-fold increase in activity in the hydrolysis of beta 1-3, 1-4-linked polysaccharides and may also exhibit at least a 1.2-fold decrease in activity in the hydrolysis of beta 1-4 -linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
  • the modified Family 6 glycosidase comprises an amino acid sequence that is from about 90% to about 99.9% identical to amino acids 83-447 of SEQ ID NO: 1 or from about 95% to about 99.9% identical to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through 36 and exhibits from about a 1.2-fold increase in activity in the hydrolysis of beta 1-3, 1-4-linked polysaccharides and may also exhibit at least a 1.2-fold decrease in activity in the hydrolysis of beta 1-4 -linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
  • modified Family 6 glycosidase may be derived from any Family 6 glycosidase—i.e., it may be derived from a naturally-occurring or “wild-type” Family 6 glycosidase or from a Family 6 glycosidase that already contains other amino acid substitutions.
  • wild type or “native” Family 6 glycosidase it is meant a Family 6 glycosidase having an amino acid sequence as encoded by the genome of the organism that naturally produces such Family 6 glycosidase without the introduction of any substitutions, deletions, insertions, or modifications.
  • wild type TrCel6A wild type HiCel6A and wild type PcCel6A it is meant the cellulases of SEQ ID NO: 1, SEQ ID NO: 23 and SEQ ID NO: 30 respectively, without any amino acid substitutions.
  • a “parental Family 6 glycosidase” or “parental glycosidase” is a Family 6 glycosidase that does not contain the amino acid substitution(s) in the modified Family 6 glycosidases, namely at one or more position selected from the group consisting of 182, 367, 399, 400 and 427 (TrCel6A numbering) but that is otherwise identical to the modified Family 6 glycosidase.
  • the parental Family 6 glycosidase may be a Family 6 glycosidase that contains amino acid substitutions at other positions that have been introduced by genetic engineering or other techniques.
  • a parental Family 6 glycosidase does not include those Family 6 enzymes in which one or more of the naturally occurring amino acid at positions 182, 367, 399, 400 and 427 are, respectively, tryptophan, asparagine, tryptophan, glutamic acid, cysteine or serine, and alanine.
  • the modified Family 6 glycosidase may be subsequently further modified to contain additional amino acid substitutions.
  • the substrate specificity of the modified Family 6 glycosidase is determined by incubation of the enzyme in the presence of several different polysaccharides substrate and measuring the release of soluble sugars from those substrates.
  • the release of soluble sugars can be measured by subsequent chemical or chemienzymatic assays known to one of skill in the art, including reaction with dinitrosalisylic acid (DNS).
  • DNS dinitrosalisylic acid
  • Hydrolysis of polysaccharides can also be monitored by chromatographic methods that separate and quantify soluble mono-, di- and oligo-saccharidses released by the enzyme activity.
  • soluble calorimetric substrates may be incorporated into agar-medium on which a host microbe expressing and secreting a parental or modified Family 6 glycosidase is grown.
  • activity of the glycosidase is detected as a colored or colorless halo around the individual microbial colony expressing and secreting an active glycosidase.
  • the practice of the present invention is not limited by the method used to assess the substrate specificity of the modified Family 6 glycosidase.
  • the modified Family 6 glycosidase exhibits at least a 1.2-fold, for example from about 1.2-fold to about 4-fold, increase in its hydrolysis activity of beta 1-3, 1-4 linked polysaccharides and may also exhibit at least a 1.2-fold, for example from about 1.2-fold to about 10-fold, decrease in its hydrolysis activity of beta 1-4 linked polysaccharides.
  • FIG. 9 shows that, for TrCel6A, amino acids W367, E399, C400 are involved in substrate binding while amino acids N182 and A427 are located within the loop regions that enclose the active site tunnel. Therefore, mutations of these highly conserved amino acids may result in a more open or flexible geometry within the TrCel6A active site that allow for the accommodation of the branched beta 1-3, 1-4 glucans.
  • the present invention also relates to genetic constructs comprising a nucleic acid sequence encoding the modified Family 6 glycosidase.
  • the modified glycosidase-encoding nucleic acid sequence may be operably linked to regulatory nucleic acid sequences directing the expression and secretion of the modified Family 6 glycosidase from a host microbe.
  • regulatory DNA sequences it is meant a promoter and a DNA sequence encoding a secretion signal peptide.
  • the regulatory DNA sequences are preferably functional in a fungal host.
  • the regulatory DNA sequences may be derived from genes that are highly expressed and secreted in the host microbe under industrial fermentation conditions. In a preferred embodiment, the regulatory sequences are derived from one or more of the Trichoderma reesei cellulase or hemicellulase genes.
  • the genetic construct may further comprise a selectable marker gene to enable isolation of a genetically modified microbe transformed with the construct as is commonly known to those of skill in the art.
  • the selectable marker gene may confer resistance to an antibiotic or the ability to grow on medium lacking a specific nutrient to the host organism that otherwise could not grow under these conditions.
  • the present invention is not limited by the choice of selectable marker gene, and one of skill in the art may readily determine an appropriate gene.
  • the selectable marker gene confers resistance to hygromycin, phleomycin, kanamycin, geneticin, or G418, complements a deficiency of the host microbe in one of the trp, arg, leu, pyr4, pyr, ura3, ura5, his, or ade genes or confers the ability to grow on acetamide as a sole nitrogen source.
  • the genetic construct may further comprise other nucleic acid sequences, for example, transcriptional terminators, nucleic acid sequences encoding peptide tags, synthetic sequences to link the various nucleic acid sequences together, origins of replication, and the like.
  • the practice of the present invention is not limited by the presence of any one or more of these other nucleic acid sequences.
  • the modified Family 6 glycosidase may be expressed and secreted from a genetically modified microbe produced by transformation of a host microbe with a genetic construct encoding the modified Family 6 glycosidase.
  • the host microbe may be a yeast or a filamentous fungus, particularly those microbes that are members of the phylum Ascomycota .
  • Genera of yeasts useful as host microbes for the expression of modified TrCel3A beta-glucosidases of the present invention include Saccharomyes, Pichia, Hansen ula, Kluyveromyces, Yarrowia , and Arxula .
  • Genera of fungi useful as microbes for the expression of modified TrCel3A beta-glucosidases of the present invention include Trichoderma, Hypocrea, Aspergillus, Fusarium, Humicola, Neurospora, and Penicillium.
  • the host microbe is one from which the gene(s) encoding any or all Family 6 glycosidase have been deleted.
  • the host microbe is an industrial strain of Trichoderma reesei.
  • the genetic construct may be introduced into the host microbe by any number of methods known by one skilled in the art of microbial transformation, including but not limited to, treatment of cells with CaCl 2 , electroporation, biolistic bombardment, PEG-mediated fusion of protoplasts (e.g. White et al., WO 2005/093072).
  • the selected recombinant strains may be cultured in submerged liquid fermentations under conditions that induce the expression of the modified Family 6 glycosidase.
  • the modified Family 6 glycosidase is produced in submerged liquid culture fermentation and separated from the cells at the end of the fermentation.
  • the cells may be separated by filtration, centrifugation, or other processes familiar to those skilled in the art.
  • the cell-free glycosidase-containing fraction may then be concentrated (for example, via ultrafiltration), preserved, and/or stabilized prior to use.
  • the present invention also provides a process for producing a modified Family 6 glycosidase.
  • the method comprises growing a genetically modified microbe comprising a nucleotide sequences encoding a modified Family 6 glycosidase, in a culture medium under conditions that induce expression and secretion of the modified Family 6 glycosidase, and recovering the modified Family 6 glycosidase from the culture medium.
  • the modified Family 6 glycosidase comprising one or more amino acid substitution at a position selected from the group consisting of N182X, W367X, E399X, C/S400X, and A427X, the position determined from alignment of a parental Family 6 glycosidase amino acid sequence with a Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1, wherein amino acids 83-447 (TrCel6A numbering) of the modified Family 6 glycosidase are from about 47% to about 99.9% identical to amino acids 83-447 of SEQ ID NO: 1, or from about 70-90% identical to amino acids 83-447 of any one of SEQ ID NO: 1 through 36.
  • a modified Family 6 glycosidase of the present invention may be produced in a fermentation process using a genetically modified microbe comprising a genetic construct encoding the modified Family 6 glycosidase, e.g., in submerged liquid culture fermentation.
  • Submerged liquid fermentations of microorganisms are typically conducted as a batch, fed-batch or continuous process.
  • all the necessary materials with the exception of oxygen for aerobic processes, are placed in a reactor at the start of the operation and the fermentation is allowed to proceed until completion, at which point the product is harvested.
  • a batch process for producing the modified Family 6 glycosidase of the present invention may be carried out in a shake-flask or a bioreactor.
  • the culture is fed continuously or sequentially with one or more media components without the removal of the culture fluid.
  • fresh medium is supplied and culture fluid is removed continuously at volumetrically equal rates to maintain the culture at a steady growth rate
  • fermentation medium comprises a carbon source, a nitrogen source and other nutrients, vitamins and minerals which can be added to the fermentation media to improve growth and enzyme production of the host cell. These other media components may be added prior to, simultaneously with or after inoculation of the culture with the host cell.
  • the carbon source may comprise a carbohydrate that will induce the expression of the modified Family 6 glycosidase from a genetic construct in the genetically modified microbe.
  • the carbon source may comprise one or more of cellulose, cellobiose, sophorose, and related oligo- or poly-saccharides known to induce expression of cellulases and beta-glucosidase in Trichoderma.
  • the carbon source may be added to the fermentation medium prior to or simultaneously with inoculation. In the cases of fed-batch or continuous operations, the carbon source may also be supplied continuously or intermittently during the fermentation process.
  • the carbon feed rate is between 0.2 and 2.5 g carbon/L of culture/h, or any amount therebetween.
  • the process for producing the modified Family 6 glycosidase of the present invention may be carried at a temperature from about 20° C. to about 40° C., or any temperature therebetween, for example from about 25° C. to about 37° C., or any temperature therebetween, or from 20, 22, 25, 26, 27, 28, 29, 30, 32, 35, 37, 40° C. or any temperature therebetween.
  • the process for producing the modified Family 6 glycosidase of the present invention may be carried out at a pH from about 3.0 to 6.5, or any pH therebetween, for example from about pH 3.5 to pH 5.5, or any pH therebetween, for example from about pH 3.0, 3.2, 3.4, 3.5, 3.7, 3.8, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.5, 5.7, 5.8, 6.0, 6.2, 6.5 or any pH therebetween.
  • the fermentation broth containing the modified Family 6 glycosidase may be used directly, or the modified Family 6 glycosidase may be separated from the fungal cells, for example by filtration or centrifugation. Low molecular solutes such as unconsumed components of the fermentation medium may be removed by ultra-filtration.
  • the modified Family 6 glycosidase may be concentrated, for example, by evaporation, precipitation, sedimentation or filtration. Chemicals such as glycerol, sucrose, sorbitol and the like may be added to stabilize the cellulase enzyme. Other chemicals, such as sodium benzoate or potassium sorbate, may be added to the cellulase enzyme to prevent growth of microbial contamination.
  • the modified Family 6 glycosidase of the present invention is used for the enzymatic hydrolysis of polysaccharides containing both beta 1-3 , 1-4 and/or beta 1-3, 1-6 glycosidic linkages. More preferably, the modified Family 6 glycosidase of the present invention is used for the enzymatic hydrolysis of beta 1-3, 1-4 glucans present in cereal grains.
  • the modified Family 6 glycosidases of the present invention may be used in industrial processes such as brewing, production of grain ethanol for fuel, and also to increase nutrient accessibility in animal feeds.
  • glycosidase enzymes or mixtures including those comprising the modified Family 6 glycosidase of the present invention, act on polysaccharides to convert all or a portion thereof to soluble sugars.
  • Saccharomyces cerevisiae strain BY4742 (MAT ⁇ his3 ⁇ 1 leu2 ⁇ 0 lys2 ⁇ 0 ura3 ⁇ 0 ⁇ kre2) was obtained from ATCC (#4014317).
  • the YEp352/PGK91-1 vector was obtained from the National Institute of Health.
  • the YEpFL ⁇ GAKpn 10-S413P vector is described in U.S. Publication No. 2008/0076152A1.
  • the YEpFLAG-1 vector was obtained from Sigma as a part of the Amino-Terminal Yeast FLAG Expression Kit.
  • the unique NheI site at position 1936 of the YEp352/PGK91-1 vector was blunted using the DNA Polymerase I large (Klenow) fragment to generate YEp352/PGK91-1 ⁇ NheI.
  • the TrCel6A-S413P gene was amplified by PCR from YEpFLAG ⁇ Kpn10-S413P vector (U.S. Publication No. 2008/0076152A1) using primers 5′NheCel6A and 3′BglKpnCel6A.
  • yeast ⁇ -factor leader sequence was amplified by PCR from the YEpFLAG- 1 vector (Sigma) using primers (5′BglAlphaSS and 3′NheAlphaSS) to introduce BglII at the 5′ end and an NheI site at 3′ end of the amplicon.
  • SEQ ID NOS: 47-50 were utilized as primer sequences.
  • the yeast alpha-factor leader sequence was isolated by BglII/NheI digestion and a three piece ligation performed with the TrCel6A-S413P gene (isolated by NheI/BglII digestion) and YEp352/PGK91-1 ⁇ NheI vector (isolated by BglII digestion).
  • the resulting vector YEp352/PGK91-1>NheI- ⁇ ss -TrCel6A-S413P ( FIG. 3 ) was transformed in yeast strain BY4742 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
  • Vector YEp352/PGK91-1 was digested with NheI and EcoRI and the plasmid band was isolated from gel.
  • a DNA adapter was made by annealing of AT046 and AT047 5′-phosphorylated primers and was ligated with the digested vector.
  • the plasmid was then digested with KpnI and self-ligated.
  • the resulting vector is named YEp/PGK-alpha ss -NKE and its sequence integrity was confirmed by sequencing.
  • PcCel6A and PcCel6A-W36G vectors The Pccel6a gene was amplified by PCR from YEpFLAG ⁇ Kpn10-PcCel6A vector (U.S. Publication No. 2008/0076152A1) using primers 5′VH098 and 3′VHO99. Pccel6a was cloned NheIlKpnI in YEp/PGK-alpha ss -NKE.
  • PcCel6A-W361G was generated by two step PCR by mutating PcCel6A in YEp/PGK-alpha ss -NKE using primers 5′VH067 and 3′PGK-term for fragment one and YalphaN21-2 and 3′VH066 to generate fragment two. Fragments 1 and 2 were combined using primers YalphaN21-2 and 3′PGK-term.
  • HiAvi2 and HiAvi2-W374G vectors The Hiavi2 gene was amplified by PCR from YEpFLAG ⁇ Kpn10-HiAvi2 vector (U.S. Patent Provisional No. 60/841,507) using primers 5′NM083 and 3′NM084.
  • HiAvi2 was cloned NheIlKpnI in YEp/PGK-alpha ss -NKE.
  • HiAvi2-W374G was generated by two step PCR by mutating HiAvi2 in YEp/PGK-alpha ss -NKE using primers 5′VH065 and 3′PGK-term for fragment one and YalphaN21-2 and 3′VH064 to generate fragment two. Fragments 1 and 2 were combined using primers YalphaN21-2 and 3′PGK-term.
  • Random mutagenesis libraries were generated using two methods: a Mutazyme® II DNA polymerase method and a Mn 2+ /biased dNTP mix method.
  • a Mutazyme® II DNA polymerase method a series of four independent PCR were performed using 10, 20, 30, 40 ng of YEp352/PGK91-1 ⁇ NheI- ⁇ ss -TrCel6A-S413P vector and the Mutazyme® II DNA polymerase with primers YalphaN21 and 3′PGK-term. The amplification was done for 25 cycles. The four PCR products were pooled and diluted to 10 ng/ ⁇ L.
  • a second PCR mutagenesis step was performed using 30 ng of pooled PCR product with Mutazyme® II DNA polymerase using the same primers for 30 amplification cycles.
  • the YEp352/PGK91-1 ⁇ NheI- ⁇ ss -TrCel6A-S413P vector was digested with NheI and KpnI and the empty vector fragment was isolated. This linear fragment and the final amplicon were transformed simultaneously and cloned by in vivo recombination into yeast strain BY4742 (Butler et al., 2003).
  • a PCR was performed using 25 ng YEp352/PGK91-1 ⁇ NheI- ⁇ ss -TrCel6A-S413P vector, 0.2 mM dATP, 0.2 mM dCTP, 0.24 mM dGTP, 0.2 mM dTTP, and 0.64 mM Mn 2+ with Taq DNA polymerase (Sigma) with primers YalphaN21 and 3′PGK-term for 30 amplification cycles.
  • the final amplicon was cloned into YEp352/PGK91-1 ⁇ NheI- ⁇ ss -TrCel6A-S413P vector as described above.
  • Saccharomyces cerevisiae transformants were grown on plates containing synthetic complete medium (SC: 2% agar w/v, 0.17% yeast nitrogen base w/v, 0.078% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) and 0.12% Azo-barley- ⁇ -glucan (Megazyme) for 2 days at 30° C. Colonies showing bigger clearing halos, after an overnight incubation at 45° C., compared to the parent enzyme TrCel6A-S413P were selected and sequenced as described below in section c.
  • TrCel6A EP-PCR Library Liquid Assay
  • Clones from the EP-PCR (Example 3) or SSM (Example 5) libraries expressing variants of TrCel6A-S413P were selected for liquid media pre-cultures by toothpick inoculation of 150 ⁇ L synthetic complete media (SC: 0.17% yeast nitrogen base w/v, 0.078% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) in 96-well microplates. Pre-cultures were grown overnight (16-18 h) at 30° C. and 300 rpm to stationary phase.
  • SC synthetic complete media
  • Pre-cultures were grown overnight (16-18 h) at 30° C. and 300 rpm to stationary phase.
  • pre-culture 25 ⁇ L of pre-culture was used to inoculate 1 mL of SC media in deep-well microplates containing one glass bead. The remaining pre-cultures were used to prepare culture stocks by the addition of glycerol to a final concentration of 15% and stored at ⁇ 80° C.
  • Expression cultures were grown for 3 days at 30° C. with orbital shaking and humidity control. Plates were centrifuged at 710 ⁇ g for 5 minutes to pellet cells and supernatant was aspirated for screening assays. An aliquot (0.05 mL) of yeast supernatant was incubated with 0.5% beta-glucan in a 0.1 mL citrate buffered (50 mM; pH 5) reaction. Activity assays were performed for 3 hours in a PCR plate at 50° C. Contained in each 96-well PCR plate were 6 parental TrCel6A-S413P controls used for comparison. A glucose standard curve was placed in the first column of the PCR plate ranging from 3 to 0.05 mg/mL. Following incubation, 0.08 mL of DNS reagent was added to all wells and the plates were boiled for 10 min. An aliquot (0.15 mL) was transferred to a microplate and the absorbance was measured at 560 nm.
  • DNS reagent contains: Component g/L 3,5-Dinitosalicylic acid (Acros) 20 Sodium hydroxide (Fisher) 20 Phenol (Sigma) 4 Sodium metabisulfate (Fisher) 1
  • the concentration of parental or modified TrCel6A glycosidases in yeast filtrates was determined by ELISA.
  • Filtrate and purified component standard were diluted 0.01-10 ⁇ g/mL (based on total protein) in phosphate-buffered saline, pH 7.2 (PBS) and incubated overnight at 4° C. in microtitre plates (Costar EIA #9018). These plates were washed with PBS containing 0.1% Tween-20 (PBS/Tween) and then incubated in PBS containing 1% bovine serum albumin (PBS/BSA) for 1 h at room temperature. Blocked microtitre wells were washed with PBS/Tween.
  • Rabbit polyclonal antisera specific for TrCel6A was diluted (1:16,000) in PBS/BSA, added to separate microtitre plates and incubated for 2 h at room temperature. Plates were washed and incubated with a goat anti-rabbit antibody coupled to horseradish peroxidase (Sigma #A6154), diluted 1/2000 in PBS/BSA, for 1 hr at room temperature. After washing, tetramethylbenzidine was added to each plate and incubated for 30 min at room temperature. The absorbance at 360 nm was measured in each well and converted into protein concentration using the TrCel6A standard curve.
  • Enzyme activity was determined by converting A 560 values to reducing equivalents using the glucose standard curve. A specific activity was calculated for all modified and parental TrCel6A glycosidases by dividing the enzyme activity by the enzyme concentration determined by ELISA. The specific activity for each modified TrCel6A glycosidase was compared to the average of 6 parental TrCel6A glycosidase controls on a particular microplate and positives were selected at the 95% confidence level using a t-test. All positive variants were produced again in microculture and re-screened to reduce the number of false positives.
  • Plasmid DNA comprising genes encoding modified TrCel6A 6 glycosidases with altered substrate specificity was isolated from yeast cultures grown from the glycerol stocks prepared in Example 4b.
  • the modified TrCel6A glycosidase genes were subjected to DNA sequencing to identify mutations that confer altered substrate specificity.
  • Site-saturation mutagenesis of residue W367 was performed by megaprimer PCR (two-step PCR reaction) using the mutagenic primer 3′W367X (SEQ ID NO: 51), the YEp352/PGK91-1 ⁇ heI-alpha ss -TrCel6A-S413P vector as template, and the Platinum® Taq DNA Polymerase High Fidelity (Invitrogen).
  • the first-step PCR was done using the mutagenic primer 3′W367X and the complementary external primer (YalphaN21 or 3′PGK-term, SEQ ID NOS: 52 and 53, respectively).
  • the purified amplicon served as a megaprimer for the second-step PCR and the other complementary external primers were used to amplify the complete mutated gene.
  • the YEp352/PGK91-1 ⁇ heI-alpha ss -TrCel6A-S413P vector was digested with NheI and KpnI and the empty vector fragment was isolated. This linear fragment and the final amplicon were transformed simultaneously and cloned by in vivo recombination into yeast strain BY4742 (Butler et al. 2003).
  • the vector Yep/PGK-alpha ss -6H-NKE was digested with NheI and KpnI and purified on gel. Saccharomyces cerevisiae strain kre2 ⁇ (MAT ⁇ his3 ⁇ 1 leu2 ⁇ 0 lys2 ⁇ 0 ura3 ⁇ 0 ⁇ kre2) was used as the host. The digested YEp/PGK-alpha ss -6H-NKE vector and the PCR Step 2 amplicons were transformed in the yeast strain kre2 ⁇ using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
  • TrCel6A-S413P variants from yeast supernatant were tested in liquid assays using three different substrates: barley- ⁇ -glucan (Medium Viscosity; Megazyme), lichenan and acid swollen cellulose (ASC, produced from Sigmacell50 using the methods described by Tansey, M. R. 1971).
  • each enzyme was determined by measuring the release of reducing sugars from the soluble barley- ⁇ -glucan or lichenan substrates. Specifically, in a 300 ⁇ L PCR plate, 50 ⁇ L of yeast supernatant (dilution series) was mixed with 50 ⁇ L of pre-heated 1% (w/v) barley- ⁇ -glucan or lichenan in 100 mM sodium citrate pH 5.0. Mixtures were incubated for up to 2 h at 50° C. Following the incubation, 80 ⁇ L of DNS reagent was added to each well and the plate was boiled for 10 minutes.
  • DNS reagent contains: Component g/L 3,5-Dinitosalicylic acid (Acros) 10 Sodium hydroxide (Fisher) 10 Phenol (Sigma) 2 Sodium metabisulfate (Fisher) 0.5
  • TrCel6A variants from yeast supernatant as described in Example 4 were diluted in 50 mM citrate buffer (pH 5.0), complemented with Trichoderma reesei Cel7B and Cel5A (10 mg protein/g cellulose) and A. niger beta-glucosidase (125 IU/g cellulose) and incubated with 0.067% ASC. Incubation was at 50° C. for 19 hr. Microplates were centrifuged for 3 min at 2800 ⁇ g and an aliquot of supernatant was sampled for glucose.
  • FIGS. 4 and 5 show the relative activity of parental modified Family 6 glycosidases on cellulose and two beta-glucan substrates: barley beta-glucan, with a ratio of 3:1 (beta 1-3: beta 1-4) and lichenan, with a ratio of 2:1 (beta 1-3 : beta 1-4). All variants show at least a 1.2-fold increase in activity against one or both of the beta-glucan substrates. Some variants also exhibit more than a 1.2-fold decrease in activity against acid swollen cellulose.
  • Saccharomyces cerevisiae transformants were grown on plates containing synthetic complete medium (SC: 2% agar w/v, 0.17% yeast nitrogen base w/v, 0.192% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) for 3 days at 30° C.
  • SC synthetic complete medium
  • a single colony of these streaks was used to inoculate 150 ⁇ L of synthetic complete medium in a 96-well microplate containing a small sterile glass bead.
  • Pre-cultures were grown overnight (16-18 hr) at 30° C. and 300 rpm to stationary phase.
  • 25 ⁇ L of pre-culture was used to inoculate 50 mL of SC media.
  • Expression cultures were grown for 3 days at 30° C. and 250 rpm with humidity control. Cultures were centrifuged at 3000 rpm for 5 min and the buffer of the supernatant was changed to 50 mM citrate buffer pH 5.0 using a Sartorius filtration device with a 5000 kDa cut-off membrane.
  • Apyr4 auxotrophic T. reesei strain (strain BTR213) was used as a host strain for expression of TrCel6A-W367G-S413.
  • BTR213 is a derivative of RutC30 (ATCC #56765; Montenecourt and Eveleigh, 1979) produced by random mutagenesis and first selected for ability to produce larger clearing zones on minimal media agar containing 1% acid swollen cellulose and 4 g L ⁇ 1 2-deoxyglucose and then selected for the ability to grow on lactose media containing 0.2 ⁇ g/ml carbendazim.
  • the pyr4 auxotroph of strain BTR213 was isolated by the ability to grow on 5-FOA (5-fluororotic acid) and inability to grow prototrophically in the absence of uridine.
  • the cel6a promoter, secretion signal, coding sequence, and terminator were isolated from pZUK636 (U.S. Pat. No. 6,015,703) as a 5.1 kb SphI/BglII fragment and inserted into the same sites of pUC-NSNB, a derivative of the standard cloning vector pUC119 containing an adaptor comprising Nhe1-Sph1-Not1-Bg1II restriction sites, make pCel6A-Not.
  • a 1.7 kb fragment containing part of the cel6a terminator (downstream of the BglII site) and 3′ flanking sequence was amplified from BTR213 using primers KW008 and KW052 (Table 5) and cloned into pGEM T-easy (Promega).
  • KW008 anneals to the internal BglII site located 1 kb downstream of the stop codon while KW052 introduces a Smal site 2.7 kb downstream of the stop codon.
  • the Cel6A 3′ flanking fragment was amplified as a 1.7 kb fragment using BTR213 genomic DNA as a template, digested with BglII and Smal restriction enzymes and cloned into the same sites of pCel6A-Not to make pCel6Apst-Not.
  • pCel6Apst-Not was linearized with SaclI and blunt-ended with T4 polymerase.
  • the hph selection marker cassette was isolated as a 3.1 kb XhoI/EcoRV fragment from pHPT136, blunt-ended, and cloned into the blunted SacII site to make pCel6Apst-hph-TV.
  • the Cel6A promoter was amplified from pZUK636 using primers KW053 and KW054 (Table 4) and cloned into pGEM T-easy (Promega).
  • KW053 spans the SphI site 2.5 kb upstream from the start codon while KW054 introduces a NcoI site at the start codon.
  • the xyn2 secretion signal was amplified from BTR213 genomic DNA using primers KW055 and KW056 with introduced NcoI and NheI sites, respectively, and cloned into pGEM T-easy.
  • a cel6a gene fragment encoding the mature TrCel6A-S413P parental glycosidase and the cel6a terminator were isolated from previously constructed pc/xC2-S413P-TV (U.S. Publication No. 2008/0076152A1) as an NheI/SphI fragment.
  • a three factor ligation with the Cel6A promoter (SphI/NcoI), the xyn2 secretion signal coding sequence (NcoI/NheI) and the pc/xC2-S413P-TV vector fragment (SphI/NheI) was used to make pCel6ApX-S413P.
  • the 5 kb SphI/BglII fragment containing gene encoding TrCel6A-S413P was isolated from pCel6ApX-S413P and cloned into the same sites of pUC-NSNB to make pCel6ApX-S413P-Not.
  • the size of the 3′ flanking fragment was increased as described above (pCel6Apst-hph-TV vector construction) generating pCel6AptX-S413P vector.
  • the pCel6AptX-S413P vector was linearized with SacII (located in the Cel6A terminator) and blunt-ended with T4 polymerase.
  • the hph selection marker cassette was isolated as a 3.1 kb XhoI/EcoRV fragment from pHPT136, blunt-ended, and cloned into the blunt-ended SacII site to make pCel6ApXt-hph-TV.
  • the 2.2. kb pyr4 selection marker was isolated as a KpnI fragment from pNcBgl (U.S. Pat. No. 6,939,704), blunted and cloned into the blunted SacII site to make pCel6ApXt-S413P-pyr4-TV ( FIG. 6A ).
  • the final vector for T. reesei transformation was generated from two previously constructed Cel6A targeting vectors—pCel6Apst-hph-TV and pCel6ApXt-hph-TV. Both vectors were digested with BglII and SalI restriction enzymes. The fragment from pCel6AXt-hph-TV vector containing Cel6A coding sequence, terminator and hph cassette and the fragment from pCel6Apst-hph-TV vector containing cel6a flanks and AmPR gene were purified from agarose gel and ligated into pCel6A413pst-hph-BB vector ( FIG. 6B ).
  • the W367G mutation into cel6a gene was introduced by 3 step PCR ligation as described below.
  • Two pairs of primers (Table 5) were used to amplify partial Cel6A coding sequence and C-terminal Cel6A coding sequence with partial cel6a terminator. Both PCR products have short overlapping ends and were used in the 2 nd step, ten-cycle PCR reaction as templates and primers to anneal to each over and fill the missing strands at each end.
  • two outside primers, Cel6A-BEII-F1 and Cel6A-Apa-R2 were added and entire fragment was amplified in standard 35 cycle PCR reaction.
  • Amplified PCR product was digested with BstEII and Apal enzymes and ligated into corresponding sites of pCel6A413pst-hph-BB vector generating pCel6A413/367pst-hph-BB vector.
  • the vector pCel6ApXt-S413P-pyr4-TV was transformed into BTR213aux28 T. reesei strain using PEG-mediated protoplast transformation method. About 5 ⁇ 10 6 spores of BTR213aux28 were plated onto sterile cellophane placed on potato dextrose agar (PDA) (Difco) supplemented with 5 mM uridine and incubated for 20 h at 30° C. Cellophane discs with mycelia were transferred to 10 mL of a protoplast preparation solution containing 7.5 g/L Driselase and 4 g/L beta-glucanase (InterSpex Products Inc., Cat.
  • Transformation mix was diluted with 2 mL of 1.2 M sorbitol in PEG solution and 4 aliquots of 0.75 mL of the mix were added into 25 mL of molten MMSS agar media (see below) cooled to about 47-50° C. and the protoplast suspensions were poured over MM agar (see below). Plates were incubated at 30° C. until colony growth is visible. Transformants were transferred to individual plates containing MM agar and allowed to sporulate. Spores are collected and plated at high dilution on MM agar to isolate homokaryon transformants, which are then plated onto PDA and incubated at 30° C. for sporulation and subsequent genetic analysis.
  • Minimal medium (MM*) agar contains: Amount for Component 1 L of medium KH 2 PO 4 10 g (NH 4 ) 2 SO 4 6 g Na 3 Citrate-2H 2 O 3 g FeSO 4 —7H 2 O 5 mg MnSO 4 —H 2 O 1.6 mg ZnSO 4 —7H 2 O 1.4 mg CaCl 2 —2H 2 O 2 mg Agar 20 g 20% Glucose f.s. 50 mL 1 M MgSO4—7H 2 O f.s.
  • MMSS agar contains the same components as MM agar plus 1.2 M sorbitol, 4 mM MgSO 4 , 1 g/L YNB (Yeast Nitrogen Base w/o Amino Acids from DIFCO Cat. No. 291940) and 0.12 g/L amino acids (-Ura DO Supplement from CLONTECH Cat. No. 8601-1).
  • Frozen biomass was grinded to a fine powder using liquid nitrogen and resuspended in 3 mL of extraction buffer (100 mM Tris pH 8.0, 50 mM EDTA pH 7.5, 1% SDS). Homogenate was transferred to a sterile 15 mL falcon tube and pelleted by cetrifugation at 4000 rpm for 5 min. Supernatant was transferred to a sterile 15 mL falcon tube, equal volume of saturated phenol (pH 6.6) was added and vortexed for 1 min. Aqueous phase containing DNA was separated by centrifugation for 5 min at 4000 rpm and transferred to fresh 15 mL falcon tube.
  • extraction buffer 100 mM Tris pH 8.0, 50 mM EDTA pH 7.5, 1% SDS.
  • Genomic DNA was further purified by adding an equal volume of phenol:chloroform:isoamyl alcohol (25:24: 1), mixing and separating aqueous phase by centrifugation for 5 min at 4000 rpm. This purification step was repeated until no interphase was visible. Phenol was removed by extracting with an equal volume of chloroform, mixing and separating aqueous phase by centrifugation. Genomic DNA was precipitated overnight at ⁇ 20° C. using 0.1 ⁇ volume of 3M NaOAc pH 5.2 and 2.5 ⁇ volume of 100% EtOH, then pelleted by centrifugation at 4000 rpm for 10-15 min. The pellet was washed once with 1 volume of 70% EtOH and once with 95% EtOH.
  • DNA was resuspended in 1 mL of TE buffer (Tris-HCl 10 mM; EDTA 1 mM; pH 8).
  • TE buffer Tris-HCl 10 mM; EDTA 1 mM; pH 8
  • RNase A 10 mg/mL was added and incubated at 37° C. for 1 hour.
  • RNase then was extracted with 1 volume of saturated phenol (pH 6.6) followed by 1 volume of phenol:chloroform:isoamyl alcohol (25:24: 1) and 1 volume of chloroform.
  • DNA was precipitated from separated aqueous phase with 0.1 volume of 3M NaOAc pH 5.2 and 2.5 volume of 100% EtOH, incubated at -20° C.
  • the vector pCel6A413/367pst-hph-BB was transformed into generated new T. reesei host strain, P577C, using PEG-mediated protoplast transformation as described above (Example 8c).
  • the selection of transformants was performed using hygromycin resistance as a selectable marker.
  • Aliquots (0.75 mL) of transformed protoplasts were added into 25 mL of PDA media cooled to about 47-50° C. and the protoplast suspensions were poured into 200 mm Petri dishes. After the PDA media containing transformed protoplasts solidified, another 25 mL of PDA media supplemented with 80U/mL of hygromycin B was added as a top agar.
  • Transformants were transferred twice to individual plates containing PDA media supplemented with 40 U/mL of hygromycin B (PDAH) and allowed to sporulate. Spores were collected and plated at high dilution on PDAH to isolate homokaryon transformants, which were then plated onto PDA and incubated at 30° C. for sporulation and subsequent analysis.
  • PDAH hygromycin B
  • Transformants possessing targeted vector integration into cel6a locus were identified by their ability to grow in the presence of hygromycin and inability to grow on minimal media lacking uridine supplement. This indicated that the pyr4 selectable marker cassette present in P577C host strain was replaced with modified Cel6A expression and hph selectable marker cassettes.
  • TrCel6A-W367G-S413P protein analysis To confirm expression of TrCel6A-W367G-S413P protein, all strains possessing targeted replacement of wild type cel6a gene with TrCel6A-W367G-S413P coding gene were grown in microcultures for Cel6A protein analysis.
  • T. reesei transformants and the parental strain BTR213aux28 were cultured on PDA plates supplemented with 5mM of uridine for 6-7 days at 30° C.
  • the spore suspensions were prepared by washing spores from the agar plate with sterile water.
  • the composition of microculture media containing glucose with cellulase inducing carbohydrates as a carbon source is indicated below.
  • Trichoderma microculture media Component Concentration g/L Glucose with cellulase inducing 35 carbohydrates a Ammonium sulphate 12.7 KH 2 PO 4 8.0 MgSO 4 —7H2O 4.0 CaCl 2 —2H 2 O 1.0 FeSO 4 —7H2O 0.1 MnSO 4 —7H2O 0.032 ZnSO 4 7H 2 O 0.028 CaCO 3 20 Corn Steep Liquor (powder) 5 pH4.24 a A cellulase-inducing cocktail comprising, as a function of total carbohydrate, 56% gentiobiose, 14% sophorose, 6% cellobiose, 10% trehalose, 6% maltotriose, 4% glucose and 14% other carbohydrates
  • T. reesei spores were inoculated in each well of 24-well culture dish (COSTAR) containing 1 mL of media. Plates were incubated for 5-7 days at 30° C. with shaking at 250 rpm.
  • the relative concentration of the TrCel6A-W367G-S413P produced by transformants was determined by ELISA (Example 4).
  • the relative concentration of TrCel6A-W367G-S413P protein was calculated by dividing TrCel6A-W367G-S413P concentration by the total amount of protein produced, as determined using a Bradford protein assay.
  • the expression levels of Cel6A are presented in FIG. 8 .
  • Trichoderma spores were inoculated onto standard 85 mm Petri plates containing potato dextrose agar (PDA). These plates were incubated at 28° C. for 3-5 days to achieve a confluent growth of fresh green spores.
  • PDA potato dextrose agar
  • Peristaltic pumps were used to deliver the carbon source at a feed rate of 0.4 grams of carbon per liter culture per hour. Operational parameters during both the batch and fed-batch portions of the run were: mixing by impeller agitation at 500 rpm, air sparging at 8 standard liters per minute, and a temperature of 28° C. Culture pH was maintained at 4.0-4.5 during batch growth and pH 3.5 during cellulase production using an automated controller connected to an online pH probe and a pump enabling the addition of a 10% ammonium hydroxide solution. Periodically, 100 mL samples of broth were drawn for biomass and protein analysis. After 96 hours of fermentation time 1L of fermentation media was collected and filtered for further protein analysis.
  • Grain samples were ground to pass a 20 mesh screen using a Wiley Mill.
  • Total carbohydrates were determined through acid hydrolysis and ion chromatography on a DX-500 system with PA1 column and amperometric detection.
  • Total carbohydrates minus total starch was used to determine quantity of non-starch polysaccharides in the substrate in order to determine starting enzyme dose. Solids determination was used to correct for sample dry weights in all experiments.
  • Viscosity reduction by parental and modified Family 6 glycosidases was deteremined using a Perten SuperRVA4 can and paddle assembly, fixed retention time of 15 min, a 30 mL sample size at 35% solids, 50 mM citrate buffer, pH 4.5, and a temperature of 52° C. An initial sec mix at 900 rpm was followed by data collection at 4 sec intervals at 160 rpm. Data were collected in centepoise units (cP)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

A modified Family 6 glycosidase enzyme comprising amino acid substitutions at one or more positions selected from the group 182, 367, 399, 400 and 427 is provided (the position determined form alignment of a parental Family 6 glycosidase with SEQ ID NO: 1). Genetic constructs and genetically modified microbes comprising nucleic sequences encoding the modified Family 6 glycosidase are also provided. Family 6 glycosidase of the invention display decreased hydrolysis activity of beta 1-4 linked polysaccharides and increased hydrolysis activity of beta 1-3, 1-4 linked polysaccharides compared with a parental Family 6 glycosidase. Such glycosidases find use in a variety of applications in industry, e.g., in hydrolysis of beta 1-3, 1-4 linked polysaccharides during the processing of cereal grains or the production of alcohol, animal feed or food products.

Description

TECHNICAL FIELD
The present invention relates to modified glycosyl hydrolase (GH) enzymes. More specifically, the invention relates to modified enzymes of the GH Family 6 (GH6) with altered substrate specificity. The present invention also relates to genetic constructs comprising nucleotide sequences that encode and direct the expression and secretion of modified GH enzymes, methods for the production of modified GH enzymes from host strains, and the use of the modified GH enzymes.
BACKGROUND OF THE INVENTION
Glycosyl hydrolases (GHs) are a large group of enzymes that cleave glycosidic bonds between individual carbohydrate monomers in large polysaccharide molecules. For example, cellulases cleave the beta 1-4 bond between glucose monomers in the cellulose polymer; arabinofuranosidases cleave the alpha 1-2 and/or alpha 1-3 bonds between arabinose and xylose in arabinoxylan; amylases cleave the alpha 1-4 bonds between glucose molecules in starch, etc. As a result of the diversity of polysaccharide molecules, there are also many different GH enzymes. However, these enzymes all share one of two common mechanisms, called inverting and retaining, for introducing a water molecule at a glycosidic bond thus cleaving the polysaccharide. The majority of GH enzymes utilize the retaining mechanism.
The GH enzymes are grouped into more than 100 different families based on commonality in their primary and tertiary structures and their catalytic mechanism (CAZy website, URL: cazy.org: Coutinho and Henrissat, 1999). Some GH enzymes families are grouped into larger clans. Depending upon the particular family (all numbers are according to the CAZy website as of 13 March 2008), it may have only a few known examples (e.g., family GH82) or many (e.g. family GH34); more than half of the families have fewer than 200 members. Similarly, all the members of a particular family may represent essentially a single activity, which is to say activity against a single specific substrate (e.g., GH11, all of which are xylanases), whereas other families may have enzymes that cover a wide range of activities (e.g., GH5, comprising cellulases, xylanases, mannanases, chitosanases, galactanases, etc.). Individually, most enzymes have their highest activity for a single substrate, although there are examples of particular enzymes that have high activity against several substrates (e.g. Cel7B from Trichoderma reesei, which has both cellulase and xylanase activity).
The GH Family 6 belongs to no clan; it comprises over 100 members, all of which exhibit primarily cellulase activity using the inverting mechanism. Both endo- and exo-cellulases have been identified from a variety of bacterial and fungal sources. In addition, some GH6 members, including Cel6A from Trichoderma reesei, have been shown to have hydrolytic activity against beta-glucan, which is a linear polymer of glucose with mixed linkages (Henriksson et al., 1995).
The beta-glucans form a large group of industrially important polysaccharides. Because of their mixed linkages, the beta-glucans have higher solubility in aqueous solutions than more regular polymers such as cellulose. In the soluble form, the beta-glucans confer viscosity and/or gel-like properties to a solution. There are two major types: beta 1-3, 1-6 glucan, also known as laminaran because a major source of this glucan is Laminaria brown algae (kelp), and beta 1-3, 1-4 glucan, also known as lichenan because a major source of this glucan is lichen. However, beta 1-3, 1-4 glucan is also found as a major component of oat and barley endosperm. Hydrolysis of beta 1-3, 1-4 glucan from grains is desirable on the industrial scale to reduce viscosity in processes such as brewing, in the production of grain ethanol for fuel, and also to increase nutrient accessibility in animal feeds. In particular, Trichoderma reesei Cel6A expressed in brewer's yeast is used to aid in the malting and brewing processes (Enari et al., 1987).
Some efforts to engineer GH enzymes in order to switch their activity from one substrate to another have been made, although experts in protein engineering generally concede that this is one of the more difficult protein engineering challenges (cf. Tao and Cornish, 2002). The research group of W. M de Vos identified three key amino acid residues of a GH1 beta-glucosidase that determined substrate specificity based on a structural comparison to a beta-galactosidase from the same family. By converting the residues of the beta-glucosidase to those found in the beta-galactosidase, they converted the beta -glucosidase into a beta-galactosidase. Similarly, key residues of a GH10 xylanase that discriminate between xylan and cellulose have been identified and mutagenized to change the enzyme from a xylanase to a cellulase (Andrews et al., 2000).
The GH6 family of enzymes have been the target of mutational and protein engineering studies. The exocellulase Cel6A from Trichoderma reesei, the exocellulase Cel6A from Humicola insolens, and the cellulases Cel6A (endo) and Cel6B (exo) from Thermobifida fusca are representative enzymes that have been particularly well characterized. Specific sites of investigation include what are known as the loop regions. These are the principal determinants of whether an enzyme is an endocellulase (lacking loops) or an exocellulase (possessing loops). Mutations in the loops (Varrot et al., 2002) or deletion of the loops (Meinke et al., 1995) will alter the interaction between Cel6A and cellulose. An extensive series of point mutations were studied in the two T. fusca enzymes, Cel6A and Cel6B (Zhang et al., 2000a; Zhang et al., 2000b). Changes in the relative activities towards different substrates—specifically filter paper, carboxymethyl cellulose, swollen cellulose and bacterial microcrystalline cellulose—were observed. Other studies have examined the role of aromatic amino acids in substrate binding (Koivula et al., 1996; Koivula et al., 1998; Zou et al., 1999) and the role of charged amino acids in activity and stability (Koivula et al., 2002; Wohlfahrt et al., 2003).
T. reesei Cel6A (or TrCel6A) is one of the two major cellobiohydrolases secreted by this fungus and has been shown to be efficient in the enzymatic hydrolysis of crystalline cellulose, with low but measurable activity in the hydrolysis of beta 1,3-1,4 mixed linkage glucans such beta-glucan and lichenan. The tryptophan amino acid residue at position 367 (W367) of the Trichoderma reesei Cel6A represents a highly conserved residue within a strongly conserved region of the enzyme (FIG. 1). Generally, mutation of conserved residues results in enzyme inactivation, or a severe loss of activity.
SUMMARY OF THE INVENTION
The present invention relates to modified glycosyl hydrolase (GH) enzymes. More specifically, to modified enzymes of the GH Family 6 (GH6) with altered substrate specificity. The present invention also relates to genetic constructs comprising nucleotide sequences that encode and direct the expression and secretion of modified GH enzymes, methods for the production of modified GH enzymes from host strains, and the use of the modified GH enzymes.
It is an object of the invention to provide a modified glycosidase with an altered substrate specificity.
The present invention provides modified glycosidase with an altered substrate preference from EC 3.2.1.91 (cellulase) to EC 3.2.1.73 (beta-glucanase).
The present invention relates to a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Familiy 6 glycosidase having an amino acid sequence in which the amino acids corresponding to those from position 83 to position 447 of TrCel6A (SEQ ID NO: 1) exhibit from about 47% to about 99.9% identity to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1. Furthermore, the one or more amino acid substitutions may be selected from the group consisting of N182S, N182R, N182G, N182A, W367A, W367C, W367G, W367N, W367R, W367S, W367T, W367V, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
The present invention also provides a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Family 6 glycosidase having an amino acid sequence in which the amino acids corresponding to those from position 83 to position 447 of TrCel6A (SEQ ID NO: 1) exhibit from about 70% to about 99.9% identity to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through SEQ ID NO: 36. Furthermore, the one or more amino acid substitutions may be selected from the group consisting of N182S, N182R, N182G, N182A, W367A, W367C, W367G, W367N, W367R, W367S, W367T, W367V, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
The position of the one or more amino acid substitution defined above may be determined from sequence alignment of the amino acids corresponding to positions 83-447 of SEQ ID NO: 1 of a parental Family 6 glycosidase enzyme with amino acids 83-447 of the Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1.
The modified Family 6 glyocosidase may be derived from a parental Family 6 glycosidase that is otherwise identical to the modified Family 6 glycosidase except for the substitution of the naturally occurring amino acid at one or more of positions 182, 367, 399, 400 and 427. For example, this invention includes a modified Family 6 glycosidase as defined above and further comprising a proline residue at position 413.
The modified Family 6 glycosidase comprising these mutations may be from a filamentous fungus, such as Trichoderma reesei.
The present invention also relates to a modified Family 6 glycosidase as defined above and that has from about a 1.2-fold increase in activity in the hydrolysis of beta 1-3, 1-4-linked or beta 1-3, 1-6-linked polysaccharides and may also exhibit at least a 1.2-fold decrease in activity in the hydrolysis of beta 1-4 -linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
The present invention also relates to a modified Family 6 glycosidases selected from the group consisting of:
TrCe16A-N182S-S413P; (SEQ ID NO: 83)
TrCe16A-N182R-D350E-S413P; (SEQ ID NO: 84)
TrCe16A-N182G-S413P; (SEQ ID NO: 85)
TrCe16A-N182A-S413P; (SEQ ID NO: 86)
TrCe16A-W367A-S413P; (SEQ ID NO: 37)
TrCe16A-W367C-S413P; (SEQ ID NO: 38)
TrCe16A-W367G-S413P; (SEQ ID NO: 39)
TrCe16A-W367N-S413P; (SEQ ID NO: 40)
TrCe16A-W367R-S413P; (SEQ ID NO: 41)
TrCe16A-W367S-S413P; (SEQ ID NO: 42)
TrCe16A-W367T-S413P; (SEQ ID NO: 43)
TrCe16A-W367V-S413P; (SEQ ID NO: 44)
HiAvi2-W367G; (SEQ ID NO: 45)
PcCe16A-W367G; (SEQ ID NO: 46)
TrCe16A-S25G-T60S-E399H-S413P; (SEQ ID NO: 87)
TrCe16A-E399T-S413P; (SEQ ID NO: 88)
TrCe16A-E399S-S413P; (SEQ ID NO: 89)
TrCe16A-C400V-S413P; (SEQ ID NO: 90)
TrCe16A-C400M-S413P; (SEQ ID NO: 91)
TrCe16A-C400T-S413P; (SEQ ID NO: 92)
TrCe16A-C400S-S413P; (SEQ ID NO: 93)
TrCe16A-A427V-S413P; (SEQ ID NO: 94)
TrCe16A-A427L-S413P; (SEQ ID NO: 95)
and
TrCe16A-A427S-5413P. (SEQ ID NO: 96)
The present invention relates to genetic constructs comprising a nucleic acid sequence encoding a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Family 6 glycosidase having an amino acid sequence that exhibits from 47% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1 or an amino acid sequence that exhibits from 70% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through SEQ ID NO: 36. The nucleic acid sequence may be operably linked to other nucleic acid sequences regulating its expression and secretion from a host microbe. Preferably, the other nucleic sequences regulating the expression and secretion of the modified Family 6 glycosidase are derived from the host microbe used for expression of the modified Family 6 glycosidase. The host microbe may be a yeast, such as Saccharomyces cerevisiae, or a filamentous fungus, such as Trichoderma reesei.
The invention also relates to a genetic construct as defined above, wherein the modified Family 6 glycosidase encoded by the genetic construct further comprises a substitution of the amino acid at position 413 with a proline or any other additional mutations at positions other than 182, 367, 399, 400 or 427.
The invention also relates to a genetically modified microbe comprising a genetic construct encoding the modified Family 6 glycosidase and capable of expression and secretion of a modified Family 6 glycosidase comprising one or more amino acid substitutions selected from the group consisting of: N182X, W367X, E399X, C/S400X and A427X, the modified Family 6 glycosidase having an amino acid sequence that exhibits 70% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1 or an amino acid sequence that exhibits from 70% to 99.9% identity to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through SEQ ID NO: 36. In one embodiment, the genetically modified microbe is capable of expression and secretion of a modified Family 6 glycosidase further comprising a substitution of the amino acid at position 413 with a proline or any other additional mutations at positions other than 182, 367, 399, 400 or 427. The genetically modified microbe may be a yeast or filamentous fungus. For example, the genetically modified microbe may be a species of Saccharomyces, Pichia, Hansenula, Trichoderma, Hypocrea, Aspergillus, Fusarium, Humicola or Neurospora.
The present invention also relates to a process for hydrolysing a beta 1-3, 1-4 -linked polysaccharide substrate with modified Family 6 glycosidase.
The invention also relates to a process of producing the modified Family 6 glycosidase as defined above, including transformation of a yeast or fungal host with a genetic construct comprising a DNA sequence encoding the modified Family 6 glycosidase, selection of recombinant yeast or fungal strains expressing the modified Family 6 glycosidase, culturing the selected recombinant strains in submerged liquid fermentations under conditions that induce the expression of the modified Family 6 glycosidase and recovering the modified Family 6 glycosidase by separation of the culture filtrate from the host microbe.
The inventors have made the surprising discovery that although substitution of N182, W367, E399, C/S400 or A427 by another amino acid generally results in loss of activity against the beta 1-4 linked substrate cellulose, several of these mutations significantly increase the activity of the enzyme towards beta 1-3, 1-4 glucans. Since these amino acids all participate in substrate binding within the active site, the inventors postulate, without wishing to be bound by theory, that the altered substrate specificity of such modified Family 6 glycosidases may be a consequence of an expansion of the enzyme active site to accommodate the branched beta 1-3, 1-4 linked substrates. This altered substrate specificity has potential value applied to industries where reduction of viscosity caused by beta 1-3, 1-4 glucan is desirable, as described above. The modified Family 6 glycosidase exhibits at least about 1.2-fold increase in activity on a beta-1-3, 1-4 linked polysaccharide and may also exhibit at least a 1.2-fold decrease in activity on a beta 1-4 linked polysaccharide such as cellulose. For example, the modified Family 6 glycosidase may exhibit from about a 1.2—to about a 4-fold increase in activity on a beta 1-3, 1-4 linked polysaccharide and may also exhibit from about a 1.2-fold to about a 10-fold decrease in activity on a beta 1-4 linked polysaccharide such as cellulose
The modified Family 6 glycosidases of the present display increased activity on beta 1-3, 1-4 -linked polysaccharides and decreased activity on beta 1-4 linked polysaccharides relative to the parental Family 6 glycosidase from which they are derived.
Such glycosidases find use in a variety of applications in industry that require high activity on beta 1-3, 1-4 -linked or beta 1-3, 1-6-linked polysaccharide substrates. For example, modified Family 6 glycosidases, as described herein, may be used in industrial grain processing applications such as brewing, production of grain ethanol for fuel, and also to increase nutrient accessibility in animal feeds.
DESCRIPTION OF THE DRAWINGS
These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein:
FIG. 1 shows an amino acid sequence alignment among selected fungal glycosidases from Glycosyl Hydrolase Family 6 and a consensus Family 6 glycosidase sequence. A graphical representation of the frequency of occurrence of the amino acid at each position of the consensus Family 6 glycosidase among the 36 fungal Family 6 glycosidases is shown underneath the aligned sequences. The catalytic aspartic acid residues at the equivalent positions 175 and 221 in TrCel6A are indicated by arrows. The highly conserved amino acids at the equivalent of positions 182, 367, 399, 400 and 427 in TrCel6A are indicated with an asterisk. For cellulases with a cellulose-binding domain, only the catalytic core sequences are presented.
FIG. 2 shows an identity matrix for the alignment of the amino acids corresponding to amino acids 83-447 of SEQ ID NO: 1 for each of 36 Family 6 glycosidase amino acid sequences to each other.
FIG. 3 depicts plasmid vectors a) YEp352/PGK91-1ΔNheI-αss-TrCel6A-S413P, and b) YEpFLAGΔKpn10-cbh2 directing the expression and secretion of native and modified TrCel6A from recombinant Saccharomyces cerevisiae, c) YEp/PGK-αss-NKE-PcCel6A directing the expression and secretion of native and modified PcCel6A from recombinant Saccharomyces cerevisiae (The same organization if found for the PcCel6 variants cloned in the same vectors), d) YEp/PGK-αss-NKE-HiAvi2 directing the expression and secretion of native and modified HiAvi2 from recombinant Saccharomyces cerevisiae (The same organization if found for the HiAvi2 variants cloned in the same vectors).
FIG. 4 shows the relative activity of modified TrCel6A glycosidases on cellulose, barley beta-glucan and lichenan to the activity of a parental TrCel6A glycosidase on each substrate.
FIG. 5 shows the relative activity of parental and modified TrCel6A, PcCel6A and HiAvi2 glycosidases on (A) barley betaglucan: cellulose and (B) lichenan: cellulose.
FIG. 6 shows the maps of Trichoderma transformation vectors pCel6Apst-S413P-pyr4-TV (A) and pCel6A413pst-hph-BB (B).
FIG. 7 shows the verification of targeting of the TrCel6A genetic locus to native cel6A locus by Southern hybridization. Genomic DNA was isolated from transformants P577A, B, C and parental strains BTR213, BTR213aux28 digested with EcoRI restriction enzyme, separated on a 1% agarose gel, transferred to a nitrocellulose membrane and hybridized using the TrCel6A coding nucleic acid sequence as a probe. pCel6ApXT-S413P-pyr4-TV transformation plasmid digested with EcoRI was used as a control (lane pCel6ApXt-pyr4-TV).
FIG. 8 shows the expression of the modified TrCel6A-W367G-S413P glycosidase by Trichoderma reesi transformants (P988A, P989A, B, C, P990A, P991B, P992A, P1005A, C, D) and the expression of wild-type TrCel6A by the host strain (P577C) and parental strain BTR213aux in microcultures. The abundance of TrCel6A-W367G-S413P or TrCel6A protein is indicated on each bar as a percent of total protein.
FIG. 9 shows the crystal structure of TrCel6A (using coordinates from PDB file 1QK2) represented in ribbon form with the active-site ligand (cellotetraose) in black sticks and the amino acids at positions 182, 367, 399, 400 and 427 represented as black ball-and-sticks and are labeled. Residues 403 to 424 were removed for ease of visualization.
DESCRIPTION OF PREFERRED EMBODIMENT
The present invention relates to modified glycosidases. More specifically, the invention relates to modified Family 6 glycosidases with altered substrate specificity. The present invention also relates to genetic constructs comprising nucleotide sequences encoding for modified Family 6 glycosidases, methods for the production of the modified Family 6 glycosidase from host strains and the use of the modified Family 6 glycosidase in the hydrolysis of beta-glucan.
The following description is of a preferred embodiment by way of example only and without limitation to the combination of features necessary for carrying the invention into effect.
Modified Glycosidases of Glycosyl Hydrolase Family 6
A glycosyl hydrolase enzyme is classified as a Family 6 glycosidase if exhibits similarity in its primary, secondary and tertiary protein structures to those of other Family 6 glycosidases. For example, all Family 6 glycosidases comprise two aspartic acid (D) residues which may serve as catalytic residues. These aspartic acid residues are found at positions 175 and 221 (see FIG. 1; based on TrCel6A, Trichoderma reesei Cel6A, amino acid numbering). Most of the Family 6 glycosidases identified thus far are mesophilic; however, this family also includes thermostable cellulases from Thermobifida fusca (TfCel6A and TfCel6B) and the alkalophilic cellulases from Humicola insolens (HiCel6A and HiCel6B). Family 6 glycosidases also share a similar three dimensional structure: an alphalbeta-barrel with a central beta-barrel containing seven parallel beta-strands connected by five alpha-helices. The three dimensional structures of several Family 6 glycosidases are known, such as TrCel6A (Rouvinen, J., et al. 1990), Thermobifida fusca endo-beta-1,4-glucanase Cel6A (TfCel6A, Spezio, M., et al. 1993), Humicola insolens cellobiohydrolase Cel6A (HiCel6A, Varrot, A., et al. 1999), Humicola insolens endo-beta-1,4-glucanase Cel6B (HiCel6B, Davies, G. J., et al. 2000) and Mycobacterium tuberculosis H37Rv Cel6A (MtCel6A, Varrot, A., et al. 2005).
As shown in FIGS. 1 and 2, there is a high degree of conservation of primary amino acid sequence among Family 6 glycosidases. Multiple alignment across 36 currently known Family 6 glycosidase amino acid sequences of fungal origin shows that the most naturally occurring Family 6 glycosidases exhibit from about 47% to about 100% amino acid sequence identity to amino acids 83-447 comprising the catalytic domain of TrCel6A (Table 1) and from about 70% to 100% amino acid sequence identity to at least one other Family 6 glycosidase. Family 6 glycosidases of bacterial origin show a much lower degree of amino acid sequence identity to TrCel6A or to other Family 6 glycosidases of fungal origin.
There are several positions where a particular amino acid is universally conserved at the same corresponding position across all Family 6 members. For example, W135, W269, W272 and W367 are highly conserved amino acids that interact with the glucose subunits in the cellulose substrate at the −2, +1, +2 and +4 subsites in the active site tunnel of TrCel6A. N182, E399, and A427 are other highly conserved residues found in the −2 subsite in the active site tunnel of TrCel6A.
TABLE 1
% Amino Acid Sequence Identity of Fungal Family 6 Glycosidases to TrCel6A
Identity with
TrCel6A catalytic
domain (83-447)
SEQ ID Organism Protein (%)
2 Hypocrea koningii cellobiohydrolase II (Cbh2) 98.9
3 Trichoderma viride CICC 13038 cellobiohydrolase II (CbhII; Cbh2) 98.9
4 Hypocrea koningii 3.2774 cellobiohydrolase II (Cbh2; CbhII) 98.1
5 Hypocrea koningii AS3.2774 cbh2 97.8
6 Trichoderma parceramosum cellobiohydrolase II (CbhII) 97.8
7 Aspergillus nidulans FGSC A4 cellobiohydrolase (AN5282.2) 72.4
8 Aspergillus niger CBS 513.88 An12g02220 72.4
9 Aspergillus oryzae RIB 40 AO090038000439 67.8
10 Aspergillus niger CBS 513.88 An08g01760 67.7
11 Acremonium cellulolyticus Y-94 cellobiohydrolase II (Acc2) 67.3
12 Talaromyces emersonii cellobiohydrolase II (CbhII) 66.8
13 Gibberella zeae K59 Cel6 - Cel6 66.1
14 Fusarium oxysporum endoglucanase B 66.1
15 Neurospora crassa OR74A NCU09680.1 (64C2.180) 65.9
16 Aspergillus nidulans FGSC A4 AN1273.2 65.5
17 Aspergillus tubingensis unnamed protein product (fragment) 65.5
18 Magnaporthe grisea 70-15 MG05520.4 65.4
19 Chaetomium thermophilum unnamed protein product 65.1
20 Chaetomium thermophilum CT2 cellobiohydrolase (Cbh2) 65.0
21 Stilbella annulata unnamed protein product 64.9
22 Humicola insolens avicelase 2 (Avi2) 63.7
23 Humicola insolens cellobiohydrolase (CBHII) - Cel6A 63.1
24 Cochliobolus heterostrophus C4 cellobiohydrolase II (CEL7) 59.6
25 Agaricus bisporus D649 cellobiohydrolase II (Cel3; Cel3A) 57.7
26 Polyporus arcularius 69B-8 cellobiohydrolase II (Cel2) 57.1
27 Lentinula edodes Stamets CS-2 cellulase - Cel6B 56.3
28 Lentinula edodes L54 cellobiohydrolase (CbhII-1) 56.0
29 Malbranchea cinnamomea unnamed protein product 54.9
30 Phanerochaete chrysosporium cellobiohydrolase II 54.9
31 Volvariella volvacea cellobiohydrolase II-I (CbhII-I) 53.8
32 Chrysosporium lucknowense cellobiohydrolase (EG6; CBH II) - Cel6A 49.5
33 Pleurotus sajor-caju cellobiohydrolase II 47.2
34 Trametes versicolor ORF 47.0
35 Neurospora crassa OR74A NCU03996.1 46.8
36 Magnaporthe grisea 70-15 MG04499.4 45.1
By “TrCel6A numbering”, it is meant the numbering corresponding to the position of amino acids based on the amino acid sequence of TrCel6A (Table 1; FIG. 1; SEQ ID NO: 1). As set forth below, and as is evident by FIG. 1, Family 6 glycosidases exhibit a substantial degree of sequence similarity. Therefore, by aligning the amino acids to optimize the sequence similarity between glycosidase enzymes, and by using the amino acid numbering of TrCel6A as the basis for numbering, the positions of amino acids within other Family 6 glycosidases can be determined relative to TrCel6A.
Methods to align amino acid sequences are well known and available to those of skill in the art and include BLAST (Basic Local Alignment Search Tool, URL: blast.ncbi.nlm.nih.gove/Blast.chi; Altschul et al., 1990; using the published default settings) which is useful for aligning two sequences and CLUSTALW (URL: ebi.cak.ak/Tools/clustalw2/index.html) for alignment of two or more sequences.
By “modified Family 6 glycosidase” or “modified glycosidase”, it is meant a Family 6 glycosidase which comprises one or more amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of: N182X(i.e. N at position 182 is substituted by X), W367X, E399X, C/S400X, and A427X, where X is any amino acid and the position is determined from sequence alignment of the modified Family 6 glycosidase with a Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1. For example, the modified Family 6 glycosidase comprises one or more amino acid substitutions selected from the group consisting of: N182S, N182R, N182G, N182A, W367A, W367C, W367G, W367N, W367R, W367S, W367T, W367V, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
It will be understood that modified Family 6 glycosidase may be derived from any Family 6 glycosidase. For example, the modified Family 6 glycosidase may be derived from a wild-type glycosidase or from a glycosidase that already contains other amino acid substitutions.
A “modified Family 6 glycosidase” may also be defined as an enzyme capable of hydrolyzing polysaccharides using an inverting mechanism and having one or more amino acid substitutions, introduced by genetic engineering techniques, selected from the group consisting of: N182X, W367X, E399X, C/S400X, and A427X, which is characterized by having an amino acid sequence that is from about 47% to about 99.9% identical to the amino acids 83 to 447 of the TrCel6A amino acid sequence (SEQ ID NO: 1) or having an amino acid sequence that is from about 70% to about 99.9% identical to amino acids 83-447 (TrCel6A) of any of the Family 6 glycosidases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36. For example, a modified Family 6 glycosidase may have an amino acid sequence that is about 47%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99.9% identical to the amino acids 83-447 of SEQ ID NO: 1 or that is about 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86%, 88%, 90%, 92%. 94%, 96%. 98% or 99.9% identical to at amino acids 83-447 (TrCel6A numbering) of any of the Family 6 glycosidases of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36. One of skill in the art recognizes that the amino acid sequence of a given Family 6 glycosidase may be modified by the addition, deletion or substitution of one or more amino acids and still be considered a modified Family 6 glycosidase. Non-limiting examples of Family 6 glycosidases that may be modified following the general approach and methodology as outlined herein are provided in Table 1.
Examples of Family 6 glycosidases useful for the present invention, which are not meant to be limiting, include Trichoderma reesei Cel6A, Humicola insolens Cel6A, Phanerochaete chrysosporium Cel6A, Cellulomonas fimi Cel6B, Thermobifida fusca Cel6B. Preferably, the modified Family 6 glycosidase of the present invention comprises a modified Trichoderma reesei Cel6A glycosidase.
As used herein in respect of modified Family 6 glycosidase amino acid sequences, “derived from” refers to the isolation of a target nucleic acid sequence element encoding the desired modified Family 6 glycosidase using genetic material or nucleic acid or amino acid sequence information specific to the corresponding parental Family 6 glycosidase. As is known by one of skill in the art, such material or sequence information can be used to generate a nucleic acid sequence encoding the desired modified Family 6 glycosidase using one or more molecular biology techniques including, but not limited to, cloning, sub-cloning, amplification by PCR, in vitro synthesis, and the like.
In one embodiment of the invention, the modified Family 6 glycosidase comprises an amino acid sequence that is from about 70% to 99.9% identical to amino acids 83-447 of SEQ ID NO: 1 and exhibits from about a 1.2-fold, for example from about 1.2-fold to 4-fold, increase in activity in the hydrolysis of beta 1-3, 1-4-linked polysaccharides and may also exhibit at least a 1.2-fold, for example from about 1.2-fold to 10-fold, decrease in activity in the hydrolysis of beta 1-4-linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
In another embodiment of the invention, the modified Family 6 glycosidase comprises an amino acid sequence that is from about 80% to about 99.9% identical to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through 36 and exhibits from about a 1.2-fold increase in activity in the hydrolysis of beta 1-3, 1-4-linked polysaccharides and may also exhibit at least a 1.2-fold decrease in activity in the hydrolysis of beta 1-4 -linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
In other embodiments of the invention, the modified Family 6 glycosidase comprises an amino acid sequence that is from about 90% to about 99.9% identical to amino acids 83-447 of SEQ ID NO: 1 or from about 95% to about 99.9% identical to amino acids 83-447 (TrCel6A numbering) of any one of SEQ ID NO: 1 through 36 and exhibits from about a 1.2-fold increase in activity in the hydrolysis of beta 1-3, 1-4-linked polysaccharides and may also exhibit at least a 1.2-fold decrease in activity in the hydrolysis of beta 1-4 -linked polysaccharides relative to a parental Family 6 glycosidase from which it is derived.
Techniques for altering amino acid sequences include, but are not limited to, site-directed mutagenesis, cassette mutagenesis, random mutagenesis, synthetic oligonucleotide construction, cloning and other genetic engineering techniques (Eij sink V G, et al. 2005). It will be understood that the modified Family 6 glycosidase may be derived from any Family 6 glycosidase—i.e., it may be derived from a naturally-occurring or “wild-type” Family 6 glycosidase or from a Family 6 glycosidase that already contains other amino acid substitutions.
By “wild type” or “native” Family 6 glycosidase, it is meant a Family 6 glycosidase having an amino acid sequence as encoded by the genome of the organism that naturally produces such Family 6 glycosidase without the introduction of any substitutions, deletions, insertions, or modifications. For example, by wild type TrCel6A, wild type HiCel6A and wild type PcCel6A it is meant the cellulases of SEQ ID NO: 1, SEQ ID NO: 23 and SEQ ID NO: 30 respectively, without any amino acid substitutions.
For the purposes of the present invention, a “parental Family 6 glycosidase” or “parental glycosidase” is a Family 6 glycosidase that does not contain the amino acid substitution(s) in the modified Family 6 glycosidases, namely at one or more position selected from the group consisting of 182, 367, 399, 400 and 427 (TrCel6A numbering) but that is otherwise identical to the modified Family 6 glycosidase. As such, the parental Family 6 glycosidase may be a Family 6 glycosidase that contains amino acid substitutions at other positions that have been introduced by genetic engineering or other techniques. However, a parental Family 6 glycosidase does not include those Family 6 enzymes in which one or more of the naturally occurring amino acid at positions 182, 367, 399, 400 and 427 are, respectively, tryptophan, asparagine, tryptophan, glutamic acid, cysteine or serine, and alanine.
Alternatively, after production of a modified Family 6 glycosidase comprising amino acid substitutions at one or more of positions 182, 367, 300, 400 and 427, the modified Family 6 glycosidase may be subsequently further modified to contain additional amino acid substitutions.
In order to assist one of skill in the art regarding those amino acid positions of a given Family 6 glycosidase at which amino acid substitutions (other than N182X, W367X, E399X, C/S400X and W427X) may be made and produce an active enzyme, an alignment of 36 Family 6 glycosidases derived from fungal sources is provided in FIG. 1 along with a graph showing the frequency of occurrence of each amino acid of the consensus sequence at each position. Using the information provided in FIG. 1, one of skill in the art would recognize regions of low sequence conservation among Family 6 glycosidases and could introduce additional amino acid substitutions in these regions.
Altering the Substrate Specificity of Family 6 Glycosidases
The substrate specificity of the modified Family 6 glycosidase is determined by incubation of the enzyme in the presence of several different polysaccharides substrate and measuring the release of soluble sugars from those substrates. The release of soluble sugars can be measured by subsequent chemical or chemienzymatic assays known to one of skill in the art, including reaction with dinitrosalisylic acid (DNS). Hydrolysis of polysaccharides can also be monitored by chromatographic methods that separate and quantify soluble mono-, di- and oligo-saccharidses released by the enzyme activity. In addition, soluble calorimetric substrates may be incorporated into agar-medium on which a host microbe expressing and secreting a parental or modified Family 6 glycosidase is grown. In such an agar-plate assay, activity of the glycosidase is detected as a colored or colorless halo around the individual microbial colony expressing and secreting an active glycosidase. The practice of the present invention is not limited by the method used to assess the substrate specificity of the modified Family 6 glycosidase.
The effect of amino acid substitutions at positions 182, 367, 399, 400 and 427 was determined via a comparative study of the substrate specificity of modified and the parental TrCel6A glycosidases. As shown in FIGS. 4 and 5 and summarized for activity on barley beta 1-3, 1-4 glucan in Table 2
TABLE 2
Altered Substrate Specificity of Modified Family 6 Glycosidases
Amino acid Relative activity on barley
substitution beta 1-3, 1-4 glucan
None (TrCel6A-S413P) 1.0
N182S 1.53
N182R 1.69
N182G 1.60
N182A 1.55
W367A 2.70
W367C 1.00
W367G 3.60
W367N 2.20
W367R 1.30
W367S 2.70
W367T 0.91
W367V 1.20
E399H 2.58
E399T 2.52
E399S 2.80
C400V 2.09
C400M 1.97
C400T 2.12
C400S 1.59
A427V 1.67
A427L 1.95
A427S 1.68
In a preferred embodiment, the modified Family 6 glycosidase exhibits at least a 1.2-fold, for example from about 1.2-fold to about 4-fold, increase in its hydrolysis activity of beta 1-3, 1-4 linked polysaccharides and may also exhibit at least a 1.2-fold, for example from about 1.2-fold to about 10-fold, decrease in its hydrolysis activity of beta 1-4 linked polysaccharides.
Without wishing to be bound by theory, the inventors hypothesize that the increased activity on beta 1-3, 1-4 glucans exhibited by the modified Family 6 glycosidases is due to the location of the substituted amino acids within or near the active site of the enzyme. FIG. 9 shows that, for TrCel6A, amino acids W367, E399, C400 are involved in substrate binding while amino acids N182 and A427 are located within the loop regions that enclose the active site tunnel. Therefore, mutations of these highly conserved amino acids may result in a more open or flexible geometry within the TrCel6A active site that allow for the accommodation of the branched beta 1-3, 1-4 glucans.
Genetic Constructs Encoding Modified Family 6 Glycosidase
The present invention also relates to genetic constructs comprising a nucleic acid sequence encoding the modified Family 6 glycosidase. The modified glycosidase-encoding nucleic acid sequence may be operably linked to regulatory nucleic acid sequences directing the expression and secretion of the modified Family 6 glycosidase from a host microbe. By “regulatory DNA sequences” it is meant a promoter and a DNA sequence encoding a secretion signal peptide. The regulatory DNA sequences are preferably functional in a fungal host. The regulatory DNA sequences may be derived from genes that are highly expressed and secreted in the host microbe under industrial fermentation conditions. In a preferred embodiment, the regulatory sequences are derived from one or more of the Trichoderma reesei cellulase or hemicellulase genes.
The genetic construct may further comprise a selectable marker gene to enable isolation of a genetically modified microbe transformed with the construct as is commonly known to those of skill in the art. The selectable marker gene may confer resistance to an antibiotic or the ability to grow on medium lacking a specific nutrient to the host organism that otherwise could not grow under these conditions. The present invention is not limited by the choice of selectable marker gene, and one of skill in the art may readily determine an appropriate gene. In a preferred embodiment, the selectable marker gene confers resistance to hygromycin, phleomycin, kanamycin, geneticin, or G418, complements a deficiency of the host microbe in one of the trp, arg, leu, pyr4, pyr, ura3, ura5, his, or ade genes or confers the ability to grow on acetamide as a sole nitrogen source.
The genetic construct may further comprise other nucleic acid sequences, for example, transcriptional terminators, nucleic acid sequences encoding peptide tags, synthetic sequences to link the various nucleic acid sequences together, origins of replication, and the like. The practice of the present invention is not limited by the presence of any one or more of these other nucleic acid sequences.
Genetically Modified Microbes Producing Modified Family 6 Glycosidases
The modified Family 6 glycosidase may be expressed and secreted from a genetically modified microbe produced by transformation of a host microbe with a genetic construct encoding the modified Family 6 glycosidase. The host microbe may be a yeast or a filamentous fungus, particularly those microbes that are members of the phylum Ascomycota. Genera of yeasts useful as host microbes for the expression of modified TrCel3A beta-glucosidases of the present invention include Saccharomyes, Pichia, Hansen ula, Kluyveromyces, Yarrowia, and Arxula. Genera of fungi useful as microbes for the expression of modified TrCel3A beta-glucosidases of the present invention include Trichoderma, Hypocrea, Aspergillus, Fusarium, Humicola, Neurospora, and Penicillium. Typically, the host microbe is one from which the gene(s) encoding any or all Family 6 glycosidase have been deleted. In a most preferred embodiment, the host microbe is an industrial strain of Trichoderma reesei.
The genetic construct may be introduced into the host microbe by any number of methods known by one skilled in the art of microbial transformation, including but not limited to, treatment of cells with CaCl2, electroporation, biolistic bombardment, PEG-mediated fusion of protoplasts (e.g. White et al., WO 2005/093072). After selecting the recombinant fungal strains expressing the modified Family 6 glycosidase, the selected recombinant strains may be cultured in submerged liquid fermentations under conditions that induce the expression of the modified Family 6 glycosidase. Preferably, the modified Family 6 glycosidase is produced in submerged liquid culture fermentation and separated from the cells at the end of the fermentation. The cells may be separated by filtration, centrifugation, or other processes familiar to those skilled in the art. The cell-free glycosidase-containing fraction may then be concentrated (for example, via ultrafiltration), preserved, and/or stabilized prior to use.
Therefore the present invention also provides a process for producing a modified Family 6 glycosidase. The method comprises growing a genetically modified microbe comprising a nucleotide sequences encoding a modified Family 6 glycosidase, in a culture medium under conditions that induce expression and secretion of the modified Family 6 glycosidase, and recovering the modified Family 6 glycosidase from the culture medium. The modified Family 6 glycosidase comprising one or more amino acid substitution at a position selected from the group consisting of N182X, W367X, E399X, C/S400X, and A427X, the position determined from alignment of a parental Family 6 glycosidase amino acid sequence with a Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1, wherein amino acids 83-447 (TrCel6A numbering) of the modified Family 6 glycosidase are from about 47% to about 99.9% identical to amino acids 83-447 of SEQ ID NO: 1, or from about 70-90% identical to amino acids 83-447 of any one of SEQ ID NO: 1 through 36.
Production of Modified TrCel3A Beta-Glucosidases
A modified Family 6 glycosidase of the present invention may be produced in a fermentation process using a genetically modified microbe comprising a genetic construct encoding the modified Family 6 glycosidase, e.g., in submerged liquid culture fermentation.
Submerged liquid fermentations of microorganisms, including Trichoderma and related filamentous fungi, are typically conducted as a batch, fed-batch or continuous process. In a batch process, all the necessary materials, with the exception of oxygen for aerobic processes, are placed in a reactor at the start of the operation and the fermentation is allowed to proceed until completion, at which point the product is harvested. A batch process for producing the modified Family 6 glycosidase of the present invention may be carried out in a shake-flask or a bioreactor.
In a fed-batch process, the culture is fed continuously or sequentially with one or more media components without the removal of the culture fluid. In a continuous process, fresh medium is supplied and culture fluid is removed continuously at volumetrically equal rates to maintain the culture at a steady growth rate,
One of skill in the art is aware that fermentation medium comprises a carbon source, a nitrogen source and other nutrients, vitamins and minerals which can be added to the fermentation media to improve growth and enzyme production of the host cell. These other media components may be added prior to, simultaneously with or after inoculation of the culture with the host cell.
For the process for producing the modified Family 6 glycosidase of the present invention, the carbon source may comprise a carbohydrate that will induce the expression of the modified Family 6 glycosidase from a genetic construct in the genetically modified microbe. For example, if the genetically modified microbe is a strain of Trichoderma, the carbon source may comprise one or more of cellulose, cellobiose, sophorose, and related oligo- or poly-saccharides known to induce expression of cellulases and beta-glucosidase in Trichoderma.
In the case of batch fermentation, the carbon source may be added to the fermentation medium prior to or simultaneously with inoculation. In the cases of fed-batch or continuous operations, the carbon source may also be supplied continuously or intermittently during the fermentation process. For example, when the genetically modified microbe is a strain of Trichoderma, the carbon feed rate is between 0.2 and 2.5 g carbon/L of culture/h, or any amount therebetween.
The process for producing the modified Family 6 glycosidase of the present invention may be carried at a temperature from about 20° C. to about 40° C., or any temperature therebetween, for example from about 25° C. to about 37° C., or any temperature therebetween, or from 20, 22, 25, 26, 27, 28, 29, 30, 32, 35, 37, 40° C. or any temperature therebetween.
The process for producing the modified Family 6 glycosidase of the present invention may be carried out at a pH from about 3.0 to 6.5, or any pH therebetween, for example from about pH 3.5 to pH 5.5, or any pH therebetween, for example from about pH 3.0, 3.2, 3.4, 3.5, 3.7, 3.8, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.5, 5.7, 5.8, 6.0, 6.2, 6.5 or any pH therebetween.
Following fermentation, the fermentation broth containing the modified Family 6 glycosidase may be used directly, or the modified Family 6 glycosidase may be separated from the fungal cells, for example by filtration or centrifugation. Low molecular solutes such as unconsumed components of the fermentation medium may be removed by ultra-filtration. The modified Family 6 glycosidase may be concentrated, for example, by evaporation, precipitation, sedimentation or filtration. Chemicals such as glycerol, sucrose, sorbitol and the like may be added to stabilize the cellulase enzyme. Other chemicals, such as sodium benzoate or potassium sorbate, may be added to the cellulase enzyme to prevent growth of microbial contamination.
The Use of Modified Family 6 Glycosidase
The modified Family 6 glycosidase of the present invention is used for the enzymatic hydrolysis of polysaccharides containing both beta 1-3 , 1-4 and/or beta 1-3, 1-6 glycosidic linkages. More preferably, the modified Family 6 glycosidase of the present invention is used for the enzymatic hydrolysis of beta 1-3, 1-4 glucans present in cereal grains. The modified Family 6 glycosidases of the present invention may be used in industrial processes such as brewing, production of grain ethanol for fuel, and also to increase nutrient accessibility in animal feeds.
By the term “enzymatic hydrolysis”, it is meant a process by which glycosidase enzymes or mixtures, including those comprising the modified Family 6 glycosidase of the present invention, act on polysaccharides to convert all or a portion thereof to soluble sugars.
EXAMPLES
The present invention will be further illustrated in the following examples. However, it is to be understood that these examples are for illustrative purposes only and should not be used to limit the scope of the present invention in any manner.
Example 1 Strains and Vectors
Saccharomyces cerevisiae strain BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 Δkre2) was obtained from ATCC (#4014317). The YEp352/PGK91-1 vector was obtained from the National Institute of Health. The YEpFLΔGAKpn 10-S413P vector is described in U.S. Publication No. 2008/0076152A1. The YEpFLAG-1 vector was obtained from Sigma as a part of the Amino-Terminal Yeast FLAG Expression Kit.
Example 2 Cloning of Modified Glycosidase Genes and Transformation of Saccharomyces cerevisiae
a. Cloning of the TrCel6A-S413P gene into the YEp352/PGK91-1 vector and transformation of S. cerevisiae BY4742
In order to facilitate cloning using NheI and KpnI restriction enzymes, the unique NheI site at position 1936 of the YEp352/PGK91-1 vector was blunted using the DNA Polymerase I large (Klenow) fragment to generate YEp352/PGK91-1ΔNheI. The TrCel6A-S413P gene was amplified by PCR from YEpFLAGΔKpn10-S413P vector (U.S. Publication No. 2008/0076152A1) using primers 5′NheCel6A and 3′BglKpnCel6A. In parallel, the yeast (α-factor leader sequence was amplified by PCR from the YEpFLAG- 1 vector (Sigma) using primers (5′BglAlphaSS and 3′NheAlphaSS) to introduce BglII at the 5′ end and an NheI site at 3′ end of the amplicon. SEQ ID NOS: 47-50 were utilized as primer sequences.
(SEQ ID NO: 47)
5′Bg1AlphaSS: 5′ACC AAA AGA TCT ATG AGA TTT CCT
TCA ATT
(SEQ ID NO: 48)
3′NheAlphaSS: 5′TGA GCA GCT AGC CCT TTT ATC CAA
AGA TAC
(SEQ ID NO: 49)
5′NheCe16A: 5′AAA AGG GCT AGC TGC TCA AGC GTC
TGG GGC
(SEQ ID NO: 50)
3′Bg1KpnCe16A: 5′GAG CTC AGA TCT GGT ACC TTA CAG
GAA CGA TGG GTT
The yeast alpha-factor leader sequence was isolated by BglII/NheI digestion and a three piece ligation performed with the TrCel6A-S413P gene (isolated by NheI/BglII digestion) and YEp352/PGK91-1ΔNheI vector (isolated by BglII digestion). The resulting vector YEp352/PGK91-1>NheI-αss-TrCel6A-S413P (FIG. 3) was transformed in yeast strain BY4742 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
b. Cloning of the Pccel6a, Pccel6A-W361G, HiAvi2 and HiAvi2-W374G genes into the YEp/PGK-αss-NKE and transfor ation in yeast
Generation of YEep/PGK-alphass-NKE: Vector YEp352/PGK91-1 was digested with NheI and EcoRI and the plasmid band was isolated from gel. A DNA adapter was made by annealing of AT046 and AT047 5′-phosphorylated primers and was ligated with the digested vector. To eliminate possible concatemerization, the plasmid was then digested with KpnI and self-ligated. The resulting vector is named YEp/PGK-alphass-NKE and its sequence integrity was confirmed by sequencing.
(SEQ ID NO: 54)
AT046: 5′ CTA GCT GAT CAC TGA GGT ACC G
(SEQ ID NO: 55)
AT047: 5′ AAT TCG GTA CCT CAG TGA TCA G
Generation of PcCel6A and PcCel6A-W36G vectors: The Pccel6a gene was amplified by PCR from YEpFLAGΔKpn10-PcCel6A vector (U.S. Publication No. 2008/0076152A1) using primers 5′VH098 and 3′VHO99. Pccel6a was cloned NheIlKpnI in YEp/PGK-alphass-NKE. PcCel6A-W361G was generated by two step PCR by mutating PcCel6A in YEp/PGK-alphass-NKE using primers 5′VH067 and 3′PGK-term for fragment one and YalphaN21-2 and 3′VH066 to generate fragment two. Fragments 1 and 2 were combined using primers YalphaN21-2 and 3′PGK-term.
(SEQ ID NO: 56)
5′VH098: 5′ GGT ATC TTT GGA TAA AAG GGC TAG CTC
GGA GTG GGG ACA G
(SEQ ID NO: 57)
3′VH099: 5′ GGA GAT CGA ATT CGG TAC CTA CAG CGG
CGG GTT GG
(SEQ ID NO: 58)
5′VH067: 5′ CAG TGG GGA GAC GGG TGC AAC ATC AAG
(SEQ ID NO: 59)
3′VH066: 5′ GTC TCC CCA CTG TTG GCG GAT G
(SEQ ID NO: 60)
YalphaN21-2 5′ GCC AGC ATT GCT GCT AAA G

The resulting vectors, YEpFLAGΔKpn10-PcCel6A and YEpFLAGΔKpn10-PcCel6A -W361G were used to transform Saccharomyces cerevisiae strain BY4742 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
Generation of HiAvi2 and HiAvi2-W374G vectors: The Hiavi2 gene was amplified by PCR from YEpFLAGΔKpn10-HiAvi2 vector (U.S. Patent Provisional No. 60/841,507) using primers 5′NM083 and 3′NM084. HiAvi2 was cloned NheIlKpnI in YEp/PGK-alphass-NKE. HiAvi2-W374G was generated by two step PCR by mutating HiAvi2 in YEp/PGK-alphass-NKE using primers 5′VH065 and 3′PGK-term for fragment one and YalphaN21-2 and 3′VH064 to generate fragment two. Fragments 1 and 2 were combined using primers YalphaN21-2 and 3′PGK-term.
(SEQ ID NO: 61)
5′NM083: 5′ AAG GAT GAC GAT GAC AAG GAA TTC CTC GAG
GCT AGC TGT GCC CCG ACT TGG GGC
(SEQ ID NO: 62)
3′NM084: 5′ AGC GGC CGC TTA CCG CGG GTC GAC GGG CCC
GGT ACC TCA GAA CGG CGG ATT GGC
(SEQ ID NO: 63)
5′VH065: 5′ GAA TGG GGC CAC GGG TGC AAT GCC ATT GG
(SEQ ID NO: 64)
3′VH064: 5′ GTG GCC CCA TTC CTT CTG GCC G

The resulting vectors, YEpFLAGΔKpn10-HiAvi2 and YEpFLAGΔKpn10-HiAvi2-W374G were used to transform Saccharomyces cerevisiae strain BY4742 using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
Example 3 Making Error Prone-PCR Libraries
Random mutagenesis libraries were generated using two methods: a Mutazyme® II DNA polymerase method and a Mn2+/biased dNTP mix method. For the Mutazyme® II DNA polymerase method, a series of four independent PCR were performed using 10, 20, 30, 40 ng of YEp352/PGK91-1ΔNheI-αss-TrCel6A-S413P vector and the Mutazyme® II DNA polymerase with primers YalphaN21 and 3′PGK-term. The amplification was done for 25 cycles. The four PCR products were pooled and diluted to 10 ng/μL. A second PCR mutagenesis step was performed using 30 ng of pooled PCR product with Mutazyme® II DNA polymerase using the same primers for 30 amplification cycles. The YEp352/PGK91-1ΔNheI-αss-TrCel6A-S413P vector was digested with NheI and KpnI and the empty vector fragment was isolated. This linear fragment and the final amplicon were transformed simultaneously and cloned by in vivo recombination into yeast strain BY4742 (Butler et al., 2003).
For the Mn2+/biased dNTP mix method, a PCR was performed using 25 ng YEp352/PGK91-1ΔNheI-αss-TrCel6A-S413P vector, 0.2 mM dATP, 0.2 mM dCTP, 0.24 mM dGTP, 0.2 mM dTTP, and 0.64 mM Mn2+ with Taq DNA polymerase (Sigma) with primers YalphaN21 and 3′PGK-term for 30 amplification cycles. The final amplicon was cloned into YEp352/PGK91-1ΔNheI-αss-TrCel6A-S413P vector as described above.
(SEQ ID NO: 49)
YalphaN21: 5′AGC ACA AAT AAC GGG TTA TTG
(SEQ ID NO: 50)
3′PGK-term: 5′GCA ACA CCT GGC AAT TCC TTA CC
Example 4 Screening of Error-Prone PCR Library of TrCel6A
a. Primary Screening of TrCel6A EP-PCR Library—Plate Assay
Saccharomyces cerevisiae transformants were grown on plates containing synthetic complete medium (SC: 2% agar w/v, 0.17% yeast nitrogen base w/v, 0.078% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) and 0.12% Azo-barley-β-glucan (Megazyme) for 2 days at 30° C. Colonies showing bigger clearing halos, after an overnight incubation at 45° C., compared to the parent enzyme TrCel6A-S413P were selected and sequenced as described below in section c.
b. Primary Screening of TrCel6A EP-PCR Library—Liquid Assay
Clones from the EP-PCR (Example 3) or SSM (Example 5) libraries expressing variants of TrCel6A-S413P were selected for liquid media pre-cultures by toothpick inoculation of 150 μL synthetic complete media (SC: 0.17% yeast nitrogen base w/v, 0.078% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) in 96-well microplates. Pre-cultures were grown overnight (16-18 h) at 30° C. and 300 rpm to stationary phase. For expression culture inoculation, 25 μL of pre-culture was used to inoculate 1 mL of SC media in deep-well microplates containing one glass bead. The remaining pre-cultures were used to prepare culture stocks by the addition of glycerol to a final concentration of 15% and stored at −80° C.
Expression cultures were grown for 3 days at 30° C. with orbital shaking and humidity control. Plates were centrifuged at 710×g for 5 minutes to pellet cells and supernatant was aspirated for screening assays. An aliquot (0.05 mL) of yeast supernatant was incubated with 0.5% beta-glucan in a 0.1 mL citrate buffered (50 mM; pH 5) reaction. Activity assays were performed for 3 hours in a PCR plate at 50° C. Contained in each 96-well PCR plate were 6 parental TrCel6A-S413P controls used for comparison. A glucose standard curve was placed in the first column of the PCR plate ranging from 3 to 0.05 mg/mL. Following incubation, 0.08 mL of DNS reagent was added to all wells and the plates were boiled for 10 min. An aliquot (0.15 mL) was transferred to a microplate and the absorbance was measured at 560 nm.
DNS reagent contains:
Component g/L
3,5-Dinitosalicylic acid (Acros) 20
Sodium hydroxide (Fisher) 20
Phenol (Sigma) 4
Sodium metabisulfate (Fisher) 1
The concentration of parental or modified TrCel6A glycosidases in yeast filtrates was determined by ELISA. Filtrate and purified component standard were diluted 0.01-10 μg/mL (based on total protein) in phosphate-buffered saline, pH 7.2 (PBS) and incubated overnight at 4° C. in microtitre plates (Costar EIA #9018). These plates were washed with PBS containing 0.1% Tween-20 (PBS/Tween) and then incubated in PBS containing 1% bovine serum albumin (PBS/BSA) for 1 h at room temperature. Blocked microtitre wells were washed with PBS/Tween. Rabbit polyclonal antisera specific for TrCel6A was diluted (1:16,000) in PBS/BSA, added to separate microtitre plates and incubated for 2 h at room temperature. Plates were washed and incubated with a goat anti-rabbit antibody coupled to horseradish peroxidase (Sigma #A6154), diluted 1/2000 in PBS/BSA, for 1 hr at room temperature. After washing, tetramethylbenzidine was added to each plate and incubated for 30 min at room temperature. The absorbance at 360 nm was measured in each well and converted into protein concentration using the TrCel6A standard curve.
Enzyme activity was determined by converting A560 values to reducing equivalents using the glucose standard curve. A specific activity was calculated for all modified and parental TrCel6A glycosidases by dividing the enzyme activity by the enzyme concentration determined by ELISA. The specific activity for each modified TrCel6A glycosidase was compared to the average of 6 parental TrCel6A glycosidase controls on a particular microplate and positives were selected at the 95% confidence level using a t-test. All positive variants were produced again in microculture and re-screened to reduce the number of false positives.
c. Sequencing of Genes Encoding Modified Glycosidases
Plasmid DNA comprising genes encoding modified TrCel6A 6 glycosidases with altered substrate specificity was isolated from yeast cultures grown from the glycerol stocks prepared in Example 4b. The modified TrCel6A glycosidase genes were subjected to DNA sequencing to identify mutations that confer altered substrate specificity.
Example 5 Making Site-Saturation Mutagenesis (SSM) Libraries
Site-saturation mutagenesis of residue W367 was performed by megaprimer PCR (two-step PCR reaction) using the mutagenic primer 3′W367X (SEQ ID NO: 51), the YEp352/PGK91-1ΔheI-alphass-TrCel6A-S413P vector as template, and the Platinum® Taq DNA Polymerase High Fidelity (Invitrogen). The first-step PCR was done using the mutagenic primer 3′W367X and the complementary external primer (YalphaN21 or 3′PGK-term, SEQ ID NOS: 52 and 53, respectively). The purified amplicon served as a megaprimer for the second-step PCR and the other complementary external primers were used to amplify the complete mutated gene. The YEp352/PGK91-1ΔheI-alphass-TrCel6A-S413P vector was digested with NheI and KpnI and the empty vector fragment was isolated. This linear fragment and the final amplicon were transformed simultaneously and cloned by in vivo recombination into yeast strain BY4742 (Butler et al. 2003).
(SEQ ID NO: 51)
3′W367X: 5′CAG CAA CAG TGG GGA GAC NNS TGC AAT
GTG ATC GGC ACC
(SEQ ID NO: 52)
YalphaN21: 5′AGC ACA AAT AAC GGG TTA TTG
(SEQ ID NO: 53)
3′PGK-term: 5′GCA ACA CCT GGC AAT TCC TTA CC
The amino acids N182, E399, C400 and A427 of TrCel6A were substituted separately for all amino acids (via SSM) by two-step PCR (Table 3) using the following primers:
(SEQ ID NO: 60)
YalphaN21-2 5′GCC AGC ATT GCT GCT AAA G
(SEQ ID NO: 53)
3′PGK-term 5′GCA ACA CCT GGC AAT TCC TTA CC
(SEQ ID NO: 66)
N182X-F 5′CC CTT GCC TCG NNS GGC GAA TAC TC
(SEQ ID NO: 65)
N182X-R 5′CGA GGC AAG GGC AGC GCA ATC G
(SEQ ID NO: 68)
E399X-F 5′G CCA GGC GGC NNS TGT GAC GGC ACC
(SEQ ID NO: 67)
E399X-R 5′GCC GCC TGG CTT GAC CCA GAC AAA CG
(SEQ ID NO: 70)
C400X-F 5′CA GGC GGC GAG NNS GAC GGC ACC AG
(SEQ ID NO: 69)
C400X-R 5′CTC GCC GCC TGG CTT GAC CCA GAC
(SEQ ID NO: 72)
A427X-F 5′CCG GCG CCT CAA NNS GGT GCT TGG TTC C
(SEQ ID NO: 71
A427X-R 5′GAG GCG CCG GTT GCA AGG CAT CTG GG
TABLE 3
Two-step PCR performed to generate site-saturated mutagenesis for all four positions.
PCR 1 and 2, Step 1 PCR Step 2
Position Primer 1 Primer 2 Size (bp) Primer 1 Primer 2 Size (bp)
N182X-1 YαN21 #2 N182X-R 588 YαN21 #2 3′PGK-Term 1473
N182X-2 N182X-F 3′PGK-Term 896
E399X-1 YαN21 #2 E399X-R 1239 YαN21 #2 3′PGK-Term 1473
E399X-2 E399X-F 3′PGK-Term 244
C400X-1 YαN21 #2 C400X-R 1242 YαN21 #2 3′PGK-Term 1473
C400X-2 C400X-F 3′PGK-Term 242
A427X-1 YαN21 #2 A427X-R 1321 YαN21 #2 3′PGK-Term 1473
A427X-2 A427X-F 3′PGK-Term 162
To perform a gap repair the vector Yep/PGK-alphass-6H-NKE was digested with NheI and KpnI and purified on gel. Saccharomyces cerevisiae strain kre2Δ (MATα his3 Δ1 leu2 Δ0 lys2Δ0 ura3Δ0 Δkre2) was used as the host. The digested YEp/PGK-alphass-6H-NKE vector and the PCR Step 2 amplicons were transformed in the yeast strain kre2 Δ using the procedure described by Gietz, R. D. and Woods, R. A. (2002).
Example 6 Liquid Assays of Modified Glycosidases to Detect Altered Substrate Preference
TrCel6A-S413P variants from yeast supernatant were tested in liquid assays using three different substrates: barley-β-glucan (Medium Viscosity; Megazyme), lichenan and acid swollen cellulose (ASC, produced from Sigmacell50 using the methods described by Tansey, M. R. 1971).
The activity of each enzyme was determined by measuring the release of reducing sugars from the soluble barley-β-glucan or lichenan substrates. Specifically, in a 300 μL PCR plate, 50 μL of yeast supernatant (dilution series) was mixed with 50 μL of pre-heated 1% (w/v) barley-β-glucan or lichenan in 100 mM sodium citrate pH 5.0. Mixtures were incubated for up to 2 h at 50° C. Following the incubation, 80 μL of DNS reagent was added to each well and the plate was boiled for 10 minutes.
DNS reagent contains:
Component g/L
3,5-Dinitosalicylic acid (Acros) 10
Sodium hydroxide (Fisher) 10
Phenol (Sigma) 2
Sodium metabisulfate (Fisher) 0.5
Once the temperature decreased below 40° C., 150 μL of each reaction mixture was transferred to individual wells of a 96-well microplate and OD560 was measured using a Fluostar Galaxy microplate reader. Blank value was measured by treating the supernatant from the strain carrying the empty vector the same way and was subtracted from each value. The data were fit with Equation A by the method of least squares using the Excel solver and by varying the a and b parameters for each enzyme.
y=(a·E)/(b+E) where E represents enzyme concentration   Equation A:
To determine the initial rate of each enzyme, the slope of Equation A was determined as the enzyme concentration approached zero. This was done by substituting E=0 into the first derivative of Equation A. Initial rates for each variant were normalized to wild-type TrCel6A (FIG. 4).
The activity of each enzyme on ASC was tested in a 0.25 mL cellulose hydrolysis assay. TrCel6A variants from yeast supernatant as described in Example 4 were diluted in 50 mM citrate buffer (pH 5.0), complemented with Trichoderma reesei Cel7B and Cel5A (10 mg protein/g cellulose) and A. niger beta-glucosidase (125 IU/g cellulose) and incubated with 0.067% ASC. Incubation was at 50° C. for 19 hr. Microplates were centrifuged for 3 min at 2800×g and an aliquot of supernatant was sampled for glucose. Enzyme activity was measured via the detection of glucose using a standard glucose oxidase/peroxidase coupled reaction assay (Trinder, 1969). The data were fit with Equation A by the method of least squares using the Excel solver and by varying the a and b parameters for each enzyme.
y=(a·E)/(b+E) where E represents enzyme concentration.   Equation A:
To determine the initial rate of each enzyme, the slope of Equation A was determined as the enzyme concentration approached zero. This was done by substituting E=0 into the first derivative of Equation A. Initial rates for each variant were normalized to wild-type TrCel6A (FIG. 4).
FIGS. 4 and 5 show the relative activity of parental modified Family 6 glycosidases on cellulose and two beta-glucan substrates: barley beta-glucan, with a ratio of 3:1 (beta 1-3: beta 1-4) and lichenan, with a ratio of 2:1 (beta 1-3 : beta 1-4). All variants show at least a 1.2-fold increase in activity against one or both of the beta-glucan substrates. Some variants also exhibit more than a 1.2-fold decrease in activity against acid swollen cellulose.
Example 7 Expression of PcCel6A, HiAvi2 and their Variant in Flasks Cultures
Saccharomyces cerevisiae transformants were grown on plates containing synthetic complete medium (SC: 2% agar w/v, 0.17% yeast nitrogen base w/v, 0.192% -Ura drop-out supplement w/v, 2% glucose w/v, 2% casamino acids w/v, 0.5% ammonium sulfate w/v, pH 5.5) for 3 days at 30° C.
A single colony of these streaks was used to inoculate 150 μL of synthetic complete medium in a 96-well microplate containing a small sterile glass bead. Pre-cultures were grown overnight (16-18 hr) at 30° C. and 300 rpm to stationary phase. For expression culture inoculation, 25 μL of pre-culture was used to inoculate 50 mL of SC media. Expression cultures were grown for 3 days at 30° C. and 250 rpm with humidity control. Cultures were centrifuged at 3000 rpm for 5 min and the buffer of the supernatant was changed to 50 mM citrate buffer pH 5.0 using a Sartorius filtration device with a 5000 kDa cut-off membrane. All centrifugations for the buffer exchange were done at 4000 rpm at room temperature. The enzymes were washed twice with 20 mL of 50 mM citrate buffer pH 5.0, concentrated in a final volume of 3 mL (approx. 15 fold concentration) of 50 mM citrate buffer pH 5.0, and stored at −20° C.
The activity of each parental and modified PcCel6A and HiAvi2 glycosidase was measured using barley beta-glucan, lichenan and acid-swollen cellulose as described in Example 6 except that HiAvi2 activity assays were performed at pH 6.5.
Example 8 Expression of Modified TrCel6A Glycosidase in Trichoderma reesei
a. Trichoderma reesei Strains
Apyr4 auxotrophic T. reesei strain (strain BTR213) was used as a host strain for expression of TrCel6A-W367G-S413. BTR213 is a derivative of RutC30 (ATCC #56765; Montenecourt and Eveleigh, 1979) produced by random mutagenesis and first selected for ability to produce larger clearing zones on minimal media agar containing 1% acid swollen cellulose and 4 g L−1 2-deoxyglucose and then selected for the ability to grow on lactose media containing 0.2 μg/ml carbendazim. The pyr4 auxotroph of strain BTR213 was isolated by the ability to grow on 5-FOA (5-fluororotic acid) and inability to grow prototrophically in the absence of uridine.
b. Construction of Transformation Vectors
Two intermediate vectors, pCel6Apst-hph-TV and pCel6ApXt-hph-TV, containing either genomic cel6a or cDNA cel6a gene versions, respectively, were constructed.
For generation of pCel6Apst-hph-TV, the cel6a promoter, secretion signal, coding sequence, and terminator were isolated from pZUK636 (U.S. Pat. No. 6,015,703) as a 5.1 kb SphI/BglII fragment and inserted into the same sites of pUC-NSNB, a derivative of the standard cloning vector pUC119 containing an adaptor comprising Nhe1-Sph1-Not1-Bg1II restriction sites, make pCel6A-Not. In order to increase the size of the 3′ flanking fragment, a 1.7 kb fragment containing part of the cel6a terminator (downstream of the BglII site) and 3′ flanking sequence, was amplified from BTR213 using primers KW008 and KW052 (Table 5) and cloned into pGEM T-easy (Promega). KW008 anneals to the internal BglII site located 1 kb downstream of the stop codon while KW052 introduces a Smal site 2.7 kb downstream of the stop codon. The Cel6A 3′ flanking fragment was amplified as a 1.7 kb fragment using BTR213 genomic DNA as a template, digested with BglII and Smal restriction enzymes and cloned into the same sites of pCel6A-Not to make pCel6Apst-Not. pCel6Apst-Not was linearized with SaclI and blunt-ended with T4 polymerase. The hph selection marker cassette was isolated as a 3.1 kb XhoI/EcoRV fragment from pHPT136, blunt-ended, and cloned into the blunted SacII site to make pCel6Apst-hph-TV.
For generation of pCel6ApXt-hph-TV vector the Cel6A promoter was amplified from pZUK636 using primers KW053 and KW054 (Table 4) and cloned into pGEM T-easy (Promega). KW053 spans the SphI site 2.5 kb upstream from the start codon while KW054 introduces a NcoI site at the start codon. The xyn2 secretion signal was amplified from BTR213 genomic DNA using primers KW055 and KW056 with introduced NcoI and NheI sites, respectively, and cloned into pGEM T-easy. A cel6a gene fragment encoding the mature TrCel6A-S413P parental glycosidase and the cel6a terminator were isolated from previously constructed pc/xC2-S413P-TV (U.S. Publication No. 2008/0076152A1) as an NheI/SphI fragment. A three factor ligation with the Cel6A promoter (SphI/NcoI), the xyn2 secretion signal coding sequence (NcoI/NheI) and the pc/xC2-S413P-TV vector fragment (SphI/NheI) was used to make pCel6ApX-S413P. The 5 kb SphI/BglII fragment containing gene encoding TrCel6A-S413P was isolated from pCel6ApX-S413P and cloned into the same sites of pUC-NSNB to make pCel6ApX-S413P-Not. The size of the 3′ flanking fragment was increased as described above (pCel6Apst-hph-TV vector construction) generating pCel6AptX-S413P vector. The pCel6AptX-S413P vector was linearized with SacII (located in the Cel6A terminator) and blunt-ended with T4 polymerase. The hph selection marker cassette was isolated as a 3.1 kb XhoI/EcoRV fragment from pHPT136, blunt-ended, and cloned into the blunt-ended SacII site to make pCel6ApXt-hph-TV. The 2.2. kb pyr4 selection marker was isolated as a KpnI fragment from pNcBgl (U.S. Pat. No. 6,939,704), blunted and cloned into the blunted SacII site to make pCel6ApXt-S413P-pyr4-TV (FIG. 6A).
TABLE 4
Primers used for PCR amplification during construction of
Trichoderma transformation vectors
Hybridization site/
Primer direction Sequence SEQ ID NO:
KW008 ce16a terminator/Forward CGAGATCTTCGAGGGCGTAAC 73
KW052 ce16a 3′ flank/Reverse GCTCACCCGGGAAGACCACATGGC 74
KW053 ce16a 5′ flank/Forward CCGTATAGTATCGCATGCAATTGC 75
KW054 ce16a secretion signal/Reverse GCCGACAACCATGGTGCAATACACAGAGGGTGA 76
KW055 xyn2 secretion signal/Forward CATCACCATGGTCTCCTTCACCTCCCTCCTCGC 77
KW056 xyn2 secretion signal/Reverse CTTGAGCAGCTAGCCTGGCGCTTCTCCACAGCC 78
The final vector for T. reesei transformation was generated from two previously constructed Cel6A targeting vectors—pCel6Apst-hph-TV and pCel6ApXt-hph-TV. Both vectors were digested with BglII and SalI restriction enzymes. The fragment from pCel6AXt-hph-TV vector containing Cel6A coding sequence, terminator and hph cassette and the fragment from pCel6Apst-hph-TV vector containing cel6a flanks and AmPR gene were purified from agarose gel and ligated into pCel6A413pst-hph-BB vector (FIG. 6B).
The W367G mutation into cel6a gene was introduced by 3 step PCR ligation as described below. Two pairs of primers (Table 5) were used to amplify partial Cel6A coding sequence and C-terminal Cel6A coding sequence with partial cel6a terminator. Both PCR products have short overlapping ends and were used in the 2nd step, ten-cycle PCR reaction as templates and primers to anneal to each over and fill the missing strands at each end. Subsequently, two outside primers, Cel6A-BEII-F1 and Cel6A-Apa-R2, were added and entire fragment was amplified in standard 35 cycle PCR reaction. Amplified PCR product was digested with BstEII and Apal enzymes and ligated into corresponding sites of pCel6A413pst-hph-BB vector generating pCel6A413/367pst-hph-BB vector.
TABLE 5
Primers used for introduction of W367G mutation into
Trichoderma transformation vector.
Hybridization site/
Primer direction Sequence SEQ ID NO:
Ce16a-BEII- ce16a 5′ end at BstEII CCTGGTGACCAACCTCGGTAC 79
F1 site/forward
Ce16a-367- ce16a 3′ end at 367 GTGGGGAGACGGGTGCAATGTG 80
R3 amino acid position/
reverse
Ce16a-367- ce16a 3′ end at 367 CACATTGCACCCGTCTCCCCAC 81
F3 amino acid position/
forward
Ce16a-Apa- ce16a terminator at CCTCTGGGCCCCCAGATAAG 82
R2 ApaI site/reverse

c. Generation of Trichoderma reesei Strains Expressing Modified TrCel6A Glycosidases by Direct Replacement of Wild Type cel6a Gene
To facilitate screening of T. reesei transformants which are targeted to cel6a locus resulting in replacement of wild type cel6a gene with modified Cel6A protein encoding gene we generated host strain with tagged cel6a locus.
The vector pCel6ApXt-S413P-pyr4-TV was transformed into BTR213aux28 T. reesei strain using PEG-mediated protoplast transformation method. About 5×106 spores of BTR213aux28 were plated onto sterile cellophane placed on potato dextrose agar (PDA) (Difco) supplemented with 5 mM uridine and incubated for 20 h at 30° C. Cellophane discs with mycelia were transferred to 10 mL of a protoplast preparation solution containing 7.5 g/L Driselase and 4 g/L beta-glucanase (InterSpex Products Inc., Cat. #0465-1 and 0439-2, respectively) in 50 mM potassium phosphate buffer, pH 6.5 containing 0.6 M ammonium sulfate (Buffer P). The mycelia were digested for 5 h at 28° C. with gentle agitation at 60 rpm. Protoplasts were collected by centrifugation at 1000-1500×g for 10 min at room temperature and washed with 5 mL of Buffer P. The pellet was resuspended in 1 mL of STC buffer (1.2 M sorbitol, 10 mM CaCl2, 10 mM Tris-HCL, pH 7.5), separated from undigested mycelia by filtration through sterile No. 60 MIRACLOTH™ and collected into a sterile microcentrifuge tube. For transformation, 0.1 mL of protoplast suspension (approximately 5×106 protoplasts) was combined with 10 μg of vector DNA, linearized with restriction enzyme BglII, and 25 μl of PEG solution (25% PEG 4000, 50 mM CaCl2, 10 mM Tris-HCl, pH 7.5). Protoplasts with DNA were incubated on ice for 30 min then 1 mL of PEG solution was added and the mixture incubated for 5 min at room temperature. Transformation mix was diluted with 2 mL of 1.2 M sorbitol in PEG solution and 4 aliquots of 0.75 mL of the mix were added into 25 mL of molten MMSS agar media (see below) cooled to about 47-50° C. and the protoplast suspensions were poured over MM agar (see below). Plates were incubated at 30° C. until colony growth is visible. Transformants were transferred to individual plates containing MM agar and allowed to sporulate. Spores are collected and plated at high dilution on MM agar to isolate homokaryon transformants, which are then plated onto PDA and incubated at 30° C. for sporulation and subsequent genetic analysis.
Minimal medium (MM*) agar contains:
Amount for
Component 1 L of medium
KH2PO4 10 g
(NH4)2SO4 6 g
Na3Citrate-2H2O 3 g
FeSO4—7H2O 5 mg
MnSO4—H2O 1.6 mg
ZnSO4—7H2O 1.4 mg
CaCl2—2H2O 2 mg
Agar 20 g
20% Glucose f.s. 50 mL
1 M MgSO4—7H2O f.s. 4 mL
pH to 5.5
*MMSS agar contains the same components as MM agar plus 1.2 M sorbitol, 4 mM MgSO4, 1 g/L YNB (Yeast Nitrogen Base w/o Amino Acids from DIFCO Cat. No. 291940) and 0.12 g/L amino acids (-Ura DO Supplement from CLONTECH Cat. No. 8601-1).
Three stable T. reesei transformants were isolated and integration site of Cel6A targeting cassette was characterized by Southern hybridization analysis. For genomic DNA extraction mitotically stable transformants, P577A, P577B and P577C, and the parental strains, BTR213 and BTR213aux28, were sporulated on PDA. Spores were inoculated in 100 mL of minimal media (MM) media and incubated at 30° C. and 150 rpm for 5 days. Biomass was filtered using GF/A filter, transferred to aluminum foil and frozen immediately at −80° C. for 24 hrs. Frozen biomass was grinded to a fine powder using liquid nitrogen and resuspended in 3 mL of extraction buffer (100 mM Tris pH 8.0, 50 mM EDTA pH 7.5, 1% SDS). Homogenate was transferred to a sterile 15 mL falcon tube and pelleted by cetrifugation at 4000 rpm for 5 min. Supernatant was transferred to a sterile 15 mL falcon tube, equal volume of saturated phenol (pH 6.6) was added and vortexed for 1 min. Aqueous phase containing DNA was separated by centrifugation for 5 min at 4000 rpm and transferred to fresh 15 mL falcon tube. Genomic DNA was further purified by adding an equal volume of phenol:chloroform:isoamyl alcohol (25:24: 1), mixing and separating aqueous phase by centrifugation for 5 min at 4000 rpm. This purification step was repeated until no interphase was visible. Phenol was removed by extracting with an equal volume of chloroform, mixing and separating aqueous phase by centrifugation. Genomic DNA was precipitated overnight at −20° C. using 0.1× volume of 3M NaOAc pH 5.2 and 2.5× volume of 100% EtOH, then pelleted by centrifugation at 4000 rpm for 10-15 min. The pellet was washed once with 1 volume of 70% EtOH and once with 95% EtOH. After the pellet was air dried, the DNA was resuspended in 1 mL of TE buffer (Tris-HCl 10 mM; EDTA 1 mM; pH 8). To remove RNA, 5 μL of RNase A (10 mg/mL) was added and incubated at 37° C. for 1 hour. RNase then was extracted with 1 volume of saturated phenol (pH 6.6) followed by 1 volume of phenol:chloroform:isoamyl alcohol (25:24: 1) and 1 volume of chloroform. DNA was precipitated from separated aqueous phase with 0.1 volume of 3M NaOAc pH 5.2 and 2.5 volume of 100% EtOH, incubated at -20° C. for 30 min, pelleted by centrifugation at 12000 rpm for 15 min and washed once with 1 volume of 70% EtOH and once with 95% EtOH. Finally, the DNA was resuspended in 0.2 mL of TE buffer and used for Southern hybridization as described below.
Southern blot using DIG labeling and detection system was performed as described in the Roche Applied Science manual. The restriction pattern at the wild type cel6a locus expected after digestion of genomic DNA from BTR213 and BTR213aux28 was predicted using cel6a sequence from JGI database URL: genomejgi-psf.org/Trire2/Trire2/home.html) and expected to be detectable as 4.2 kb band specifically hybridizing with cel6a probe (FIG. 7). In the event of ectopic vector integration resulting in presence of two copies of cel6a gene in the genome, two specific bands would be observed. The targeting of Cel6A vectors into cel6a locus in transformants P577A, P577B, and P577C would result in a 6.4 kb fragment, as seen after EcoRI digestion of transformation vector (FIG. 7) due to the presence of tye pyr4 selection cassette. As demonstrated in FIG. 7, the Southern blot confirmed the integration of Cel6A-marker cassettes into the native cel6a locus and replacement of native Cel6A coding sequence with coding sequence from the transformation vector.
d. Generation of Trichoderma reesei Transformants Expressing Tr Cel6A-W367G-S413P
The vector pCel6A413/367pst-hph-BB was transformed into generated new T. reesei host strain, P577C, using PEG-mediated protoplast transformation as described above (Example 8c). The selection of transformants was performed using hygromycin resistance as a selectable marker. Aliquots (0.75 mL) of transformed protoplasts were added into 25 mL of PDA media cooled to about 47-50° C. and the protoplast suspensions were poured into 200 mm Petri dishes. After the PDA media containing transformed protoplasts solidified, another 25 mL of PDA media supplemented with 80U/mL of hygromycin B was added as a top agar. Plates were incubated at 30° C., until colony growth was visible. Transformants were transferred twice to individual plates containing PDA media supplemented with 40 U/mL of hygromycin B (PDAH) and allowed to sporulate. Spores were collected and plated at high dilution on PDAH to isolate homokaryon transformants, which were then plated onto PDA and incubated at 30° C. for sporulation and subsequent analysis.
Transformants possessing targeted vector integration into cel6a locus were identified by their ability to grow in the presence of hygromycin and inability to grow on minimal media lacking uridine supplement. This indicated that the pyr4 selectable marker cassette present in P577C host strain was replaced with modified Cel6A expression and hph selectable marker cassettes.
Example 9 Production of Modified Glycosidase from Trichoderma reesei
a. Production of TrCel6A-W367G-S413P in T. reesei Microcultures
To confirm expression of TrCel6A-W367G-S413P protein, all strains possessing targeted replacement of wild type cel6a gene with TrCel6A-W367G-S413P coding gene were grown in microcultures for Cel6A protein analysis.
T. reesei transformants and the parental strain BTR213aux28 were cultured on PDA plates supplemented with 5mM of uridine for 6-7 days at 30° C. The spore suspensions were prepared by washing spores from the agar plate with sterile water. The composition of microculture media containing glucose with cellulase inducing carbohydrates as a carbon source is indicated below.
Trichoderma microculture media
Component Concentration g/L
Glucose with cellulase inducing 35
carbohydratesa
Ammonium sulphate 12.7
KH2PO4 8.0
MgSO4—7H2O 4.0
CaCl2—2H2O 1.0
FeSO4—7H2O 0.1
MnSO4—7H2O 0.032
ZnSO47H2O 0.028
CaCO 3 20
Corn Steep Liquor (powder) 5
pH4.24
aA cellulase-inducing cocktail comprising, as a function of total carbohydrate, 56% gentiobiose, 14% sophorose, 6% cellobiose, 10% trehalose, 6% maltotriose, 4% glucose and 14% other carbohydrates
About 5000 T. reesei spores were inoculated in each well of 24-well culture dish (COSTAR) containing 1 mL of media. Plates were incubated for 5-7 days at 30° C. with shaking at 250 rpm.
The relative concentration of the TrCel6A-W367G-S413P produced by transformants was determined by ELISA (Example 4). The relative concentration of TrCel6A-W367G-S413P protein was calculated by dividing TrCel6A-W367G-S413P concentration by the total amount of protein produced, as determined using a Bradford protein assay. The expression levels of Cel6A are presented in FIG. 8.
b. Analysis of T. reesei Transformants in 14L Pilot Fermentations
Two T. reesei transformants with the highest Cel6A expression levels, strains P989B and P989B, were selected for 14L fed-batch pilot fermentation and enzyme analysis. Trichoderma spores were inoculated onto standard 85 mm Petri plates containing potato dextrose agar (PDA). These plates were incubated at 28° C. for 3-5 days to achieve a confluent growth of fresh green spores. To prepare the inoculum for fermentation, spores from a single PDA plate were transferred to 2 L, baffled Erlenmeyer flasks containing 750 mL of liquid Berkley media (pH 5.5) supplemented with 10 mM of uridine. Flasks were incubated at 28° C. for 3 days using an orbital agitator (Model G-52 New Brunswick Scientific Co.) running at 100 rpm.
Berkley Media for Flasks
Component Concentration, g/L
(NH4)2SO4 1.4
KH2PO4 2.0
MgSO4•7H2O 0.31
CaCl2•2H2O 0.53
Dry Corn Steep Liquor 5.1
Glucose 10
Trace elements* 1 mL/L
*Trace elements solution contains 5 g/L FeSO4•7H 20; 1.6 g/L MnSO4•H 20; 1.4 g/L ZnSO4•7H 20.
The contents of an inoculum flask were transferred to a 14L pilot scale fermentation vessel (Model MF114 New Brunswick Scientific Co.) set up with 10 L of Initial Media for Feb-Batch fermentation (pH 5.5) supplemented with 10 mM of uridine. The vessel was run in batch mode until glucose in the media was depleted. At this point, the carbon source containing cellulase inducing carbohydrates (56% gentiobiose, 14% sophorose, 6% cellobiose, 10% trehalose, 6% maltotriose, 4% glucose and 14% other carbohydrates) was added, on a continuous basis, from a stock that was 35.5% w/v of solids dissolved in water. Peristaltic pumps were used to deliver the carbon source at a feed rate of 0.4 grams of carbon per liter culture per hour. Operational parameters during both the batch and fed-batch portions of the run were: mixing by impeller agitation at 500 rpm, air sparging at 8 standard liters per minute, and a temperature of 28° C. Culture pH was maintained at 4.0-4.5 during batch growth and pH 3.5 during cellulase production using an automated controller connected to an online pH probe and a pump enabling the addition of a 10% ammonium hydroxide solution. Periodically, 100 mL samples of broth were drawn for biomass and protein analysis. After 96 hours of fermentation time 1L of fermentation media was collected and filtered for further protein analysis.
Initial Media for Fed-Batch Fermentations
Component Concentration, g/L
(NH4)2SO4 2.20
KH2PO4 1.39
MgSO4•7H2O 0.70
CaCl2•2H2O 0.185
Dry Corn Steep Liquor 6.00
Glucose 13.00
Trace elements* 0.38 mL/L
*Trace elements solution contains 5 g/L FeSO4•7H 20; 1.6 g/L MnSO4•H 20; 1.4 g/L ZnSO4•7H 20.
Example 10 Hydrolysis of Beta-Glucan by T. reesei Enzyme Mixtures Comprising Parental and Modified TrCel6A Glycosidases.
Testing was performed on a Legacy Barley varietal from northern Saskatchewan. Solids 89.6%, ˜60% starch, 10-14% NSP (non-starch polysaccharides).
Grain samples were ground to pass a 20 mesh screen using a Wiley Mill. Total carbohydrates were determined through acid hydrolysis and ion chromatography on a DX-500 system with PA1 column and amperometric detection. Total carbohydrates minus total starch was used to determine quantity of non-starch polysaccharides in the substrate in order to determine starting enzyme dose. Solids determination was used to correct for sample dry weights in all experiments.
Viscosity reduction by parental and modified Family 6 glycosidases was deteremined using a Perten SuperRVA4 can and paddle assembly, fixed retention time of 15 min, a 30 mL sample size at 35% solids, 50 mM citrate buffer, pH 4.5, and a temperature of 52° C. An initial sec mix at 900 rpm was followed by data collection at 4 sec intervals at 160 rpm. Data were collected in centepoise units (cP)
Samples were treated with dilute enzyme solutions of 1 mL based on a weight of protein per metric tonne of substrate. Viscosity reduction was calculated as a change from control over the last 1 minute of data collection. The results are presented in Tables 6 and 7.
A much greater reduction in viscosity of the barley beta-glucan substrate is achieved by the modified Family 6 glycosidase TrCel6A-W367G-S413P effects than by the wild type Family 6 glycosidase TrCel6A both when the Family 6 glycosidase is acting alone (Table 6) or in combination with other cellulases and hemicellulases (Table 7).
TABLE 6
Reduction of Barley beta-glucan viscosity by wild-type and
modified Family 6 glycosidases
Glycosidase Dose (mg Viscosity relative to
Sample protein/30 mL assay) Untreated Samplea
Untreated 0 1.0
TrCel6A-W367G-S413 0.076 0.45
TrCel6A (wild-type) 0.076 0.70
TABLE 7
Reduction of Barley beta-glucan viscosity by cellulase-hemicellulase
mixtures comprising wild-type and modified Family 6 glycosidases
Ultimase XTP Glycosidase Dose
Dosage (mg (mg protein/30 mL Viscosity relative to
Sample protein/sample) assay) Untreated Sample
Untreated 0 0 1.0
Ultimase XTP 0.069 0 0.175
Ultimase XTPa + TrCel6A- 0.069 0.036 0.14
W367G-S413P 0.069 0.078 0.147
Ultimase XTPa + TrCel6A 0.069 0.036 0.17
(wild-type) 0.069 0.078 0.17
aUltimase XTP is a commercial Trichoderma reesei whole cellulase with an enriched thermostable xylanase II component.
REFERENCES
  • Altschul et al. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-10
  • Butler, T. and Alcalde, M. (2003) In Methods in Molecular Biology, vol. 231: (F. H. Arnold and G. Georgiou, editors), Humana Press Inc. Totowa (N.J.), pages 17-22.
  • Coutinho, P. M. & Henrissat, B. (1999) “Carbohydrate-active enzymes: an integrated database approach.” In Recent Advances in Carbohydrate Bioengineering. H. J. Gilbert, G. Davies, B. Henrissat and B. Svensson eds., The Royal Society of Chemistry, Cambridge, pp. 3-12.
  • Davies, et al. (2000) “Structure and function of Humicola insolens family 6 cellulases: structure of the endoglucanase, Cel6B, at 1.6 A resolution”. Biochem. J. 348:201-207
  • Eijsink. V. G., et al. (2005) “Directed evolution of enzyme stability.” Biomol. Eng. 22:21-30
  • Enari, T.-M., Knowles, J. K. C., Lehtinen, U., Nikkola, M., Penttila, M., Suihko, M.-L., Home, S., and A. Vilpola. (1987) “Glucanolytic brewer's yeast.” Proc. 2st Congr. Eur. Brew. Conv. Madrid IRL Press, Oxford, pp. 529-536.
  • Gietz, R. D. and Woods, R. A. (2002) Transformation of yeast by the Liac/ss carrier DNA/PEG method. In Methods in Enzymology, 350:87-96.
  • Henriksson, K., Teleman, A., Suortti, T., Reinikainen, T., Jaskari, J., Teleman, O., and K. Poutanen. (1995) “Hydrolysis of barley (1→3), (1→4)-β-D-glucan by a cellobiohydrolase II preparation from Trichoderma reesei.” Carbohydrate Polymers 26, 109-119.
  • Koivula, A., Ruohonen, L., Wohlfahrt, G., Reinikainen, T., Teeri, T. T., Piens, K., Claeyssens, M., Weber, M., Vasella, A., Becker, D., Sinnott, M. L., Zou, J. Y., Kleywegt, G. J., Szardenings, M., Stahlberg, J., and T. A. Jones. (2002) “The active site of cellobiohydrolase Cel6A from Trichoderma reesei: the roles of aspartic acids D221 and D175.” J Am Chem Soc. 124, 10015-24.
  • Koivula, A., Kinnari, T., Harjunpaa, V., Ruohonen, L., Teleman, A., Drakenberg, T., Rouvinen, J., Jones, T. A., and T. T. Teeri. (1999) “Tryptophan 272: an essential determinant of crystalline cellulose degradation by Trichoderma reesei cellobiohydrolase Cel6A.” FEBS Lett. 429, 341-6.
  • Koivula, A., Reinikainen, T., Ruohonen, L., Valkeajarvi, A., Claeyssens, M., Teleman, O., Kleywegt, G. J., Szardenings, M., Rouvinen, J., Jones, T. A., and T. T. Teeri. (1996) “The active site of Trichoderma reesei cellobiohydrolase II: the role of tyrosine 169.” Protein Eng. 9, 691-9.
  • Meinke, A., Damude, H. G., Tomme, P., Kwan, E., Kilburn, D. G., Miller, R.C. Jr., Warren, R. A., and N. R. Gilkes. (1995) “Enhancement of the endo-beta-1,4-glucanase activity of an exocellobiohydrolase by deletion of a surface loop.” J Biol Chem. 270, 4383-6.
  • Rouvinen, J. et al. (1990) “Three-dimensional structure of cellobiohydrolase II from I.” Science 249:380-386. Erratum in: Science 1990 249:1359
  • Spezio, M. et al. (1993) “Crystal structure of the catalytic domain of a thermophilic endocellulase”. Biochemistry 32:9906-9916
  • Tao, H. and Cornish, V. W (2002) “Milestones in Directed Enzyme Evolution.” Curr Opin Chem Biol 6: 858-864.
  • Tansey, M. R. (1971) Agar-Diffusion Assay of Cellulolytic Ability of Thermophilic Fungi. Arch. Mikrobiol, 77:1-11.
  • Trinder, P. (1969) Determination of glucose in blood using glucose oxidase with an alternative oxygen accepter. Annals of Clinical Biochemistry, 6:24-27.
  • Varrot, A., et al. (1999) “Crystal structure of the catalytic core domain of the family 6 cellobiohydrolase II, Cel6A, from Humicola insolens, at 1.92 A resolution”. Biochem J. Varrot, A., Frandsen, T.P., Driguez, H., and G. J. Davies. (2002) “Structure of the Humicola insolens cellobiohydrolase Cel6A D416A mutant in complex with a non-hydrolysable substrate analogue, methyl cellobiosyl-4-thio-beta-cellobioside, at 1.9 A.” Acta C ystallogr D Biol C ystallogr. 58, 2201-4.
  • Varrot, A. et al. (2005) “Mycobacterium tuberculosis strains possess functional cellulases”. J. Biol. Chem. 280:20181-20184
  • Wohlfahrt, G., Pellikka, T., Boer, H., Teeri, T. T., and A. Koivula. (2003) “Probing pH-dependent functional elements in proteins: modification of carboxylic acid pairs in Trichoderma reesei cellobiohydrolase Cel6A.” Biochemistry. 42, 10095-103.
  • Zhang, S., Irwin, D. C., and D. B. Wilson. (2000a) “Site-directed mutation of noncatalytic residues of Thermobifidia fusca exocellulase Cel6B.” Eur J Biochem. 267, 3101-15.
  • Zhang, S., Barr, B. K., and D. B. Wilson. (2000b) “Effects of noncatalytic residue mutations on substrate specificity and ligand binding of Thermobifida fusca endocellulase cel6A.” Eur J Biochem. 267, 244-52.
  • Zou, J., Kleywegt, G. J., Stahlberg, J., Driguez, H., Nerinckx, W., Claeyssens, M., Koivula, A., Teeri, T. T., and T. A. Jones. (1999) “Crystallographic evidence for substrate ring distortion and protein conformational changes during catalysis in cellobiohydrolase Cel6A from Trichoderma reesei.” Structure

Claims (18)

1. A modified Family 6 glycosidase comprising an amino acid substitution at position 367 selected from the group consisting of W367G, W367A, W367C, W367N, W367R, W367S, W367T, and W367V, said position determined from alignment of a parental Family 6 glycosidase amino acid sequence with a Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1, wherein amino acids 83-447 (TrCel6A numbering) of said modified Family 6 glycosidase are from about 90% to about 99.9% identical to amino acids 83-447 of SEQ ID NO: 1 and wherein said modified Family 6 glycosidase exhibits at least a 1.2-fold increase in hydrolysis activity of beta 1-3, 1-4 -linked polysaccharides and at least a three-fold decrease in hydrolysis activity of beta 1-4 linked polysaccharides, compared with said parental Family 6 glycosidase from which said modified Family 6 glycosidase is derived.
2. A modified Family 6 glycosidase comprising amino acid substitution selected W367G, said position determined from alignment of a parental Family 6 glycosidase amino acid sequence with a Trichoderma reesei Cel6A amino acid sequence as defined in SEQ ID NO: 1, wherein amino acids 83-447 (TrCel6A numbering) of said modified Family 6 glycosidase are from about 90% to about 99.9% identical to amino acids 83-447 (TrCel6A numbering) of SEQ ID NO: 1, and wherein said isolated Family 6 glycosidase exhibits at least a 1.2-fold increase in hydrolysis activity of beta 1-3, 1-4 -linked polysaccharides and at least a three-fold decrease in hydrolysis activity of beta 1-4 linked polysaccharides, compared with said parental Family 6 glycosidase from which said modified Family 6 glycosidase is derived.
3. The isolated Family 6 glycosidase of claim 1, wherein said modified Family 6 glycosidase exhibits at least a 1.2-fold decrease in hydrolysis activity of beta 1-4-linked polysaccharides compared with the hydrolysis activity of a parental Family 6 glycosidase from which said modified Family 6 glycosidase is derived.
4. The isolated Family 6 glycosidase of claim 2, wherein said modified Family 6 glycosidase exhibits at least a 1.2-fold decrease in hydrolysis activity of beta 1-4-linked polysaccharides compared with the hydrolysis activity of a parental Family 6 glycosidase from which said modified Family 6 glycosidase is derived.
5. The isolated Family 6 glycosidase of claim 2, wherein amino acids 83-447 (TrCel6A numbering) of said isolated Family 6 glycosidase are from about 95% to about 99.9% identical to amino acids 83-447 (TrCle6A numbering) of SEQ ID NO: 1.
6. The isolated Family 6 glycosidase of claim 1, further comprising at least one amino acid substitution selected from the group consisting of N182S, N182R, N182G, N182A, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
7. The isolated Family 6 glycosidase of claim 2, further comprising at least one amino acid substitutions selected from the group consisting of N182S, N182R, N182G, N182A, E399H, E399S, E399T, C400V, C400M, C400T, C400S, A427V, A427L, and A427S.
8. A process for producing a Family 6 glycosidase comprising the steps of growing an isolated genetically modified microbe harboring a genetic construct comprising a nucleic acid sequence encoding the Family 6 glycosidase according to claim 1, in a culture medium under conditions that induce the expression and secretion of the Family 6 glycosidase and recovering the Family 6 glycosidase from the culture medium.
9. A process for producing a Family 6 glycosidase, comprising the steps of growing an isolated genetically modified microbe harboring a genetic construct comprising a nucleic acid sequence encoding the Family 6 glycosidase according to claim 2, in a culture medium under conditions that induce the expression and secretion of the modified Family 6 glycosidase and recovering the Family 6 glycosidase from the culture medium.
10. A process for hydrolyzing a beta-1,3-1,4-linked polysaccharide substrate comprising contacting said substrate with the isolated Family 6 glycosidase of claim 1.
11. A process for hydrolyzing a beta- 1,3-1,4-linked polysaccharide substrate comprising contacting said substrate with the isolated Family 6 glycosidase of claim 2.
12. The process of claim 10, wherein said beta-1,3-1,4-linked polysaccharide substrate is a constituent of a cereal grain.
13. The process of claim 11, wherein said beta-1,3-1,4-linked polysaccharide substrate is a constituent of a cereal grain.
14. The process of claim 12, wherein said process is part of an industrial process to produce alcohol, animal feed or food products.
15. The process of claim 13, wherein said process is part of an industrial process to produce alcohol, animal feed or food products.
16. A process for producing a Family 6 glycosidase comprising the steps of; (i) transforming fungal host cells with a genetic construct encoding the isolated Family 6 glycosidase of claim 1 to produce recombinant fungal strains; (ii) selecting the recombinant fungal strains expressing the Family 6 glycosidase; and (iii) culturing selected recombinant strains by submerged liquid fermentations under conditions that induce expression of the Family 6 glycosidase.
17. A process for producing a Family 6 glycosidase, comprising the steps of; (i) transforming fungal host cells with a genetic construct encoding the isolated Family 6 glycosidase of claim 6 to produce recombinant fungal strains; (ii) selecting the recombinant fungal strains expressing the Family 6 glycosidase; and (iii) culturing selected recombinant strains by submerged liquid fermentations under conditions that induce expression of the modified Family 6 glycosidase.
18. A isolated Family 6 glycosidase comprising amino acid sequence TrCel6A-W367G-S413P (SEQ ID NO: 39).
US12/504,070 2008-07-16 2009-07-16 Modified family 6 glycosidases with altered substrate specificity Expired - Fee Related US8263379B2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/504,070 US8263379B2 (en) 2008-07-16 2009-07-16 Modified family 6 glycosidases with altered substrate specificity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8107908P 2008-07-16 2008-07-16
US12/504,070 US8263379B2 (en) 2008-07-16 2009-07-16 Modified family 6 glycosidases with altered substrate specificity

Publications (2)

Publication Number Publication Date
US20100016570A1 US20100016570A1 (en) 2010-01-21
US8263379B2 true US8263379B2 (en) 2012-09-11

Family

ID=41530876

Family Applications (1)

Application Number Title Priority Date Filing Date
US12/504,070 Expired - Fee Related US8263379B2 (en) 2008-07-16 2009-07-16 Modified family 6 glycosidases with altered substrate specificity

Country Status (7)

Country Link
US (1) US8263379B2 (en)
EP (1) EP2313500A4 (en)
AU (1) AU2009270398A1 (en)
BR (1) BRPI0916767A2 (en)
CA (1) CA2730662A1 (en)
MX (1) MX2011000552A (en)
WO (1) WO2010006446A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100255542A1 (en) * 2009-04-06 2010-10-07 California Institute Of Technology Polypeptides having cellulase activity
US8778641B1 (en) * 2013-02-12 2014-07-15 Novozymes Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US8778640B1 (en) * 2013-02-12 2014-07-15 Novozymes Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US9695407B2 (en) 2008-06-06 2017-07-04 Danisco Us Inc Compositions and methods comprising cellulase variants with reduced affinity to non-cellulosic materials

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9133448B2 (en) 2010-02-11 2015-09-15 Dsm Ip Assets B.V. Polypeptide having cellobiohydrolase activity and uses thereof
EP2690590A1 (en) 2012-07-26 2014-01-29 Welcome Real Time Anonymous loyalty program consent

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2477175A1 (en) 2002-02-25 2003-08-28 Oji Paper Co., Ltd. Cellulolytic enzyme gene and use thereof
WO2004056981A2 (en) 2002-12-20 2004-07-08 Novozymes A/S Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
WO2008025164A1 (en) 2006-08-31 2008-03-06 Iogen Energy Corporation Family 6 cellulases with increased thermostability, thermophilicity, and alkalophilicity
WO2008095033A2 (en) 2007-01-30 2008-08-07 Verenium Corporation Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
US20090186381A1 (en) 2008-01-18 2009-07-23 Iogen Energy Corporation Cellulase variants with reduced inhibition by glucose

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120062643A (en) * 2009-06-03 2012-06-14 다니스코 유에스 인크. Cellulase variants with improved expression, activity and/or stability, and use thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2477175A1 (en) 2002-02-25 2003-08-28 Oji Paper Co., Ltd. Cellulolytic enzyme gene and use thereof
WO2004056981A2 (en) 2002-12-20 2004-07-08 Novozymes A/S Polypeptides having cellobiohydrolase ii activity and polynucleotides encoding same
WO2008025164A1 (en) 2006-08-31 2008-03-06 Iogen Energy Corporation Family 6 cellulases with increased thermostability, thermophilicity, and alkalophilicity
WO2008095033A2 (en) 2007-01-30 2008-08-07 Verenium Corporation Enzymes for the treatment of lignocellulosics, nucleic acids encoding them and methods for making and using them
US20090186381A1 (en) 2008-01-18 2009-07-23 Iogen Energy Corporation Cellulase variants with reduced inhibition by glucose

Non-Patent Citations (41)

* Cited by examiner, † Cited by third party
Title
Andrews et al., "Substrate Specificity in Glycoside Hydrolase Family 10", J. Biolog. Chem., vol. 275, No. 30 (2000) 23027-33.
Bauer et al., "beta-1,4-glucan-cellobiohydrolase [Emericella nidulans]", GenBank Acc. No. ABF50873 (2006).
Bauer et al., "β-1,4-glucan-cellobiohydrolase [Emericella nidulans]", GenBank Acc. No. ABF50873 (2006).
Birren et al., "hypothetical protein SNOG-06409 [Phaeosphaeria nodorum SN15]", GenBank Acc. No. EAT86240 (2006).
Birren et al., "hypothetical protein SNOG—06409 [Phaeosphaeria nodorum SN15]", GenBank Acc. No. EAT86240 (2006).
Birren et al., "hypothetical protein SS1G-00892 [Sclerotinia sclerotiorum 1980]", GenBank Acc. No. EDN91489 (2007).
Birren et al., "hypothetical protein SS1G—00892 [Sclerotinia sclerotiorum 1980]", GenBank Acc. No. EDN91489 (2007).
Broun et al., Catalytic plasticity of fatty acid modification enzymes underlying chemical diversity of plant lipids. Science, 1998, vol. 282: 1315-1317. *
Chica et al., Semi-rational approaches to engineering enzyme activity: combining the benefits of directed evolution and rational design. Curr. Opi. Biotechnol., 2005, vol. 16: 378-384. *
Coutinho et al., "Carbohydrate-active Enzymes: an Integrated Database Approach", Recent Advances in Carbohydrate Bioengineering-The Royal Society of Chemistry (1999) 3-12.
Coutinho et al., "Carbohydrate-active Enzymes: an Integrated Database Approach", Recent Advances in Carbohydrate Bioengineering—The Royal Society of Chemistry (1999) 3-12.
Davies, et al., "Structure and function of Humicola insolens family 6 cellulases: structure of the endoglucanase, Cel6B, at 1.6 Å Resolution", Biochem. J., vol. 348 (2000) 201-7.
Devos et al., Practical limits of function prediction. Proteins: Structure, Function, and Genetics. 2000, vol. 41: 98-107. *
Enari, et al. "Glucanolytic brewer's yeast", Proc. 21st. Congr. Euro. Brew. Conv.(1987) 529-36.
Erratum (re Rouvinen et al., "Res. Art. Three-dimensional structure of cellobiohydrolase II from Trichoderma ressei") in: Science vol. 249 (1990) 1359.
Guo et al., Protein tolerance to random amino acid change. PNAS., 2004, vol. 101 (25): 9205-9210. *
Henricksson, et al, "Hydrolysis of barley (1->3), (1->4)-beta-D-glucan by a cellobiohydrolase II preparation from Trichoderma reesei", Carbohydrate Polymers, vol. 26 (1995) 109-19.
Henricksson, et al, "Hydrolysis of barley (1→3), (1→4)-β-D-glucan by a cellobiohydrolase II preparation from Trichoderma reesei", Carbohydrate Polymers, vol. 26 (1995) 109-19.
Kimchi-Sarfaty et al., A "Silent" polymorphism in the MDR1 gene changes substrate specificty. Science, 2007, vol. 315: 525-528. *
Koivula et al., "The Active Site of Cellobiohydrolase Cel6A from Trichoderma reesei: The Roles of Aspartic Acids D221 and D175", J. Am. Chem. Soc., vol. 124 (2002) 10015-24.
Koivula et al., "The active site of Trichoderma reesei cellobiohydrolase II: the role of tyrosine 169", Protein Eng., vol. 9, No. 8 (1996) 691-99.
Koivula et al., "Tryptophan 272: an essential determinant of crystalline cellulose degradation by Trichoderma reesei cellobiohydrolase Cel6A", FEBS Lett., vol. 429 (1998) 341-46.
Meinke et al., "Enhancement of the Endo-beta-1,4-glucanase Activity of an Exocellobiohydrolase by Deletion of a Surface Loop", J. Biol. Chem., vol. 270, No. 9 (1995) 4383-86.
Meinke et al., "Enhancement of the Endo-β-1,4-glucanase Activity of an Exocellobiohydrolase by Deletion of a Surface Loop", J. Biol. Chem., vol. 270, No. 9 (1995) 4383-86.
Nackley et al., Human Caechol-O-Methytransferase haplotypes modulate protein expression by altering mRNA secondary structure. Science, 2006, vol. 314: 1930-1933. *
Rouvinen et al., "Three-Dimensional Structure of Cellobiohydrolyase II from Trichoderma reesei", Science, vol. 249 (1990) 380-86.
Sauna et al., Silent polymorhisms speak: How they affect pharmacogenomics and the treatment of cancer. Cancer Res., 2007, vol. 67(20): 9609-9612. *
Seffernick et al., Melamine deaminase and Atrazine chlorohydrolase: 98 percent identical but functionally different. J. Bacteriol., 2001, vol. 183 (8): 2405-2410. *
Sen et al., Developments in directed evolution for improving enzyme functions. Appl. Biochem. Biotechnol., 2007, vol. 143: 212-223. *
Spezio et al., "Crystal Structure of the Catalytic Domain of a Thermophilic Endocellulase", Biochem., vol. 32, No. 38 (1993) 9906-16.
Tao et al., "Milestones in directed enzyme evolution", Curr. Opin. Chem. Biol., vol. 6 (2002) 858-64.
Varrot et al., "Crystal structure of the catalytic core domain of the family 6 cellobiohydrolase II, Cel6A, from Humicola insolens, at 1.92 Å resolution", Biochem. J., vol. 337 (1999) 297-304.
Varrot et al., "Mycobacterium tuberculosis Strains Posses Functional Cellulases", J. Biol. Chem., vol. 280, No. 21 (2005) 20181-184.
Varrot et al., "Structure of the Humicola insolens cellobiohydrolase Cel6A D416A mutant in complex with a non-hydrolysable substrate analogue, methyl cellobiosyl-4-thio-beta-cellobioside, at 1/9 Å", Acta. Crystallogr., vol. 58 (2002) 2201-04.
Varrot et al., "Structure of the Humicola insolens cellobiohydrolase Cel6A D416A mutant in complex with a non-hydrolysable substrate analogue, methyl cellobiosyl-4-thio-β-cellobioside, at 1/9 Å", Acta. Crystallogr., vol. 58 (2002) 2201-04.
Whisstock et al., Prediction of protein function from protein sequence. Q. Rev. Biophysics., 2003, vol. 36 (3): 307-340. *
Witkowski et al., Conversion of b-ketoacyl synthase to a Malonyl Decarboxylase by replacement of the active cysteine with glutamine. Biochemistry, 1999, vol. 38: 11643-11650. *
Wohlfahrt et al, "Probing pH-Dependent Functional Elements in Proteins: Modification of Carboxylic Acid Pairs in Trichoderma reesei Cellobiohydrolase Cel6A", Biochem., vol. 42, No. 34 (2003) 10095-103.
Zhang et al., "Effects of noncatalytic residue mutations on substrate specificity and ligand binding of Thermobifida fusca endocellulase Cel6A" Euro. Journ. of Biochem., vol. 267 (2000) 244-52.
Zhang, {dot over (S)}. et al., "Site-directed mutation of noncatalytic residues of Thermobifida fusca exocellulase Cel6B", Euro. Journ. Of Biochem., vol. 267 (2000) 3101-15.
Zou et al., "Crystallographic evidence for substrate ring distortion and protein conformational changes during catalysis in cellobiohydrolase Cel6A from Trichoderma reesei", Structure, vol. 7, No. 9 (1999) 1035-45.

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9695407B2 (en) 2008-06-06 2017-07-04 Danisco Us Inc Compositions and methods comprising cellulase variants with reduced affinity to non-cellulosic materials
US20100255542A1 (en) * 2009-04-06 2010-10-07 California Institute Of Technology Polypeptides having cellulase activity
US9249401B2 (en) * 2009-04-06 2016-02-02 California Institute Of Technology Polypeptides having cellulase activity
US8778641B1 (en) * 2013-02-12 2014-07-15 Novozymes Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US8778640B1 (en) * 2013-02-12 2014-07-15 Novozymes Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

Also Published As

Publication number Publication date
WO2010006446A1 (en) 2010-01-21
CA2730662A1 (en) 2010-01-21
BRPI0916767A2 (en) 2018-10-16
US20100016570A1 (en) 2010-01-21
MX2011000552A (en) 2011-04-28
EP2313500A1 (en) 2011-04-27
EP2313500A4 (en) 2013-02-13
AU2009270398A1 (en) 2010-01-21

Similar Documents

Publication Publication Date Title
US10364422B2 (en) Cellulase enzymes having a modified linker and reduced lignin binding
US9279163B2 (en) Cellobiohydrolase enzymes
US8486683B2 (en) Beta-glucosidase enzymes
EP2599862B1 (en) Beta-glucosidase variants with improved properties
US8143049B2 (en) Modified beta-glucosidases with improved stability
US9885028B2 (en) Carbohydrate binding modules with reduced binding to lignin
US20150329841A1 (en) Cellulose-degrading enzyme composition comprising gh16
CN111094562A (en) Polypeptides with trehalase activity and their use in methods for producing fermentation products
CN110997701A (en) Polypeptides having trehalase activity and polynucleotides encoding same
US20100016570A1 (en) Modified family 6 glycosidases with altered substrate specificity
US8110389B2 (en) Family 6 cellulase with decreased inactivation by lignin
US8975058B2 (en) Endoglucanases for treatment of cellulosic material
EP2855673B1 (en) Improved endoglucanases for treatment of cellulosic material
Wei et al. Molecular cloning and characterization of two major endoglucanases from Penicillium decumbens
WO2013052831A2 (en) Variant cbh i polypeptides with reduced product inhibition
CN108368529A (en) β-glucosyl enzym and application thereof
WO2019074828A1 (en) Cellobiose dehydrogenase variants and methods of use thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: IOGEN ENERGY CORPORATION,CANADA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TOMASHEK, JOHN;LAVIGNE, JAMES;TREMBLAY, ANNIE;AND OTHERS;SIGNING DATES FROM 20090722 TO 20090728;REEL/FRAME:023188/0820

Owner name: IOGEN ENERGY CORPORATION, CANADA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TOMASHEK, JOHN;LAVIGNE, JAMES;TREMBLAY, ANNIE;AND OTHERS;SIGNING DATES FROM 20090722 TO 20090728;REEL/FRAME:023188/0820

CC Certificate of correction
REMI Maintenance fee reminder mailed
LAPS Lapse for failure to pay maintenance fees
STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

STCH Information on status: patent discontinuation

Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362

FP Lapsed due to failure to pay maintenance fee

Effective date: 20160911